Science.gov

Sample records for intron-flanking pcr primer

  1. ConservedPrimers 2.0: A high-throughput pipeline for comparative genome referenced intron-flanking PCR primer design and its application in wheat SNP discovery

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In some genomic applications it is necessary to design large numbers of PCR primers in exons flanking one or several introns on the basis of orthologous gene sequences in related species. The primer pairs designed by this target gene approach are called "intron-flanking primers" or because they ar...

  2. Multiplexed Primer Prediction for PCR

    SciTech Connect

    2007-07-23

    MPP predicts sets of multiplex-compatible primers for Polymerase Chain Reaction (PCR), finding a near minimal set of primers such that at least one amplicon will be generated from every target sequence in the input file. The code finds highly conserved oligos that are suitable as primers, according to user-specified desired primer characteristics such as length, melting temperature, and amplicon length. The primers are predicted not to form unwanted dimer or hairpin structures. The target sequences used as input can be diverse, since no multiple sequence alighment is required. The code is scalable, taking up to tens of thousands of sequences as input, and works, for example, to find a "universal primer set" for all viral genomes provided as a single input file. The code generates a periodic check-point file, thus in the event of premature execution termination, the application can be restarted from the last check-point file.

  3. PCR hot-start using duplex primers.

    PubMed

    Kong, Deming; Shen, Hanxi; Huang, Yanping; Mi, Huaifeng

    2004-02-01

    A new technique of PCR hot-start using duplex primers has been developed which can decrease the undesirable products arising throughout PCR amplification thereby giving better results than a manual hot-start method.

  4. Specific PCR product primer design using memetic algorithm.

    PubMed

    Yang, Cheng-Hong; Cheng, Yu-Huei; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2009-01-01

    To provide feasible primer sets for performing a polymerase chain reaction (PCR) experiment, many primer design methods have been proposed. However, the majority of these methods require a relatively long time to obtain an optimal solution since large quantities of template DNA need to be analyzed. Furthermore, the designed primer sets usually do not provide a specific PCR product size. In recent years, evolutionary computation has been applied to PCR primer design and yielded promising results. In this article, a memetic algorithm (MA) is proposed to solve primer design problems associated with providing a specific product size for PCR experiments. The MA is compared with a genetic algorithm (GA) using an accuracy formula to estimate the quality of the primer design and test the running time. Overall, 50 accession nucleotide sequences were sampled for the comparison of the accuracy of the GA and MA for primer design. Five hundred runs of the GA and MA primer design were performed with PCR product lengths of 150-300 bps and 500-800 bps, and two different methods of calculating T(m) for each accession nucleotide sequence were tested. A comparison of the accuracy results for the GA and MA primer design showed that the MA primer design yielded better results than the GA primer design. The results further indicate that the proposed method finds optimal or near-optimal primer sets and effective PCR products in a dry dock experiment. Related materials are available online at http://bio.kuas.edu.tw/ma-pd/.

  5. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    PubMed

    O'Halloran, Damien M

    2016-02-08

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction.

  6. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

    PubMed Central

    O’Halloran, Damien M.

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  7. Multiplexing Short Primers for Viral Family PCR

    SciTech Connect

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  8. A new PCR method: one primer amplification of PCR-CTPP products.

    PubMed

    Yin, Guang; Mitsuda, Yoko; Ezaki, Takayuki; Hamajima, Nobuyuki

    2012-10-01

    Polymerase chain reaction with confronting two-pair primers (PCR-CTPP) is a convenient method for genotyping single nucleotide polymorphisms, saving time, and costs. It uses four primers for PCR; F1 and R1 for one allele, and F2 and R2 for the other allele, by which three different sizes of DNA are amplified; between F1 and R1, between F2 and R2, and between F1 and R2. To date, we have applied PCR-CTPP successfully for genotyping more than 60 polymorphisms. However, it is not rare that PCR does not produce balanced amplification of allele specific bands. Accordingly, the method was modified by attaching a common sequence at the 5' end of two-pair primers and adding another primer with the common sequence in PCR, in total five different primers in a tube for PCR. The modification allowed one primer amplification for the products of initial PCR with confronting two-pair primers, named as one primer amplification of PCR-CTPP products (OPA-CTPP). This article demonstrates an example for an A/G polymorphism of paraoxonase 1 (PON1) Gln192Arg (rs662). PCR-CTPP failed clear genotyping for the polymorphism, while OPA-CTPP successfully produced PCR products corresponding to the allele. The present example indicated that the OPA-CTPP would be useful in the case that PCR-CTPP failed to produce balanced PCR products specific to each allele.

  9. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    SciTech Connect

    Gardner, S. N.

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  10. DPPrimer – A Degenerate PCR Primer Design Tool

    PubMed Central

    Gahoi, Shachi; Arya, L; Anil, Rai; Marla, ss

    2013-01-01

    Designed degenerate primers unlike conventional primers are superior in matching and amplification of large number of genes, from related gene families. DPPrimer tool was designed to predict primers for PCR amplification of homologous gene from related or diverse plant species. The key features of this tool include platform independence and user friendliness in primer design. Embedded features such as search for functional domains, similarity score selection and phylogebetic tree further enhance the user friendliness of DPPrimer tool. Performance of DPPrimer tool was evaluated by successful PCR amplification of ADP-glucose phosphorylase genes from wheat, barley and rice. Availability DPPrimer is freely accessible at http://202.141.12.147/DGEN_tool/index.html PMID:24307773

  11. Primer design for PCR reactions in forensic biology.

    PubMed

    Elkins, Kelly M

    2015-01-01

    The polymerase chain reaction (PCR) is a popular method to copy DNA in vitro. Its invention revolutionized fields ranging from clinical medicine to anthropology, molecular biology, and forensic biology. The method employs one of many available heat-stable DNA polymerases in a reaction that is repeated many times in situ. The DNA polymerase reads a template DNA strand and using the components of the reaction mix, catalyzes the addition of free 2'-deoxynucleotide triphosphate nitrogenous bases to short segment of DNA that forms a complement with the template via Watson-Crick base pairing. This short segment of DNA is referred to as a PCR primer and it is essential to the success of the reaction. The most widely used application of PCR in forensic labs is the amplification of short tandem repeat (STR) loci used in DNA typing. The STRs are routinely evaluated in concert with 16 or more reactions, a multiplex, run in one test tube simultaneously. In a multiplex, it is essential that the primers work specifically and accurately on the intended reactions without hindering the other reactions. The primers, which are very specific, also can be used to probe single nucleotide polymorphisms (SNPs) in a DNA sequence of interest by single base extension. Primers are often designed using one of many available automated software packages. Here the process of manually designing PCR primers for forensic biology using no-cost software is described.

  12. PCR Primers for Metazoan Mitochondrial 12S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Kweskin, Matthew; Knowlton, Nancy

    2012-01-01

    Background Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. Methodology/Principal Findings A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. Conclusions/Significance Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans. PMID:22536450

  13. STITCHER 2.0: primer design for overlapping PCR applications.

    PubMed

    O'Halloran, Damien M; Uriagereka-Herburger, Isabel; Bode, Katrin

    2017-03-30

    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to 'stitch' individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user's input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html.

  14. STITCHER 2.0: primer design for overlapping PCR applications

    PubMed Central

    O’Halloran, Damien M.; Uriagereka-Herburger, Isabel; Bode, Katrin

    2017-01-01

    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to ‘stitch’ individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user’s input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html. PMID:28358011

  15. Real-time PCR (qPCR) primer design using free online software.

    PubMed

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software.

  16. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR

    PubMed Central

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-lin; Korbie, Darren; Trau, Matt

    2017-01-01

    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com). PMID:28117430

  17. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.

    PubMed

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt

    2017-01-24

    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).

  18. BatchPrimer3: A high throughput web application for PCR and sequencing primer design

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricte...

  19. Design of primers and probes for quantitative real-time PCR methods.

    PubMed

    Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J

    2015-01-01

    Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.

  20. COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

    PubMed Central

    2016-01-01

    Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

  1. COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids.

    PubMed

    Anglès d'Auriac, Marc B

    2016-01-01

    Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3'-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5'-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5'-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3'-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered.

  2. RNase H-dependent PCR (rhPCR): improved specificity and single nucleotide polymorphism detection using blocked cleavable primers

    PubMed Central

    2011-01-01

    Background The polymerase chain reaction (PCR) is commonly used to detect the presence of nucleic acid sequences both in research and diagnostic settings. While high specificity is often achieved, biological requirements sometimes necessitate that primers are placed in suboptimal locations which lead to problems with the formation of primer dimers and/or misamplification of homologous sequences. Results Pyrococcus abyssi (P.a.) RNase H2 was used to enable PCR to be performed using blocked primers containing a single ribonucleotide residue which are activated via cleavage by the enzyme (rhPCR). Cleavage occurs 5'-to the RNA base following primer hybridization to the target DNA. The requirement of the primer to first hybridize with the target sequence to gain activity eliminates the formation of primer-dimers and greatly reduces misamplification of closely related sequences. Mismatches near the scissile linkage decrease the efficiency of cleavage by RNase H2, further increasing the specificity of the assay. When applied to the detection of single nucleotide polymorphisms (SNPs), rhPCR was found to be far more sensitive than standard allele-specific PCR. In general, the best discrimination occurs when the mismatch is placed at the RNA:DNA base pair. Conclusion rhPCR eliminates the formation of primer dimers and markedly improves the specificity of PCR with respect to off-target amplification. These advantages of the assay should find utility in challenging qPCR applications such as genotyping, high level multiplex assays and rare allele detection. PMID:21831278

  3. Development of a Universal Intimin Antiserum and PCR Primers

    PubMed Central

    Batchelor, Miranda; Knutton, Stuart; Caprioli, Alfredo; Huter, Veronika; Zanial, Mazlina; Dougan, Gordon; Frankel, Gad

    1999-01-01

    Enteropathogenic Escherichia coli (EPEC) and enterohemorrhagic E. coli (EHEC) constitute a significant risk to human health worldwide. A hallmark of both pathogens is their ability to produce characteristic attaching-and-effacing (A/E) lesions in intestinal epithelial cells. Genes encoding A/E lesion formation map to a chromosomal pathogenicity island termed the locus of enterocyte effacement (LEE). Intimin, an LEE-encoded bacterial adhesion molecule, mediates the intimate bacterium-host cell interaction characteristic of A/E lesions. On the basis of characterization of the C-terminal 280-amino-acid cell binding domain of intimin (Int280661–939), four distinct Int280 types (types α, β, γ, and δ) have been identified. Importantly, Int280α and Int280β antisera specifically recognized their respective intimin types. Using a conserved region of the intimin molecule (Int388–667) and primers synthesized to generate the recombinant Int388–667, we have now generated universal intimin antiserum and PCR primers that are reactive with the different intimin types expressed by both human and animal A/E lesion-forming strains. Use of immunogold electron microscopy to visualize intimin on the surfaces of EPEC and EHEC strains revealed, in general, a uniform distribution on the bacterial cell surface. However, a filamentous staining pattern was observed with a few strains expressing intimin γ. Cloning of the intimin eae gene from one such strain (strain ICC57) into strain CVD206, an EPEC strain which harbors a null deletion in eae, produced a uniform intimin staining pattern indicating that, if the filamentous staining pattern defines a filamentous form of intimin γ, it is dependent upon the genetic background of the strain and is not a feature of the intimin molecule. PMID:10565891

  4. FUNGAL-SPECIFIC PCR PRIMERS DEVELOPED FOR ANALYSIS OF THE ITS REGION OF ENVIRONMENTAL DNA EXTRACTS

    EPA Science Inventory

    Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmenta...

  5. Multi-primer target PCR for rapid identification of bovine DRB3 alleles.

    PubMed

    Ledwidge, S A; Mallard, B A; Gibson, J P; Jansen, G B; Jiang, Z H

    2001-08-01

    Multi-primer target polymerase chain reaction (MPT-PCR) is a rapid method for the identification of specific BoLA-DRB3 alleles. In a single PCR reaction, the presence of two alleles associated with increased risk, DRB3.2*23 (DRB3*2701-2703, 2705-2707) and decreased risk, DRB3.2*16 (DRB3*1501, 1502), of mastitis in Canadian Holstein can be detected. Two outer primers amplify exon 2 of DRB3. Simultaneously, two inner, allele-specific primers amplify individual alleles. Initially, 40 cows previously typed by PCR-restriction fragment length polymorphism (PCR-RFLP) were genotyped using the multi-primer approach. An additional 30 cows were first genotyped by multi-primer target PCR, then by PCR-RFLP. All animals were correctly identified and there were no false positives. This technique can readily be modified to identify other BoLA alleles of interest.

  6. Quantitative PCR measurements of the effects of introducing inosines into primers provides guidelines for improved degenerate primer design.

    PubMed

    Zheng, Linda; Gibbs, Mark J; Rodoni, Brendan C

    2008-11-01

    Polymerase chain reaction (PCR) is used to detect groups of viruses with the use of group-specific degenerate primers. Inosine residues are sometimes used in the primers to match variable positions within the complementary target sequences, but there is little data on their effects on cDNA synthesis and amplification. A quantitative reverse-transcription PCR was used to measure the rate of amplification with primers containing inosine residues substituted at different positions and in increasing numbers. Experiments were conducted using standard quantities of cloned DNA copied from Potato virus Y genomic RNA and RNA (cRNA) transcribed from the cloned DNA. Single inosine residues had no affect on the amplification rate in the forward primer, except at one position close to the 3' terminus. Conversely, single inosine residues significantly reduced the amplification rate when placed at three out of four positions in the reverse primer. Four or five inosine substitutions could be tolerated with some decline in rates, but amplification often failed from cRNA templates with primers containing larger numbers of inosines. Greater declines in the rate of amplification were observed with RNA templates, suggesting that reverse transcription suffers more than PCR amplification when inosine is included in the reverse primer.

  7. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    PubMed

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease.

  8. Single-primer PCR correction: a strategy for false-positive exclusion.

    PubMed

    Ma, J; Wang, P W; Yao, D; Wang, Y P; Yan, W; Guan, S C

    2011-02-01

    Polymerase chain reaction (PCR) technology plays an important role in molecular biology research, but false-positive and nonspecific PCR amplification have plagued many researchers. Currently, research on the optimization of the PCR system focuses on double-primer-based PCR products. This research has shown that PCR amplification based on single-primer binding to the DNA template is an important contributing factor to obtaining false-positive results, fragment impurity, and nonspecific fragment amplification, when the PCR conditions are highly restricted during PCR-based target gene cloning, detection of transgenic plants, simple-sequence repeat marker-assisted selection, and mRNA differential display. Here, we compared single- and double-primer amplification and proposed "single-primer PCR correction"; improvements in PCR that eliminate interference caused by single-primer-based nonspecific PCR amplification were demonstrated and the precision and success rates of experiments were increased. Although for some kinds of experiments, the improvement effect of single-primer PCR correction was variable, the precision and success rate could be elevated at 12-50% in our experiment by this way.

  9. Oligonucleotide primers for PCR amplification of coelomate introns.

    PubMed

    Jarman, Simon N; Ward, Robert D; Elliott, Nicholas G

    2002-09-01

    Abstract Seven novel oligonucleotide primer pairs for polymerase chain reaction amplification of introns from nuclear genes in coelomates were designed and tested. Each pair bound to adjacent exons that are separated by a single intron in most coelomate species. The primer sets amplified introns in species as widely separated by the course of evolution as oysters (Mollusca: Protostoma) and salmon (Chordata: Deuterostoma). Each primer set was tested on a further 6 coelomate species and found to amplify introns in most cases. These primer sets may therefore be useful tools for developing nuclear DNA markers in diverse coelomate species for studies of population genetics, phylogenetics, or genome mapping.

  10. Hypervariable spacer regions are good sites for developing specific PCR-RFLP markers and PCR primers for screening actinorhizal symbionts.

    PubMed

    Varehese, Rajani; Chauhan, Vineeta S; Misra, Arvind K

    2003-06-01

    While the ribosomal RNA like highly conserved genes are good molecular chronometers for establishing phylogenetic relationships, they can also be useful in securing the amplification of adjoining hyper-variable regions. These regions can then be used for developing specific PCR primers or PCR-RFL profiles to be used as molecular markers. We report here the use of ITS region of rrn operon of Frankia for developing PCR-RFL profiles capable of discriminating between closely related frankiae. We have also made use of the ITS1 region of the nuclear rrn operon of Alnus nepalensis (D Don) for designing a PCR primer for specific amplification of nuclear DNA of this tree.

  11. STITCHER: A web resource for high-throughput design of primers for overlapping PCR applications.

    PubMed

    O'Halloran, Damien M

    2015-06-01

    Overlapping PCR is routinely used in a wide number of molecular applications. These include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping by traditional PCR techniques and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online (http://ohalloranlab.net/STITCHER.html). STITCHER can handle both single sequence and multi-sequence input, and specific features facilitate numerous other PCR applications, including assembly PCR, adapter PCR, and primer walking. Field PCR, and in particular, LAMP, offers promise as an on site tool for pathogen detection in underdeveloped areas, and STITCHER includes off-target detection features for pathogens commonly targeted using LAMP technology.

  12. Biofunctionalization of Polyoxometalates with DNA Primers, Their Use in the Polymerase Chain Reaction (PCR) and Electrochemical Detection of PCR Products.

    PubMed

    Debela, Ahmed M; Ortiz, Mayreli; Beni, Valerio; Thorimbert, Serge; Lesage, Denis; Cole, Richard B; O'Sullivan, Ciara K; Hasenknopf, Bernold

    2015-12-01

    The bioconjugation of polyoxometalates (POMs), which are inorganic metal oxido clusters, to DNA strands to obtain functional labeled DNA primers and their potential use in electrochemical detection have been investigated. Activated monooxoacylated polyoxotungstates [SiW11 O39 {Sn(CH2 )2 CO}](8-) and [P2 W17 O61 {Sn(CH2 )2 CO}](6-) have been used to link to a 5'-NH2 terminated 21-mer DNA forward primer through amide coupling. The functionalized primer was characterized by using a battery of techniques, including electrophoresis, mass spectrometry, as well as IR and Raman spectroscopy. The functionality of the POM-labeled primers was demonstrated through hybridization with a surface-immobilized probe. Finally, the labeled primers were successfully used in the polymerase chain reaction (PCR) and the PCR products were characterized by using electrophoresis.

  13. Novel primers and PCR protocols for the specific detection and quantification of Sphingobium suberifaciens in situ

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The pathogen causing corky root on lettuce, Sphingobium suberifaciens, is recalcitrant to standard epidemiological methods. Primers were selected from 16S rDNA sequences useful for the specific detection and quantification of S. suberifaciens. Conventional (PCR) and quantitative (qPCR) PCR protocols...

  14. PCR Primers for identification of high sucrose Saccharum genotypes.

    PubMed

    Vinayak, Vandana; Dhawan, Ashok K; Gupta, V K

    2010-01-01

    The progeny of a cross between high sucrose sugarcane clone S. officinarum 'Gungera' and a low sucrose clone S. spontaneum 'SES 603' resulted in interspecific hybrids that were named as ISH-1 to ISH-29 and graded on the basis of sucrose content. Hybrids ISH-1, ISH-5, ISH-17 and ISH-23 were selected as very high sucrose (65 to 100 mg/g tissue) genotypes, whereas ISH-10, ISH-11, ISH-12 and ISH-25 were very low sucrose (2 to 25 mg/g tissue) genotypes. DNA from leaves of both the parent clones, as also the progeny hybrids, was amplified using selected primers, in order to identify markers for sucrose content. Ten specific primers were examined: primers 'A' and 'B' that detect polymorphism in promoter region of sucrose synthase-2 gene; primers AI, SS and SPS that were designed on the basis of nucleotide sequences of genes for acid invertase, sucrose synthase and sucrose phosphate synthase enzymes, respectively and primers MSSCIR43, MSSCIRI, SMC226CG, SMC1039CG and SCB07 selected for relation to sucrose accumulation process. DNA products specific to low or high sucrose clones were identified. Primer 'A' and AI amplified DNA products of size 230 and 500 bp, respectively only in high sucrose genotypes ('Gungera', ISH-1, ISH-5, ISH-17 and ISH-23), while primer SMC226CG generated a DNA product of size 920 bp only in low sucrose genotypes ('SES 603', ISH-10, ISH-11, ISH-12 and ISH-25). Ten random decamer primers were also examined, but their products did not show relationship to sucrose content of genotypes.

  15. Guidelines for the tetra-primer ARMS-PCR technique development.

    PubMed

    Medrano, Ruan Felipe Vieira; de Oliveira, Camila Andréa

    2014-07-01

    The tetra-primer amplification refractory mutation system-polymerase chain (ARMS-PCR) reaction is a simple and economical method to genotype single-nucleotide polymorphisms (SNPs). It uses four primers in a single PCR and is followed just by gel electrophoresis. However, the optimization step can be very hardworking and time-consuming. Hence, we propose to demonstrate and discuss critical steps for its development, in a way to provide useful information. Two SNPs that provided different amplification conditions were selected. DNA extraction methods, annealing temperatures, PCR cycles protocols, reagents, and primers concentration were also analyzed. The use of tetra-primer ARMS-PCR could be impaired for SNPs in DNA regions rich in cytosine and guanine and for samples with DNA not purified. The melting temperature was considered the factor of greater interference. However, small changes in the reagents concentration significantly affect the PCR, especially MgCl2. Balancing the inner primers band is also a key step. So, in order to balance the inner primers band, intensity is important to observe which one has the weakest band and promote its band by increasing its concentration. The use of tetra-primer ARMS-PCR attends the expectations of modern genomic research and allows the study of SNPs in a fast, reliable, and low-cost way.

  16. Novel computational methods for increasing PCR primer design effectiveness in directed sequencing

    PubMed Central

    Li, Kelvin; Brownley, Anushka; Stockwell, Timothy B; Beeson, Karen; McIntosh, Tina C; Busam, Dana; Ferriera, Steve; Murphy, Sean; Levy, Samuel

    2008-01-01

    Background Polymerase chain reaction (PCR) is used in directed sequencing for the discovery of novel polymorphisms. As the first step in PCR directed sequencing, effective PCR primer design is crucial for obtaining high-quality sequence data for target regions. Since current computational primer design tools are not fully tuned with stable underlying laboratory protocols, researchers may still be forced to iteratively optimize protocols for failed amplifications after the primers have been ordered. Furthermore, potentially identifiable factors which contribute to PCR failures have yet to be elucidated. This inefficient approach to primer design is further intensified in a high-throughput laboratory, where hundreds of genes may be targeted in one experiment. Results We have developed a fully integrated computational PCR primer design pipeline that plays a key role in our high-throughput directed sequencing pipeline. Investigators may specify target regions defined through a rich set of descriptors, such as Ensembl accessions and arbitrary genomic coordinates. Primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the specified target regions. As part of the tiling process, primer pairs are computationally screened to meet the criteria for success with one of two PCR amplification protocols. In the process of improving our sequencing success rate, which currently exceeds 95% for exons, we have discovered novel and accurate computational methods capable of identifying primers that may lead to PCR failures. We reveal the laboratory protocols and their associated, empirically determined computational parameters, as well as describe the novel computational methods which may benefit others in future primer design research. Conclusion The high-throughput PCR primer design pipeline has been very successful in providing the basis for high-quality directed sequencing results and for minimizing costs associated with labor and

  17. MFEprimer-2.0: a fast thermodynamics-based program for checking PCR primer specificity.

    PubMed

    Qu, Wubin; Zhou, Yang; Zhang, Yanchun; Lu, Yiming; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2012-07-01

    Evaluating the specificity of polymerase chain reaction (PCR) primers is an essential step in PCR primer design. The MFEprimer-2.0 server allows users to check primer specificity against genomic DNA and messenger RNA/complementary DNA sequence databases quickly and easily. MFEprimer-2.0 uses a k-mer index algorithm to accelerate the search process for primer binding sites and uses thermodynamics to evaluate binding stability between each primer and its DNA template. Several important characteristics, such as the sequence, melting temperature and size of each amplicon, either specific or non-specific, are reported on the results page. Based on these characteristics and the user-friendly output, users can readily draw conclusions about the specificity of PCR primers. Analyses for degenerate primers and multiple PCR primers are also supported in MFEprimer-2.0. In addition, the databases supported by MFEprimer-2.0 are comprehensive, and custom databases can also be supported on request. The MFEprimer-2.0 server does not require a login and is freely available at http://biocompute.bmi.ac.cn/CZlab/MFEprimer-2.0. More over, the MFEprimer-2.0 command-line version and local server version are open source and can be downloaded at https://github.com/quwubin/MFEprimer/wiki/Manual/.

  18. MRPrimerV: a database of PCR primers for RNA virus detection

    PubMed Central

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo

    2017-01-01

    Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620

  19. Noncontinuously binding loop-out primers for avoiding problematic DNA sequences in PCR and sanger sequencing.

    PubMed

    Sumner, Kelli; Swensen, Jeffrey J; Procter, Melinda; Jama, Mohamed; Wooderchak-Donahue, Whitney; Lewis, Tracey; Fong, Michael; Hubley, Lindsey; Schwarz, Monica; Ha, Youna; Paul, Eleri; Brulotte, Benjamin; Lyon, Elaine; Bayrak-Toydemir, Pinar; Mao, Rong; Pont-Kingdon, Genevieve; Best, D Hunter

    2014-09-01

    We present a method in which noncontinuously binding (loop-out) primers are used to exclude regions of DNA that typically interfere with PCR amplification and/or analysis by Sanger sequencing. Several scenarios were tested using this design principle, including M13-tagged PCR primers, non-M13-tagged PCR primers, and sequencing primers. With this technique, a single oligonucleotide is designed in two segments that flank, but do not include, a short region of problematic DNA sequence. During PCR amplification or sequencing, the problematic region is looped-out from the primer binding site, where it does not interfere with the reaction. Using this method, we successfully excluded regions of up to 46 nucleotides. Loop-out primers were longer than traditional primers (27 to 40 nucleotides) and had higher melting temperatures. This method allows the use of a standardized PCR protocol throughout an assay, keeps the number of PCRs to a minimum, reduces the chance for laboratory error, and, above all, does not interrupt the clinical laboratory workflow.

  20. Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts

    PubMed Central

    Martin, Kendall J; Rygiewicz, Paul T

    2005-01-01

    Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmental samples provide varying degrees of success at discriminating against plant DNA while maintaining a broad range of compatibility. Typically, it has been necessary to use multiple primer sets to accommodate the range of fungi under study, potentially creating artificial distinctions for fungal sequences that amplify with more than one primer set. Results Numerous sequences for PCR primers were tested to develop PCR assays with a wide range of fungal compatibility and high discrimination from plant DNA. A nested set of 4 primers was developed that reflected these criteria and performed well amplifying ITS regions of fungal rDNA. Primers in the 5.8S sequence were also developed that would permit separate amplifications of ITS1 and ITS2. A range of basidiomycete fruiting bodies and ascomycete cultures were analyzed with the nested set of primers and Restriction Fragment Length Polymorphism (RFLP) fingerprinting to demonstrate the specificity of the assay. Single ectomycorrhizal root tips were similarly analyzed. These primers have also been successfully applied to Quantitative PCR (QPCR), Length Heterogeneity PCR (LH-PCR) and Terminal Restriction Fragment Length Polymorphism (T-RFLP) analyses of fungi. A set of wide-range plant-specific primers were developed at positions corresponding to one pair of the fungal primers. These were used to verify that the host plant DNA was not being amplified with the fungal primers. Conclusion These plant primers have been successfully applied to PCR-RFLP analyses of forest plant tissues from above- and below-ground samples and work well at distinguishing a selection of plants to the species level. The complete set of primers was developed with an emphasis on

  1. PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.

    PubMed

    Pauthenier, Cyrille; Faulon, Jean-Loup

    2014-07-01

    PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions.

  2. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera.

    PubMed

    Wahlberg, Niklas; Peña, Carlos; Ahola, Milla; Wheat, Christopher W; Rota, Jadranka

    2016-01-01

    We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera, including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera. We feel that a PCR-based approach still has its place in molecular systematic studies of Lepidoptera, particularly at the intrafamilial level, and our new set of primers now provides a route to generating phylogenomic datasets using traditional methods.

  3. Improved efficiency and robustness in qPCR and multiplex end-point PCR by twisted intercalating nucleic acid modified primers.

    PubMed

    Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

    2012-01-01

    We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5'-end. In qPCR, the 5'-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5'-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5'-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5'-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5'-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5'-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions.

  4. A simple ABO genotyping by PCR using sequence-specific primers with mismatched nucleotides.

    PubMed

    Taki, Takashi; Kibayashi, Kazuhiko

    2014-05-01

    In forensics, the specific ABO blood group is often determined by analyzing the ABO gene. Among various methods used, PCR employing sequence-specific primers (PCR-SSP) is simpler than other methods for ABO typing. When performing the PCR-SSP, the pseudo-positive signals often lead to errors in ABO typing. We introduced mismatched nucleotides at the second and the third positions from the 3'-end of the primers for the PCR-SSP method and examined whether reliable typing could be achieved by suppressing pseudo-positive signals. Genomic DNA was extracted from nail clippings of 27 volunteers, and the ABO gene was examined with PCR-SSP employing primers with and without mismatched nucleotides. The ABO blood group of the nail clippings was also analyzed serologically, and these results were compared with those obtained using PCR-SSP. When mismatched primers were employed for amplification, the results of the ABO typing matched with those obtained by the serological method. When primers without mismatched nucleotides were used for PCR-SSP, pseudo-positive signals were observed. Thus our method may be used for achieving more reliable ABO typing.

  5. Cloning flanking sequence by single-primer PCR in transgenic plants.

    PubMed

    Ma, J; Wang, Y P; Ren, S; Zhang, Z; Lu, S; Wang, P W

    2014-10-20

    The insertion position of exogenous genes in plant genomes is usually identified by adapter ligation-mediated polymerase chain reaction (PCR), thermal asymmetric interlaced PCR, and restriction site extension PCR in transgenic plant research. However, these methods have various limitations, such as the complexity of designing primers and time-consuming and multiple-step procedures. The goal of this study was to establish an easier, more rapid, and more accurate method to clone flanking sequence using single-primer PCR in transgenic plants. Unknown flanking genome sequences in transgenic plants, including those in tobacco, soybean, rice, and maize, were cloned using the single-primer PCR method established in this study, with the Bar gene as the anchor gene. The primer 1 (P1), P2, and P3 PCRs obtained 4 sequences, and the completely correct flanking sequence of 508 bp that was obtained in the P3 PCR was verified by sequencing analysis. The single-primer PCR is more rapid and accurate than conventional methods, justifying its application widely in cloning flanking sequences in transgenic plants.

  6. Design of primer pairs for species-specific diagnosis of Leishmania (Leishmania) infantum chagasi using PCR.

    PubMed

    da Silveira Neto, Osvaldo José; Duarte, Sabrina Castilho; da Costa, Hérika Xavier; Linhares, Guido Fontgalland Coelho

    2012-01-01

    The objective of this study was to design and evaluate new primers for species-specific detection of L. infantum chagasi using PCR. Two combinations of primer pairs were established with the aim of obtaining specific amplification products from the L. infantum chagasi 18S rRNA gene. The combinations of the primer pairs and the respective sizes of the PCR products, based on the U422465 GenBank reference sequence of L. infantum chagasi, were: LCS1/LCS3 (259 bp) and LCS2/LCS3 (820 bp). It was concluded that the new PCR assays optimized using the primer pairs LCS1/LCS3 and LCS2/LCS3 were effective for specific detection of L. infantum chagasi, with analytical sensitivity to detect 1 pg/µL of DNA.

  7. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  8. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    ERIC Educational Resources Information Center

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  9. PCR Conditions for 16S Primers for Analysis of Microbes in the Colon of Rats

    PubMed Central

    Camacho, H.; Tuero, A. D.; Bacardí, D.; Palenzuela, D. O.; Aguilera, A.; Silva, J. A.; Estrada, R.; Gell, O.; Suárez, J.; Ancizar, J.; Brown, E.; Colarte, A. B.; Castro, J.; Novoa, L. I.

    2016-01-01

    The study of the composition of the intestinal flora is important to the health of the host, playing a key role in maintaining intestinal homeostasis and the evolution of the immune system. For these studies, various universal primers of the 16S rDNA gene are used in microbial taxonomy. Here, we report an evaluation of 5 universal primers to explore the presence of microbial DNA in colon biopsies preserved in RNAlater solution. The DNA extracted was used for the amplification of PCR products containing the variable (V) regions of the microbial 16S rDNA gene. The PCR products were studied by restriction fragment length polymorphism (RFLP) analysis and DNA sequence, whose percent of homology with microbial sequences reported in GenBank was verified using bioinformatics tools. The presence of microbes in the colon of rats was quantified by the quantitative PCR (qPCR) technique. We obtained microbial DNA from rat, useful for PCR analysis with the universal primers for the bacteria 16S rDNA. The sequences of PCR products obtained from a colon biopsy of the animal showed homology with the classes bacilli (Lactobacillus spp) and proteobacteria, normally represented in the colon of rats. The proposed methodology allowed the attainment of DNA of bacteria with the quality and integrity for use in qPCR, sequencing, and PCR-RFLP analysis. The selected universal primers provided knowledge of the abundance of microorganisms and the formation of a preliminary test of bacterial diversity in rat colon biopsies. PMID:27382362

  10. Multiplex PCR based on a universal biotinylated primer to generate templates for pyrosequencing.

    PubMed

    Chen, Zhiyao; Liu, Yunlong; Duan, Wenbang; Ye, Hui; Wu, Haiping; Li, Jinheng; Zhou, Guohua

    2014-06-01

    Pyrosequencing is a powerful tool widely used in genetic analysis, however template preparation prior to pyrosequencing is still costly and time-consuming. To achieve an inexpensive and labor-saving template preparation for pyrosequencing, we have successfully developed a single-tube multiplex PCR including a pre-amplification and a universal amplification. In the process of pre-amplification, a low concentration of target-specific primers tagged with universal ends introduced universal priming regions into amplicons. In the process of universal amplification, a high concentration of universal primers was used for yielding amplicons with various SNPs of interest. As only a universal biotinylated primer and one step of single-stranded DNA preparation were required for typing multiple SNPs located on different sequences, pyrosequencing-based genotyping became time-saving, labor-saving, sample-saving, and cost-saving. By a simple optimization of multiplex PCR condition, only a 4-plex and a 3-plex PCR were required for typing 7 SNPs related to tamoxifen metabolism. Further study showed that pyrosequencing coupled with an improved multiplex PCR protocol allowed around 30% decrease of either typing cost or typing labor. Considering the biotinylated primer and the optimized condition of the multiplex PCR are independent of SNP locus, it is easy to use the same condition and the identical biotinylated primer for typing other SNPs. The preliminary typing results of the 7 SNPs in 11 samples demonstrated that multiplex PCR-based pyrosequencing could be promising in personalized medicine at a low cost.

  11. 5'-degenerate 3'-dideoxy-terminated competitors of PCR primers increase specificity of amplification.

    PubMed

    Atamas, S P; Luzina, I G; Handwerger, B S; White, B

    1998-03-01

    Amplification of a product in PCR with specific primers may be viewed as an artificial Darwinian-type "selection of the fittest". In other selective systems, such as general evolution, immune system and probably brain cortex, the stringency of selection is not absolute but rather degenerate, with selection of many highly fit units, not limited, however, to only the fittest. In PCR also, annealing of the primers is not absolutely specific. The subsequent amplification frequently leads to amplification of not only the desired product but also to less-specific sequences. Using theoretical analysis of the degenerate mode of selection, we predict theoretically and prove experimentally that 5'-degenerate, 3'-dideoxy-terminated competitors of PCR primers can be used to dramatically improve the specificity of PCR amplification without affecting the quantitation of the final specific product.

  12. A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR

    PubMed Central

    Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven

    2016-01-01

    Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and

  13. Identification of putative sequence specific PCR primers for detection of the toxigenic fungal species Stachybotrys chartarum.

    PubMed

    Haugland, R A; Heckman, J L

    1998-12-01

    The nucleotide sequence of a c 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachybotrys and the related genus Memnoniella. This information was used to infer the phylogenetic relationships of these organisms and to search for sequence specific polymerase chain reaction (PCR) primers for S. chartarum in the internal transcribed spacer (ITS) regions. Searches for candidate primers were performed both by computer using the commercially available Oligo(R) v5.0 primer analysis software package and by manual inspection of the aligned sequences. Primers identified in both types of searches were evaluated for their specificities using a priming efficiency analysis algorithm available in the Oligo(R) 5.0 software. The automated computer searches were unsuccessful in finding S. chartarum-specific primers but did identify a group-specific reverse primer (designated as StacR4) for a phylogenetically related cluster of species that included S. chartarum. Manual searches led to the identification of a reverse primer (designated as StacR3) that was predicted to be specific for only S. chartarum and one other species of Stachybotrys. Experimental PCR analyses using these primers in conjunction with a universal forward primer indicated that the computer-generated amplification efficiency predictions were correct in most instances. A notable exception was the finding that StacR3 was specific only for S. chartarum. The relative merits of different PCR strategies for the detection of S. chartarum employing either one or both of the primers identified in this study are discussed.

  14. A Comprehensive Evaluation of PCR Primers to Amplify the nifH Gene of Nitrogenase

    PubMed Central

    Gaby, John Christian; Buckley, Daniel H.

    2012-01-01

    The nifH gene is the most widely sequenced marker gene used to identify nitrogen-fixing Bacteria and Archaea. Numerous PCR primers have been designed to amplify nifH, but a comprehensive evaluation of nifH PCR primers has not been performed. We performed an in silico analysis of the specificity and coverage of 51 universal and 35 group-specific nifH primers by using an aligned database of 23,847 nifH sequences. We found that there are 15 universal nifH primers that target 90% or more of nitrogen fixers, but that there are also 23 nifH primers that target less than 50% of nifH sequences. The nifH primers we evaluated vary in their phylogenetic bias and their ability to recover sequences from commonly sampled environments. In addition, many of these primers will amplify genes that do not mediate nitrogen fixation, and thus it would be advisable for researchers to screen their sequencing results for the presence of non-target genes before analysis. Universal primers that performed well in silico were tested empirically with soil samples and with genomic DNA from a phylogenetically diverse set of nitrogen-fixing strains. This analysis will be of great utility to those engaged in molecular analysis of nifH genes from isolates and environmental samples. PMID:22848735

  15. Indexed PCR Primers Induce Template-Specific Bias in Large-Scale DNA Sequencing Studies.

    PubMed

    O'Donnell, James L; Kelly, Ryan P; Lowell, Natalie C; Port, Jesse A

    2016-01-01

    Massively parallel sequencing is rapidly emerging as an efficient way to quantify biodiversity at all levels, from genetic variation and expression to ecological community assemblage. However, the number of reads produced per sequencing run far exceeds the number required per sample for many applications, compelling researchers to sequence multiple samples per run in order to maximize efficiency. For studies that include a PCR step, this can be accomplished using primers that include an index sequence allowing sample origin to be determined after sequencing. The use of indexed primers assumes they behave no differently than standard primers; however, we found that indexed primers cause substantial template sequence-specific bias, resulting in radically different profiles of the same environmental sample. Likely the outcome of differential amplification efficiency due to primer-template mismatch, two indexed primer sets spuriously change the inferred sequence abundance from the same DNA extraction by up to 77.1%. We demonstrate that a double PCR approach alleviates these effects in applications where indexed primers are necessary.

  16. Nano-magnetic primer based electrochemiluminescence-polymerase chain reaction (NMPE-PCR) assay.

    PubMed

    Zhu, Xiao; Zhou, Xiaoming; Xing, Da

    2012-01-15

    Here we have developed a novel nano-magnetic primer based electrochemiluminescence-polymerase chain reaction (NMPE-PCR) strategy for detection of genome. The key idea of this method is integrating the two in situ processes: PCR on the surface of magnetic nanoparticles (MNPs) and magnetic beads based ECL readout platform, to avoid some laborious manual operations and achieve rapid yet sensitive detection. At first, the approach employs a pair of functional primers for amplification: one is tris-(2,2'-bipyridyl) ruthenium (TBR) labeled primer; the other one is nano-magnetic primer which is prepared by attaching the primer to the surfaces of MNPs. With the presence of DNA analyte and PCR mixture, the TBR labeled products are directly loaded and enriched on the surface of MNPs during PCR cycling. Then the MNPs-TBR complexes can be analyzed by a magnetic ECL platform without any post-modification or post-incubation. Finally, we used Listeria monocytogenes as the target to examine these desirable properties of this assay, reaching a detection limit of 500 fg/μL for genome in 1 h. The proposed study has provided the evidence as a proof-of-concept, thus having potential for development of automatic mode for detection of specific gene.

  17. Vectorette PCR isolation of microsatellite repeat sequences using anchored dinucleotide repeat primers.

    PubMed Central

    Lench, N J; Norris, A; Bailey, A; Booth, A; Markham, A F

    1996-01-01

    We have developed a vectorette PCR approach to provide an improved method for isolation of microsatellite repeats. The modified procedure relies on PCR amplification using a vectorette-specific primer in combination with one of a panel of anchored dinucleotide repeat primers. The target DNA to be screened for microsatellite sequences can be from YAC, P1, cosmid, bacteriophage or plasmid clones. We have used this technique to isolate novel, polymorphic microsatellite repeats from clones containing the amelogenin gene (AMGX) located on human chromosome Xp22.3. PMID:8668553

  18. Real-Time PCR (qPCR) Primer Design Using Free Online Software

    ERIC Educational Resources Information Center

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

  19. Advances in multiplex PCR: balancing primer efficiencies and improving detection success

    PubMed Central

    Sint, Daniela; Raso, Lorna; Traugott, Michael

    2012-01-01

    1. Multiplex PCR is a valuable tool in many biological studies but it is a multifaceted procedure that has to be planned and optimised thoroughly to achieve robust and meaningful results. In particular, primer concentrations have to be adjusted to assure an even amplification of all targeted DNA fragments. Until now, total DNA extracts were used for balancing primer efficiencies; however, the applicability for comparisons between taxa or different multiple-copy genes was limited owing to the unknown number of template molecules present per total DNA. 2. Based on a multiplex system developed to track trophic interactions in high Alpine arthropods, we demonstrate a fast and easy way of generating standardised DNA templates. These were then used to balance the amplification success for the different targets and to subsequently determine the sensitivity of each primer pair in the multiplex PCR. 3. In the current multiplex assay, this approach led to an even amplification success for all seven targeted DNA fragments. Using this balanced multiplex PCR, methodological bias owing to variation in primer efficiency will be avoided when analysing field-derived samples. 4. The approach outlined here allows comparing multiplex PCR sensitivity, independent of the investigated species, genome size or the targeted genes. The application of standardised DNA templates not only makes it possible to optimise primer efficiency within a given multiplex PCR, but it also offers to adjust and/or to compare the sensitivity between different assays. Along with other factors that influence the success of multiplex reactions, and which we discuss here in relation to the presented detection system, the adoption of this approach will allow for direct comparison of multiplex PCR data between systems and studies, enhancing the utility of this assay type. PMID:23549328

  20. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera

    PubMed Central

    Wahlberg, Niklas; Peña, Carlos; Ahola, Milla; Wheat, Christopher W.; Rota, Jadranka

    2016-01-01

    Abstract We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera, including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera. We feel that a PCR-based approach still has its place in molecular systematic studies of Lepidoptera, particularly at the intrafamilial level, and our new set of primers now provides a route to generating phylogenomic datasets using traditional methods. PMID:27408580

  1. Comprehensive detection of phototrophic sulfur bacteria using PCR primers that target reverse dissimilatory sulfite reductase gene.

    PubMed

    Mori, Yumi; Purdy, Kevin J; Oakley, Brian B; Kondo, Ryuji

    2010-01-01

    A new set of primers for the detection of phototrophic sulfur bacteria in natural environments is described. The primers target the α-subunit of the reverse dissimilatory sulfite reductase gene (dsrA). PCR-amplification resulted in products of the expected size from all the phototrophic strains tested, including purple sulfur and green sulfur bacteria. Seventy-nine clones obtained from environmental DNA using the primers were sequenced and all found to be closely related to the dsrA of purple sulfur bacteria and green sulfur bacteria. This newly developed PCR assay targeting dsrA is rapid and simple for the detection of phototrophic sulfur bacteria in situ and superior to the use of culture-dependent techniques.

  2. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.

    PubMed

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-11-16

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR.

  3. Revealing the Diversity and Quantity of Peritrich Ciliates in Environmental Samples Using Specific Primer-based PCR and Quantitative PCR

    PubMed Central

    Liu, Xihan; Gong, Jun

    2012-01-01

    Peritrichs are a diverse, ecologically important ciliate group usually with a complex life cycle. To date, the community of the peritrichs has been investigated by using morphology-based methods such as living observation and silver staining. Here we show a molecular approach for characterizing the diversity and quantity of free-living peritrichs in environmental samples. We newly designed four peritrich-specific primers targeting 18S rRNA genes that allow clone library construction, screening and analysis. A quantitative real-time PCR (qPCR) assay was developed to quantify peritrichs in environmental samples by using rDNA copy number as an indicator. DNA extracted from four water samples of contrasting environmental gradients was analysed. The results showed that the peritrich community was differentiated among these samples, and that the diversity decreased with the increase of water salinity. The qPCR results are consistent with the library sequence analysis in terms of quantity variations from sample to sample. The development of peritrich-specific primers, for the first time, for conventional PCR and qPCR assays, provides useful molecular tools for revealing the diversity and quantity of peritrich ciliates in environmental samples. Also, our study illustrates the potential of these molecular tools to ecological studies of other ciliate groups in diverse environments. PMID:23100023

  4. primers4clades: a web server that uses phylogenetic trees to design lineage-specific PCR primers for metagenomic and diversity studies.

    PubMed

    Contreras-Moreira, Bruno; Sachman-Ruiz, Bernardo; Figueroa-Palacios, Iraís; Vinuesa, Pablo

    2009-07-01

    Primers4clades is an easy-to-use web server that implements a fully automatic PCR primer design pipeline for cross-species amplification of novel sequences from metagenomic DNA, or from uncharacterized organisms, belonging to user-specified phylogenetic clades or taxa. The server takes a set of non-aligned protein coding genes, with or without introns, aligns them and computes a neighbor-joining tree, which is displayed on screen for easy selection of species or sequence clusters to design lineage-specific PCR primers. Primers4clades implements an extended CODEHOP primer design strategy based on both DNA and protein multiple sequence alignments. It evaluates several thermodynamic properties of the oligonucleotide pairs, and computes the phylogenetic information content of the predicted amplicon sets from Shimodaira-Hasegawa-like branch support values of maximum likelihood phylogenies. A non-redundant set of primer formulations is returned, ranked according to their thermodynamic properties. An amplicon distribution map provides a convenient overview of the coverage of the target locus. Altogether these features greatly help the user in making an informed choice between alternative primer pair formulations. Primers4clades is available at two mirror sites: http://maya.ccg.unam.mx/primers4clades/and http://floresta.eead.csic.es/primers4clades/. Three demo data sets and a comprehensive documentation/tutorial page are provided for easy testing of the server's capabilities and interface.

  5. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy

    2012-01-01

    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  6. Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays.

    PubMed

    Kimura, Yasumasa; Soma, Takahiro; Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J L; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

    2016-01-01

    Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download.

  7. Development of SCAR Primers for PCR Assay to Detect Diplodia seriata

    PubMed Central

    Martín, M. T.; Cuesta, M. J.; Martín, L.

    2014-01-01

    The aim of this study was to develop primer pairs for Diplodia seriata identification, one of the most common fungal species associated with grapevine decline in Castilla y León (Spain). Genetic variability of selected isolates of D. seriata was estimated. A molecular marker was generated from a random amplified polymorphic DNA (RAPD) fragment. PCR products of around 1200 bp were obtained with OPE20 primer. The PCR products were cloned and sequenced. The sequences were compared and a fragment of 1207 bp was used to design primer pairs. Two primer pairs were selected (DS3.8 S3-DS3.8 R6 and DS3.8 S3-DS3.8 R4) that amplified a single DNA product of 634 bp and 233 bp, respectively, with D. seriata isolates. No amplification was obtained for any of the 57 isolates of other species. The designed SCAR primer pairs allowed a rapid detection of D. seriata, and were able to detect 0.1 pg of the target DNA. Detection was specific and sensitive for D. seriata. The established protocols detected these fungi in naturally infected grapevines after DNA purification. Diplodia seriata was detectable without DNA purification and isolation in 62.5% to 75% of reactions. The detection of this pathogen in wood samples has great potential for use in pathogen-free certification schemes. PMID:27437468

  8. Specific primers for PCR amplification of the ITS1 (ribosomal DNA) of Trypanosoma lewisi.

    PubMed

    Desquesnes, Marc; Marc, Desquesnes; Kamyingkird, Ketsarin; Ketsarin, Kamyingkird; Yangtara, Sarawut; Sarawut, Yangtara; Milocco, Cristina; Cristina, Milocco; Ravel, Sophie; Sophie, Ravel; Wang, Ming-Hui; Ming-Hui, Wang; Lun, Zhao-Rong; Zhao-Rong, Lun; Morand, Serge; Serge, Morand; Jittapalapong, Sathaporn; Sathaporn, Jittapalapong

    2011-08-01

    Trypanosoma lewisi is a mild or non-pathogenic parasite of the sub-genus Herpetosoma transmitted by fleas to rats. In a previous study we described pan-trypanosome specific primers TRYP1 which amplify the ITS1 of ribosomal DNA by hybridizing in highly conserved regions of 18S and 5.8S genes. These primers proved to be useful for detecting T. lewisi DNA in laboratory rats, but a recent large scale survey in wild rodents demonstrated a lack of specificity. In the present study, we designed and evaluated mono-specific primers LEW1S and LEW1R, for the detection and identification of T. lewisi by a single-step PCR. These primers were designed inside the highly variable region of the ITS1 sequence of T. lewisi ribosomal DNA. The product size of 220 bp is specific to T. lewisi. The sensitivity limit was estimated between 0.055 and 0.55 pg of DNA per reaction, equivalent to 1-10 organisms per reaction. All the PCR products obtained from 6 different T. lewisi isolates were more than 98% similar with each other and similar to the sequences of T. lewisi already published in Genbank. All DNA of 7 T. lewisi stocks from China gave the specific 220 bp product. We showed that LEW1S and LEW1R primers enabled sensitive detection and identification of T. lewisi infection in laboratory and wild rats. This assay is recommended for monitoring T. lewisi infections in rat colonies or for studying infections in the wild fauna. An absence of cross reaction with human DNA means that these primers can be used to investigate atypical trypanosome infections in humans. Given the risk of T. lewisi infection in human, we believe that these primers will be beneficial for public health diagnosis and rodents investigation programmes.

  9. [Primers design and optimization of PCR and nested-PCR assays for the specific detection of Tritrichomonas foetus].

    PubMed

    Fernandes, Paula Rogério; Da Silva, Andréa Caetano; Gambarini, Maria Lúcia; Linhares, Guido Fontgalland C

    2008-01-01

    Tritrichomonas foetus is a pathogenic protozoan that causes a venereal disease in cattle known as bovine genital tricomonosis. In spite of the efficacy to recognize the target genomic DNA, the protocols so far developed for the diagnosis of this organism by PCR promote some inespecific amplifications or they are unable to discriminate T. foetus against other species within the genus. The objective of this study was to assess and optimize PCR and nested-PCR assays for the specific diagnosis of T. foetus, using novel primers selected from the alignment of sequences of the genes 18S rRNA, 5.8S rRNA, 28S rRNA and of the internal transcribed spacers of the rDNA (ITS1 and ITS2). A pair of primers was constructed for the genus-specific amplification of a 648 bp fragment and two others to amplify T. foetus species-specific fragments of 343 and 429 bp. No cross amplification was observed against Bos taurus genomic DNA neither against the DNA of usual bovine genital pathogens. Both, single and nested-PCR assays, presented analytical sensitivity to detect at least two T. foetus organisms.

  10. Pseudomonas aeruginosa serotype O12 outbreak studied by arbitrary primer PCR.

    PubMed Central

    Elaichouni, A; Verschraegen, G; Claeys, G; Devleeschouwer, M; Godard, C; Vaneechoutte, M

    1994-01-01

    A total of 16 colonizing and infecting ofloxacin-resistant Pseudomonas aeruginosa strains and two strains isolated from ventilation equipment fluids, all with similar colonial morphologies and with minor but distinct susceptibility differences, were suspected of belonging to a single outbreak and were studied by arbitrary primer (AP) PCR. Thirteen nonrelated strains were included to evaluate the discriminatory capacity of the technique. AP PCR fingerprinting was compared with serotyping, phage typing, and antibiotic susceptibility testing. AP PCR was performed independently with three different primers. The different AP PCR typing systems yielded almost identical patterns for the epidemic strains and enabled us to differentiate most of the nonrelated strains from each other and from the outbreak strains. The combination of AP PCR typing and the phenotyping techniques that we used enabled us to conclude that an outbreak was occurring. In general, the typeability of AP PCR was greater than those of phage typing and serotyping, while the discriminatory powers of the three methods were comparable. Images PMID:8195376

  11. Retrieval of glycoside hydrolase family 9 cellulase genes from environmental DNA by metagenomic gene specific multi-primer PCR.

    PubMed

    Xiong, Xiaolong; Yin, Xiaopu; Pei, Xiaolin; Jin, Peng; Zhang, Ao; Li, Yan; Gong, Weibo; Wang, Qiuyan

    2012-05-01

    A new method, termed metagenomic gene specific multi-primer PCR (MGSM-PCR), is presented that uses multiple gene specific primers derived from an isolated gene from a constructed metagenomic library rather than degenerate primers designed based on a known enzyme family. The utility of MGSM-PCR was shown by applying it to search for homologues of the glycoside hydrolase family 9 cellulase in metagenomic DNA. The success of the multiplex PCR was verified by visualizing products on an agarose gel following gel electrophoresis. A total of 127 homologous genes were amplified with combinatorial multi-primer reactions from 34 soil DNA samples. Multiple alignments revealed extensive sequence diversity among these captured sequences with sequence identity varying from 26 to 99.7%. These results indicated that significantly diverse homologous genes were indeed readily accessible when using multiple metagenomic gene specific primers.

