Science.gov

Sample records for intron-flanking pcr primer

  1. ConservedPrimers 2.0: A high-throughput pipeline for comparative genome referenced intron-flanking PCR primer design and its application in wheat SNP discovery

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In some genomic applications it is necessary to design large numbers of PCR primers in exons flanking one or several introns on the basis of orthologous gene sequences in related species. The primer pairs designed by this target gene approach are called "intron-flanking primers" or because they ar...

  2. BatchPrimer3: A high throughput web application for PCR and sequencing primer design

    PubMed Central

    You, Frank M; Huo, Naxin; Gu, Yong Qiang; Luo, Ming-cheng; Ma, Yaqin; Hane, Dave; Lazo, Gerard R; Dvorak, Jan; Anderson, Olin D

    2008-01-01

    Background Microsatellite (simple sequence repeat – SSR) and single nucleotide polymorphism (SNP) markers are two types of important genetic markers useful in genetic mapping and genotyping. Often, large-scale genomic research projects require high-throughput computer-assisted primer design. Numerous such web-based or standard-alone programs for PCR primer design are available but vary in quality and functionality. In particular, most programs lack batch primer design capability. Such a high-throughput software tool for designing SSR flanking primers and SNP genotyping primers is increasingly demanded. Results A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricted primers. BatchPrimer3 v1.0 implements several types of primer designs including generic primers, SSR primers together with SSR detection, and SNP genotyping primers (including single-base extension primers, allele-specific primers, and tetra-primers for tetra-primer ARMS PCR), as well as DNA sequencing primers. DNA sequences in FASTA format can be batch read into the program. The basic information of input sequences, as a reference of parameter setting of primer design, can be obtained by pre-analysis of sequences. The input sequences can be pre-processed and masked to exclude and/or include specific regions, or set targets for different primer design purposes as in Primer3Web and primer3Plus. A tab-delimited or Excel-formatted primer output also greatly facilitates the subsequent primer-ordering process. Thousands of primers, including wheat conserved intron-flanking primers, wheat genome-specific SNP genotyping primers, and Brachypodium SSR flanking primers in several genome projects have been designed using the program and validated in several laboratories

  3. Explanatory chapter: PCR primer design.

    PubMed

    Álvarez-Fernández, Rubén

    2013-01-01

    This chapter is intended as a guide on polymerase chain reaction (PCR) primer design (for information on PCR, see General PCR and Explanatory Chapter: Troubleshooting PCR). In the next section, general guidelines will be provided, followed by a discussion on primer design for specific applications. A list of recommended software tools is shown at the end.

  4. Multiplexed Primer Prediction for PCR

    SciTech Connect

    2007-07-23

    MPP predicts sets of multiplex-compatible primers for Polymerase Chain Reaction (PCR), finding a near minimal set of primers such that at least one amplicon will be generated from every target sequence in the input file. The code finds highly conserved oligos that are suitable as primers, according to user-specified desired primer characteristics such as length, melting temperature, and amplicon length. The primers are predicted not to form unwanted dimer or hairpin structures. The target sequences used as input can be diverse, since no multiple sequence alighment is required. The code is scalable, taking up to tens of thousands of sequences as input, and works, for example, to find a "universal primer set" for all viral genomes provided as a single input file. The code generates a periodic check-point file, thus in the event of premature execution termination, the application can be restarted from the last check-point file.

  5. Multiplexed Primer Prediction for PCR

    2007-07-23

    MPP predicts sets of multiplex-compatible primers for Polymerase Chain Reaction (PCR), finding a near minimal set of primers such that at least one amplicon will be generated from every target sequence in the input file. The code finds highly conserved oligos that are suitable as primers, according to user-specified desired primer characteristics such as length, melting temperature, and amplicon length. The primers are predicted not to form unwanted dimer or hairpin structures. The target sequencesmore » used as input can be diverse, since no multiple sequence alighment is required. The code is scalable, taking up to tens of thousands of sequences as input, and works, for example, to find a "universal primer set" for all viral genomes provided as a single input file. The code generates a periodic check-point file, thus in the event of premature execution termination, the application can be restarted from the last check-point file.« less

  6. [DNA amplification using PCR with abutting primers].

    PubMed

    Garafutdinov, R R; Galimova, A A; Sakhabutdinova, A R; Vakhitov, V A; Chemeris, A V

    2015-01-01

    DNA analysis of ñîmplex biological objects (wastewater, soil, archaeological and forensic samples, etc.) is currently of great interest. DNA of these objects is characterized by low suitability for research due to the violation of its integrity and chemical structure; thus, the detection of specific nucleic acid fragments can be achieved by PCR with contiguous primers. In this paper, we present the results that clarify the specific characteristics of PCR with abutting primers. The 3'-ends of these primers are annealed at adjacent nucleotides of complementary chains of DNA target. It has been shown that the proximity of primers enables the formation of specific reaction products with a higher sensitivity and less reaction time. Using artificially damaged DNA and DNA from the soil we demonstrated that the abutting primers provide assured detection of specific DNA fragments. The results of this work may be taken into account in PCR with degraded (fragmented) DNA.

  7. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

    PubMed Central

    O’Halloran, Damien M.

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  8. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    PubMed

    O'Halloran, Damien M

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  9. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    PubMed

    O'Halloran, Damien M

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction.

  10. Multiplexing Short Primers for Viral Family PCR

    SciTech Connect

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  11. A new PCR method: one primer amplification of PCR-CTPP products.

    PubMed

    Yin, Guang; Mitsuda, Yoko; Ezaki, Takayuki; Hamajima, Nobuyuki

    2012-10-01

    Polymerase chain reaction with confronting two-pair primers (PCR-CTPP) is a convenient method for genotyping single nucleotide polymorphisms, saving time, and costs. It uses four primers for PCR; F1 and R1 for one allele, and F2 and R2 for the other allele, by which three different sizes of DNA are amplified; between F1 and R1, between F2 and R2, and between F1 and R2. To date, we have applied PCR-CTPP successfully for genotyping more than 60 polymorphisms. However, it is not rare that PCR does not produce balanced amplification of allele specific bands. Accordingly, the method was modified by attaching a common sequence at the 5' end of two-pair primers and adding another primer with the common sequence in PCR, in total five different primers in a tube for PCR. The modification allowed one primer amplification for the products of initial PCR with confronting two-pair primers, named as one primer amplification of PCR-CTPP products (OPA-CTPP). This article demonstrates an example for an A/G polymorphism of paraoxonase 1 (PON1) Gln192Arg (rs662). PCR-CTPP failed clear genotyping for the polymorphism, while OPA-CTPP successfully produced PCR products corresponding to the allele. The present example indicated that the OPA-CTPP would be useful in the case that PCR-CTPP failed to produce balanced PCR products specific to each allele.

  12. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether theremore » are also TaqMan/Luminex probe matches within predicted amplicons.« less

  13. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    SciTech Connect

    Gardner, S. N.

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  14. Rapid and simple method of qPCR primer design.

    PubMed

    Thornton, Brenda; Basu, Chhandak

    2015-01-01

    Quantitative real-time polymerase chain reaction (qPCR) is a powerful tool for analysis and quantification of gene expression. It is advantageous compared to traditional gel-based method of PCR, as gene expression can be visualized "real-time" using a computer. In qPCR, a reporter dye system is used which intercalates with DNA's region of interest and detects DNA amplification. Some of the popular reporter systems used in qPCR are the following: Molecular Beacon(®), SYBR Green(®), and Taqman(®). However, success of qPCR depends on the optimal primers used. Some of the considerations for primer design are the following: GC content, primer self-dimer, or secondary structure formation. Freely available software could be used for ideal qPCR primer design. Here we have shown how to use some freely available web-based software programs (such as Primerquest(®), Unafold(®), and Beacon designer(®)) to design qPCR primers.

  15. Homolog-specific PCR primer design for profiling splice variants

    PubMed Central

    Srivastava, Gyan Prakash; Hanumappa, Mamatha; Kushwaha, Garima; Nguyen, Henry T.; Xu, Dong

    2011-01-01

    To study functional diversity of proteins encoded from a single gene, it is important to distinguish the expression levels among the alternatively spliced variants. A variant-specific primer pair is required to amplify each alternatively spliced variant individually. For this purpose, we developed a new feature, homolog-specific primer design (HSPD), in our high-throughput primer and probe design software tool, PRIMEGENS-v2. The algorithm uses a de novo approach to design primers without any prior information of splice variants or close homologs for an input query sequence. It not only designs primer pairs but also finds potential isoforms and homologs of the input sequence. Efficiency of this algorithm was tested for several gene families in soybean. A total of 187 primer pairs were tested under five different abiotic stress conditions with three replications at three time points. Results indicate a high success rate of primer design. Some primer pairs designed were able to amplify all splice variants of a gene. Furthermore, by utilizing combinations within the same multiplex pool, we were able to uniquely amplify a specific variant or duplicate gene. Our method can also be used to design PCR primers to specifically amplify homologs in the same gene family. PRIMEGENS-v2 is available at: http://primegens.org. PMID:21415011

  16. Primer design for PCR reactions in forensic biology.

    PubMed

    Elkins, Kelly M

    2015-01-01

    The polymerase chain reaction (PCR) is a popular method to copy DNA in vitro. Its invention revolutionized fields ranging from clinical medicine to anthropology, molecular biology, and forensic biology. The method employs one of many available heat-stable DNA polymerases in a reaction that is repeated many times in situ. The DNA polymerase reads a template DNA strand and using the components of the reaction mix, catalyzes the addition of free 2'-deoxynucleotide triphosphate nitrogenous bases to short segment of DNA that forms a complement with the template via Watson-Crick base pairing. This short segment of DNA is referred to as a PCR primer and it is essential to the success of the reaction. The most widely used application of PCR in forensic labs is the amplification of short tandem repeat (STR) loci used in DNA typing. The STRs are routinely evaluated in concert with 16 or more reactions, a multiplex, run in one test tube simultaneously. In a multiplex, it is essential that the primers work specifically and accurately on the intended reactions without hindering the other reactions. The primers, which are very specific, also can be used to probe single nucleotide polymorphisms (SNPs) in a DNA sequence of interest by single base extension. Primers are often designed using one of many available automated software packages. Here the process of manually designing PCR primers for forensic biology using no-cost software is described.

  17. PCR Primers for Metazoan Mitochondrial 12S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Kweskin, Matthew; Knowlton, Nancy

    2012-01-01

    Background Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. Methodology/Principal Findings A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. Conclusions/Significance Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans. PMID:22536450

  18. Real-time PCR (qPCR) primer design using free online software.

    PubMed

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software.

  19. Rational primer design greatly improves differential display-PCR (DD-PCR).

    PubMed Central

    Graf, D; Fisher, A G; Merkenschlager, M

    1997-01-01

    Since its conception in 1992, differential display PCR (DD-PCR) has attracted widespread interest. Theoretically an attractive cloning approach, it combines the comparative analysis of several samples with the sensitivity of PCR. Although a large number of studies embracing this technology have been initiated, few novel genes of interest have been identified, suggesting that the method has not realised its potential. The present report shows that by modifying primer design, sampling of differentially expressed genes can be greatly enhanced and relevant genes can be isolated. Using our modified conditions DD-PCR efficiently screens a wide range of gene expression levels, in which differences are represented on a linear scale. PMID:9153330

  20. Whole genome amplification using single-primer PCR.

    PubMed

    Lao, Kaiqin; Xu, Nan Lan; Straus, Neil A

    2008-03-01

    Comprehensive genomic molecular analyses require relatively large DNA amounts that are often not available from forensic, clinical and other crucial biological samples. Numerous methods to amplify the whole genome have been proposed for cancer, forensic and taxonomic research. Unfortunately, when using truly random primers for the initial priming step, all of these procedures suffer from high background problems for sub-nanogram quantities of input DNA. Here we report an approach to eliminate this problem for PCR-based methods even at levels of DNA approaching that of a single cell.

  1. COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

    PubMed Central

    2016-01-01

    Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

  2. FUNGAL-SPECIFIC PCR PRIMERS DEVELOPED FOR ANALYSIS OF THE ITS REGION OF ENVIRONMENTAL DNA EXTRACTS

    EPA Science Inventory

    Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmenta...

  3. STITCHER: A web resource for high-throughput design of primers for overlapping PCR applications.

    PubMed

    O'Halloran, Damien M

    2015-06-01

    Overlapping PCR is routinely used in a wide number of molecular applications. These include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping by traditional PCR techniques and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online (http://ohalloranlab.net/STITCHER.html). STITCHER can handle both single sequence and multi-sequence input, and specific features facilitate numerous other PCR applications, including assembly PCR, adapter PCR, and primer walking. Field PCR, and in particular, LAMP, offers promise as an on site tool for pathogen detection in underdeveloped areas, and STITCHER includes off-target detection features for pathogens commonly targeted using LAMP technology.

  4. Biofunctionalization of Polyoxometalates with DNA Primers, Their Use in the Polymerase Chain Reaction (PCR) and Electrochemical Detection of PCR Products.

    PubMed

    Debela, Ahmed M; Ortiz, Mayreli; Beni, Valerio; Thorimbert, Serge; Lesage, Denis; Cole, Richard B; O'Sullivan, Ciara K; Hasenknopf, Bernold

    2015-12-01

    The bioconjugation of polyoxometalates (POMs), which are inorganic metal oxido clusters, to DNA strands to obtain functional labeled DNA primers and their potential use in electrochemical detection have been investigated. Activated monooxoacylated polyoxotungstates [SiW11 O39 {Sn(CH2 )2 CO}](8-) and [P2 W17 O61 {Sn(CH2 )2 CO}](6-) have been used to link to a 5'-NH2 terminated 21-mer DNA forward primer through amide coupling. The functionalized primer was characterized by using a battery of techniques, including electrophoresis, mass spectrometry, as well as IR and Raman spectroscopy. The functionality of the POM-labeled primers was demonstrated through hybridization with a surface-immobilized probe. Finally, the labeled primers were successfully used in the polymerase chain reaction (PCR) and the PCR products were characterized by using electrophoresis.

  5. Novel primers and PCR protocols for the specific detection and quantification of Sphingobium suberifaciens in situ

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The pathogen causing corky root on lettuce, Sphingobium suberifaciens, is recalcitrant to standard epidemiological methods. Primers were selected from 16S rDNA sequences useful for the specific detection and quantification of S. suberifaciens. Conventional (PCR) and quantitative (qPCR) PCR protocols...

  6. Guidelines for the tetra-primer ARMS-PCR technique development.

    PubMed

    Medrano, Ruan Felipe Vieira; de Oliveira, Camila Andréa

    2014-07-01

    The tetra-primer amplification refractory mutation system-polymerase chain (ARMS-PCR) reaction is a simple and economical method to genotype single-nucleotide polymorphisms (SNPs). It uses four primers in a single PCR and is followed just by gel electrophoresis. However, the optimization step can be very hardworking and time-consuming. Hence, we propose to demonstrate and discuss critical steps for its development, in a way to provide useful information. Two SNPs that provided different amplification conditions were selected. DNA extraction methods, annealing temperatures, PCR cycles protocols, reagents, and primers concentration were also analyzed. The use of tetra-primer ARMS-PCR could be impaired for SNPs in DNA regions rich in cytosine and guanine and for samples with DNA not purified. The melting temperature was considered the factor of greater interference. However, small changes in the reagents concentration significantly affect the PCR, especially MgCl2. Balancing the inner primers band is also a key step. So, in order to balance the inner primers band, intensity is important to observe which one has the weakest band and promote its band by increasing its concentration. The use of tetra-primer ARMS-PCR attends the expectations of modern genomic research and allows the study of SNPs in a fast, reliable, and low-cost way. PMID:24519268

  7. MFEprimer-2.0: a fast thermodynamics-based program for checking PCR primer specificity.

    PubMed

    Qu, Wubin; Zhou, Yang; Zhang, Yanchun; Lu, Yiming; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2012-07-01

    Evaluating the specificity of polymerase chain reaction (PCR) primers is an essential step in PCR primer design. The MFEprimer-2.0 server allows users to check primer specificity against genomic DNA and messenger RNA/complementary DNA sequence databases quickly and easily. MFEprimer-2.0 uses a k-mer index algorithm to accelerate the search process for primer binding sites and uses thermodynamics to evaluate binding stability between each primer and its DNA template. Several important characteristics, such as the sequence, melting temperature and size of each amplicon, either specific or non-specific, are reported on the results page. Based on these characteristics and the user-friendly output, users can readily draw conclusions about the specificity of PCR primers. Analyses for degenerate primers and multiple PCR primers are also supported in MFEprimer-2.0. In addition, the databases supported by MFEprimer-2.0 are comprehensive, and custom databases can also be supported on request. The MFEprimer-2.0 server does not require a login and is freely available at http://biocompute.bmi.ac.cn/CZlab/MFEprimer-2.0. More over, the MFEprimer-2.0 command-line version and local server version are open source and can be downloaded at https://github.com/quwubin/MFEprimer/wiki/Manual/.