  12. Low-stringency PCR with diagnostically useful primers for identification of Leptospira serovars.

    PubMed Central

    de Caballero, O L; Dias Neto, E; Koury, M C; Romanha, A J; Simpson, A J

    1994-01-01

    Primers proposed for the diagnosis of the pathogenic spirochete Leptospira spp. (C. Gravekamp, H. V. D. Kemp, M. Franzen, D. Carrington, G.J. Schoone, G.J.J.M. Van Eys, C. O. R. Everard, R.A. Hartskeel, and W.J. Terpstra, J. Gen. Microbiol. 139:1691-1700, 1993) have been found to produce complex serovar-specific patterns under low-stringency PCR conditions. Such patterns obtained by low-stringency PCR, which maintain the specific band as an internal control, offer, an approach to the standardized identification of Leptospira serovars in clinical laboratories. Images PMID:8051272

  13. Sensitive, microliter PCR with consensus degenerate primers for Epstein Barr virus amplification

    PubMed Central

    Oh, Kyudam; Pak, Nikita; Saunders, D. Curtis; Conrardy, Christina; Landers, James P.; Tong, Suxiang; Forest, Craig R.

    2016-01-01

    Sensitive identification of the etiology of viral diseases is key to implementing appropriate prevention and treatment. The gold standard for virus identification is the polymerase chain reaction (PCR), a technique that allows for highly specific and sensitive detection of pathogens by exponentially amplifying a specific region of DNA from as little as a single copy through thermocycling a biochemical cocktail. Today, molecular biology laboratories use commercial instruments that operate in 0.5–2 h/analysis using reaction volumes of 5–50 μL contained within polymer tubes or chambers. Towards reducing this volume and maintaining performance, we present a semi-quantitative, systematic experimental study of how PCR yield is affected by tube/chamber substrate, surface-area-to-volume ratio (SA:V), and passivation methods. We perform PCR experiments using traditional PCR tubes as well as using disposable polymer microchips with 1 μL reaction volumes thermocycled using water baths. We report the first oil encapsulation microfluidic PCR method without fluid flow and its application to the first microfluidic amplification of Epstein Barr virus using consensus degenerate primers, a powerful and broad PCR method to screen for both known and novel members of a viral family. The limit of detection is measured as 140 starting copies of DNA from a starting concentration of 3×105 copies/mL, regarded as an accepted sensitivity threshold for diagnostic purposes, and reaction specificity was improved as compared to conventional methods. Also notable, these experiments were conducted with conventional reagent concentrations, rather than commonly spiked enzyme and/or template mixtures. This experimental study of the effects of substrate, SA:V, and passivation, together with sensitive and specific microfluidic PCR with consensus degenerate primers represent advances towards lower cost and higher throughput pathogen screening. PMID:23080522

  14. Design and evaluation of PCR primers for denaturing gradient gel electrophoresis analysis of plant parasitic and fungivorous nematode communities.

    PubMed

    Kushida, Atsuhiko

    2013-01-01

    A PCR-DGGE primer pair, Tyl2F-Tyl4R, specific to plant parasitic and fungivorous nematodes was designed based on the 18S rRNA gene. The results of community analysis using the primers showed that they are specific to the order Tylenchida. This primer pair detected species belonging to Tylenchida with high sensitivity and high resolution. The number of detected species of plant parasitic and fungivorous nematodes and their band intensity were much improved compared with PCR-DGGE analysis using the SSU18A-SSU9R primer, which is commonly used for nematode community analysis. It was confirmed that using a group-specific primer was effective for nematode community analysis with PCR-DGGE.

  15. Triplex PCR using new primers for the detection of Toxoplasma gondii.

    PubMed

    Rahumatullah, Anizah; Khoo, Boon Yin; Noordin, Rahmah

    2012-06-01

    Molecular methods are used increasingly for the detection of Toxoplasma gondii infection. This study developed a rapid, sensitive, and specific conventional triplex PCR for the detection of the B1 gene and ITS1 region of T. gondii using newly designed primers and an internal control based on the Vibrio cholerae HemM gene. The annealing temperature and concentrations of the primers, MgCl(2), and dNTPs were optimized. Two sets of primers (set 1 and 2) were tested, which contained different segments of the T. gondii B1 gene, 529 repeat region and ITS1 region. A series of sensitivity tests were performed using parasite DNA, whole parasites, and spiked human body fluids. Specificity tests were performed using DNA from common protozoa and bacteria. The newly developed assay based on set 2 primers was found to be specific and sensitive. The test was capable of detecting as little as 10 pg T. gondii DNA, 10(4) tachyzoites in spiked body fluids, and T. gondii DNA in the organ tissues of experimentally infected mice. The assay developed in this study will be useful for the laboratory detection of T. gondii infection.

  16. Species-specific PCR primers for the rapid identification of yeasts of the genus Zygosaccharomyces.

    PubMed

    Harrison, Elizabeth; Muir, Alastair; Stratford, Malcolm; Wheals, Alan

    2011-06-01

    Species-specific primer pairs that produce a single band of known product size have been developed for members of the Zygosaccharomyces clade including Zygosaccharomyces bailii, Zygosaccharomyces bisporus, Zygosaccharomyces kombuchaensis, Zygosaccharomyces lentus, Zygosaccharomyces machadoi, Zygosaccharomyces mellis and Zygosaccharomyces rouxii. An existing primer pair for the provisional new species Zygosaccharomyces pseudorouxii has been confirmed as specific. The HIS3 gene, encoding imidazole-glycerolphosphate dehydratase, was used as the target gene. This housekeeping gene evolves slowly and is thus well conserved among different isolates, but shows a significant number of base pair changes between even closely related species, sufficient for species-specific primer design. The primers were tested on type and wild strains of the genus Zygosaccharomyces and on members of the Saccharomycetaceae. Sequencing of the D1/D2 region of rDNA was used to confirm the identification of all nonculture collection isolates. This approach used extracted genomic DNA, but in practice, it can be used efficiently with a rapid colony PCR protocol. The method also successfully detected known and new hybrid strains of Z. rouxii and Z. pseudorouxii. The method is rapid, robust and inexpensive. It requires little expertise by the user and is thus useful for preliminary, large-scale screens.

  17. Detection of Xanthomonas arboricola pv. pruni by PCR using primers based on DNA sequences related to the hrp genes.

    PubMed

    Park, So Yeon; Lee, Young Sun; Koh, Young Jin; Hur, Jae-Sun; Jung, Jae Sung

    2010-10-01

    Efficient control of Xanthomonas arboricola pv. pruni, the causal agent of bacterial spot on stone fruit, requires a sensitive and reliable diagnostic tool. A PCR detection method that utilizes primers to target the hrp gene cluster region was developed in this study. The nucleotide sequence of the PCR product amplified with primers specific for the hrp region of the xanthomonads and genomic DNA of X. arboricola pv. pruni was determined, and the sequence was aligned with that of X. campestris pv. campestris, which was obtained from the GenBank database. On the basis of the sequence of the amplified hrp region, a PCR primer set of XapF/R specific to X. arboricola pv. pruni was designed. This primer set yielded a 243-bp product from the genomic DNA of X. aboricola pv. pruni strains, but no products from other 21 strains of Xanthomonas or from two epiphytic bacterial species. Southern blot hybridization with the probe derived from the PCR product with the primer set and X. aboricola pv. pruni DNA confirmed the PCR results. The Xap primer system was successfully applied to detect the pathogen from infected peach fruits. When it was applied in field samples, the primer set was proved as a reliable diagnostic tool for specific detection of X. aboricola pv. pruni from peach orchards.

  18. Partial molecular cloning of the JHK retrovirus using gammaretrovirus consensus PCR primers

    PubMed Central

    Halligan, Brian D; Sun, Hai-Yuan; Kushnaryov, Vladimir M; Grossberg, Sidney E

    2013-01-01

    The JHK virus (JHKV) was previously described as a type C retrovirus that has some distinctive ultrastructural features and replicates constitutively in a human B-lymphoblastoid cell line, JHK-3. In order to facilitate the cloning of sequences from JHKV, a series of partially degenerate consensus retroviral PCR primers were created by a data-driven design approach based on an alignment of 14 diverse gammaretroviral genomes. These primers were used in the PCR amplification of purified JHK virion cDNA, and ana lysis of the resulting amplified sequence indicates that the JHKV is in the murine leukemia virus (MLV) family. The JHK sequence is nearly identical to the corresponding region of the Bxv-1 endogenous mouse retrovirus (GenBank accession AC115959) and distinct from XMRV. JHKV gag-specific amplification was demonstrated with nucleic acids from uncultivated, frozen, peripheral blood mononuclear cells (PBMCs) of the index patient, but not in PBMCs from nine healthy blood donors. Unlike earlier reports, in which MLV-like sequences were identified in human source material, which may have been due to murine contamination, budding retrovirions were demonstrated repeatedly by electron microscopy in uncultivated lymphocytes of the index patient that were morphologically identical in their development to the virions in the JHK-3 cells, and immunological evidence was obtained that the index patient produced IgG antibodies that bound to the budding viral particles in patient PBMCs and in the JHK-3 cells. These data indicate that the patient had been infected by JHKV, lending significance to the demonstration of JHKV amplicons in nucleic acids of the patient’s PBMCs. In future studies, the PCR primer sets described herein may expand the detection of an amplifiable subset of viruses related to MLV. PMID:24159361

  19. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    SciTech Connect

    Jothikumar, N. Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  20. Use of degenerate primers and touchdown PCR to amplify a halogenase gene fragment from Streptomyces venezuelae ISP5230.

    PubMed

    Piraee, M; Vining, Leo C

    2002-07-01

    Consensus amino acid sequences of FADH(2)-dependent bacterial halogenases were used to design PCR primers amplifying a halogenase gene fragment from the chloramphenicol producer Streptomyces venezuelae ISP5230. The sequence-specific degenerate primers (MPF1 and MPR2) were used with a touchdown PCR procedure in the first PCR-assisted cloning of a halogenase gene fragment. In the region of the 290-bp PCR product containing the reverse primer, the deduced amino acid sequence exhibited characteristics of a beta-alpha-beta fold present in FAD-binding sites of certain monooxygenases. When used to probe Southern blots of restriction-enzyme-digested DNA, the [alpha-(32)P]dCTP-labeled PCR product hybridized specifically with DNA fragments from genomic DNA of S. venezuelae ISP5230. Primers MPF1 and MPR2 also allowed amplification by PCR of approximately 290-bp DNA fragments from several other streptomycetes. The fragments from Streptomyces aureofaciens NRRL2209 and Streptomyces coelicolor A3(2) showed sequence identity with halogenase genes from these species. Thus, the PCR primers are of potential value for amplification and subsequent isolation of actinomycete halogenase genes.

  1. An improved DNA marker technique for genetic characterization using RAMP-PCR with high-GC primers.

    PubMed

    Wei, C L; Cheng, J L; Khan, M A; Yang, L Q; Imani, S; Chen, H C; Fu, J J

    2016-09-16

    Random amplified polymorphic DNA (RAPD) is a widely used molecular marker technique. As traditional RAPD has poor reproducibility and productivity, we previously developed an improved RAPD method (termed RAMP-PCR), which increased the reproducibility, number of bands, and efficiency of studies on polymorphism. To further develop the efficiency of this method, we used high-GC content primers for improved RAMP-PCR with DNA samples from Lonicera japonica. Comparison of amplification profiles obtained by standard RAPD primers with those obtained by regular PCR and RAMP-PCR, and high-GC primers with regular PCR and RAMP-PCR showed that the average number of bands and polymorphisms per primer gradually and significantly increased (from 6.4 to 15.0 and from 4.6 to 10.2, respectively). Cluster dendrograms showed similar results, indicating that this new method is consistent and reproducible. A total of 22 samples from different species, including plants, animals, and humans, were used for RAMP-PCR with high-GC primers. Multiple bands were successfully amplified from all samples, demonstrating that this method is a reliable technique with consistent results and may be of general interest in studies on different genera and species. We developed highly effective DNA markers, which can provide a more effective and potentially valuable approach than traditional RAPD for the genetic identification of various organisms, particularly of medicinal plants.

  2. Evaluation of primers and PCR performance on HPV DNA screening in normal and low grade abnormal cervical cells.

    PubMed

    Chaiwongkot, Arkom; Pientong, Chamsai; Ekalaksananan, Tipaya; Kongyingyoes, Bunkerd; Thinkhamrop, Jadsada; Yuenyao, Pissamai; Sriamporn, Supannee

    2007-01-01

    High risk human papillomaviruses (HR-HPVs) are associated with increased risk of normal cervical cells developing to dysplasia and cervical carcinoma. Therefore, HR-HPV DNA testing can predict an endpoint of cervical carcinogenesis that is earlier than the development of cervical abnormalities. Not only the sensitivity of methods but also the amount of HPV DNA are very important and might be parameters to distinguish HPV detection. In this study, we evaluated the effects of primer sets and the polymerase chain reaction (PCR) performance with low viral load samples with normal cervical cytology (140 samples) and mild dysplasia (140 samples) using two consensus primers MY09/MY11 and GP5+/6+. The PCR was performed with single and nested PCR. Positive samples with both primer sets were then HPV genotyped by dot blot hybridization. Results showed higher sensitivity of single PCR using primer GP5+/GP6+ than primer MY09/MY11. HPV DNA was detected in 15% (21 of 140)and 20.7% (29 of 140) of normal cervical samples, respectively. For mild dysplasia samples, HPV DNA was detected in 37.1% (52 of 140) with MY09/MY11 and 50% (70 of 140) using GP5+/GP6+. In normal cervical samples, the positivity rate was increased to 38.5% (54 of 140) by nested PCR using primer GP5+/6+, but only 2 mild dysplasia samples that were negative by single GP5+/6+ were positive by auto-nested PCR. These results suggested that, in low viral load samples, the sensitivity of HPV DNA detection depends not only on primer sets but also PCR performance. HPV 16 was the most common in mild dysplasia samples (20.8%), whereas HPV type 58 was found in 11.1%. This study suggested that nested PCR might be necessary for HPV DNA detection in cervical samples of women participating in cervical cancer screening.

  3. PCR differentiation of commercial yeast strains using intron splice site primers.

    PubMed Central

    de Barros Lopes, M; Soden, A; Henschke, P A; Langridge, P

    1996-01-01

    The increased use of pure starter cultures in the wine industry has made it necessary to develop a rapid and simple identification system for yeast strains. A method based upon the PCR using oligonucleotide primers that are complementary to intron splice sites has been developed. Since most introns are not essential for gene function, introns have evolved with minimal constraint. By targeting these highly variable sequences, the PCR has proved to be very effective in uncovering polymorphisms in commercial yeast strains. The speed of the method and the ability to analyze many samples in a single day permit the monitoring of specific yeast strains during fermentations. Furthermore, the simplicity of the technique, which does not require the isolation of DNA, makes it accessible to industrial laboratories that have limited molecular expertise and resources. PMID:8953723

  4. Barcoding the kingdom Plantae: new PCR primers for ITS regions of plants with improved universality and specificity.

    PubMed

    Cheng, Tao; Xu, Chao; Lei, Li; Li, Changhao; Zhang, Yu; Zhou, Shiliang

    2016-01-01

    The internal transcribed spacer (ITS) of nuclear ribosomal DNA is one of the most commonly used DNA markers in plant phylogenetic and DNA barcoding analyses, and it has been recommended as a core plant DNA barcode. Despite this popularity, the universality and specificity of PCR primers for the ITS region are not satisfactory, resulting in amplification and sequencing difficulties. By thoroughly surveying and analysing the 18S, 5.8S and 26S sequences of Plantae and Fungi from GenBank, we designed new universal and plant-specific PCR primers for amplifying the whole ITS region and a part of it (ITS1 or ITS2) of plants. In silico analyses of the new and the existing ITS primers based on these highly representative data sets indicated that (i) the newly designed universal primers are suitable for over 95% of plants in most groups; and (ii) the plant-specific primers are suitable for over 85% of plants in most groups without amplification of fungi. A total of 335 samples from 219 angiosperm families, 11 gymnosperm families, 24 fern and lycophyte families, 16 moss families and 17 fungus families were used to test the performances of these primers. In vitro PCR produced similar results to those from the in silico analyses. Our new primer pairs gave PCR improvements up to 30% compared with common-used ones. The new universal ITS primers will find wide application in both plant and fungal biology, and the new plant-specific ITS primers will, by eliminating PCR amplification of nonplant templates, significantly improve the quality of ITS sequence information collections in plant molecular systematics and DNA barcoding.

  5. Evaluation of Different Primers for Detection of Brucella by Using PCR Method

    PubMed Central

    Moulana, Zahra; Roushan, Mohammad Reza Hasanjani; Marashi, Seyed Mahmoud Amin

    2016-01-01

    Introduction Brucellosis is a worldwide zoonosis and a significant cause of loss of health in humans and animals. Traditionally, classic diagnosis is carried out by isolation of Brucella, which is time-consuming, technically challenging and potentially dangerous. The aim of this study was to expand a molecular test that would be used for the develop detection of Brucella in a single reaction with high sensitivity and specificity, by targeting IS711element. Methods This study was carried out from 2015 to 2016 at the Ayatolla Rohani hospital in Babol, Iran. The present study was designed to develop PCR assay, based on IS711 gene for rapid diagnosis of Brucella spp. and immediate detection of Brucella, with high sensitivity and specificity. Four pairs of oligo-nucleotide primers with sizes of 547, 403, 291 and 127bp respectively, were planned to exclusively amplify the targeted genes of Brucella species. Results Our results show that, five PCR primers set up, would be helpful in amplifying the DNAs from the genus Brucella with high specificity and sensitivity so it can be 12 fg, for Brucella species to provide a valuable tool for diagnosis. Conclusion This method can be more useful than serological and biochemical tests and in addition, this reduces the number of required tests more rapidly and economically. PMID:28070255

  6. Validation and Application of a PCR Primer Set to Quantify Fungal Communities in the Soil Environment by Real-Time Quantitative PCR

    PubMed Central

    Chemidlin Prévost-Bouré, Nicolas; Christen, Richard; Dequiedt, Samuel; Mougel, Christophe; Lelièvre, Mélanie; Jolivet, Claudy; Shahbazkia, Hamid Reza; Guillou, Laure; Arrouays, Dominique; Ranjard, Lionel

    2011-01-01

    Fungi constitute an important group in soil biological diversity and functioning. However, characterization and knowledge of fungal communities is hampered because few primer sets are available to quantify fungal abundance by real-time quantitative PCR (real-time Q-PCR). The aim in this study was to quantify fungal abundance in soils by incorporating, into a real-time Q-PCR using the SYBRGreen® method, a primer set already used to study the genetic structure of soil fungal communities. To satisfy the real-time Q-PCR requirements to enhance the accuracy and reproducibility of the detection technique, this study focused on the 18S rRNA gene conserved regions. These regions are little affected by length polymorphism and may provide sufficiently small targets, a crucial criterion for enhancing accuracy and reproducibility of the detection technique. An in silico analysis of 33 primer sets targeting the 18S rRNA gene was performed to select the primer set with the best potential for real-time Q-PCR: short amplicon length; good fungal specificity and coverage. The best consensus between specificity, coverage and amplicon length among the 33 sets tested was the primer set FR1 / FF390. This in silico analysis of the specificity of FR1 / FF390 also provided additional information to the previously published analysis on this primer set. The specificity of the primer set FR1 / FF390 for Fungi was validated in vitro by cloning - sequencing the amplicons obtained from a real time Q-PCR assay performed on five independent soil samples. This assay was also used to evaluate the sensitivity and reproducibility of the method. Finally, fungal abundance in samples from 24 soils with contrasting physico-chemical and environmental characteristics was examined and ranked to determine the importance of soil texture, organic carbon content, C∶N ratio and land use in determining fungal abundance in soils. PMID:21931659

  7. Comparative assessment of 5' A/T-rich overhang sequences with optimal and sub-optimal primers to increase PCR yields and sensitivity.

    PubMed

    Arif, M; Ochoa-Corona, F M

    2013-09-01

    Efficient PCR amplifications require precisely designed and optimized oligonucleotide primers, components, and cycling conditions. Despite recent software development and reaction improvement, primer design can still be enhanced. The aims of this research are to understand (1) the effect on PCR efficiency and DNA yields of primer thermodynamics parameters, and (2) the incorporation of 5' A/T-rich overhanging sequences (flaps) during primer design. Two primer sets, one optimal (ΔG = 0) and one sub-optimal (ΔG = 0.9), were designed using web interface software Primer3, BLASTn, and mFold to target a movement protein gene of Tobacco mosaic virus. The optimal primer set amplifies a product of 195 bp and supports higher PCR sensitivity and yields compared to the sub-optimal primer set, which amplifies a product of 192 bp. Greater fluorescence was obtained using optimal primers compared to that with sub-optimal primers. Primers designed with sub-optimal thermodynamics can be substantially improved by adding 5' flaps. Results indicate that even if the performance of some primers can be improved substantially by 5' flap addition, not all primers will be similarly improved. Optimal 5' flap sequences are dependent on the primer sequences, and alter the primer's T m value. The manipulation of this feature may enhance primer's efficiency to increase the PCR sensitivity and DNA yield.

  8. Fusion primer and nested integrated PCR (FPNI-PCR): a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    PubMed Central

    2011-01-01

    Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809

  9. Development of strain-specific PCR primers for quantitative detection of Bacillus mesentericus strain TO-A in human feces.

    PubMed

    Sato, Naoki; Seo, Genichiro; Benno, Yoshimi

    2014-01-01

    Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.

  10. LSSP-PCR of Trypanosoma cruzi: how the single primer sequence affects the kDNA signature

    PubMed Central

    2013-01-01

    Background Low-stringency single specific primer PCR (LSSP-PCR) is a highly sensitive and discriminating technique that has been extensively used to genetically characterize Trypanosoma cruzi populations in the presence of large amounts of host DNA. To ensure high sensitivity, in most T. cruzi studies, the variable regions of the naturally amplified kinetoplast DNA (kDNA) minicircles were targeted, and this method translated the intraspecific polymorphisms of these molecules into specific and reproducible kDNA signatures. Although the LSSP-PCR technique is reproducible under strict assay conditions, the complex banding pattern generated can be significantly altered by even a single-base change in the target DNA. Our survey of the literature identified eight different primers with similar, if not identical, names that have been used for kDNA amplification and LSSP-PCR of T. cruzi. Although different primer sequences were used in these studies, many of the authors cited the same reference report to justify their primer choice. We wondered whether these changes in the primer sequence could affect also the parasite LSSP-PCR profiles. Findings To answer this question we compared the kDNA signatures obtained from three different and extensively studied T. cruzi populations with the eight primers found in the literature. Our results clearly demonstrate that even minimal modifications in the oligonucleotide sequences, especially in the 3′ or 5′ end, can significantly change the kDNA signature of a T. cruzi strain. Conclusions These results highlight the necessity of careful preservation of primer nomenclature and sequence when reproducing an LSSP-PCR work to avoid confusion and allow comparison of results among different laboratories. PMID:23639061

  11. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp.

    PubMed

    Jothikumar, N; Hill, Vincent R

    2013-06-28

    We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3'-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5'-end forms a hairpin structure. A fluorescent dye is attached to 5'-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3' dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000-0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource-limited environments.

  12. New PCR primers targeting hydrazine synthase and cytochrome c biogenesis proteins in anammox bacteria.

    PubMed

    Zhou, Zhichao; Chen, Jing; Meng, Han; Dvornyk, Volodymyr; Gu, Ji-Dong

    2017-02-01

    PCR primers targeting genes encoding the two proteins of anammox bacteria, hydrazine synthase and cytochrome c biogenesis protein, were designed and tested in this study. Three different ecotypes of samples, namely ocean sediments, coastal wetland sediments, and wastewater treatment plant (WWTP) samples, were used to assess the primer efficiency and the community structures of anammox bacteria retrieved by 16S ribosomal RNA (rRNA) and the functional genes. Abundances of hzsB gene of anammox bacteria in South China Sea (SCS) samples were significantly correlated with 16S rRNA gene by qPCR method. And hzsB and hzsC gene primer pair hzsB364f-hzsB640r and hzsC745f-hzsC862r in combination with anammox bacterial 16S rRNA gene primers were recommended for quantifying anammox bacteria. Congruent with 16S rRNA gene-based community study, functional gene hzsB could also delineate the coastal-ocean distributing pattern, and seawater depth was positively associated with the diversity and abundance of anammox bacteria from shallow- to deep-sea. Both hzsC and ccsA genes could differentiate marine samples between deep and shallow groups of the Scalindua sp. clades. As for WWTP samples, non-Scalindua anammox bacteria reflected by hzsB, hzsC, ccsA, and ccsB gene-based libraries showed a similar distribution pattern with that by 16S rRNA gene. NH4(+) and NH4(+)/Σ(NO3(-) + NO2(-)) positively correlated with anammox bacteria gene diversity, but organic matter contents correlated negatively with anammox bacteria gene diversity in SCS. Salinity was positively associated with diversity indices of hzsC and ccsB gene-harboring anammox bacteria communities and could potentially differentiate the distribution patterns between shallow- and deep-sea sediment samples. SCS surface sediments harbored considerably diverse community of Scalindua. A new Mai Po clade representing coastal estuary wetland anammox bacteria group based on 16S rRNA gene phylogeny is proposed. Existence of anammox

  13. Identification of Mycobacterium bovis in bovine clinical samples by PCR species-specific primers.

    PubMed Central

    Romero, R E; Garzón, D L; Mejía, G A; Monroy, W; Patarroyo, M E; Murillo, L A

    1999-01-01

    Tuberculosis, caused by Mycobacterium bovis is emerging as the most important disease affecting cattle. Furthermore, it results in a major public health problem when transmitted to humans. Due to its difficult and non-specific diagnosis, M. bovis has been declared to be one of the etiologic agents causing significant economic loss in the cattle industry. Our group evaluated a more rapid and specific method, based on a new polymerase chain reaction species-specific primers, which amplifies a 470-base pair fragment of the M. bovis genome. A total of 275 milk-producing cows were studied by intradermal tuberculin test (ITT) which gave 184 positive and 91 negative cases. From them, 50 animals were taken from a cattle ranch free of tuberculosis. Three different samples were collected from each animal (blood, nasal mucus, and milk). Positive results were obtained from 26 animals by PCR (11.4%), 1 by bacteriological culturing (0.4%) and 1 by bacilloscopy (0.4%). This finding suggests, as in previous reports, that ITT, normally used for bovine tuberculosis detection, has the inconvenience of having a broad range of specificity and sensitivity, and the PCR technique is a more specific and sensitive test to detect infection associated with M. bovis. Therefore, we propose this PCR assay as a useful tool in the epidemiological characterization of infected animals in areas considered to be at high risk of transmission. Images Figure 1. PMID:10369566

  14. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    PubMed

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases.

  15. Environmental distribution of two widespread uncultured freshwater Euryarchaeota clades unveiled by specific primers and quantitative PCR.

    PubMed

    Restrepo-Ortiz, Claudia X; Casamayor, Emilio O

    2013-12-01

    Quantitative environmental distribution of two widely distributed uncultured freshwater Euryarchaeota with unknown functional role was explored by newly designed quantitative PCR primers targeting the 16S rRNA gene of clades Miscellaneous Euryarchaeota Group (MEG, containing the groups pMC2A384 and VALII/Eury4) and Deep-Sea Euryarchaeotal Groups (DSEG, targeting the cluster named VALIII containing the DHVE-3/DSEG, BC07-2A-27/DSEG-3 and DSEG-2 groups), respectively. The summer surface plankton of 28 lakes was analysed, and one additional dimictic deep alpine lake, Lake Redon, was temporally and vertically surveyed covering seasonal limnological variability. A trophic range between 0.2 and 5.2 μg l(-1) Chl a, and pH span from 3.8 to 9.5 was explored at altitudes between 632 and 2590 m above sea level. The primers showed to be highly selective with c. 85% coverage and 100% specificity. Only pH significantly explained the changes observed in gene abundances and environment. In Lake Redon, DSEG bloomed in deep stratified waters both in summer and early spring, and MEG at intermediate depths during the ice-cover period. Overall, MEG and DSEG showed a differential ecological distribution although correlational analyses indicated lack of coupling of both Euryarchaeota with phytoplankton (chlorophyll a). However, an intriguing positive and significant relationship was found between DSEG and putative ammonia oxidizing thaumarchaeota.

  16. Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers

    PubMed Central

    Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie

    2013-01-01

    The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. PMID:23996915

  17. Determination of ABO genotypes by real-time PCR using allele-specific primers.

    PubMed

    Muro, Tomonori; Fujihara, Junko; Imamura, Shinji; Nakamura, Hiroaki; Kimura-Kataoka, Kaori; Toga, Tomoko; Iida, Reiko; Yasuda, Toshihiro; Takeshita, Haruo

    2012-01-01

    ABO grouping of biological specimens is informative for identifying victims and narrowing down suspects. In Japan and elsewhere, ABO grouping as well as DNA profiling plays an essential role in crime investigations. In the present study, we developed a new method for ABO genotyping using allele-specific primers and real-time PCR. The method allows for the detection of three single nucleotide polymorphisms (SNPs) at nucleotide positions 261, 796, and 803 in the ABO gene and the determination of six major ABO genotypes. This method required less than 2 h for accurate ABO genotyping using 2.0 ng of DNA. This method could be applicable for rapid and simple screening of forensic samples.

  18. Primer design for identifying economically important Liriomyza species (Diptera: Agromyzidae) by multiplex PCR.

    PubMed

    Nakamura, Shigeo; Masuda, Toshio; Mochizuki, Atsushi; Konishi, Kazuhiko; Tokumaru, Susumu; Ueno, Keiichiro; Yamaguchi, Takuhiro

    2013-01-01

    Leafminer flies, especially, Liriomyza huidobrensis, Liriomyza sativae and Liriomyza trifolii, are quarantine species in many countries. Their morphological similarity makes identification difficult. To develop a rapid, reliable, sensitive and simple molecular identification method using multiplex PCR, we newly sequenced the mitochondrial cytochrome oxidase I (COI) genes of Liriomyza bryoniae, Liriomyza chinensis, L. huidobrensis, L. sativae, L. trifolii, Chromatomyia horticola and four parasitoid species. We aligned them with all the COI sequences of the leafminer flies found in the international DNA nucleotide sequence databases (DDBJ/EMBL/GenBank). We then designed species-specific primers to allow us to differentiate between L. bryoniae, L. chinensis, L. huidobrensis, L. sativae, and L. trifolii.

  19. Evaluation of combined general primer-mediated PCR sequencing and type-specific PCR strategies for determination of human papillomavirus genotypes in cervical cell specimens.

    PubMed

    Fontaine, Véronique; Mascaux, Corinne; Weyn, Christine; Bernis, Aurore; Celio, Nathalie; Lefèvre, Philippe; Kaufman, Leonard; Garbar, Christian

    2007-03-01

    A strategy combining human papillomavirus general primer (mainly the PGMY primers)-directed PCR sequencing and type-specific PCR is presented. DNA samples were first tested in general primer-mediated PCR. The amplified fragments of positive samples after ethidium bromide-stained DNA gel analysis were further sequenced, and corresponding DNA samples were further analyzed by PCR using type-specific primers for human papillomavirus (HPV) types 16, 18, 31, and 52. The comparison of the results of 157 samples analyzed by this strategy in parallel with the Hybrid Capture 2 tests and with the HPV INNO-LiPA (Innogenetics line probe assay) shows that this method is suitable for HPV detection and genotyping in cervical cell samples. Although the PCR sequencing method is as sensitive as the HPV INNO-LiPA for HPV detection, our method allows the identification of a broader range of HPV types. In contrast, the HPV INNO-LiPA was less time-consuming and better identified coinfections.

  20. Evaluation of Combined General Primer-Mediated PCR Sequencing and Type-Specific PCR Strategies for Determination of Human Papillomavirus Genotypes in Cervical Cell Specimens▿

    PubMed Central

    Fontaine, Véronique; Mascaux, Corinne; Weyn, Christine; Bernis, Aurore; Celio, Nathalie; Lefèvre, Philippe; Kaufman, Leonard; Garbar, Christian

    2007-01-01

    A strategy combining human papillomavirus general primer (mainly the PGMY primers)-directed PCR sequencing and type-specific PCR is presented. DNA samples were first tested in general primer-mediated PCR. The amplified fragments of positive samples after ethidium bromide-stained DNA gel analysis were further sequenced, and corresponding DNA samples were further analyzed by PCR using type-specific primers for human papillomavirus (HPV) types 16, 18, 31, and 52. The comparison of the results of 157 samples analyzed by this strategy in parallel with the Hybrid Capture 2 tests and with the HPV INNO-LiPA (Innogenetics line probe assay) shows that this method is suitable for HPV detection and genotyping in cervical cell samples. Although the PCR sequencing method is as sensitive as the HPV INNO-LiPA for HPV detection, our method allows the identification of a broader range of HPV types. In contrast, the HPV INNO-LiPA was less time-consuming and better identified coinfections. PMID:17229855

  1. rDNA-targeted PCR primers and FISH probe in the detection of Ophiocordyceps sinensis hyphae and conidia.

    PubMed

    Zhong, Xin; Peng, Qingyun; Qi, Lili; Lei, Wei; Liu, Xin

    2010-11-01

    Ophiocordyceps sinensis (Berk.) Sung, Sung, Hywel-Jones & Spatafora (syn. Cordyceps sinensis) one of the entomopathogenic fungi, is a rare Traditional Chinese Medicine (TCM) found in the Qinghai-Tibetan Plateau. Polymerase Chain Reaction (PCR) and Fluorescence in situ hybridization (FISH) methods are necessary to identify the mycelia or spores of O. sinensis from its habitat and to monitor its dispersal, colonization and infectivity. To develop both primers and probe specific to O. sinensis, ribosomal DNA (rDNA) amplified with universal primers from O. sinensis genomic DNA and seven closely related fungi were sequenced. According to these sequences, the upper and lower primers (OsT-F and OsT-R) were designed within internal transcribed spacer region 1 (ITS1) and ITS2 and flanked by universal primers ITS5 and ITS4, respectively. The designed primers were used for general PCR, touchdown PCR, or both together with the universal primers for nested-touchdown PCR. The results showed that only the extracted DNA of O. sinensis was specifically amplified. The sensitivity of nested-touchdown PCR with extracted DNA of O. sinensis is as low as 10(-14)g (10 fg) and at least 1000 times higher than the other PCR methods. In addition, Cy5-labeled probe (OsLSU) for cytoplasmic LSU rRNA was hybridized with the ascospores of O. sinensis. It showed a strong red fluorescence throughout the whole cell but did not cross-react with other entomopathogenic fungi. Taken together, these methods were useful for studying the biology and ecology of O. sinensis.

  2. Controlled hot start and improved specificity in carrying out PCR utilizing touch-up and loop incorporated primers (TULIPS).

    PubMed

    Ailenberg, M; Silverman, M

    2000-11-01

    The PCR technique often yields nonspecific products. To overcome this problem, a simple, specific and efficient method was designed: touch-up and loop incorporated primers (TULIPS)-PCR. This approach utilizes loop primers (i.e., additional nontemplate 5' sequence that self-anneals to the 3' region and inhibits initiation of polymerization). Upon heating of the reaction, the primers melt, initiating hot start. The reaction also uses touch-up pre-cycling with gradual elevation in annealing temperatures to ensure correct pairing. The method has been validated with glyceraldehyde-3-phosphate dehydrogenase (GAPD) primers, and its general applicability is demonstrated by specific amplification of the human gelatinase A transgene from genomic DNA extracted from transgenic mice tails. The TULIPS-PCR protocol is a novel method. The self-annealing primers utilized in this method offer improved specificity and more robust synthesis compared with touch-down and manual hot start PCR. It is performed without the need to open, pause or add to the reaction mixture any nonrectant components, such as wax, antibody or nonspecific dsDNA.

  3. Comparison of primers for RAPD-PCR from environmental isolates of Cryptococcus neoformans, Cryptococcus albidus and Cryptococcus laurentii complex.

    PubMed

    Dos Santos Pedroso, Reginaldo; Ferreira, Joseane Cristina; da Costa, Karen Regina Carim; Candido, Regina Celia

    2012-07-01

    Various organisms have been characterized by molecular methods, including fungi of the genus Cryptococcus. The purposes of this study were: to determine the discriminatory potential of the RAPD (Random Amplified Polymorphic DNA) primers, the pattern of similarity of the Cryptococcus species, and discuss their useful application in epidemiological studies. We analyzed 10 isolates of each specie/group: C. albidus, C. laurentii complex, C. neoformans var. grubii, all from environmental source, and two ATCC strains, C. neoformans var. grubii ATCC 90112, and C. neoformans var. neoformans ATCC 28957 by RAPD-PCR using the primers CAV1, CAV2, ZAP19, ZAP20, OPB11 and SEQ6. The primers showed a good discriminatory power, revealing important differences between them and between species; the SEQ6 primer discriminated a larger number of isolates of three species. Isolates of C. laurentii showed greater genetic diversity than other species revealed by all six primers. Isolates of C. neoformans were more homogeneous. Only the primer CAV2 showed no amplification of DNA bands for C. albidus. It was concluded that the use of limited number of carefully selected primers allowed the discrimination of different isolates, and some primers (e.g., CAV2 for C. albidus) may not to be applied to some species.

  4. Comparison of primers for RAPD-PCR from environmental isolates of Cryptococcus neoformans, Cryptococcus albidus and Cryptococcus laurentii complex

    PubMed Central

    dos Santos Pedroso, Reginaldo; Ferreira, Joseane Cristina; da Costa, Karen Regina Carim; Candido, Regina Celia

    2012-01-01

    Various organisms have been characterized by molecular methods, including fungi of the genus Cryptococcus. The purposes of this study were: to determine the discriminatory potential of the RAPD (Random Amplified Polymorphic DNA) primers, the pattern of similarity of the Cryptococcus species, and discuss their useful application in epidemiological studies. We analyzed 10 isolates of each specie/group: C. albidus, C. laurentii complex, C. neoformans var. grubii, all from environmental source, and two ATCC strains, C. neoformans var. grubii ATCC 90112, and C. neoformans var. neoformans ATCC 28957 by RAPD-PCR using the primers CAV1, CAV2, ZAP19, ZAP20, OPB11 and SEQ6. The primers showed a good discriminatory power, revealing important differences between them and between species; the SEQ6 primer discriminated a larger number of isolates of three species. Isolates of C. laurentii showed greater genetic diversity than other species revealed by all six primers. Isolates of C. neoformans were more homogeneous. Only the primer CAV2 showed no amplification of DNA bands for C. albidus. It was concluded that the use of limited number of carefully selected primers allowed the discrimination of different isolates, and some primers (e.g., CAV2 for C. albidus) may not to be applied to some species. PMID:24031912

  5. Multiplex detection and genotyping of pathogenic bacteria on paper-based biosensor with a novel universal primer mediated asymmetric PCR.

    PubMed

    Liu, Fang; Liu, Hongxing; Liao, Yuhui; Wei, Jitao; Zhou, Xiaoming; Xing, Da

    2015-12-15

    Traditionary multiplex asymmetric polymerase chain reaction (PCR) can be applied to detect multiplex target organisms simultaneously, but complex optimizations of primer concentrations and staggered additions of primers are required to achieve equal amplification of multiplex genes. To overcome this shortcoming, we propose a novel method based on multiplex asymmetric PCR and paper-based nucleic acid diagnostics (PBNAD). In the asymmetric PCR, a universal primer was introduced to break the bottlenecks of low sensitivity and self-inhibition among different sets of primers. Amplification using the novel multiplex asymmetric PCR boosted the quantity of single-stranded amplicons, and the amplified products contained the same sequence at the 5' end. Therefore, only one gold nanoparticle-based signal probe was needed for the simultaneous detection of three genes using the PBNAD platform, and the detection signals could be observed with the naked eye. With this highly efficient, novel multiplex asymmetric PCR, as little as 1 pg/μL genomic DNA can be detected. This method can also be applied to genotyping for reliable epidemiological investigations. This proof-of-concept study highlights the potential of the PBNAD platform for cost- and labor-effective applications in the detection of pathogenic bacteria.

  6. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers.

    PubMed

    Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos

    2015-10-22

    Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  7. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

    PubMed Central

    Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C.; Chorianopoulos, Nikos

    2015-01-01

    Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry. PMID:26506345

  8. A Unique Primer with an Inosine Chain at the 5'-Terminus Improves the Reliability of SNP Analysis Using the PCR-Amplified Product Length Polymorphism Method.

    PubMed

    Shojo, Hideki; Tanaka, Mayumi; Takahashi, Ryohei; Kakuda, Tsuneo; Adachi, Noboru

    2015-01-01

    Polymerase chain reaction-amplified product length polymorphism (PCR-APLP) is one of the most convenient and reliable methods for single nucleotide polymorphism (SNP) analysis. This method is based on PCR, but uses allele-specific primers containing SNP sites at the 3'-terminus of each primer. To use this method at least two allele-specific primers and one "counter-primer", which serves as a common forward or reverse primer of the allele-specific primers, are required. The allele-specific primers have SNP sites at the 3'-terminus, and another primer should have a few non-complementary flaps at the 5'-terminus to detect SNPs by determining the difference of amplicon length by PCR and subsequent electrophoresis. A major disadvantage of the addition of a non-complementary flap is the non-specific annealing of the primer with non-complementary flaps. However, a design principle for avoiding this undesired annealing has not been fully established, therefore, it is often difficult to design effective APLP primers. Here, we report allele-specific primers with an inosine chain at the 5'-terminus for PCR-APLP analysis. This unique design improves the competitiveness of allele-specific primers and the reliability of SNP analysis when using the PCR-APLP method.

  9. PCR detection of human papillomavirus: comparison between MY09/MY11 and GP5+/GP6+ primer systems.

    PubMed

    Qu, W; Jiang, G; Cruz, Y; Chang, C J; Ho, G Y; Klein, R S; Burk, R D

    1997-06-01

    Human papillomavirus (HPV) is an etiologic agent of cervical cancer and is the most common sexually transmitted disease in women. PCR amplification of HPV genomes is the most sensitive method for the detection of cervicovaginal HPV. We have compared the two most commonly used PCR primer sets, MY09/MY11 (MY-PCR) and GP5+/GP6+ (GP+-PCR), for the detection of HPV DNA in cervicovaginal lavage samples from 208 women. Oligonucleotide probes for 39 different HPV types were used. Both primer sets amplified a wide spectrum of HPV genotypes and detected similar overall prevalences of 45% (94 of 208) and 43% (89 of 208), respectively. The MY-PCR system detected 27 of 30 (90%) samples with multiple HPV types, whereas the GP+-PCR system detected 14 of 30 (47%) samples with multiple HPV types. Differences in the detection of HPV types 35, 53, and 61 were noted between the two primer systems. Serial dilution of plasmid templates indicated a 3-log decrease in the amplification of HPV type 35 by MY-PCR and HPV types 53 and 61 by GP+-PCR. These results indicate that although the MY-PCR and GP+-PCR identified nearly equivalent prevalences of HPV in a set of clinical samples, differences in the detection of specific types and infections with multiple types were found. Differences in the sensitivities and characteristics of the PCR systems for the detection of HPV within clinical samples should be considered when comparing data between studies and/or in designing new studies or clinical trials.

  10. DegePrime, a program for degenerate primer design for broad-taxonomic-range PCR in microbial ecology studies.

    PubMed

    Hugerth, Luisa W; Wefer, Hugo A; Lundin, Sverker; Jakobsson, Hedvig E; Lindberg, Mathilda; Rodin, Sandra; Engstrand, Lars; Andersson, Anders F

    2014-08-01

    The taxonomic composition of a microbial community can be deduced by analyzing its rRNA gene content by, e.g., high-throughput DNA sequencing or DNA chips. Such methods typically are based on PCR amplification of rRNA gene sequences using broad-taxonomic-range PCR primers. In these analyses, the use of optimal primers is crucial for achieving an unbiased representation of community composition. Here, we present the computer program DegePrime that, for each position of a multiple sequence alignment, finds a degenerate oligomer of as high coverage as possible and outputs its coverage among taxonomic divisions. We show that our novel heuristic, which we call weighted randomized combination, performs better than previously described algorithms for solving the maximum coverage degenerate primer design problem. We previously used DegePrime to design a broad-taxonomic-range primer pair that targets the bacterial V3-V4 region (341F-805R) (D. P. Herlemann, M. Labrenz, K. Jurgens, S. Bertilsson, J. J. Waniek, and A. F. Andersson, ISME J. 5:1571-1579, 2011, http://dx.doi.org/10.1038/ismej.2011.41), and here we use the program to significantly increase the coverage of a primer pair (515F-806R) widely used for Illumina-based surveys of bacterial and archaeal diversity. By comparison with shotgun metagenomics, we show that the primers give an accurate representation of microbial diversity in natural samples.

  11. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    PubMed

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

  12. Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel Electrophoresis

    PubMed Central

    Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.

    2003-01-01

    Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643

  13. Collecting in collections: a PCR strategy and primer set for DNA barcoding of decades-old dried museum specimens.

    PubMed

    Mitchell, Andrew

    2015-09-01

    Natural history museums are vastly underutilized as a source of material for DNA analysis because of perceptions about the limitations of DNA degradation in older specimens. Despite very few exceptions, most DNA barcoding projects, which aim to obtain sequence data from all species, generally use specimens collected specifically for that purpose, instead of the wealth of identified material in museums, constrained by the lack of suitable PCR methods. Any techniques that extend the utility of museum specimens for DNA analysis therefore are highly valuable. This study first tested the effects of specimen age and PCR amplicon size on PCR success rates in pinned insect specimens, then developed a PCR primer set and amplification strategy allowing greatly increased utilization of older museum specimens for DNA barcoding. PCR success rates compare favourably with the few published studies utilizing similar aged specimens, and this new strategy has the advantage of being easily automated for high-throughput laboratory workflows. The strategy uses hemi-nested, degenerate, M13-tailed PCR primers to amplify two overlapping amplicons, using two PCRs per amplicon (i.e. four PCRs per DNA sample). Initial PCR products are reamplified using an internal primer and a M13 primer. Together the two PCR amplicons yield 559 bp of the COI gene from Coleoptera, Lepidoptera, Diptera, Hemiptera, Odonata and presumably also other insects. BARCODE standard-compliant data were recovered from 67% (56 of 84) of specimens up to 25 years old, and 51% (102 of 197) of specimens up to 55 years old. Given the time, cost and specialist expertise required for fieldwork and identification, 'collecting in collections' is a viable alternative allowing researchers to capitalize on the knowledge captured by curation work in decades past.

  14. Influence of primer & probe chemistry and amplification target on reverse transcription digital PCR quantification of viral RNA.

    PubMed

    Van Heuverswyn, Fran; Karczmarczyk, Maria; Schimmel, Heinz; Trapmann, Stefanie; Emons, Hendrik

    2016-09-01

    Compared to other PCR technologies, digital PCR is a potentially highly accurate approach for the quantification of nucleic acid fragments. This study describes the impact of four experimental factors, namely primer and probe chemistry, PCR amplification target, duplexing, and template type, on the measurement results obtained by reverse transcription digital PCR (RT-dPCR) of viral RNA using influenza A virus as a model. Along conventional dual labelled probes (DLP), alternative primer and probe chemistries, including Zip Nucleic Acids (ZNAs), Locked Nucleic Acids (LNAs), and Scorpions(®), were compared with two RNA template types: i) total genomic RNA extracted from cell cultured influenza A and ii) a synthetically prepared RNA transcript (In vitro transcribed RNA). While apparently duplexing or a different PCR target choice did not have a significant influence on the estimated RNA copy numbers, the impact of the choice of primer and probe chemistry and template type differed significantly for some methods. The combined standard uncertainty of the dPCR analysis results has been assessed, taking into account both the repeatability and the intermediate precision of the procedure. Our data highlight the importance of dPCR method optimisation and the advantage of using a more sophisticated primer and probe chemistry, which turned out to be dependent on the template type. Considerations are provided with respect to the molecular diagnostics of viral RNA pathogens, and more specifically, for precise quantification of RNA, which is of tremendous importance for the development of RNA calibration materials and the qualification of these calibrants as certified reference materials.

  15. Modified Proofreading PCR for Detection of Point Mutations, Insertions and Deletions Using a ddNTP-Blocked Primer.

    PubMed

    Hao, Weiming; Fan, Lujuan; Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu

    2015-01-01

    The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach.

  16. Evaluation of multiplex PCR using MPB64 and IS6110 primers for rapid diagnosis of tuberculous meningitis.

    PubMed

    Lekhak, Sunil Prasad; Sharma, Laxmi; Rajbhandari, Reema; Rajbhandari, Pravesh; Shrestha, Resha; Pant, Basant

    2016-09-01

    Tuberculous meningitis (TBM) is one of those most serious manifestations of extra-pulmonary tuberculosis and prompt diagnosis and treatment is required for better clinical outcome. It is difficult to diagnose due to lack of rapid, sensitive, and specific tests. Newer methods, which are easy and reliable, are required to diagnose TBM at an early stage. Thus our aim was to evaluate the Multiplex polymerase chain reaction (PCR) technique, using primers directed against the insertion sequence IS6110 and MPB64 gene for the detection of Mycobacterium tuberculosis in Cerebrospinal fluid (CSF), for rapid diagnosis of TBM patients. 102 CSF samples were analyzed from patients suspected with TBM along with a control group of 10 patients having other neurological disorders. CSF sediments were analyzed individually for M. tuberculosis DNA by Multiplex PCR using two set of primers targeting insertion sequence IS6110 and gene MBp64, which is very specific for MTBC. Out of 37 patients diagnosed with TBM clinically, MPB64 PCR was positive in 22, IS6110 PCR was positive in 28, both PCR using Multiplex were positive in 34 and Microscopy was positive in one. Thus Sensitivity of MPB64 PCR, IS6110 PCR, Multiplex PCR and Microscopy were found to be 62.3%, 75.4%, 91.8% and 2.7% respectively. In non TBM group PCR was negative in all cases hence, the specificity was 100%. Multiplex PCR system using primers targeting IS6110 and MPB64, for the detection of M. tuberculosis DNA in CSF samples, has high sensitivity than any one of them alone, and could be used for the early detection of TBM in CSF samples.

  17. Primers determine the sensitivity of PCR-mediated hepatitis B virus DNA detection and pretreatment of PCR mixture with 8-methoxypsoralen eliminates false-positive results.

    PubMed

    Keum, W K; Park, C E; Lee, J H; Khil, L Y; Kang, I; Kim, S S; Jung, J C; Oh, S M; Woo, H J; Lee, J H; Kim, Y C; Yoon, Y; Choi, J W; Ha, J

    1997-04-30

    Most methods for the diagnosis of hepatitis B virus (HBV) infection largely depend on viral DNA detection by polymerase chain reaction (PCR) or radioimmunological assay of viral antigens or antibodies. The quality assurance program recently established in Europe reported that PCR-mediated HBV DNA detection methods used in many laboratories produced a high rate of false-positive and false-negative results. Thus, we attempted to improve the conditions of current PCR methods for detection of HBV DNA. In the present study, we applied a recently developed method of releasing HBV DNA from virion by NaOH treatment of patient serum. Using four different primer sets specific to the HBV core region, we found that the sensitivity of first-round PCR can be improved by more than two orders of magnitude depending on the primers. The second round of PCR using nested primers was sensitive enough to detect up to 10(-6) pg of the HBV DNA, which is equivalent to approximately 3 copies of the HBV genome. Among the approximately 800 HBV-infected patient sera investigated in our laboratory, more than 60% of the tested samples gave positive results in the first-round PCR. The rate of positive results obtained using our experimental conditions is very high in comparison with other reports. The reamplification of the first-round PCR reaction mixture with the nested primers produced practically 100% positive results. For diagnosis of HBV infection, we routinely used 1 microliter of patient serum, which was found to be optimum in our laboratory. Surprisingly, from 20% of our positive results, even serum diluted to 1/100 (0.01 microliter) produced a stronger signal than 1 microliter. This observation suggests that direct PCR amplification of HBV DNA released from serum by NaOH treatment has to be compensated by other DNA detection methods for correct quantitation. In order to eliminate the false positive signal resulting from the carry-over due to massive screening of a large number of

  18. Mining of novel species-specific primers for PCR detection of Listeria monocytogenes based on genomic approach.

    PubMed

    Tao, Tingting; Chen, Qiming; Bie, Xiaomei; Lu, Fengxia; Lu, Zhaoxin

    2015-12-01

    Listeria monocytogenes in contaminated food is considered as a serious health threat for consumers due to its high mortality rate. The objective of this study was to obtain novel species-specific target-genes and primers for the molecular detection of L. monocytogenes using a comparative genomic approach. By comparative analysis of L. monocytogenes and non-L. monocytogenes genome sequences in the GenBank database with BLAST program, 26 specific target sequences were used as candidates and the primers were designed for L. monocytogenes species-specificity verification by using PCR assay. Finally, the three genes LMOf2365_0970, LMOf2365_2721 and mpl were identified to have L. monocytogenes species-specificity and be unique as detection targets for diagnostic application. The species-specific primer Lm8 of gene LMOf2365_0970, Lm13 of gene LMOf2365_2721 and Lm20 of gene mpl showed better specificity and sensitivity than the primers described previously. The PCR detection limits of the three specific primer sets were 430, 43, 4.3 fg/μL for genomic DNA, and 5 × 10(3), 50, 5 cfu/mL for pure culture of L. monocytogenes. There was no interference in specificity of detecting L. monocytogenes by co-culture with other foodborne pathogens in high concentration. Moreover, after 6-8 h of enrichment, L. monocytogenes in the artificially contaminated milk samples at an inoculum dose of 38 cfu/10 mL milk could be detected successfully with the studied three primers. Therefore, the three specific genes and primers can be applied to establish a novel rapid and accurate method for detecting L. monocytogenes in food materials.

  19. PCR primers specific for the genus Tuber reveal the presence of several truffle species in a truffle-ground.

    PubMed

    Zampieri, Elisa; Mello, Antonietta; Bonfante, Paola; Murat, Claude

    2009-08-01

    Truffles are hypogeous Ascomycete fungi belonging to the genus Tuber and forming fruiting bodies highly prized for their taste and aroma. The identification of the genus Tuber and its species is important to investigate their ecology and avoid fraud in the food market. As genus-specific primers are not available, the aims of this work were (1) to assess the usefulness of the beta-tubulin gene as a DNA barcoding region for designing Tuber genus-specific primers, (2) to test the primers on a range of fruiting bodies, representing a large part of truffle biodiversity and (3) to check their ecological usefulness, applying them to truffle-ground soil. The new primers designed on the beta-tubulin gene were specific to the Tuber genus in nested PCR. When applied to DNA from soils, they gave a positive signal for 23 of 32 soils. Phylogenetic analysis confirmed that the bands corresponded to Tuber and that at least five Tuber species were present in the truffle-ground. beta-tubulin was found to be a good barcoding region for designing Tuber genus-specific primers, detecting a high Tuber diversity in a natural environment. These primers will be useful for understanding truffle ecology and for practical needs in plantation management.

  20. An RT-PCR primer pair for the detection of Pospiviroid and its application in surveying ornamental plants for viroids.

    PubMed

    Bostan, Hidayet; Nie, Xianzhou; Singh, Rudra P

    2004-03-15

    A primer pair for reverse transcription-polymerase chain reaction (RT-PCR), based on the conserved sequences of the members of genus Pospiviroid was designed to yield a fragment of about 200 base pairs (bp). Since pospiviroids infect a large number of plants species and a few members of the genus Pospiviroid have been already detected in some ornamental plants, the primer pair was evaluated for its efficacy using ornamental plants. The method of return-polyacrylamide gel electrophoresis (R-PAGE) was used to determine the general presence of viroids in the test samples. Efficacy of the primer pair for members of genus Pospiviroid was demonstrated by the detection of Potato spindle tuber viroid (PSTVd) and Tomato chlorotic dwarf viroid (TCDVd) in potato, Chrysanthemum stunt viroid and Iresine viroid in Verbena and Vinca species, and Citrus exocortis viroid in Impatiens species. Specificity of the primer pair became evident, where additional viroids were detected by R-PAGE in Coleus and Magilla species, but they were not amplified by the Pospiviroid primer. This primer pair would be of benefit in indexing ornamental plants in quarantine samples or in viroid-free certification schemes, irrespective of their actual identity.

  1. Single-step PCR using (GACA)4 primer: utility for rapid identification of dermatophyte species and strains.

    PubMed

    Shehata, Atef S; Mukherjee, Pranab K; Aboulatta, Hassan N; el-Akhras, Atef I; Abbadi, Said H; Ghannoum, Mahmoud A

    2008-08-01

    Dermatophytes are fungi that belong to three genera: Epidermophyton, Microsporum, and Trichophyton. Identification of dermatophyte species is essential for appropriate diagnosis and treatment of dermatophytosis. Routine identification depends on macroscopic and microscopic morphology, which is time-consuming and does not identify dermatophyte strains. In this study, two PCR-based methods were compared for their abilities to identify 21 dermatophyte isolates obtained from Egyptian patients to the species and strain levels. The first method employed a two-step method: PCR amplification, using ITS1 and ITS4 as primers, followed by restriction enzyme digestion using the endonuclease MvaI. The second method employed a one-step approach employing the repetitive oligonucleotide (GACA)(4) as a primer. Dermatophyte strains were also identified using a conventional culture method. Our results showed that the conventional culture method identified four species: Microsporum canis, Trichophyton mentagrophytes, Trichophyton rubrum, and Trichophyton violaceum. Moreover, both PCR methods agreed with the diagnosis made using the conventional approach. Furthermore, ITS1/ITS4-based PCR provided no strain differentiation, while (GACA)(4)-based PCR identified different varieties among the T. mentagrophytes isolates. Taken together, our results suggest that (GACA)(4)-based PCR has utility as a simple and rapid method for identification of dermatophyte species as well as utility for differentiation of T. mentagrophytes variants.

  2. PCR Primers to Study the Diversity of Expressed Fungal Genes Encoding Lignocellulolytic Enzymes in Soils Using High-Throughput Sequencing

    PubMed Central

    Barbi, Florian; Bragalini, Claudia; Vallon, Laurent; Prudent, Elsa; Dubost, Audrey; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

    2014-01-01

    Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5) and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2), active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may lead to the

  3. A novel PCR technique using Alu-specific primers to identify unknown flanking sequences from the human genome

    SciTech Connect

    Minami, M.; Poussin, K.; Brechot, C.; Paterlini, P.

    1995-09-20

    The rapid and reproducible identification of new cellular DNA sequences is difficult to achieve with the currently available procedures. Here we describe a novel approach based on the polymerase chain reaction (PCR) using a primer specific to the known sequence and another directed to a human Alu repeat. To avoid undesirable amplifications between Alu sequences, primers are constructed with dUTPs and destroyed by uracil DNA glycosylase treatment after 10 initial cycles of amplification. Only desirable fragments are then further amplified with specific primers to the known region and to a tag sequence introduced in the Alu-specific primer. Using this protocol, we have successfully indentified cellular sequences flanking integrated hepatitis B virus DNA from the human genome of three hepatoma tissues. The method enables a direct specific amplification without any ligation or nonspecific annealing steps as required by previous PCR-based protocols. This rapid and straightforward approach will be a powerful tool for the study of viral integration sites, but is also widely applicable to other studies of the human genome. 39 refs., 4 figs.

  4. Fast DNA-based identification of the black truffle Tuber melanosporum with direct PCR and species-specific primers.

    PubMed

    Bonito, Gregory

    2009-12-01

    Abstract A quick and sensitive DNA-based assay for identifying the black truffle species Tuber melanosporum is presented. Both direct PCR and species-specific primers are used to amplify a phylogenetically informative region of T. melanosporum rDNA. This method was successfully used to screen fresh and frozen T. melanosporum fruitbodies, and could be modified for the molecular detection of other truffle and mushroom species.

  5. GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms

    PubMed Central

    David, Fabrice P.A.; Rougemont, Jacques; Deplancke, Bart

    2017-01-01

    GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. PMID:28053161

  6. Linear-After-The-Exponential (LATE)-PCR: Primer design criteria for high yields of specific single-stranded DNA and improved real-time detection

    PubMed Central

    Pierce, Kenneth E.; Sanchez, J. Aquiles; Rice, John E.; Wangh, Lawrence J.

    2005-01-01

    Traditional asymmetric PCR uses conventional PCR primers at unequal concentrations to generate single-stranded DNA. This method, however, is difficult to optimize, often inefficient, and tends to promote nonspecific amplification. An alternative approach, Linear-After-The-Exponential (LATE)-PCR, solves these problems by using primer pairs deliberately designed for use at unequal concentrations. The present report systematically examines the primer design parameters that affect the exponential and linear phases of LATE-PCR amplification. In particular, we investigated how altering the concentration-adjusted melting temperature (Tm) of the limiting primer (TmL) relative to that of the excess primer (TmX) affects both amplification efficiency and specificity during the exponential phase of LATE-PCR. The highest reaction efficiency and specificity were observed when TmL - TmX ≥ 5°C. We also investigated how altering TmX relative to the higher Tm of the double-stranded amplicon (TmA) affects the rate and extent of linear amplification. Excess primers with TmX closer to TmA yielded higher rates of linear amplification and stronger signals from a hybridization probe. These design criteria maximize the yield of specific single-stranded DNA products and make LATE-PCR more robust and easier to implement. The conclusions were validated by using primer pairs that amplify sequences within the cystic fibrosis transmembrane regulator (CFTR) gene, mutations of which are responsible for cystic fibrosis. PMID:15937116

  7. Quantification of low-expressed mRNA using 5' LNA-containing real-time PCR primers

    SciTech Connect

    Malgoyre, A.; Banzet, S.; Mouret, C.; Bigard, A.X.; Peinnequin, A. . E-mail: andrepeinnequin@crssa.net

    2007-03-02

    Real-time RT-PCR is the most sensitive and accurate method for mRNA quantification. Using specific recombinant DNA as a template, real-time PCR allows accurate quantification within a 7-log range and increased sensitivity below 10 copies. However, when using RT-PCR to quantify mRNA in biological samples, a stochastic off-targeted amplification can occur. Classical adjustments of assay parameters have minimal effects on such amplification. This undesirable amplification appears mostly to be dependent on specific to non-specific target ratio rather than on the absolute quantity of the specific target. This drawback, which decreases assay reliability, mostly appears when quantifying low-expressed transcript in a whole organ. An original primer design using properties of LNA allows to block off-target amplification. 5'-LNA substitution strengthens 5'-hybridization. Consequently on-target hybridization is stabilized and the probability for the off-target to lead to amplification is decreased.

  8. easyPAC: A Tool for Fast Prediction, Testing and Reference Mapping of Degenerate PCR Primers from Alignments or Consensus Sequences

    PubMed Central

    Rosenkranz, David

    2012-01-01

    The PCR-amplification of unknown homologous or paralogous genes generally relies on PCR primers predicted from multi sequence alignments. But increasing sequence divergence can induce the need to use degenerate primers which entails the problem of testing the characteristics, unwanted interactions and potential mispriming of degenerate primers. Here I introduce easyPAC, a new software for the prediction of degenerate primers from multi sequence alignments or single consensus sequences. As a major innovation, easyPAC allows to apply all customary primer test procedures to degenerate primer sequences including fast mapping to reference files. Thus, easyPAC simplifies and expedites the designing of specific degenerate primers enormously. Degenerate primers suggested by easyPAC were used in PCR amplification with subsequent de novo sequencing of TDRD1 exon 11 homologs from several representatives of the haplorrhine primate phylogeny. The results demonstrate the efficient performance of the suggested primers and therefore show that easyPAC can advance upcoming comparative genetic studies.

  9. An Alternative Suite of Universal Primers for Genotyping in Multiplex PCR

    PubMed Central

    Ge, Cheng; Cui, Yu-Nan; Jing, Peng-Yu; Hong, Xiao-Yue

    2014-01-01

    The universal primer three-primer approach can dramatically reduce the cost when genotyping the microsatellites. One former research reported four universal primers that can be used in singleplex and multiplex genotyping. In this study, we proposed an alternative suite of universal primers with four dyes for genotyping 8–12 loci in one single run. This multiplex method was tested on Tetranychus truncatus. Published microsatellite loci of T. kanzawai, Frankliniella occidentalis and Nilaparvata lugens were modified as needed and also tested. The robustness of the method was confirmed by comparing with singleplex using multiple fluorophores and genotyping two populations of T. truncatus. This method showed lower signal strength than the singleplex three-primer system, but it was still sufficient to determine the fragment length. The cost of such a project can be reduced dramatically when many loci of different species are involved. In this way, laboratories performing population genetic analyses or studying several different species may benefit from the use of this cost-effective protocol. PMID:24658225

  10. Molecular characterization of high plant species using PCR with primers designed from consensus branch point signal sequences.

    PubMed

    Xiong, Faqian; Jiang, Jing; Han, Zhuqiang; Zhong, Ruichun; He, Liangqiong; Zhuang, Weijian; Tang, Ronghua

    2011-06-01

    A novel method is introduced for producing molecular markers in plants using single 15- to 18-mer PCR primers designed from the short conserved consensus branch point signal sequences and standard agarose gel electrophoresis. This method was tested on cultivated peanut and verified to give good fingerprinting results in other plant species (mango, banana, and longan). These single primers, designed from relatively conserved branch point signal sequences within gene introns, should be universal across other plant species. The method is rapid, simple, and efficient, and it requires no sequence information of the plant genome of interest. It could be used in conjunction with, or as a substitute for, conventional RAPD or ISSR techniques for applications including genetic diversity analysis, phylogenetic tree construction, and quantitative trait locus mapping. This technique provides a new way to develop molecular markers for assessing genetic diversity of germplasm in diverse species based on conserved branch point signal sequences.

  11. Novel intein-containing DNA specific primers for rapid identification of Candida glabrata using Real-Time PCR assays.

    PubMed

    Kumar, R Satish; Ramesh, S

    2014-12-01

    Candida glabrata is an opportunistic human pathogen known to cause systemic and vaginal candidiasis. Rapid detection of Candida glabrata is indispensable for appropriate selection of antifungal drugs for chemotherapy. The study describes a unique intein-containing DNA fragment for specific detection of C. glabrata. The designed oligonucleotides detected C. glabrata (Ct mean: 24.75 ± 1.1 and Tm: 70.08 ± 0.23°C) in Real-Time PCR assays. The fluorescent signals were negative when the primers were tested for cross-species and cross-genera amplifications. In conclusion, our study recommends a novel primer set for developing a quick identification system which does not require laborious and time-consuming experimentations.

  12. Development of an Alu-based, QSY 7-labeled primer PCR method for quantitation of human DNA in forensic samples.

    PubMed

    Nicklas, Janice A; Buel, Eric

    2003-03-01

    Determining the amount of human DNA extracted from a crime scene sample is an important step in DNA profiling. The forensic community relies almost entirely upon a technique (slot blot) to quantitate human DNA that is imprecise, time consuming, and labor intensive. This paper describes the development of a new technique based on PCR amplification of a repetitive Alu sequence. Specific primers were used to amplify a 124-bp fragment of Alu sequence; amplification was detected by SYBR Green I staining in a fluorescent plate reader. To reduce background in the plate reader assay, QSY-7 labeled primers were utilized. The assay was tested on animal DNAs, human blood spots, mock crime samples, and degraded DNA in comparison with the slot blot technique. The QSY Alu assay has a dynamic range of 10 ng to 10 pg, and is sensitive, specific, fast, quantitative, and comparable in cost to the slot blot assay.

  13. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments.

    PubMed

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

    2016-07-08

    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com.

  14. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments

    PubMed Central

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

    2016-01-01

    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272

  15. TM7 detection in human microbiome: are PCR primers and FISH probes specific enough?

    PubMed Central

    Sizova, Maria V.; Doerfert, Sebastian N.; Gavrish, Ekaterina; Epstein, Slava S.

    2015-01-01

    TM7 appears important and omnipresent because it is repeatedly detected by molecular techniques in diverse environments. Here we report that most of primers and FISH probes thought to be TM7-specific do hybridize with multiple species from oral and vaginal cavity. This calls for re-examination of TM7 distribution and abundance. PMID:25957511

  16. Kinetic characterisation of primer mismatches in allele-specific PCR: a quantitative assessment.

    PubMed

    Waterfall, Christy M; Eisenthal, Robert; Cobb, Benjamin D

    2002-12-20

    A novel method of estimating the kinetic parameters of Taq DNA polymerase during rapid cycle PCR is presented. A model was constructed using a simplified sigmoid function to represent substrate accumulation during PCR in combination with the general equation describing high substrate inhibition for Michaelis-Menten enzymes. The PCR progress curve was viewed as a series of independent reactions where initial rates were accurately measured for each cycle. Kinetic parameters were obtained for allele-specific PCR (AS-PCR) amplification to examine the effect of mismatches on amplification. A high degree of correlation was obtained providing evidence of substrate inhibition as a major cause of the plateau phase that occurs in the later cycles of PCR.

  17. Tetra-primer amplification refractory mutation system PCR (T-ARMS-PCR) rapidly identified a critical missense mutation (P236T) of bovine ACADVL gene affecting growth traits.

    PubMed

    Zhang, Sihuan; Dang, Yonglong; Zhang, Qingfeng; Qin, Qiaomei; Lei, Chuzhao; Chen, Hong; Lan, Xianyong

    2015-04-01

    Acyl-CoA dehydrogenase, very long chain (ACADVL), encoding ACADVL protein, targets the inner mitochondrial membrane where it catalyzes the first step of the mitochondrial fatty acid beta-oxidation pathway and plays an important role in body metabolism and oxidation of long chain fatty acid releasing energy. Tetra-primer amplification refractory mutation system PCR (T-ARMS-PCR) is an easy-to-operate, rapid, inexpensive, and exact method for SNP genotyping. Herein, T-ARMS-PCR was carried out to detect a critical missense mutation (AC_000176:g.2885C>A; Pro236Thr) within the ACADVL gene in 644 individuals from two cattle breeds. In order to evaluate the accuracy of the T-ARMS-PCR at this locus, the genotype of the sampled individuals was also identified by PCR-RFLP. The concordance between these two methods was 98.76%. Statistical analysis showed that the bovine ACADVL gene had a significant effect on chest width (P<0.05), chest depth (P<0.05), and hip width (P<0.05) in the Qinchuan breed. The cattle with AA genotype had superior growth traits compared to cattle with AC and/or CC genotypes. The "A" allele had positive effects on growth traits. Therefore, T-ARMS-PCR can replace PCR-RFLP for rapid genotyping of this mutation, which could be used as a DNA marker for selecting individuals with superior growth traits in the Qinchuan breed. These findings contribute to breeding and genetics in beef cattle industry.

  18. Sex determination of early medieval individuals through nested PCR using a new primer set in the SRY gene.

    PubMed

    Luptáková, Lenka; Bábelová, Andrea; Omelka, Radoslav; Kolena, Branislav; Vondráková, Mária; Bauerová, Mária

    2011-04-15

    One of the first questions asked about excavated human skeletal remains is the sex. As the morphological sex determination is complicated in cases involving fragmentary bones and in skeletons from infants and children, the development of DNA-based techniques has led to improvements in sex determination. This study is focused on sex determination from ancient DNA obtained from 25 skeletons found in Middle Aged burials in western Slovakia. We performed separate amplifications of DXZ4 repetitive satellite sequences on the X chromosome, and SRY gene - testis determined factor on the Y chromosome, using nested PCR. Our results showed that DXZ4 was amplified in the case of 23 individuals. With newly designed internal and external primer sets for SRY detection with internal PCR products in lengths of 102 bp and 85 bp we succeeded in detecting the SRY locus in 9 samples. Finally, the gender was determined in 23 individuals (14 females and 9 males). In 20 samples, the gender was determined by morphological and molecular methods. Sex determination of 17 samples using nested PCR matched the morphological one, providing evidence of the authenticity and ancient origin of the PCR amplifications. The DXZ4/SRY nested PCR method represents a useful technique in sex determination of medieval human remains and it is a critical addition to anthropological studies.

  19. High-specificity single-tube multiplex genotyping using Ribo-PAP PCR, tag primers, alkali cleavage of RNA/DNA chimeras and MALDI-TOF MS.

    PubMed

    Mauger, Florence; Gelfand, David H; Gupta, Amar; Bodepudi, Veeraiah; Will, Stephen G; Bauer, Keith; Myers, Thomas W; Gut, Ivo G

    2013-01-01

    Here, we describe a high-throughput, single-tube, allele-specific ribonucleotide analog pyrophosphorolysis-activated polymerization (ribo-PAP) PCR multiplex genotyping and resequencing method. An RNA/DNA chimeric PCR product is generated using genomic DNA as starting template, a panel of allele-selective 5'-tagged primers, a reverse primer, one nucleotide in the ribo-form (90-100%), the other nucleotides in the deoxy-form, a DNA polymerase capable of incorporating ribonucleotides, a suitable buffer and thermal cycling. The RNA/DNA chimeric PCR products are fragmented by treatment with alkali and analyzed by mass spectrometry. All allele-selective primers have a 5' repetitive motif where each repeat unit has a unique, distinct mass upon reverse copying and alkali fragmentation. The mass of the complement repeat fragment or flag identifies the primer or primers that were recruited in the ribo-PAP PCR. The method readily identifies homozygous and heterozygous positions in simplex or duplex ribo-PAP PCR. Many different tags can be analyzed simultaneously. The assay can genotype several SNPs in a single tube. It thus constitutes the simplest genotyping protocol with multiplex analysis. This novel genotyping and resequencing protocol was applied to different genomic loci: NOS1 and H19 in 30 individuals in simplex ribo-PAP PCR and at two SLCO1B1 loci in 95 individuals in duplex ribo-PAP PCR.

  20. Sequence-modified primers for the differential RT-PCR detection of Andean potato latent and Andean potato mild mosaic viruses in quarantine tests.

    PubMed

    Koenig, Renate; Ziebell, Heiko

    2014-05-01

    To enable the differential PCR detection of Andean potato latent virus (APLV) and Andean potato mild mosaic virus (APMMV) strains, sense primers were designed that correspond to regions directly upstream of the coat protein genes. Their differentiating power was increased by A->C or T->C replacements in their 3'-terminal parts. Together with the broad-specificity antisense primer EM3, primer AL-a-mod3C detected all APLV strains tested, but none of the APMMV strains. Primer AM-a-mod4C yielded PCR products with all APMMV preparations, but also with some APLV preparations. Sequence analysis revealed that this was not due to a lack of primer specificity, but to the sensitive detection of contaminating APMMV in some of our APLV preparations.

  1. Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise

    ERIC Educational Resources Information Center

    Robertson, Amber L.; Phillips, Allison R.

    2008-01-01

    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel…

  2. Data supporting the design and evaluation of a universal primer pair for pseudogene-free amplification of HPRT1 in real-time PCR.

    PubMed

    Valadan, Reza; Hedayatizadeh-Omran, Akbar; Alhosseini-Abyazani, Mahdyieh Naghavi; Amjadi, Omolbanin; Rafiei, Alireza; Tehrani, Mohsen; Alizadeh-Navaei, Reza

    2015-09-01

    Hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) is a common housekeeping gene for sample normalization in the quantitative reverse transcriptase polymerase chain (qRT-PCR). However, co-amplification of HPRT1 pseudogenes may affect accurate results obtained in qRT-PCR. We designed a primer pair (HPSF) for pseudogene-free amplification of HPRT1 in qRT-PCR [1]. We showed specific amplification of HPRT1 mRNA in some common laboratory cell lines, including HeLa, NIH/3T3, CHO, BHK, COS-7 and VERO. This article provides data supporting the presence and location of HPRT1 pseudogenes within human and mouse genome, and the strategies used for designing primers that avoid the co-amplification of contaminating pseudogenes in qRT-PCR. In silico analysis of human genome showed three homologous sequences for HPRT1 on chromosomes 4, 5 and 11. The mRNA sequence of HPRT1 was aligned with the pseudogenes, and the primers were designed toward 5' end of HPRT1 mRNA that was only specific to HPRT1 mRNA not to the pseudogenes. The standard curve plot generated by HPSF primers showed the correlation coefficient of 0.999 and the reaction efficiency of 99.5%. Our findings suggest that HPSF primers can be recommended as a candidate primer pair for accurate and reproducible qRT-PCR assays.

  3. Data supporting the design and evaluation of a universal primer pair for pseudogene-free amplification of HPRT1 in real-time PCR

    PubMed Central

    Valadan, Reza; Hedayatizadeh-Omran, Akbar; Alhosseini-Abyazani, Mahdyieh Naghavi; Amjadi, Omolbanin; Rafiei, Alireza; Tehrani, Mohsen; Alizadeh-Navaei, Reza

    2015-01-01

    Hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) is a common housekeeping gene for sample normalization in the quantitative reverse transcriptase polymerase chain (qRT-PCR). However, co-amplification of HPRT1 pseudogenes may affect accurate results obtained in qRT-PCR. We designed a primer pair (HPSF) for pseudogene-free amplification of HPRT1 in qRT-PCR [1]. We showed specific amplification of HPRT1 mRNA in some common laboratory cell lines, including HeLa, NIH/3T3, CHO, BHK, COS-7 and VERO. This article provides data supporting the presence and location of HPRT1 pseudogenes within human and mouse genome, and the strategies used for designing primers that avoid the co-amplification of contaminating pseudogenes in qRT-PCR. In silico analysis of human genome showed three homologous sequences for HPRT1 on chromosomes 4, 5 and 11. The mRNA sequence of HPRT1 was aligned with the pseudogenes, and the primers were designed toward 5′ end of HPRT1 mRNA that was only specific to HPRT1 mRNA not to the pseudogenes. The standard curve plot generated by HPSF primers showed the correlation coefficient of 0.999 and the reaction efficiency of 99.5%. Our findings suggest that HPSF primers can be recommended as a candidate primer pair for accurate and reproducible qRT-PCR assays. PMID:26217821

  4. Opisthorchis viverrini and Haplorchis taichui: development of a multiplex PCR assay for their detection and differentiation using specific primers derived from HAT-RAPD.

    PubMed

    Wongsawad, Chalobol; Wongsawad, Pheravut

    2012-10-01

    Specific primers for the detection of Opisthorchis viverrini and Haplorchis taichui were investigated by using the HAT-RAPD PCR method. Fourteen arbitrary primers (Operon Technologies) were performed for the generation of polymorphic DNA profiles. The results showed that a 319 bp fragment generated from the OPA-04 primer was expected to be O. viverrini-specific while a 256 bp fragment generated from the OPP-11 primer was considered to be H. taichui-specific. Based on each sequence data, two pairs of specific primers were designed and sequences of each primer were as follows; H. taichui; Hapt_F5'-GGCCAACGCAATCGTCATCC-3'and Hapt_R1 5'-CTCTCGACCTCCTCTAGAAT-3' which yielded a 170 bp PCR product. For O. viverrini, OpV-1F: 5'-AATCGGGCTGCATATTGACCGAT-3' and OpV-1R: 5'-CGGTGTTGCTTATTTTGCAGACAA-3' which generated a 319 bp PCR product. These specific primers were tested for efficacy and specific detection for all parasites DNA samples. The results showed that 170 and 319 bp specific PCR products were generated as equivalent to positive result in H. taichui and O. viverrini, respectively by having no cross-reaction with any parasites tested. PCR conditions are recommended at 68°C annealing temperature and with 0.5 mM magnesium chloride (Mg Cl(2)). Additionally, specific primers developed in this study were effective to determine the presence of both parasites in fish and snail intermediate hosts, which the DNA of O. viverrini was artificially spiked since it is rarely found in northern Thailand. The H. taichui and O. viverrini-specific primers successfully developed in this study can be use for epidemiological monitoring, preventing management and control programs.

  5. Degenerate PCR primer design for the specific identification of rhinovirus C.

    PubMed

    Nam, Young Ran; Lee, Uk; Choi, Han Seok; Lee, Kyoung Jin; Kim, Nari; Jang, Yong Ju; Joo, Chul Hyun

    2015-03-01

    Human rhinovirus (HRV)-A and -B is a common cause of upper respiratory tract infections. Recently, a third species, HRV-C, was categorized based on molecular typing studies. The results showed that the HRV-C genome had diverged from that of HRV-A and -B. Despite its late identification, increasing evidence suggests that HRV-C causes more severe pathogenic infections than HRV-A or -B; however, a large amount of epidemiological data is required to confirm this association in different clinical settings. Consequently, a simple and rapid method for identifying HRV-C is required to expedite such epidemiological studies. Here, two degenerate primer sets (HEV and HRVC) were designed based on bioinformatic analyses. The HEV set targeting the fifth IRES domain sequence within the 5'-UTR, which is highly conserved among enteroviruses, was designed to detect all enteroviruses, whereas the HRVC set, which targeted the VP2 coding region, was designed to detect HRV-C alone. Both primer sets were tested against a panel of standard enteroviruses and clinical lavage samples. HEV detected all enteroviruses tested whereas HRVC was specific for HRV-C. Although the primer design strategy was confirmed with a limited number of samples, extensive tests are required to be applied in clinical settings.

  6. 16S ribosomal DNA-directed PCR primers for ruminal methanogens and identification of methanogens colonising young lambs.

    PubMed

    Skillman, Lucy C; Evans, Paul N; Naylor, Graham E; Morvan, Brieuc; Jarvis, Graeme N; Joblin, Keith N

    2004-10-01

    The population densities and identities of methanogens colonising new-born lambs in a grazing flock were determined from rumen samples collected at regular intervals after birth. Methanogen colonisation was found at the first sampling (1-3 days after birth) and population densities reached around 10(4) methanogens per gram at 1 week of age. Population densities increased in an exponential manner to a maximum of 10(8)-10(9) per gram at 3 weeks of age. To identify methanogens, PCR primers specific for each of the Archaea; a grouping of the orders Methanomicrobiales, Methanosarcinales and Methanococcales; the order Methanobacteriales; the order Methanococcales; the order Methanosarcinales; the genus Methanobacterium; and the genus Methanobrevibacter were designed. Primer-pair specificities were confirmed in tests with target and non-target micro-organisms. PCR analysis of DNA extracts revealed that all the detectable ruminal methanogens belonged to the order Methanobacteriales, with no methanogens belonging to the Methanomicrobiales, the Methanosarcinales, or the Methanococcales being detected. In 3 lambs, the initial colonising methanogens were Methanobrevibacter spp. and in 2 lambs were a mixture of Methanobrevibacter and Methanobacterium spp. In the latter case, the initial colonising Methanobacterium spp. subsequently disappeared and were not detectable 12-19 days after birth. Seven weeks after birth, lambs contained only Methanobrevibacter spp. This study, the first to provide information on the identities of methanogens colonising pre-ruminants, suggests that the predominant methanogens found in the mature rumen establish very soon after birth and well before a functioning rumen develops.

  7. Development of catechol 2,3-dioxygenase-specific primers for monitoring bioremediation by competitive quantitative PCR

    SciTech Connect

    Mesarch, M.B.; Nakatsu, C.H.; Nies, L.

    2000-02-01

    Benzene, toluene, xylenes, phenol, naphthalene, and biphenyl are among a group of compounds that have at least one reported pathway for biodegradation involving catechol 2,3-dioxygenase enzymes. Thus, detection of the corresponding catechol 2,3-dioxygenase genes can serve as a basis for identifying and quantifying bacteria that have these catabolic abilities. Primes that can successfully amplify a 238-bp catechol 2,3-dioxygenase gene fragment from eight different bacteria are described. The identities of the amplicons were confirmed by hybridization with a 238-bp catechol 2,3-dioxygenase probe. The detection limit was 10{sup 2} to 10{sup 3} gene copies, which was lowered to 10{sup 0} to 10{sup 1} gene copies of hybridization. Using the dioxygenase-specific primers, an increase in catechol 2,3-dioxygenase genes was detected in petroleum-amended soils. The dioxygenase genes were enumerated by competitive quantitative PCR and a 163-bp competitor that was amplified using the same primers. Target and competitor sequences had identical amplification kinetics. Potential PCR inhibitors that could coextract with DNA, nonamplifying DNA, soil factors (humics), and soil pollutants (toluene) did not impact enumeration. Therefore, this technique can be used to accurately and reproducibly quantify catechol 2,3-dioxygenase genes in complex environments such as petroleum-contaminated soil. Direct, non-cultivation-based molecular techniques for detecting and enumerating microbial pollutant-biodegrading genes in environmental samples are powerful tools for monitoring bioremediation and developing field evidence in support of natural attenuation.

  8. Group-specific PCR primers for the phylum Acidobacteria designed based on the comparative analysis of 16S rRNA gene sequences.

    PubMed

    Lee, Sang-Hoon; Cho, Jae-Chang

    2011-08-01

    We performed a comprehensive phylogenetic analysis of the phylum Acidobacteria and developed novel, group-specific PCR primers for Acidobacteria and its class-level subgroups. Acidobacterial 16S rRNA gene sequences deposited in the RDP database were used to construct a local database then subsequently analyzed. A total of 556 phylotypes were observed and the majority of the phylotypes belonged to five major subgroups (subgroups 1, 2, 3, 4, and 6), which comprised >80% of the acidobacterial sequences in the RDP database. Phylum-specific and subgroup-specific primers were designed from the consensus sequences of the phylotype sequences, and the specificities of the designed primers were evaluated both in silico and empirically for coverage and tolerance. The phylum-specific primer ACIDO, which was designed in this study, showed increased coverage for Acidobacteria, as compared to the previous phylum-specific primer 31F. However, the tolerance of the primer ACIDO for non-target sequences was slightly higher than that of the primer 31F. We also developed subgroup-specific PCR primers for the major subgroups of Acidobacteria, except for subgroup 4. Subgroup-specific primers S1, S2, and S3, which targeted subgroups 1, 2, and 3, respectively, showed high coverage for their target subgroups and low tolerance for non-target sequences. However, the primer S6 targeting subgroup 6 showed a lower specificity in its empirical evaluation than expected from the in silico results. The subgroup-specific primers, as well as the phylum-specific primer designed in this study, will be valuable tools in understanding the phylogenetic diversity and ecological niche of the phylum Acidobacteria and its subgroups.

  9. New Design Strategy for Development of Specific Primer Sets for PCR-Based Detection of Chlorophyceae and Bacillariophyceae in Environmental Samples▿ †

    PubMed Central

    Valiente Moro, Claire; Crouzet, Olivier; Rasconi, Séréna; Thouvenot, Antoine; Coffe, Gérard; Batisson, Isabelle; Bohatier, Jacques

    2009-01-01

    Studying aquatic microalgae is essential for monitoring biodiversity and water quality. We designed new sets of 18S rRNA PCR primers for Chlorophyceae and Bacillariophyceae by using the ARB software and implementing a virtual PCR program. The results of specificity analysis showed that most of the targeted algal families were identified and nontargeted organisms, such as fungi or ciliates, were excluded. These newly developed PCR primer sets were also able to amplify microalgal rRNA genes from environmental samples with accurate specificity. These tools could be of great interest for studying freshwater microalgal ecology and for developing bioindicators of the health status of aquatic environments. PMID:19592531

  10. New design strategy for development of specific primer sets for PCR-based detection of Chlorophyceae and Bacillariophyceae in environmental samples.

    PubMed

    Moro, Claire Valiente; Crouzet, Olivier; Rasconi, Séréna; Thouvenot, Antoine; Coffe, Gérard; Batisson, Isabelle; Bohatier, Jacques

    2009-09-01

    Studying aquatic microalgae is essential for monitoring biodiversity and water quality. We designed new sets of 18S rRNA PCR primers for Chlorophyceae and Bacillariophyceae by using the ARB software and implementing a virtual PCR program. The results of specificity analysis showed that most of the targeted algal families were identified and nontargeted organisms, such as fungi or ciliates, were excluded. These newly developed PCR primer sets were also able to amplify microalgal rRNA genes from environmental samples with accurate specificity. These tools could be of great interest for studying freshwater microalgal ecology and for developing bioindicators of the health status of aquatic environments.

  11. Evaluation of strain-specific primer sequences from an abortifacient strain of ovine Chlamydophila abortus (Chalmydia psittaci) for the detection of EAE by PCR.

    PubMed

    Creelan, J L; McCullough, S J

    2000-09-01

    Strain-specific primer sequences derived from the helicase gene of an ovine abortifacient strain (S26/3) of Chlamydophila abortus (Chlamydia psittaci) were evaluated for the diagnosis of enzootic abortion in ewes (EAE) by polymerase chain reaction (PCR). C abortus DNA was amplified from tissues submitted from ovine abortion cases using genus-specific and strain-specific primers in a standard thermal cycler. Amplification was followed by Southern blotting and hybridisation with a strain-specific probe. Real-time PCR was also evaluated using strain-specific primers in a microvolume fluorimeter-based thermal cycler (LightCycler). Detection using both PCR methods was compared with other diagnostic methods against the standard of McCoy cell culture isolation. In this paper we report the application of strain-specific PCR as a fast, sensitive, specific method for the detection of EAE.

  12. Detection of single-nucleotide polymorphisms in Plasmodium falciparum by PCR primer extension and lateral flow immunoassay.

    PubMed

    Moers, A P H A; Hallett, R L; Burrow, R; Schallig, H D F H; Sutherland, C J; van Amerongen, A

    2015-01-01

    The resistance of Plasmodium falciparum to some antimalarial drugs is linked to single-nucleotide polymorphisms (SNPs). Currently, there are no methods for the identification of resistant parasites that are sufficiently simple, cheap, and fast enough to be performed at point-of-care, i.e., in local hospitals where drugs are prescribed. Primer extension methods (PEXT) were developed to identify 4 SNPs in P. falciparum positioned at amino acids 86, 184, and 1246 of the P. falciparum multidrug resistance 1 gene (pfmdr1) and amino acid 76 of the chloroquine resistance transporter gene (pfcrt). The PEXT products were visualized by a nucleic acid lateral flow immunoassay (NALFIA) with carbon nanoparticles as the detection labels. PCR-PEXT-NALFIAs showed good correlation to the reference methods, quantitative PCR (qPCR) or direct amplicon sequence analysis, in an initial open-label evaluation with 17 field samples. The tests were further evaluated in a blind study design in a set of 150 patient isolates. High specificities of 98 to 100% were found for all 4 PCR-PEXT genotyping assays. The sensitivities ranged from 75% to 100% when all PEXT-positive tests were considered. A number of samples with a low parasite density were successfully characterized by the reference methods but failed to generate a result in the PCR-PEXT-NALFIA, particularly those samples with microscopy-negative subpatent infections. This proof-of principle study validates the use of PCR-PEXT-NALFIA for the detection of resistance-associated mutations in P. falciparum, particularly for microscopy-positive infections. Although it requires a standard thermal cycler, the procedure is cheap and rapid and thus a potentially valuable tool for point-of-care detection in developing countries.

  13. Detection of Single-Nucleotide Polymorphisms in Plasmodium falciparum by PCR Primer Extension and Lateral Flow Immunoassay

    PubMed Central

    Moers, A. P. H. A.; Hallett, R. L.; Burrow, R.; Schallig, H. D. F. H.; Sutherland, C. J.

    2014-01-01

    The resistance of Plasmodium falciparum to some antimalarial drugs is linked to single-nucleotide polymorphisms (SNPs). Currently, there are no methods for the identification of resistant parasites that are sufficiently simple, cheap, and fast enough to be performed at point-of-care, i.e., in local hospitals where drugs are prescribed. Primer extension methods (PEXT) were developed to identify 4 SNPs in P. falciparum positioned at amino acids 86, 184, and 1246 of the P. falciparum multidrug resistance 1 gene (pfmdr1) and amino acid 76 of the chloroquine resistance transporter gene (pfcrt). The PEXT products were visualized by a nucleic acid lateral flow immunoassay (NALFIA) with carbon nanoparticles as the detection labels. PCR-PEXT-NALFIAs showed good correlation to the reference methods, quantitative PCR (qPCR) or direct amplicon sequence analysis, in an initial open-label evaluation with 17 field samples. The tests were further evaluated in a blind study design in a set of 150 patient isolates. High specificities of 98 to 100% were found for all 4 PCR-PEXT genotyping assays. The sensitivities ranged from 75% to 100% when all PEXT-positive tests were considered. A number of samples with a low parasite density were successfully characterized by the reference methods but failed to generate a result in the PCR-PEXT-NALFIA, particularly those samples with microscopy-negative subpatent infections. This proof-of principle study validates the use of PCR-PEXT-NALFIA for the detection of resistance-associated mutations in P. falciparum, particularly for microscopy-positive infections. Although it requires a standard thermal cycler, the procedure is cheap and rapid and thus a potentially valuable tool for point-of-care detection in developing countries. PMID:25367901

  14. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    PubMed

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  15. Mitochondrial D-loop {open_quotes}signatures{close_quotes} produced by low-stringency single specific primer PCR constitute a simple comparative human identity test

    SciTech Connect

    Barreto, G.; Vago, A.R.; Pena, S.D.J.

    1996-03-01

    We have developed a technique called {open_quotes}LSSP-PCR{close_quotes} (low-stringency single specific primer PCR) that detects single or multiple mutations in DNA. A purified DNA fragment is submitted to PCR by using a single primer specific for one of the extremities of the fragment, under conditions of very low stringency. The primer hybridizes specifically to its complementary extremity and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner. A complex set of reaction products is thus created that, when separated by electrophoresis, constitutes a unique {open_quotes}gene signature.{close_quotes} We here report the application of LSSP-PCR to the detection of sequence variation in the control (D-loop) region of human mtDNA, which is known to differ significantly between unrelated individuals. We prepared human DNA samples from blood and amplified a 1,024-bp portion of the mtDNA control region, using primers L15996 and H408. The amplified mtDNA fragments were then reamplified under LSSP-PCR conditions by using L15996 or H408 as drivers to produce complex signatures that always differed between unrelated individuals and yet were highly reproducible. In contrast, all mother-child pairs tested were identical, as expected from the matrilineal inheritance of mtDNA. Thus, the use of LSSP-PCR to produce D-loop signatures constitutes a powerful new technique for mtDNA-based comparative identity testing. 18 refs., 7 figs.

  16. Prey choice by carabid beetles feeding on an earthworm community analysed using species- and lineage-specific PCR primers.

    PubMed

    King, R Andrew; Vaughan, Ian P; Bell, James R; Bohan, David A; Symondson, William O C

    2010-04-01

    The carabid beetle Pterostichus melanarius is a major natural enemy of pests, such as aphids and slugs in agricultural systems. Earthworms are a dominant non-pest component of the diet of P. melanarius which help sustain the beetles during periods when the pest population is low or absent. In this study we wanted to test whether this predator exercises prey choice among different earthworm species or ecological groups. High levels of genetic diversity within morphological species of earthworm necessitated the development of primers that were specific not just to species but lineages and sub-lineages within species as well. Gut samples from beetles were analysed using multiplex-PCR and fluorescent-labelled primers. Calibratory feeding trials were undertaken to calculate median detection times for prey DNA following ingestion. Extensive testing demonstrated that the primers were species-specific, that detection periods were negatively related to amplicon size and that meal size had a highly significant effect on detection periods. Monte Carlo simulations showed that, in general, worms were being predated in proportion to their densities in the field with little evidence of prey choice, other than probable avoidance of the larger, deep-living species. There was no evidence that epigeic species were being taken preferentially in comparison with endogeic species. There was also no evidence that defensive secretions by Allolobophora chlorotica reduced predation pressure on this species by P. melanarius. We concluded that any management system that increases earthworm densities generally, regardless of component species, is likely to be optimal for increasing numbers of this beneficial beetle predator.

  17. RT-PCR for detecting five distinct Tospovirus species using degenerate primers and dsRNA template.

    PubMed

    Okuda, M; Hanada, K

    2001-08-01

    RT-PCR procedures for detection of multiple species of tospovirus from plant tissues were investigated. Downstream primers were designated from the 3' untranslated sequences of the S RNA. An upstream primer was designated from the degenerated sequences of the nucleocapsid protein. Approximately 450 bp DNA fragments were detected when Tomato spotted wilt virus (TSWV)- or Impatiens necrotic spot virus (INSV)- infected tissues were examined. Approximately 350 bp DNA fragments were detected when Watermelon silver mottle virus (WSMoV)- or Melon yellow spot virus (MYSV)-infected tissues were examined. Template RNA was extracted using CF 11 cellulose powder, and nonspecific amplification became unnoticeable when double-stranded RNA was used. The amplified fragments of WSMoV were differentiated from those of MYSV by AluI or TaqI digestion. The amplified fragments of TSWV were differentiated from those of INSV by DraI or HindIII digestion. An alstroemeria plant that was infected with an unidentified tospovirus was also examined, and a 350 bp fragment that was 97% identical to Iris yellow spot virus was detected. This method, therefore, detected at least five distinct Tospovirus species.

  18. Novel multiplex PCR assay using locked nucleic acid (LNA)-based universal primers for the simultaneous detection of five swine viruses.

    PubMed

    Chen, Ru; Gao, Xiao-Bo; Yu, Xiao-Lu; Song, Chang-Xu; Qiu, Yang

    2016-02-01

    A novel multiplex PCR assay using non-homologous oligonucleotides with locked nucleic acid (LNA) modifications as universal primers was developed and validated for the simultaneous detection of five swine viruses. The assay utilizes five virus-specific primer pairs modified at the 5' end through the addition of the universal primer sequence. In the reaction, small amounts of target templates with the 5' tail were generated and subsequently amplified through the extension of a LNA universal primer set. To validate the specificity of this assay, 27 viral target strains and 12 non-target pathogens were tested. The lower limit of detection of viral nucleic acids was 1.1-1.9 pg per reaction or 11-32 pg in a five-plex viral nucleic acid mixture. The LNA mPCR assay displayed higher analytical sensitivity and efficiency for the detection of plasmid standards compared with the conventional assay, which uses standard primers without the 5' tail. A total of 207 field samples were tested using both assays. The LNA mPCR assay provided numerically higher detection rates for all pathogens in independent samples. Moreover, the LNA mPCR assay had significantly higher detection rates in independent samples compared with the conventional assay.

  19. Group-specific identification of polioviruses by PCR using primers containing mixed-base or deoxyinosine residue at positions of codon degeneracy.

    PubMed Central

    Kilpatrick, D R; Nottay, B; Yang, C F; Yang, S J; Mulders, M N; Holloway, B P; Pallansch, M A; Kew, O M

    1996-01-01

    We have developed a method for differentiating polioviruses from nonpolio enteroviruses using PCR. A pair of panpoliovirus PCR primers were designed to match intervals encoding amino acid sequences within VP1 that are strongly conserved among polioviruses. The initiating primer hybridizes with codons of a 7-amino-acid sequence that has been found only in polioviruses; the second primer matches codons of a domain thought to interact with the cell receptor. The panpoliovirus PCR primers contain mixed-base and deoxyinosine residues to compensate for the high degeneracy of the targeted codons. All RNAs from 48 vaccine-related and 110 wild poliovirus isolates of all three serotypes served as efficient templates for amplification of 79-bp product. None of the genomic sequences of 49 nonpolio enterovirus reference strains were amplified under equivalent reaction conditions. Sensitivities of poliovirus detection were as low as 100 fg (equivalent to approximately 25,000 genomic copies or 25 to 250 PFU) when the amplified products were visualized by ethidium bromide fluorescence. These degenerate PCR primers should aid in the detection of all polioviruses, including those wild poliovirus isolates for which genotype-specific reagents are unavailable. PMID:8940436

  20. Agronomically important thrips: development of species-specific primers in multiplex PCR and microarray assay using internal transcribed spacer 1 (ITS1) sequences for identification.

    PubMed

    Yeh, W B; Tseng, M J; Chang, N T; Wu, S Y; Tsai, Y S

    2015-02-01

    Thrips, the sole vector of plant Tospovirus, are major pests of many agricultural crops throughout the world. Molecular approaches have been applied in recent decades to identify these minute and morphologically difficult to distinguish insects. In this study, sequences of internal transcribed spacer 1 (ITS1) region of 15 agronomically important thrips, including several virus transmission species, have been analyzed in order to design species-specific primers for multiplex PCR and probes for microarray assay. That the ITS1 sequence distances within species were smaller than those among species suggests that the ITS1 fragment can be used for thrips species identification. The specificity and stability of these primers, combined with universal paired primers, were tested and verified in multiplex PCR. Using these specific primers as probes, microarray assay showed that PCR products of all thrips species hybridized consistently to their corresponding probes, though some signals were weak. We have demonstrated that multiplex PCR using specific primers based on ITS1 sequences is a simple, reliable, and cost-effective diagnostic tool for thrips species identification. Moreover, the DNA microarray assay is expected to extend into a reliable high-throughput screening tool for the vast numbers of thrips.

  1. Assessment of primers designed for the subspecies-specific discrimination among Babesia canis canis, Babesia canis vogeli and Babesia canis rossi by PCR assay.

    PubMed

    Duarte, Sabrina Castilho; Linhares, Guido Fontgalland Coelho; Romanowsky, Tatiana Nunes; da Silveira Neto, Osvaldo José; Borges, Ligia Miranda Ferreira

    2008-03-25

    Canine babesiosis is an infectious disease caused by either Babesia gibsoni or Babesia canis protozoans. The latter is also classified under three different phylogenetic groups, referred to as subspecies B. canis canis, B. canis vogeli and B. canis rossi. The objective of the present study was to validate and standardize a PCR assay to discriminate the organisms at the subspecies level. First, the reference sequences of the 18S rRNA, 5.8S rRNA and 28S rRNA genes, including the internal transcribed spacer 1 (ITS1) and 2 (ITS2) of the most common species and subspecies of the genus Babesia were retrieved from the GenBank database. Subspecies-specific primers (BAB3, BAB4 and BAB5) and one genus-specific primer were designed from the alignment of the sequences. The PCR assays were evaluated in three different combinations of primer pairs in order to assure complete specificity for each reaction. The results of the tests had demonstrated effectiveness of the novel primer pairs BAB1/BAB3, BAB1/BAB4 and BAB1/BAB5 for the amplification of the subspecies-specific target fragments of 746 bp (B. c. canis), 546 bp (B. c. vogeli) and 342 bp (B. c. rossi) by PCR. The original enzymatic amplification assays with novel primers reported in this paper were confirmed to be a reliable tool for the specific discrimination among B. canis subspecies by single-step PCR assays.

  2. [Rapid detection of mutations related to Mycobacterium leprae drug resistance by using Hp-rPCR (hairpin primer- real time PCR) method].

    PubMed

    Kai, Masanori

    2014-03-01

    Rapid and simple detection method of drug resistance bacteria is required. In the present study, Hp-rPCR (hairpin primer-real time PCR) was applied to Mycobacterium leprae genes to detect mutations. Target sites of the method were as follows: first base and second base on 53rd codon and second base on 55th codon infolP1 gene for dapsone resistance, first base on 441st codon and 451st codon and second base on 456th and 458th codon in rpoB gene for rifampicin resistance, and first base on 89th codon and second base on 91st codon in gyrA gene for quinolone resistance which were common mutation sites in clinical reports. The total number of the target sites was 9. Mycobacterium leprae, Thai-53, Zensho-2 and Zensho-4 were used as reference bacteria in the present study and clear, reliable results were obtained. Double-blind study was conducted using 15 samples. The number of target sites was calculated as 135 in total by 9 sites in 15 samples. There was only one misreading in the blind samples and the sensitivity was more than 99%.

  3. Empirical testing of 16S rRNA gene PCR primer pairs reveals variance in target specificity and efficacy not suggested by in silico analysis.

    PubMed

    Morales, Sergio E; Holben, William E

    2009-05-01

    Phylogenetic and "fingerprinting" analyses of the 16S rRNA genes of prokaryotes have been a mainstay of microbial ecology during the last two decades. However, many methods and results from studies that rely on the 16S rRNA gene for detection and quantification of specific microbial taxa have seemingly received only cursory or even no validation. To directly examine the efficacy and specificity of 16S rRNA gene-based primers for phylum-, class-, and operational taxonomic unit-specific target amplification in quantitative PCR, we created a collection of primers based solely on an extensive soil bacterial 16S rRNA gene clone library containing approximately 5,000 sequences from a single soil sample (i.e., a closed site-specific library was used to create PCR primers for use at this site). These primers were initially tested in silico prior to empirical testing by PCR amplification of known target sequences and of controls based on disparate phylogenetic groups. Although all primers were highly specific according to the in silico analysis, the empirical analyses clearly exhibited a high degree of nonspecificity for many of the phyla or classes, while other primers proved to be highly specific. These findings suggest that significant care must be taken when interpreting studies whose results were obtained with target specific primers that were not adequately validated, especially where population densities or dynamics have been inferred from the data. Further, we suggest that the reliability of quantification of specific target abundance using 16S rRNA-based quantitative PCR is case specific and must be determined through rigorous empirical testing rather than solely in silico.

  4. Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR

    PubMed Central

    Chaumeau, V.; Andolina, C.; Fustec, B.; Tuikue Ndam, N.; Brengues, C.; Herder, S.; Cerqueira, D.; Chareonviriyaphap, T.; Nosten, F.; Corbel, V.

    2016-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies. PMID:27441839

  5. Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR.

    PubMed

    Chaumeau, V; Andolina, C; Fustec, B; Tuikue Ndam, N; Brengues, C; Herder, S; Cerqueira, D; Chareonviriyaphap, T; Nosten, F; Corbel, V

    2016-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies.

  6. Species-specific ITS primers for the identification of Picoa juniperi and Picoa lefebvrei and using nested-PCR for detection of P. juniperi in planta.

    PubMed

    Jamali, Samad; Banihashemi, Zia

    2013-10-01

    Desert truffles, hypogeous Pezizales (Ascomycota), are difficult to identify due to evolutionary convergence of morphological characters among taxa that share a similar habitat and mode of spore dispersal. Also, during their symbiotic phase, these are barely distinguishable morphologically, and molecular probes are needed for their identification. We have developed a PCR-based method for the identification of Picoa juniperi and Picoa lefebvrei based on internal transcribed spacers of rDNA. Two PCR primers specific for P. lefebvrei (FLE/RLE) and two specific for P. juniperi (FJU/RJU) were designed. A collection of samples from different geographical areas representing diversity of these species were examined for unique regions of internal transcribed spacers 1, 2 and 5.8S gene of rDNA (ITS) compared to other closely related species. Annealing temperatures and extension times were optimized for each set of primers for maximum specificity and efficiency. They proved to be efficient to specifically detect the presence of P. juniperi and P. lefebvrei by PCR and neither set amplified purified DNA from other truffle species as well as some ascomycetous fungi. The partial small subunit of ribosomal DNA genes of P. juniperi were amplified with the genomic DNA extracted from Helianthemum ledifolium var. ledifolium roots by nested polymerase chain reaction (PCR) using the universal fungal primer pair ITS1/ITS4 and specific primer pair FTC/RTC, which was designed based on internal transcribed spacer 1, 2 and 5.8S gene of rDNA sequences of P juniperi. The nested-PCR was sensitive enough to re-amplify the direct-PCR product, resulting in a DNA fragment of 426 bp. The efficacy of nested-PCR showed that it could re-amplify the direct-PCR product and detect 200 fg genomic DNA.

  7. Highly specific and efficient primers for in-house multiplex PCR detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum

    PubMed Central

    2014-01-01

    Background Although sophisticated methodologies are available, the use of endpoint polymerase chain reaction (PCR) to detect 16S rDNA genes remains a good approach for estimating the incidence and prevalence of specific infections and for monitoring infections. Considering the importance of the early diagnosis of sexually transmitted infections (STIs), the development of a sensitive and affordable method for identifying pathogens in clinical samples is needed. Highly specific and efficient primers for a multiplex polymerase chain reaction (m-PCR) system were designed in silico to detect the 16S rDNA genes of four bacteria that cause genital infections, and the PCR method was developed. Methods The Genosensor Probe Designer (GPD) (version 1.0a) software was initially used to design highly specific and efficient primers for in-house m-PCR. Single-locus PCR reactions were performed and standardised, and then primers for each locus in turn were added individually in subsequent amplifications until m-PCR was achieved. Amplicons of the expected size were obtained from each of the four bacterial gene fragments. Finally, the analytical specificity and limits of detection were tested. Results Because they did not amplify any product from non-STI tested species, the primers were specific. The detection limits for the Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum primer sets were 5.12 × 105, 3.9 × 103, 61.19 × 106 and 6.37 × 105 copies of a DNA template, respectively. Conclusions The methodology designed and standardised here could be applied satisfactorily for the simultaneous or individual detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum. This method is at least as efficient as other previously described methods; however, this method is more affordable for low-income countries. PMID:24997675

  8. Use of 16S rRNA Gene-Targeted Group-Specific Primers for Real-Time PCR Analysis of Predominant Bacteria in Mouse Feces.