  8. PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.

    PubMed

    Pauthenier, Cyrille; Faulon, Jean-Loup

    2014-07-01

    PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. PMID:24829457

  9. PCR hot start using primers with the structure of molecular beacons (hairpin-like structure).

    PubMed

    Kaboev, O K; Luchkina, L A; Tret'iakov, A N; Bahrmand, A R

    2000-11-01

    A new technique of PCR hot start using oligonucleotide primers with a stem-loop structure is developed here. The molecular beacon oligonucleotide structure without any chromophore addition to the ends was used. The 3'-end sequence of the primers was complementary to the target and five or six nucleotides complementary to the 3'-end were added to the 5'-end. During preparation of the reaction mixture and initial heating, the oligonucleotide has a stem-loop structure and cannot serve as an effective primer for DNA polymerase. After heating to the annealing temperature it acquires a linear structure and primer extension can begin.

  10. Cloning flanking sequence by single-primer PCR in transgenic plants.

    PubMed

    Ma, J; Wang, Y P; Ren, S; Zhang, Z; Lu, S; Wang, P W

    2014-10-20

    The insertion position of exogenous genes in plant genomes is usually identified by adapter ligation-mediated polymerase chain reaction (PCR), thermal asymmetric interlaced PCR, and restriction site extension PCR in transgenic plant research. However, these methods have various limitations, such as the complexity of designing primers and time-consuming and multiple-step procedures. The goal of this study was to establish an easier, more rapid, and more accurate method to clone flanking sequence using single-primer PCR in transgenic plants. Unknown flanking genome sequences in transgenic plants, including those in tobacco, soybean, rice, and maize, were cloned using the single-primer PCR method established in this study, with the Bar gene as the anchor gene. The primer 1 (P1), P2, and P3 PCRs obtained 4 sequences, and the completely correct flanking sequence of 508 bp that was obtained in the P3 PCR was verified by sequencing analysis. The single-primer PCR is more rapid and accurate than conventional methods, justifying its application widely in cloning flanking sequences in transgenic plants.

  11. PCR primers for the amplification of four insect mitochondrial gene fragments.

    PubMed

    Kambhampati, S; Smith, P T

    1995-11-01

    Insect mitochondrial genome (mtDNA) analysis is a powerful tool for the study of population genetics and phylogenetics. In the past few years primer sequences for the PCR amplification of various insect mtDNA genes have been published. The objectives of this study were (1) present new primer sequences for six insect mitochondrial genes and (2) test primers designed in our laboratory and some previously published primers on a wide range of insects to determine if amplification of the target fragment could be obtained. The primers for the amplification of the two ribosomal RNA gene (16S and 12S rRNA) fragments are universal for insects and related groups; the primers for NADH5 and NADH4 dehydrogenase gene fragments and cytochrome c oxidase I gene fragment are applicable broadly.

  12. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    ERIC Educational Resources Information Center

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  13. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  14. PCR Conditions for 16S Primers for Analysis of Microbes in the Colon of Rats.

    PubMed

    Guillen, I A; Camacho, H; Tuero, A D; Bacardí, D; Palenzuela, D O; Aguilera, A; Silva, J A; Estrada, R; Gell, O; Suárez, J; Ancizar, J; Brown, E; Colarte, A B; Castro, J; Novoa, L I

    2016-09-01

    The study of the composition of the intestinal flora is important to the health of the host, playing a key role in maintaining intestinal homeostasis and the evolution of the immune system. For these studies, various universal primers of the 16S rDNA gene are used in microbial taxonomy. Here, we report an evaluation of 5 universal primers to explore the presence of microbial DNA in colon biopsies preserved in RNAlater solution. The DNA extracted was used for the amplification of PCR products containing the variable (V) regions of the microbial 16S rDNA gene. The PCR products were studied by restriction fragment length polymorphism (RFLP) analysis and DNA sequence, whose percent of homology with microbial sequences reported in GenBank was verified using bioinformatics tools. The presence of microbes in the colon of rats was quantified by the quantitative PCR (qPCR) technique. We obtained microbial DNA from rat, useful for PCR analysis with the universal primers for the bacteria 16S rDNA. The sequences of PCR products obtained from a colon biopsy of the animal showed homology with the classes bacilli (Lactobacillus spp) and proteobacteria, normally represented in the colon of rats. The proposed methodology allowed the attainment of DNA of bacteria with the quality and integrity for use in qPCR, sequencing, and PCR-RFLP analysis. The selected universal primers provided knowledge of the abundance of microorganisms and the formation of a preliminary test of bacterial diversity in rat colon biopsies. PMID:27382362

  15. PCR Conditions for 16S Primers for Analysis of Microbes in the Colon of Rats.

    PubMed

    Guillen, I A; Camacho, H; Tuero, A D; Bacardí, D; Palenzuela, D O; Aguilera, A; Silva, J A; Estrada, R; Gell, O; Suárez, J; Ancizar, J; Brown, E; Colarte, A B; Castro, J; Novoa, L I

    2016-09-01

    The study of the composition of the intestinal flora is important to the health of the host, playing a key role in maintaining intestinal homeostasis and the evolution of the immune system. For these studies, various universal primers of the 16S rDNA gene are used in microbial taxonomy. Here, we report an evaluation of 5 universal primers to explore the presence of microbial DNA in colon biopsies preserved in RNAlater solution. The DNA extracted was used for the amplification of PCR products containing the variable (V) regions of the microbial 16S rDNA gene. The PCR products were studied by restriction fragment length polymorphism (RFLP) analysis and DNA sequence, whose percent of homology with microbial sequences reported in GenBank was verified using bioinformatics tools. The presence of microbes in the colon of rats was quantified by the quantitative PCR (qPCR) technique. We obtained microbial DNA from rat, useful for PCR analysis with the universal primers for the bacteria 16S rDNA. The sequences of PCR products obtained from a colon biopsy of the animal showed homology with the classes bacilli (Lactobacillus spp) and proteobacteria, normally represented in the colon of rats. The proposed methodology allowed the attainment of DNA of bacteria with the quality and integrity for use in qPCR, sequencing, and PCR-RFLP analysis. The selected universal primers provided knowledge of the abundance of microorganisms and the formation of a preliminary test of bacterial diversity in rat colon biopsies.

  16. PCR Conditions for 16S Primers for Analysis of Microbes in the Colon of Rats

    PubMed Central

    Camacho, H.; Tuero, A. D.; Bacardí, D.; Palenzuela, D. O.; Aguilera, A.; Silva, J. A.; Estrada, R.; Gell, O.; Suárez, J.; Ancizar, J.; Brown, E.; Colarte, A. B.; Castro, J.; Novoa, L. I.

    2016-01-01

    The study of the composition of the intestinal flora is important to the health of the host, playing a key role in maintaining intestinal homeostasis and the evolution of the immune system. For these studies, various universal primers of the 16S rDNA gene are used in microbial taxonomy. Here, we report an evaluation of 5 universal primers to explore the presence of microbial DNA in colon biopsies preserved in RNAlater solution. The DNA extracted was used for the amplification of PCR products containing the variable (V) regions of the microbial 16S rDNA gene. The PCR products were studied by restriction fragment length polymorphism (RFLP) analysis and DNA sequence, whose percent of homology with microbial sequences reported in GenBank was verified using bioinformatics tools. The presence of microbes in the colon of rats was quantified by the quantitative PCR (qPCR) technique. We obtained microbial DNA from rat, useful for PCR analysis with the universal primers for the bacteria 16S rDNA. The sequences of PCR products obtained from a colon biopsy of the animal showed homology with the classes bacilli (Lactobacillus spp) and proteobacteria, normally represented in the colon of rats. The proposed methodology allowed the attainment of DNA of bacteria with the quality and integrity for use in qPCR, sequencing, and PCR-RFLP analysis. The selected universal primers provided knowledge of the abundance of microorganisms and the formation of a preliminary test of bacterial diversity in rat colon biopsies. PMID:27382362

  17. Multiplex PCR based on a universal biotinylated primer to generate templates for pyrosequencing.

    PubMed

    Chen, Zhiyao; Liu, Yunlong; Duan, Wenbang; Ye, Hui; Wu, Haiping; Li, Jinheng; Zhou, Guohua

    2014-06-01

    Pyrosequencing is a powerful tool widely used in genetic analysis, however template preparation prior to pyrosequencing is still costly and time-consuming. To achieve an inexpensive and labor-saving template preparation for pyrosequencing, we have successfully developed a single-tube multiplex PCR including a pre-amplification and a universal amplification. In the process of pre-amplification, a low concentration of target-specific primers tagged with universal ends introduced universal priming regions into amplicons. In the process of universal amplification, a high concentration of universal primers was used for yielding amplicons with various SNPs of interest. As only a universal biotinylated primer and one step of single-stranded DNA preparation were required for typing multiple SNPs located on different sequences, pyrosequencing-based genotyping became time-saving, labor-saving, sample-saving, and cost-saving. By a simple optimization of multiplex PCR condition, only a 4-plex and a 3-plex PCR were required for typing 7 SNPs related to tamoxifen metabolism. Further study showed that pyrosequencing coupled with an improved multiplex PCR protocol allowed around 30% decrease of either typing cost or typing labor. Considering the biotinylated primer and the optimized condition of the multiplex PCR are independent of SNP locus, it is easy to use the same condition and the identical biotinylated primer for typing other SNPs. The preliminary typing results of the 7 SNPs in 11 samples demonstrated that multiplex PCR-based pyrosequencing could be promising in personalized medicine at a low cost.

  18. A new tetra-primer ARMS-PCR for genotyping bovine kappa-casein polymorphisms.

    PubMed

    Fonseca, P A S; Rosse, I C; Demiranda, M; Machado, M A; Verneque, R S; Peixoto, M G C D; Carvalho, M R S

    2013-12-11

    Kappa-casein (κ-casein) is one of the most abundant milk proteins. Its main function is to avoid the aggregation of casein micelles, keeping them, and therefore calcium phosphate, in pockets in solution. In bovines, a κ-casein functional polymorphism has been associated with fat, calcium, and protein milk contents and faster curd contraction in cheese production. Quicker curd contraction reduces the loss of milk solids, enhancing cheese yield. This polymorphism induces a double amino acid substitution (Thr136Ile and Ala148Asp). The polymorphism is normally detected by PCR-RFLP, which is a laborious method. An interesting methodological alternative is the tetra-primer amplification refractory mutation system PCR (tetra-primer ARMS-PCR). A tetra-primer ARMS-PCR for the detection of this κ-casein polymorphism has been described. However, specificity was not achieved, probably due to problems with primer design. We developed a new tetra-primer ARMS-PCR for the detection of the κ-casein polymorphism. This new method was validated in a double-blind test, by comparison with the results obtained for 50 Guzerá bulls formerly genotyped by PCR-RFLP. This new method achieved 100% sensitivity and specificity. We conclude that this method is a useful, cost-efficient alternative for the detection of functional κ-casein polymorphisms.

  19. A novel universal primer-multiplex-PCR method with sequencing gel electrophoresis analysis.

    PubMed

    Xu, Wentao; Zhai, Zhifang; Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

    2012-01-01

    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5'-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on.

  20. Heat-activatable primers for hot-start PCR and hot-start one-step RT-PCR: endpoint and real-time experiments.

    PubMed

    Ashrafi, Elena Hidalgo; Paul, Natasha

    2009-10-01

    Hot-start PCR is a technique that improves PCR performance by reducing nonspecific amplification during the initial setup stages of the PCR. This unit describes hot-start PCR protocols which utilize primers containing temperature-sensitive modifications. The introduction of 4-oxo-tetradecyl (OXT) phosphotriester groups onto the 3' end of the primer allows for primer-based hot-start PCR that is amenable for use in a number of PCR-based applications. The protocols described in this unit utilize OXT-modified primers in applications such as standard thermal cycling PCR, fast thermal cycling PCR, multiplex PCR, and one-step reverse-transcription PCR. This method is also advantageous for instances where improved PCR specificity is desired and a hot-start polymerase suitable for your application is not available.

  1. A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR

    PubMed Central

    Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven

    2016-01-01

    Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and

  2. A Comprehensive Evaluation of PCR Primers to Amplify the nifH Gene of Nitrogenase

    PubMed Central

    Gaby, John Christian; Buckley, Daniel H.

    2012-01-01

    The nifH gene is the most widely sequenced marker gene used to identify nitrogen-fixing Bacteria and Archaea. Numerous PCR primers have been designed to amplify nifH, but a comprehensive evaluation of nifH PCR primers has not been performed. We performed an in silico analysis of the specificity and coverage of 51 universal and 35 group-specific nifH primers by using an aligned database of 23,847 nifH sequences. We found that there are 15 universal nifH primers that target 90% or more of nitrogen fixers, but that there are also 23 nifH primers that target less than 50% of nifH sequences. The nifH primers we evaluated vary in their phylogenetic bias and their ability to recover sequences from commonly sampled environments. In addition, many of these primers will amplify genes that do not mediate nitrogen fixation, and thus it would be advisable for researchers to screen their sequencing results for the presence of non-target genes before analysis. Universal primers that performed well in silico were tested empirically with soil samples and with genomic DNA from a phylogenetically diverse set of nitrogen-fixing strains. This analysis will be of great utility to those engaged in molecular analysis of nifH genes from isolates and environmental samples. PMID:22848735

  3. Indexed PCR Primers Induce Template-Specific Bias in Large-Scale DNA Sequencing Studies

    PubMed Central

    O’Donnell, James L.; Kelly, Ryan P.; Lowell, Natalie C.; Port, Jesse A.

    2016-01-01

    Massively parallel sequencing is rapidly emerging as an efficient way to quantify biodiversity at all levels, from genetic variation and expression to ecological community assemblage. However, the number of reads produced per sequencing run far exceeds the number required per sample for many applications, compelling researchers to sequence multiple samples per run in order to maximize efficiency. For studies that include a PCR step, this can be accomplished using primers that include an index sequence allowing sample origin to be determined after sequencing. The use of indexed primers assumes they behave no differently than standard primers; however, we found that indexed primers cause substantial template sequence-specific bias, resulting in radically different profiles of the same environmental sample. Likely the outcome of differential amplification efficiency due to primer-template mismatch, two indexed primer sets spuriously change the inferred sequence abundance from the same DNA extraction by up to 77.1%. We demonstrate that a double PCR approach alleviates these effects in applications where indexed primers are necessary. PMID:26950069

  4. Real-Time PCR (qPCR) Primer Design Using Free Online Software

    ERIC Educational Resources Information Center

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

  5. Specific oligonucleotide primers for detection of lecithinase-positive Bacillus spp. by PCR.

    PubMed Central

    Schraft, H; Griffiths, M W

    1995-01-01

    An assay based on the PCR has been developed to facilitate detection and identification of Bacillus cereus in foods. Three primers for the PCR have been designed within the sequence for cereolysin AB, a cytolytic determinant that encodes lecithin-hydrolyzing and hemolytic activities of B. cereus. With the PCR and hybridization, the specificity of the primers was tested with 39 isolates of the B. cereus group, with 17 other Bacillus spp., and with 21 non-Bacillus strains. Results demonstrate a high specificity of the three oligonucleotides for isolates of the B. cereus group. With a combined PCR-hybridization assay, the detection limit for B. cereus in artificially contaminated milk was 1 CFU/ml of milk. PMID:7887632

  6. Advances in multiplex PCR: balancing primer efficiencies and improving detection success

    PubMed Central

    Sint, Daniela; Raso, Lorna; Traugott, Michael

    2012-01-01

    1. Multiplex PCR is a valuable tool in many biological studies but it is a multifaceted procedure that has to be planned and optimised thoroughly to achieve robust and meaningful results. In particular, primer concentrations have to be adjusted to assure an even amplification of all targeted DNA fragments. Until now, total DNA extracts were used for balancing primer efficiencies; however, the applicability for comparisons between taxa or different multiple-copy genes was limited owing to the unknown number of template molecules present per total DNA. 2. Based on a multiplex system developed to track trophic interactions in high Alpine arthropods, we demonstrate a fast and easy way of generating standardised DNA templates. These were then used to balance the amplification success for the different targets and to subsequently determine the sensitivity of each primer pair in the multiplex PCR. 3. In the current multiplex assay, this approach led to an even amplification success for all seven targeted DNA fragments. Using this balanced multiplex PCR, methodological bias owing to variation in primer efficiency will be avoided when analysing field-derived samples. 4. The approach outlined here allows comparing multiplex PCR sensitivity, independent of the investigated species, genome size or the targeted genes. The application of standardised DNA templates not only makes it possible to optimise primer efficiency within a given multiplex PCR, but it also offers to adjust and/or to compare the sensitivity between different assays. Along with other factors that influence the success of multiplex reactions, and which we discuss here in relation to the presented detection system, the adoption of this approach will allow for direct comparison of multiplex PCR data between systems and studies, enhancing the utility of this assay type. PMID:23549328

  7. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera

    PubMed Central

    Wahlberg, Niklas; Peña, Carlos; Ahola, Milla; Wheat, Christopher W.; Rota, Jadranka

    2016-01-01

    Abstract We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera, including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera. We feel that a PCR-based approach still has its place in molecular systematic studies of Lepidoptera, particularly at the intrafamilial level, and our new set of primers now provides a route to generating phylogenomic datasets using traditional methods. PMID:27408580

  8. Single-primer PCR amplification of segments of the main noncoding region of human mitochondrial DNA

    SciTech Connect

    Derenko, M.V.; Malyarchuk, B.A.

    1994-11-01

    A method for amplifying segments of the main noncoding region of human mitochondrial DNA using a single-primer PCR is proposed. The method employs oligonucleotides that are homologous to this region of the human mitochondrial genome. Possible reaction mechanisms and the prospects for using the method in evolutionary and population genetic studies are discussed. 15 refs., 1 fig.

  9. Comparison of nine PCR primer sets designed to detect Pantoea stewartii subsp. stewartii in maize

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pantoea stewartii subsp. stewartii, the causal agent of Stewart's bacterial wilt of maize, is a major quarantine pest in maize seed. Verifying freedom from P. stewartii remains a significant hurdle in exporting corn seed from the U.S. Several PCR primer sets have been developed and suggested as bein...

  10. Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.

    PubMed

    Lee, Jaikoo; Lee, Sangsun; Young, J Peter W

    2008-08-01

    A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups. PMID:18631176

  11. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR

    PubMed Central

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-01-01

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350

  12. Revealing the Diversity and Quantity of Peritrich Ciliates in Environmental Samples Using Specific Primer-based PCR and Quantitative PCR

    PubMed Central

    Liu, Xihan; Gong, Jun

    2012-01-01

    Peritrichs are a diverse, ecologically important ciliate group usually with a complex life cycle. To date, the community of the peritrichs has been investigated by using morphology-based methods such as living observation and silver staining. Here we show a molecular approach for characterizing the diversity and quantity of free-living peritrichs in environmental samples. We newly designed four peritrich-specific primers targeting 18S rRNA genes that allow clone library construction, screening and analysis. A quantitative real-time PCR (qPCR) assay was developed to quantify peritrichs in environmental samples by using rDNA copy number as an indicator. DNA extracted from four water samples of contrasting environmental gradients was analysed. The results showed that the peritrich community was differentiated among these samples, and that the diversity decreased with the increase of water salinity. The qPCR results are consistent with the library sequence analysis in terms of quantity variations from sample to sample. The development of peritrich-specific primers, for the first time, for conventional PCR and qPCR assays, provides useful molecular tools for revealing the diversity and quantity of peritrich ciliates in environmental samples. Also, our study illustrates the potential of these molecular tools to ecological studies of other ciliate groups in diverse environments. PMID:23100023

  13. primers4clades: a web server that uses phylogenetic trees to design lineage-specific PCR primers for metagenomic and diversity studies

    PubMed Central

    Contreras-Moreira, Bruno; Sachman-Ruiz, Bernardo; Figueroa-Palacios, Iraís; Vinuesa, Pablo

    2009-01-01

    Primers4clades is an easy-to-use web server that implements a fully automatic PCR primer design pipeline for cross-species amplification of novel sequences from metagenomic DNA, or from uncharacterized organisms, belonging to user-specified phylogenetic clades or taxa. The server takes a set of non-aligned protein coding genes, with or without introns, aligns them and computes a neighbor-joining tree, which is displayed on screen for easy selection of species or sequence clusters to design lineage-specific PCR primers. Primers4clades implements an extended CODEHOP primer design strategy based on both DNA and protein multiple sequence alignments. It evaluates several thermodynamic properties of the oligonucleotide pairs, and computes the phylogenetic information content of the predicted amplicon sets from Shimodaira–Hasegawa-like branch support values of maximum likelihood phylogenies. A non-redundant set of primer formulations is returned, ranked according to their thermodynamic properties. An amplicon distribution map provides a convenient overview of the coverage of the target locus. Altogether these features greatly help the user in making an informed choice between alternative primer pair formulations. Primers4clades is available at two mirror sites: http://maya.ccg.unam.mx/primers4clades/and http://floresta.eead.csic.es/primers4clades/. Three demo data sets and a comprehensive documentation/tutorial page are provided for easy testing of the server's capabilities and interface. PMID:19465390

  14. primers4clades: a web server that uses phylogenetic trees to design lineage-specific PCR primers for metagenomic and diversity studies.

    PubMed

    Contreras-Moreira, Bruno; Sachman-Ruiz, Bernardo; Figueroa-Palacios, Iraís; Vinuesa, Pablo

    2009-07-01

    Primers4clades is an easy-to-use web server that implements a fully automatic PCR primer design pipeline for cross-species amplification of novel sequences from metagenomic DNA, or from uncharacterized organisms, belonging to user-specified phylogenetic clades or taxa. The server takes a set of non-aligned protein coding genes, with or without introns, aligns them and computes a neighbor-joining tree, which is displayed on screen for easy selection of species or sequence clusters to design lineage-specific PCR primers. Primers4clades implements an extended CODEHOP primer design strategy based on both DNA and protein multiple sequence alignments. It evaluates several thermodynamic properties of the oligonucleotide pairs, and computes the phylogenetic information content of the predicted amplicon sets from Shimodaira-Hasegawa-like branch support values of maximum likelihood phylogenies. A non-redundant set of primer formulations is returned, ranked according to their thermodynamic properties. An amplicon distribution map provides a convenient overview of the coverage of the target locus. Altogether these features greatly help the user in making an informed choice between alternative primer pair formulations. Primers4clades is available at two mirror sites: http://maya.ccg.unam.mx/primers4clades/and http://floresta.eead.csic.es/primers4clades/. Three demo data sets and a comprehensive documentation/tutorial page are provided for easy testing of the server's capabilities and interface.

  15. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy

    2012-01-01

    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  16. Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays

    PubMed Central

    Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J. L.; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

    2016-01-01

    Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download. PMID:26863543

  17. Development of SCAR Primers for PCR Assay to Detect Diplodia seriata

    PubMed Central

    Martín, M. T.; Cuesta, M. J.; Martín, L.

    2014-01-01

    The aim of this study was to develop primer pairs for Diplodia seriata identification, one of the most common fungal species associated with grapevine decline in Castilla y León (Spain). Genetic variability of selected isolates of D. seriata was estimated. A molecular marker was generated from a random amplified polymorphic DNA (RAPD) fragment. PCR products of around 1200 bp were obtained with OPE20 primer. The PCR products were cloned and sequenced. The sequences were compared and a fragment of 1207 bp was used to design primer pairs. Two primer pairs were selected (DS3.8 S3-DS3.8 R6 and DS3.8 S3-DS3.8 R4) that amplified a single DNA product of 634 bp and 233 bp, respectively, with D. seriata isolates. No amplification was obtained for any of the 57 isolates of other species. The designed SCAR primer pairs allowed a rapid detection of D. seriata, and were able to detect 0.1 pg of the target DNA. Detection was specific and sensitive for D. seriata. The established protocols detected these fungi in naturally infected grapevines after DNA purification. Diplodia seriata was detectable without DNA purification and isolation in 62.5% to 75% of reactions. The detection of this pathogen in wood samples has great potential for use in pathogen-free certification schemes. PMID:27437468

  18. Development of SCAR Primers for PCR Assay to Detect Diplodia seriata.

    PubMed

    Martín, M T; Cuesta, M J; Martín, L

    2014-01-01

    The aim of this study was to develop primer pairs for Diplodia seriata identification, one of the most common fungal species associated with grapevine decline in Castilla y León (Spain). Genetic variability of selected isolates of D. seriata was estimated. A molecular marker was generated from a random amplified polymorphic DNA (RAPD) fragment. PCR products of around 1200 bp were obtained with OPE20 primer. The PCR products were cloned and sequenced. The sequences were compared and a fragment of 1207 bp was used to design primer pairs. Two primer pairs were selected (DS3.8 S3-DS3.8 R6 and DS3.8 S3-DS3.8 R4) that amplified a single DNA product of 634 bp and 233 bp, respectively, with D. seriata isolates. No amplification was obtained for any of the 57 isolates of other species. The designed SCAR primer pairs allowed a rapid detection of D. seriata, and were able to detect 0.1 pg of the target DNA. Detection was specific and sensitive for D. seriata. The established protocols detected these fungi in naturally infected grapevines after DNA purification. Diplodia seriata was detectable without DNA purification and isolation in 62.5% to 75% of reactions. The detection of this pathogen in wood samples has great potential for use in pathogen-free certification schemes.

  19. Helicobacter pylori in dental plaque: a comparison of different PCR primer sets.

    PubMed

    Song, Q; Haller, B; Schmid, R M; Adler, G; Bode, G

    1999-03-01

    This study was designed to compare different primer sets for PCR analysis of H. pylori in the same series of 40 dental plaque samples. Three pairs of primers, HPU1/HPU2, HP1/HP2, and EHC-U/EHC-L, directed to the urease A gene, 16S rRNA gene, or 860-bp DNA of H. pylori, respectively, were used. Our results demonstrate that EHC-L/EHC-U were more specific and sensitive for H. pylori added to saliva or dental plaque than HPU1/HPU2 and HP1/HP2. The detection rates for H. pylori DNA in dental plaque samples from randomly selected adult patients from the Dental Clinic of the University of Ulm were 26.5% (9/34) for HPU1/HPU2, 78.9% (30/38) for HP1/HP2, and 100% (40/40) for EHC-U/EHC-L (P < 0.001). Nested PCR using primers directed to the 860-bp DNA of H. pylori further confirmed the presence of H. pylori DNA (40/40) in all these samples. Our results indicate that primers EHC-U/EHC-L are to be recommended for PCR detection of H. pylori in the oral cavity.

  20. Problems with and a system to eliminate single-primer PCR product contamination in simple sequence repeat molecular marker-assisted selection in soybean.

    PubMed

    Ma, J; Guan, S C; Yao, D; Wei, Y F; Wang, P W

    2011-01-01

    Polymerase chain reaction (PCR) provides a foundation for simple sequence repeat molecular marker-assisted selection (SSR MAS) in soybean. This PCR system and its various conditions have been optimized by many researchers. However, current research on the optimization of the PCR system focuses on double-primer PCR products. We compared single- and double-SSR primer PCR products from 50 soybean samples and found that the use of single-PCR primers in the reaction system can lead to amplified fragments of portions of the SSR primers in the PCR process, resulting in both false-positives and fragment impurity of double-primer PCR amplification, inconvenient for subsequent analysis. We used "single-primer PCR correction" to eliminate interference caused by single-primer nonspecific PCR amplification and improve PCR quality. Using this method, the precision and success rates of SSR MAS in soybean can be increased.

  1. Removal of PCR Error Products and Unincorporated Primers by Metal-Chelate Affinity Chromatography

    PubMed Central

    Kanakaraj, Indhu; Jewell, David L.; Murphy, Jason C.; Fox, George E.; Willson, Richard C.

    2011-01-01

    Immobilized Metal Affinity Chromatography (IMAC) has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and “histidine tags” genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu2+-iminodiacetic acid (IDA) agarose spin column, 94–99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu2+-IDA agarose) can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs. PMID:21264292

  2. Sensitive, microliter PCR with consensus degenerate primers for Epstein Barr virus amplification

    PubMed Central

    Oh, Kyudam; Pak, Nikita; Saunders, D. Curtis; Conrardy, Christina; Landers, James P.; Tong, Suxiang; Forest, Craig R.

    2016-01-01

    Sensitive identification of the etiology of viral diseases is key to implementing appropriate prevention and treatment. The gold standard for virus identification is the polymerase chain reaction (PCR), a technique that allows for highly specific and sensitive detection of pathogens by exponentially amplifying a specific region of DNA from as little as a single copy through thermocycling a biochemical cocktail. Today, molecular biology laboratories use commercial instruments that operate in 0.5–2 h/analysis using reaction volumes of 5–50 μL contained within polymer tubes or chambers. Towards reducing this volume and maintaining performance, we present a semi-quantitative, systematic experimental study of how PCR yield is affected by tube/chamber substrate, surface-area-to-volume ratio (SA:V), and passivation methods. We perform PCR experiments using traditional PCR tubes as well as using disposable polymer microchips with 1 μL reaction volumes thermocycled using water baths. We report the first oil encapsulation microfluidic PCR method without fluid flow and its application to the first microfluidic amplification of Epstein Barr virus using consensus degenerate primers, a powerful and broad PCR method to screen for both known and novel members of a viral family. The limit of detection is measured as 140 starting copies of DNA from a starting concentration of 3×105 copies/mL, regarded as an accepted sensitivity threshold for diagnostic purposes, and reaction specificity was improved as compared to conventional methods. Also notable, these experiments were conducted with conventional reagent concentrations, rather than commonly spiked enzyme and/or template mixtures. This experimental study of the effects of substrate, SA:V, and passivation, together with sensitive and specific microfluidic PCR with consensus degenerate primers represent advances towards lower cost and higher throughput pathogen screening. PMID:23080522

  3. PCR identification of four medically important Candida species by using a single primer pair.

    PubMed Central

    Jordan, J A

    1994-01-01

    A single pair of primers was used in a PCR assay to amplify and identify the DNAs from four medically important Candida species: C. albicans, C. parapsilosis, C. tropicalis, and C. (Torulopsis) glabrata. The report describes the first successful amplification of a chitin synthase-specific fragment from the four Candida species responsible for more than 90% of all cases of neonatal candidemia. The primer pair sequence was based on that from the C. albicans chitin synthase gene, CHS1 (J. Au-Young and P.W. Robbins, Mol. Microbiol. 4:197-207, 1990). Each of the four amplified products is a single band of a different size. The DNA sequence of each PCR product was determined, and four species-specific probes were synthesized. The DNAs from as few as 10 organisms in 100 microliters of plasma could be detected after amplification and Southern blot analysis. In a retrospective study of 27 paired blood samples from 16 patients with culture-proven candidemia, PCR analysis was successful at detecting and correctly identifying to the species level 26 of the 27 Candida isolates. The speed and accuracy of this PCR-based technology make it a very powerful tool for detecting and diagnosing candidemia. Implementation of this assay for analyzing blood samples should result in the more timely treatment of neonatal candidemia, thereby reducing morbidity and mortality. Images PMID:7883883

  4. Detection of polyhydroxyalkanoate-accumulating bacteria from domestic wastewater treatment plant using highly sensitive PCR primers.

    PubMed

    Huang, Yu-Tzu; Chen, Pi-Ling; Semblante, Galilee Uy; You, Sheng-Jie

    2012-08-01

    Polyhydroxyalkanoate (PHA) is a class of biodegradable plastics that have great potential applications in the near future. In this study, the micro-biodiversity and productivity of PHA-accumulating bacteria in activated sludge from a domestic wastewater treatment plant were investigated. A previously reported primer set and a selfdesigned primer set (phaCF1BO/phaCR2BO) were both used to amplify the PHA synthase (phaC) gene of isolated colonies. The new primers demonstrated higher sensitivity for phaC, and combining the PCR results of the two primer sets was able to widen the range of detected genera and raise the sensitivity to nearly 90%. Results showed that 85.3% of the identified bacteria were Gram-negative, with Ralstonia as the dominant genus, and 14.7% were Gram-positive. In addition, Zoogloea and Rhizobium contained the highest amounts of intracellular PHA. It is apparent that glucose was a better carbon source than pentone or tryptone for promoting PHA production in Micrococcus. Two different classes, class I and class II, of phaC were detected from alphaproteobacteria, betaproteobacteria, and gammaproteobacteria, indicating the wide diversity of PHA-accumulating bacteria in this particular sampling site. Simultaneous wastewater treatment and PHA production is promising by adopting the high PHAaccumulating bacteria isolated from activated sludge.