    PubMed

    Yang, Yun-Wen; Chen, Mang-Kun; Yang, Bing-Ya; Huang, Xian-Jie; Zhang, Xue-Rui; He, Liang-Qiang; Zhang, Jing; Hua, Zi-Chun

    2015-10-01

    Mouse models are widely used for studying gastrointestinal (GI) tract-related diseases. It is necessary and important to develop a new set of primers to monitor the mouse gut microbiota. In this study, 16S rRNA gene-targeted group-specific primers for Firmicutes, Actinobacteria, Bacteroidetes, Deferribacteres, "Candidatus Saccharibacteria," Verrucomicrobia, Tenericutes, and Proteobacteria were designed and validated for quantification of the predominant bacterial species in mouse feces by real-time PCR. After confirmation of their accuracy and specificity by high-throughput sequencing technologies, these primers were applied to quantify the changes in the fecal samples from a trinitrobenzene sulfonic acid-induced colitis mouse model. Our results showed that this approach efficiently predicted the occurrence of colitis, such as spontaneous chronic inflammatory bowel disease in transgenic mice. The set of primers developed in this study provides a simple and affordable method to monitor changes in the intestinal microbiota at the phylum level.

  9. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRna Gene PCR Primers

    EPA Science Inventory

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  10. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

    EPA Science Inventory

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  11. Simultaneous detection of virulence factors from a colony in diarrheagenic Escherichia coli by a multiplex PCR assay with Alexa Fluor-labeled primers.

    PubMed

    Kuwayama, Masaru; Shigemoto, Naoki; Oohara, Sachiko; Tanizawa, Yukie; Yamada, Hiroko; Takeda, Yoshihiro; Matsuo, Takeshi; Fukuda, Shinji

    2011-07-01

    We have developed simultaneous detection of eight genes associated with the five categories of diarrheagenic Escherichia coli by the multiplex PCR assay with Alexa Fluor-labeled primers. This assay can easily distinguish eight genes based on the size and color of amplified products without gel staining.

  12. Redesign of PCR primers for mitochondrial cytochrome c oxidase subunit I for marine invertebrates and application in all-taxa biotic surveys.

    PubMed

    Geller, J; Meyer, C; Parker, M; Hawk, H

    2013-09-01

    DNA barcoding is a powerful tool for species detection, identification and discovery. Metazoan DNA barcoding is primarily based upon a specific region of the cytochrome c oxidase subunit I gene that is PCR amplified by primers HCO2198 and LCO1490 ('Folmer primers') designed by Folmer et al. (Molecular Marine Biology and Biotechnology, 3, 1994, 294). Analysis of sequences published since 1994 has revealed mismatches in the Folmer primers to many metazoans. These sequences also show that an extremely high level of degeneracy would be necessary in updated Folmer primers to maintain broad taxonomic utility. In primers jgHCO2198 and jgLCO1490, we replaced most fully degenerated sites with inosine nucleotides that complement all four natural nucleotides and modified other sites to better match major marine invertebrate groups. The modified primers were used to amplify and sequence cytochrome c oxidase subunit I from 9105 specimens from Moorea, French Polynesia and San Francisco Bay, California, USA representing 23 phyla, 42 classes and 121 orders. The new primers, jgHCO2198 and jgLCO1490, are well suited for routine DNA barcoding, all-taxon surveys and metazoan metagenomics.

  13. Design and testing of multiplex RT-PCR primers for the rapid detection of influenza A virus genomic segments: Application to equine influenza virus.

    PubMed

    Lee, EunJung; Kim, Eun-Ju; Shin, Yeun-Kyung; Song, Jae-Young

    2016-02-01

    The avian influenza A virus causes respiratory infections in animal species. It can undergo genomic recombination with newly obtained genetic material through an interspecies transmission. However, the process is an unpredictable event, making it difficult to predict the emergence of a new pandemic virus and distinguish its origin, especially when the virus is the result of multiple infections. Therefore, identifying a novel influenza is entirely dependent on sequencing its whole genome. Occasionally, however, it can be time-consuming, costly, and labor-intensive when sequencing many influenza viruses. To compensate for the difficulty, we developed a rapid, cost-effective, and simple multiplex RT-PCR to identify the viral genomic segments. As an example to evaluate its performance, H3N8 equine influenza virus (EIV) was studied for the purpose. In developing this protocol to amplify the EIV eight-segments, a series of processes, including phylogenetic analysis based on different influenza hosts, in silico analyses to estimate primer specificity, coverage, and variation scores, and investigation of host-specific amino acids, were progressively conducted to reduce or eliminate the negative factors that might affect PCR amplification. Selectively, EIV specific primers were synthesized with dual priming oligonucleotides (DPO) system to increase primer specificity. As a result, 16 primer pairs were selected to screen the dominantly circulating H3N8 EIV 8 genome segments: PA (3), PB2 (1), PA (3), NP (3), NA8 (2), HA3 (1), NS (1), and M (2). The diagnostic performance of the primers was evaluated with eight sets composing of four segment combinations using viral samples from various influenza hosts. The PCR results suggest that the multiplex RT-PCR has a wide range of applications in detection and diagnosis of newly emerging EIVs. Further, the proposed procedures of designing multiplex primers are expected to be used for detecting other animal influenza A viruses.

  14. Development of 2, 7-Diamino-1, 8-Naphthyridine (DANP) Anchored Hairpin Primers for RT-PCR Detection of Chikungunya Virus Infection.

    PubMed

    Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann

    2016-08-01

    A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP-primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a 'turn-on' system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world.

  15. Development of 2, 7-Diamino-1, 8-Naphthyridine (DANP) Anchored Hairpin Primers for RT-PCR Detection of Chikungunya Virus Infection

    PubMed Central

    Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann

    2016-01-01

    A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP—primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a ‘turn-on’ system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world. PMID:27571201

  16. Primer evaluation and adaption for cost-efficient SYBR Green-based qPCR and its applicability for specific quantification of methanogens.

    PubMed

    Reitschuler, Christoph; Lins, Philipp; Illmer, Paul

    2014-01-01

    In the present study nine promising primer sets, targeting Archaea and methanogenic Archaea in particular, were evaluated in silico, in vitro and in situ concerning specificity, accuracy and applicability in end-point (ep-) and especially quantitative (q-)PCR research. The main goal was to adapt and evaluate already adapted primer sets, which were partially designed in combination with TaqMan probes, in substantially cheaper SYBR Green-based qPCR applications. An initial 16S rRNA gene bank-based in silico evaluation revealed high coverage potentials for all primers within targeted groups, ranging from 71 to 90%, except the Methanosaeta specific set showing a low potential of 37%. Mentionable cross-reacting potentials could be detected for the Methanothermobacter, Methanomicrobiales and Methanoculleus sets. The in vitro evaluation with selected reference organisms revealed a specific behavior for most primer sets, while the Methanosarcina and Methanothermobacter sets showed most problematic cross-reactions in epPCR application. We were able to show that primers for detecting the total archaeal community, methanogenic orders Methanosarcinales, Methanobacteriales, Methanococcales and the genus Methanoculleus performed in a highly specific way and allowed an accurate quantification of targeted organisms without the use of expensive TaqMan probes. However, primer pairs designed for detecting Methanomicrobiales, Methanothermobacter, Methanosarcina and Methanosaeta are not suitable for SYBR Green applications. The reliability of in situ quantifications was assessed for a typical methanogenic community, derived from a thermophilic fermenter, and confirmed via denaturing gradient gel band quantification and sequencing. Thereby, we revealed high abundances of methanogenic Archaea, mainly comprising Methanoculleus and Methanosarcinales, while Methanobacteriales only formed a minor fraction.

  17. A newly designed degenerate PCR primer based on pmoA gene for detection of nitrite-dependent anaerobic methane-oxidizing bacteria from different ecological niches.

    PubMed

    Han, Ping; Gu, Ji-Dong

    2013-12-01

    A new pmoA gene-based PCR primer set was designed for detection of nitrite-dependent anaerobic oxidation of methane (n-damo) bacteria from four different ecosystems, namely rice paddy soil, freshwater reservoir, reed bed, and sludge from wastewater treatment plant. This primer set showed high specificity and efficiency in recovering n-damo bacteria from these diverse samples. The obtained sequences showed 88-94 and 90-96% similarity to nucleotide and amino acid sequences, respectively, with the known NC10 phylum bacterium. According to the UniFrac principal coordinates analysis (PCoA), DNA sequences retrieved by the new PCR primer set in this study formed a separate group from the reported sequences, indicating higher diversity of n-damo in the environment. This newly designed PCR primer is capable of amplifying not only the currently known n-damo bacteria but also those that have not been reported, providing new information on the ecological diversity and distribution of this group of microorganisms in the ecosystem.

  18. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies

    PubMed Central

    Klindworth, Anna; Pruesse, Elmar; Schweer, Timmy; Peplies, Jörg; Quast, Christian; Horn, Matthias; Glöckner, Frank Oliver

    2013-01-01

    16S ribosomal RNA gene (rDNA) amplicon analysis remains the standard approach for the cultivation-independent investigation of microbial diversity. The accuracy of these analyses depends strongly on the choice of primers. The overall coverage and phylum spectrum of 175 primers and 512 primer pairs were evaluated in silico with respect to the SILVA 16S/18S rDNA non-redundant reference dataset (SSURef 108 NR). Based on this evaluation a selection of ‘best available’ primer pairs for Bacteria and Archaea for three amplicon size classes (100–400, 400–1000, ≥1000 bp) is provided. The most promising bacterial primer pair (S-D-Bact-0341-b-S-17/S-D-Bact-0785-a-A-21), with an amplicon size of 464 bp, was experimentally evaluated by comparing the taxonomic distribution of the 16S rDNA amplicons with 16S rDNA fragments from directly sequenced metagenomes. The results of this study may be used as a guideline for selecting primer pairs with the best overall coverage and phylum spectrum for specific applications, therefore reducing the bias in PCR-based microbial diversity studies. PMID:22933715

  19. Superior Multiplexing Capacity of PlexPrimers Enables Sensitive and Specific Detection of SNPs and Clustered Mutations in qPCR

    PubMed Central

    Tan, Lit Yeen; Walker, Samantha Michelle; Lonergan, Tina; Lima, Nicole Elizabeth; Todd, Alison Velyian

    2017-01-01

    Background Whilst qPCR provides an extremely powerful tool for genetic analysis, some applications such as multiplexing variant alleles (eg SNPs, point mutations or deletions), remain challenging using current primer/probe systems. The novel design features of PlexPrimers allow sensitive, multiplexed analysis of variant alleles even when these are tightly clustered. Method PlexPrimers were combined with PlexZymes in qPCR assays for the detection of SNPs in human absorption, distribution, metabolism, and excretion (ADME) genes; clustered mutations in the 23S rRNA gene which confer antibiotic resistance to Mycoplasma genitalium; and deletions within the human epidermal growth factor receptor (EGFR) gene. Results The combination of PlexPrimers and PlexZymes allowed robust multiplexing of targets which resulted in 100% concordance with results obtained using hydrolysis probe kits for 14 SNPs in the ADME genes. A 7-plex qPCR assay targeting M. genitalium, 5 clustered mutations associated with macrolide resistance and an internal control, allowed efficient amplification of all targets, with all 5 mutations detected in a single channel. Finally, the strategy was employed to analyse common EGFR mutants with high sensitivity, detecting deletions present at only 0.01%. Conclusion PlexPrime is a novel technology for the detection of genetic variants. Unlike previous strategies, the combination of PlexPrimers with PlexZymes enables both allele-specific detection and allele-specific amplification in qPCR. The study demonstrated highly sensitive and specific detection of mutations and SNPs, and superior multiplexing capacity. The ability to multiplex clustered genetic variants reduces the time to result providing more actionable information. PMID:28114309

  20. A novel Tetra-primer ARMS-PCR based assay for genotyping SNP rs12303764(G/T) of human Unc-51 like kinase 1 gene.

    PubMed

    Randhawa, Rohit; Duseja, Ajay; Changotra, Harish

    2017-02-01

    Various case-control studies have shown association of single nucleotide polymorphism rs12303764(G/T) in ULK1 with crohn's disease. The techniques used in these studies were time consuming, complicated and require sophisticated/expensive instruments. Therefore, in order to overcome these problems, we have developed a new, rapid and cost effective Tetra-primer ARMS-PCR assay to genotype single nucleotide polymorphism rs12303764(G/T) of ULK1 gene. We manually designed allele specific primers. DNA fragment amplified using outer primers was sequenced to obtain samples with known genotypes (GG, GT and TT) for further use in the development of T-ARMS-PCR assay. Amplification conditions were optimized for parameters; annealing temperature, Taq DNA polymerase and primers. The developed T-ARMS-PCR assay was applied to genotype one hundred samples from healthy individuals. Genotyping results of 10 DNA samples from healthy individuals for rs12303764(G/T) by T-ARMS-PCR assay and sequencing were concordant. The newly developed assay was further applied to genotype samples from 100 healthy individuals of North Indian origin. Genotype frequencies were 9, 34 and 57 % for GG, GT and TT, respectively. Allele frequencies were 0.26 and 0.74 for G and T, respectively. The allele frequencies were in Hardy-Weinberg's equilibrium (p = 0.2443). T-ARMS-PCR assay developed in our laboratory for genotyping rs12303764 (G/T) of ULK1 gene is time saving and cost-effective as compared to the available methods. Furthermore, this is the first study reporting allelic and genotype frequencies of ULK1 rs12303764 (G/T) variants in North Indian population.

  1. Identification of new primer binding site mutations at TH01 and D13S317 loci and determination of their corresponding STR alleles by allele-specific PCR.

    PubMed

    Li, Fengrui; Xuan, Jinfeng; Xing, Jiaxin; Ding, Mei; Wang, Baojie; Pang, Hao

    2014-01-01

    Several commercial multiplex PCR kits for the amplification of short tandem repeat (STR) loci have been extensively applied in forensic genetics. Consequently, large numbers of samples have been genotyped, and the number of discordant genotypes observed has also increased. We observed allele dropout with two novel alleles at the STR loci TH01 and D13S317 during paternity testing using the AmpFℓSTR Identifiler PCR Amplification Kit. The lost alleles reappeared when alternative PCR primer pairs were used. A sequence analysis revealed a G-to-A substitution 82 bases downstream of the last TCAT motif of the repeat region at the TH01 locus (GenBank accession: D00269) and a G-to-T substitution 90 bases upstream of the first TATC motif of the repeat region at the D13S317 locus (GenBank accession: G09017). The frequencies of these two point mutations were subsequently investigated in the Chinese population using sequence-specific primer PCR (SSP-PCR), but neither of these mutations was detected in any of the samples tested. In addition, the DNA samples in which the mutations were identified were amplified to type the point mutations by SSP-PCR to determine the corresponding STR alleles at the two loci. Subsequently, the amplified PCR products with different point mutations and STR repeat numbers were directly sequenced because this strategy overcomes the appearance overlapping peaks generated by different STR alleles and accurately characterizes genotypes. Thus, our findings not only provide useful information for DNA databases and forensic identification but also establish an effective strategy for typing STR alleles with primer binding site mutations.

  2. Wet-lab tested microRNA assays for qPCR studies with SYBR® Green and DNA primers in pig tissues.

    PubMed

    Mentzel, Caroline M J; Skovgaard, Kerstin; Córdoba, Sarai; Herrera Uribe, Juber; Busk, Peter K; Cirera, Susanna

    2014-01-01

    MicroRNAs are key post-transcriptional regulators of gene expression that are involved in several biological processes including those that mediate disease pathophysiology. Hence, quantifying microRNA expression levels can provide important and novel insights into disease biology. In recent years, the pig has emerged as an excellent large animal model for studying human diseases and conditions (e.g. obesity) due to similarities in organ size, gastro-intestinal tract, metabolism, immune response, genetics and the availability of relevant tissues that are not normally easily available in humans. We have previously developed two useful tools in the field of microRNA quantitative real time PCR (qPCR): 1) a very specific, sensitive and simple qPCR method based on DNA primers, MiR-specific qPCR; and 2) the free primer-design software miRprimer. The present study integrates in a publicly accessible database all available information on validated porcine microRNA qPCR assays that have utilized these tools. Due to the high phylogenetic conservation in microRNA sequence between pig, humans and other domestic species this database is a very valuable resource for the broader scientist community who are working on microRNAs and want to use readily tested qPCR assays in a simple and cost-effective manner.

  3. A new PCR primer for the identification of Paracoccidioides brasiliensis based on rRNA sequences coding the internal transcribed spacers (ITS) and 5 x 8S regions.

    PubMed

    Imai, T; Sano, A; Mikami, Y; Watanabe, K; Aoki, F H; Branchini, M L; Negroni, R; Nishimura, K; Miyaji, M

    2000-08-01

    Internal transcribed spacer (ITS) genes including the 5.8S ribosomal (r)RNA of Paracoccidioides brasiliensis were amplified and the DNA sequences were determined. Based on a comparison of the sequence information, a new polymerase chain reaction (PCR) primer pair was designed for specific amplification of DNA for P. brasiliensis. This primer pair amplified a 418-bp DNA sequence and was 100% successful in identifying 29 strains of P. brasiliensis (including the reference strains) isolated from the regions of Brazil, Costa Rica, Japan, Argentina or from different sources. The results of specificity tests of these primers to compare the fungus with those of Aspergillus fumigatus, Blastomyces dermatitidis, Candida albicans, Cryptococcus neoformans, Histoplasma capsulatum and Penicillium marneffei are also reported.

  4. Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

    PubMed

    Jarausch, W; Saillard, C; Dosba, F; Bové, J M

    1994-08-01

    A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle.

  5. Patho-Genes.org: a website dedicated to gene sequences of potential bioterror bacteria and PCR primers used to amplify them.

    PubMed

    Gardès, Julien; Bachar, Dipankar; Croce, Olivier; Christen, Richard

    2012-09-01

    Pathogenic agents can be very hard to detect, and usually they do not cause illness for several hours or days. To improve the speed and the accuracy of detection tests and satisfy the needs of early diagnosis, molecular biology methods such as PCR are now used. However, selecting a proper target gene and designing good primers is often not easy. We present a dedicated website, http://patho-genes.org, where we provide every sequence, functional annotation, published primer and relevant article for every annotated gene of major pathogenic bacterial species listed as key agents to be used for a bioterrorism attack. Each published primer was analysed to determine its melting temperature, its specificity and its coverage (i.e. its sensitivity against every allele of its target gene). Data generated have been organized in the form of data sheet for each gene, which are available through multiple browser panels and query systems.

  6. Use of conserved genomic regions and degenerate primers in a PCR-based assay for the detection of members of the genus Caulimovirus.

    PubMed

    Pappu, H R; Druffel, K L

    2009-04-01

    The genus Caulimovirus consists of several distinct virus species with a double-stranded DNA genome that infect diverse plant species. A comparative analysis of the sequences of known Caulimovirus species revealed two regions that are conserved in all Caulimovirus species with the exception of Strawberry vein banding virus. Degenerate primers based on these two regions were designed and tested in a polymerase chain reaction-based assay for broad spectrum detection of members of this genus. Cauliflower mosaic virus, Figwort mosaic virus and three distinct caulimoviruses associated with dahlia (Dahlia variabilis) were used to show the utility of this test in detecting diverse caulimoviruses. The primer pair gave an amplicon of expected size (840bp). Amplicons from each virus were cloned and sequenced to verify their identity. The primer pair and the PCR assay provide approach for the broad spectrum detection of several members of the genus Caulimovirus.

  7. Evaluation of cells and biological reagents for adventitious agents using degenerate primer PCR and massively parallel sequencing.

    PubMed

    McClenahan, Shasta D; Uhlenhaut, Christine; Krause, Philip R

    2014-12-12

    We employed a massively parallel sequencing (MPS)-based approach to test reagents and model cell substrates including Chinese hamster ovary (CHO), Madin-Darby canine kidney (MDCK), African green monkey kidney (Vero), and High Five insect cell lines for adventitious agents. RNA and DNA were extracted either directly from the samples or from viral capsid-enriched preparations, and then subjected to MPS-based non-specific virus detection with degenerate oligonucleotide primer (DOP) PCR. MPS by 454, Illumina MiSeq, and Illumina HiSeq was compared on independent samples. Virus detection using these methods was reproducibly achieved. Unclassified sequences from CHO cells represented cellular sequences not yet submitted to the databases typically used for sequence identification. The sensitivity of MPS-based virus detection was consistent with theoretically expected limits based on dilution of virus in cellular nucleic acids. Capsid preparation increased the number of viral sequences detected. Potential viral sequences were detected in several samples; in each case, these sequences were either artifactual or (based on additional studies) shown not to be associated with replication-competent viruses. Virus-like sequences were more likely to be identified in BLAST searches using virus-specific databases that did not contain cellular sequences. Detected viral sequences included previously described retrovirus and retrovirus-like sequences in CHO, Vero, MDCK and High Five cells, and nodavirus and endogenous bracovirus sequences in High Five insect cells. Bovine viral diarrhea virus, bovine hokovirus, and porcine circovirus sequences were detected in some reagents. A recently described parvo-like virus present in some nucleic acid extraction resins was also identified in cells and extraction controls from some samples. The present study helps to illustrate the potential for MPS-based strategies in evaluating the presence of viral nucleic acids in various sample types

  8. Development of PCR primers for specific amplification of two distinct regions of the genomes of San Miguel sea-lion and vesicular exanthema of swine viruses.

    PubMed

    Neill, J D; Seal, B S

    1995-02-01

    The San Miguel sea-lion viruses (SMSV) and vesicular exanthema of swine viruses (VESV) are members of the calicivirus family and aetiologic agents of vesicular disease in susceptible hosts. These two virus groups have been shown by several serological methods to be closely related antigenically. To further examine their relatedness, two sets of non-degenerate oligonucleotide primers were designed for the specific amplification of two distinct regions of the SMSV and VESV genomes using a reverse transcriptase-polymerase chain reaction (RT-PCR) protocol. The sequence of the primers were based on the nucleotide sequence of SMSV serotypes 1 and 4. The RNAs from a number of SMSV serotypes and a single VESV isolate were used as template in this study. These included SMSV serotypes 1, 2, 4, 5, 6, 7, 13 and 14 and VESV serotype A48. Also included in this study were Tillamook calicivirus (Bos-1 calicivirus, BCV) and a recently isolated skunk calicivirus (SCV). The first primer set amplified a 357-bp fragment from the 2C-like or RNA-helicase-encoding region (11 of 11 viruses) and the second set amplified a fragment from the RNA-dependent RNA polymerase region (520 bp, 9 of 11 viruses). These primer sets did not amplify product from either feline calicivirus or mink calicivirus. The results of this study demonstrate the genetic relatedness of SMSV and VESV and the potential usefulness of RT-PCR to detect and identify these viruses in diagnostic and routine screening applications.

  9. Sensitive and specific detection of Xanthomonas axonopodis pv. citri by PCR using pathovar specific primers based on hrpW gene sequences.

    PubMed

    Park, Dong Suk; Hyun, Jae Wook; Park, Young Jin; Kim, Jung Sun; Kang, Hee Wan; Hahn, Jang Ho; Go, Seung Joo

    2006-01-01

    A sensitive and specific assay was developed to detect citrus bacterial canker caused by Xanthomonas axonopodis pv. citri, in leaves and fruits of citrus. Primers XACF and XACR from hrpW homologous to pectate lyase, modifying the structure of pectin in plants, were used to amplify a 561 bp DNA fragment. PCR technique was applied to detect the pathogen in naturally or artificially infected leaves of citrus. The PCR product was only produced from X. axonopodis pv. citri among 26 isolates of Xanthomonas strains, Escherichia coli (O157:H7), Pectobacterium carotovorum subsp. carotovorum, and other reference microbes.

  10. Primers to block the amplification of symbiotic apostome ciliate 18S rRNA gene in a PCR-based copepod diet study

    NASA Astrophysics Data System (ADS)

    Yi, Xiaoyan; Zhang, Huan; Liu, Guangxing

    2014-05-01

    Pelagic copepods play an important role in the marine food web. However, a full understanding of the ecological status of this zooplankton group depends on the careful study of their natural diets. In previous PCR-based copepod diet studies, we found many apostome ciliates that live symbiotically under the exoskeleton of the copepods, and their sequences were often over-represented in the 18S rRNA gene (18S rDNA) libraries. As a first step to address this issue, we designed three apostome ciliate 18S rDNA blocking primers, and tested their blocking efficiency against apostome ciliate 18s rDNA under various PCR conditions. Using a semi-quantitative PCR method, we optimized the conditions to efficiently amplify the 18S rDNA of the prey while simultaneously excluding the symbiotic apostome ciliates. This technique will facilitate PCR-based diet studies of copepods and other zooplankton in their natural environments.

  11. Differentiation of Plum pox virus isolates by single-strand conformation polymorphism and low-stringency single specific primer PCR analysis of HC-Pro genome region.

    PubMed

    Gadiou, S; Safárová, D; Navrátil, M

    2009-01-01

    Single-strand conformation polymorphism (SSCP) and low-stringency single specific primer (LSSP)-PCR were assessed for suitability and reliability in genotyping of Plum pox virus (PPV) isolates. Examined PPV isolates included 16 PPV-D, 12 PPV-M, and 14 PPV-Rec isolates collected in Czech Republic. The analysis was performed on the helper component protease (HC-Pro) region of the PPV genome. SSCP and LSSP-PCR allowed the differentiation of PPV strain, but SSCP was not able to distinguish isolates within the same strain. The individual genotyping of each PPV isolate was obtained by LSSP-PCR. Nevertheless, both SSCP and LSSP-PCR techniques are suitable for preliminary screening of genetic variability of plant RNA viruses.

  12. Identification of the sex of a wide range of Carinatae birds by PCR using primer sets selected from chicken EE0.6 and its related sequences.

    PubMed

    Itoh, Y; Suzuki, M; Ogawa, A; Munechika, I; Murata, K; Mizuno, S

    2001-01-01

    A 0.6 kb EcoRI fragment (EE0.6), cloned from the W chromosome of chickens, is a nonrepetitive sequence and contains an exonlike sequence, ET15, which is likely a part of a pseudogene. The EE0.6 sequence is conserved in all species of birds examined both in Carinatae and Ratitae. A counterpart sequence of EE0.6 is present on the Z chromosome. The extent of diversity between the W- and Z-linked sequences are variable among species. The W- and Z-linked EE0.6 sequences, cloned from 12 different species, were compared and four forward and three reverse primers were selected to amplify parts of the EE0.6 sequence by polymerase chain reaction (PCR). By choosing a suitable combination of primers for EE0.6 and a set of primers for a Z/W-common sequence, as an internal control, the sex of 36 species belonging to 16 different orders of Carinatae could be determined clearly by PCR. The sex of two other species representing different orders could be determined by Southern blot hybridization using ET15 as a probe. For the two Ratitae species, emu and ostrich, EE0.6 sequences on W and Z chromosomes could not be distinguished either by PCR or Southern blotting.

  13. Development of PCR primers and a DNA macroarray for the simultaneous detection of major Staphylococcus species using groESL gene.

    PubMed

    Chiang, Yu-Cheng; Lu, Hsi-Chi; Li, Sheng-Chih; Chang, Yu-Hsin; Chen, Hsin-Yen; Lin, Chia-Wei; Tsen, Hau-Yang

    2012-03-01

    Staphylococcus spp., including S. aureus, S. intermedius, S. hyicus, S. epidermidis, S. saprophyticus, S. haemolyticus, S. xylosus, and S. carnosus, are major bacterial species associated with food poisoning, and human and veterinary clinics. Traditional methods for the identification of these staphylococci are time-consuming, laborious, or inaccurate. Therefore, rapid and accurate diagnostic methods are needed. In this study, we designed the DNA probes and polymerase chain reaction (PCR) primers for the detection of the aforementioned Staphylococcus species. These primers were proved to be specific for the detection of their corresponding target strains. Furthermore, by using a consensus primer pair, we were able to co-amplify the intergenic region of groES-groEL for these staphylococci. Followed by a chromogenic macroarray system with the specific probes on the plastic chips, these staphylococci in milk products or clinical samples could be simultaneously detected. When the system was used for the inspection of milk or urine samples containing N × 10⁰ target cells per milliliter of the sample, all these staphylococcal species could be identified after an 8-h pre-enrichment step. This system also allowed the adequate diagnosis of bacteremia, since N × 10⁰ target cells per milliliter of the blood samples could be detected after a 12-h pre-enrichment. Compared to the multiplex PCR method, this approach has the additional advantage that it allowed the discrimination of more bacterial strains-even some bacterial strains that may generate PCR products with the same molecular sizes.

  14. Development of real-time PCR primer and probe sets for detecting degenerated and non-degenerated forms of the butanol-producing bacterium Clostridium acetobutylicum ATCC 824.

    PubMed

    Lee, Sun-Mi; Cho, Min Ok; Um, Youngsoon; Sang, Byoung-In

    2010-05-01

    Degeneration is one of the limiting factors in butanol fermentation, and it must be monitored and prevented for stable butanol production. In Clostridium acetobutylicum ATCC 824, the most well-known butanol-producing microorganism, degeneration is caused by the loss of the pSOL1 plasmid that carries essential genes involved in solvent production. In this study, we designed two specific primer and probe sets for real-time qPCR (RT-qPCR) detection of C. acetobutylicum ATCC 824 (the C. aceto set) and pSOL1-possessing C. acetobutylicum ATCC 824 (the DGS set). Specific primer and probe sets were designed on the basis of the 16S rDNA sequence and pSOL1 sequence. The number of degenerated C. acetobutylicum could be quantified by subtracting the number of C. acetobutylicum ATCC 824 containing pSOL1 from the total number of C. acetobutylicum ATCC 824. The primer and probe sets permitted the specific detection and quantification of degenerated C. acetobutylicum and total butanol-producing C. acetobutylicum by RT-qPCR.

  15. PCR primers for the detection of staphylococcal enterotoxins K, L, and M and survey of staphylococcal enterotoxin types in Staphylococcus aureus isolates from food poisoning cases in Taiwan.

    PubMed

    Chiang, Yu-Cheng; Chang, Li-Tung; Lin, Chia-Wei; Yang, Chi-Yea; Tsen, Hau-Yang

    2006-05-01

    Staphylococcal enterotoxins (SEs) are important causative agents in gastroenteritidis and food poisoning cases. They are serologically grouped into five major classical types, i.e., SEA, SEB, SEC, SED, and SEE. In addition, new SEs, such as SEG through SEM, have recently been identified and characterized. In an attempt to survey the distribution of classical and new SEs in organisms responsible for staphylococcal infections in Taiwan, we developed PCR primers for the genes that define the SEK, SEL, and SEM types. Bacterial strains other than sek, sel, and sem Staphylococcus aureus, including strains of other Staphylococcus species, did not generate any false-positive results when examined with these primers. The expression potential for the sek, sel, and sem types were also determined by reverse transcription-PCR. Together with the PCR primers specific for the classical SEs and other new SEs, including SEG, SEH, SEI, and SEJ, we surveyed the SE genes in S. aureus strains isolated from food poisoning cases. For 147 S. aureus isolates originating from food poisoning cases, 109 (74.1%) were positive for one or more SE genes. Of them, the major classical enterotoxin type was sea (28.6%), followed by seb (20.4%), sec (8.2%), and sed (2.0%). For the new SE types, sei (30.6%) was detected the most often, followed by sek (18.4%), sem (12.9%), and sel (8.2%). Also, 64 (43.5%) of the total bacterial strains had more than one enterotoxin gene.

  16. Optimization of chloroplast microsatellite PCR conditions and primer screening for endangered Rheum officinale, Rheum palmatum, and Rheum tanguticum.

    PubMed

    Zhou, Y; Guo, Z J; Han, L; Li, Y; Wang, X M

    2014-07-29

    Chloroplast microsatellite primers were developed in order to provide more population genetic information of endangered Rheum officinale, R. palmatum, and R. tanguticum for conservation. The dried roots and rhizomes of these plants are important in traditional Chinese medicine. The results showed that the optimum concentrations of Mg(2+), Taq DNA polymerase, dNTPs, template DNA, and primers in a 25-μL reaction system were 2.0 mM, 1.0 U, 0.10 mM, 20 ng, and 0.8 μM, respectively. Fourteen of 53 primer combinations were chosen for their high clarity and repetition in three species, and their annealing temperatures ranged from 56 to 58°C. These primers and the optimized polymerase chain reaction system may provide a tool for understanding the demography and genetic variation of these endangered plants.

  17. The allele-specific probe and primer amplification assay, a new real-time PCR method for fine quantification of single-nucleotide polymorphisms in pooled DNA.

    PubMed

    Billard, A; Laval, V; Fillinger, S; Leroux, P; Lachaise, H; Beffa, R; Debieu, D

    2012-02-01

    The evolution of fungicide resistance within populations of plant pathogens must be monitored to develop management strategies. Such monitoring often is based on microbiological tests, such as microtiter plate assays. Molecular monitoring methods can be considered if the mutations responsible for resistance have been identified. Allele-specific real-time PCR approaches, such as amplification refractory mutation system (ARMS) PCR and mismatch amplification mutation assay (MAMA) PCR, are, despite their moderate efficacy, among the most precise methods for refining SNP quantification. We describe here a new real-time PCR method, the allele-specific probe and primer amplification assay (ASPPAA PCR). This method makes use of mixtures of allele-specific minor groove binder (MGB) TaqMan probes and allele-specific primers for the fine quantification of SNPs from a pool of DNA extracted from a mixture of conidia. It was developed for a single-nucleotide polymorphism (SNP) that is responsible for resistance to the sterol biosynthesis inhibitor fungicide fenhexamid, resulting in the replacement of the phenylalanine residue (encoded by the TTC codon) in position 412 of the enzymatic target (3-ketoreductase) by a serine (TCC), valine (GTC), or isoleucine (ATC) residue. The levels of nonspecific amplification with the ASPPAA PCR were reduced at least four times below the level of currently available allele-specific real-time PCR approaches due to strong allele specificity in amplification cycles, including two allele selectors. This new method can be used to quantify a complex quadriallelic SNP in a DNA pool with a false discovery rate of less than 1%.

  18. Geographical clustering of Trypanosoma cruzi I groups from Colombia revealed by low-stringency single specific primer-PCR of the intergenic regions of spliced-leader genes.

    PubMed

    Mejía-Jaramillo, Ana María; Arboleda-Sánchez, Sair; Rodríguez, Ingrid Bibiana; Cura, Carolina; Salazar, Alexander; Del Mazo, Jesús; Triana-Chávez, Omar; Schijman, Alejandro Gabriel

    2009-01-01

    A low-stringency single-primer polymerase chain reaction (LSSP-PCR) typing procedure targeted to the intergenic regions of spliced-leader genes (SL) was designed to profile Trypanosoma cruzi I stocks from endemic regions of Colombia. Comparison between SL-LSSP-PCR profiles of parasite DNA from vector faeces and cultures isolated from those faeces showed more conservative signatures than profiles using LSSP-PCR targeted to the minicircle variable regions (kDNA). This was also observed by analysing 15 parasite clones from one stock as well as serial samples of a same stock after in vitro culturing or inoculation into mice. Thus, SL-LSSP-PCR appears more appropriate than kDNA-LSSP-PCR for reliable typing of major T. cruzi I groups from in vitro cultured stocks and triatomine faeces. SL-LSSP-PCR grouped 46 of 47 T. cruzi I Colombian stocks according to their geographical procedences in four clusters: Cluster Cas from Casanare Department, Cluster Mg from Northern Magdalena department, Cluster Mom from Momposina Depression in Southern Magdalena and finally Cluster NW from northwestern Colombia, including Sucre, Chocó, Córdoba and Antioquia departments. Sequence analysis identified punctual mutations among amplicons from each cluster. Within Cluster Mg, sequence polymorphism allowed association with different sylvatic vector species. Novel SL sequences and LSSP-PCR profiles are reported from T. cruzi I infecting Eratyrus cuspidatus, Panstrongylus geniculatus and Rhodnius pallescens vectors.

  19. Novel PCR primers for the archaeal phylum Thaumarchaeota designed based on the comparative analysis of 16S rRNA gene sequences.

    PubMed

    Hong, Jin-Kyung; Kim, Hye-Jin; Cho, Jae-Chang

    2014-01-01

    Based on comparative phylogenetic analysis of 16S rRNA gene sequences deposited in an RDP database, we constructed a local database of thaumarchaeotal 16S rRNA gene sequences and developed a novel PCR primer specific for the archaeal phylum Thaumarchaeota. Among 9,727 quality-filtered (chimeral-checked, size >1.2 kb) archaeal sequences downloaded from the RDP database, 1,549 thaumarchaeotal sequences were identified and included in our local database. In our study, Thaumarchaeota included archaeal groups MG-I, SAGMCG-I, SCG, FSCG, RC, and HWCG-III, forming a monophyletic group in the phylogenetic tree. Cluster analysis revealed 114 phylotypes for Thaumarchaeota. The majority of the phylotypes (66.7%) belonged to the MG-I and SCG, which together contained most (93.9%) of the thaumarchaeotal sequences in our local database. A phylum-directed primer was designed from a consensus sequence of the phylotype sequences, and the primer's specificity was evaluated for coverage and tolerance both in silico and empirically. The phylum-directed primer, designated THAUM-494, showed >90% coverage for Thaumarchaeota and <1% tolerance to non-target taxa, indicating high specificity. To validate this result experimentally, PCRs were performed with THAUM-494 in combination with a universal archaeal primer (ARC917R or 1017FAR) and DNAs from five environmental samples to construct clone libraries. THAUM-494 showed a satisfactory specificity in empirical studies, as expected from the in silico results. Phylogenetic analysis of 859 cloned sequences obtained from 10 clone libraries revealed that >95% of the amplified sequences belonged to Thaumarchaeota. The most frequently sampled thaumarchaeotal subgroups in our samples were SCG, MG-I, and SAGMCG-I. To our knowledge, THAUM-494 is the first phylum-level primer for Thaumarchaeota. Furthermore, the high coverage and low tolerance of THAUM-494 will make it a potentially valuable tool in understanding the phylogenetic diversity and

  20. Comparative evaluation of the GP5+/6+, MY09/11 and PGMY09/11 primer sets for HPV detection by PCR in oral squamous cell carcinomas.

    PubMed

    Erhart, Sibele Morais Miyata; Rivero, Elena Riet Correa; Bazzo, Maria Luiza; Onofre, Alexandre Sherlley Casimiro

    2016-02-01

    The aim of this study was to evaluate the use of GP5+/6+, MY09/11 and PGMY09/11 primer sets for the detection of human papillomavirus (HPV) DNA by single step polymerase chain reaction (PCR) and nested PCR in formalin-fixed and paraffin-embedded (FFPE) tissues from oral squamous cell carcinomas (OSCCs). DNA extracted from FFPE tissues were tested for amplification of the human beta globin gene with PCO3/4 primers. Positive samples for this gene were tested for HPV DNA using single step PCR with GP5+/6+, MY09/11 and PGMY09/11 primer sets. All negative samples at single step PCR with MY09/11 and PGMY09/11 were subjected to a further PCR with GP5+/6+ primers using the non-amplified product in the previously reactions (nested PCR) as samples. Among 26 samples, 23 were positive for the human beta globin gene and were considered viable for HPV DNA detection by PCR. Single step PCR with GP5+/6+ and MY09/11 primers and MY/GP+ nested PCR did not amplify HPV DNA in any samples. PGMY09/11 primers detected HPV DNA in 13.0% of OSCC cases and this rate was raise to 17.4% with the use of PGMY/GP+ nested PCR. According to our results the PGMY/GP+ nested PCR is the most appropriate primer set for the detection of HPV DNA using FFPE samples from OSCC.

  1. An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

    ERIC Educational Resources Information Center

    Elkins, Kelly M.; Kadunc, Raelynn E.

    2012-01-01

    In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

  2. Optimization of PCR in application of hot start Taq DNA polymerase for detection of Erwinia amylovora with primers FER1-F and FER1-R.

    PubMed

    Obradovic, D; Kevresan, S

    2010-01-01

    There are two approaches in detection of bacterium Erwinia amylovora by PCR. One is based on detection of plasmid pEA29 and the other is based on detection of a chromosomal DNA sequence, specific for E. amylovora, in a sample. Since pathogenic strains without pEA29 have been isolated from the environment, methods based on this plasmid have been compromised and PCR methods based on chromosomal DNA species specific sequences became only reliable methods. PCR method with chromosomal primers FER1-F and FER1-R is currently the most reliable method due to its high sensitivity and specificity. The goal of this research is to make a significant improvement of the method by optimization of PCR in application of hot start DNA Taq polymerase, instead of wax, to obtain a hot start reaction. This enzyme, which is currently widely applied, can provide simpler achievement of hot start, saving labor and time and decreasing possibility of cross contamination of samples. Experiments showed that simple replacement of a regular recombinant Taq DNA polymerase by a hot start Taq DNA polymerase leads to complete failure of the reaction. Many optimization experiments had to be carried out to obtain an operational and reliable PCR which simultaneously has high sensitivity and specificity. Content of the reaction mixture, as well as temperature and time parameters of PCR, were significantly changed to achieve proper optimization.

  3. Development of genomic microsatellite multiplex PCR using dye-labeled universal primer and its validation in pedigree analysis of Pacific oyster ( Crassostrea gigas)

    NASA Astrophysics Data System (ADS)

    Liu, Ting; Li, Qi; Song, Junlin; Yu, Hong

    2017-02-01

    There is an increasing requirement for traceability of aquaculture products, both for consumer protection and for food safety. There are high error rates in the conventional traceability systems depending on physical labels. Genetic traceability technique depending on DNA-based tracking system can overcome this problem. Genealogy information is essential for genetic traceability, and microsatellite DNA marker is a good choice for pedigree analysis. As increasing genotyping throughput of microsatellites, microsatellite multiplex PCR has become a fast and cost-effective technique. As a commercially important cultured aquatic species, Pacific oyster Crassostrea gigas has the highest global production. The objective of this study was to develop microsatellite multiplex PCR panels with dye-labeled universal primer for pedigree analysis in C. gigas, and these multiplex PCRs were validated using 12 full-sib families with known pedigrees. Here we developed six informative multiplex PCRs using 18 genomic microsatellites in C. gigas. Each multiplex panel contained a single universal primer M13(-21) used as a tail on each locus-specific forward primer and a single universal primer M13(-21) labeled with fluorophores. The polymorphisms of the markers were moderate, with an average of 10.3 alleles per locus and average polymorphic information content of 0.740. The observed heterozygosity per locus ranged from 0.492 to 0.822. Cervus simulations revealed that the six panels would still be of great value when massive families were analysed. Pedigree analysis of real offspring demonstrated that 100% of the offspring were unambiguously allocated to their parents when two multiplex PCRs were used. The six sets of multiplex PCRs can be an important tool for tracing cultured individuals, population genetic analysis, and selective breeding program in C. gigas.

  4. Real-time PCR detection of Staphylococcus aureus in milk and meat using new primers designed from the heat shock protein gene htrA sequence.

    PubMed

    Chiang, Yu-Cheng; Fan, Chih-Ming; Liao, Wan-Wen; Lin, Chien-Ku; Tsen, Hau-Yang

    2007-12-01

    Staphylococcus aureus may cause foodborne disease outbreaks and staphylococcal infections and is one of the major causes of mastitis. Rapid and reliable methods for detection of this microorganism in milk and other foods are needed. In this study, we designed a primer set from the sequence of the heat shock protein gene htrA, a gene coding for high-temperature-requirement A (HtrA) protein, and used it for real-time PCR detection of S. aureus isolates: 16 reference strains and 40 strains isolated from food-poisoning cases. All strains tested generated positive results. Bacterial strains other than S. aureus, including strains of other Staphylococcus species, did not produce positive results. When this primer set was used for the real-time PCR detection of S. aureus in milk and meat samples without the preenrichment step, samples with target cell numbers greater than 10(3) CFU/ml or CFU/g could be detected, indicating the potential quantitative ability of this real-time PCR assay. With a 10-h preenrichment step, however, a detection limit of 1 CFU/ml or CFU/g could be obtained.

  5. Novel PCR Primers for the Archaeal Phylum Thaumarchaeota Designed Based on the Comparative Analysis of 16S rRNA Gene Sequences

    PubMed Central

    Hong, Jin-Kyung; Kim, Hye-Jin; Cho, Jae-Chang

    2014-01-01

    Based on comparative phylogenetic analysis of 16S rRNA gene sequences deposited in an RDP database, we constructed a local database of thaumarchaeotal 16S rRNA gene sequences and developed a novel PCR primer specific for the archaeal phylum Thaumarchaeota. Among 9,727 quality-filtered (chimeral-checked, size >1.2 kb) archaeal sequences downloaded from the RDP database, 1,549 thaumarchaeotal sequences were identified and included in our local database. In our study, Thaumarchaeota included archaeal groups MG-I, SAGMCG-I, SCG, FSCG, RC, and HWCG-III, forming a monophyletic group in the phylogenetic tree. Cluster analysis revealed 114 phylotypes for Thaumarchaeota. The majority of the phylotypes (66.7%) belonged to the MG-I and SCG, which together contained most (93.9%) of the thaumarchaeotal sequences in our local database. A phylum-directed primer was designed from a consensus sequence of the phylotype sequences, and the primer’s specificity was evaluated for coverage and tolerance both in silico and empirically. The phylum-directed primer, designated THAUM-494, showed >90% coverage for Thaumarchaeota and <1% tolerance to non-target taxa, indicating high specificity. To validate this result experimentally, PCRs were performed with THAUM-494 in combination with a universal archaeal primer (ARC917R or 1017FAR) and DNAs from five environmental samples to construct clone libraries. THAUM-494 showed a satisfactory specificity in empirical studies, as expected from the in silico results. Phylogenetic analysis of 859 cloned sequences obtained from 10 clone libraries revealed that >95% of the amplified sequences belonged to Thaumarchaeota. The most frequently sampled thaumarchaeotal subgroups in our samples were SCG, MG-I, and SAGMCG-I. To our knowledge, THAUM-494 is the first phylum-level primer for Thaumarchaeota. Furthermore, the high coverage and low tolerance of THAUM-494 will make it a potentially valuable tool in understanding the phylogenetic diversity and

  6. PhiSiGns: an online tool to identify signature genes in phages and design PCR primers for examining phage diversity

    PubMed Central

    2012-01-01

    Background Phages (viruses that infect bacteria) have gained significant attention because of their abundance, diversity and important ecological roles. However, the lack of a universal gene shared by all phages presents a challenge for phage identification and characterization, especially in environmental samples where it is difficult to culture phage-host systems. Homologous conserved genes (or "signature genes") present in groups of closely-related phages can be used to explore phage diversity and define evolutionary relationships amongst these phages. Bioinformatic approaches are needed to identify candidate signature genes and design PCR primers to amplify those genes from environmental samples; however, there is currently no existing computational tool that biologists can use for this purpose. Results Here we present PhiSiGns, a web-based and standalone application that performs a pairwise comparison of each gene present in user-selected phage genomes, identifies signature genes, generates alignments of these genes, and designs potential PCR primer pairs. PhiSiGns is available at (http://www.phantome.org/phisigns/; http://phisigns.sourceforge.net/) with a link to the source code. Here we describe the specifications of PhiSiGns and demonstrate its application with a case study. Conclusions PhiSiGns provides phage biologists with a user-friendly tool to identify signature genes and design PCR primers to amplify related genes from uncultured phages in environmental samples. This bioinformatics tool will facilitate the development of novel signature genes for use as molecular markers in studies of phage diversity, phylogeny, and evolution. PMID:22385976

  7. Rapid diagnosis of aneuploidy in chromosomes 13, 18, 21, X and Y by quantitative fluorescence-PCR combined with short tandem repeat and fluorescence-labeled homologous gene quantitative‑PCR using 4-color fluorescently labeled universal primers.

    PubMed

    Long, Ju; Ye, Xuehe; Weng, Xunjin; Fu, Kepeng; Sun, Lei; Pang, Wanrong

    2013-11-01

    The present study aimed to develop a rapid diagnostic test of aneuploidy in chromosomes 13, 18, 21, X and Y through a program combining short tandem repeat (STR) typing with fluorescence-labeled homologous gene quantitative‑polymerase chain reaction (fHGQ-PCR), which avoids misjudgment risks by using one method alone. Furthermore, fluorescently labeled universal primers not only ensure the accuracy of the results but also reduces the cost of fluorescent labels. The verification of DNA extracted from samples confirmed by karyotype analysis with quantitative fluorescence (QF)-PCR shows that the results obtained using the QF-PCR program are consistent with the results of karyotype analysis in rapidly diagnosing the aneuploidy of chromosomes 13, 18, 21, X and Y.

  8. PCR Primer Design for 16S rRNAs for Experimental Horizontal Gene Transfer Test in Escherichia coli

    PubMed Central

    Miyazaki, Kentaro; Sato, Mitsuharu; Tsukuda, Miyuki

    2017-01-01

    We recently demonstrated that the Escherichia coli ribosome is robust enough to accommodate foreign 16S rRNAs from diverse gamma- and betaproteobacteria bacteria (Kitahara et al., 2012). Therein, we used the common universal primers Bac8f and UN1541r to obtain a nearly full-length gene. However, we noticed that these primers overlap variable sites at 19[A/C] and 1527[U/C] in Bac8f and UN1541r, respectively, and thus, the amplicon could contain mutations. This is problematic, particularly for the former site, because the 19th nucleotide pairs with the 916th nucleotide, which is a part of the “central pseudoknot” and is critical for function. Therefore, we mutationally investigated the role of the base pair using several 16S rRNAs from gamma- and betaproteobacteria. We found that both the native base pairs (gammaproteobacterial 19A–916U and betaproteobacterial 19C–916G) and the non-native 19A–916G pair retained function, whereas the non-native 19C–916U was defective 16S rRNAs. We next designed a new primer set, Bac1f and UN1542r, so that they do not overlap the potential mismatch sites. 16S rRNA amplicons obtained from the environmental metagenome using the new primer set were dominated by proteobacterial species (~85%). Subsequent functional screening identified various 16S rRNAs from proteobacteria, all of which contained native 19A–916U or 19C–916G base pairs. The primers developed in this study are thus advantageous for functional characterization of foreign 16S rRNA in E. coli with no artifacts. PMID:28293553

  9. Diversity of Methane-Cycling Archaea in Hydrothermal Sediment Investigated by General and Group-Specific PCR Primers

    PubMed Central

    Teske, Andreas P.

    2014-01-01

    The zonation of anaerobic methane-cycling Archaea in hydrothermal sediment of Guaymas Basin was studied by general primer pairs (mcrI, ME1/ME2, mcrIRD) targeting the alpha subunit of methyl coenzyme M reductase gene (mcrA) and by new group-specific mcrA and 16S rRNA gene primer pairs. The mcrIRD primer pair outperformed the other general mcrA primer pairs in detection sensitivity and phylogenetic coverage. Methanotrophic ANME-1 Archaea were the only group detected with group-specific primers only. The detection of 14 mcrA lineages surpasses the diversity previously found in this location. Most phylotypes have high sequence similarities to hydrogenotrophs, methylotrophs, and anaerobic methanotrophs previously detected at Guaymas Basin or at hydrothermal vents, cold seeps, and oil reservoirs worldwide. Additionally, five mcrA phylotypes belonging to newly defined lineages are detected. Two of these belong to deeply branching new orders, while the others are new species or genera of Methanopyraceae and Methermicoccaceae. Downcore diversity decreases from all groups detected in the upper 6 cm (∼2 to 40°C, sulfate measurable to 4 cm) to only two groups below 6 cm (>40°C). Despite the presence of hyperthermophilic genera (Methanopyrus, Methanocaldococcus) in cooler surface strata, no genes were detected below 10 cm (≥60°C). While mcrA-based and 16S rRNA gene-based community compositions are generally congruent, the deeply branching mcrA cannot be assigned to specific 16S rRNA gene lineages. Our study indicates that even among well-studied metabolic groups and in previously characterized model environments, major evolutionary branches are overlooked. Detecting these groups by improved molecular biological methods is a crucial first step toward understanding their roles in nature. PMID:25527539

  10. PCR Primer Design for 16S rRNAs for Experimental Horizontal Gene Transfer Test in Escherichia coli.

    PubMed

    Miyazaki, Kentaro; Sato, Mitsuharu; Tsukuda, Miyuki

    2017-01-01

    We recently demonstrated that the Escherichia coli ribosome is robust enough to accommodate foreign 16S rRNAs from diverse gamma- and betaproteobacteria bacteria (Kitahara et al., 2012). Therein, we used the common universal primers Bac8f and UN1541r to obtain a nearly full-length gene. However, we noticed that these primers overlap variable sites at 19[A/C] and 1527[U/C] in Bac8f and UN1541r, respectively, and thus, the amplicon could contain mutations. This is problematic, particularly for the former site, because the 19th nucleotide pairs with the 916th nucleotide, which is a part of the "central pseudoknot" and is critical for function. Therefore, we mutationally investigated the role of the base pair using several 16S rRNAs from gamma- and betaproteobacteria. We found that both the native base pairs (gammaproteobacterial 19A-916U and betaproteobacterial 19C-916G) and the non-native 19A-916G pair retained function, whereas the non-native 19C-916U was defective 16S rRNAs. We next designed a new primer set, Bac1f and UN1542r, so that they do not overlap the potential mismatch sites. 16S rRNA amplicons obtained from the environmental metagenome using the new primer set were dominated by proteobacterial species (~85%). Subsequent functional screening identified various 16S rRNAs from proteobacteria, all of which contained native 19A-916U or 19C-916G base pairs. The primers developed in this study are thus advantageous for functional characterization of foreign 16S rRNA in E. coli with no artifacts.

  11. Use of tuf gene-based primers for the PCR detection of probiotic Bifidobacterium species and enumeration of bifidobacteria in fermented milk by cultural and quantitative real-time PCR methods.

    PubMed

    Sheu, Sen-Je; Hwang, Wen-Zhe; Chiang, Yu-Cheng; Lin, Wen-Hsin; Chen, Hsin-Chih; Tsen, Hau-Yang

    2010-10-01

    Due to the increasing use of bifidobacteria in probiotic products, it is essential to establish a rapid method for the qualitative and quantitative assay of the bifidobacteria in commercial products. In this study, partial sequences of the tuf gene for 18 Bifidobacterium strains belonging to 14 species were determined. Alignment of these sequences showed that the similarities among these Bifidobacterium species were 82.24% to 99.72%. Based on these tuf gene sequences, 6 primer sets were designed for the polymerase chain reaction (PCR) assay of B. animalis subsp. animalis, B. animalis subsp. lactis, B. bifidum, B. breve, B. longum subsp. infantis, B. longum subsp. longum, and the genus of Bifidobacterium, respectively. These Bifidobacterium species are common probiotic species present in dairy and probiotic products. When each target Bifidobacterium spp. was assayed with the designed primers, PCR product with expected size was generated. In addition, for each target species, more than 70 bacterial strains other than the target species, including strains of other Bifidobacterium species, strains of Lactobacillus spp., Enterococcus spp., and other bacterial species, all generated negative results. PCR assay with primers specific to B. animalis subsp. lactis and B. longum subsp. longum confirmed the presence of these Bifidobacterium species in commercial yogurt products. In addition, for each product, enumeration of the bifidobacteria cells by culture method with BIM-25 agar and the quantitative real-time PCR showed similar cell counts. Such results indicated that within 15-d storage (4 °C) after manufacture, all the bifidobacteria cells originally present in yogurt products were viable and culturable during the storage.

  12. Undergraduate Virology Exercises Demonstrate Conventional and Real-Time PCR Using Commercially Available HIV Primers and Noninfectious Target

    ERIC Educational Resources Information Center

    Sulzinski, Michael A.; Wasilewski, Melissa A.; Farrell, James C.; Glick, David L.

    2009-01-01

    It is an extraordinary challenge to offer an undergraduate laboratory course in virology that teaches hands-on, relevant molecular biology techniques using nonpathogenic models of human virus detection. To our knowledge, there exists no inexpensive kits or reagent sets that are appropriate for demonstrating real-time PCR (RT-PCR) in an…

  13. Diversity of methane-cycling archaea in hydrothermal sediment investigated by general and group-specific PCR primers.

    PubMed

    Lever, Mark A; Teske, Andreas P

    2015-02-01

    The zonation of anaerobic methane-cycling Archaea in hydrothermal sediment of Guaymas Basin was studied by general primerpairs (mcrI, ME1/ME2, mcrIRD) targeting the alpha subunit of methyl coenzyme M reductase gene (mcrA) and by new group specific mcrA and 16S rRNA gene primer pairs. The mcrIRD primer pair outperformed the other general mcrA primer pairs indetection sensitivity and phylogenetic coverage. Methanotrophic ANME-1 Archaea were the only group detected with group specific primers only. The detection of 14 mcrA lineages surpasses the diversity previously found in this location. Most phylotypes have high sequence similarities to hydrogenotrophs, methylotrophs, and anaerobic methanotrophs previously detected at Guaymas Basin or at hydrothermal vents, cold seeps, and oil reservoirs worldwide. Additionally, five mcrA phylotypes belonging to newly defined lineages are detected. Two of these belong to deeply branching new orders, while the others are new species or genera of Methanopyraceae and Methermicoccaceae. Downcore diversity decreases from all groups detected in the upper 6 cm(2 to 40 °C, sulfate measurable to 4 cm) to only two groups below 6 cm (>40 °C). Despite the presence of hyperthermophilic genera (Methanopyrus, Methanocaldococcus) in cooler surface strata, no genes were detected below 10 cm (>60 °C). While mcrAbased and 16S rRNA gene-based community compositions are generally congruent, the deeply branching mcrA cannot be assigned to specific 16S rRNA gene lineages. Our study indicates that even among well-studied metabolic groups and in previously characterized model environments, major evolutionary branches are overlooked. Detecting these groups by improved molecular biological methods is a crucial first step toward understanding their roles in nature.

  14. Differentiation of Lactobacillus plantarum, L. pentosus, and L. paraplantarum by recA Gene Sequence Analysis and Multiplex PCR Assay with recA Gene-Derived Primers

    PubMed Central

    Torriani, Sandra; Felis, Giovanna E.; Dellaglio, Franco

    2001-01-01

    In this study, we succeeded in differentiating Lactobacillus plantarum, Lactobacillus pentosus, and Lactobacillus paraplantarum by means of recA gene sequence comparison. Short homologous regions of about 360 bp were amplified by PCR with degenerate consensus primers, sequenced, and analyzed, and 322 bp were considered for the inference of phylogenetic trees. Phylograms, obtained by parsimony, maximum likelihood, and analysis of data matrices with the neighbor-joining model, were coherent and clearly separated the three species. The validity of the recA gene and RecA protein as phylogenetic markers is discussed. Based on the same sequences, species-specific primers were designed, and a multiplex PCR protocol for the simultaneous distinction of these bacteria was optimized. The sizes of the amplicons were 318 bp for L. plantarum, 218 bp for L. pentosus, and 107 bp for L. paraplantarum. This strategy permitted the unambiguous identification of strains belonging to L. plantarum, L. pentosus, and L. paraplantarum in a single reaction, indicating its applicability to the speciation of isolates of the L. plantarum group. PMID:11472918

  15. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species

    PubMed Central

    Miya, M.; Sato, Y.; Fukunaga, T.; Sado, T.; Poulsen, J. Y.; Sato, K.; Minamoto, T.; Yamamoto, S.; Yamanaka, H.; Araki, H.; Kondoh, M.; Iwasaki, W.

    2015-01-01

    We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163–185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales. PMID:26587265

  16. Cryptococcus neoformans Typing by PCR Fingerprinting Using (GACA)4 Primers Based on C. neoformans Genome Project Data▿

    PubMed Central

    Cogliati, Massimo; Esposto, Maria Carmela; Liberi, Giordano; Tortorano, Anna Maria; Viviani, Maria Anna

    2007-01-01

    Four (GACA)4 PCR fingerprinting sequences, used as markers to identify serotypes A and D and AD hybrids, were retrieved in four Cryptococcus neoformans genome databases. Their locations, both in serotype A and D genomes, were confirmed by chromosomal hybridization with specific probes. Two sequences were recognized to code for hypothetical functional proteins. PMID:17670921

  17. A Molecular Approach to Nested RT-PCR Using a New Set of Primers for the Detection of the Human Immunodeficiency Virus Protease Gene

    PubMed Central

    Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab

    2016-01-01

    Background The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. Objectives This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. Patients and Methods In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher’s exact test, and SPSS17 software. Results The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. Conclusions These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1. PMID:27679699

  18. Simultaneous Detection and Genotype Determination of HSV 1 and 2 by Real-time PCR Using Melting Curve Analysis and a Unique Pair of Primers.

    PubMed

    Paryan, Mahdi; Mohammadi-Yeganeh, Samira; Rezvan, Houri; Kia, Vahid; Mansouri, Ardalan; Mirab Samiee, Siamak

    2017-02-01

    Herpes simplex virus (HSV) is a human pathogen that causes different pathologic manifestations. Rapid and feasible detection and discrimination methods for HSV genotyping is a challenge in clinical laboratories, especially in children suffering from herpetic encephalitis. A quantitative real-time polymerase chain reaction (PCR)-based genotyping assay using SYBR Green I was established. We designed only 1 pair of primer for HSV 1 and 2, targeting thymidine kinase gene conserved region. HSV genotypes were determined by PCR using melting curve analysis with LightCycler. Different HSV genotypes were successfully detected in all clinical samples. The melting temperature for HSV 1 and 2 was 85.5±0.78°C and 89±0.53°C, respectively. These 2 genotypes were completely distinguished by means of the accurate melting assay. Importantly, detection was reliably performed within only 1 hour. The assay had no cross-reactivity across species, an excellent dynamic range from 10 to 10 copies per reaction, a good intra-assay and interassay reproducibility, and a detection limit of a single copy per reaction. Our homebrew designed and validated quantitative real-time PCR followed by a melting curve analysis provided a rapid and convenient screening test for differential identification of HSV genotypes 1 and 2. We recommend the large-scale application of this method for HSV 1 and 2 detection.

  19. Detection of Lactobacillus, Pediococcus, Leuconostoc, and Weissella species in human feces by using group-specific PCR primers and denaturing gradient gel electrophoresis.

    PubMed

    Walter, J; Hertel, C; Tannock, G W; Lis, C M; Munro, K; Hammes, W P

    2001-06-01

    Denaturing gradient gel electrophoresis (DGGE) of DNA fragments generated by PCR with 16S ribosomal DNA-targeted group-specific primers was used to detect lactic acid bacteria (LAB) of the genera Lactobacillus, Pediococcus, Leuconostoc, and Weissella in human feces. Analysis of fecal samples of four subjects revealed individual profiles of DNA fragments originating not only from species that have been described as intestinal inhabitants but also from characteristically food-associated bacteria such as Lactobacillus sakei, Lactobacillus curvatus, Leuconostoc mesenteroides, and Pediococcus pentosaceus. Comparison of PCR-DGGE results with those of bacteriological culture showed that the food-associated species could not be cultured from the fecal samples by plating on Rogosa agar. On the other hand, all of the LAB species cultured from feces were detected in the DGGE profile. We also detected changes in the types of LAB present in human feces during consumption of a milk product containing the probiotic strain Lactobacillus rhamnosus DR20. The analysis of fecal samples from two subjects taken before, during, and after administration of the probiotic revealed that L. rhamnosus was detectable by PCR-DGGE during the test period in the feces of both subjects, whereas it was detectable by culture in only one of the subjects.

  20. A universal primer set for PCR amplification of nuclear histone H4 genes from all animal species.

    PubMed

    Pineau, Pascal; Henry, Michel; Suspène, Rodolphe; Marchio, Agnès; Dettai, Agnès; Debruyne, Régis; Petit, Thierry; Lécu, Alexis; Moisson, Pierre; Dejean, Anne; Wain-Hobson, Simon; Vartanian, Jean-Pierre

    2005-03-01

    To control the quality of genomic DNA of samples from a wide variety of animals, a heminested PCR assay specifically targeting a nuclear gene has been developed. The histone H4 gene family comprises a small number of genes considered among the most conserved genes in living organisms. Tissue samples from necropsies and from cells belonging to 43 different species were studied, eight samples from invertebrates and 35 samples from vertebrates covering all classes. Ancient DNA samples from three Siberian woolly mammoths (Mammuthus primigenius) dating between 40,000 and 49,000 years before present were also tested for PCR amplification. Performance of HIST2H4 amplification were also compared with those of previously published universal PCRs (28S rRNA, 18S rRNA, and cytochrome b). Overall, 95% of species studied yielded an amplification product, including some old samples from gorilla and chimpanzees. The data indicate that the HIST2H4 amplimers are, thus, suitable for both DNA quality testing as well as species identification in the animal kingdom.

  1. Use of PCR primers and probes based on the 23S rRNA and internal transcription spacer (ITS) gene sequence for the detection and enumerization of Lactobacillus acidophilus and Lactobacillus plantarum in feed supplements.

    PubMed

    Tsai, Cheng-Chih; Lai, Chieh-Hsien; Yu, Bi; Tsen, Hau-Yang

    2010-06-01

    Novel polymerase chain reaction (PCR) primers designed from the 16S-23S internal transcription spacer (ITS) rRNA and 23S rRNA genes, respectively, were used for the specific detection of Lactobacillus acidophilus and Lactobacillus plantarum. Molecular weights of the PCR products were 221 and 599 bp, respectively. Strains of L. acidophilus and L. plantarum obtained from the culture center, dairy products, infant stool and other samples, could be identified with these PCR primers. DNAs from other lactic acid bacteria (LAB) species including strains of Lactobacillus pentosus which was closely related to L. plantarum, and bacteria species other than LAB, would not generate the false positive results. When this PCR primer set was used for the detection of L. acidophilus and L. plantarum in feed supplement or feed starter samples, reliable results were obtained. Furthermore, when these L. acidophilus or L. plantarum specific primers were used as DNA probes for the colony hybridization of L. acidophilus and L. plantarum, the viable cells of these LAB species in culture and feed supplements or starter products could be identified and enumerized. The method described here thus offers a rapid and economic way to inspect and assure the quality of the feed supplements or fermentation starters.

  2. Development of a 16S rRNA Gene Primer and PCR-Restriction Fragment Length Polymorphism Method for Rapid Detection of Members of the Genus Megasphaera and Species-Level Identification ▿ †

    PubMed Central

    Ohnishi, Akihiro; Abe, Shinko; Nashirozawa, Shiho; Shimada, Sayaka; Fujimoto, Naoshi; Suzuki, Masaharu

    2011-01-01

    The genus Megasphaera is relevant to the environment, human health and food, and renewable energy for the future. In this study, a primer set was designed for PCR-restriction fragment length polymorphism (RFLP) analyses to detect and identify the members of Megasphaera. Direct detection and identification were achieved for environmental samples and isolates. PMID:21705538

  3. Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant-Associated Fungi.

    PubMed

    Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

    2016-09-29

    The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant-associated fungi due to the similar homologies of sequences in primer-annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3' end of the primer-binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant-associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant-associated fungi.

  4. [A method using long primers for cloning the upstream sequence of delta-6 fatty acid desaturases gene of Thamnidium elegans by nested inverse PCR].

    PubMed

    Wang, De-Pei; Sun, Wei; Li, Ming-Chun; Wei, Dong-Sheng; Zhang, Ying-Hui; Xing, Lai-Jun

    2006-07-01

    Thamnidium elegans is a kind of phycomycete that produces essential unsaturated fatty acids, particularly y-linolenic acid. In this process, delta6-Fatty acid desaturase (D6D) plays a key role due to its enzymatic properties that catalyze the delta6 site dehydrogenation of precursor linoleic acid (18:2delta(9, 12) n-6) and a-linolenic acid (18:3delta(9, 12, 15) n-3). This reaction is the first and rate-limiting step of highly unsaturated fatty acids (HUFA) synthesis pathways. After we have isolated and cloned the gene coding delta6-fatty acid desaturase from Thamnidium elegans As3.2806 (GenBank accession number DQ099380), our interest focuses on the promotion and regulation of the gene transcription. To achieve this aim, we designed long primers and used nested inverse PCR to amplify DNA flanking sequences. First, genome of Thamnidium elegans was extracted and digested with restriction enzymes EcoR I and Kpn I , respectively. Then we ligated the digested DNA with T4 ligase at low concentration which is propitious for linear DNA to joint intromolecule. According to the sequence of delta6-fatty acid desaturase gene of Thamnidium elegans, we designed a couple of 35nt long inverse primers and two couples of shorter inverse primers for inverse PCR. Three rounds of PCR reactions were performed. In the primary reaction, the ligated DNA was used as a template, and the product was used as the template of the secondary reaction, the tertiary reaction was achieved in the same way. After all the three rounds of reactions, we got a nice product about 4 kb from the EcoR I digested sample, in which a 1.3kb 5' upstream sequence (GenBank accession number DQ309425) of delta6-fatty acid desaturase gene containing several putative regulatory elements including TATA. box, FSE-2, AP-1 sites, CCAAT cis-element site and STRE-binding site was derived after sequencing. All of these implied intensely that this 1.3kb fragment is a condition-regulated promoter. It is the first report about

  5. Multi-primer qPCR assay capable of highly efficient and specific detection of the vast majority of all known Mycoplasma.

    PubMed

    Salling, H K; Bang-Christensen, S R

    2016-05-01

    Mycoplasma bacteria are able to pass through sterilizing grade filters due to their small size and lack of a cell wall, making them a common contaminant of biopharmaceutical productions. The classical method for detecting Mycoplasma is described in the European Pharmacopeia (Ph.Eur) 2.6.7. The method takes 28 days to perform, due to the slow growing nature of some Mycoplasma species. The Ph.Eur has described Nucleic Acid Testing (NAT) as a rapid alternative to the classical method. Here we present the development of a quantitative polymerase chain reaction (qPCR) assay capable of unambiguous detection of Mycoplasma with high sensitivity and specificity. The broadness of detection and the specificity towards Mycoplasma has been investigated by in silico analysis of the primer sequences followed by testing on purified Mycoplasma DNA as well as DNA from closely related genera. The assay will in all probability detect at least 356 species and strains of Mycoplasma, Spiroplasma and Acholeplasma with high sensitivity. To our knowledge this assay has the most uniform amplification efficiency over the broadest range of species and it is extremely specific towards Mycoplasma. With appropriate validation, the assay can be applied as a powerful tool for rapid Mycoplasma detection in the biopharmaceutical industry.

  6. Genetic structure of soil population of fungus Fusarium oxysporum Schlechtend.: Fr.: Molecular reidentification of the species and genetic differentiation of isolates using polymerase chain reaction technique with universal primers (UP-PCR)

    SciTech Connect

    Bulat, S.A.; Mironenko, N.V.; Zholkevich, Yu.G.

    1995-07-01

    The genetic structure of three soil populations of fungus Fusarium oxysporum was analyzed using polymerase chain reaction with universal primers (UP-PCR). Distinct UP-PCR variants revealed by means of cross-dot hybridization of amplified DNA and restriction analysis of nuclear ribosomal DNA represent subspecies or sibling species of F. oxysporum. The remaining isolates of F. oxysporum showed moderate UP-PCR polymorphism characterized by numerous types, whose relatedness was analyzed by computer treatment of the UP-PCR patterns. The genetic distance trees based on the UP-PCR patterns, which were obtained with different universal primers, demonstrated similar topology. This suggests that evolutionarily important genome rearrangements correlatively occur within the entire genome. Isolates representing different UP-PCR polymorphisms were encountered in all populations, being distributed asymmetrically in two of these. In general, soil populations of F. oxysporum were represented by numerous genetically isolated groups with a similar genome structure. The genetic heterogeneity of the isolates within these groups is likely to be caused by the parasexual process. The usefulness of the UP-PCR technique for population studies of F. oxysporum was demonstrated. 39 refs., 7 figs., 2 tabs.

  7. Neuraminidase subtyping of avian influenza viruses with PrimerHunter-designed primers and quadruplicate primer pools.

    PubMed

    Huang, Yanyan; Khan, Mazhar I; Khan, Mazhar; Măndoiu, Ion; Măndoiu, Ion I

    2013-01-01

    We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers.

  8. Correlation Between Pneumocystis jirovecii Mitochondrial Genotypes and High and Low Fungal Loads Assessed by Single Nucleotide Primer Extension Assay and Quantitative Real-Time PCR.

    PubMed

    Alanio, Alexandre; Olivi, Martine; Cabaret, Odile; Foulet, Françoise; Bellanger, Anne-Pauline; Millon, Laurence; Berceanu, Ana; Cordonnier, Catherine; Costa, Jean-Marc; Bretagne, Stéphane

    2015-01-01

    We designed a single nucleotide primer extension (SNaPshot) assay for Pneumocystis jirovecii genotyping, targeting mt85 SNP of the mitochondrial large subunit ribosomal RNA locus, to improve minority allele detection. We then analyzed 133 consecutive bronchoalveolar lavage (BAL) fluids tested positive for P. jirovecii DNA by quantitative real-time PCR, obtained from two hospitals in different locations (Hospital 1 [n = 95] and Hospital 2 [n = 38]). We detected three different alleles, either singly (mt85C: 39.1%; mt85T: 24.1%; mt85A: 9.8%) or together (27%), and an association between P. jirovecii mt85 genotype and the patient's place of hospitalization (p = 0.011). The lowest fungal loads (median = 0.82 × 10(3) copies/μl; range: 15-11 × 10(3) ) were associated with mt85A and the highest (median = 1.4 × 10(6) copies/μl; range: 17 × 10(3) -1.3 × 10(7) ) with mt85CTA (p = 0.010). The ratios of the various alleles differed between the 36 mixed-genotype samples. In tests of serial BALs (median: 20 d; range 4-525) from six patients with mixed genotypes, allele ratio changes were observed five times and genotype replacement once. Therefore, allele ratio changes seem more frequent than genotype replacement when using a SNaPshot assay more sensitive for detecting minority alleles than Sanger sequencing. Moreover, because microscopy detects only high fungal loads, the selection of microscopy-positive samples may miss genotypes associated with low loads.

  9. Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant–Associated Fungi

    PubMed Central

    Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

    2016-01-01

    The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant–associated fungi due to the similar homologies of sequences in primer–annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3′ end of the primer–binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant–associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant–associated fungi. PMID:27600711

  10. A real-time PCR approach based on SPF10 primers and the INNO-LiPA HPV genotyping extra assay for the detection and typing of human papillomavirus.

    PubMed

    Micalessi, M Isabel; Boulet, Gaëlle A; Bogers, Johannes

    2015-01-01

    A highly sensitive SPF10 real-time PCR was developed to achieve simultaneous amplification and detection of the human papillomavirus (HPV) target. That way, LiPA analysis of the HPV-negative samples can be avoided, reducing workload and cost. Here, we describe in detail a SYBR Green I-based real-time PCR assay based on SPF10 primers using the LightCycler(®) 480 system to generate and detect HPV amplicons, which are compatible with the LiPA assay.

  11. Differentiation of entC1 from entC2/entC3 with a single primer pair using simple and rapid SYBR Green-based RT-PCR melt curve analysis.

    PubMed

    Nagaraj, Sowmya; Ramlal, Shylaja; Venkataswamachari, Bhavani Peddayelachagiri; Paul, Soumya; Kingston, Joseph; Batra, Harsh Vardhan

    2016-10-01

    In spite of their involvement in foodborne illness, the epidemiological relevance of staphylococcal enterotoxin C (SEC) subtypes is poorly documented may be due to high sequence similarity. Among subtypes, SEC1, SEC2, and SEC3 exhibit more than 97 % homology because of which specific detection tools are seldom available to identify and differentiate them. In this study, a SYBR Green-based RT-PCR followed by melt curve analysis was developed for differentiation of entC1 from entC2/entC3 using a single primer pair. Nucleotide sequences of all three subtypes were analyzed using Clustal Omega program and the region with significant sequence variation/heterogeneity (where utmost SNPs were closely located and accessible for RT-PCR) was selected for amplification by designing a single primer pair that could amplify all three subtypes. In spite of same amplicon size, entC1 showed distinct melt peak at 76 °C. However, due to high similarity between entC2 and entC3, the developed format was deficient to discriminate between them and both showed melt peak at 82 °C. Reliability of developed RT-PCR was evaluated using various naturally contaminated samples and 91 food and clinical Staphylococcus aureus isolates where satisfactory results were obtained in comparison with commercial immunoassay kit and conventional PCRs using validated primers. To the best of our knowledge, this is the first method being reported to differentiate entC1 from entC2/entC3 using single primer pair which is unachievable by conventional PCR due to same amplicon size. As benefits, the method is sensitive, rapid, and inexpensive with no requirement of fluorescent probes, multiple primers, and post-PCR procedures. Thus, the assay might find its utility as a detection tool in epidemiological survey of foodborne outbreaks for simultaneous identification and differentiation of entC1 from entC2/entC3.

  12. Detection of gastroenteritis viruses among pediatric patients in Hiroshima Prefecture, Japan, between 2006 and 2013 using multiplex reverse transcription PCR-based assays involving fluorescent dye-labeled primers.

    PubMed

    Shigemoto, Naoki; Hisatsune, Yuri; Toukubo, Yasushi; Tanizawa, Yukie; Shimazu, Yukie; Takao, Shinichi; Tanaka, Tomoyuki; Noda, Mamoru; Fukuda, Shinji

    2017-05-01

    Multiplex reverse transcription (RT)-polymerase chain reaction (PCR)-based assays involving fluorescent dye-labeled primers were modified to detect 10 types of gastroenteritis viruses by adding two further assays to a previously developed assay. Then, these assays were applied to clinical samples, which were collected between January 2006 and December 2013. All 10 types of viruses were effectively detected in the multiplex RT-PCR-based assays. In addition, various viral parameters, such as the detection rates and age distributions of each viral type, were examined. The frequency and types of mixed infections were also investigated. Among the 186 virus-positive samples, genogroup II noroviruses were found to be the most common type of virus (32.7%), followed by group A rotaviruses (10.6%) and parechoviruses (10.3%). Mixed infections were observed in 37 samples, and many of them were detected in patients who were less than 2 years old. These observations showed that the multiplex RT-PCR-based assays involving fluorescent dye-labeled primers were able to effectively detect the viruses circulating among pediatric acute gastroenteritis patients and contributed to the highly specific and sensitive diagnosis of gastroenteritis. J. Med. Virol. 89:791-800, 2017. © 2016 Wiley Periodicals, Inc.

  13. Universal primer-multiplex-polymerase chain reaction (UP-M-PCR) and capillary electrophoresis-laser-induced fluorescence analysis for the simultaneous detection of six genetically modified maize lines.

    PubMed

    Zhang, Chunjiao; Xu, Wentao; Zhai, Zhifang; Luo, Yunbo; Yan, Xinghua; Zhang, Nan; Huang, Kunlun

    2011-05-25

    To meet the labeling and traceability requirement of genetically modified (GM) maize and their products for trade and regulation, it is essential to develop a specific detection method for monitoring the presence of GM content. In this work, six GM maize lines, including GA21, Bt11, NK603, Bt176, Mir604, and Mon810, were simultaneously detected by universal primer-multiplex-polymerase chain reaction (UP-M-PCR), and the amplicons for the six event-specific genes as well as the endogenous Ivr gene were successfully separated by the method of capillary electrophoresis-laser-induced fluorescence (CE-LIF). The UP-M-PCR method overcame the disadvantages in conventional M-PCR, such as complex manipulation, lower sensitivity, amplification disparity resulting from different primers, etc., and in combination with CE-LIF, it obtained a high sensitivity of 0.1 ng for both single and mixed DNA samples. The established method can be widely used for the qualitative identification of the GM maize lines.

  14. The use of RT-PCR for determination of separate end-points for the strains IB H120 and IB D274 in titration of the combination vaccine Poulvac IB® primer.

    PubMed

    Geerligs, H J; Meinders, C A M; Snel, J; Duyves, W

    2013-11-01

    Poulvac IB® Primer is a lyophilized vaccine containing two attenuated infectious bronchitis strains in one vial, IB H120 and IB D274. For quantification of the viral content of the vaccine, dilution series of the final product are inoculated in embryonated chicken eggs. After the incubation period of seven days standard practice is for the embryos to be taken from each egg and examined visually for IB specific lesions; these readings are used to determine an end-point in viral titrations. The result is a titre value to which both strains contribute. However, it is not clear what the live virus titre is for strain IB H120 and for strain IB D274. In order to determine end-points in the titration for each of the two strains, we collected the allantoic fluids from each egg after the incubation period and tested these for the presence of IB H120 and IB D274 by a strain specific reverse phase PCR. Based on the data obtained by PCR we were able to determine an end-point for each of the two strains. For a given commercial batch of Poulvac IB primer we determined titres of 10(6.31) EID50 per vial for IB H120 and 10(6.59) EID50 for IB D274 using PCR for end-point determination. These end-points matched well with the end-point determined for both strains cumulatively after visual examination, i.e. 10(6.67) EID50 per vial. It is concluded that PCR is a suitable means to determine end-points in titrations of live viruses.

  15. Detection of bacteria and fungi in blood of patients with febrile neutropenia by real-time PCR with universal primers and probes.

    PubMed

    Teranishi, Hideto; Ohzono, Nanae; Inamura, Norikazu; Kato, Atsushi; Wakabayashi, Tokio; Akaike, Hiroto; Terada, Kihei; Ouchi, Kazunobu

    2015-03-01

    Febrile neutropenia is the main treatment-related cause of mortality in cancer patients. During June 2012 to April 2014, 97 blood culture samples were collected from patients receiving chemotherapy for hematological malignancy and cancer with febrile neutropenia episodes (FNEs). The samples were examined for the presence of bacteria and fungi using real-time PCR amplification and sequencing of 16S and 18S rRNA genes. Bacteria were identified in 20 of 97 samples (20.6%) by the real-time PCR assay and in 10 of 97 (10.3%) samples by blood culture. In 6 blood culture-positive samples, the real-time PCR assay detected the same type of bacteria. No fungi were detected by the real-time PCR assay or blood culture. During antibiotic therapy, all samples were negative by blood culture, but the real-time PCR assay yielded a positive result in 2 cases of 2 (100%). The bacterial DNA copy number was not well correlated with the serum C-reactive protein titer of patients with FNEs. We conclude that a real-time PCR assay could provide better detection of causative microbes' in a shorter time, and with a smaller blood sample than blood culture. Using a real-time PCR assay in combination with blood culture could improve microbiological documentation of FNEs.

  16. Influence of primer sequences and DNA extraction method on detection of non-O157 Shiga toxin-producing Escherichia coli in ground beef by real-time PCR targeting the eae, stx, and serogroup-specific genes.

    PubMed

    Wasilenko, Jamie L; Fratamico, Pina M; Narang, Neelam; Tillman, Glenn E; Ladely, Scott; Simmons, Mustafa; Cray, William C

    2012-11-01

    Non-O157 Shiga toxin-producing Escherichia coli (STEC) infections, particularly those caused by the "big six" or "top six" non-O157 serogroups (O26, O45, O103, O111, O121, and O145) can result in severe illness and complications. Because of their significant public health impact and the notable prevalence of STEC in cattle, methods for detection of the big six non-O157 STEC in ground beef have been established. Currently, the U.S. Department of Agriculture, Food Safety and Inspection Service detection methods for screening beef samples for non-O157 STEC target the stx(1), stx(2), and eae virulence genes, with the 16S rRNA gene as an internal control, in a real-time PCR multiplex assay. Further, the serogroup is determined by PCR targeting genes in the E. coli O-antigen gene clusters of the big six non-O157 serogroups. The method that we previously reported was improved so that additional stx variants, stx(1d), stx(2e), and stx(2g), are detected. Additionally, alignments of the primers targeting the eae gene were used to improve the detection assay so that eae subtypes that could potentially be of clinical significance would also be detected. Therefore, evaluation of alternative real-time PCR assay primers and probes for the stx and eae reactions was carried out in order to increase the stx and eae subtypes detected. Furthermore, a Tris-EDTA DNA extraction method was compared with a previously used procedure that was based on a commercially available reagent. The Tris-EDTA DNA extraction method significantly decreased the cycle threshold values for the stx assay (P < 0.0001) and eae assay (P < 0.0001), thereby increasing the ability to detect the targets. The use of different stx primers and probes increased the subtypes detected to include stx(1d), stx(2e), and stx(2g), and sequence data showed that modification of the eae primer should allow the known eae subtypes to be detected.

  17. Detection and analysis of six lizard adenoviruses by consensus primer PCR provides further evidence of a reptilian origin for the atadenoviruses.

    PubMed

    Wellehan, James F X; Johnson, April J; Harrach, Balázs; Benkö, Mária; Pessier, Allan P; Johnson, Calvin M; Garner, Michael M; Childress, April; Jacobson, Elliott R

    2004-12-01

    A consensus nested-PCR method was designed for investigation of the DNA polymerase gene of adenoviruses. Gene fragments were amplified and sequenced from six novel adenoviruses from seven lizard species, including four species from which adenoviruses had not previously been reported. Host species included Gila monster, leopard gecko, fat-tail gecko, blue-tongued skink, Tokay gecko, bearded dragon, and mountain chameleon. This is the first sequence information from lizard adenoviruses. Phylogenetic analysis indicated that these viruses belong to the genus Atadenovirus, supporting the reptilian origin of atadenoviruses. This PCR method may be useful for obtaining templates for initial sequencing of novel adenoviruses.

  18. Deconstructing the polymerase chain reaction: understanding and correcting bias associated with primer degeneracies and primer-template mismatches.

    PubMed

    Green, Stefan J; Venkatramanan, Raghavee; Naqib, Ankur

    2015-01-01

    The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3-12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled "Polymerase-exonuclease (PEX) PCR", in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3' end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers and

  19. Reference gene selection, primer design and amplification interference of quantitative real-time PCR in tomato and orange subjected to environmental and disease stress

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Response of gene expression in the oxylipin pathway to chilling and heating in tomatoes at full ripe stage was investigated. Total RNA was isolated from tomato pericarp tissue, and gene expression of Tomlox A-Tomlox D, HPL and ADH were determined by real-time Polymerase Chain Reaction (PCR) using t...

  20. DETECTION OF STACHYBOTRYS CHARTARUM USING rRNA, tri5, AND Β-TUBULIN PRIMERS AND DETERMINING THEIR RELATIVE COPY NUMBER BY REAL TIME PCR

    EPA Science Inventory

    This research utilizes the quantitative polymerase chain reaction (qPCR) to determine ribosomal copy number of fungal organisms found in unhealthy indoor environments. Knowing specific copy numbers will allow for greater accuracy in quantification when utilizing current pQCR tec...

  1. Assessing mycoplasma contamination of cell cultures by qPCR using a set of universal primer pairs targeting a 1.5 kb fragment of 16S rRNA genes

    PubMed Central

    Jean, Audrey; Tardy, Florence; Allatif, Omran; Grosjean, Isabelle; Blanquier, Bariza

    2017-01-01

    Mycoplasmas (a generic name for Mollicutes) are a predominant bacterial contaminant of cell culture and cell derived products including viruses. This prokaryote class is characterized by very small size and lack of a cell wall. Consequently, mycoplasmas escape ultrafiltration and visualization under routine microscopic examination, hence the ease with which cells in culture can be contaminated, with routinely more than 10% of cell lines being contaminated. Mycoplasma are a formidable threat both in fundamental research by perverting a whole range of cell properties and functions and in the pharmacological use of cells and cell derived products. Although many methods have been developed, there is still a need for a sensitive, universal assay. Here is reported the development and validation of a quantitative polymerase chain reaction (qPCR) based on the amplification of a 1.5 kb fragment covering the 16S rDNA of the Mollicute class by real-time PCR using universal U1 and U8 degenerate primers. The method includes the addition of a DNA loading probe to each sample to monitor DNA extraction and the absence of PCR inhibitors in the extracted DNA, a positive mycoplasma 16S rDNA traceable reference sample to exclude any accidental contamination of an unknown sample with this reference DNA, an analysis procedure based on the examination of the melting curve and the size of the PCR amplicon, followed by quantification of the number of 16S rDNA copies (with a lower limit of 19 copies) when relevant, and, if useful, the identification of the contaminating prokaryote by sequencing. The method was validated on a collection of mycoplasma strains and by testing over 100 samples of unknown contamination status including stocks of viruses requiring biosafety level 2, 3 or 4 containments. When compared to four established methods, the m16S_qPCR technique exhibits the highest sensitivity in detecting mycoplasma contamination. PMID:28225826

  2. Phonics Primer

    ERIC Educational Resources Information Center

    Elam, Sandra

    2007-01-01

    This primer lists the 44 sounds in the English language and then gives steps for teaching those 44 sounds and their most common spelling patterns. In addition to learning sounds and spellings, each day the student must read lists of phonetically related words and spell these words from dictation. Phonics instruction must be reinforced by having…

  3. The specific isolation of complete 5S rDNA units from chromosome 1A of hexaploid, tetraploid, and diploid wheat species using PCR with head-to-head oriented primers.

    PubMed

    Van Campenhout, S; Stappen, J V; Volckaert, G

    2001-08-01

    The presence of 5S rDNA units on chromosome 1A of Triticum aestivum was shown by the development of a specific PCR test, using head-to-head oriented primers. This primer set allowed the amplification of complete 5S DNA units and was used to isolate SS-Rrna-A1 sequences from polyploid and diploid wheat species. Multiple-alignment and parsimony analyses of the 132 sequences divided the sequences into four types. The isolates from T. aestivum and the tetraploid species (T. dicoccoides, T. dicoccum, T durum, T. araraticum, and T timopheevi) were all of one type, which was shown to be closely related to the type mainly characteristic for T. urartu. The other two types were isolated exclusively from the diploid species T. monococcum, T aegilopoides, T. thaoudar, and T. sinskajae and the hexaploid species T. zhukovski. Triticum monococcum was the only species for which representatives of each of the four sequence types were found to be present. Further, we discuss the possible multicluster arrangement of the 5S-Rrna-A1 array.

  4. Design and validation of a RT-qPCR procedure for diagnosis and quantification of most types of infectious pancreatic necrosis virus using a single pair of degenerated primers.

    PubMed

    Vázquez, D; Cutrín, J M; Olveira, J G; Dopazo, C P

    2016-12-27

    Infectious pancreatic necrosis virus (IPNV) is an important virus which affects the salmonid aquaculture industry worldwide; therefore, it is important to develop rapid and reliable methods of diagnosis to detect the disease at early stages. Nowadays, RT-qPCR is replacing other methods because it provides additional information on the viral load, which is important to have a better understanding of the virus replication level and of the stage of the infection and its risk level. The main problem stems from the high diversity of this virus, which can compromise the reliability of the diagnosis. In this study, we have designed an RT-qPCR procedure for diagnosis and quantification of IPNV based on a single pair of primers targeted to segment B. The procedure has been validated, in vitro and in vivo, testing two different types of standards against seven reference strains and 23 field isolates from different types. The procedure is reliable for the detection of any type, with a detection limit of 31 TCID50  mL(-1) , 50 pfu mL(-1) or 66 RNA copies mL(-1) , depending on the standard. All the standard curves showed high reliability (R(2)  > 0.95). The results support the high reliability of this new procedure for the diagnosis and quantification of IPNV.

  5. [Detection of JAK2V617F mutation rate by real-time fluorescent quantitative PCR using allele specific primer and TaqMan-MGB probe for dual inhibiting amplification of wild type alleles].

    PubMed

    Liang, Guo-Wei; Shao, Dong-Hua; He, Mei-Ling; Cao, Qing-Yun

    2012-12-01

    This study was purposed to develop a real-time PCR assay for sensitive quantification of JAK2V617F allele burden in peripheral blood and to evaluate the clinical value of this method. Both allele-specific mutant reverse primer and wild-type TaqMan-MGB probe were used for dual-inhibiting amplification of wild-type alleles in a real-time PCR, and then the JAK2V617F mutant alleles were amplified specially. The standard curve for quantification of JAK2V617F was established by percentages of JAK2V617F alleles with threshold cycle (Ct) values in a real-time PCR. Furthermore, 89 apparent healthy donors were tested by this method. The results showed that the quantitative lower limit of this method for JAK2V617F was 0.1%, and the intra- and inter-assay average variability for quantifying percentage of JAK2V617F in total DNA was 4.1% and 6.1%, respectively. Two JAK2V617F-positive individuals were identified (the percentage of JAK2V617F alleles were 0.64% and 0.98%, respectively) using this method in blood from 89 apparently healthy donors. It is concluded that the developed method with highly sensitive and reproducible quantification of JAK2V617F mutant burden can be used clinically for diagnosis and evaluation of disease prognosis and efficacy of therapy in patients with myeloproliferative neoplasms. Moreover, this technique can be also used for quantitative detection of variety of single nucleotide mutation.

  6. Salinas primer.

    SciTech Connect

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2004-08-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis. This capability is required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. General capabilities for modal, statics and transient dynamics are provided. Salinas is similar to commercial codes like Nastran or Abaqus. It has some nonlinear capability, but excels in linear computation. It is different than the above commercial codes in that it is designed to operate efficiently in a massively parallel environment. Even for an experienced analyst, running a new finite element package can be a challenge. This little primer is intended to make part of this task easier by presenting the basic steps in a simple way. The analyst is referred to the theory manual for details of the mathematics behind the work. The User's Notes should be used for more complex inputs, and will have more details about the process (as well as many more examples). More information can be found on our web pages, 3 or 4. Finite element analysis can be deceptive. Any software can give the wrong answers if used improperly, and occasionally even when used properly. Certainly a solid background in structural mechanics is necessary to build an adequate finite element model and interpret the results. This primer should provide a quick start in answering some of the more common questions that come up in using Salinas.

  7. PrimerZ: streamlined primer design for promoters, exons and human SNPs.

    PubMed

    Tsai, Ming-Fang; Lin, Yi-Jung; Cheng, Yu-Chang; Lee, Kuo-Hsi; Huang, Cheng-Chih; Chen, Yuan-Tsong; Yao, Adam

    2007-07-01

    PrimerZ (http://genepipe.ngc.sinica.edu.tw/primerz/) is a web application dedicated primarily to primer design for genes and human SNPs. PrimerZ accepts genes by gene name or Ensembl accession code, and SNPs by dbSNP rs or AFFY_Probe IDs. The promoter and exon sequence information of all gene transcripts fetched from the Ensembl database (http://www.ensembl.org) are processed before being passed on to Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) for individual primer design. All results returned from Primer 3 are organized and integrated in a specially designed web page for easy browsing. Besides the web page presentation, csv text file export is also provided for enhanced user convenience. PrimerZ automates highly standard but tedious gene primer design to improve the success rate of PCR experiments. More than 2000 primers have been designed with PrimerZ at our institute since 2004 and the success rate is over 70%. The addition of several new features has made PrimerZ even more useful to the research community in facilitating primer design for promoters, exons and SNPs.

  8. Nucleic acid amplification using modular branched primers

    DOEpatents

    Ulanovsky, Levy; Raja, Mugasimangalam C.

    2001-01-01

    Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

  9. Primer design for large scale sequencing.

    PubMed

    Haas, S; Vingron, M; Poustka, A; Wiemann, S

    1998-06-15

    We have developed PRIDE, a primer design program that automatically designs primers in single contigs or whole sequencing projects to extend the already known sequence and to double strand single-stranded regions. The program is fully integrated into the Staden package (GAP4) and accessible with a graphical user interface. PRIDE uses a fuzzy logic-based system to calculate primer qualities. The computational performance of PRIDE is enhanced by using suffix trees to store the huge amount of data being produced. A test set of 110 sequencing primers and 11 PCR primer pairs has been designed on genomic templates, cDNAs and sequences containing repetitive elements to analyze PRIDE's success rate. The high performance of PRIDE, combined with its minimal requirement of user interaction and its fast algorithm, make this program useful for the large scale design of primers, especially in large sequencing projects.

  10. Primer design for large scale sequencing.

    PubMed Central

    Haas, S; Vingron, M; Poustka, A; Wiemann, S

    1998-01-01

    We have developed PRIDE, a primer design program that automatically designs primers in single contigs or whole sequencing projects to extend the already known sequence and to double strand single-stranded regions. The program is fully integrated into the Staden package (GAP4) and accessible with a graphical user interface. PRIDE uses a fuzzy logic-based system to calculate primer qualities. The computational performance of PRIDE is enhanced by using suffix trees to store the huge amount of data being produced. A test set of 110 sequencing primers and 11 PCR primer pairs has been designed on genomic templates, cDNAs and sequences containing repetitive elements to analyze PRIDE's success rate. The high performance of PRIDE, combined with its minimal requirement of user interaction and its fast algorithm, make this program useful for the large scale design of primers, especially in large sequencing projects. PMID:9611248

  11. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.

    1995-02-01

    The differential display of eukaryotic cDNAs using PCR allows for determination of mRNA species differentially expressed when comparing two similar cell populations. This procedure uses a (T){sub 12}XY oligonucleotide as the 3 ft primer and an arbitrary 8-10-mer as the 5 ft primer. Labeling occurs by inclusion of {alpha}[{sup 33}P]-dATP in the PCR reaction. Two artifacts caused by this approach are (1) random printing from dT present from affinity purification of PolyA+RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. In this work, we have developed an approach for both eliminating smearing and identifying nonspecific bands on sequencing gels. By separately using 5 ft-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns rather than including labeled nucleotides in the PCR reaction itself, we can detect only those products incorporating the M{sub 12}XY primer on the 3 ft ends and the arbitrary primer on 5 ft ends. Those bands that are generated randomly in the PCR reaction are readily detectable and can be ignored. If on the other hand, one is interested only in a diagnostic banding pattern for differential display, benefit can be derived from the simplicity of the pattern obtained when labeled (T){sub 12}XY is used.

  12. Generation of polymerase chain reaction-specific probes for library screening using single degenerate primers.

    PubMed

    Hommes, N G; Arp, D J; Sayavedra-Soto, L A

    1995-03-01

    Degenerate oligonucleotide primers were made to peptide sequences from hydroxylamine oxidoreductase (HAO) from Nitrosomonas europaea. The primers were used singly in PCR reactions to amplify portions of the gene for HAO from genomic DNA. Southern hybridizations using fragments amplified with each primer showed that they labeled the same genomic DNA fragments. The PCR-amplified fragments were successfully used to screen a gene library for clones containing the HAO gene. The method of isolating genes by PCR with single primers has general utility.

  13. Virtual PCR

    SciTech Connect

    Gardner, S N; Clague, D S; Vandersall, J A; Hon, G; Williams, P L

    2006-02-23

    The polymerase chain reaction (PCR) stands among the keystone technologies for analysis of biological sequence data. PCR is used to amplify DNA, to generate many copies from as little as a single template. This is essential, for example, in processing forensic DNA samples, pathogen detection in clinical or biothreat surveillance applications, and medical genotyping for diagnosis and treatment of disease. It is used in virtually every laboratory doing molecular, cellular, genetic, ecologic, forensic, or medical research. Despite its ubiquity, we lack the precise predictive capability that would enable detailed optimization of PCR reaction dynamics. In this LDRD, we proposed to develop Virtual PCR (VPCR) software, a computational method to model the kinetic, thermodynamic, and biological processes of PCR reactions. Given a successful completion, these tools will allow us to predict both the sequences and concentrations of all species that are amplified during PCR. The ability to answer the following questions will allow us both to optimize the PCR process and interpret the PCR results: What products are amplified when sequence mixtures are present, containing multiple, closely related targets and multiplexed primers, which may hybridize with sequence mismatches? What are the effects of time, temperature, and DNA concentrations on the concentrations of products? A better understanding of these issues will improve the design and interpretation of PCR reactions. The status of the VPCR project after 1.5 years of funding is consistent with the goals of the overall project which was scoped for 3 years of funding. At half way through the projected timeline of the project we have an early beta version of the VPCR code. We have begun investigating means to improve the robustness of the code, performed preliminary experiments to test the code and begun drafting manuscripts for publication. Although an experimental protocol for testing the code was developed, the preliminary

  14. Development of Specific Primer for Tricholoma matsutake

    PubMed Central

    Kim, Jang-Han

    2009-01-01

    In this study, in an effort to develop a method for the molecular detection of Tricholoma matsutake in Korea from other closely related Tricholomataceae, a species-specific PCR primer pair, TmF and TmR, was designed using nuclear ribosomal intertranscribed spacer (ITS) sequences. The DTmF and DTmR sequences were 5'-CCTGACGCCAATCTTTTCA-3' and 5'-GGAGAGCAGACTTGTGAGCA-3', respectively. The PCR primers reliably amplified only the ITS sequences of T. matsutake, and not those of other species used in this study. PMID:23983557

  15. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.

    1995-01-01

    Two artifacts introduced in using differential display technology are (1) random priming from dT present from affinity purification of PolyA+ RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. We have developed a method eliminating both problems. By separately using 5`-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns, we can detect only those products incorporating the (T){sub 12}XY primer on the 3` ends and the arbitrary primer on 5` ends. Those bands that are generated randomly in the PCR are readily detectable and can be ignored.

  16. Microsatellite primers for red drum (Sciaenops ocellatus)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...

  17. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  18. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi

    1989-01-01

    Hydrophylic polyacids, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests.

  19. Transmission Investment: A Primer

    SciTech Connect

    McGarvey, Joe

    2006-10-15

    This primer highlights recent trends in transmission investment, summarizes the division of jurisdictional authority over transmission, and presents four alternative models for transmission ownership. (author)

  20. Universal multiplexable matK primers for DNA barcoding of angiosperms1

    PubMed Central

    Heckenhauer, Jacqueline; Barfuss, Michael H. J.; Samuel, Rosabelle

    2016-01-01

    Premise of the study: PCR amplification of the matK barcoding region is often difficult when dealing with multiple angiosperm families. We developed a primer cocktail to amplify this region efficiently across angiosperm diversity. Methods and Results: We developed 14 matK primers (seven forward, seven reverse) for multiplex PCR, using sequences available in GenBank for 178 taxa belonging to 123 genera in 41 families and 18 orders. Universality of these new multiplexed primers was tested with 53 specimens from 44 representative angiosperm families in 23 different orders. Our primers showed high PCR amplification and sequencing success. Conclusions: These results show that our newly developed primers are highly effective for multiplex PCR and can be employed in future barcode projects involving taxonomically diverse samples across angiosperms. Using multiplex primers for barcoding will reduce the cost and time needed for PCR amplification. PMID:27347449

  1. A real-time PCR approach based on SPF10 primers and the INNO-LiPA HPV Genotyping Extra assay for the detection and typing of human papillomavirus.

    PubMed

    Micalessi, M I; Boulet, G A; Vorsters, A; De Wit, K; Jannes, G; Mijs, W; Ieven, M; Van Damme, P; Bogers, J J

    2013-01-01

    The SPF10 PCR targets a conserved 65bp region of the HPV L1 gene for broad-spectrum amplification. The LiPA assay allows subsequent genotyping of the HPV amplicons. This study aims to develop a SPF10 real-time PCR to achieve simultaneous amplification and detection of the HPV target. That way, LiPA analysis of the HPV-negative samples can be avoided, reducing workload and cost. The real-time PCR shows an analytical sensitivity of 29.7 copies for HPV 6, 16, 18 and 31 and an HPV-specific melting peak. Thirty-one HPV DNA plasmids were genotyped correctly using the SPF10 real-time PCR in combination with the LiPA. Here, the LiPA assay was performed at an increased hybridisation temperature (49.5°C) in combination with a reduced amplicon volume (1μl) to avoid cross-reactivity. In conclusion, the SPF10 real-time PCR proves to be very sensitive and generates amplicons, which are compatible with the LiPA.

  2. Quick spacecraft charging primer

    SciTech Connect

    Larsen, Brian Arthur

    2014-03-12

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  3. A novel technique for detecting single nucleotide polymorphisms by analyzing consumed allele-specific primers.

    PubMed

    Watanabe, G; Umetsu, K; Yuasa, I; Sato, M; Sakabe, M; Naito, E; Yamanouchi, H; Suzuki, T

    2001-02-01

    We present a simple and rapid polymerase chain reaction (PCR)-based technique, termed consumed allele-specific primer analysis (CASPA), as a new strategy for single nucleotide polymorphism (SNP) analysis. The method involves the use of labeled allele-specific primers, differing in length, with several noncomplementary nucleotides added in the 5'-terminal region. After PCR amplification, the amounts of the remaining primers not incorporated into the PCR products are determined. Thus, nucleotide substitutions are identified by measuring the consumption of primers. In this study, the CASPA method was successfully applied to ABO genotyping. In the present method, the allele-specific primer only anneals with the target polymorphic site on the DNA, so it is not necessary to analyze the PCR products. Therefore, this method is only little affected by modification of the PCR products. The CASPA method is expected to be a useful tool for typing of SNPs.

  4. Exquisite allele discrimination by toehold hairpin primers

    PubMed Central

    Byrom, Michelle; Bhadra, Sanchita; Jiang, Yu Sherry; Ellington, Andrew D.

    2014-01-01

    The ability to detect and monitor single nucleotide polymorphisms (SNPs) in biological samples is an enabling research and clinical tool. We have developed a surprising, inexpensive primer design method that provides exquisite discrimination between SNPs. The field of DNA computation is largely reliant on using so-called toeholds to initiate strand displacement reactions, leading to the execution of kinetically trapped circuits. We have now similarly found that the short toehold sequence to a target of interest can initiate both strand displacement within the hairpin and extension of the primer by a polymerase, both of which will further stabilize the primer:template complex. However, if the short toehold does not bind, neither of these events can readily occur and thus amplification should not occur. Toehold hairpin primers were used to detect drug resistance alleles in two genes, rpoB and katG, in the Mycobacterium tuberculosis genome, and ten alleles in the Escherichia coli genome. During real-time PCR, the primers discriminate between mismatched templates with Cq delays that are frequently so large that the presence or absence of mismatches is essentially a ‘yes/no’ answer. PMID:24990378

  5. Simultaneous detection of Legionella species and L. anisa, L. bozemanii, L. longbeachae and L. micdadei using conserved primers and multiple probes in a multiplex real-time PCR assay.

    PubMed

    Cross, Kristen E; Mercante, Jeffrey W; Benitez, Alvaro J; Brown, Ellen W; Diaz, Maureen H; Winchell, Jonas M

    2016-07-01

    Legionnaires' disease is a severe respiratory disease that is estimated to cause between 8,000 and 18,000 hospitalizations each year, though the exact burden is unknown due to under-utilization of diagnostic testing. Although Legionella pneumophila is the most common species detected in clinical cases (80-90%), other species have also been reported to cause disease. However, little is known about Legionnaires' disease caused by these non-pneumophila species. We designed a multiplex real-time PCR assay for detection of all Legionella spp. and simultaneous specific identification of four clinically-relevant Legionella species, L. anisa, L. bozemanii, L. longbeachae, and L. micdadei, using 5'-hydrolysis probe real-time PCR. The analytical sensitivity for detection of nucleic acid from each target species was ≤50fg per reaction. We demonstrated the utility of this assay in spiked human sputum specimens. This assay could serve as a tool for understanding the scope and impact of non-pneumophila Legionella species in human disease.

  6. China Energy Primer

    SciTech Connect

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  7. Systems Engineering Measurement Primer

    DTIC Science & Technology

    1998-03-01

    Systems Engineering Measurement Primer A Basic Introduction to Systems Engineering Measurement Concepts and Use Version 1.0 March 1998 This document...Federal Systems Garry Roedler Lockheed Martin Management & Data Systems Cathy Tilton The National Registry, Inc. E. Richard Widmann Raytheon Systems...IV 1. INTRODUCTION

  8. An SAT® Validity Primer

    ERIC Educational Resources Information Center

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  9. Primer on Social Economics.