  5. Detection of Xanthomonas arboricola pv. pruni by PCR using primers based on DNA sequences related to the hrp genes.

    PubMed

    Park, So Yeon; Lee, Young Sun; Koh, Young Jin; Hur, Jae-Sun; Jung, Jae Sung

    2010-10-01

    Efficient control of Xanthomonas arboricola pv. pruni, the causal agent of bacterial spot on stone fruit, requires a sensitive and reliable diagnostic tool. A PCR detection method that utilizes primers to target the hrp gene cluster region was developed in this study. The nucleotide sequence of the PCR product amplified with primers specific for the hrp region of the xanthomonads and genomic DNA of X. arboricola pv. pruni was determined, and the sequence was aligned with that of X. campestris pv. campestris, which was obtained from the GenBank database. On the basis of the sequence of the amplified hrp region, a PCR primer set of XapF/R specific to X. arboricola pv. pruni was designed. This primer set yielded a 243-bp product from the genomic DNA of X. aboricola pv. pruni strains, but no products from other 21 strains of Xanthomonas or from two epiphytic bacterial species. Southern blot hybridization with the probe derived from the PCR product with the primer set and X. aboricola pv. pruni DNA confirmed the PCR results. The Xap primer system was successfully applied to detect the pathogen from infected peach fruits. When it was applied in field samples, the primer set was proved as a reliable diagnostic tool for specific detection of X. aboricola pv. pruni from peach orchards. PMID:21046331

  6. Development of universal primers for detection of potato carlaviruses by RT-PCR.

    PubMed

    Nie, Xianzhou; Bai, Yanju; Molen, Teresa A; Desjardins, David C

    2008-05-01

    To facilitate efficient and accurate detection of potato-infecting carlaviruses, degenerated universal primers were designed based on conserved amino acid and nucleotide sequences. Two sense primers, Car-F1 and Car-F2, were based on the amino acid sequences "SNNMA" and "GLGVPTE", respectively, in the coat protein. The reverse primer, Car-R, which was located at the border of the nucleic acid binding protein gene and the 3' untranslated region, and dT-B, which was derived from the oligo-dT targeting the poly(A) tail, were selected. Successful application of fragments within the predicted size range of carlaviruses was obtained using Car-F1 paired with either Car-R or dT-B from tested carlaviruses (Potato virus S, M and latent) by RT-PCR. The Car-F2 failed to yield clear-cut fragments within the predicted size range when paired with either Car-R or dT-B in RT-PCR. However, a less degenerated version of the primer, Car-F2b, resulted in amplicons within the predicted size range when paired with either Car-R or dT-B. Sequencing of the tentative carlavirus-fragments resulting from Car-F1/Car-R and Car-F2b/dT-B proved their carlavirus-origin, thus indicating the high specificity of these primers. The sensitivity of Car-F1/Car-R or Car-F2b/Car-R mediated RT-PCR for the detection of carlavirus-infected potato tubers were assessed using composite samples containing one carlavirus-infected-potato-tuber RNA sample with up to 49 virus-free-potato-tuber RNA samples under the optimal annealing temperature. The target carlaviruses were detected readily from all composites, demonstrating a high sensitivity. The method was further evaluated using presumed virus-free or carlavirus-infected potatoes of several cultivars, and reliable results were obtained. PMID:18353450

  7. Selection of more appropriate PCR primer pairs for improved efficiency in detecting Norwalk-like virus (NLV) RNA.

    PubMed

    Naitou, Hirotaka; Morita, Tamotsu

    2001-10-01

    A pair of primers, NV35 and NV36, and another pair of primers, NV81 and NV82/SM82, are commonly used for polymerase chain reaction (PCR) detection of Norwalk-like virus (NLV) genome RNA sequences in authorized test laboratories in Japan. However, the efficiency of NLV genome RNA detection with these primer pairs has been less than satisfactory. In the present study, we attempted to establish more appropriately matched primer pairs for improved detection of NLV genome RNA sequences using a combination of primers including NV35, NV36, NV81, NV82/SM82, SR33, and SRs (a mixture of 4 primers SR46, SR48, SR50, and SR52). We also evaluated appropriate primers for improved reverse transcription of NLV genome RNA. Stool samples used for detection of NLV included 18 samples collected from NLV-infected patients who ingested oysters (group 1) and 13 samples collected from those who did not ingest oysters (group 2). Reverse transcription of RNA genome with primer NV35 was less efficient compared with that with primer SR33 or NV81. When PCR products obtained with NV35 and NV36 as a pair of primers were subjected to gel electrophoresis, a strong extra band was detected compared with those obtained with other primer pairs. Since this extra band may represent heterodimeric or homodimeric hybrids, or intramolecular hybrids derived from these primers, this template-independent hybridization could lower the efficiency of primer-dependent polymerase reaction. Of 18 primer pairs, a pair of NV81 and SRs provided the best detection of PCR products following reverse transcription of NLV RNA with SR33 or NV81. The detection rate was 61% for both reverse transcription with SR33 and that with NV81. After reverse transcription using SR33 as a primer, nested PCR using a pair of NV81 and SRs following primary PCR using a pair of NV81 and NV82/SM82 increased the detection rate to 89% in group 1 and 100% in group 2.

  8. Partial molecular cloning of the JHK retrovirus using gammaretrovirus consensus PCR primers

    PubMed Central

    Halligan, Brian D; Sun, Hai-Yuan; Kushnaryov, Vladimir M; Grossberg, Sidney E

    2013-01-01

    The JHK virus (JHKV) was previously described as a type C retrovirus that has some distinctive ultrastructural features and replicates constitutively in a human B-lymphoblastoid cell line, JHK-3. In order to facilitate the cloning of sequences from JHKV, a series of partially degenerate consensus retroviral PCR primers were created by a data-driven design approach based on an alignment of 14 diverse gammaretroviral genomes. These primers were used in the PCR amplification of purified JHK virion cDNA, and ana lysis of the resulting amplified sequence indicates that the JHKV is in the murine leukemia virus (MLV) family. The JHK sequence is nearly identical to the corresponding region of the Bxv-1 endogenous mouse retrovirus (GenBank accession AC115959) and distinct from XMRV. JHKV gag-specific amplification was demonstrated with nucleic acids from uncultivated, frozen, peripheral blood mononuclear cells (PBMCs) of the index patient, but not in PBMCs from nine healthy blood donors. Unlike earlier reports, in which MLV-like sequences were identified in human source material, which may have been due to murine contamination, budding retrovirions were demonstrated repeatedly by electron microscopy in uncultivated lymphocytes of the index patient that were morphologically identical in their development to the virions in the JHK-3 cells, and immunological evidence was obtained that the index patient produced IgG antibodies that bound to the budding viral particles in patient PBMCs and in the JHK-3 cells. These data indicate that the patient had been infected by JHKV, lending significance to the demonstration of JHKV amplicons in nucleic acids of the patient’s PBMCs. In future studies, the PCR primer sets described herein may expand the detection of an amplifiable subset of viruses related to MLV. PMID:24159361

  9. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    SciTech Connect

    Jothikumar, N. Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  10. Tetra Primer ARMS PCR Optimization to Detect Single Nucleotide Polymorphisms of the CYP2E1 Gene.

    PubMed

    Suhda, Saihas; Paramita, Dewi Kartikawati; Fachiroh, Jajah

    2016-01-01

    Single nucleotide polymorphism (SNP) detection has been used extensively for genetic association studies of diseases including cancer. For mass, yet accurate and more economic SNP detection we have optimized tetra primer amplification refractory mutation system polymerase chain reaction (ARMS PCR) to detect three SNPs in the cytochrome P450 2E1 (CYP2E1) gene locus; i.e. rs3813865, rs2070672 and rs3813867. The optimization system strategies used were (1) designing inner and outer primers; (2) determining of their optimum primer concentration ratios; and (3) determining of the optimum PCR annealing temperature. The tetra primer ARMS PCR result could be directly observed using agarose gel electrophoresis. The method succesfully determined three SNPs in CYP2E1 locus, the results being consistent with validation using DNA sequencing and restriction fragment length polymorphisms (RFLP). PMID:27509930

  11. Tetra Primer ARMS PCR Optimization to Detect Single Nucleotide Polymorphisms of the CYP2E1 Gene.

    PubMed

    Suhda, Saihas; Paramita, Dewi Kartikawati; Fachiroh, Jajah

    2016-01-01

    Single nucleotide polymorphism (SNP) detection has been used extensively for genetic association studies of diseases including cancer. For mass, yet accurate and more economic SNP detection we have optimized tetra primer amplification refractory mutation system polymerase chain reaction (ARMS PCR) to detect three SNPs in the cytochrome P450 2E1 (CYP2E1) gene locus; i.e. rs3813865, rs2070672 and rs3813867. The optimization system strategies used were (1) designing inner and outer primers; (2) determining of their optimum primer concentration ratios; and (3) determining of the optimum PCR annealing temperature. The tetra primer ARMS PCR result could be directly observed using agarose gel electrophoresis. The method succesfully determined three SNPs in CYP2E1 locus, the results being consistent with validation using DNA sequencing and restriction fragment length polymorphisms (RFLP).

  12. PCR differentiation of commercial yeast strains using intron splice site primers.

    PubMed Central

    de Barros Lopes, M; Soden, A; Henschke, P A; Langridge, P

    1996-01-01

    The increased use of pure starter cultures in the wine industry has made it necessary to develop a rapid and simple identification system for yeast strains. A method based upon the PCR using oligonucleotide primers that are complementary to intron splice sites has been developed. Since most introns are not essential for gene function, introns have evolved with minimal constraint. By targeting these highly variable sequences, the PCR has proved to be very effective in uncovering polymorphisms in commercial yeast strains. The speed of the method and the ability to analyze many samples in a single day permit the monitoring of specific yeast strains during fermentations. Furthermore, the simplicity of the technique, which does not require the isolation of DNA, makes it accessible to industrial laboratories that have limited molecular expertise and resources. PMID:8953723

  13. A universal method for the identification of bacteria based on general PCR primers.

    PubMed

    Barghouthi, Sameer A

    2011-10-01

    The Universal Method (UM) described here will allow the detection of any bacterial rDNA leading to the identification of that bacterium. The method should allow prompt and accurate identification of bacteria. The principle of the method is simple; when a pure PCR product of the 16S gene is obtained, sequenced, and aligned against bacterial DNA data base, then the bacterium can be identified. Confirmation of identity may follow. In this work, several general 16S primers were designed, mixed and applied successfully against 101 different bacterial isolates. One mixture, the Golden mixture7 (G7) detected all tested isolates (67/67). Other golden mixtures; G11, G10, G12, and G5 were useful as well. The overall sensitivity of the UM was 100% since all 101 isolates were detected yielding intended PCR amplicons. A selected PCR band from each of 40 isolates was sequenced and the bacterium identified to species or genus level using BLAST. The results of the UM were consistent with bacterial identities as validated with other identification methods; cultural, API 20E, API 20NE, or genera and species specific PCR primers. Bacteria identified in the study, covered 34 species distributed among 24 genera. The UM should allow the identification of species, genus, novel species or genera, variations within species, and detection of bacterial DNA in otherwise sterile samples such as blood, cerebrospinal fluid, manufactured products, medical supplies, cosmetics, and other samples. Applicability of the method to identifying members of bacterial communities is discussed. The approach itself can be applied to other taxa such as protists and nematodes.

  14. Validation and application of a PCR primer set to quantify fungal communities in the soil environment by real-time quantitative PCR.

    PubMed

    Chemidlin Prévost-Bouré, Nicolas; Christen, Richard; Dequiedt, Samuel; Mougel, Christophe; Lelièvre, Mélanie; Jolivet, Claudy; Shahbazkia, Hamid Reza; Guillou, Laure; Arrouays, Dominique; Ranjard, Lionel

    2011-01-01

    Fungi constitute an important group in soil biological diversity and functioning. However, characterization and knowledge of fungal communities is hampered because few primer sets are available to quantify fungal abundance by real-time quantitative PCR (real-time Q-PCR). The aim in this study was to quantify fungal abundance in soils by incorporating, into a real-time Q-PCR using the SYBRGreen® method, a primer set already used to study the genetic structure of soil fungal communities. To satisfy the real-time Q-PCR requirements to enhance the accuracy and reproducibility of the detection technique, this study focused on the 18S rRNA gene conserved regions. These regions are little affected by length polymorphism and may provide sufficiently small targets, a crucial criterion for enhancing accuracy and reproducibility of the detection technique. An in silico analysis of 33 primer sets targeting the 18S rRNA gene was performed to select the primer set with the best potential for real-time Q-PCR: short amplicon length; good fungal specificity and coverage. The best consensus between specificity, coverage and amplicon length among the 33 sets tested was the primer set FR1/FF390. This in silico analysis of the specificity of FR1/FF390 also provided additional information to the previously published analysis on this primer set. The specificity of the primer set FR1/FF390 for Fungi was validated in vitro by cloning--sequencing the amplicons obtained from a real time Q-PCR assay performed on five independent soil samples. This assay was also used to evaluate the sensitivity and reproducibility of the method. Finally, fungal abundance in samples from 24 soils with contrasting physico-chemical and environmental characteristics was examined and ranked to determine the importance of soil texture, organic carbon content, C∶N ratio and land use in determining fungal abundance in soils.

  15. Fusion primer and nested integrated PCR (FPNI-PCR): a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    PubMed Central

    2011-01-01

    Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809

  16. Development of Prevotella nigrescens-specific PCR primers based on the nucleotide sequence of a Pn23 DNA probe.

    PubMed

    Kim, Min Jung; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-02-01

    A previous study reported the cloning of a putative Prevotella nigrescens-specific DNA probe, Pn23, using random shotgun method. The present study evaluated the species-specificity of Pn23 for P. nigrescens using the clinical strains of Prevotella intermedia and P. nigrescens to develop P. nigrescens-specific polymerase chain reaction (PCR) primers. Southern blot analysis showed that the DNA probe, Pn23, detected only the genomic DNA of P. nigrescens strains. PCR showed that the two sets of PCR primers, Pn23-F1/Pn23-R1 and Pn23-F2/Pn23-R2, had species-specificity for P. nigrescens. Interestingly, the two sets of PCR primers, Pn23-F6/Pn23-R6 and Pn23-F7/Pn23-R7, had strain-specificity for P. nigrescens ATCC 33563. The detection limits of the four primer sets were 40 or 4 pg of the purified genomic DNA of P. nigrescens ATCC 33563. These results suggest that the DNA probe, Pn23, and the two sets of PCR primers, Pn23-F1/Pn23-R1 and Pn23-F2/Pn23-R2, can be useful for the detection of P. nigrescens in the molecular epidemiological studies of oral infectious diseases. PMID:21184839

  17. Identification of Mycobacterium bovis in bovine clinical samples by PCR species-specific primers.

    PubMed Central

    Romero, R E; Garzón, D L; Mejía, G A; Monroy, W; Patarroyo, M E; Murillo, L A

    1999-01-01

    Tuberculosis, caused by Mycobacterium bovis is emerging as the most important disease affecting cattle. Furthermore, it results in a major public health problem when transmitted to humans. Due to its difficult and non-specific diagnosis, M. bovis has been declared to be one of the etiologic agents causing significant economic loss in the cattle industry. Our group evaluated a more rapid and specific method, based on a new polymerase chain reaction species-specific primers, which amplifies a 470-base pair fragment of the M. bovis genome. A total of 275 milk-producing cows were studied by intradermal tuberculin test (ITT) which gave 184 positive and 91 negative cases. From them, 50 animals were taken from a cattle ranch free of tuberculosis. Three different samples were collected from each animal (blood, nasal mucus, and milk). Positive results were obtained from 26 animals by PCR (11.4%), 1 by bacteriological culturing (0.4%) and 1 by bacilloscopy (0.4%). This finding suggests, as in previous reports, that ITT, normally used for bovine tuberculosis detection, has the inconvenience of having a broad range of specificity and sensitivity, and the PCR technique is a more specific and sensitive test to detect infection associated with M. bovis. Therefore, we propose this PCR assay as a useful tool in the epidemiological characterization of infected animals in areas considered to be at high risk of transmission. Images Figure 1. PMID:10369566

  18. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    PubMed

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. PMID:21192988

  19. [Development, optimization and application of the expression analysis platform based on multiplex quantitative RT-PCR using fluorescent universal primers].

    PubMed

    Wang, Qin-Xi; Li, Kai; Zhou, Yu-Xun; Xiao, Jun-Hua

    2009-05-01

    A multiplex quantitative RT-PCR technology with a universal fluorescent primer was established. This technology employs a chimeric-primer-induced-universal-primer amplification method that ensures target genes amplified in a constant ratio. This technique was cost-effective, moderate-throughput, and reliable in quantification of gene expression. It is complementary to cDNA chip, which has low quantitative accuracy , and Real-time quantitative PCR with low throughput, through improving the entire process of expression profiling analysis. Eleven genes within a QTL segment regulating mouse puberty onset on chromosome X were investigated to construct and optimize the method. The sensitivity of detection (102 copies) was determined, the concentration ratio of universal primer and chimeric forward primers (1:1) was optimized, and the accuracy and repeatability were validated. The method of Touchdown PCR with addition of universal primers significantly improved amplification of genes expressed in low abundance. After testing the expression profile of 11 genes in hypothalamus and testis in two mouse strains C3H/HeJ and C57BL/6J at the age of 15 d, one gene named PHF6 was found differentially expressed for further function analysis.

  20. Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers.

    PubMed

    Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie

    2013-10-01

    The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum.

  1. Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers

    PubMed Central

    Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie

    2013-01-01

    The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. PMID:23996915

  2. [Detection of Neisseria gonorrhoeae(NG), Chlamydia trachomatis(CT) and Ureaplasma urealyticum(UU) by multiple primer PCR].

    PubMed

    Lu, Y; Li, J; Chen, Y

    2000-04-01

    For the detection of Neisseria gonorrhoeae(NG), Chlamydia trachomat is(CT) and Ureaplasma urealyticum(UU) in urogenital infection in one specimen, multiple primer PCR was used in 156 sex transmitted disease patients, it was shown that in 156 specimens there were 40 NG positive and 31 CT positive and 27 UU positive, 10 NG + CT positive, 4 NG + UU positive, 3 CT + UU positive and 2 NG + CT + UU positive respectively. The results were in correspondence with each other. It is suggested that multiple primer PCR is a quick, sensitive, simple and specific technique which can be applied in clinical test.

  3. Genetic relationships among strains of Xanthomonas fragariae based on random amplified polymorphic DNA PCR, repetitive extragenic palindromic PCR, and enterobacterial repetitive intergenic consensus PCR data and generation of multiplexed PCR primers useful for the identification of this phytopathogen.

    PubMed Central

    Pooler, M R; Ritchie, D F; Hartung, J S

    1996-01-01

    Genetic relationships among 25 isolates of Xanthomonas fragariae from diverse geographic regions were determined by three PCR methods that rely on different amplification priming strategies: random amplified polymorphic DNA (RAPD) PCR, repetitive extragenic palindromic (REP) PCR, and enterobacterial repetitive intergenic consensus (ERIC) PCR. The results of these assays are mutually consistent and indicate that pathogenic strains are very closely related to each other. RAPD, ERIC, and REP PCR assays identified nine, four, and two genotypes, respectively, within X. fragariae isolates. A single nonpathogenic isolate of X. fragariae was not distinguishable by these methods. The results of the PCR assays were also fully confirmed by physiological tests. There was no correlation between DNA amplification product patterns and geographic sites of isolation, suggesting that this bacterium has spread largely through exchange of infected plant germ plasm. Sequences identified through the RAPD assays were used to develop three primer pairs for standard PCR assays to identify X. fragariae. In addition, we developed a stringent multiplexed PCR assay to identify X. fragariae by simultaneously using the three independently derived sets of primers specific for pathogenic strains of the bacteria. PMID:8795198

  4. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers.