    ERIC Educational Resources Information Center

    Darcy, Robert L.

    An elaboration of the author's booklet entitled "First Steps Toward Economic Understanding," this primer is designed to help the reader develop a functional understanding of the economic process so that he can make wiser decisions on issues of social policy and on matters affecting his economic well-being. The document is not "economics in one…

  10. Primer on Water Quality

    MedlinePlus

    ... fs-027-01.pdf--665KB A Primer on Water Quality What is in the water? Is it safe for drinking? Can fish and ... affect water quality. What do we mean by "water quality"? Water quality can be thought of as ...

  11. Real-time colorimetric detection of DNA methylation of the PAX1 gene in cervical scrapings for cervical cancer screening with thiol-labeled PCR primers and gold nanoparticles

    PubMed Central

    Huang, Jin; Liou, Yu-Ligh; Kang, Ya-Nan; Tan, Zhi-Rong; Peng, Ming-Jing; Zhou, Hong-Hao

    2016-01-01

    Background DNA methylation can induce carcinogenesis by silencing key tumor suppressor genes. Analysis of aberrant methylation of tumor suppressor genes can be used as a prognostic and predictive biomarker for cancer. In this study, we propose a colorimetric method for the detection of DNA methylation of the paired box gene 1 (PAX1) gene in cervical scrapings obtained from 42 patients who underwent cervical colposcopic biopsy. Methods A thiolated methylation-specific polymerase chain reaction (MSP) primer was used to generate MSP products labeled with the thiol group at one end. After bisulfite conversion and MSP amplification, the unmodified gold nanoparticles (AuNPs) were placed in a reaction tube and NaCl was added to induce aggregation of bare AuNPs without generating polymerase chain reaction products. After salt addition, the color of AuNPs remained red in the methylated PAX1 gene samples because of binding to the MSP-amplified products. By contrast, the color of the AuNP colloid solution changed from red to blue in the non-methylated PAX1 gene samples because of aggregation of AuNPs in the absence of the MSP-amplified products. Furthermore, PAX1 methylation was quantitatively detected in cervical scrapings of patients with varied pathological degrees of cervical cancer. Conventional quantitative MSP (qMSP) was also performed for comparison. Results The two methods showed a significant correlation of the methylation frequency of the PAX1 gene in cervical scrapings with severity of cervical cancer (n=42, P<0.05). The results of the proposed method showed that the areas under the receiver operating characteristic curve (AUCs) of PAX1 were 0.833, 0.742, and 0.739 for the detection of cervical intraepithelial neoplasms grade 2 and worse lesions (CIN2+), cervical intraepithelial neoplasms grade 3 and worse lesions (CIN3+), and squamous cell carcinoma, respectively. The sensitivity and specificity for detecting CIN2+ lesions were 0.941 and 0.600, respectively, with

  12. Greene SCPrimer: a rapid comprehensive tool for designing degenerate primers from multiple sequence alignments

    PubMed Central

    Jabado, Omar J.; Palacios, Gustavo; Kapoor, Vishal; Hui, Jeffrey; Renwick, Neil; Zhai, Junhui; Briese, Thomas; Lipkin, W. Ian

    2006-01-01

    Polymerase chain reaction (PCR) is widely applied in clinical and environmental microbiology. Primer design is key to the development of successful assays and is often performed manually by using multiple nucleic acid alignments. Few public software tools exist that allow comprehensive design of degenerate primers for large groups of related targets based on complex multiple sequence alignments. Here we present a method for designing such primers based on tree building followed by application of a set covering algorithm, and demonstrate its utility in compiling Multiplex PCR primer panels for detection and differentiation of viral pathogens. PMID:17135211

  13. Microsatellite primer resource for Populus developed from

    SciTech Connect

    Yin, Tongming; Yang, Xiaohan; Gunter, Lee E; Tuskan, Gerald A; Wullschleger, Stan D; Huang, Prof. Minren; Li, Shuxian; Zhang, Xinye

    2008-01-01

    In this study, 148 428 simple sequence repeat (SSR) primer pairs were designed from the unambiguously mapped sequence scaffolds of the Nisqually-1 genome. The physical position of the priming sites were identified along each of the 19 Populus chromosomes, and it was specified whether the priming sequences belong to intronic, intergenic, exonic or UTR regions. A subset of 150 SSR loci were amplified and a high amplification success rate (72%) was obtained in P. tremuloides, which belongs to a divergent subgenus of Populus relative to Nisqually-1. PCR reactions showed that the amplification success rate of exonic primer pairs was much higher than that of the intronic/intergenic primer pairs. Applying ANOVA and regression analyses to the flanking sequences of microsatellites, the repeat lengths, the GC contents of the repeats, the repeat motif numbers, the repeat motif length and the base composition of the repeat motif, it was determined that only the base composition of the repeat motif and the repeat motif length significantly affect the microsatellite variability in P. tremuloides samples. The SSR primer resource developed in this study provides a database for selecting highly transferable SSR markers with known physical position in the Populus genome and provides a comprehensive genetic tool to extend the genome sequence of Nisqually-1 to genetic studies in different Populus species.

  14. PCR test for detecting Taenia solium cysticercosis in pig carcasses.

    PubMed

    Sreedevi, Chennuru; Hafeez, Mohammad; Kumar, Putcha Anand; Rayulu, Vukka Chengalva; Subramanyam, Kothapalli Venkata; Sudhakar, Krovvidi

    2012-01-01

    Polymerase chain reaction (PCR) test was employed to detect Taenia solium DNA in muscle lesions for validation of the meat inspection results of slaughtered pigs. Two sets of oligonucleotide primers, one targeted against the large subunit rRNA gene (TBR primers) and the other targeted against cytochrome c oxidase subunit 1 gene (Cox1 primers) of T. solium were used in this study. On reactivity in PCR test, the TBR primers and the Cox1 primers yielded products of 286 and 984 bp, respectively, in cysticercosis positive cases. Both the sets of primers were found to be highly specific, since they did not yield any PCR product in negative controls. A total of 225 pig carcasses were screened for cysticercosis by meat inspection, out of which 25 carcasses with visible cysts (16 viable and 9 degenerated cysts) were also confirmed to be positive for cysticercosis in PCR test. However, out of the 35 carcasses with suspected lesions on meat inspection, only two were found to be positive for cysticercosis in PCR test. The detection limits for both the primer sets were analyzed. The TBR primer set could detect up to 10 pg of cysticercus DNA, whereas the Cox1 primer set could detect only up to 1 ng. It is evident from the study that PCR test is an efficient tool for validation of meat inspection results and also to rule out ambiguity in carcass judgment of suspected cases of porcine cysticercosis.

  15. Identification of bacterial plant pathogens using multilocus PCR and electrospray ionization-mass spectrometry (PCR/ESI-MS)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    PCR/electrospray ionization-mass spectrometry (PCR/ESI-MS, previously known as “TIGER”) utilizes PCR with broad range primers to amplify products from wide array of organisms within a taxonomic group, followed by analysis of PCR amplicons using mass spectrometry. Computer analysis of precise masses ...

  16. Primer on molecular genetics

    SciTech Connect

    Not Available

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  17. Coal Bed Methane Primer

    SciTech Connect

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  18. Crystalline Silica Primer

    USGS Publications Warehouse

    ,

    1992-01-01

    substance and will present a nontechnical overview of the techniques used to measure crystalline silica. Because this primer is meant to be a starting point for anyone interested in learning more about crystalline silica, a list of selected readings and other resources is included. The detailed glossary, which defines many terms that are beyond the scope of this publication, is designed to help the reader move from this presentation to a more technical one, the inevitable next step.

  19. An improved arbitrary primed PCR method for rapid characterization of transposon insertion sites.

    PubMed

    Das, Sankar; Noe, Jody C; Paik, Sehmi; Kitten, Todd

    2005-10-01

    Modifications were made to published arbitrary primed polymerase chain reaction (AP-PCR) procedures that resulted in increased specificity and sensitivity. Several arbitrary primer sequences were also evaluated, resulting in recommendations for primer design.

  20. Comparison and validation of some ITS primer pairs useful for fungal metabarcoding studies.

    PubMed

    Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V

    2014-01-01

    Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding.

  1. Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies

    PubMed Central

    Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V.

    2014-01-01

    Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding. PMID:24933453

  2. SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.

    PubMed

    Villard, Pierre; Malausa, Thibaut

    2013-07-01

    SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php.

  3. Recovery of the mitochondrial COI barcode region in diverse Hexapoda through tRNA-based primers

    PubMed Central

    2010-01-01

    Background DNA barcoding uses a 650 bp segment of the mitochondrial cytochrome c oxidase I (COI) gene as the basis for an identification system for members of the animal kingdom and some other groups of eukaryotes. PCR amplification of the barcode region is a key step in the analytical chain, but it sometimes fails because of a lack of homology between the standard primer sets and target DNA. Results Two forward PCR primers were developed following analysis of all known arthropod mitochondrial genome arrangements and sequence alignment of the tRNA-W gene which was usually located within 200 bp upstream of the COI gene. These two primers were combined with a standard reverse primer (LepR1) to produce a cocktail which generated a barcode amplicon from 125 of 141 species that included representatives of 121 different families of Hexapoda. High quality sequences were recovered from 79% of the species including groups, such as scale insects, that invariably fail to amplify with standard primers. Conclusions A cocktail of two tRNA-W forward primers coupled with a standard reverse primer amplifies COI for most hexapods, allowing characterization of the standard barcode primer binding region in COI 5' as well as the barcode segment. The current results show that primers designed to bind to highly conserved gene regions upstream of COI will aid the amplification of this gene region in species where standard primers fail and provide valuable information to design a primer for problem groups. PMID:20615258

  4. Primer on Beam Optics

    DTIC Science & Technology

    2007-11-02

    Inc. San Diego, California Table of Contents Page 1 . Introduction 1 1.1 Organization of Primer 1 1.2 Introduction to Neutral Particle Beam...Optical Systems 3 2. Fundamentals of Charged Particle Optics 10 2.1 Introduction 1 ° 2.2 Phase Space and Nonlinear Motion 10 2.3 Linear Maps 22 2.4...102 Figures Figure Pag© 1 . Generic Neutral Particle Beam Device 4 2. An orthogonal three dimensional coordinate system 11 3. Trajectory of a

  5. Laser Doppler velocimetry primer

    NASA Technical Reports Server (NTRS)

    Bachalo, William D.

    1985-01-01

    Advanced research in experimental fluid dynamics required a familiarity with sophisticated measurement techniques. In some cases, the development and application of new techniques is required for difficult measurements. Optical methods and in particular, the laser Doppler velocimeter (LDV) are now recognized as the most reliable means for performing measurements in complex turbulent flows. And such, the experimental fluid dynamicist should be familiar with the principles of operation of the method and the details associated with its application. Thus, the goals of this primer are to efficiently transmit the basic concepts of the LDV method to potential users and to provide references that describe the specific areas in greater detail.

  6. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    USGS Publications Warehouse

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  7. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    PubMed

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  8. Plastid primers for angiosperm phylogenetics and phylogeography1

    PubMed Central

    Prince, Linda M.

    2015-01-01

    Premise of the study: PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Methods: Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Results: Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Discussion: Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. “Universal” primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications. PMID:26082876

  9. PD5: A General Purpose Library for Primer Design Software

    PubMed Central

    Riley, Michael C.; Aubrey, Wayne; Young, Michael; Clare, Amanda

    2013-01-01

    Background Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. Results The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C++ with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. Conclusions The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design PMID:24278254

  10. Mega primer-mediated molecular cloning strategy for chimaeragenesis and long DNA fragment insertion.

    PubMed

    Zhang, Hui; Liu, Chang-Jun; Jiang, Hui; Zhou, Lu; Li, Wen-Ying; Zhu, Ling-Yun; Wu, Lei; Meng, Er; Zhang, Dong-Yi

    2017-04-30

    Molecular cloning methods based on primer and overlap-extension PCR are widely used due to their simplicity, reliability, low cost and high efficiency. In this article, an efficient mega primer-mediated (MP) cloning strategy for chimaeragenesis and long DNA fragment insertion is presented. MP cloning is a seamless, restriction/ligation-independent method that requires only three steps: (i) the first PCR for mega primer generation; (ii) the second PCR for exponential amplification mediated by the mega primers and (iii) DpnI digestion and transformation. Most importantly, for chimaeragenesis, genes can be assembled and constructed into the plasmid vector in a single PCR step. By employing this strategy, we successfully inserted four DNA fragments (approximately 500 bp each) into the same vector simultaneously. In conclusion, the strategy proved to be a simple and efficient tool for seamless cloning.

  11. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    2005-04-19

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  12. Limited-life cartridge primers

    DOEpatents

    Makowiecki, D.M.; Rosen, R.S.

    1998-06-30

    A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.

  13. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    1998-01-01

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  14. A primer on water

    USGS Publications Warehouse

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  15. Metabolomics: A Primer.

    PubMed

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future.

  16. Rapid diagnosis of poliovirus infection by PCR amplification.

    PubMed Central

    Chezzi, C

    1996-01-01

    A single-tube, single-primer-set reverse transcription-PCR assay was developed for the rapid detection of polioviruses in infected tissue culture fluids and clinical materials. The poliovirus-specific PCR primers are located in the VP1-2A region of the poliovirus genome. They generate a 290-bp product and can be used in duplex reactions with general enterovirus primers. The primers span the region used for genotype determination, so that genotype analysis of wild-type polioviruses can be performed by direct sequencing of the PCR products. Of 125 virus isolates typed as polioviruses by neutralization assays, 125 (100%) were also positive by PCR, and of 38 isolates typed as non-polio enteroviruses by conventional techniques, 38 (100%) were also negative by PCR. The assay described here is rapid, highly sensitive, and specific and has clinical applicability in the diagnosis of poliovirus infections. PMID:8784577

  17. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  18. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  19. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  20. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  1. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  2. Selective and universal primers for trematode barcoding in freshwater snails.

    PubMed

    Routtu, J; Grunberg, D; Izhar, R; Dagan, Y; Guttel, Y; Ucko, M; Ben-Ami, F

    2014-07-01

    Trematodes are significant pathogens of high medical, veterinary, and environmental importance. They are hard to isolate from their intermediate hosts, and their early life stages are difficult to identify morphologically. Therefore, primers were developed for trematodes to create a species barcoding system and allow selective PCR amplification in mixed samples. The specific oligonucleotide primer was universal for trematodes that infected several freshwater snail species in Israel. The diagnostic tool is based on the 18S rDNA gene. In contrast to morphological identification, trematode barcoding is rapid as it is based on a sequence of only 800 bp, and it classifies species accurately due to high polymorphism between conserved areas.

  3. Estimation of teaching-learning-based optimization primer design using regression analysis for different melting temperature calculations.

    PubMed

    Cheng, Yu-Huei

    2015-01-01

    Primers plays important role in polymerase chain reaction (PCR) experiments, thus it is necessary to select characteristic primers. Unfortunately, manual primer design manners are time-consuming and easy to get human negligence because many PCR constraints must be considered simultaneously. Automatic programs for primer design were developed urgently. In this study, the teaching-learning-based optimization (TLBO), a robust and free of algorithm-specific parameters method, is applied to screen primers conformed primer constraints. The optimal primer frequency (OPF) based on three known melting temperature formulas is estimated by 500 runs for primer design in each different number of generations. We selected optimal primers from fifty random nucleotide sequences of Homo sapiens at NCBI. The results indicate that the SantaLucia's formula is better coupled with the method to get higher optimal primer frequency and shorter CPU-time than the Wallace's formula and the Bolton and McCarthy's formula. Through the regression analysis, we also find the generations are significantly associated with the optimal primer frequency. The results are helpful for developing the novel TLBO-based computational method to design feasible primers.

  4. [Rapid PCR authentication Lonicera japanica].

    PubMed

    Jiang, Chao; Hou, Jing-Yi; Huang, Lu-Qi; Yuan, Yuan; Chen, Min; Jin, Yan

    2014-10-01

    To simply and rapid authenticate Lonicera japanica. Rapid allele-specific PCR primer was designed base on trnL-trnF 625 G/T Single nucleotide polymorphism and the PCR reaction systems including annealing temperature was optimized; optimized results were performed to authenticate L. japanica and its 9 adulterants. When 100 x SYBR Green I was added in the PCR product of 87 degrees C initial denatured 1 min; 87 degrees C denatured 5 s, 68 degrees C annealing 5 s, 30 cycle; L. japanica visualize strong green fluorescence under 365 nm UV lamp whereas adulterants without. The results indicate rapid allele-specific PCR could authenticate L. japanica and its adulterants rapidly and simply.

  5. Design of allele-specific primers and detection of the human ABO genotyping to avoid the pseudopositive problem.

    PubMed

    Yaku, Hidenobu; Yukimasa, Tetsuo; Nakano, Shu-ichi; Sugimoto, Naoki; Oka, Hiroaki

    2008-11-01

    PCR experiments using DNA primers forming mismatch pairing with template lambda DNA at the 3' end were carried out in order to develop allele-specific primers capable of detecting SNP in genomes without generating pseudopositive amplification products, and thus avoiding the so-called pseudopositive problem. Detectable amounts of PCR products were obtained when primers forming a single or two mismatch pairings at the 3' end were used. In particular, 3' terminal A/C or T/C (primer/template) mismatches tended to allow PCR amplification to proceed, resulting in pseudopositive results in many cases. While less PCR product was observed for primers forming three terminal mismatch pairings, target DNA sequences were efficiently amplified by primers forming two mismatch pairings next to the terminal G/C base pairing. These results indicate that selecting a primer having a 3' terminal nucleotide that recognizes the SNP nucleotide and the next two nucleotides that form mismatch pairings with the template sequence can be used as an allele-specific primer that eliminates the pseudopositive problem. Trials with the human ABO genes demonstrated that this primer design is also useful for detecting a single base pair difference in gene sequences with a signal-to-noise ratio of at least 45.

  6. Real-Time PCR (RT-PCR) Assays for Burkholderia mallei and B. pseudomallei

    DTIC Science & Technology

    2005-10-01

    1 Real - time PCR (RT-PCR) Assays for Burkholderia mallei and B. pseudomallei Vipin K. Rastogi1, Tu-chen Cheng1, Lisa Collins1 and Jennifer Bagley2 1...A 3. DATES COVERED - 4. TITLE AND SUBTITLE Real - time PCR (RT-PCR) Assays for Burkholderia mallei and B.pseudomallei 5a. CONTRACT NUMBER 5b...risk. There is currently no real - time PCR assay for detection of both of these pathogens. Primers and probes corresponding to specific genomic regions

  7. PCR for capsular typing of Haemophilus influenzae.

    PubMed Central

    Falla, T J; Crook, D W; Brophy, L N; Maskell, D; Kroll, J S; Moxon, E R

    1994-01-01

    A PCR method for the unequivocal assignment of Haemophilus influenzae capsular type (types a to f) was developed. PCR primers were designed from capsule type-specific DNA sequences cloned from the capsular gene cluster of each of the six capsular types. PCR product was amplified only from the capsular type for which the primers were designed. Product was confirmed by using either an internal oligonucleotide or restriction endonuclease digestion. A total of 172 H. influenzae strains of known capsular type (determined genetically) comprising all capsular types and noncapsulate strains were tested by PCR capsular typing. In all cases the PCR capsular type corresponded to the capsular genotype determined by restriction fragment length polymorphism analysis of the cap region. When used in conjunction with PCR primers derived from the capsular gene bexA, capsulate, noncapsulate, and capsule-deficient type b mutant strains could be differentiated. PCR capsular typing overcomes the problems of cross-reaction and autoagglutination associated with the serotyping of H. influenzae strains. The rapid and unequivocal capsular typing method that is described will be particularly important for typing invasive H. influenzae strains isolated from recipients of H. influenzae type b vaccine. Images PMID:7814470

  8. Highly Specific Detection of Five Exotic Quarantine Plant Viruses using RT-PCR

    PubMed Central

    Choi, Hoseong; Cho, Won Kyong; Yu, Jisuk; Lee, Jong-Seung; Kim, Kook-Hyung

    2013-01-01

    To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus) for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was 51.9°C. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea. PMID:25288934

  9. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    PubMed

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%.

  10. New primer strategy improves precision of differential display.

    PubMed

    Zhao, S; Ooi, S L; Pardee, A B

    1995-05-01

    To increase the reproducibility and to reduce the false positives in the initial mRNA differential display, modified long composite primers were developed based on both mRNA differential display and RNA arbitrarily primed PCR fingerprinting methods. Ten-base nucleotides were added at the 5' ends of the primers used in the initial mRNA differential display. These included a restriction site to aid cloning. PCR began with one low-stringency cycle (40 degrees C for annealing) followed by 35 high-stringency cycles (60 degrees C for annealing). The modified method significantly improved the reproducibility and sensitivity of the mRNA differential display while still keeping the characteristics of the original method.

  11. pcrEfficiency: a Web tool for PCR amplification efficiency prediction

    PubMed Central

    2011-01-01

    Background Relative calculation of differential gene expression in quantitative PCR reactions requires comparison between amplification experiments that include reference genes and genes under study. Ignoring the differences between their efficiencies may lead to miscalculation of gene expression even with the same starting amount of template. Although there are several tools performing PCR primer design, there is no tool available that predicts PCR efficiency for a given amplicon and primer pair. Results We have used a statistical approach based on 90 primer pair combinations amplifying templates from bacteria, yeast, plants and humans, ranging in size between 74 and 907 bp to identify the parameters that affect PCR efficiency. We developed a generalized additive model fitting the data and constructed an open source Web interface that allows the obtention of oligonucleotides optimized for PCR with predicted amplification efficiencies starting from a given sequence. Conclusions pcrEfficiency provides an easy-to-use web interface allowing the prediction of PCR efficiencies prior to web lab experiments thus easing quantitative real-time PCR set-up. A web-based service as well the source code are provided freely at http://srvgen.upct.es/efficiency.html under the GPL v2 license. PMID:22014212

  12. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  13. Variations in the sensitivity of different primers for detecting Wolbachia in Anastrepha (diptera: tephritidae)

    PubMed Central

    Marcon, Helena Sanches; Coscrato, Virgínia Elias; Selivon, Denise; Perondini, André Luiz Paranhos; Marino, Celso Luis

    2011-01-01

    Wolbachia are endosymbiont bacteria of the family Rickettsiacea that are widespread in invertebrates and occur between 20% and 60% of Neotropical insects. These bacteria are responsible for reproductive phenomena such as cytoplasmic incompatibility, male killing, feminization and parthenogenesis. Supergroups A and B of Wolbachia are common in insects and can be identified using primers for 16S rDNA, ftsZ and wsp; these primers vary in their ability to detect Wolbachia. The ftsZ primer was the first primer used to detect Wolbachia in Anastrepha fruit flies. The primers for 16S rDNA, ftsZ and wsp and the corresponding PCR conditions have been optimized to study the distribution of Wolbachia and their effect on the biology of Anastrepha in Brazil. In this work, we examined the ability of these primers to detect Wolbachia in Anastrepha populations from three regions in the State of São Paulo, southeastern Brazil. All of the samples were positive for Wolbachia supergroup A when screened with primers for 16S A rDNA and wsp A; the wsp B primer also gave a positive result, indicating cross-reactivity. The ftsZ primer showed a poor ability to detect Wolbachia in Anastrepha and generated false negatives in 44.9% of the samples. These findings indicate that reliable PCR detection of Wolbachia requires the use of primers for 16S rDNA and wsp to avoid cross-reactions and false negatives, and that the ftsZ primer needs to be redesigned to improve its selectivity. PMID:24031693

  14. Cloning of flanking sequence in transgenic plants by restriction site-anchored single-primer polymerase chain reaction.

    PubMed

    Ma, J; Wang, N N; Ren, S; Fu, Y P; Lu, S; Wang, Y P; Wang, P W

    2014-12-12

    Determining the insertion position of an exogenous gene in the target plant genome is one of the main issues in the transgenic plant field. This study introduced a simple, rapid, and accurate method to clone the flanking sequences of the transgenic bar gene as the anchoring gene in the transgenic maize genome using single-primer polymerase chain reaction (PCR). This method was based on the distribution of restriction sites in the maize genome and adopted the single-primer PCR method. Cloning the flanking sequences with the restriction site-anchored single-primer PCR simplified the experimental procedures by about 70% and reduced the experimental time by more than 80%. In conclusion, the restriction site-anchored single-primer PCR was a simple, rapid method to obtain the unknown flanking sequences in the transgenic plants.

  15. Charter School Primer. Peter Lang Primer. Volume 34

    ERIC Educational Resources Information Center

    Tryjankowski, Anne Marie

    2012-01-01

    The "Charter School Primer" presents an overview of public charter schools in the United States. The book discusses what charter schools are; the history of public charter school choice in the United States; the role of teachers, parents, boards, and unions in the charter school movement; and gives examples of innovations in education made…

  16. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    ERIC Educational Resources Information Center

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  17. Sensitivity of PCR and real-time PCR for the diagnosis of human visceral leishmaniasis using peripheral blood

    PubMed Central

    da Costa Lima, Manoel Sebastião; Zorzenon, Denielly Christina Rodrigues; Dorval, Maria Elizabeth Cavalheiros; Pontes, Elenir Rose Jardim Cury; Oshiro, Elisa Teruya; Cunha, Rodrigo; Andreotti, Renato; Matos, Maria de Fatima Cepa

    2013-01-01

    Objective To evaluate the effectiveness of PCR and real-time PCR for the diagnosis of human visceral leishmaniasis using peripheral blood samples. Methods DNA extraction was performed using Promega Wizard® Genomic kits. PCR employing RV1/RV2 primers yielded 145-bp amplicons. Real-time PCR was performed with the same primers and SYBR Green ROX Plus mix. These techniques were used to analyze 100 peripheral blood samples from patients with clinical signs of the disease. Results The sensitivity and specificity levels were 91,3%% and 29,6%, respectively, for real-time PCR and 97.78% and 61.82%, respectively, for PCR. Conclusions Real-time PCR proved to be a satisfactory method for the diagnosis of human visceral leishmaniasis.

  18. Comparison of three different primer sets for sexing birds.

    PubMed

    Çakmak, Emel; Akın Pekşen, Çiğdem; Bilgin, C Can

    2017-01-01

    Because many bird species are monomorphic or only sexually dimorphic in adult stages, it is difficult to determine their sexes, which may cause significant problems in population and conservation studies. DNA-based sexing relies on the chromodomain helicase DNA binding ( CHD) gene located on the W chromosome and its homolog on the Z chromosome, giving distinct banding patterns on agarose gel as a result of length differences in intronic regions within this gene. We used 3 specific primer sets, CHD1F/CHD1R, 2550F/2718R, and P2/P8, for sex determination of 230 samples from 77 avian species. We report here the records for 70 of those species analyzed using the CHD1F/CHD1R primer set, and 49 species using 2550F/2718R, and 46 species using P2/P8. CHD1F/CHD1R PCR products on agarose gel generally showed an apparent single band in males and 2 bands in females, but the products of 2550F/2718R (61%) and P2/P8 (42%) showed distinct banding patterns for separate bird orders. However, when PCR products of these last 2 primer pairs labeled with fluorescent dye were run in a capillary gel and detected using a DNA analyzer, P2/P8 gave 2 distinguishable peaks in females, whereas 2550F/2718R results remained the same. DNA sexing with any of those 3 primer sets can be used for all sexually monomorphic avian taxa although the primer sets should be compared before choosing the most efficient one for molecular sexing of the studied species.

  19. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.

    PubMed

    Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R

    1994-10-01

    We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.

  20. Prim-SNPing: a primer designer for cost-effective SNP genotyping.

    PubMed

    Chang, Hsueh-Wei; Chuang, Li-Yeh; Cheng, Yu-Huei; Hung, Yu-Chen; Wen, Cheng-Hao; Gu, De-Leung; Yang, Cheng-Hong

    2009-05-01

    Many kinds of primer design (PD) software tools have been developed, but most of them lack a single nucleotide polymorphism (SNP) genotyping service. Here, we introduce the web-based freeware "Prim-SNPing," which, in addition to general PD, provides three kinds of primer design functions for cost-effective SNP genotyping: natural PD, mutagenic PD, and confronting two-pair primers (CTPP) PD. The natural PD and mutagenic PD provide primers and restriction enzyme mining for polymerase chain reaction-restriction fragment of length polymorphism (PCR-RFLP), while CTPP PD provides primers for restriction enzyme-free SNP genotyping. The PCR specificity and efficiency of the designed primers are improved by BLAST searching and evaluating secondary structure (such as GC clamps, dimers, and hairpins), respectively. The length pattern of PCR-RFLP using natural PD is user-adjustable, and the restriction sites of the RFLP enzymes provided by Prim-SNPing are confirmed to be absent within the generated PCR product. In CTPP PD, the need for a separate digestion step in RFLP is eliminated, thus making it faster and cheaper. The output of Prim-SNPing includes the primer list, melting temperature (Tm) value, GC percentage, and amplicon size with enzyme digestion information. The reference SNP (refSNP, or rs) clusters from the Single Nucleotide Polymorphism database (dbSNP) at the National Center for Biotechnology Information (NCBI), and multiple other formats of human, mouse, and rat SNP sequences are acceptable input. In summary, Prim-SNPing provides interactive, user-friendly and cost-effective primer design for SNP genotyping. It is freely available at http://bio.kuas.edu.tw/prim-snping.

  1. New primers for detecting and quantifying denitrifying anaerobic methane oxidation archaea in different ecological niches.

    PubMed

    Ding, Jing; Ding, Zhao-Wei; Fu, Liang; Lu, Yong-Ze; Cheng, Shuk H; Zeng, Raymond J

    2015-11-01

    The significance of ANME-2d in methane sink in the environment has been overlooked, and there was no any study evaluating the distribution of ANME-2d in the environment. New primers were thus needed to be designed for following research. In this paper, a pair of primers (DP397F and DP569R) was designed to quantify ANME-2d. The specificity and amplification efficiency of this primer pair were acceptable. PCR amplification of another pair of primers (DP142F and DP779R) generated a single, bright targeted band from the enrichment sample, but yielded faint, multiple bands from the environmental samples. Nested PCR was conducted using the primers DP142F/DP779R in the first round and DP142F/DP569R in the second round, which generated a bright targeted band. Further phylogenetic analysis showed that these targeted bands were ANME-2d-related sequences. Real-time PCR showed that the copies of the 16s ribosomal RNA gene of ANME-2d in these samples ranged from 3.72 × 10(4) to 2.30 × 10(5) copies μg(-1) DNA, indicating that the percentage of ANME-2d was greatest in a polluted river sample and least in a rice paddy sample. These results demonstrate that the newly developed real-time PCR primers could sufficiently quantify ANME-2d and that nested PCR with an appropriate combination of the new primers could successfully detect ANME-2d in environmental samples; the latter finding suggests that ANME-2d may spread in environments.

  2. A Primer on Multilevel Modeling

    ERIC Educational Resources Information Center

    Hayes, Andrew F.

    2006-01-01

    Multilevel modeling (MLM) is growing in use throughout the social sciences. Although daunting from a mathematical perspective, MLM is relatively easy to employ once some basic concepts are understood. In this article, I present a primer on MLM, describing some of these principles and applying them to the analysis of a multilevel data set on…

  3. A Hearing Aid Primer 1

    ERIC Educational Resources Information Center

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  4. Primer vector theory and applications

    NASA Technical Reports Server (NTRS)

    Jezewski, D. J.

    1975-01-01

    A method developed to compute two-body, optimal, N-impulse trajectories was presented. The necessary conditions established define the gradient structure of the primer vector and its derivative for any set of boundary conditions and any number of impulses. Inequality constraints, a conjugate gradient iterator technique, and the use of a penalty function were also discussed.

  5. Postsecondary Data Connections: A Primer

    ERIC Educational Resources Information Center

    Data Quality Campaign, 2011

    2011-01-01

    There is an increasing focus at the state and federal levels on linking data across the P-20/Workforce spectrum to help inform policies and practices. This primer is intended to provide policymakers with: (1) An overview of the status of states vis-a-vis the linking of postsecondary data to K-12 and workforce data; (2) A subset of questions…

  6. Freshwater Wetlands: A Citizen's Primer.

    ERIC Educational Resources Information Center

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  7. Straight Talk: A Communication Primer.

    ERIC Educational Resources Information Center

    Maidment, Robert

    Using typical statements made by teachers and school administrators as examples, this self-help primer offers tips for developing conversational patterns that promote interpersonal understanding. The tips are designed to help readers learn about 40 effective conversational habits, including being specific, talking sparingly, admitting mistakes,…

  8. Alternative Teacher Compensation: A Primer

    ERIC Educational Resources Information Center

    Koppich, Julia E.; Rigby, Jessica

    2009-01-01

    This policy primer is designed to provide base-line information about new forms of teacher pay that are emerging around the country, to support the local conversations and negotiations that will lead to the development of innovative compensation systems. It identifies reasons why teacher compensation is high on local, state, and federal policy…

  9. New Primers for Discovering Fungal Diversity Using Nuclear Large Ribosomal DNA

    PubMed Central

    Gloor, Gregory B.; Lindo, Zoë

    2016-01-01

    Metabarcoding has become an important tool in the discovery of biodiversity, including fungi, which are the second most speciose group of eukaryotes, with diverse and important ecological roles in terrestrial ecosystems. We have designed and tested new PCR primers that target the D1 variable region of nuclear large subunit (LSU) ribosomal DNA; one set that targets the phylum Ascomycota and another that recovers all other fungal phyla. The primers yield amplicons compatible with the Illumina MiSeq platform, which is cost-effective and has a lower error rate than other high throughput sequencing platforms. The new primer set LSU200A-F/LSU476A-R (Ascomycota) yielded 95–98% of reads of target taxa from environmental samples, and primers LSU200-F/LSU481-R (all other fungi) yielded 72–80% of target reads. Both primer sets have fairly low rates of data loss, and together they cover a wide variety of fungal taxa. We compared our results with these primers by amplifying and sequencing a subset of samples using the previously described ITS3_KYO2/ITS4_KYO3 primers, which amplify the internal transcribed spacer 2 (ITS2) of Ascomycota and Basidiomycota. With approximately equivalent read depth, our LSU primers recovered a greater number and phylogenetic diversity of sequences than the ITS2 primers. For instance, ITS3_KYO2/ITS4_KYO3 primers failed to pick up any members of Eurotiales, Mytilinidiales, Pezizales, Saccharomycetales, or Venturiales within Ascomycota, or members of Exobasidiomycetes, Microbotryomycetes, Pucciniomycetes, or Tremellomycetes within Basidiomycota, which were retrieved in good numbers from the same samples by our LSU primers. Among the OTUs recovered using the LSU primers were 127 genera and 28 species that were not obtained using the ITS2 primers, although the ITS2 primers recovered 10 unique genera and 16 species that were not obtained using either of the LSU primers These features identify the new primer sets developed in this study as useful

  10. Detection of summer truffle (Tuber aestivum Vittad.) in ectomycorrhizae and in soil using specific primers.

    PubMed

    Gryndler, Milan; Hršelová, Hana; Soukupová, Lucie; Streiblová, Eva; Valda, Slavomír; Borovička, Jan; Gryndlerová, Hana; Gažo, Ján; Miko, Marián

    2011-05-01

    Tuber aestivum is becoming an important commodity of great economical value in some European countries. At the same time, it is a highly protected organism in other countries, where it needs careful treatment. A reliable method of detection in roots and soil is thus needed for assessment of geographic distribution, ecological studies and inoculation efficiency testing in man-made experiments. A PCR-based method of detection of T. aestivum using specific primers was therefore developed. A pair of PCR primers Tu1sekvF/Tu2sekvR selective for T. aestivum and some genotypes of Tuber mesentericum was designed on the basis of the known internal transcribed spacer T. aestivum sequences. TaiI restriction cleavage was then used to distinguish the two species. The selectivity of the designed primer pair was evaluated using DNA extracted from specimens of a further 13 Tuber spp. Subsequently, the selectivity and robustness to false-positive results with nontarget DNA of the designed primers was compared with two other primer pairs (UncI/UncII and BTAE-F/BTAEMB-R). The occurrence of T. aestivum in soil and ectomycorrhizae collected in its native habitat has been successfully detected using the designed primers and nested PCR. The method is reliable and thus suitable for detection of T. aestivum in the field.

  11. Universal Primers for Detection and Sequencing of Hepatitis B Virus Genomes across Genotypes A to G.

    PubMed

    Chook, Jack Bee; Teo, Woon Li; Ngeow, Yun Fong; Tee, Kok Keng; Ng, Kee Peng; Mohamed, Rosmawati

    2015-06-01

    Hepatitis B virus (HBV) has been divided into 10 genotypes, A to J, based on an 8% nucleotide sequence divergence between genotypes. The conventional practice of using a single set of primers to amplify a near-complete HBV genome is hampered by its low analytical sensitivity. The current practice of using overlapping conserved primer sets to amplify a complete HBV genome in a clinical sample is limited by the lack of pan-primers to detect all HBV genotypes. In this study, we designed six highly conserved, overlapping primer sets to cover the complete HBV genome. We based our design on the sequences of 5,154 HBV genomes of genotypes A to I downloaded from the GenBank nucleotide database. These primer sets were tested on 126 plasma samples from Malaysia, containing genotypes A to D and with viral loads ranging from 20 to >79,780,000 IU/ml. The overall success rates for PCR amplification and sequencing were >96% and >94%, respectively. Similarly, there was 100% amplification and sequencing success when the primer sets were tested on an HBV reference panel of genotypes A to G. Thus, we have established primer sets that gave a high analytical sensitivity for PCR-based detection of HBV and a high rate of sequencing success for HBV genomes in most of the viral genotypes, if not all, without prior known sequence data for the particular genotype/genome.

  12. Status of NC Primer Demonstration & Transition

    DTIC Science & Technology

    2014-11-20

    Primer Demos: Gloss Paint Scheme 4 Demonstration COMPLETE BUNO Induction Date Non- Chrome Primer Date Delivery Date Carrier Deployments...Includes T-6, T-34, T-44, T-45* NC Primer Demos: Gloss Paint Scheme 6 P-3C Demonstration is on-going… • PPG-Deft 02-GN-084 demonstrated over CCC on OML...Only one P-3C demonstrating NC Primer, A/C # 510  Primed Sept. 15, 2011 NC Primer Demos: Gloss Paint Scheme 7 NC Primer Demos: Gloss Paint

  13. Automation of a primer design and evaluation pipeline for subsequent sequencing of the coding regions of all human Refseq genes

    PubMed Central

    Lai, Daniel; Love, Donald R

    2012-01-01

    Screening for mutations in human disease-causing genes in a molecular diagnostic environment demands simplicity with a view to allowing high throughput approaches. In order to advance these requirements, we have developed and applied a primer design program, termed BatchPD, to achieve the PCR amplification of coding exons of all known human Refseq genes. Primer design, in silico PCR checks and formatted primer information for subsequent web-based interrogation are queried from existing online tools. BatchPD acts as an intermediate to automate queries and results processing and provides exon-specific information that is summarised in a spreadsheet format. PMID:22570517

  14. Simultaneous multiplex PCR detection of seven cucurbit-infecting viruses.

    PubMed

    Kwon, Ji Yeon; Hong, Jin Sung; Kim, Min Jea; Choi, Sun Hee; Min, Byeong Eun; Song, Eun Gyeong; Kim, Hyun Hee; Ryu, Ki Hyun

    2014-09-01

    Two multiplex polymerase chain reaction (PCR) systems using dual priming oligonucleotide (DPO) primers were developed for the simultaneous detection of seven cucurbit-infecting viruses. One system allows for the detection of papaya ringspot virus, watermelon mosaic virus, and zucchini yellow mosaic virus, whereas the other permits the detection of cucumber green mottle mosaic virus, cucumber fruit mottle mosaic virus, kyuri green mottle mosaic virus, and zucchini green mottle mosaic virus. Viral species-specific DPO primers developed in this study detected as little as 10 fg/μl of viral RNA under monoplex conditions and 10 pg/μl of viral RNA under multiplex conditions. Multiplex PCR using the DPO primer sets was capable of amplifying viral genes at annealing temperatures ranging from 53 °C to 63 °C. Whereas the use of conventional primers gave rise to non-specific bands, the DPO primers detected target viral genes in the absence of non-specific amplification. When these DPO multiplex primer sets were applied to virus-infected cucurbit samples obtained in the field, multiple infection as well as single infection was accurately identified. This novel approach could also detect multiple viruses in infected seeds. The reliability of multiplex PCR systems using DPO primers for plant virus detection is discussed.

  15. HIV lipodystrophy syndrome: a primer.

    PubMed

    Robinson, F Patrick

    2004-01-01

    Treatment with highly active antiretroviral therapy (HAART) has been implicated in the development of anthropomorphic and metabolic abnormalities termed HIV lipodystrophy syndrome (or LDS). This primer offers a comprehensive overview of LDS including epidemiology, hypothesized etiologies, and clinical consequences. The evidence-based literature is reviewed for current treatment strategies including discontinuation of specific antiretrovirals, pharmacological management of dyslipidemia and insulin resistance, exercise training, facial augmentation, liposuction, and hormonal therapy. Patient education, counseling, and adherence are discussed.

  16. MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

    PubMed Central

    Zhou, Quan

    2017-01-01

    An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

  17. Using Primers to Motivate Your Students

    ERIC Educational Resources Information Center

    Graff, Dan

    2002-01-01

    Primers are used to motivate and uplift your class. They come in many different styles and can be used in a variety of ways. Making primers relevant to students helps them to learn and makes them feel appreciated and knowledgeable when they participate. Using primers in the classroom to make students feel valued brings much success.

  18. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  19. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  20. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  1. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  2. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  3. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  4. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  5. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  6. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  7. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  8. Environmental Acceptable Medium Caliber Ammunition Percussion Primers

    DTIC Science & Technology

    2008-05-01

    percussion primers typically consist of lead styphnate and antimony sulfide. Although highly effective, these heavy material compounds were identified under...Percussion primers, including those used in medium caliber ammunition, typically contain lead styphnate and antimony sulfide along with other constituents...Furthermore, current percussion primer compositions also contain barium nitrate. Although not negatively categorized by the Environmental Protection

  9. PCR thermocycler

    DOEpatents

    Benett, William J.; Richards, James B.

    2003-01-01

    A sleeve-type silicon polymerase chain reaction (PCR) chamber or thermocycler having improved thermal performance. The silicon sleeve reaction chamber is improved in thermal performance by etched features therein that reduce thermal mass and increase the surface area of the sleeve for cooling. This improved thermal performance of the thermocycler enables an increase in speed and efficiency of the reaction chamber. The improvement is accomplished by providing grooves in the faces of the sleeve and a series of grooves on the interior surfaces that connect with grooves on the faces of the sleeve. The grooves can be anisotropically etched in the silicon sleeve simultaneously with formation of the chamber.

  10. PCR thermocycler

    DOEpatents

    Benett, William J.; Richards, James B.

    2005-05-17

    A sleeve-type silicon polymerase chain reaction (PCR) chamber or thermocycler having improved thermal performance. The silicon sleeve reaction chamber is improved in thermal performance by etched features therein that reduce thermal mass and increase the surface area of the sleeve for cooling. This improved thermal performance of the thermocycler enables an increase in speed and efficiency of the reaction chamber. The improvement is accomplished by providing grooves in the faces of the sleeve and a series of grooves on the interior surfaces that connect with grooves on the faces of the sleeve. The grooves can be anisotropically etched in the silicon sleeve simultaneously with formation of the chamber.

  11. Microsatellite primers for the rare shrub Acacia adinophylla (Fabaceae)1

    PubMed Central

    Nevill, Paul G.; Wardell-Johnson, Grant

    2016-01-01

    Premise of the study: Microsatellite primers were developed for the rare shrub Acacia adinophylla (Fabaceae) to assess genetic diversity and its spatial structuring. Methods and Results: Shotgun sequencing on an Illumina MiSeq produced 6,372,575 reads. Using the QDD pipeline, we designed 60 primer pairs, which were screened using PCR. Seventeen loci were developed, of which 12 loci were identified that were polymorphic, amplified reliably, and could be consistently scored. These loci were then screened for variation in individuals from three populations. The number of alleles observed for these 12 loci ranged from three to 18 and expected heterozygosity ranged from 0.13 to 0.85. Conclusions: These markers will enable the quantification of genetic impact of proposed mining activities on the short-range endemic Acacia adinophylla. PMID:27843728

  12. A Guide to Using STITCHER for Overlapping Assembly PCR Applications.

    PubMed

    O'Halloran, Damien M

    2017-01-01

    Overlapping PCR is commonly used in many molecular applications that include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping assembly PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online.

  13. Rapid amplification of cDNA ends (RACE) improves the PCR-based isolation of immunoglobulin variable region genes from murine and human lymphoma cells and cell lines.

    PubMed

    Doenecke, A; Winnacker, E L; Hallek, M

    1997-10-01

    The isolation of rearranged immunoglobulin (Ig) variable region (V) genes is usually performed by PCR with consensus primers binding to conserved regions within the V sequences. However, the isolation of Ig genes by this method is hampered in 15-35% by technical difficulties, mostly mismatches of oligonucleotide primers to V sequences. In order to obtain DNA sequences from V heavy chain (VH) genes which could not be amplified with consensus primers, we used a modified PCR technique, the rapid amplification of cDNA ends (RACE) PCR in combination with new heavy chain constant region primers for the isolation of human and murine VH genes. In comparison, consensus primer PCR with different sets of previously published oligonucleotide primers was used. Both methods were applied to isolate VH genes from murine B cell lymphoma (A20 and BCL1), myeloma (NS1) and hybridoma (SP6) cell lines and from freshly isolated human chronic lymphocytic leukemia and lymphoma cells. RACE PCR allowed the amplification and subsequent cloning of the complete VH gene in all cases. In contrast, consensus primer PCR failed to isolate the VH sequence of the murine A20 cell line; this was explained by a mismatch of consensus primers with VH sequences. When both PCR methods amplified VH sequences, the DNA sequences obtained were identical. Taken together, RACE PCR represents a reliable and versatile method for the isolation of VH genes from human and murine lymphoma cells, in particular if consensus primer PCR fails.

  14. Establishment of quantitative analysis method for genetically modified maize using a reference plasmid and novel primers.

    PubMed

    Moon, Gi-Seong; Shin, Weon-Sun

    2012-12-01

    For the quantitative analysis of genetically modified (GM) maize in processed foods, primer sets and probes based on the 35S promoter (p35S), nopaline synthase terminator (tNOS), p35S-hsp70 intron, and zSSIIb gene encoding starch synthase II for intrinsic control were designed. Polymerase chain reaction (PCR) products (80~101 bp) were specifically amplified and the primer sets targeting the smaller regions (80 or 81 bp) were more sensitive than those targeting the larger regions (94 or 101 bp). Particularly, the primer set 35F1-R1 for p35S targeting 81 bp of sequence was even more sensitive than that targeting 101 bp of sequence by a 3-log scale. The target DNA fragments were also specifically amplified from all GM labeled food samples except for one item we tested when 35F1-R1 primer set was applied. A reference plasmid pGMmaize (3 kb) including the smaller PCR products for p35S, tNOS, p35S-hsp70 intron, and the zSSIIb gene was constructed for real-time PCR (RT-PCR). The linearity of standard curves was confirmed by using diluents ranging from 2×10(1)~10(5) copies of pGMmaize and the R(2) values ranged from 0.999~1.000. In the RT-PCR, the detection limit using the novel primer/probe sets was 5 pg of genomic DNA from MON810 line indicating that the primer sets targeting the smaller regions (80 or 81 bp) could be used for highly sensitive detection of foreign DNA fragments from GM maize in processed foods.

  15. Simultaneous detection and differentiation of Campylobacter jejuni, C. coli, and C. lari in chickens by multiplex real-time PCR

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A multiplex real-time PCR (qPCR) assay was developed to detect and differentiate the three most commonly found and harmful species of Campylobacter in a single PCR reaction. The qPCR primers and TaqMan probes were designed to amplify the unique DNA sequences of hipO, cdtA, and pepT genes which are s...

  16. Evaluation of a New Primer In Comparison With Microscopy for the Detection of Giardia lamblia Infection in Stool Samples

    PubMed Central

    BAIRAMI, Amir; REZAEI, Sasan; REZAEIAN, Mostafa

    2016-01-01

    Background: Among the most important parasitic disease, causing diarrhea, Giardia lamblia is noteworthy. Nowadays detection methods for these parasites include parasitological methods such as microscopic examination. The sensitivity of these methods relies on the expertise and experience of examiners. In contrast, molecular methods such as PCR are less dependent on the expertise of the examiner. Here we developed a PCR for the detection of G. lamblia genome in stool samples in comparison with microscopy, which is the gold standard. Methods: For the evaluation of primers, 22 positive samples and 47 negative samples were used. QIAamp DNA Stool Mini Kit (QIAGEN, Germany) was used for DNA extraction from feces. Primers for PCR were designed using Primer-BLAST which uses Primer 3 to designing specific primers (NCBI/Primer-BLAST). Results: Sensitivity of the PCR was done with 100% (95%CI: 84.56–100) for the detection of G. lamblia DNA isolated from patients stool samples which were positive for G. lamblia cysts and/or trophozoites using microscopy as gold standard. In comparison with microscopy, PCR had showed the specificity of 97.87% (95%CI: 88.71–99.95). Conclusion: We designed new primers for the Giardia, and PCR method for the rapid and accurate identification of Giardia parasites established. With consideration to the routine diagnosis techniques in medical parasitology and their limitations such as time consuming, laborious, less sensitivity etc. This G. lamblia PCR is a sensitive and specific application for the diagnosis of G. lamblia and provides us a reliable method in the routine intestinal parasitic infection laboratory diagnosis. PMID:27095964

  17. Water based adhesive primers on aluminum substrates

    SciTech Connect

    Wightman, J.P.; Mori, S.

    1996-12-31

    The number of aluminum alloy bonding applications has been increasing recently in the automobile industry. Primer coating of aluminum substrates is one of the main processes used to promote bond performance. Solvent based organic primers have been used for a long time but environmental regulations now require the substitution of volatile organic compounds (VOC) by alternate materials such as water based adhesive primers. However, the bond strengths obtained with many water based primers are generally lower than for solvent based ones. Water based primers which have some reactive functional groups have been proposed recently but such primers require special treatment. This paper describes a study conducted to optimize bond strength using a water based adhesive as a primer in the adhesive bonding of anodized aluminum.

  18. Output testing of small-arms primers

    NASA Technical Reports Server (NTRS)

    Bement, Laurence J.; Doris, Thomas A.; Schimmel, Morry L.

    1991-01-01

    The performance of two standard primers for initiating small-caliber ammunition are compared to that of a primer for initiating aircraft escape-system components. Three testing methods are employed including: (1) firing the primer to measure total energy delivered; (2) monitoring output in terms of gaseous product-mass flow rate and pressure as a function of time; and (3) firing the primer onto ignition material to study gas pressure produced during ignition and burning as a function of time. The results of the test demonstrate differences in the ignitability factors of the standard primers and time peak pressures of less than 100 microseconds. One unexpected result is that two percussion primers (the FA-41 and the M42C1) developed for different applications have the same ignitability. The ignitability test method is shown to yield the most useful data and can be used to specify percussion primers and optimize their performance.

  19. DEVELOPMENT OF AN IMPROVED PCR-BASED TECHNIQUE FOR DETECTION OF PHYTOPHTHORA CACTORUM IN STRAWBERRY PLANTS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Specific and rapid plant pathogen detection methods can aid in strawberry disease management decisions. PCR-based diagnostics for Phytophthora cactorum and other strawberry pathogens are hindered by PCR inhibitors and lack of species-specific PCR primers. We developed a DNA extraction and purificati...

  20. Internal transcribed spacer primers and sequences for improved characterization of basidiomycetous orchid mycorrhizas.

    PubMed

    Taylor, D Lee; McCormick, Melissa K

    2008-01-01

    Despite advances owing to molecular approaches, several hurdles still obstruct the identification of fungi forming orchid mycorrhizas. The Tulasnellaceae exhibit accelerated evolution of the nuclear ribosomal operon, causing most standard primers to fail in polymerase chain reaction (PCR) trials. Insufficient sequences are available from well characterized isolates and fruitbodies. Lastly, taxon-specific PCR primers are needed in order to explore the ecology of the fungi outside of the orchid root. Here, progress in overcoming these hurdles is reported. Broad-spectrum basidiomycete internal transcribed spacer (ITS) primers that do not exclude most known Tulasnellaceae are presented. blast searches and empirical PCR tests support their wide utility within the Basidiomycota. Taxon-specific ITS primers are presented targeted to orchid-associated Tulasnella, and a core component of the Thelephora-Tomentella complex. The efficiency and selectivity of these primer sets are again supported by blast searches and empirical tests. Lastly, ITS DNA sequences are presented from several strains of Epulorhiza, Ceratorhiza, Ceratobasidium, Sistotrema, Thanatephorus and Tulasnella that were originally described in the landmark mycorrhizal studies of Currah and Warcup. Detailed phylogenetic analyses reveal some inconsistencies in species concepts in these taxonomically challenging resupinate basidiomycetes, but also help to place several sequences from environmental samples.