    PubMed

    Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos

    2015-10-22

    Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  5. DegePrime, a Program for Degenerate Primer Design for Broad-Taxonomic-Range PCR in Microbial Ecology Studies

    PubMed Central

    Hugerth, Luisa W.; Wefer, Hugo A.; Lundin, Sverker; Jakobsson, Hedvig E.; Lindberg, Mathilda; Rodin, Sandra; Engstrand, Lars

    2014-01-01

    The taxonomic composition of a microbial community can be deduced by analyzing its rRNA gene content by, e.g., high-throughput DNA sequencing or DNA chips. Such methods typically are based on PCR amplification of rRNA gene sequences using broad-taxonomic-range PCR primers. In these analyses, the use of optimal primers is crucial for achieving an unbiased representation of community composition. Here, we present the computer program DegePrime that, for each position of a multiple sequence alignment, finds a degenerate oligomer of as high coverage as possible and outputs its coverage among taxonomic divisions. We show that our novel heuristic, which we call weighted randomized combination, performs better than previously described algorithms for solving the maximum coverage degenerate primer design problem. We previously used DegePrime to design a broad-taxonomic-range primer pair that targets the bacterial V3-V4 region (341F-805R) (D. P. Herlemann, M. Labrenz, K. Jurgens, S. Bertilsson, J. J. Waniek, and A. F. Andersson, ISME J. 5:1571–1579, 2011, http://dx.doi.org/10.1038/ismej.2011.41), and here we use the program to significantly increase the coverage of a primer pair (515F-806R) widely used for Illumina-based surveys of bacterial and archaeal diversity. By comparison with shotgun metagenomics, we show that the primers give an accurate representation of microbial diversity in natural samples. PMID:24928874

  6. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    PubMed

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

  7. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    PubMed

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree. PMID:19778057

  8. Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel Electrophoresis

    PubMed Central

    Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.

    2003-01-01

    Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643

  9. Influence of primer & probe chemistry and amplification target on reverse transcription digital PCR quantification of viral RNA.

    PubMed

    Van Heuverswyn, Fran; Karczmarczyk, Maria; Schimmel, Heinz; Trapmann, Stefanie; Emons, Hendrik

    2016-09-01

    Compared to other PCR technologies, digital PCR is a potentially highly accurate approach for the quantification of nucleic acid fragments. This study describes the impact of four experimental factors, namely primer and probe chemistry, PCR amplification target, duplexing, and template type, on the measurement results obtained by reverse transcription digital PCR (RT-dPCR) of viral RNA using influenza A virus as a model. Along conventional dual labelled probes (DLP), alternative primer and probe chemistries, including Zip Nucleic Acids (ZNAs), Locked Nucleic Acids (LNAs), and Scorpions(®), were compared with two RNA template types: i) total genomic RNA extracted from cell cultured influenza A and ii) a synthetically prepared RNA transcript (In vitro transcribed RNA). While apparently duplexing or a different PCR target choice did not have a significant influence on the estimated RNA copy numbers, the impact of the choice of primer and probe chemistry and template type differed significantly for some methods. The combined standard uncertainty of the dPCR analysis results has been assessed, taking into account both the repeatability and the intermediate precision of the procedure. Our data highlight the importance of dPCR method optimisation and the advantage of using a more sophisticated primer and probe chemistry, which turned out to be dependent on the template type. Considerations are provided with respect to the molecular diagnostics of viral RNA pathogens, and more specifically, for precise quantification of RNA, which is of tremendous importance for the development of RNA calibration materials and the qualification of these calibrants as certified reference materials. PMID:27617229

  10. Influence of primer & probe chemistry and amplification target on reverse transcription digital PCR quantification of viral RNA.

    PubMed

    Van Heuverswyn, Fran; Karczmarczyk, Maria; Schimmel, Heinz; Trapmann, Stefanie; Emons, Hendrik

    2016-09-01

    Compared to other PCR technologies, digital PCR is a potentially highly accurate approach for the quantification of nucleic acid fragments. This study describes the impact of four experimental factors, namely primer and probe chemistry, PCR amplification target, duplexing, and template type, on the measurement results obtained by reverse transcription digital PCR (RT-dPCR) of viral RNA using influenza A virus as a model. Along conventional dual labelled probes (DLP), alternative primer and probe chemistries, including Zip Nucleic Acids (ZNAs), Locked Nucleic Acids (LNAs), and Scorpions(®), were compared with two RNA template types: i) total genomic RNA extracted from cell cultured influenza A and ii) a synthetically prepared RNA transcript (In vitro transcribed RNA). While apparently duplexing or a different PCR target choice did not have a significant influence on the estimated RNA copy numbers, the impact of the choice of primer and probe chemistry and template type differed significantly for some methods. The combined standard uncertainty of the dPCR analysis results has been assessed, taking into account both the repeatability and the intermediate precision of the procedure. Our data highlight the importance of dPCR method optimisation and the advantage of using a more sophisticated primer and probe chemistry, which turned out to be dependent on the template type. Considerations are provided with respect to the molecular diagnostics of viral RNA pathogens, and more specifically, for precise quantification of RNA, which is of tremendous importance for the development of RNA calibration materials and the qualification of these calibrants as certified reference materials.

  11. Collecting in collections: a PCR strategy and primer set for DNA barcoding of decades-old dried museum specimens.

    PubMed

    Mitchell, Andrew

    2015-09-01

    Natural history museums are vastly underutilized as a source of material for DNA analysis because of perceptions about the limitations of DNA degradation in older specimens. Despite very few exceptions, most DNA barcoding projects, which aim to obtain sequence data from all species, generally use specimens collected specifically for that purpose, instead of the wealth of identified material in museums, constrained by the lack of suitable PCR methods. Any techniques that extend the utility of museum specimens for DNA analysis therefore are highly valuable. This study first tested the effects of specimen age and PCR amplicon size on PCR success rates in pinned insect specimens, then developed a PCR primer set and amplification strategy allowing greatly increased utilization of older museum specimens for DNA barcoding. PCR success rates compare favourably with the few published studies utilizing similar aged specimens, and this new strategy has the advantage of being easily automated for high-throughput laboratory workflows. The strategy uses hemi-nested, degenerate, M13-tailed PCR primers to amplify two overlapping amplicons, using two PCRs per amplicon (i.e. four PCRs per DNA sample). Initial PCR products are reamplified using an internal primer and a M13 primer. Together the two PCR amplicons yield 559 bp of the COI gene from Coleoptera, Lepidoptera, Diptera, Hemiptera, Odonata and presumably also other insects. BARCODE standard-compliant data were recovered from 67% (56 of 84) of specimens up to 25 years old, and 51% (102 of 197) of specimens up to 55 years old. Given the time, cost and specialist expertise required for fieldwork and identification, 'collecting in collections' is a viable alternative allowing researchers to capitalize on the knowledge captured by curation work in decades past.

  12. Universal primer-multiplex PCR approach for simultaneous detection of Escherichia coli, Listeria monocytogenes, and Salmonella spp. in food samples.

    PubMed

    Yuan, Yanfang; Xu, Wentao; Zhai, Zhifang; Shi, Hui; Luo, Yunbo; Chen, Zhuojun; Huang, Kunlun

    2009-10-01

    Escherichia coli, Listeria monocytogenes, and Salmonella spp. are 3 kinds of the most important food-borne human pathogens. Traditional microbiological analysis is labor-intensive, time-consuming, and easily contaminated, thus producing false positive signals; it also involves much subjectivity judgments. Multiplex-PCR could be applied to detect multiple target organisms simultaneously to save time and labor, but there is always disproportionate amplification resulting from the disparity of different primers. To gain a rapid and sensitive method, a universal primer-multiplex PCR system (UP-M-PCR) was developed and applied for simultaneous detection of the 3 organisms. This method simplified traditional multiplex-PCR reaction system and overcame its amplification disparities among different primers; moreover, it got a high specificity and sensitivity (85, 155, and 104 copies/reaction for E. coli O157, L. monocytogenes, and Salmonella spp., respectively). Compared with the time-consuming and laborious microbiological analysis, UP-M-PCR had a lower risk of cross-contamination without inoculation and incubation. Test results for 36 food samples showed that UP-M-PCR method got a relative accuracy of 91.77% when compared with traditional microbiological analysis. It could serve as a rapid screening method for pathogen detection and could detect target genes even in dead pathogenic cells. In addition, it has the potential to be performed in an automation mode and might find broader application in simultaneous detection of other multiple pathogens.

  13. Evaluation of multiplex PCR using MPB64 and IS6110 primers for rapid diagnosis of tuberculous meningitis.

    PubMed

    Lekhak, Sunil Prasad; Sharma, Laxmi; Rajbhandari, Reema; Rajbhandari, Pravesh; Shrestha, Resha; Pant, Basant

    2016-09-01

    Tuberculous meningitis (TBM) is one of those most serious manifestations of extra-pulmonary tuberculosis and prompt diagnosis and treatment is required for better clinical outcome. It is difficult to diagnose due to lack of rapid, sensitive, and specific tests. Newer methods, which are easy and reliable, are required to diagnose TBM at an early stage. Thus our aim was to evaluate the Multiplex polymerase chain reaction (PCR) technique, using primers directed against the insertion sequence IS6110 and MPB64 gene for the detection of Mycobacterium tuberculosis in Cerebrospinal fluid (CSF), for rapid diagnosis of TBM patients. 102 CSF samples were analyzed from patients suspected with TBM along with a control group of 10 patients having other neurological disorders. CSF sediments were analyzed individually for M. tuberculosis DNA by Multiplex PCR using two set of primers targeting insertion sequence IS6110 and gene MBp64, which is very specific for MTBC. Out of 37 patients diagnosed with TBM clinically, MPB64 PCR was positive in 22, IS6110 PCR was positive in 28, both PCR using Multiplex were positive in 34 and Microscopy was positive in one. Thus Sensitivity of MPB64 PCR, IS6110 PCR, Multiplex PCR and Microscopy were found to be 62.3%, 75.4%, 91.8% and 2.7% respectively. In non TBM group PCR was negative in all cases hence, the specificity was 100%. Multiplex PCR system using primers targeting IS6110 and MPB64, for the detection of M. tuberculosis DNA in CSF samples, has high sensitivity than any one of them alone, and could be used for the early detection of TBM in CSF samples.

  14. Development of PCR primers from internal transcribed spacer region 2 for detection of Phytophthora species infecting potatoes.

    PubMed Central

    Tooley, P W; Bunyard, B A; Carras, M M; Hatziloukas, E

    1997-01-01

    We developed PCR primers and assay methods to detect and differentiate three Phytophthora species which infect potatoes and cause late blight (Phytophthora infestans) and pink rot (P. erythroseptica and P. nicotianae) diseases. Primers based on sequence analysis of internal transcribed spacer region 2 of ribosomal DNA produced PCR products of 456 bp (P. infestans), 136 bp (P. erythroseptica), and 455 bp (P. nicotianae) and were used to detect the pathogens in potato leaf (P. infestans) and tuber (P. infestans, P. erythroseptica, and P. nicotianae) tissue with a sensitivity of 1 to 10 pg of DNA. Leaf and tuber tissue were processed for PCR by a rapid NaOH method as well as a method based on the use of commercially available ion-exchange columns of P. infestans primers and the rapid NaOH extraction method were used to detect late blight in artificially and naturally infected tubers of potato cultivar Red LaSoda. In sampling studies, P. infestans was detected by PCR from artificially infected tubers at 4 days postinoculation, before any visible symptoms were present. The PCR assay and direct tissue extraction methods provide tools which may be used to detect Phytophthora pathogens in potato seedlots and storages and thus limit the transmission and spread of new, aggressive strains of P. infestans in U.S. potato-growing regions. PMID:9097445

  15. Methods for detection and differentiation of existing and new crinivirus species through multiplex and degenerate primer RT-PCR.

    PubMed

    Wintermantel, William M; Hladky, Laura L

    2010-12-01

    A method was developed for rapid identification and differentiation of both known and novel crinivirus species involving both multiplex and degenerate reverse transcription-polymerase chain reaction (RT-PCR). The multiplex method can discriminate among known criniviruses infecting vegetable and small fruit crops, and rapidly identify viruses associated with disease symptoms, as well as identification of mixed crinivirus infections. Four host groups for multiplex detection of criniviruses were selected based on the types of crops where specific criniviruses would be expected to occur. Each detection group contained three to four crop-specific primers designed to the same region of the gene encoding the highly conserved RNA-dependent RNA polymerase gene (RdRp) of criniviruses for rapid, single-reaction determination of which crinivirus(es) may be infecting a plant. Degenerate reverse primers used for RT and in PCR were designed to amplify all members of each host group, and were coupled with species-specific forward primers resulting in four separate single-reaction cocktails for detection of most criniviruses sequenced to date, whether present in single or mixed virus infections. Additional viruses can be added to multiplex detection by adjustment of primer concentration for balanced detection of target viruses. In order to identify unknown putative criniviruses or those for which sequence information is not yet available, a genus-wide, universal degenerate primer set was developed. These primers also targeted the crinivirus RdRp gene, and amplify a wide range of crinivirus sequences. Both detection systems can be used with most RNA extraction methods, and with RT-PCR reagents common in most laboratories.

  16. Mining of novel species-specific primers for PCR detection of Listeria monocytogenes based on genomic approach.

    PubMed

    Tao, Tingting; Chen, Qiming; Bie, Xiaomei; Lu, Fengxia; Lu, Zhaoxin

    2015-12-01

    Listeria monocytogenes in contaminated food is considered as a serious health threat for consumers due to its high mortality rate. The objective of this study was to obtain novel species-specific target-genes and primers for the molecular detection of L. monocytogenes using a comparative genomic approach. By comparative analysis of L. monocytogenes and non-L. monocytogenes genome sequences in the GenBank database with BLAST program, 26 specific target sequences were used as candidates and the primers were designed for L. monocytogenes species-specificity verification by using PCR assay. Finally, the three genes LMOf2365_0970, LMOf2365_2721 and mpl were identified to have L. monocytogenes species-specificity and be unique as detection targets for diagnostic application. The species-specific primer Lm8 of gene LMOf2365_0970, Lm13 of gene LMOf2365_2721 and Lm20 of gene mpl showed better specificity and sensitivity than the primers described previously. The PCR detection limits of the three specific primer sets were 430, 43, 4.3 fg/μL for genomic DNA, and 5 × 10(3), 50, 5 cfu/mL for pure culture of L. monocytogenes. There was no interference in specificity of detecting L. monocytogenes by co-culture with other foodborne pathogens in high concentration. Moreover, after 6-8 h of enrichment, L. monocytogenes in the artificially contaminated milk samples at an inoculum dose of 38 cfu/10 mL milk could be detected successfully with the studied three primers. Therefore, the three specific genes and primers can be applied to establish a novel rapid and accurate method for detecting L. monocytogenes in food materials. PMID:26354019

  17. An RT-PCR primer pair for the detection of Pospiviroid and its application in surveying ornamental plants for viroids.

    PubMed

    Bostan, Hidayet; Nie, Xianzhou; Singh, Rudra P

    2004-03-15

    A primer pair for reverse transcription-polymerase chain reaction (RT-PCR), based on the conserved sequences of the members of genus Pospiviroid was designed to yield a fragment of about 200 base pairs (bp). Since pospiviroids infect a large number of plants species and a few members of the genus Pospiviroid have been already detected in some ornamental plants, the primer pair was evaluated for its efficacy using ornamental plants. The method of return-polyacrylamide gel electrophoresis (R-PAGE) was used to determine the general presence of viroids in the test samples. Efficacy of the primer pair for members of genus Pospiviroid was demonstrated by the detection of Potato spindle tuber viroid (PSTVd) and Tomato chlorotic dwarf viroid (TCDVd) in potato, Chrysanthemum stunt viroid and Iresine viroid in Verbena and Vinca species, and Citrus exocortis viroid in Impatiens species. Specificity of the primer pair became evident, where additional viroids were detected by R-PAGE in Coleus and Magilla species, but they were not amplified by the Pospiviroid primer. This primer pair would be of benefit in indexing ornamental plants in quarantine samples or in viroid-free certification schemes, irrespective of their actual identity.

  18. An RT-PCR primer pair for the detection of Pospiviroid and its application in surveying ornamental plants for viroids.

    PubMed

    Bostan, Hidayet; Nie, Xianzhou; Singh, Rudra P

    2004-03-15

    A primer pair for reverse transcription-polymerase chain reaction (RT-PCR), based on the conserved sequences of the members of genus Pospiviroid was designed to yield a fragment of about 200 base pairs (bp). Since pospiviroids infect a large number of plants species and a few members of the genus Pospiviroid have been already detected in some ornamental plants, the primer pair was evaluated for its efficacy using ornamental plants. The method of return-polyacrylamide gel electrophoresis (R-PAGE) was used to determine the general presence of viroids in the test samples. Efficacy of the primer pair for members of genus Pospiviroid was demonstrated by the detection of Potato spindle tuber viroid (PSTVd) and Tomato chlorotic dwarf viroid (TCDVd) in potato, Chrysanthemum stunt viroid and Iresine viroid in Verbena and Vinca species, and Citrus exocortis viroid in Impatiens species. Specificity of the primer pair became evident, where additional viroids were detected by R-PAGE in Coleus and Magilla species, but they were not amplified by the Pospiviroid primer. This primer pair would be of benefit in indexing ornamental plants in quarantine samples or in viroid-free certification schemes, irrespective of their actual identity. PMID:14738987

  19. Establishing a novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure for the direct detection of gene doping.

    PubMed

    Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles

    2008-01-01

    So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications. PMID:19203085

  20. Establishing a novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure for the direct detection of gene doping.

    PubMed

    Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles

    2008-01-01

    So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications.