  1. Blocking human contaminant DNA during PCR allows amplification of rare mammal species from sedimentary ancient DNA.

    PubMed

    Boessenkool, Sanne; Epp, Laura S; Haile, James; Bellemain, Eva; Edwards, Mary; Coissac, Eric; Willerslev, Eske; Brochmann, Christian

    2012-04-01

    Analyses of degraded DNA are typically hampered by contamination, especially when employing universal primers such as commonly used in environmental DNA studies. In addition to false-positive results, the amplification of contaminant DNA may cause false-negative results because of competition, or bias, during the PCR. In this study, we test the utility of human-specific blocking primers in mammal diversity analyses of ancient permafrost samples from Siberia. Using quantitative PCR (qPCR) on human and mammoth DNA, we first optimized the design and concentration of blocking primer in the PCR. Subsequently, 454 pyrosequencing of ancient permafrost samples amplified with and without the addition of blocking primer revealed that DNA sequences from a diversity of mammalian representatives of the Beringian megafauna were retrieved only when the blocking primer was added to the PCR. Notably, we observe the first retrieval of woolly rhinoceros (Coelodonta antiquitatis) DNA from ancient permafrost cores. In contrast, reactions without blocking primer resulted in complete dominance by human DNA sequences. These results demonstrate that in ancient environmental analyses, the PCR can be biased towards the amplification of contaminant sequences to such an extent that retrieval of the endogenous DNA is severely restricted. The application of blocking primers is a promising tool to avoid this bias and can greatly enhance the quantity and the diversity of the endogenous DNA sequences that are amplified.

  2. A degenerate pair of primers for simultaneous detection of four alpha- and betanecroviruses.

    PubMed

    Varanda, C M R; Cardoso, J M S; Oliveira, M D M; Oliveira, S; Clara, M I E; Félix, M R F

    2014-11-01

    The high infection levels due to Olive latent virus 1 (OLV-1), Olive mild mosaic virus (OMMV) (alphanecrovirus) and Tobacco necrosis virus D (TNV-D) (betanecrovirus) in Portuguese olive orchards prompted us to develop a rapid PCR-based assay for the simultaneous detection of these viruses aimed at the sanitary selection and marketing of plant material in compliance with European Union regulations. A pair of degenerate oligonucleotide primers, parRdRp5' and parCoat3' was designed based on conserved regions located in the RNA-dependent RNA polymerase (RdRp) and coat protein (CP) genes of these viruses and one other alphanecrovirus, Tobacco necrosis virus A. Its use in RT-PCR assays generated a product of ca. 2000 bp for the 4 viral species tested. These primers were compared with virus specific primers in multiplex RT-PCR, and identical results were obtained. Its application to dsRNA extracted from 54 olive field growing trees originated the expected ca. 2000 bp amplicon in 17 trees. The virus identity was determined by sequencing the cloned RT-PCR products. No TNV-A was found. The RT-PCR assay using the degenerate primers described in this study were shown to be reliable in detecting any of the above-mentioned alpha- and betanecroviruses, and it is as sensitive as that which uses virus specific primers in multiplex assays. Therefore, this assay is well suited for the rapid screen of virus-free plant material in selection and improvement crop programmes. Additionally, it has the potential to reveal virus diversity and the presence of new viruses, provided the RT-PCR generated amplicon is further sequenced.

  3. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    PubMed

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed.

  4. Sample Return Primer and Handbook

    NASA Technical Reports Server (NTRS)

    Barrow, Kirk; Cheuvront, Allan; Faris, Grant; Hirst, Edward; Mainland, Nora; McGee, Michael; Szalai, Christine; Vellinga, Joseph; Wahl, Thomas; Williams, Kenneth; Lee, Gentry; Duxbury, Thomas

    2007-01-01

    This three-part Sample Return Primer and Handbook provides a road map for conducting the terminal phase of a sample return mission. The main chapters describe element-by-element analyses and trade studies, as well as required operations plans, procedures, contingencies, interfaces, and corresponding documentation. Based on the experiences of the lead Stardust engineers, the topics include systems engineering (in particular range safety compliance), mission design and navigation, spacecraft hardware and entry, descent, and landing certification, flight and recovery operations, mission assurance and system safety, test and training, and the very important interactions with external support organizations (non-NASA tracking assets, landing site support, and science curation).

  5. Exploiting extension bias in polymerase chain reaction to improve primer specificity in ensembles of nearly identical DNA templates.

    PubMed

    Wright, Erik S; Yilmaz, L Safak; Ram, Sri; Gasser, Jeremy M; Harrington, Gregory W; Noguera, Daniel R

    2014-05-01

    We describe a semi-empirical framework that combines thermodynamic models of primer hybridization with experimentally determined elongation biases introduced by 3'-end mismatches for improving polymerase chain reaction (PCR)-based sequence discrimination. The framework enables rational and automatic design of primers for optimal targeting of one or more sequences in ensembles of nearly identical DNA templates. In situations where optimal targeting is not feasible, the framework accurately predicts non-target sequences that are difficult to distinguish with PCR alone. Based on the synergistic effects of disparate sources of PCR bias, we used our framework to robustly distinguish between two alleles that differ by a single base pair. To demonstrate the applicability to environmental microbiology, we designed primers specific to all recognized archaeal and bacterial genera in the Ribosomal Database Project, and have made these primers available online. We applied these primers experimentally to obtain genus-specific amplification of 16S rRNA genes representing minor constituents of an environmental DNA sample. Our results demonstrate that inherent PCR biases can be reliably employed in an automatic fashion to maximize sequence discrimination and accurately identify potential cross-amplifications. We have made our framework accessible online as a programme for designing primers targeting one group of sequences in a set with many other sequences (http://DECIPHER.cee.wisc.edu).

  6. Detection of flaviviruses by reverse transcriptase-polymerase chain reaction with the universal primer set.

    PubMed

    Meiyu, F; Huosheng, C; Cuihua, C; Xiaodong, T; Lianhua, J; Yifei, P; Weijun, C; Huiyu, G

    1997-01-01

    Using a universal primer set designed to match the sequence of the NS1 gene of flaviviruses, the virus RNA of dengue (DEN), Japanese encephalitis (JEV), powassan and langat of Flaviviridae were successfully amplified by polymerase chain reaction (PCR) via cDNA; and with different internal primers, the serotypes of the dengue viruses were identified. Of the 78 clinically diagnosed dengue fever patients, 18 patients were positive for DEN 1, 48 patients for DEN 2 and 8 patients concurrently infected with DEN 4. Of the 52 patients admitted with Japanese encephalitis (JE), 45 were determined to be JEV infections. By nested PCR, we completed the identification of flaviviruses within 2 days. The results show that seven primers have a potential value for rapid clinical diagnosis of flavivirus infections.

  7. Abridged adapter primers increase the target scope of Hi-Plex.

    PubMed

    Nguyen-Dumont, Tú; Hammet, Fleur; Mahmoodi, Maryam; Pope, Bernard J; Giles, Graham G; Hopper, John L; Southey, Melissa C; Park, Daniel J

    2015-01-01

    Previously, we reported Hi-Plex, an amplicon-based method for targeted massively parallel sequencing capable of generating 60 amplicons simultaneously. In further experiments, however, we found our approach did not scale to higher amplicon numbers. Here, we report a modification to the original Hi-Plex protocol that includes the use of abridged adapter oligonucleotides as universal primers (bridge primers) in the initial PCR mixture. Full-length adapter primers (indexing primers) are included only during latter stages of thermal cycling with concomitant application of elevated annealing temperatures. Using this approach, we demonstrate the application of Hi-Plex across a broad range of amplicon numbers (16-plex, 62-plex, 250-plex, and 1003-plex) while preserving the low amount (25 ng) of input DNA required.

  8. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    PubMed Central

    Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  9. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

    PubMed

    Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

  10. A new approach to primer selection in polymerase chain reaction experiments

    SciTech Connect

    Pearson, W.R.; Robins, G.; Wrege, D.E.; Zhang, Tongtong

    1995-12-31

    We address the problem of primer selection in polymerase chain reaction (PCR) experiments. We prove that the problem of minimizing the number of primers required to amplify a set of DNA sequences is NP-complete, and show that even approximating solutions to this problem to within a constant factor times optimal is intractable. On the practical side, we give a simple branch-and-bound algorithm that solves the primers minimization problem within reasonable time for typical instances. We present an efficient approximation scheme for this problem, and prove that our heuristic always produces solutions no worse than a logarithmic factor times the optimal, this being the best approximation possible within polynomial time. Finally, we analyze a weighted variant, where both the number of primers as well as the sum of their {open_quotes}costs{close_quotes} is optimized simultaneously. We conclude by presenting the empirical performance of our methods on biological data.

  11. A specific oligonucleotide primer for the rapid detection of Lactobacillus lindneri by polymerase chain reaction.

    PubMed

    Yasui, T; Okamoto, T; Taguchi, H

    1997-02-01

    A polymerase chain reaction (PCR) method was developed for the rapid detection of the beer-spoilage heterofermentative lactic acid bacterium Lactobacillus lindneri. Three strains, the Chinese brewery isolate DA1, the Japanese commercial beer isolate BG2, and the Japanese brewery isolate SE3, which were serologically classified as belonging to L. lindneri, were used in this study. After sequencing the 16S rDNA of the isolates DA1 and BG2 and the typical beer-spoilage heterofermentative Lactobacillus brevis L63, these sequences were compared with published data. A L. lindneri specific PCR primer, DA-40, was then constructed based on the V1 variable region of 16S rDNA. The specificity of PCR using the L. lindneri specific primer DA-40 and the universal primer 907r was examined using five L. lidneri strains: the three isolates described above and two strains from culture collection, DSM 20690 and DSM 20692. A variety of beer-spoilage lactic acid bacteria, including 71 Lactobacillus strains and 13 Pediococcus strains, were also included in this examination. No PCR product was obtained from any DNA with the exception of the five L. lindneri strains, indicating that the L. lindneri specific primer DA-40 was highly specific. The detection limit for L. lindneri in beer was 63 CFU/100 mL of beer.

  12. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    PubMed Central

    Aremu, Bukola Rhoda; Babalola, Olubukola Oluranti

    2015-01-01

    Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI). These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi) and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation. PMID:26437427

  13. PCR (Polymerase Chain Reaction) Testing for Leishmaniasis

    DTIC Science & Technology

    1993-10-20

    reactions. Prior to temperature cycling, this moderately heat stable enzyme selectively excises uracil residues which have been incorporated into DNA... temperature . Despite these precautions, some non-specific annealing of PCR primers does occur, even with single copy gene detection, and more so with...Mallinckrodt) in slightly hypotonic saline and allowed to remain at ambient temperature for 5 minutes, during which time RBC’s are lysed. Centrifugation

  14. Use of PCR-Based Methods for Rapid Differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis

    PubMed Central

    Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco

    1999-01-01

    Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059

  15. Novel PCR assay for determining the genetic sex of mice.

    PubMed

    McFarlane, L; Truong, V; Palmer, J S; Wilhelm, D

    2013-01-01

    A number of studies require the determination of the genetic sex of mouse embryos before sexual differentiation and/or of mutant mice that display partial or complete sex reversal. The majority of current methods for sexing by PCR involve multiplexing of 2 primer pairs. We have developed a novel sexing PCR using a single primer pair that amplifies fragments from the X and the Y chromosome with a clear size difference between the respective amplicons. This assay provides a rapid and reliable method to identify the genetic sex of mice across different mouse strains.

  16. Sheep poxvirus identification by PCR in cell cultures.

    PubMed

    Mangana-Vougiouka, O; Markoulatos, P; Koptopoulos, G; Nomikou, K; Bakandritsos, N; Papadopoulos, O

    1999-01-01

    A simple, rapid and specific diagnostic polymerase chain reaction (PCR) method was developed for sheep poxvirus identification. The primers used were from the sequenced genomes of the capripox viruses KS-1 and InS-1. Six different sheep pox isolates were tested against two orf (parapox) and three animal herpesviruses as controls. Material from uninfected cell cultures was also used as control. The sensitivity of the PCR was approximately equivalent with each of the two primers and for the six sheep pox isolates. All the negative control virus DNAs were negative and differed clearly from those of the sheep pox strains.

  17. Real-time RT-PCR assay for detection and differentiation of Citrus tristeza virus isolates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    For universal detection of Citrus tristeza virus (CTV) strains by real time RT-PCR, a protocol was developed based on a set of primers and a Cy5-labeled TaqMan probe. This test included primers and a TET-labeled TaqMan probe selected on the mitochondrial nad5 gene for the simultaneous detection of ...

  18. Linear-After-The-Exponential (LATE)–PCR: An advanced method of asymmetric PCR and its uses in quantitative real-time analysis

    PubMed Central

    Sanchez, J. Aquiles; Pierce, Kenneth E.; Rice, John E.; Wangh, Lawrence J.

    2004-01-01

    Conventional asymmetric PCR is inefficient and difficult to optimize because limiting the concentration of one primer lowers its melting temperature below the reaction annealing temperature. Linear-After-The-Exponential (LATE)–PCR describes a new paradigm for primer design that renders assays as efficient as symmetric PCR assays, regardless of primer ratio. LATE-PCR generates single-stranded products with predictable kinetics for many cycles beyond the exponential phase. LATE-PCR also introduces new probe design criteria that uncouple hybridization probe detection from primer annealing and extension, increase probe reliability, improve allele discrimination, and increase signal strength by 80–250% relative to symmetric PCR. These improvements in PCR are particularly useful for real-time quantitative analysis of target numbers in small samples. LATE-PCR is adaptable to high throughput applications in fields such as clinical diagnostics, biodefense, forensics, and DNA sequencing. We showcase LATE-PCR via amplification of the cystic fibrosis CFΔ508 allele and the Tay-Sachs disease TSD 1278 allele from single heterozygous cells. PMID:14769930

  19. Design and validation of four new primers for next-generation sequencing to target the 18S rRNA genes of gastrointestinal ciliate protozoa.

    PubMed

    Ishaq, Suzanne L; Wright, André-Denis G

    2014-09-01

    Four new primers and one published primer were used to PCR amplify hypervariable regions within the protozoal 18S rRNA gene to determine which primer pair provided the best identification and statistical analysis. PCR amplicons of 394 to 498 bases were generated from three primer sets, sequenced using Roche 454 pyrosequencing with Titanium, and analyzed using the BLAST database (NCBI) and MOTHUR version 1.29. The protozoal diversity of rumen contents from moose in Alaska was assessed. In the present study, primer set 1, P-SSU-316F and GIC758R (amplicon of 482 bases), gave the best representation of diversity using BLAST classification, and the set amplified Entodinium simplex and Ostracodinium spp., which were not amplified by the other two primer sets. Primer set 2, GIC1080F and GIC1578R (amplicon of 498 bases), had similar BLAST results and a slightly higher percentage of sequences that were identified with a higher sequence identity. Primer sets 1 and 2 are recommended for use in ruminants. However, primer set 1 may be inadequate to determine protozoal diversity in nonruminants. The amplicons created by primer set 1 were indistinguishable for certain species within the genera Bandia, Blepharocorys, Polycosta, and Tetratoxum and between Hemiprorodon gymnoprosthium and Prorodonopsis coli, none of which are normally found in the rumen.

  20. Design and Validation of Four New Primers for Next-Generation Sequencing To Target the 18S rRNA Genes of Gastrointestinal Ciliate Protozoa

    PubMed Central

    Wright, André-Denis G.

    2014-01-01

    Four new primers and one published primer were used to PCR amplify hypervariable regions within the protozoal 18S rRNA gene to determine which primer pair provided the best identification and statistical analysis. PCR amplicons of 394 to 498 bases were generated from three primer sets, sequenced using Roche 454 pyrosequencing with Titanium, and analyzed using the BLAST database (NCBI) and MOTHUR version 1.29. The protozoal diversity of rumen contents from moose in Alaska was assessed. In the present study, primer set 1, P-SSU-316F and GIC758R (amplicon of 482 bases), gave the best representation of diversity using BLAST classification, and the set amplified Entodinium simplex and Ostracodinium spp., which were not amplified by the other two primer sets. Primer set 2, GIC1080F and GIC1578R (amplicon of 498 bases), had similar BLAST results and a slightly higher percentage of sequences that were identified with a higher sequence identity. Primer sets 1 and 2 are recommended for use in ruminants. However, primer set 1 may be inadequate to determine protozoal diversity in nonruminants. The amplicons created by primer set 1 were indistinguishable for certain species within the genera Bandia, Blepharocorys, Polycosta, and Tetratoxum and between Hemiprorodon gymnoprosthium and Prorodonopsis coli, none of which are normally found in the rumen. PMID:24973070

  1. Taxon-specific oligonucleotide primers for detection of two ancient endomycorrhizal fungi, Glomus occultum and Glomus brasilianum.

    PubMed

    Millner, P D; Mulbry, W W; Reynolds, S L

    2001-03-15

    A unique oligonucleotide pair, GOCC56:GOCC427, was designed that correctly primed specific amplification of a approximately 370-bp sequence spanning the ITS and 5.8S rDNA regions of Glomus occultum and Glomus brasilianum. In addition, this primer pair successfully detected G. occultum and G. brasilianum DNA in nested PCR using a primary PCR product amplified from highly diluted extracts of colonized corn (Zea mays) roots using modified ITS1:ITS4 primers. A second primer pair, GBRAS86:GBRAS388, primed specific amplification of a approximately 200-bp sequence spanning the ITS and 5.8S rDNA regions present only in G. brasilianum and Glomus strain GR582. Combined use of both primer pairs provides the means to detect and differentiate two ancient endomycorrhizal species, G. occultum and G. brasilianum, undetectable by standard root staining procedures. Sequence analysis showed that the purported G. occultum strain GR582 is likely a strain of G. brasilianum.

  2. A Primer on Observational Measurement.

    PubMed

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  3. A Practical Primer on Geostatistics

    USGS Publications Warehouse

    Olea, Ricardo A.

    2009-01-01

    significant methodological implications. HISTORICAL REMARKS As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields. PIONEERS Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorology CALCULATIONS Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations. SOFTWARE For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics. ORGANIZATION OF THE PRIMER The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of th

  4. Linear elastic fracture mechanics primer

    NASA Technical Reports Server (NTRS)

    Wilson, Christopher D.

    1992-01-01

    This primer is intended to remove the blackbox perception of fracture mechanics computer software by structural engineers. The fundamental concepts of linear elastic fracture mechanics are presented with emphasis on the practical application of fracture mechanics to real problems. Numerous rules of thumb are provided. Recommended texts for additional reading, and a discussion of the significance of fracture mechanics in structural design are given. Griffith's criterion for crack extension, Irwin's elastic stress field near the crack tip, and the influence of small-scale plasticity are discussed. Common stress intensities factor solutions and methods for determining them are included. Fracture toughness and subcritical crack growth are discussed. The application of fracture mechanics to damage tolerance and fracture control is discussed. Several example problems and a practice set of problems are given.

  5. Primer: Shotgun Proteomics in Neuroscience

    PubMed Central

    Liao, Lujian; McClatchy, Daniel B.; Yates, John R.

    2009-01-01

    Mass spectrometry-based proteomics is increasingly used to address basic and clinical questions in biomedical research through studies of differential protein expression, protein-protein interactions, and post-translational modifications. The complex structural and functional organization of the human brain warrants the application of high-throughput, systematic approaches to understand the functional alterations under normal physiological conditions and the perturbations of neurological diseases. This primer focuses on shotgun proteomics based tandem mass spectrometry for the identification of proteins in a complex mixture. It describes the basic concepts of protein differential expression analysis and post-translational modification analysis and discusses several strategies to improve the coverage of the proteome. PMID:19607789

  6. Computational tradeoffs in multiplex PCR assay design for SNP genotyping

    PubMed Central

    Rachlin, John; Ding, Chunming; Cantor, Charles; Kasif, Simon

    2005-01-01

    Background Multiplex PCR is a key technology for detecting infectious microorganisms, whole-genome sequencing, forensic analysis, and for enabling flexible yet low-cost genotyping. However, the design of a multiplex PCR assays requires the consideration of multiple competing objectives and physical constraints, and extensive computational analysis must be performed in order to identify the possible formation of primer-dimers that can negatively impact product yield. Results This paper examines the computational design limits of multiplex PCR in the context of SNP genotyping and examines tradeoffs associated with several key design factors including multiplexing level (the number of primer pairs per tube), coverage (the % of SNP whose associated primers are actually assigned to one of several available tube), and tube-size uniformity. We also examine how design performance depends on the total number of available SNPs from which to choose, and primer stringency criterial. We show that finding high-multiplexing/high-coverage designs is subject to a computational phase transition, becoming dramatically more difficult when the probability of primer pair interaction exceeds a critical threshold. The precise location of this critical transition point depends on the number of available SNPs and the level of multiplexing required. We also demonstrate how coverage performance is impacted by the number of available snps, primer selection criteria, and target multiplexing levels. Conclusion The presence of a phase transition suggests limits to scaling Multiplex PCR performance for high-throughput genomics applications. Achieving broad SNP coverage rapidly transitions from being very easy to very hard as the target multiplexing level (# of primer pairs per tube) increases. The onset of a phase transition can be "delayed" by having a larger pool of SNPs, or loosening primer selection constraints so as to increase the number of candidate primer pairs per SNP, though the latter

  7. Comparison of the immunofluorescence assay with RT-PCR and nested PCR in the diagnosis of canine distemper.

    PubMed

    Jóźwik, A; Frymus, T

    2005-05-01

    Two pairs of primers were prepared, both localized within the sequences of the nucleoprotein gene (NP) of canine distemper virus (CDV). A number of experiments were done to optimize the conditions of RT-PCR and nested PCR methods. The nucleic acids of the Onderstepoort, Rockborn, Snyder Hill and Lederle strains of CDV could be detected with these primers. However, they did not react with the sequences of the Edmonston strain of the measles virus. The detection limit for RT-PCR was 10 TCID50 and for nested PCR 0.1 TCID50 of CDV. The RT-PCR was able to demonstrate the nucleic acid of CDV in the blood of all seven puppies vaccinated with a modified live virus. Blood samples of 23 dogs clinically suspected of distemper were examined by RT-PCR combined with nested PCR, and the results were compared with the detection of the CDV antigen in the smears from the mucous membranes by the direct immunofluorescence (IF) test. Of the 23 dogs, 12 were positive in nested PCR, six in the IF assay, and only two in single RT-PCR. It is concluded that nested PCR seems to be the most sensitive method for ante-mortem diagnosis of canine distemper, especially in its subacute or chronic forms.

  8. Rapid detection of Vibrio cholerae O139 Bengal from stool specimens by PCR.

    PubMed Central

    Albert, M J; Islam, D; Nahar, S; Qadri, F; Falklind, S; Weintraub, A

    1997-01-01

    In a previous study using pure bacterial cultures in a PCR assay, a primer pair corresponding to a unique chromosomal region of Vibrio cholerae O139 Bengal generated an amplicon from only V. cholerae O139 Bengal. PCR with the same primer pair was used to screen 180 diarrheal stool specimens. All the 67 V. cholerae O139 culture-positive stool specimens were positive by PCR, and the remaining specimens, which contained either other recognized enteric pathogens or no pathogens, were all negative by PCR. PMID:9163504

  9. Detection of the glmM Gene in Helicobacter pylori Isolates with a Novel Primer by PCR▿

    PubMed Central

    Córdova Espinoza, Maria Guadalupe; González Vazquez, Rosa; Morales Mendez, Iyari; Ruelas Vargas, Consuelo; Giono Cerezo, Silvia

    2011-01-01

    A novel reverse primer (GLM MR1) was designed for detection of the glmM gene in Helicobacter pylori by PCR. The percentage of amplification in clinical isolates using GLM MR1 was 100% for detection of the glmM gene and 86.36% for the ureA gene. The primer designed is useful for the identification of H. pylori. PMID:21289140

  10. The novel primers for sex identification in the brown eared-pheasant and their application to other species.

    PubMed

    Wang, N; Zhang, Z-W

    2009-01-01

    We designed a pair of primers for sex identification in the brown eared-pheasant (Crossoptilon mantchuricum) based on the mechanism of PCR amplification of CHD fragments, and identified the number of products. The new primers were considered to have more sensitivity than P2/P8, and cross-species application indicated that they can also be used for sex identification in other species of Phasianidae and Passeriformes.

  11. Variation in extragenic repetitive DNA sequences in Pseudomonas syringae and potential use of modified REP primers in the identification of closely related isolates

    PubMed Central

    Çepni, Elif; Gürel, Filiz

    2012-01-01

    In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP)-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP- and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC) sequences failed to produce clear banding patterns in this study. PMID:23055805

  12. Genus-Specific Primers for Study of Fusarium Communities in Field Samples.

    PubMed

    Karlsson, Ida; Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-10-30

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology.

  13. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    PubMed Central

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  14. Amplification of soil fungal community DNA using the ITS86F and ITS4 primers.

    PubMed

    Vancov, Tony; Keen, Brad

    2009-07-01

    Internal transcribed spacer (ITS) 86F and ITS4 and the ITS1-F and ITS86R primer pairs were tested to specifically amplify fungal community DNA extracted from soil. Libraries were constructed from PCR-amplified fragments, sequenced and compared against sequences deposited in GenBank. The results confirmed that the ITS86F and ITS4 primer pair was selectively specific for the Ascomycetes, Basidiomycetes and Zygomycetes fungal clades. Amplified products generated by the ITS1F and ITS86R primer pair also aligned with sequences from a range of species within the Ascomycete and Basidiomycete clades but not from the Zygomycete. Both primer sets demonstrated fungal specificity and appear to be well suited for rapid PCR-based (fingerprinting) analysis of environmental fungal community DNA. This is the first reported use and assessment of the ITS86F and ITS4 and the ITS1-F and ITS86R primer pairs in amplifying fungal community DNA from soil.

  15. Application of real time PCR for diagnosis of Swine Dysentery.

    PubMed

    Akase, Satoru; Uchitani, Yumi; Sohmura, Yoshiko; Tatsuta, Keikichi; Sadamasu, Kenji; Adachi, Yoshikazu

    2009-03-01

    Evaluation of a genetic diagnostic technique using real time PCR of Swine Dysentery (SD) was performed using nox primers. Culture, ordinary PCR and real time PCR were compared in this experiment. Sixty-seven specimens from pigs with clinical signs of SD brought to a slaughterhouse in Shibaura, Tokyo, were used. B. hyodysenteriae was isolated from 49 of the pigs, was detected by ordinary PCR in 49 of the pigs and was detected by real time PCR in 54 of the pigs. Furthermore, we were able to determine the numbers of B. hyodysenteriae cells in all positive specimens by real time PCR. The rapid diagnostic technique established in this experiment was useful for detection of B. hyodysenteriae because it was more effective than ordinary PCR and culture.

  16. Identification of Alocasia odora (Kuwazuimo in Japanese) Using PCR Method.

    PubMed

    Hagino, Kayo; Nakano, Hisako; Shimizu, Motomu; Terai, Akiko; Ogai, Mami; Aragane, Masako; Abe, Tomohiro; Sasamoto, Takeo

    2017-01-01

    Kuwazuimo (Alocasia odora) and shimakuwazuimo (Alocasia cucullata) are evergreen perennial plants that originated in East Asia. Although inedible, they are occasionally eaten by mistake because they resemble satoimo (Colocasia esculenta), and this has caused food poisoning in Japan. It is not easy to determine the cause of a food poisoning outbreak from the shape or chemical composition when the available sample is small. Therefore, we developed a new primer pair for PCR to identify kuwazuimo and shimakuwazuimo in small samples, based on the internal transcribed spacer (ITS) region of ribosomal DNA. Using PCR with the developed primer pair, we detected all samples of kuwazuimo obtained from the market, while excluding 17 other kinds of crops. The samples were identified as shimakuwazuimo by DNA sequencing of the PCR products. The present PCR method showed high specificity and was confirmed to be applicable to the identification of kuwazuimo and shimakuwazuimo from various crops.

  17. A Primer on Sampling for Statewide Assessment.

    ERIC Educational Resources Information Center

    Jaeger, Richard M.

    This paper is a primer on sampling procedures for statewide assessment. The careful reader should gain substantial knowledge about the promises and pitfalls of sampling for assessment. The primer has three basic objectives: (1) to define terms and concepts basic to sampling theory and its application, including population, sampling unit, sampling…

  18. Primer on Special Education in Charter Schools

    ERIC Educational Resources Information Center

    Luna, Tom

    2007-01-01

    This section of the Idaho Primer on Special Education in Charter Schools is divided into two parts: (1) a discussion of the legal status of charter schools and their linkage to other local education agencies (LEAs), and (2) a synopsis of federal laws that are most relevant to special education in charter schools. The Primer on Special Education in…

  19. Comparative Evaluation of Four Bacteria-Specific Primer Pairs for 16S rRNA Gene Surveys

    PubMed Central

    Thijs, Sofie; Op De Beeck, Michiel; Beckers, Bram; Truyens, Sascha; Stevens, Vincent; Van Hamme, Jonathan D.; Weyens, Nele; Vangronsveld, Jaco

    2017-01-01

    Bacterial taxonomic community analyses using PCR-amplification of the 16S rRNA gene and high-throughput sequencing has become a cornerstone in microbiology research. To reliably detect the members, or operational taxonomic units (OTUs), that make up bacterial communities, taxonomic surveys rely on the use of the most informative PCR primers to amplify the broad range of phylotypes present in up-to-date reference databases. However, primers specific for the domain Bacteria were often developed some time ago against database versions that are now out of date. Here we evaluated the performance of four bacterial primers for characterizing complex microbial communities in explosives contaminated and non-contaminated forest soil and by in silico evaluation against the current SILVA123 database. Primer pair 341f/785r produced the highest number of bacterial OTUs, phylogenetic richness, Shannon diversity, low non-specificity and most reproducible results, followed by 967f/1391r and 799f/1193r. Primer pair 68f/518r showed overall low coverage and a bias toward Alphaproteobacteria. In silico, primer pair 341f/785r showed the highest coverage of the domain Bacteria (96.1%) with no obvious bias toward the majority of bacterial species. This suggests the high utility of primer pair 341f/785r for soil and plant-associated bacterial microbiome studies.

  20. Multiplex PCR for Detection and Typing of Porcine Circoviruses

    PubMed Central

    Ouardani, M.; Wilson, L.; Jetté, R.; Montpetit, C.; Dea, S.

    1999-01-01

    Sets of oligonucleotide primers were designed according to the sequences of the open reading frames (ORFs) ORF1 and ORF2 of the prototype nonpathogenic PK-15 strain of porcine circovirus (PCV) type 1 (PCV-1). By the PCR performed with the various primer sets, genomic DNA or RNA from other bacterial or viral pathogens of the respiratory tracts of pigs could not be amplified. A positive amplification reaction could be visualized with DNA extracted from a viral suspension containing as few as 10 viral particles per ml. No DNA fragment could be amplified from lysates of continuous porcine cell lines (PT, ST, and PFT cells) known to be negative for PCV. When tested with clinical samples from pigs, the results of the single PCR method showed nearly 93% (13 of 14 samples) correlation with histopathological and immunohistochemical findings. Interestingly, subclinical PCV infections could be detected by single PCR with clinical samples that have been submitted from animals with irrelevant cases of respiratory and/or enteric problems. On the basis of the nucleotide sequences of PCV strains (PCV-2) recently associated with outbreaks of postweaning multisystemic wasting syndrome (PWMS) in Quebec, Canada, pig farms, other primers were designed from the PCV-1 genome, and these primers failed to amplify genomic fragments specific to the ORF1 or ORF2 genes of clinical isolates associated with PWMS but amplified DNA from the PCV-1 strain. Two rapid multiplex PCR (mPCR) methods have been developed to distinguish between both genotypes of PCV. By those two mPCR methods, (i) species-specific primer pairs were used to amplify a DNA fragment of 488 bp specific for the ORF2 genes of both genotypes, whereas a 375-bp fragment was amplified from the ORF1 gene of the PCV-1 strain only, or (ii) species-specific primer pairs were used to amplify a DNA fragment of 646 bp specific for the ORF1 genes of both genotypes, whereas a 425-bp fragment was amplified from the ORF2 gene of the PCV-1 strain

  1. Miniaturized technology for DNA typing: cassette PCR.

    PubMed

    Manage, Dammika P; Pilarski, Linda M

    2015-01-01

    With the smaller size, low cost, and rapid testing capabilities, miniaturized lab-on-a-chip devices can change the way medical diagnostics are currently performed in the health-care system. We have demonstrated such a device that is self-contained, simple, disposable, and inexpensive. It is capable of performing DNA amplification on an inexpensive instrument suitable for near point of care settings. This technology will enable on the spot evaluation of patients in the clinic for faster medical decision-making and more informed therapeutic choices. Our device, a gel capillary cassette, termed cassette PCR, contains capillary reaction units each holding a defined primer set, with arrays of capillary reaction units for simultaneously detecting multiple targets. With the exception of the sample to be tested, each capillary reaction unit holds all the reagents needed for PCR in a desiccated form that can be stored at room temperature for up to 3 months and even longer in colder conditions. It relies on capillary forces for sample delivery of microliter volumes through capillaries, hence avoiding the need for pumps or valves. In the assembled cassette, the wax architecture supporting the capillaries melts during the PCR and acts as a vapor barrier as well as segregating capillaries with different primer sets. No other chip sealing techniques are required. Cassette PCR accepts raw samples such as urine, genital swabs, and blood. The cassette is made with off-the-shelf components and contains integrated positive and negative controls.

  2. SBE primer : multiplexing minisequencing-based genotyping

    SciTech Connect

    Kaderali, L.; Deshpande, A.; Uribe-Romeo, F. J.; Schliep, A.; Torney, D. C.

    2002-01-01

    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Most of the known genetic diseases are caused by point mutations, and a growing number of SNPs will be routinely analyzed to diagnose genetic disorders. Mutation analysis by polymerase mediated single-base primer extension (minisequencing) can be massively parallelized using for example DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5-inch end of the minisequencing primer and attaching the complementary anti-tag to the array or bead surface, the assay can be 'demultiplexed'. However, such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. Primers can be chosen from either the plus or the minus strand, and primers used in the same experiment must not bind to one another. To genotype a given number of polymorphic sites, the question is which primer to use for each SNP, and which primers to group into the same experiment. Furthermore, a crosshybridization-free tag/anti-tag code is required in order to sort the extended primers to the corresponding microspheres or chip spots. These problems pose challenging algorithmic questions. We present a computer program lo automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/anti-tag system is generated, and the pairing of primers and DNA-Tags is automatically done in a way to avoid any crossreactivity. We report first results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping.

  3. Primer and platform effects on 16S rRNA tag sequencing

    DOE PAGES

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  4. Primer and platform effects on 16S rRNA tag sequencing

    SciTech Connect

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as well as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.

  5. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    PubMed

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  6. cry1 genes from Bacillus thuringiensis: specificity determination and implications for primer design.

    PubMed

    Davolos, Camila C; Guidelli-Thuler, Ana M; de Abreu, Irlan L; Sena, Janete A D; Lemos, Manoel V F

    2009-12-01

    Some pest management programs employ PCR to identify cry1 genes from Bacillus thuringiensis to predict bacterial toxicity towards different insect pests. However, due to changes on the mode of action of the Cry proteins, new primers had to be designed to detect the new genes. Therefore, an 'in-silico' study of genetic sequences from five cry1 subclasses was carried out and characterized by molecular tools. The design of new primers allows for more precise selection of B. thuringiensis isolates, helping to better direct the programs employing biological control.

  7. Species-specific PCR for the identification of goat cashmere and sheep wool.

    PubMed

    Geng, Rong-Qing

    2015-02-01

    In order to establish rapid and species-specific method of goat cashmere and sheep wool identification, a polymerase chain reaction using specific primer pairs targeting mitochondrial D-loop was developed. The goat specific primers yielded a 294 bp PCR fragment and the sheep specific primers yielded three PCR fragments of which only the 404 bp fragment was found highly diagnostic. The specificity and reliability of the developed species-specific PCR assay was validated by considering as many as 500 cashmere and wool samples. The developed species-specific PCR was found effective in detecting mixed samples of cashmere and wool precisely with the relative content over 9.09%. The species-specific PCR method proved to be low cost, fast, easy and reliable alternative to determine the addition of sheep wool in goat cashmere.

  8. Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

    PubMed

    Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

    2016-01-01

    Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

  9. Comparison of two PCR strategies for the detection of bovine papillomavirus.

    PubMed

    Silva, M A R; Batista, M V A; Pontes, N E; Santos, E U D; Coutinho, L C A; Castro, R S; Balbino, V Q; Freitas, A C

    2013-09-01

    Bovine papillomavirus (BPV) is a diverse group of double-stranded DNA oncogenic viruses, which have been detected in epithelial lesions and body fluids. Most studies of BPV infection rely on a single method for DNA detection; however the use of any single method or technique may underestimate the true prevalence of this virus. The purpose of this study was to compare two PCR strategies for the detection of BPV in skin lesions and fluids: these involve the use of BPV type-specific and consensus primers. Seventy-two cutaneous lesions, 57 blood samples and 59 semen samples were collected. PCR was used with the FAP consensus primers and BPV type-specific primers (for BPVs 2, 3, 4, 5, 8, 9 and 10), along with sequencing assays, to detect the BPV types. Phylogenetic analysis was carried out by means of the maximum likelihood method. It was found that both FAP and BPV type-specific primer sets could amplify BPV types of DNA in skin lesions, blood and semen samples. However, the BPV type-specific primers were more sensitive than the consensus primers and were able to detect co-infection of BPV in the samples. The consensus primers amplified five BPV types and were more suitable for detecting new putative BPV types. Thus, account should be taken of both PCR primer systems to identify co-infection, the presence of novel viruses, and avoid false-negative results.

  10. An expanded nuclear phylogenomic PCR toolkit for Sapindales1

    PubMed Central

    Collins, Elizabeth S.; Gostel, Morgan R.; Weeks, Andrea

    2016-01-01

    Premise of the study: We tested PCR amplification of 91 low-copy nuclear gene loci in taxa from Sapindales using primers developed for Bursera simaruba (Burseraceae). Methods and Results: Cross-amplification of these markers among 10 taxa tested was related to their phylogenetic distance from B. simaruba. On average, each Sapindalean taxon yielded product for 53 gene regions (range: 16–90). Arabidopsis thaliana (Brassicales), by contrast, yielded product for two. Single representatives of Anacardiaceae and Rutacaeae yielded 34 and 26 products, respectively. Twenty-six primer pairs worked for all Burseraceae species tested if highly divergent Aucoumea klaineana is excluded, and eight of these amplified product in every Sapindalean taxon. Conclusions: Our study demonstrates that customized primers for Bursera can amplify product in a range of Sapindalean taxa. This collection of primer pairs, therefore, is a valuable addition to the toolkit for nuclear phylogenomic analyses of Sapindales and warrants further investigation. PMID:28101434

  11. Oligoribonucleotide (ORN) interference-PCR (ORNi-PCR): a simple method for suppressing PCR amplification of specific DNA sequences using ORNs.

    PubMed

    Tanigawa, Naoki; Fujita, Toshitsugu; Fujii, Hodaka

    2014-01-01

    Polymerase chain reaction (PCR) amplification of multiple templates using common primers is used in a wide variety of molecular biological techniques. However, abundant templates sometimes obscure the amplification of minor species containing the same primer sequences. To overcome this challenge, we used oligoribonucleotides (ORNs) to inhibit amplification of undesired template sequences without affecting amplification of control sequences lacking complementarity to the ORNs. ORNs were effective at very low concentrations, with IC50 values for ORN-mediated suppression on the order of 10 nM. DNA polymerases that retain 3'-5' exonuclease activity, such as KOD and Pfu polymerases, but not those that retain 5'-3' exonuclease activity, such as Taq polymerase, could be used for ORN-mediated suppression. ORN interference-PCR (ORNi-PCR) technology should be a useful tool for both molecular biology research and clinical diagnosis.

  12. Citrus stubborn disease incidence determined by quantitative real time PCR

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Quantitative real-time (q) PCR was developed for detection of Spiroplasma citri, the causal agent of citrus stubborn disease (CSD), using the DNA binding fluorophore SYBR Green I. The primer pair, P58-3f/4r, developed based on sequences from the P58 putative adhesin multigene of the pathogen result...

  13. Multiplex Amplification Refractory Mutation System PCR (ARMS-PCR) provides sequencing independent typing of canine parvovirus.

    PubMed

    Chander, Vishal; Chakravarti, Soumendu; Gupta, Vikas; Nandi, Sukdeb; Singh, Mithilesh; Badasara, Surendra Kumar; Sharma, Chhavi; Mittal, Mitesh; Dandapat, S; Gupta, V K

    2016-10-29

    Canine parvovirus-2 antigenic variants (CPV-2a, CPV-2b and CPV-2c) ubiquitously distributed worldwide in canine population causes severe fatal gastroenteritis. Antigenic typing of CPV-2 remains a prime focus of research groups worldwide in understanding the disease epidemiology and virus evolution. The present study was thus envisioned to provide a simple sequencing independent, rapid, robust, specific, user-friendly technique for detecting and typing of presently circulating CPV-2 antigenic variants. ARMS-PCR strategy was employed using specific primers for CPV-2a, CPV-2b and CPV-2c to differentiate these antigenic types. ARMS-PCR was initially optimized with reference positive controls in two steps; where first reaction was used to differentiate CPV-2a from CPV-2b/CPV-2c. The second reaction was carried out with CPV-2c specific primers to confirm the presence of CPV-2c. Initial validation of the ARMS-PCR was carried out with 24 sequenced samples and the results were matched with the sequencing results. ARMS-PCR technique was further used to screen and type 90 suspected clinical samples. Randomly selected 15 suspected clinical samples that were typed with this technique were sequenced. The results of ARMS-PCR and the sequencing matched exactly with each other. The developed technique has a potential to become a sequencing independent method for simultaneous detection and typing of CPV-2 antigenic variants in veterinary disease diagnostic laboratories globally.

  14. Multiplex Amplification Refractory Mutation System PCR (ARMS-PCR) provides sequencing independent typing of canine parvovirus.

    PubMed

    Chander, Vishal; Chakravarti, Soumendu; Gupta, Vikas; Nandi, Sukdeb; Singh, Mithilesh; Badasara, Surendra Kumar; Sharma, Chhavi; Mittal, Mitesh; Dandapat, S; Gupta, V K

    2016-12-01

    Canine parvovirus-2 antigenic variants (CPV-2a, CPV-2b and CPV-2c) ubiquitously distributed worldwide in canine population causes severe fatal gastroenteritis. Antigenic typing of CPV-2 remains a prime focus of research groups worldwide in understanding the disease epidemiology and virus evolution. The present study was thus envisioned to provide a simple sequencing independent, rapid, robust, specific, user-friendly technique for detecting and typing of presently circulating CPV-2 antigenic variants. ARMS-PCR strategy was employed using specific primers for CPV-2a, CPV-2b and CPV-2c to differentiate these antigenic types. ARMS-PCR was initially optimized with reference positive controls in two steps; where first reaction was used to differentiate CPV-2a from CPV-2b/CPV-2c. The second reaction was carried out with CPV-2c specific primers to confirm the presence of CPV-2c. Initial validation of the ARMS-PCR was carried out with 24 sequenced samples and the results were matched with the sequencing results. ARMS-PCR technique was further used to screen and type 90 suspected clinical samples. Randomly selected 15 suspected clinical samples that were typed with this technique were sequenced. The results of ARMS-PCR and the sequencing matched exactly with each other. The developed technique has a potential to become a sequencing independent method for simultaneous detection and typing of CPV-2 antigenic variants in veterinary disease diagnostic laboratories globally.

  15. Primer on spontaneous heating and pyrophoricity

    SciTech Connect

    Not Available

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  16. Fluorescent-increase kinetics of different fluorescent reporters used for qPCR depend on monitoring chemistry, targeted sequence, type of DNA input and PCR efficiency.

    PubMed

    Ruijter, Jan M; Lorenz, Peter; Tuomi, Jari M; Hecker, Michael; van den Hoff, Maurice J B

    2014-01-01

    The analysis of quantitative PCR data usually does not take into account the fact that the increase in fluorescence depends on the monitoring chemistry, the input of ds-DNA or ss-cDNA, and the directionality of the targeting of probes or primers. The monitoring chemistries currently available can be categorized into six groups: (A) DNA-binding dyes; (B) hybridization probes; (C) hydrolysis probes; (D) LUX primers; (E) hairpin primers; and (F) the QZyme system. We have determined the kinetics of the increase in fluorescence for each of these groups with respect to the input of both ds-DNA and ss-cDNA. For the latter, we also evaluated mRNA and cDNA targeting probes or primers. This analysis revealed three situations. Hydrolysis probes and LUX primers, compared to DNA-binding dyes, do not require a correction of the observed quantification cycle. Hybridization probes and hairpin primers require a correction of -1 cycle (dubbed C-lag), while the QZyme system requires the C-lag correction and an efficiency-dependent C-shift correction. A PCR efficiency value can be derived from the relative increase in fluorescence in the exponential phase of the amplification curve for all monitoring chemistries. In case of hydrolysis probes, LUX primers and hairpin primers, however, this should be performed after cycle 12, and for the QZyme system after cycle 19, to keep the overestimation of the PCR efficiency below 0.5 %. FigureThe qPCR monitoring chemistries form six groups with distinct fluorescence kinetics. The displacement of the amplification curve depends on the chemistry, DNA input and probe-targeting. The observed shift in Cq values can be corrected and PCR efficiencies can be derived.

  17. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    PubMed

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast

  18. Applications of competitor RNA in diagnostic reverse transcription-PCR.

    PubMed

    Kleiboeker, Steven B

    2003-05-01

    Detection of RNA viruses by reverse transcription (RT)-PCR has proven to be a useful approach for the diagnosis of infections caused by many viral pathogens. However, adequate controls are required for each step of the RT-PCR protocol to ensure the accuracies of diagnostic test results. Heterologous competitor RNA can be used as a control for a number of different aspects of diagnostic RT-PCR. Competitor RNA can be applied to assessments of the efficiency of RNA recovery during extraction procedures, detection of endogenous RT-PCR inhibitors that could lead to false-negative results, and quantification of viral template in samples used for diagnosis; competitor RNA can also be used as a positive control for the RT-PCR. In the present study, heterologous competitor RNA was synthesized by a method that uses two long oligonucleotide primers containing primer binding sites for RT-PCR amplification of porcine reproductive and respiratory syndrome virus or West Nile virus. Amplification of the competitor RNA by RT-PCR resulted in a product that was easily distinguished from the amplification product of viral RNA by agarose gel electrophoresis. Assessment of a variety of RNA samples prepared from routine submissions to a veterinary diagnostic laboratory found that either partial or complete inhibition of the RT-PCR could be demonstrated for approximately 20% of the samples. When inhibition was detected, either dilution of the sample or RNA extraction by an alternative protocol proved successful in eliminating the source of inhibition.

  19. Combined Overlap Extension PCR Method for Improved Site Directed Mutagenesis

    PubMed Central

    Chong, Nikson Fatt-Ming

    2016-01-01

    The combined overlap extension PCR (COE-PCR) method developed in this work combines the strengths of the overlap extension PCR (OE-PCR) method with the speed and ease of the asymmetrical overlap extension (AOE-PCR) method. This combined method allows up to 6 base pairs to be mutated at a time and requires a total of 40–45 PCR cycles. A total of eight mutagenesis experiments were successfully carried out, with each experiment mutating between two to six base pairs. Up to four adjacent codons were changed in a single experiment. This method is especially useful for codon optimization, where doublet or triplet rare codons can be changed using a single mutagenic primer set, in a single experiment. PMID:27995143

  20. A primer set to determine sex in the small Indian mongoose, Herpestes auropunctatus.

    PubMed

    Murata, C; Ogura, G; Kuroiwa, A

    2011-03-01

    To enable the accurate sexing of individuals of introduced populations of the small Indian mongoose, Herpestes auropunctatus, we designed a primer set for the amplification of the sex-specific fragments EIF2S3Y and EIF2S3X. Using this primer set, the expected amplification products were obtained for all samples of genomic DNA tested: males yielded two bands and females a single band. Sequencing of each PCR product confirmed that the 769-bp fragment amplified from DNA samples of both sexes was derived from EIF2S3X, whereas the 546-bp fragment amplified only from male DNA samples was derived from EIF2S3Y. The results indicated that this primer set is useful for sex identification in this species.

  1. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

    PubMed

    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

    2016-07-01

    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.

  2. Sex Determination Using PCR

    ERIC Educational Resources Information Center

    Kima, Peter E.; Rasche, Madeline E.

    2004-01-01

    PCR has revolutionized many aspects of biochemistry and molecular biology research. In the following exercise, students learn PCR by isolating their own DNA, amplifying specific segments of the X and Y chromosomes, and estimating the sizes of the PCR products using agarose gel electrophoresis. Based on the pattern of PCR products, students can…

  3. Streamlining DNA Barcoding Protocols: Automated DNA Extraction and a New cox1 Primer in Arachnid Systematics

    PubMed Central

    Vidergar, Nina; Toplak, Nataša; Kuntner, Matjaž

    2014-01-01

    Background DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences—mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1)—are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1) improving an automated DNA extraction protocol, (2) testing the performance of commonly used primer combinations, and (3) developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. Methodology We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor—an automated high throughput DNA extraction system—and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. Results The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198) that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93%) matched that of C1-J-2183. Conclusions The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding. PMID:25415202

  4. Climate Ready Estuaries Rolling Easements Primer

    EPA Pesticide Factsheets

    Rolling easements enable wetlands and beaches to migrate inland and allow society to avoid the costs and hazards of protecting low lands from rising sea levels. This document provides a primer on more than a dozen rolling easement approaches.

  5. A Dozen Primers on Important Information Standards

    ERIC Educational Resources Information Center

    Dempsey, Kathy, Comp.

    2007-01-01

    This is a compilation of 12 primers on important information standards and protocols. These primers are: (1) Atom; (2) COinS; (3) MADS; (4) MARC 21/MARCXML; (5) MIX; (6) MXG; (7) OpenSearch; (8) PREMIS; (9) RESTful HTTP; (10) unAPI; (11) XMPP (aka Jabber); and (12) ZeeRex. The Atom Syndication Format defines a new XML-based syndication format for…

  6. Protective Coats For Zinc-Rich Primers

    NASA Technical Reports Server (NTRS)

    Macdowell, Louis G, III

    1993-01-01

    Report describes tests of topcoats for inorganic zinc-rich primers on carbon steel. Topcoats intended to provide additional protection against corrosion in acidic, salty seacoast-air/rocket-engine-exhaust environment of Space Shuttle launch site. Tests focused on polyurethane topcoats on epoxy tie coats on primers. Part of study involved comparison between "high-build" coating materials and thin-film coating materials.

  7. Are "universal" DNA primers really universal?

    PubMed

    Sharma, Pranay; Kobayashi, Tsuyoshi

    2014-11-01

    "Universal" DNA primers LCO 1490 and HCO 2198 were originally designed from three coding and six anticoding strands by comparing highly conserved regions of mitochondrial cytochrome c oxidase subunit I (COI) genes across 15 taxa. These primers have been successful in amplifying a 710-bp fragment of highly conserved regions of the COI gene for more than 80 invertebrate species from 11 phyla. In the present study, 130,843 variations were reviewed in the primer region of mitochondrial molecular markers by comparing 725 COI sequences from the kingdom Animalia. It was found that, for 177 invertebrate species, the forward primer (LCO 1490) showed only four conserved regions, compared to 12 in the original study. For ascidians, fungi and vertebrates, it showed approximately 50 % conserved regions, dropping to one conserved region for echinoderms. However, the reverse primer (HCO 2198) was highly conserved across 725 COI primer sequences. A similar pattern was observed in amino acid distributions. There was a significant difference in the means of base pair differences from the level of family, genus and species for LCO 1490 [analysis of variance (ANOVA), F 6,188 = 8.193, P < 0.001] and at the level of genus and species for HCO 2198 (ANOVA, F 6,77 = 2.538, P < 0.027). We conclude that, at different taxonomic levels, it is possible to design forward primers from reference sequences belonging to the level of order (maximum 5 bp differences), family (maximum 6 bp differences) or genus (maximum 1 bp difference). Reverse primers can be designed from the level of family (maximum 5 bp differences) or genus (maximum 2 bp differences).

  8. Identification and characterization of dermatophyte species and strains with PCR amplification.

    PubMed

    Liu, Guofang; He, Chenghua; Zhang, Haibin

    2014-08-01

    The aim of the present study was to use two polymerase chain reaction (PCR) methods, with (GACA)4 and non-transcribed spacer (NTS) as primers, to identify and characterize dermatophyte isolates from dogs and cats to a species and strain level. A total of 45 isolates from nine dermatophyte species were collected from pet dogs and cats and subjected to PCR amplification with the microsatellite primer (GACA)4. Dermatophyte strains of three of the same species collected from four cities were subjected to PCR amplification with the NTS primer set. These two PCR methods were applied to identify and characterize the dermatophyte isolates to a species and strain level. Regional differences among the strain specificities were also examined. The results from PCR with (GACA)4 demonstrated that strains from the same species produced similar PCR product band patterns. In addition, these patterns differed among species, indicating that (GACA)4 primer-based PCR was able to distinguish between the various dermatophyte species. By contrast, dermatophyte isolates and/or strains within the same species revealed various band patterns with NTS-based PCR. In addition, the results indicated that regional differences contributed to the variations in PCR product band patterns. Therefore, the results of the present study indicate that the NTS-based PCR method is efficient in distinguishing dermatophytes to the strain level, while a combination of (GACA)4 and NTS primer-based PCR methods is able to clarify dermatophyte isolates to a species and strain level. The present study provides information concerning the identification of pathogenic fungi and the epidemiological characteristics of fungal skin diseases.

  9. Identification of Staphylococcus spp. by PCR-Restriction Fragment Length Polymorphism of gap Gene

    PubMed Central

    Yugueros, Javier; Temprano, Alejandro; Sánchez, María; Luengo, José María; Naharro, Germán

    2001-01-01

    Oligonucleotide primers specific for the Staphylococcus aureus gap gene were previously designed to identify 12 Staphylococcus spp. by PCR. In the present study, AluI digestion of PCR-generated products rendered distinctive restriction fragment length polymorphism patterns that allowed 24 Staphylococcus spp. to be identified with high specificity. PMID:11574593

  10. PCR M Typing: a New Method for Rapid Typing of Group A Streptococci

    PubMed Central

    Vitali, Luca A.; Zampaloni, Claudia; Prenna, Manuela; Ripa, Sandro

    2002-01-01

    A new approach for the M-typing of Streptococcus pyogenes is reported. Oligonucleotide primers were used in a PCR to amplify the N-terminal region of the emm gene. The presence of the PCR amplification product is associated with the corresponding M serotype. This technique offers potential advantages over other molecular typing methods. PMID:11825995

  11. PCR m typing: a new method for rapid typing of group a streptococci.

    PubMed

    Vitali, Luca A; Zampaloni, Claudia; Prenna, Manuela; Ripa, Sandro

    2002-02-01

    A new approach for the M-typing of Streptococcus pyogenes is reported. Oligonucleotide primers were used in a PCR to amplify the N-terminal region of the emm gene. The presence of the PCR amplification product is associated with the corresponding M serotype. This technique offers potential advantages over other molecular typing methods.