  1. PCR Primers to Study the Diversity of Expressed Fungal Genes Encoding Lignocellulolytic Enzymes in Soils Using High-Throughput Sequencing

    PubMed Central

    Barbi, Florian; Bragalini, Claudia; Vallon, Laurent; Prudent, Elsa; Dubost, Audrey; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

    2014-01-01

    Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5) and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2), active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may lead to the

  2. PCR primers to study the diversity of expressed fungal genes encoding lignocellulolytic enzymes in soils using high-throughput sequencing.

    PubMed

    Barbi, Florian; Bragalini, Claudia; Vallon, Laurent; Prudent, Elsa; Dubost, Audrey; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

    2014-01-01

    Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5) and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2), active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may lead to the

  3. A novel PCR technique using Alu-specific primers to identify unknown flanking sequences from the human genome

    SciTech Connect

    Minami, M.; Poussin, K.; Brechot, C.; Paterlini, P.

    1995-09-20

    The rapid and reproducible identification of new cellular DNA sequences is difficult to achieve with the currently available procedures. Here we describe a novel approach based on the polymerase chain reaction (PCR) using a primer specific to the known sequence and another directed to a human Alu repeat. To avoid undesirable amplifications between Alu sequences, primers are constructed with dUTPs and destroyed by uracil DNA glycosylase treatment after 10 initial cycles of amplification. Only desirable fragments are then further amplified with specific primers to the known region and to a tag sequence introduced in the Alu-specific primer. Using this protocol, we have successfully indentified cellular sequences flanking integrated hepatitis B virus DNA from the human genome of three hepatoma tissues. The method enables a direct specific amplification without any ligation or nonspecific annealing steps as required by previous PCR-based protocols. This rapid and straightforward approach will be a powerful tool for the study of viral integration sites, but is also widely applicable to other studies of the human genome. 39 refs., 4 figs.

  4. Development of a Dinoflagellate-Oriented PCR Primer Set Leads to Detection of Picoplanktonic Dinoflagellates from Long Island Sound†

    PubMed Central

    Lin, Senjie; Zhang, Huan; Hou, Yubo; Miranda, Lilibeth; Bhattacharya, Debashish

    2006-01-01

    We developed dinoflagellate-specific 18S rRNA gene primers. PCR amplification using these oligonucleotides for a picoplanktonic DNA sample from Long Island Sound yielded 24 clones, and all but one of these clones were dinoflagellates primarily belonging to undescribed and Amoebophrya-like lineages. These results highlight the need for a systematic investigation of picodinoflagellate diversity in both coastal and oceanic ecosystems. PMID:16885319

  5. Quantitative real-time PCR assay for detection of Paenibacillus polymyxa using membrane-fusion protein-based primers.

    PubMed

    Cho, Min Seok; Park, Dong Suk; Lee, Jung Won; Chi, Hee Youn; Sohn, Soo-In; Jeon, Bong-Kyun; Ma, Jong-Beom

    2012-11-01

    Paenibacillus polymyxa is known to be a plant-growthpromoting rhizobacterium. The present study describes a quantitative polymerase chain reaction (qPCR) assay for the specific detection and quantitation of P. polymyxa using a primer pair based on the sequence of a membranefusion protein for the amplification of a 268 bp DNA fragment. This study reports that the qPCR-based method is applicable for the rapid and sensitive detection of P. polymyxa and can be used as an alternative method for agricultural soil monitoring.

  6. Specific PCR primers directed to identify cryI and cryIII genes within a Bacillus thuringiensis strain collection.

    PubMed Central

    Cerón, J; Ortíz, A; Quintero, R; Güereca, L; Bravo, A

    1995-01-01

    In this paper we describe a PCR strategy that can be used to rapidly identify Bacillus thuringiensis strains that harbor any of the known cryI or cryIII genes. Four general PCR primers which amplify DNA fragments from the known cryI or cryIII genes were selected from conserved regions. Once a strain was identified as an organism that contains a particular type of cry gene, it could be easily characterized by performing additional PCR with specific cryI and cryIII primers selected from variable regions. The method described in this paper can be used to identify the 10 different cryI genes and the five different cryIII genes. One feature of this screening method is that each cry gene is expected to produce a PCR product having a precise molecular weight. The genes which produce PCR products having different sizes probably represent strains that harbor a potentially novel cry gene. Finally, we present evidence that novel crystal genes can be identified by the method described in this paper. PMID:8526493

  7. Application of Self-Quenched JH Consensus Primers for Real-Time Quantitative PCR of IGH Gene to Minimal Residual Disease Evaluation in Multiple Myeloma

    PubMed Central

    Martinez-Lopez, Joaquin; Martinez-Sanchez, Pilar; Garcia-Sanz, Ramon; Sarasquete, Maria Eugenia; Ayala, Rosa; Gonzalez, Marcos; Bautista, Jose Manuel; Gonzalez, David; Miguel, Jesus San; Garcia-Effron, Guillermo; Lahuerta, Juan Jose

    2006-01-01

    Monitoring multiple myeloma patients for relapse requires sensitive methods to measure minimal residual disease and to establish a more precise prognosis. The present study aimed to standardize a real-time quantitative polymerase chain reaction (PCR) test for the IgH gene with a JH consensus self-quenched fluorescence reverse primer and a VDJH or DJH allele-specific sense primer (self-quenched PCR). This method was compared with allele-specific real-time quantitative PCR test for the IgH gene using a TaqMan probe and a JH consensus primer (TaqMan PCR). We studied nine multiple myeloma patients from the Spanish group treated with the MM2000 therapeutic protocol. Self-quenched PCR demonstrated sensitivity of ≥10−4 or 16 genomes in most cases, efficiency was 1.71 to 2.14, and intra-assay and interassay reproducibilities were 1.18 and 0.75%, respectively. Sensitivity, efficiency, and residual disease detection were similar with both PCR methods. TaqMan PCR failed in one case because of a mutation in the JH primer binding site, and self-quenched PCR worked well in this case. In conclusion, self-quenched PCR is a sensitive and reproducible method for quantifying residual disease in multiple myeloma patients; it yields similar results to TaqMan PCR and may be more effective than the latter when somatic mutations are present in the JH intronic primer binding site. PMID:16825510

  8. Determination of DQB1 alleles using PCR amplification and allele-specific primers.

    PubMed

    Lepage, V; Ivanova, R; Loste, M N; Mallet, C; Douay, C; Naoumova, E; Charron, D

    1995-10-01

    Molecular genotyping of HLA class II genes is commonly carried out using polymerase chain reaction (PCR) in combination with sequence-specific oligotyping (PCR-SSO) or a combination of the PCR and restriction fragment length polymorphism methods (PCR-RFLP). However, the identification of the DQB1 type by PCR-SSO and PCR-RFLP is very time-consuming which is disadvantageous for the typing of cadaveric organ donors. We have developed a DQB1 typing method using PCR in combination with allele-specific amplification (PCR-ASA), which allows the identification of the 17 most frequent alleles in one step using seven amplification mixtures. PCR allele-specific amplification HLA-DQB1 typing is easy to perform, and the results are easy to interpret in routine clinical practice. The PCR-ASA method is therefore better suited to DQB1 typing for organ transplantation than other methods.

  9. Linear-After-The-Exponential (LATE)-PCR: primer design criteria for high yields of specific single-stranded DNA and improved real-time detection.

    PubMed

    Pierce, Kenneth E; Sanchez, J Aquiles; Rice, John E; Wangh, Lawrence J

    2005-06-14

    Traditional asymmetric PCR uses conventional PCR primers at unequal concentrations to generate single-stranded DNA. This method, however, is difficult to optimize, often inefficient, and tends to promote nonspecific amplification. An alternative approach, Linear-After-The-Exponential (LATE)-PCR, solves these problems by using primer pairs deliberately designed for use at unequal concentrations. The present report systematically examines the primer design parameters that affect the exponential and linear phases of LATE-PCR amplification. In particular, we investigated how altering the concentration-adjusted melting temperature (Tm) of the limiting primer (TmL) relative to that of the excess primer (TmX) affects both amplification efficiency and specificity during the exponential phase of LATE-PCR. The highest reaction efficiency and specificity were observed when TmL - TmX 5 degrees C. We also investigated how altering TmX relative to the higher Tm of the double-stranded amplicon (TmA) affects the rate and extent of linear amplification. Excess primers with TmX closer to TmA yielded higher rates of linear amplification and stronger signals from a hybridization probe. These design criteria maximize the yield of specific single-stranded DNA products and make LATE-PCR more robust and easier to implement. The conclusions were validated by using primer pairs that amplify sequences within the cystic fibrosis transmembrane regulator (CFTR) gene, mutations of which are responsible for cystic fibrosis.

  10. Quantification of low-expressed mRNA using 5' LNA-containing real-time PCR primers

    SciTech Connect

    Malgoyre, A.; Banzet, S.; Mouret, C.; Bigard, A.X.; Peinnequin, A. . E-mail: andrepeinnequin@crssa.net

    2007-03-02

    Real-time RT-PCR is the most sensitive and accurate method for mRNA quantification. Using specific recombinant DNA as a template, real-time PCR allows accurate quantification within a 7-log range and increased sensitivity below 10 copies. However, when using RT-PCR to quantify mRNA in biological samples, a stochastic off-targeted amplification can occur. Classical adjustments of assay parameters have minimal effects on such amplification. This undesirable amplification appears mostly to be dependent on specific to non-specific target ratio rather than on the absolute quantity of the specific target. This drawback, which decreases assay reliability, mostly appears when quantifying low-expressed transcript in a whole organ. An original primer design using properties of LNA allows to block off-target amplification. 5'-LNA substitution strengthens 5'-hybridization. Consequently on-target hybridization is stabilized and the probability for the off-target to lead to amplification is decreased.

  11. Development of species-specific PCR primers and polyphasic characterization of Lactobacillus sanfranciscensis isolated from Korean sourdough.

    PubMed

    Lee, Hyeongrho; Baek, Hyunwook; Lim, Sae Bom; Hur, Jin Soo; Shim, Sangmin; Shin, So-Yeon; Han, Nam Soo; Seo, Jin-Ho

    2015-05-01

    Lactobacillus sanfranciscensis is a bacterium used in sourdough that provides desirable properties such as better flavor and texture to the sourdough bread. Here, the intra-species diversity of L. sanfranciscensis strains isolated from Korean sourdough was studied using genotypic (multiplex-RAPD-PCR: multiplex-Randomly Amplified Polymorphic DNA-polymerase chain reaction) and phenotypic (VITEK2 Compact system) analyses. For this, a novel species-specific set of PCR primers was developed to identify L. sanfranciscensis using the recently published genome database. The primers were able to detect L. sanfranciscensis isolated from Korean sourdough with 100% accuracy. Genotyping and phenotyping analyses at the strain level demonstrated that Korean sourdough possesses various biotypes of L. sanfranciscensis strains. These strains were clustered into 5 subtypes (genotyping) or 7 subtypes (phenotyping). In summary, this strategy to construct novel primers reduced the chance of cross amplification and was able to identify the desired strain. The various strains isolated in this study can be used to develop a sourdough starter after the analysis of their fermentation characteristics.

  12. PCR analysis of oilseed rape cultivars (Brassica napus L. ssp. oleifera) using 5' -anchored simple sequence repeat (SSR) primers.

    PubMed

    Charters, Y M; Robertson, A; Wilkinson, M J; Ramsay, G

    1996-03-01

    Primers complementary to simple sequence repeats (SSRs) and with variable three-base 'anchors' at their 5' end, were used in PCR analyses to compare pooled DNA samples from various Brassica napus and B. rapa cultivars. Amplification products were resolved on polyacrylamide gels and detected by silver-nitrate staining. The resulting banding patterns were highly repeatable between replicate PCRs. Two of the primers produced polymorphisms at 33 and 23 band positions, respectively, and could each discriminate 16 of the 20 cultivars studied. Combined use of both primers allowed all 20 cultivars to be distinguished. The UPGMA dendrogram, based on the cultivar banding profiles, demonstrated clustering on the basis of winter/spring growth habit, high/low glucosinolate content, and cultivar origin (i.e. the breeder involved). Intracultivar polymorphism was investigated using a minimum of ten individuals for each cultivar and was found to vary considerably between cultivars. It is concluded that anchored SSR-PCR analysis is a highly informative and reproducible method for fingerprinting oilseed rape populations, but that intra-cultivar variation should be investigated before using banding profiles from pooled samples for the identification of individuals.

  13. A New Multiplex-PCR for Urinary Tract Pathogen Detection Using Primer Design Based on an Evolutionary Computation Method.

    PubMed

    García, Liliana Torcoroma; Cristancho, Laura Maritza; Vera, Erika Patricia; Begambre, Oscar

    2015-10-01

    This work describes a new strategy for optimal design of Multiplex-PCR primer sequences. The process is based on the Particle Swarm Optimization-Simplex algorithm (Mult-PSOS). Diverging from previous solutions centered on heuristic tools, the Mult-PSOS is selfconfigured because it does not require the definition of the algorithm's initial search parameters. The successful performance of this method was validated in vitro using Multiplex- PCR assays. For this validation, seven gene sequences of the most prevalent bacteria implicated in urinary tract infections were taken as DNA targets. The in vitro tests confirmed the good performance of the Mult-PSOS, with respect to infectious disease diagnosis, in the rapid and efficient selection of the optimal oligonucleotide sequences for Multiplex-PCRs. The predicted sequences allowed the adequate amplification of all amplicons in a single step (with the correct amount of DNA template and primers), reducing significantly the need for trial and error experiments. In addition, owing to its independence from the initial selection of the heuristic constants, the Mult-PSOS can be employed by non-expert users in computational techniques or in primer design problems.

  14. easyPAC: A Tool for Fast Prediction, Testing and Reference Mapping of Degenerate PCR Primers from Alignments or Consensus Sequences

    PubMed Central

    Rosenkranz, David

    2012-01-01

    The PCR-amplification of unknown homologous or paralogous genes generally relies on PCR primers predicted from multi sequence alignments. But increasing sequence divergence can induce the need to use degenerate primers which entails the problem of testing the characteristics, unwanted interactions and potential mispriming of degenerate primers. Here I introduce easyPAC, a new software for the prediction of degenerate primers from multi sequence alignments or single consensus sequences. As a major innovation, easyPAC allows to apply all customary primer test procedures to degenerate primer sequences including fast mapping to reference files. Thus, easyPAC simplifies and expedites the designing of specific degenerate primers enormously. Degenerate primers suggested by easyPAC were used in PCR amplification with subsequent de novo sequencing of TDRD1 exon 11 homologs from several representatives of the haplorrhine primate phylogeny. The results demonstrate the efficient performance of the suggested primers and therefore show that easyPAC can advance upcoming comparative genetic studies.

  15. Comparative in silico analysis of PCR primers suited for diagnostics and cloning of ammonia monooxygenase genes from ammonia-oxidizing bacteria.

    PubMed

    Junier, Pilar; Kim, Ok-Sun; Molina, Verónica; Limburg, Petra; Junier, Thomas; Imhoff, Johannes F; Witzel, Karl-Paul

    2008-04-01

    Over recent years, several PCR primers have been described to amplify genes encoding the structural subunits of ammonia monooxygenase (AMO) from ammonia-oxidizing bacteria (AOB). Most of them target amoA, while amoB and amoC have been neglected so far. This study compared the nucleotide sequence of 33 primers that have been used to amplify different regions of the amoCAB operon with alignments of all available sequences in public databases. The advantages and disadvantages of these primers are discussed based on the original description and the spectrum of matching sequences obtained. Additionally, new primers to amplify the almost complete amoCAB operon of AOB belonging to Betaproteobacteria (betaproteobacterial AOB), a primer pair for DGGE analysis of amoA and specific primers for gammaproteobacterial AOB, are also described. The specificity of these new primers was also evaluated using the databases of the sequences created during this study. PMID:18248438

  16. Blocking primers to enhance PCR amplification of rare sequences in mixed samples – a case study on prey DNA in Antarctic krill stomachs

    PubMed Central

    Vestheim, Hege; Jarman, Simon N

    2008-01-01

    Background Identification of DNA sequence diversity is a powerful means for assessing the species present in environmental samples. The most common molecular strategies for estimating taxonomic composition depend upon PCR with universal primers that amplify an orthologous DNA region from a range of species. The diversity of sequences within a sample that can be detected by universal primers is often compromised by high concentrations of some DNA templates. If the DNA within the sample contains a small number of sequences in relatively high concentrations, then less concentrated sequences are often not amplified because the PCR favours the dominant DNA types. This is a particular problem in molecular diet studies, where predator DNA is often present in great excess of food-derived DNA. Results We have developed a strategy where a universal PCR simultaneously amplifies DNA from food items present in DNA purified from stomach samples, while the predator's own DNA is blocked from amplification by the addition of a modified predator-specific blocking primer. Three different types of modified primers were tested out; one annealing inhibiting primer overlapping with the 3' end of one of the universal primers, another annealing inhibiting primer also having an internal modification of five dI molecules making it a dual priming oligo, and a third elongation arrest primer located between the two universal primers. All blocking primers were modified with a C3 spacer. In artificial PCR mixtures, annealing inhibiting primers proved to be the most efficient ones and this method reduced predator amplicons to undetectable levels even when predator template was present in 1000 fold excess of the prey template. The prey template then showed strong PCR amplification where none was detectable without the addition of blocking primer. Our method was applied to identifying the winter food of one of the most abundant animals in the world, the Antarctic krill, Euphausia superba. Dietary

  17. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments.