  12. Molecular diagnostics of the honey bee parasites Lotmaria passim and Crithidia spp. (Trypanosomatidae) using multiplex PCR

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lotmaria passim Schwarz is a recently described trypanosome parasite of honey bees in continental United States, Europe, and Japan. We developed a multiplex PCR technique using a PCR primer specific for L. passim to distinguish this species from C. mellificae. We report the presence of L. passim in ...

  13. PCR amplification on microarrays of gel immobilized oligonucleotides

    DOEpatents

    Strizhkov, Boris; Tillib, Sergei; Mikhailovich, Vladimir; Mirzabekov, Andrei

    2003-11-04

    The invention relates two general methods for performing PCR amplification, combined with the detection and analysis of the PCR products on a microchip. In the first method, the amplification occurs both outside and within a plurality of gel pads on a microchip, with at least one oligonucleotide primer immobilized in a gel pad. In the second method, PCR amplification also takes place within gel pads on a microchip, but the pads are surrounded by a hydrophobic liquid such as that which separates the individual gel pads into environments which resemble micro-miniaturized test tubes.

  14. Development of Quantitative Real-time PCR Assays for Different Clades of “Candidatus Accumulibacter”

    NASA Astrophysics Data System (ADS)

    Zhang, An Ni; Mao, Yanping; Zhang, Tong

    2016-05-01

    We designed novel quantitative real-time polymerase chain reaction (qPCR) primers for the polyphosphate kinase 1 (ppk1) gene, targeting eight individual “Candidatus Accumulibacter” (referred to as Accumulibacter) clades. An evaluation of primer sets was conducted regarding the coverage, specificity, and PCR efficiency. (i) All primer sets were designed to cover all available sequences of the target clade. (ii) The phylogenetic analysis of the sequences retrieved from the qPCR products by each primer set demonstrated a high level of specificity. (iii) All calibration curves presented high PCR efficiencies in the range of 85–112% (R2 = 0.962–0.998). In addition, the possible interference of non-target amplicons was individually examined using the qPCR assay for 13 Accumulibacter clades, which were either undetected or showed negligible detection. With the primers designed by other research groups, a highly selective and sensitive qPCR-based method was developed to quantify all Accumulibacter clades, with the exception of Clade IE, in one assay, which enables more comprehensive insights into the community dynamics. The applicability to environmental samples was demonstrated by profiling the Accumulibacter clades in activated sludge samples of nine full-scale wastewater treatment plants.

  15. Development of Quantitative Real-time PCR Assays for Different Clades of “Candidatus Accumulibacter”

    PubMed Central

    Zhang, An Ni; Mao, Yanping; Zhang, Tong

    2016-01-01

    We designed novel quantitative real-time polymerase chain reaction (qPCR) primers for the polyphosphate kinase 1 (ppk1) gene, targeting eight individual “Candidatus Accumulibacter” (referred to as Accumulibacter) clades. An evaluation of primer sets was conducted regarding the coverage, specificity, and PCR efficiency. (i) All primer sets were designed to cover all available sequences of the target clade. (ii) The phylogenetic analysis of the sequences retrieved from the qPCR products by each primer set demonstrated a high level of specificity. (iii) All calibration curves presented high PCR efficiencies in the range of 85–112% (R2 = 0.962–0.998). In addition, the possible interference of non-target amplicons was individually examined using the qPCR assay for 13 Accumulibacter clades, which were either undetected or showed negligible detection. With the primers designed by other research groups, a highly selective and sensitive qPCR-based method was developed to quantify all Accumulibacter clades, with the exception of Clade IE, in one assay, which enables more comprehensive insights into the community dynamics. The applicability to environmental samples was demonstrated by profiling the Accumulibacter clades in activated sludge samples of nine full-scale wastewater treatment plants. PMID:27142574

  16. Methods for producing partially digested restriction DNA fragments and for producing a partially modified PCR product

    DOEpatents

    Wong, Kwong-Kwok

    2000-01-01

    The present invention is an improved method of making a partially modified PCR product from a DNA fragment with a polymerase chain reaction (PCR). In a standard PCR process, the DNA fragment is combined with starting deoxynucleoside triphosphates, a primer, a buffer and a DNA polymerase in a PCR mixture. The PCR mixture is then reacted in the PCR producing copies of the DNA fragment. The improvement of the present invention is adding an amount of a modifier at any step prior to completion of the PCR process thereby randomly and partially modifying the copies of the DNA fragment as a partially modified PCR product. The partially modified PCR product may then be digested with an enzyme that cuts the partially modified PCR product at unmodified sites thereby producing an array of DNA restriction fragments.

  17. Heat properties of an integrated micro PCR vessel

    NASA Astrophysics Data System (ADS)

    Zhao, Zhan; Cui, Dafu; Yu, Zhongyao; Wang, Li; Xia, Shanhong; Cui, Zheng

    2001-09-01

    The PCR amplification is based on multiple temperature cycles of DNA synthesis; each includes denaturation of the template, annealing of the primers to complementary sites in the template and primer extension. The key technique of PCR amplification is the heating control in design and fabrication of its chip form. The specifications of the chip are heat properties. In this paper the heat properties of a micro PCR vessel integration heater and temperature sensor was introduced. The temperature distribution of the vessel was simulated with software tool IntelliSuite. The temperatures cycles were measured and the time response of the chip was discussed. It is found that the integrate micro vessel is a very useful tool not only for DNA synthesis but also as a biochemical reactor for many other biological and chemical analyses.

  18. Microsatellite primers for the rare sedge Lepidosperma bungalbin (Cyperaceae)1

    PubMed Central

    Nevill, Paul G.; Wardell-Johnson, Grant

    2016-01-01

    Premise of the study: Microsatellite markers were developed for the rare sedge Lepidosperma bungalbin (Cyperaceae) to assess genetic variation and its spatial structuring. Methods and Results: We conducted shotgun sequencing on an Illumina MiSeq and produced 6,215,872 sequence reads. The QDD pipeline was used to design 60 primer pairs that were screened using PCR. We developed 17 loci, of which 12 loci were identified that were polymorphic, amplified reliably, and could be consistently scored. We then screened these loci for variation in individuals from three populations. The number of alleles observed for these 12 loci across the three populations ranged from nine to 19 and expected heterozygosity ranged from 0.41 to 0.89. Conclusions: These markers will enable the quantification of the potential impact of mining on genetic variation within L. bungalbin and establish a baseline for future management of genetic variation of the rare sedge. PMID:27843727

  19. Multiplex real-time PCR assays for the identification of the potato cyst and tobacco cyst nematodes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    TaqMan primer-probe sets were developed for the detection and identification of potato cyst nematodes (PCN) Globodera pallida and G. rostochiensis using two-tube, multiplex real-time PCR. One tube contained a primer-probe set specific for G. pallida (pale cyst nematode) multiplexed with another prim...

  20. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

    DOE PAGES

    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

    2015-12-09

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

  1. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

    SciTech Connect

    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

    2015-12-09

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable region of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.

  2. Accurate quantification of supercoiled DNA by digital PCR.

    PubMed

    Dong, Lianhua; Yoo, Hee-Bong; Wang, Jing; Park, Sang-Ryoul

    2016-04-11

    Digital PCR (dPCR) as an enumeration-based quantification method is capable of quantifying the DNA copy number without the help of standards. However, it can generate false results when the PCR conditions are not optimized. A recent international comparison (CCQM P154) showed that most laboratories significantly underestimated the concentration of supercoiled plasmid DNA by dPCR. Mostly, supercoiled DNAs are linearized before dPCR to avoid such underestimations. The present study was conducted to overcome this problem. In the bilateral comparison, the National Institute of Metrology, China (NIM) optimized and applied dPCR for supercoiled DNA determination, whereas Korea Research Institute of Standards and Science (KRISS) prepared the unknown samples and quantified them by flow cytometry. In this study, several factors like selection of the PCR master mix, the fluorescent label, and the position of the primers were evaluated for quantifying supercoiled DNA by dPCR. This work confirmed that a 16S PCR master mix avoided poor amplification of the supercoiled DNA, whereas HEX labels on dPCR probe resulted in robust amplification curves. Optimizing the dPCR assay based on these two observations resulted in accurate quantification of supercoiled DNA without preanalytical linearization. This result was validated in close agreement (101~113%) with the result from flow cytometry.

  3. Accurate quantification of supercoiled DNA by digital PCR

    PubMed Central

    Dong, Lianhua; Yoo, Hee-Bong; Wang, Jing; Park, Sang-Ryoul

    2016-01-01

    Digital PCR (dPCR) as an enumeration-based quantification method is capable of quantifying the DNA copy number without the help of standards. However, it can generate false results when the PCR conditions are not optimized. A recent international comparison (CCQM P154) showed that most laboratories significantly underestimated the concentration of supercoiled plasmid DNA by dPCR. Mostly, supercoiled DNAs are linearized before dPCR to avoid such underestimations. The present study was conducted to overcome this problem. In the bilateral comparison, the National Institute of Metrology, China (NIM) optimized and applied dPCR for supercoiled DNA determination, whereas Korea Research Institute of Standards and Science (KRISS) prepared the unknown samples and quantified them by flow cytometry. In this study, several factors like selection of the PCR master mix, the fluorescent label, and the position of the primers were evaluated for quantifying supercoiled DNA by dPCR. This work confirmed that a 16S PCR master mix avoided poor amplification of the supercoiled DNA, whereas HEX labels on dPCR probe resulted in robust amplification curves. Optimizing the dPCR assay based on these two observations resulted in accurate quantification of supercoiled DNA without preanalytical linearization. This result was validated in close agreement (101~113%) with the result from flow cytometry. PMID:27063649

  4. Development of PCR and TaqMan PCR Assays to Detect Pseudomonas coronafaciens, a Causal Agent of Halo Blight of Oats

    PubMed Central

    An, Ji-Hye; Noh, Young-Hee; Kim, Yong-Eon; Lee, Hyok-In; Cha, Jae-Soon

    2015-01-01

    Pseudomonas coronafaciens causes halo blight on oats and is a plant quarantine bacterium in many countries, including the Republic of Korea. Using of the certificated seed is important for control of the disease. Since effective detection method of P. coronafaciens is not available yet, PCR and TaqMan PCR assays for specific detection of P. coronafaciens were developed in this study. PCR primers were designed from the draft genome sequence of P. coronafaciens LMG 5060 which was obtained by the next-generation sequencing in this study. The PCR primer set Pc-12-F/Pc-12-R specifically amplified 498 bp from the 13 strains of P. coronafaciens isolated in the seven different countries (Canada, Japan, United Kingdom, Zimbabwe, Kenya, Germany, and New Zealand) and the nested primer set Pc-12-ne-F/Pc-12-ne-R specifically amplified 298 bp from those strains. The target-size PCR product was not amplified from the non-target bacteria with the PCR and nested primer sets. TaqMan PCR with Pc-12-ne-F/Pc-12-ne-R and a TaqMan probe, Pc-taqman, which were designed inside of the nested PCR amplicon, generated Ct values which in a dose-dependent manner to the amount of the target DNA and the Ct values of all the P. coronafaciens strains were above the threshold Ct value for positive detection. The TaqMan PCR generated positive Ct values from the seed extracts of the artificially inoculated oat seeds above 10 cfu/ml inoculation level. PCR and TaqMan PCR assays developed in this study will be useful tools to detect and identify the plant quarantine pathogen, P. coronafaciens. PMID:25774107

  5. Development of PCR and TaqMan PCR Assays to Detect Pseudomonas coronafaciens, a Causal Agent of Halo Blight of Oats.

    PubMed

    An, Ji-Hye; Noh, Young-Hee; Kim, Yong-Eon; Lee, Hyok-In; Cha, Jae-Soon

    2015-03-01

    Pseudomonas coronafaciens causes halo blight on oats and is a plant quarantine bacterium in many countries, including the Republic of Korea. Using of the certificated seed is important for control of the disease. Since effective detection method of P. coronafaciens is not available yet, PCR and TaqMan PCR assays for specific detection of P. coronafaciens were developed in this study. PCR primers were designed from the draft genome sequence of P. coronafaciens LMG 5060 which was obtained by the next-generation sequencing in this study. The PCR primer set Pc-12-F/Pc-12-R specifically amplified 498 bp from the 13 strains of P. coronafaciens isolated in the seven different countries (Canada, Japan, United Kingdom, Zimbabwe, Kenya, Germany, and New Zealand) and the nested primer set Pc-12-ne-F/Pc-12-ne-R specifically amplified 298 bp from those strains. The target-size PCR product was not amplified from the non-target bacteria with the PCR and nested primer sets. TaqMan PCR with Pc-12-ne-F/Pc-12-ne-R and a TaqMan probe, Pc-taqman, which were designed inside of the nested PCR amplicon, generated Ct values which in a dose-dependent manner to the amount of the target DNA and the Ct values of all the P. coronafaciens strains were above the threshold Ct value for positive detection. The TaqMan PCR generated positive Ct values from the seed extracts of the artificially inoculated oat seeds above 10 cfu/ml inoculation level. PCR and TaqMan PCR assays developed in this study will be useful tools to detect and identify the plant quarantine pathogen, P. coronafaciens.

  6. DNA Sequence Signatures for Rapid Detection of Six Target Bacterial Pathogens Using PCR Assays

    PubMed Central

    Nagamine, Kenjiro; Hung, Guo-Chiuan; Li, Bingjie; Lo, Shyh-Ching

    2015-01-01

    Using Streptococcus pyogenes as a model, we previously established a stepwise computational workflow to effectively identify species-specific DNA signatures that could be used as PCR primer sets to detect target bacteria with high specificity and sensitivity. In this study, we extended the workflow for the rapid development of PCR assays targeting Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Clostridium difficile, Clostridium tetani, and Staphylococcus aureus, which are of safety concern for human tissue intended for transplantation. Twenty-one primer sets that had sensitivity of detecting 5–50 fg DNA from target bacteria with high specificity were selected. These selected primer sets can be used in a PCR array for detecting target bacteria with high sensitivity and specificity. The workflow could be widely applicable for the rapid development of PCR-based assays for a wide range of target bacteria, including those of biothreat agents. PMID:26279626

  7. A general method for the detection of large CAG repeat expansions by fluorescent PCR.

    PubMed Central

    Warner, J P; Barron, L H; Goudie, D; Kelly, K; Dow, D; Fitzpatrick, D R; Brock, D J

    1996-01-01

    The expansion of a tandemly repeated trinucleotide sequence, CAG, is the mutational mechanism for several human genetic diseases. We present a generally applicable PCR amplification method using a fluorescently labelled locus specific primer flanking the CAG repeat together with paired primers amplifying from multiple priming sites within the CAG repeat. Triplet repeat primed PCR (TP PCR) gives a characteristic ladder on the fluorescence trace enabling the rapid identification of large pathogenetic CAG repeats that cannot be amplified using flanking primers. We used our method to test a cohort of 183 people from myotonic dystrophy families including unaffected subjects and spouses. Eighty five clinically affected subjects with expanded alleles on Southern blot analysis were all correctly identified by TP PCR. This method is applicable for any human diseases involving CAG repeat expansions. Images PMID:9004136

  8. Monitoring of geosmin producing Anabaena circinalis using quantitative PCR.

    PubMed

    Tsao, Hsiang-Wei; Michinaka, Atsuko; Yen, Hung-Kai; Giglio, Steven; Hobson, Peter; Monis, Paul; Lin, Tsair-Fuh

    2014-02-01

    Geosmin is one of the most commonly detected off-flavor chemicals present in reservoirs and drinking water systems. Quantitative real-time PCR (qPCR) is useful for quantifying geosmin-producers by focusing on the gene encoding geosmin synthase, which is responsible for geosmin synthesis. In this study, several primers and probes were designed and evaluated to detect the geosmin synthase gene in cyanobacteria. The specificity of primer and probe sets was tested using 21 strains of laboratory cultured cyanobacteria isolated from surface waters in Australia (18) and Taiwan (2), including 6 strains with geosmin producing ability. The results showed that the primers designed in this study could successfully detect all geosmin producing strains tested. The selected primers were used in a qPCR assay, and the calibration curves were linear from 5 × 10(1) to 5 × 10(5) copies mL(-1), with a high correlation coefficient (R(2) = 0.999). This method was then applied to analyze samples taken from Myponga Reservoir, South Australia, during a cyanobacterial bloom event. The results showed good correlations between qPCR techniques and traditional methods, including cell counts determined by microscopy and geosmin concentration measured using gas chromatography (GC) coupled with a mass selective detector (MSD). Results demonstrate that qPCR could be used for tracking geosmin-producing cyanobacteria in drinking water reservoirs. The qPCR assay may provide water utilities with the ability to properly characterize a taste and odor episode and choose appropriate management and treatment options.

  9. Digital PCR to assess gene-editing frequencies (GEF-dPCR) mediated by designer nucleases.

    PubMed

    Mock, Ulrike; Hauber, Ilona; Fehse, Boris

    2016-03-01

    Genome editing using designer nucleases such as transcription activator-like effector nucleases (TALENs) or clustered regularly interspersed short palindromic repeats (CRISPR)-Cas9 nucleases is an emerging technology in basic and applied research. Whereas the application of editing tools, namely CRISPR-Cas9, has recently become very straightforward, quantification of resulting gene knockout rates still remains a bottleneck. This is particularly true if the product of a targeted gene is not easily detectable. To address this problem, we devised a novel gene-editing frequency digital PCR (GEF-dPCR) technique. GEF-dPCR exploits two differently labeled probes that are placed within one amplicon at the gene-editing target site to simultaneously detect wild-type and nonhomologous end-joining (NHEJ)-affected alleles. Taking advantage of the principle of dPCR, this enables concurrent quantification of edited and wild-type alleles in a given sample. We propose that our method is optimal for the monitoring of gene-edited cells in vivo, e.g., in clinical settings. Here we describe preparation, design of primers and probes, and setup and analysis of GEF-dPCR. The setup of GEF-dPCR requires up to 2 weeks (depending on the starting point); once the dPCR has been established, the protocol for sample analysis takes <1 d.

  10. How Many Microorganisms Are Present? Quantitative Reverse Transcription PCR (qRT-PCR)

    NASA Astrophysics Data System (ADS)

    Price, Andy; Álvarez, Laura Acuña; Whitby, Corinne; Larsen, Jan

    Quantitative reverse transcription PCR (qRT-PCR) is a variation of conventional quantitative or real-time PCR, whereby mRNA is first converted into the complementary DNA (cDNA) by reverse transcription, the cDNA is then subsequently quantified by qPCR. The use of mRNA as the initial template allows the quantification of gene transcripts, rather than gene copy numbers. mRNA is only produced by actively metabolising cells and is produced by its corresponding gene to provide a 'blueprint' in order for a cell to manufacture a specific protein. Conventional qPCR detects not only DNA present in actively metabolising cells but also inactive and dead cells. qRT-PCR has the advantage that only actively metabolising cells are detected, hence provides a more reliable measure of microbial activity in oilfield samples. When qRT-PCR is combined with primers and probes for specific genes, the activity of microbial processes important in the oilfield, such as sulphate reduction, methanogenesis and nitrate reduction can be monitored.

  11. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

    DOE PAGES

    Yoon, Hyejin; Leitner, Thomas

    2014-12-17

    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

  12. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

    SciTech Connect

    Yoon, Hyejin; Leitner, Thomas

    2014-12-17

    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-M finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.

  13. Multiplex PCR to detect four different tomato-infecting pathogens.

    PubMed

    Quintero-Vásquez, Gabriela Alejandra; Bazán-Tejeda, María Luisa; Martínez-Peñafiel, Eva; Kameyama-Kawabe, Luis; Bermúdez-Cruz, Rosa María

    2013-07-01

    This work was aimed to develop a multiplex PCR assay to detect infectious agents such as Clavibacter michiganensis subsp. michiganensis, Fusarium sp, Leveillula taurica, and begomoviruses in tomato (Solanum lycopersicum) plants. Specific primer sets of each pathogen were designed based on intergenic ribosomal RNA sequences for the first three, whereas for begomoviruses, primers were designed based on conserved regions. The design also considered that the length (200-800 bp) of the PCR products was resolvable by electrophoresis; thus 296, 380, 457, and 731 bp fragments for Clavibacter, Fusarium, Leveillula, and begomoviruses, respectively, were considered. PCR conditions were optimized to amplify all the products in a single tube from genomic DNA and circumvent PCR inhibitors from infected plants. Finally, when the multiplex PCR assay was tested with tomato plants infected with any of the four pathogens, specific PCR products confirmed the presence of the pathogens. Optimized PCR multiplex allowed for the accurate and simultaneous detection of Clavibacter, Fusarium, Leveillula, and begomoviruses in infected plants or seeds from tomato.

  14. A New Primer for Sex Identification of Ducks and a Minimally Invasive Technique for Sampling of Allantoic Fluid to Detect Sex during Bird Embryo Development.

    PubMed

    Li, Huifang; Hu, Yan; Song, Chi; Ji, Gaige; Liu, Hongxiang; Xu, Wenjuan; Ding, Jing

    2015-01-01

    During the early incubation period of the duck, from embryonic day 1 to 13, a precise identification of the sex may be difficult. In a preliminary test, we found a defect in the use of the classical P2/P8, 1237L/1272H, and 2550F/2718R primers for chromo-helicase-DNA-binding 1 gene (CHD1) as a PCR-based test to identify sex in ducks. Therefore, universal PCR primers HPF/HPR for sexing ducks were designed. The PCR product was cloned, sequenced, and analyzed using GenBank. The effectiveness of the primers was compared using samples of blood and feathers from adult birds and chorioallantoic membranes and allantoic fluid (AF) of embryos as a source of DNA. The 495-bp CHD1-Z and the 351-bp CHD1-W PCR amplicons could be easily distinguished on a 3% agarose gel, and females (ZW) displayed 2 visible bands whereas only a single band was found in males (ZZ). The results indicated that HPF/HPR primers were highly efficient and more reliable than the classical primers used for sexing ducks. During the design of the new primers, an AF sampling technique was established to collect a very small amount of AF from free-living birds. This technique, which was minimally invasive, had no adverse effects on either embryos or the post-hatching survival of young ducks and could be used in developmental biology research in birds.

  15. Consensus-degenerate hybrid oligonucleotide primers for amplification of distantly related sequences.

    PubMed Central

    Rose, T M; Schultz, E R; Henikoff, J G; Pietrokovski, S; McCallum, C M; Henikoff, S

    1998-01-01

    We describe a new primer design strategy for PCR amplification of unknown targets that are related to multiply-aligned protein sequences. Each primer consists of a short 3' degenerate core region and a longer 5' consensus clamp region. Only 3-4 highly conserved amino acid residues are necessary for design of the core, which is stabilized by the clamp during annealing to template molecules. During later rounds of amplification, the non-degenerate clamp permits stable annealing to product molecules. We demonstrate the practical utility of this hybrid primer method by detection of diverse reverse transcriptase-like genes in a human genome, and by detection of C5DNA methyltransferase homologs in various plant DNAs. In each case, amplified products were sufficiently pure to be cloned without gel fractionation. This COnsensus-DEgenerate Hybrid Oligonucleotide Primer (CODEHOP) strategy has been implemented as a computer program that is accessible over the World Wide Web (http://blocks.fhcrc.org/codehop.html) and is directly linked from the BlockMaker multiple sequence alignment site for hybrid primer prediction beginning with a set of related protein sequences. PMID:9512532

  16. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    PubMed

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis.

  17. Beam shaping for laser initiated optical primers

    NASA Astrophysics Data System (ADS)

    Lizotte, Todd E.

    2008-08-01

    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  18. Direct Quantitative Bisulfite Sequencing Using Tag-modified Primers and Internal Normalization.

    PubMed

    Dietrich, Dimo

    2016-12-01

    For the investigation of DNA methylation patterns, bisulfite conversion of the DNA followed by polymerase chain reaction (PCR) amplification and sequencing of the region of interest is the method of choice when information at single CpG site resolution is desired. In this study, a simple method for direct quantitative bisulfite sequencing based on the Sanger method is shown to be usable for the accurate analysis of single CpG sites. This method is based on the usage of tag-modified primers to obtain an internal normalization signal within the PCR product.

  19. Human Blastocystis subtyping with subtype-specific primers developed from unique sequences of the SSU rRNA gene.

    PubMed

    Yoshikawa, Hisao; Iwamasa, Ayana

    2016-12-01

    The genus Blastocystis is one of the most genetically diverse parasites. Blastocystis isolates from humans and animals have been classified into subtypes (STs) based on the phylogeny of the small subunit rRNA gene (SSU rDNA). Although human Blastocystis isolates are limited to STs 1-9, the identification of all 9 STs remains challenging due to the lack of specific primers for several STs. The sequencing of partial SSU rDNA is therefore essential for the identification of several STs. In this study, we developed 9 sets of PCR primers to detect each of the 9 kinds of ST in humans. When these ST-specific primer pairs were examined reference Blastocystis for the 9 STs, all 9 amplified only the target ST even in a DNA mixture of all 9 STs. The specificities of the 9 primer sets were tested against several intestinal parasites and fungi found in human stool samples. No amplification with these common human intestinal eukaryotes was observed using the primer pairs for 8 STs, while the ST5 primer set gave only faint bands with some parasites. Since genomic DNA levels of these parasites extracted from Blastocystis-positive cultures are expected to be markedly lower than the pure or highly concentrated DNA samples tested, the cross-amplifications with these organisms are unlikely to be detected when DNA samples are extracted from Blastocystis-positive cultures. The PCR conditions for all 9 primer sets were the same, hence a one-step analysis by PCR amplification, followed by electrophoresis has potential as a simple tool for the subtyping of human Blastocystis isolates.

  20. Identification of Kashmir bee virus in France using a new RT-PCR method which distinguishes closely related viruses.

    PubMed

    Blanchard, Philippe; Carletto, Jerome; Siede, Reinhold; Schurr, Frank; Thiéry, Richard; Ribière, Magali

    2014-03-01

    A new RT-PCR protocol has been developed, avoiding potential misdiagnosis of Kashmir bee virus (KBV) linked to the use of KBV primers designed originally. The PCR assay validation was realised taking into account the analytical specificity and the PCR detection limit. KBV was detected in a bee sample collected in France from an apparently healthy apiary in 2012. The specificity of the primers was confirmed by sequencing the PCR product. This French sequence clustered into the KBV genotype by phylogenetic analysis, while previous French sequence isolates collected in 2002 belong to the IAPV genotype. These data represent the first detection of KBV in France.

  1. PCR-based diversity estimates of artificial and environmental 18S rRNA gene libraries.

    PubMed

    Potvin, Marianne; Lovejoy, Connie

    2009-01-01

    Environmental clone libraries constructed using small subunit ribosomal RNA (rRNA) or other gene-specific primers have become the standard molecular approach for identifying microorganisms directly from their environment. This technique includes an initial polymerase chain reaction (PCR) amplification step of a phylogenetically useful marker gene using universal primers. Although it is acknowledged that such primers introduce biases, there have been few studies if any to date systematically examining such bias in eukaryotic microbes. We investigated some implications of such bias by constructing clone libraries using several universal primer pairs targeting rRNA genes. Firstly, we constructed artificial libraries using a known mix of small cultured pelagic arctic algae with representatives from five major lineages and secondly we investigated environmental samples using several primer pairs. No primer pair retrieved all of the original algae in the artificial clone libraries and all showed a favorable bias toward the dinoflagellate Polarella glacialis and a bias against the prasinophyte Micromonas and a pennate diatom. Several other species were retrieved by only one primer pair tested. Despite this, sequences from nine environmental libraries were diverse and contained representatives from all major eukaryotic clades expected in marine samples. Further, libraries from the same sample grouped together using Bray-Curtis clustering, irrespective of primer pairs. We conclude that environmental PCR-based techniques are sufficient to compare samples, but the total diversity will probably always be underestimated and relative abundance estimates should be treated with caution.

  2. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys.

    PubMed

    Walters, William; Hyde, Embriette R; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada, Alma; Gilbert, Jack A; Jansson, Janet K; Caporaso, J Gregory; Fuhrman, Jed A; Apprill, Amy; Knight, Rob

    2016-01-01

    Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5' end, allowing for a range of different 3' primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection of Thaumarchaeota and clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies. IMPORTANCE We continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to human skin. This confirms the utility of these primers for

  3. Single universal primer multiplex ligation-dependent probe amplification with sequencing gel electrophoresis analysis.

    PubMed

    Shang, Ying; Zhu, Pengyu; Xu, Wentao; Guo, Tianxiao; Tian, Wenying; Luo, Yunbo; Huang, Kunlun

    2013-12-15

    In this study, a novel single universal primer multiplex ligation-dependent probe amplification (SUP-MLPA) technique that uses only one universal primer to perform multiplex polymerase chain reaction (PCR) was developed. Two reversely complementary common sequences were designed on the 5' or 3' end of the ligation probes (LPs), which allowed the ligation products to be amplified through only a single universal primer (SUP). SUP-MLPA products were analyzed on sequencing gel electrophoresis with extraordinary resolution. This method avoided the high expenses associated with capillary electrophoresis, which was the commonly used detection instrument. In comparison with conventional multiplex PCR, which suffers from low sensitivity, nonspecificity, and amplification disparity, SUP-MLPA had higher specificity and sensitivity and a low detection limit of 0.1 ng for detecting single crop species when screening the presence of genetically modified crops. We also studied the effect of different lengths of stuffer sequences on the probes for the first time. Through comparing the results of quantitative PCR, the LPs with different stuffer sequences did not affect the ligation efficiency, which further increased the multiplicity of this assay. The improved SUP-MLPA and sequencing gel electrophoresis method will be useful for food and animal feed identification, bacterial detection, and verification of genetic modification status of crops.

  4. Hybridization probes for conventional DNA fingerprinting used as single primers in the polymerase chain reaction to distinguish strains of Cryptococcus neoformans.

    PubMed Central

    Meyer, W; Mitchell, T G; Freedman, E Z; Vilgalys, R

    1993-01-01

    In conventional DNA fingerprinting, hypervariable and repetitive sequences (minisatellite or microsatellite DNA) are detected with hybridization probes. As demonstrated here, these probes can be used as single primers in the polymerase chain reaction (PCR) to generate individual fingerprints. Several conventional DNA fingerprinting probes were used to prime the PCR, yielding distinctive, hypervariable multifragment profiles for different strains of Cryptococcus neoformans. PCR fingerprinting with the oligonucleotide primers (GTG)5, (GACA)4, and the phage M13 core sequence (GAGGGTGGXGGXTCT), but not with (CA)8 or (CT)8, generated DNA polymorphisms with all 42 strains of C. neoformans investigated. PCR fingerprints produced by priming with (GTG)5, (GACA)4, or the M13 core sequence differentiated the two varieties of C. neoformans, C. neoformans var. neoformans (serotypes A and D) and C. neoformans var. gattii (serotypes B and C). Furthermore, strains of serotypes A, D, and B or C could be distinguished from each other by specific PCR fingerprint patterns. These primers, which also successfully amplified hypervariable DNA segments from other species, provide a convenient method of identification at the species or individual level. Amplification of polymorphic DNA patterns by PCR with these primers offers several advantages over classical DNA fingerprinting techniques, appears to be more reliable than other PCR-based methods for detecting polymorphic DNA, such as analysis of random-amplified polymorphic DNA, and should be applicable to many other organisms. Images PMID:8408543

  5. Multiplex enrichment quantitative PCR (ME-qPCR): a high-throughput, highly sensitive detection method for GMO identification.

    PubMed

    Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang

    2017-04-01

    Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for

  6. Development of a prokaryotic universal primer for simultaneous analysis of Bacteria and Archaea using next-generation sequencing.

    PubMed

    Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki

    2014-01-01

    For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace × Large white × Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (± 20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples.

  7. Primers on Special Education and Charter Schools: Compilation of Full Primer Set

    ERIC Educational Resources Information Center

    Ahearn, Eileen M.; Giovannetti, Elizabeth A.; Lange, Cheryl M.; Rhim, Lauren Morando; Warren, Sandra Hopfengardner

    2004-01-01

    This set of primers for charter school authorizers; charter school operators and state-level administrators has been developed to provide background information and resources for the "builders" of charter schools and policymakers to facilitate the successful inclusion of students with disabilities in charter schools. The primers open…

  8. Primer-design for multiplexed genotyping.

    PubMed

    Kaderali, Lars; Deshpande, Alina; Nolan, John P; White, P Scott

    2003-03-15

    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Mutation analysis by polymerase-mediated single-base primer extension (minisequencing) can be massively parallelized using DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5' end of the minisequencing primer and attaching the complementary antitag to the array or bead surface, the assay can be 'demultiplexed'. Such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. We present a computer program to automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/antitag system is generated, and the pairing of primers and DNA tags is automatically done in a way to avoid any crossreactivity. We report results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping. The software is available to academic users on request.

  9. PCR detection of Clostridium chauvoei in pure cultures and in formalin-fixed, paraffin-embedded tissues.

    PubMed

    Uzal, F A; Hugenholtz, P; Blackall, L L; Petray, S; Moss, S; Assis, R A; Fernandez Miyakawa, M; Carloni, G

    2003-02-02

    The polymerase chain reaction (PCR) was used to amplify specific segments of the 16S ribosomal RNA gene of Clostridium chauvoei, a major pathogen of ruminants. Three sets of primers were used to produce amplicons of 159, 836 and 959 base pairs (bp), respectively. The PCR was evaluated by testing clinically important strains of Clostridium, including 21 strains of C. chauvoei, five strains each of Clostridium septicum and Clostridium perfringens and two strains each of Clostridium novyi, Clostridium histolyticum and Clostridium sordellii. Both purified DNA and biomass from pure cultures of each of these microorganisms were evaluated as templates in the PCR. In addition, extracts of formalin-fixed, paraffin-embedded tissues of eight sheep experimentally inoculated with C. chauvoei or C. septicum (four animals each) were also tested by the PCR using the three sets of primers. Purified DNA template of all C. chauvoei strains produced PCR amplicons of the expected size for all three primer pairs. However, when biomass from pure cultures of C. chauvoei or tissue extracts were used as templates, only the primer pair designed to produce the 159bp amplicon gave consistently positive results. No positive results were obtained with any primer pair when purified DNA or biomass from pure cultures of non-target clostridial species were used as templates. Therefore, the PCR primer sets appear to be very specific for identifying C. chauvoei in both cultures and tissues.

  10. Detection of episomal banana streak badnavirus by IC-PCR.

    PubMed

    Harper, G; Dahal, G; Thottappilly, G; Hull, R

    1999-04-01

    A polymerase chain reaction (PCR) based strategy to detect episomal banana streak badnavirus (BSV) in banana and plantain plants that carry integrated BSV sequences was developed. Antisera used in immuno-capture polymerase chain reaction (IC-PCR) are capable of binding a large number of BSV serotypes. The primers used for PCR are capable of annealing to and amplifying across the aspartic protease-reverse transcriptase domain boundaries of both episomal and integrated BSV sequences and result in similar or identical sequence size fragments from either template. However, we show that under the conditions selected for IC-PCR, nuclear, mitochondrial or chloroplast genomic sequences are not amplified and thus only captured episomal BSV is amplified. IC-PCR is suitable for the large-scale screening of Musa for episomal BSV which is necessary for germplasm movement.

  11. Multiplex PCR identification of Taenia spp. in rodents and carnivores.

    PubMed

    Al-Sabi, Mohammad N S; Kapel, Christian M O

    2011-11-01

    The genus Taenia includes several species of veterinary and public health importance, but diagnosis of the etiological agent in definitive and intermediate hosts often relies on labor intensive and few specific morphometric criteria, especially in immature worms and underdeveloped metacestodes. In the present study, a multiplex PCR, based on five primers targeting the 18S rDNA and ITS2 sequences, produced a species-specific banding patterns for a range of Taenia spp. Species typing by the multiplex PCR was compared to morphological identification and sequencing of cox1 and/or 12S rDNA genes. As compared to sequencing, the multiplex PCR identified 31 of 32 Taenia metacestodes from rodents, whereas only 14 cysts were specifically identified by morphology. Likewise, the multiplex PCR identified 108 of 130 adult worms, while only 57 were identified to species by morphology. The tested multiplex PCR system may potentially be used for studies of Taenia spp. transmitted between rodents and carnivores.

  12. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    PubMed

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  13. Climate Change, Health, and Communication: A Primer.

    PubMed

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  14. Identification of Actinobacillus pleuropneumoniae biovars 1 and 2 in pigs using a PCR assay.

    PubMed

    Serrano-Rubio, Luis E; Tenorio-Gutiérrez, Víctor; Suárez-Güemes, Francisco; Reyes-Cortés, Ruth; Rodríguez-Mendiola, Martha; Arias-Castro, Carlos; Godínez-Vargas, Delfino; de la Garza, Mireya

    2008-01-01

    Actinobacillus pleuropneumoniae causes swine pleuropneumonia worldwide. Previously, we described a gene sequence of approximately 800bp in A. pleuropneumoniae serotype 1 that encodes a metalloprotease of 24kDa, (Genbank accession no. AY217757). We selected primers carrying the forward and reverse 5'-terminal sequences of this region of the gene for the development of a species-specific PCR assay. The primers amplified an 800bp sequence from isolated DNA and lysed bacteria of the 13 A. pleuropneumoniae biovar 1 serotypes, with the exception of subtype 1b. The primers also amplified the sequence in nasal secretion cultures from pigs with chronic and acute experimental pleuropneumonia. No PCR products were detected when A. pleuropneumoniae serotypes of biovar 2 were used. Internal primers from this gene sequence detected biovar 2 and subtype 1b, leading to the production of a 350bp PCR product. The primers did not amplify DNA from other related species from the Pasteurellaceae family. The 800bp PCR assay was sensitive in vitro, with a detection limit of 5.5pg of extracted DNA, and an average of 120CFU. The specificity and sensitivity of this PCR assay make it a useful method for the rapid identification and diagnosis of A. pleuropneumoniae.

  15. Identification of Staphylococcus spp. using (GTG)₅-PCR fingerprinting.

    PubMed

    Svec, Pavel; Pantůček, Roman; Petráš, Petr; Sedláček, Ivo; Nováková, Dana

    2010-12-01

    A group of 212 type and reference strains deposited in the Czech Collection of Microorganisms (Brno, Czech Republic) and covering 41 Staphylococcus species comprising 21 subspecies was characterised using rep-PCR fingerprinting with the (GTG)₅ primer in order to evaluate this method for identification of staphylococci. All strains were typeable using the (GTG)₅ primer and generated PCR products ranging from 200 to 4500 bp. Numerical analysis of the obtained fingerprints revealed (sub)species-specific clustering corresponding with the taxonomic position of analysed strains. Taxonomic position of selected strains representing the (sub)species that were distributed over multiple rep-PCR clusters was verified and confirmed by the partial rpoB gene sequencing. Staphylococcus caprae, Staphylococcus equorum, Staphylococcus sciuri, Staphylococcus piscifermentans, Staphylococcus xylosus, and Staphylococcus saprophyticus revealed heterogeneous fingerprints and each (sub)species was distributed over several clusters. However, representatives of the remaining Staphylococcus spp. were clearly separated in single (sub)species-specific clusters. These results showed rep-PCR with the (GTG)₅ primer as a fast and reliable method applicable for differentiation and straightforward identification of majority of Staphylococcus spp.

  16. Genus identification of toxic plant by real-time PCR.

    PubMed

    Matsuyama, Shuji; Nishi, Katsuji

    2011-03-01

    Some plants have toxicities that are dangerous for humans. In the case of poisoning by toxic plants, a rapid and easy screening test is required for accurate medical treatment or forensic investigation. In this study, we designed specific primer pairs for identification of toxic plants, such as subgenus Aconitum, genus Ricinus, genus Illicium, and genus Scopolia, by internal transcribed spacer sequences of nuclear ribosomal DNA. Allied species of target plants, foods, and human DNA were not detected, but each primer pair provided a specific PCR product from the target plant using real-time PCR. This method can detect the subgenus Aconitum, genus Ricinus, and genus Scopolia with template DNA of 10 pg, respectively, and genus Illicium with 1 pg. Furthermore, each primer pair provided the exact PCR product from digested target plants in artificial gastric fluid. When a trace unknown plant sample in forensic investigation is collected from stomach contents, this PCR assay may be useful for screening toxic plants.

  17. Evaluation of PCR methods for detection of Brucella strains from culture and tissues.

    PubMed

    Çiftci, Alper; İça, Tuba; Savaşan, Serap; Sareyyüpoğlu, Barış; Akan, Mehmet; Diker, Kadir Serdar

    2017-04-01

    The genus Brucella causes significant economic losses due to infertility, abortion, stillbirth or weak calves, and neonatal mortality in livestock. Brucellosis is still a zoonosis of public health importance worldwide. The study was aimed to optimize and evaluate PCR assays used for the diagnosis of Brucella infections. For this aim, several primers and PCR protocols were performed and compared with Brucella cultures and biological material inoculated with Brucella. In PCR assays, genus- or species-specific oligonucleotide primers derived from 16S rRNA sequences (F4/R2, Ba148/928, IS711, BruP6-P7) and OMPs (JPF/JPR, 31ter/sd) of Brucella were used. All primers except for BruP6-P7 detected the DNA from reference Brucella strains and field isolates. In spiked blood, milk, and semen samples, F4-R2 primer-oriented PCR assays detected minimal numbers of Brucella. In spiked serum and fetal stomach content, Ba148/928 primer-oriented PCR assays detected minimal numbers of Brucella. Field samples collected from sheep and cattle were examined by bacteriological methods and optimized PCR assays. Overall, sensitivity of PCR assays was found superior to conventional bacteriological isolation. Brucella DNA was detected in 35.1, 1.1, 24.8, 5.0, and 8.0% of aborted fetus, blood, milk, semen, and serum samples by PCR assays, respectively. In conclusion, PCR assay in optimized conditions was found to be valuable in sensitive and specific detection of Brucella infections of animals.

  18. PCR performance of a thermostable heterodimeric archaeal DNA polymerase.

    PubMed

    Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine

    2014-01-01

    DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications.

  19. PCR performance of a thermostable heterodimeric archaeal DNA polymerase

    PubMed Central

    Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine

    2014-01-01

    DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications. PMID:24847315

  20. Discrimination between Mycoplasma mycoides subsp. capri and Mycoplasma capricolum subsp. capricolum using PCR-RFLP and PCR.

    PubMed

    Cillara, Grazia; Manca, Maria Giovanna; Longheu, Carla; Tola, Sebastiana

    2015-09-01

    In this study, the dihydrolipoyl dehydrogenase (lpdA) gene was used to distinguish Mycoplasma mycoides subsp. capri (Mmc) from Mycoplasma capricolum subsp. capricolum (Mcc), two of four Mycoplasma species that cause contagious agalactia in sheep and goats. After alignment of nucleotide sequences of both species, specific primer sets were designed from unchanging and variable gene segments. The first primer set LPD-C1-F/LPD-C1-R was used to amplify a 911 bp fragment that was subsequently co-digested with FastDigest PstI, SspI, EcoRI and ClaI enzymes. The PCR-RFLP profiles differentiated the two mycoplasma species. The second primer set was used to distinguish Mmc from Mcc by single tube PCR. Both methods were further applied to identify 54 isolates collected from dairy herds from different provinces in Sardinia. The results of this study showed that PCR-RFLP and PCR could be used in routine diagnosis for rapid and specific simultaneous discrimination of Mmc and Mcc.

  1. Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

    NASA Astrophysics Data System (ADS)

    Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam

    2013-11-01

    This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

  2. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction.

    PubMed

    Zhan, Fangfang; Zhou, Xiaoming; Xing, Da

    2013-01-25

    A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2'-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental results showed that the detection limit of the assay was 0.2 pg μL(-1) of rotavirus. The ECL intensity was linearly with the concentration from 0.2 pg μL(-1) to 400 pg μL(-1). What's more, the specificity of this method was confirmed by detecting other fecal specimens of patients with nonrotavirus-associated gastroenteritis. We anticipate that the proposed magnetic primer based RT-PCR with ECL detection strategy will find numerous applications in food safety field and clinical diagnosis.

  3. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    PubMed Central

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-01-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911

  4. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    NASA Astrophysics Data System (ADS)

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-03-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  5. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River.

    PubMed

    Cannon, M V; Hester, J; Shalkhauser, A; Chan, E R; Logue, K; Small, S T; Serre, D

    2016-03-11

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  6. Development of a DNA probe for the myxosporean parasite, Ceratomyxa shasta, using the polymerase chain reaction with arbitrary primers

    USGS Publications Warehouse

    Bartholomew, Jerri L; Rodriguez, Rusty J.; Arakawa, Cindy K.

    1995-01-01

    The arbitrarily primed polymerase chain reaction (PCR) was used to generate a DNA marker specific for the myxosporean parasite Ceratomyxa shasta. The [32~]-labeled marker hybridized to purified C. shasta DNA and to parasite DNA combined with salmonid DNA in a dot blot assay, demonstrating its potential as a diagnostic tool. The amplified DNA segment was cloned and sequenced, and primers specific for the marker were designed. When these primers were used in a standard PCR assay, DNA was amplified from C. shasta and from infected fish tissues, but not from uninfected fish tissues or from 2 other myxosporean parasites. The sensitivity of the PCR assay will permit detection of low levels of C. shasta from infected fish or oligochaetes and will be useful in defining the parasite's life cycle as well as examining its impact on salmonid populatiosn

  7. Chemoselective Coupling Preserves the Substrate Integrity of Surface-Immobilized Oligonucleotides for Emulsion PCR-Based Gene Library Construction.

    PubMed

    Malone, Marie L; Cavett, Valerie J; Paegel, Brian M

    2017-01-09

    Combinatorial bead libraries figure prominently in next-generation sequencing and are also important tools for in vitro evolution. The most common methodology for generating such bead libraries, emulsion PCR (emPCR), enzymatically extends bead-immobilized oligonucleotide PCR primers in emulsion droplets containing a single progenitor library member. Primers are almost always immobilized on beads via noncovalent biotin-streptavidin binding. Here, we describe covalent bead functionalization with primers (∼10(6) primers/2.8-μm-diameter bead) via either azide-alkyne click chemistry or Michael addition. The primers are viable polymerase substrates (4-7% bead-immobilized enzymatic extension product yield from one thermal cycle). Carbodiimide-activated carboxylic acid beads only react with oligonucleotides under conditions that promote nonspecific interactions (low salt, low pH, no detergent), comparably immobilizing primers on beads, but yielding no detectable enzymatic extension product. Click-functionalized beads perform satisfactorily in emPCR of a site-saturation mutagenesis library, generating monoclonal templated beads (10(4)-10(5) copies/bead, 1.4-kb amplicons). This simpler, chemical approach to primer immobilization may spur more economical library preparation for high-throughput sequencing and enable more complex surface elaboration for in vitro evolution.

  8. Solid-phase PCR for rapid multiplex detection of Salmonella spp. at the subspecies level, with amplification efficiency comparable to conventional PCR.

    PubMed

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas; Hung, Tran Quang; Wolff, Anders; Bang, Dang Duong

    2017-04-01

    Solid-phase PCR (SP-PCR) has attracted considerable interest in different research fields since it allows parallel DNA amplification on the surface of a solid substrate. However, the applications of SP-PCR have been hampered by the low efficiency of the solid-phase amplification. In order to increase the yield of the solid-phase amplification, we studied various parameters including the length, the density, as well as the annealing position of the solid support primer. A dramatic increase in the signal-to-noise (S/N) ratio was observed when increasing the length of solid support primers from 45 to 80 bp. The density of the primer on the surface was found to be important for the S/N ratio of the SP-PCR, and the optimal S/N was obtained with a density of 1.49 × 10(11) molecules/mm(2). In addition, the use of solid support primers with a short overhang at the 5' end would help improve the S/N ratio of the SP-PCR. With optimized conditions, SP-PCR can achieve amplification efficiency comparable to conventional PCR, with a limit of detection of 1.5 copies/μl (37.5 copies/reaction). These improvements will pave the way for wider applications of SP-PCR in various fields such as clinical diagnosis, high-throughput DNA sequencing, and single-nucleotide polymorphism analysis. Graphical abstract Schematic representation of solid-phase PCR.

  9. Selection of a set of specific primers for the identification of Tuber rufum: a truffle species with high genetic variability.

    PubMed

    Iotti, Mirco; Amicucci, Antonella; Bonito, Gregory; Bonuso, Enrico; Stocchi, Vilberto; Zambonelli, Alessandra

    2007-12-01

    Tuber rufum is a truffle widely distributed throughout Europe, which forms mycorrhizal associations with numerous species of broadleaf and coniferous trees. The possibility of T. rufum contamination in commercial truffle-infected plants makes its detection important. To facilitate the identification of T. rufum from mycorrhiza and fruitbodies, species-specific primers were designed and tested. To overcome the high intraspecific genetic variability within the internal transcribed spacer (ITS) regions of T. rufum, as demonstrated by phylogenetic analysis, two forward primers, Ru1f and Ru2f, located on the ITS1 region were designed to be used in concert with the reverse primer ITS4. Only T. rufum was amplified with this primer combination, while DNA of Tuber magnatum, Tuber brumale, Tuber maculatum, Tuber borchii, Tuber excavatum and Tuber melanosporum was not. These primers give a specific amplicon ranging between 566 and 572 bp and are able to discriminate between T. rufum, T. borchii and T. magnatum in multiplex PCR. In addition, T. rufum-specific amplicons were obtained from both spore suspensions and mycorrhiza by direct PCR. Tuber rufum mycorrhiza obtained in the greenhouse using mycelial inoculation techniques had morphological features similar to those of other species of Tuber, stressing the importance of molecular tools for their identification.

  10. GPUDePiCt: A Parallel Implementation of a Clustering Algorithm for Computing Degenerate Primers on Graphics Processing Units.

    PubMed

    Cickovski, Trevor; Flor, Tiffany; Irving-Sachs, Galen; Novikov, Philip; Parda, James; Narasimhan, Giri

    2015-01-01

    In order to make multiple copies of a target sequence in the laboratory, the technique of Polymerase Chain Reaction (PCR) requires the design of "primers", which are short fragments of nucleotides complementary to the flanking regions of the target sequence. If the same primer is to amplify multiple closely related target sequences, then it is necessary to make the primers "degenerate", which would allow it to hybridize to target sequences with a limited amount of variability that may have been caused by mutations. However, the PCR technique can only allow a limited amount of degeneracy, and therefore the design of degenerate primers requires the identification of reasonably well-conserved regions in the input sequences. We take an existing algorithm for designing degenerate primers that is based on clustering and parallelize it in a web-accessible software package GPUDePiCt, using a shared memory model and the computing power of Graphics Processing Units (GPUs). We test our implementation on large sets of aligned sequences from the human genome and show a multi-fold speedup for clustering using our hybrid GPU/CPU implementation over a pure CPU approach for these sequences, which consist of more than 7,500 nucleotides. We also demonstrate that this speedup is consistent over larger numbers and longer lengths of aligned sequences.

  11. Forest Interpreter's Primer on Fire Management.

    ERIC Educational Resources Information Center

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  12. The FAS Child: A Primer for Teachers.

    ERIC Educational Resources Information Center

    Wentz, Thomas L.; Larson, Julie

    1993-01-01

    This primer on fetal alcohol syndrome (FAS) distinguishes between the syndrome and fetal alcohol effects (FAE), offers a history of FAS, outlines medical criteria for diagnosis, rates of incidence, factors influencing incidence and severity, developmental stages of children with FAS, clinical features, and educational implications and approaches.…

  13. Issues Primer. EEE708 Negotiated Study Program.

    ERIC Educational Resources Information Center

    Jennings, Leonie

    This issues primer is structured around a series of 20 contemporary concerns in the changing world of work and training in Australia in the early 1990s. It is part of the study materials for the one-semester distance education unit, Negotiated Study Program, in the Open Campus Program at Deakin University (Australia). Information on each issue is…

  14. School Safety & Youth Violence: A Legal Primer.

    ERIC Educational Resources Information Center

    Bailey, Kirk A.; Ross, Catherine J.

    This legal primer on violence in schools addresses the responsibility of school officials to respond to undisciplined youths whose behavior threatens the welfare and safety of other children in attendance. It is broken down into sections that provide a brief overview of the key rules and guidelines for school officials and teachers in each topic…

  15. Exploratory Development of Corrosion Inhibiting Primers

    DTIC Science & Technology

    1977-07-01

    melamine , were selected for further evaluation in primer systems as examples of soluble and insoluble corrosion inhibitors. Other routes to potential...guanidine dichromate gave relatively poor performance. Melamine dich- romate pigment was more generally effective in preventing corrosion than the common...dihpneyl- guanidine ....... ..................... ... 66 9.2.1.3) Preparation Of Melamine Dichromate (Compound #25). 66 vii TABLE OF CONTENTS

  16. Apparatus For Tests Of Percussion Primers

    NASA Technical Reports Server (NTRS)

    Bement, Laurence J.; Bailey, James W.; Schimmel, Morry L.

    1991-01-01

    Test apparatus and method developed to measure ignition capability of percussion primers. Closely simulates actual conditions and interfaces encountered in such applications as in munitions and rocket motors. Ignitability-testing apparatus is small bomb instrumented with pressure transducers. Sizes, shapes, and positions of bomb components and materials under test selected to obtain quantitative data on ignition.

  17. A primer on effectiveness and efficacy trials.

    PubMed

    Singal, Amit G; Higgins, Peter D R; Waljee, Akbar K

    2014-01-02

    Although efficacy and effectiveness studies are both important when evaluating interventions, they serve distinct purposes and have different study designs. Unfortunately, the distinction between these two types of trials is often poorly understood. In this primer, we highlight several differences between these two types of trials including study design, patient populations, intervention design, data analysis, and result reporting.