    PubMed

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

    2016-07-01

    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272

  18. Evaluation of PCR primer selectivity and phylogenetic specificity by using amplification of 16S rRNA genes from betaproteobacterial ammonia-oxidizing bacteria in environmental samples.

    PubMed

    Junier, Pilar; Kim, Ok-Sun; Hadas, Ora; Imhoff, Johannes F; Witzel, Karl-Paul

    2008-08-01

    The effect of primer specificity for studying the diversity of ammonia-oxidizing betaproteobacteria (betaAOB) was evaluated. betaAOB represent a group of phylogenetically related organisms for which the 16S rRNA gene approach is especially suitable. We used experimental comparisons of primer performance with water samples, together with an in silico analysis of published sequences and a literature review of clone libraries made with four specific PCR primers for the betaAOB 16S rRNA gene. With four aquatic samples, the primers NitA/NitB produced the highest frequency of ammonia-oxidizing-bacterium-like sequences compared to clone libraries with products amplified with the primer combinations betaAMOf/betaAMOr, betaAMOf/Nso1255g, and NitA/Nso1225g. Both the experimental examination of ammonia-oxidizing-bacterium-specific 16S rRNA gene primers and the literature search showed that neither specificity nor sensitivity of primer combinations can be evaluated reliably only by sequence comparison. Apparently, the combination of sequence comparison and experimental data is the best approach to detect possible biases of PCR primers. Although this study focused on betaAOB, the results presented here more generally exemplify the importance of primer selection and potential primer bias when analyzing microbial communities in environmental samples.

  19. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments

    PubMed Central

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

    2016-01-01

    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272

  20. The Use of Coded PCR Primers Enables High-Throughput Sequencing of Multiple Homolog Amplification Products by 454 Parallel Sequencing

    PubMed Central

    Bollback, Jonathan P.; Panitz, Frank; Bendixen, Christian; Nielsen, Rasmus; Willerslev, Eske

    2007-01-01

    Background The invention of the Genome Sequence 20™ DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources. Methodology We use conventional PCR with 5′-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20™ DNA Sequencing System (GS20, Roche/454 Life Sciences). Each DNA sequence is subsequently traced back to its individual source through 5′tag-analysis. Conclusions We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%). Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5′ nucleotide of the tag. In particular, primers 5′ labelled with a cytosine are heavily overrepresented among the final sequences, while those 5′ labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5′primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of

  1. Kinetic characterisation of primer mismatches in allele-specific PCR: a quantitative assessment.

    PubMed

    Waterfall, Christy M; Eisenthal, Robert; Cobb, Benjamin D

    2002-12-20

    A novel method of estimating the kinetic parameters of Taq DNA polymerase during rapid cycle PCR is presented. A model was constructed using a simplified sigmoid function to represent substrate accumulation during PCR in combination with the general equation describing high substrate inhibition for Michaelis-Menten enzymes. The PCR progress curve was viewed as a series of independent reactions where initial rates were accurately measured for each cycle. Kinetic parameters were obtained for allele-specific PCR (AS-PCR) amplification to examine the effect of mismatches on amplification. A high degree of correlation was obtained providing evidence of substrate inhibition as a major cause of the plateau phase that occurs in the later cycles of PCR. PMID:12470637

  2. Kinetic characterisation of primer mismatches in allele-specific PCR: a quantitative assessment.

    PubMed

    Waterfall, Christy M; Eisenthal, Robert; Cobb, Benjamin D

    2002-12-20

    A novel method of estimating the kinetic parameters of Taq DNA polymerase during rapid cycle PCR is presented. A model was constructed using a simplified sigmoid function to represent substrate accumulation during PCR in combination with the general equation describing high substrate inhibition for Michaelis-Menten enzymes. The PCR progress curve was viewed as a series of independent reactions where initial rates were accurately measured for each cycle. Kinetic parameters were obtained for allele-specific PCR (AS-PCR) amplification to examine the effect of mismatches on amplification. A high degree of correlation was obtained providing evidence of substrate inhibition as a major cause of the plateau phase that occurs in the later cycles of PCR.

  3. Tetra-primer amplification refractory mutation system PCR (T-ARMS-PCR) rapidly identified a critical missense mutation (P236T) of bovine ACADVL gene affecting growth traits.

    PubMed

    Zhang, Sihuan; Dang, Yonglong; Zhang, Qingfeng; Qin, Qiaomei; Lei, Chuzhao; Chen, Hong; Lan, Xianyong

    2015-04-01

    Acyl-CoA dehydrogenase, very long chain (ACADVL), encoding ACADVL protein, targets the inner mitochondrial membrane where it catalyzes the first step of the mitochondrial fatty acid beta-oxidation pathway and plays an important role in body metabolism and oxidation of long chain fatty acid releasing energy. Tetra-primer amplification refractory mutation system PCR (T-ARMS-PCR) is an easy-to-operate, rapid, inexpensive, and exact method for SNP genotyping. Herein, T-ARMS-PCR was carried out to detect a critical missense mutation (AC_000176:g.2885C>A; Pro236Thr) within the ACADVL gene in 644 individuals from two cattle breeds. In order to evaluate the accuracy of the T-ARMS-PCR at this locus, the genotype of the sampled individuals was also identified by PCR-RFLP. The concordance between these two methods was 98.76%. Statistical analysis showed that the bovine ACADVL gene had a significant effect on chest width (P<0.05), chest depth (P<0.05), and hip width (P<0.05) in the Qinchuan breed. The cattle with AA genotype had superior growth traits compared to cattle with AC and/or CC genotypes. The "A" allele had positive effects on growth traits. Therefore, T-ARMS-PCR can replace PCR-RFLP for rapid genotyping of this mutation, which could be used as a DNA marker for selecting individuals with superior growth traits in the Qinchuan breed. These findings contribute to breeding and genetics in beef cattle industry.

  4. Development of a direct blood-based PCR system to detect BLV provirus using CoCoMo primers.

    PubMed

    Takeshima, Shin-Nosuke; Watanuki, Sonoko; Ishizaki, Hiroshi; Matoba, Kazuhiro; Aida, Yoko

    2016-06-01

    Bovine leukemia virus (BLV), the etiologic agent of enzootic bovine leucosis, has caused pandemic outbreaks worldwide. Because transcription of the BLV is quickly blocked after infection, detecting integrated provirus at host genome is an important method of identifying whether an animal is infected. The aim of the present study was to develop a novel direct blood-based PCR system to detect the BLV provirus with high specificity and at low cost. The assay was based on the BLV-CoCoMo degenerate primers, which amplify all known BLV strains. Cattle blood samples (n = 182) were collected from the same BLV-positive farm and subjected to BLV-CoCoMo-direct-PCR to detect the BLV provirus. The proviral load was then estimated. This novel PCR method showed 100 % specificity. The BLV-CoCoMo-direct-PCR can be used in a variety of laboratory situations because it does not require expensive equipment/reagents, DNA purification, or a second round of PCR. Therefore, the method is extremely cost-effective and the risk of a false-positive result due to DNA contamination is very low. PMID:26997610

  5. Data supporting the design and evaluation of a universal primer pair for pseudogene-free amplification of HPRT1 in real-time PCR

    PubMed Central

    Valadan, Reza; Hedayatizadeh-Omran, Akbar; Alhosseini-Abyazani, Mahdyieh Naghavi; Amjadi, Omolbanin; Rafiei, Alireza; Tehrani, Mohsen; Alizadeh-Navaei, Reza

    2015-01-01

    Hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) is a common housekeeping gene for sample normalization in the quantitative reverse transcriptase polymerase chain (qRT-PCR). However, co-amplification of HPRT1 pseudogenes may affect accurate results obtained in qRT-PCR. We designed a primer pair (HPSF) for pseudogene-free amplification of HPRT1 in qRT-PCR [1]. We showed specific amplification of HPRT1 mRNA in some common laboratory cell lines, including HeLa, NIH/3T3, CHO, BHK, COS-7 and VERO. This article provides data supporting the presence and location of HPRT1 pseudogenes within human and mouse genome, and the strategies used for designing primers that avoid the co-amplification of contaminating pseudogenes in qRT-PCR. In silico analysis of human genome showed three homologous sequences for HPRT1 on chromosomes 4, 5 and 11. The mRNA sequence of HPRT1 was aligned with the pseudogenes, and the primers were designed toward 5′ end of HPRT1 mRNA that was only specific to HPRT1 mRNA not to the pseudogenes. The standard curve plot generated by HPSF primers showed the correlation coefficient of 0.999 and the reaction efficiency of 99.5%. Our findings suggest that HPSF primers can be recommended as a candidate primer pair for accurate and reproducible qRT-PCR assays. PMID:26217821

  6. Data supporting the design and evaluation of a universal primer pair for pseudogene-free amplification of HPRT1 in real-time PCR.

    PubMed

    Valadan, Reza; Hedayatizadeh-Omran, Akbar; Alhosseini-Abyazani, Mahdyieh Naghavi; Amjadi, Omolbanin; Rafiei, Alireza; Tehrani, Mohsen; Alizadeh-Navaei, Reza

    2015-09-01

    Hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) is a common housekeeping gene for sample normalization in the quantitative reverse transcriptase polymerase chain (qRT-PCR). However, co-amplification of HPRT1 pseudogenes may affect accurate results obtained in qRT-PCR. We designed a primer pair (HPSF) for pseudogene-free amplification of HPRT1 in qRT-PCR [1]. We showed specific amplification of HPRT1 mRNA in some common laboratory cell lines, including HeLa, NIH/3T3, CHO, BHK, COS-7 and VERO. This article provides data supporting the presence and location of HPRT1 pseudogenes within human and mouse genome, and the strategies used for designing primers that avoid the co-amplification of contaminating pseudogenes in qRT-PCR. In silico analysis of human genome showed three homologous sequences for HPRT1 on chromosomes 4, 5 and 11. The mRNA sequence of HPRT1 was aligned with the pseudogenes, and the primers were designed toward 5' end of HPRT1 mRNA that was only specific to HPRT1 mRNA not to the pseudogenes. The standard curve plot generated by HPSF primers showed the correlation coefficient of 0.999 and the reaction efficiency of 99.5%. Our findings suggest that HPSF primers can be recommended as a candidate primer pair for accurate and reproducible qRT-PCR assays.

  7. Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise

    ERIC Educational Resources Information Center

    Robertson, Amber L.; Phillips, Allison R.

    2008-01-01

    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel…

  8. Development of catechol 2,3-dioxygenase-specific primers for monitoring bioremediation by competitive quantitative PCR

    SciTech Connect

    Mesarch, M.B.; Nakatsu, C.H.; Nies, L.

    2000-02-01

    Benzene, toluene, xylenes, phenol, naphthalene, and biphenyl are among a group of compounds that have at least one reported pathway for biodegradation involving catechol 2,3-dioxygenase enzymes. Thus, detection of the corresponding catechol 2,3-dioxygenase genes can serve as a basis for identifying and quantifying bacteria that have these catabolic abilities. Primes that can successfully amplify a 238-bp catechol 2,3-dioxygenase gene fragment from eight different bacteria are described. The identities of the amplicons were confirmed by hybridization with a 238-bp catechol 2,3-dioxygenase probe. The detection limit was 10{sup 2} to 10{sup 3} gene copies, which was lowered to 10{sup 0} to 10{sup 1} gene copies of hybridization. Using the dioxygenase-specific primers, an increase in catechol 2,3-dioxygenase genes was detected in petroleum-amended soils. The dioxygenase genes were enumerated by competitive quantitative PCR and a 163-bp competitor that was amplified using the same primers. Target and competitor sequences had identical amplification kinetics. Potential PCR inhibitors that could coextract with DNA, nonamplifying DNA, soil factors (humics), and soil pollutants (toluene) did not impact enumeration. Therefore, this technique can be used to accurately and reproducibly quantify catechol 2,3-dioxygenase genes in complex environments such as petroleum-contaminated soil. Direct, non-cultivation-based molecular techniques for detecting and enumerating microbial pollutant-biodegrading genes in environmental samples are powerful tools for monitoring bioremediation and developing field evidence in support of natural attenuation.

  9. New Design Strategy for Development of Specific Primer Sets for PCR-Based Detection of Chlorophyceae and Bacillariophyceae in Environmental Samples▿ †

    PubMed Central

    Valiente Moro, Claire; Crouzet, Olivier; Rasconi, Séréna; Thouvenot, Antoine; Coffe, Gérard; Batisson, Isabelle; Bohatier, Jacques

    2009-01-01

    Studying aquatic microalgae is essential for monitoring biodiversity and water quality. We designed new sets of 18S rRNA PCR primers for Chlorophyceae and Bacillariophyceae by using the ARB software and implementing a virtual PCR program. The results of specificity analysis showed that most of the targeted algal families were identified and nontargeted organisms, such as fungi or ciliates, were excluded. These newly developed PCR primer sets were also able to amplify microalgal rRNA genes from environmental samples with accurate specificity. These tools could be of great interest for studying freshwater microalgal ecology and for developing bioindicators of the health status of aquatic environments. PMID:19592531

  10. New design strategy for development of specific primer sets for PCR-based detection of Chlorophyceae and Bacillariophyceae in environmental samples.

    PubMed

    Moro, Claire Valiente; Crouzet, Olivier; Rasconi, Séréna; Thouvenot, Antoine; Coffe, Gérard; Batisson, Isabelle; Bohatier, Jacques

    2009-09-01

    Studying aquatic microalgae is essential for monitoring biodiversity and water quality. We designed new sets of 18S rRNA PCR primers for Chlorophyceae and Bacillariophyceae by using the ARB software and implementing a virtual PCR program. The results of specificity analysis showed that most of the targeted algal families were identified and nontargeted organisms, such as fungi or ciliates, were excluded. These newly developed PCR primer sets were also able to amplify microalgal rRNA genes from environmental samples with accurate specificity. These tools could be of great interest for studying freshwater microalgal ecology and for developing bioindicators of the health status of aquatic environments. PMID:19592531

  11. A robust PCR primer design platform applied to the detection of Acidobacteria Group 1 in soil.

    PubMed

    Gans, Jason D; Dunbar, John; Eichorst, Stephanie A; Gallegos-Graves, La Verne; Wolinsky, Murray; Kuske, Cheryl R

    2012-07-01

    Environmental biosurveillance and microbial ecology studies use PCR-based assays to detect and quantify microbial taxa and gene sequences within a complex background of microorganisms. However, the fragmentary nature and growing quantity of DNA-sequence data make group-specific assay design challenging. We solved this problem by developing a software platform that enables PCR-assay design at an unprecedented scale. As a demonstration, we developed quantitative PCR assays for a globally widespread, ecologically important bacterial group in soil, Acidobacteria Group 1. A total of 33,684 Acidobacteria 16S rRNA gene sequences were used for assay design. Following 1 week of computation on a 376-core cluster, 83 assays were obtained. We validated the specificity of the top three assays, collectively predicted to detect 42% of the Acidobacteria Group 1 sequences, by PCR amplification and sequencing of DNA from soil. Based on previous analyses of 16S rRNA gene sequencing, Acidobacteria Group 1 species were expected to decrease in response to elevated atmospheric CO(2). Quantitative PCR results, using the Acidobacteria Group 1-specific PCR assays, confirmed the expected decrease and provided higher statistical confidence than the 16S rRNA gene-sequencing data. These results demonstrate a powerful capacity to address previously intractable assay design challenges.

  12. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    PubMed

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  13. Phototyping: comprehensive DNA typing for HLA-A, B, C, DRB1, DRB3, DRB4, DRB5 & DQB1 by PCR with 144 primer mixes utilizing sequence-specific primers (PCR-SSP).

    PubMed

    Bunce, M; O'Neill, C M; Barnardo, M C; Krausa, P; Browning, M J; Morris, P J; Welsh, K I

    1995-11-01

    We have developed a single DNA typing method which uses 144 sequence-specific primer (SSP) reactions to simultaneously detect all known HLA-A, B, C, DRB1, DRB3, DRB4, DRB5 and DQB1 specificities in an allele specific or group specific manner using the same method, reagents, PCR parameters and protocols for all loci. The results from this integrated class I & II method can be visualized on a single photographic or electronic image and hence is described as "Phototyping". Phototyping has an overall resolution greater than or equivalent to good serology and results can be obtained in under 3 hours making the method suitable for genotyping potential cadaver donor peripheral blood without serological backup. This in turn produces the potential for reducing cold ischaemia times in renal transplantation as well as the application of prospective matching to cardiac and liver transplantation. The method has capacity to detect new alleles, for example, novel amplification patterns suggestive of 4 new HLA-B alleles have been detected. The Phototyping set has been used as the sole method of HLA typing for over 1010 individuals. Phototyping is not problem-free; deviations from the standard protocol, poor quality DNA and unsuitable PCR machines can result in individual PCR failures or in incorrect assignment of antigens. Approximately 5% of genotypes were repeated (either partially or fully) because of incomplete or equivocal results.

  14. Development of Primers to O-Antigen Biosynthesis Genes for Specific Detection of Escherichia coli O157 by PCR

    PubMed Central

    Maurer, John J.; Schmidt, Denise; Petrosko, Patricia; Sanchez, Susan; Bolton, Lance; Lee, Margie D.

    1999-01-01

    The chemical composition of each O-antigen subunit in gram-negative bacteria is a reflection of the unique DNA sequences within each rfb operon. By characterizing DNA sequences contained with each rfb operon, a diagnostic serotype-specific probe to Escherichia coli O serotypes that are commonly associated with bacterial infections can be generated. Recently, from an E. coli O157:H7 cosmid library, O-antigen-positive cosmids were identified with O157-specific antisera. By using the cosmid DNAs as probes, several DNA fragments which were unique to E. coli O157 serotypes were identified by Southern analysis. Several of these DNA fragments were subcloned from O157-antigen-positive cosmids and served as DNA probes in Southern analysis. One DNA fragment within plasmid pDS306 which was specific for E. coli O157 serotypes was identified by Southern analysis. The DNA sequence for this plasmid revealed homology to two rfb genes, the first of which encodes a GDP-mannose dehydratase. These rfb genes were similar to O-antigen biosynthesis genes in Vibrio cholerae and Yersinia enterocolitica serotype O:8. An oligonucleotide primer pair was designed to amplify a 420-bp DNA fragment from E. coli O157 serotypes. The PCR test was specific for E. coli O157 serotypes. PCR detected as few as 10 cells with the O157-specific rfb oligonucleotide primers. Coupled with current enrichment protocols, O157 serotyping by PCR will provide a rapid, specific, and sensitive method for identifying E. coli O157. PMID:10388689

  15. PCR amplification of the hrcV gene through specific primers for detecting Pseudomonas syringae pathovars.

    PubMed

    Vaseghi, Akbar; Bakhshinejad, Babak; Safaie, Naser; Parchin, Reza Ashrafi; Sadeghizadeh, Majid

    2014-02-01

    Pseudomonas syringae pathovars are important pathogens among phytopathogenic bacteria causing a variety of diseases in plants. These pathogens can rapidly disseminate in a large area leading to infection and destruction of plants. To prevent the incidence of the bacteria, appropriate detection methods should be employed. Routinely serological tests, being time-consuming and costly, are exploited to detect these pathogens in plants, soil, water and other resources. Over the recent years, DNA-based detection approaches which are stable, rapid, specific and reliable have been developed and sequence analysis of various genes are widely utilized to identify different strains of P. syringe. However, the greatest limitation of these genes is inability to detect numerous pathovars of P. syringae. Herein, by using bioinformatic analysis, we found the hrcV gene located at pathogenicity islands of bacterial genome with the potential of being used as a new marker for phylogenetic detection of numerous pathovars of P. syringae. Following design of specific primers to hrcV, we amplified a 440 bp fragment. Of 13 assayed pathovars, 11 were detected. Also, through experimental procedures and bioinformatic analysis it was revealed that the designed primers have the capacity to detect 19 pathovars. Our findings suggest that hrcV could be used as a gene with the merit of detecting more pathovars of P. syringae in comparison with other genes used frequently for detection purposes.

  16. PCR-Based Serotyping of Streptococcus pneumoniae from Culture-Negative Specimens: Novel Primers for Detection of Serotypes within Serogroup 18

    PubMed Central

    Tanmoy, Arif M.; Saha, Senjuti; Darmstadt, Gary L.; Whitney, Cynthia G.

    2016-01-01

    Six multiplex-compatible PCR primers were designed to distinguish Streptococcus pneumoniae serotypes within serogroup 18 from culturable/nonculturable pneumococcal specimens, with no cross-reactivity with other serotypes and respiratory organisms. These primers will aid in the generation of better data on vaccine/nonvaccine serotypes in invasive and carriage pneumococcal surveillance and contribute to future vaccine formulation and impact studies. PMID:27252464

  17. Prey choice by carabid beetles feeding on an earthworm community analysed using species- and lineage-specific PCR primers.

    PubMed

    King, R Andrew; Vaughan, Ian P; Bell, James R; Bohan, David A; Symondson, William O C

    2010-04-01

    The carabid beetle Pterostichus melanarius is a major natural enemy of pests, such as aphids and slugs in agricultural systems. Earthworms are a dominant non-pest component of the diet of P. melanarius which help sustain the beetles during periods when the pest population is low or absent. In this study we wanted to test whether this predator exercises prey choice among different earthworm species or ecological groups. High levels of genetic diversity within morphological species of earthworm necessitated the development of primers that were specific not just to species but lineages and sub-lineages within species as well. Gut samples from beetles were analysed using multiplex-PCR and fluorescent-labelled primers. Calibratory feeding trials were undertaken to calculate median detection times for prey DNA following ingestion. Extensive testing demonstrated that the primers were species-specific, that detection periods were negatively related to amplicon size and that meal size had a highly significant effect on detection periods. Monte Carlo simulations showed that, in general, worms were being predated in proportion to their densities in the field with little evidence of prey choice, other than probable avoidance of the larger, deep-living species. There was no evidence that epigeic species were being taken preferentially in comparison with endogeic species. There was also no evidence that defensive secretions by Allolobophora chlorotica reduced predation pressure on this species by P. melanarius. We concluded that any management system that increases earthworm densities generally, regardless of component species, is likely to be optimal for increasing numbers of this beneficial beetle predator. PMID:20345680

  18. Specific primer sets used to amplify by PCR the hepatitis B virus overlapping S/Pol region select different viral variants.

    PubMed

    Cuestas, M L; Mathet, V L; Oubiña, J R

    2012-10-01

    PCR detection of viral genomes has provided new insights into viral diagnosis. Nowadays, it is the most frequently used nucleic acid testing (qualitative and quantitative) technique. The aim of this study was to analyse the major circulating hepatitis B virus (HBV) variants PCR-amplified by three sets of primers in a patient infected with genotype E. The HBV S/Pol overlapping genomic region was amplified from the serum of an infected child using three primer sets previously described. Sequence analysis corresponding to the HBV S/Pol region revealed the presence of different viral populations depending on the set of primers used. D144A S-escape mutant was detected with two of the primer sets, while the rtL217R mutant within the Pol - conferring resistance to Adefovir - could be picked up with a different pair of primer sets. This study undoubtedly implies that the description of viral polymorphisms should be stated together with the sequence of the primers used for PCR amplification when studies of escape and/or antiviral-resistant HBV mutants are carried out.

  19. Specific primer sets used to amplify by PCR the hepatitis B virus overlapping S/Pol region select different viral variants.

    PubMed

    Cuestas, M L; Mathet, V L; Oubiña, J R

    2012-10-01

    PCR detection of viral genomes has provided new insights into viral diagnosis. Nowadays, it is the most frequently used nucleic acid testing (qualitative and quantitative) technique. The aim of this study was to analyse the major circulating hepatitis B virus (HBV) variants PCR-amplified by three sets of primers in a patient infected with genotype E. The HBV S/Pol overlapping genomic region was amplified from the serum of an infected child using three primer sets previously described. Sequence analysis corresponding to the HBV S/Pol region revealed the presence of different viral populations depending on the set of primers used. D144A S-escape mutant was detected with two of the primer sets, while the rtL217R mutant within the Pol - conferring resistance to Adefovir - could be picked up with a different pair of primer sets. This study undoubtedly implies that the description of viral polymorphisms should be stated together with the sequence of the primers used for PCR amplification when studies of escape and/or antiviral-resistant HBV mutants are carried out. PMID:22967107

  20. PCR detection of DNAs of animal origin in feed by primers based on sequences of short and long interspersed repetitive elements.

    PubMed

    Tajima, Kiyoshi; Enishi, Osamu; Amari, Masahiro; Mitsumori, Makoto; Kajikawa, Hiroshi; Kurihara, Mitsunori; Yanai, Satoshi; Matsui, Hiroki; Yasue, Hiroshi; Mitsuhashi, Tadayoshi; Kawashima, Tomoyuki; Matsumoto, Mitsuto

    2002-10-01

    PCR primers for the detection of materials derived from ruminants, pigs, and chickens were newly designed on the basis of sequences of the Art2 short interspersed repetitive element (SINE), PRE-1 SINE, and CR1 long interspersed repetitive element (LINE), respectively. These primers amplified the SINE or LINE from total DNA extracted from the target animals and from test feed containing commercial meat and bone meal (MBM). With the primers, detection of Art2, PRE-1, or CR1 in test feed at concentrations of 0.01% MBM or less was possible. This method was suitable for the detection of microcontamination of feed by animal materials. PMID:12450143

  1. Primers with 5' flaps improve the efficiency and sensitivity of multiplex PCR assays for the detection of Salmonella and Escherichia coli O157:H7.

    PubMed

    Timmons, Chris; Dobhal, Shefali; Fletcher, Jacqueline; Ma, Li Maria

    2013-04-01

    Foodborne illnesses caused by Salmonella enterica and Escherichia coli O157:H7 are worldwide health concerns. Rapid, sensitive, and robust detection of these pathogens in foods and in clinical and environmental samples is essential for routine food quality testing, effective surveillance, and outbreak investigations. The aim of this study was to evaluate the effect on PCR sensitivity of adding a short, AT-rich overhanging nucleotide sequence (flap) to the 5' end of PCR primers specific for the detection of Salmonella and E. coli O157:H7. Primers targeting the invA gene of Salmonella and the rfbE gene of E. coli O157:H7 were synthesized with or without a 12-bp, AT-rich 5' flap (5'-AATAAATCATAA-3'). Singleplex PCR, multiplex PCR, and real-time PCR sensitivity assays were conducted using purified bacterial genomic DNA and crude cell lysates of bacterial cells. The effect of background flora on detection was evaluated by spiking tomato and jalapeno pepper surface washes with E. coli O157:H7 and Salmonella Saintpaul. When targeting individual pathogens, end-point PCR assays using flap-amended primers were more efficient than nonamended primers, with 20.4 and 23.5% increases in amplicon yield for Salmonella and E. coli O157:H7, respectively. In multiplex PCR assays, a 10- to 100-fold increase in detection sensitivity was observed when the primer flap sequence was incorporated. This improvement in both singleplex and multiplex PCR efficiency and sensitivity can lead to improved Salmonella and E. coli O157:H7 detection.

  2. Novel multiplex PCR assay using locked nucleic acid (LNA)-based universal primers for the simultaneous detection of five swine viruses.

    PubMed

    Chen, Ru; Gao, Xiao-Bo; Yu, Xiao-Lu; Song, Chang-Xu; Qiu, Yang

    2016-02-01

    A novel multiplex PCR assay using non-homologous oligonucleotides with locked nucleic acid (LNA) modifications as universal primers was developed and validated for the simultaneous detection of five swine viruses. The assay utilizes five virus-specific primer pairs modified at the 5' end through the addition of the universal primer sequence. In the reaction, small amounts of target templates with the 5' tail were generated and subsequently amplified through the extension of a LNA universal primer set. To validate the specificity of this assay, 27 viral target strains and 12 non-target pathogens were tested. The lower limit of detection of viral nucleic acids was 1.1-1.9 pg per reaction or 11-32 pg in a five-plex viral nucleic acid mixture. The LNA mPCR assay displayed higher analytical sensitivity and efficiency for the detection of plasmid standards compared with the conventional assay, which uses standard primers without the 5' tail. A total of 207 field samples were tested using both assays. The LNA mPCR assay provided numerically higher detection rates for all pathogens in independent samples. Moreover, the LNA mPCR assay had significantly higher detection rates in independent samples compared with the conventional assay. PMID:26615807

  3. Soil clone library analyses to evaluate specificity and selectivity of PCR primers targeting fungal 18S rDNA for denaturing-gradient gel electrophoresis (DGGE).

    PubMed

    Takada Hoshino, Yuko; Morimoto, Sho

    2010-01-01

    We evaluated the fungal specificity and detection bias of four fungal 18S rRNA gene (18S rDNA) primer sets for denaturing-gradient gel electrophoresis (DGGE). We constructed and compared clone libraries amplified from upland and paddy field soils with each primer set (1, NS1/GCFung; 2, FF390/FR1-GC; 3, NS1/FR1-GC; and 4, NS1/EF3 for the first PCR and NS1/FR1-GC for the second PCR). Primer set 4 (for nested PCR) showed the highest specificity for fungi but biased specific sequences. Sets 1, 2, and 3 (for single PCR) amplified non-fungal eukaryotic sequences (from 7 to 16% for upland soil and from 20 to 31% for paddy field soil) and produced libraries with similar distributions of fungal 18S rDNA sequences at both the phylum and the class level. Set 2 tended to amplify more diverse fungal sequences, maintaining higher specificity for fungi. In addition, clone analyses revealed differences among primer sets in the frequency of chimeras. In upland field soil, the libraries amplified with primer sets 3 and 4, which targeted long fragments, contained many chimeric 18S rDNA sequences (18% and 48%, respectively), while the libraries obtained with sets 1 and 2, which targeted short fragments, contained fewer chimeras (5% and 10%, respectively).

  4. Profiling of Epstein-Barr virus latent RNA expression in clinical specimens by gene-specific multiprimed cDNA synthesis and PCR.

    PubMed

    Stevens, Servi J C; Brink, Antoinette A T P; Middeldorp, Jaap M

    2005-01-01

    We describe a two-step RT-PCR method for simultaneous detection of EBNA-1 (QK and Y3K splice variants), EBNA-2, LMP-1, LMP-2a and -2b, ZEBRA, and BARTs RNA encoded by Epstein-Barr virus. As a control for RNA integrity, the low-copy-number transcript derived from U1A snRNP, a cellular housekeeping gene, is coamplified. Copy DNA (cDNA) for these nine targets is simultaneously synthesized in a gene-specific, multiprimed cDNA reaction, which strongly reduces the amount of required clinical specimen and allows more sensitive detection than random hexamer or oligo-dT priming. For amplification, cDNA synthesis is followed by nine separate PCRs for the mentioned targets. Primers were designed either as intron-flanking, to avoid background DNA amplification, or in different exons, allowing identification of differentially spliced RNA molecules. To increase specificity, PCR products are detected by autoradiography after hybridization with radiolabeled internal oligonucleotide probes. The method described is highly suitable for profiling EBV latent RNA expression in tissue biopsies, cultured or isolated cells, and unfractionated whole blood and for definition of EBV latency type I, II, or III gene expression in these samples.

  5. Coamplification of eukaryotic DNA with 16S rRNA gene-based PCR primers: possible consequences for population fingerprinting of complex microbial communities.

    PubMed

    Huys, Geert; Vanhoutte, Tom; Joossens, Marie; Mahious, Amal S; De Brandt, Evie; Vermeire, Severine; Swings, Jean

    2008-06-01

    The main aim of this study was to evaluate the specificity of three commonly used 16S rRNA gene-based polymerase chain reaction (PCR) primer sets for bacterial community analysis of samples contaminated with eukaryotic DNA. The specificity of primer sets targeting the V3, V3-V5, and V6-V8 hypervariable regions of the 16S rRNA gene was investigated in silico and by community fingerprinting of human and fish intestinal samples. Both in silico and PCR-based analysis revealed cross-reactivity of the V3 and V3-V5 primers with the 18S rRNA gene of human and sturgeon. The consequences of this primer anomaly were illustrated by denaturing gradient gel electrophoresis (DGGE) profiling of microbial communities in human feces and mixed gut of Siberian sturgeon. DGGE profiling indicated that the cross-reactivity of 16S rRNA gene primers with nontarget eukaryotic DNA might lead to an overestimation of bacterial biodiversity. This study has confirmed previous sporadic indications in literature indicating that several commonly applied 16S rRNA gene primer sets lack specificity toward bacteria in the presence of eukaryotic DNA. The phenomenon of cross-reactivity is a potential source of systematic error in all biodiversity studies where no subsequent analysis of individual community amplicons by cloning and sequencing is performed.

  6. Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR

    PubMed Central

    Chaumeau, V.; Andolina, C.; Fustec, B.; Tuikue Ndam, N.; Brengues, C.; Herder, S.; Cerqueira, D.; Chareonviriyaphap, T.; Nosten, F.; Corbel, V.

    2016-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies. PMID:27441839

  7. Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR.

    PubMed

    Chaumeau, V; Andolina, C; Fustec, B; Tuikue Ndam, N; Brengues, C; Herder, S; Cerqueira, D; Chareonviriyaphap, T; Nosten, F; Corbel, V

    2016-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies. PMID:27441839

  8. Highly specific and efficient primers for in-house multiplex PCR detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum

    PubMed Central

    2014-01-01

    Background Although sophisticated methodologies are available, the use of endpoint polymerase chain reaction (PCR) to detect 16S rDNA genes remains a good approach for estimating the incidence and prevalence of specific infections and for monitoring infections. Considering the importance of the early diagnosis of sexually transmitted infections (STIs), the development of a sensitive and affordable method for identifying pathogens in clinical samples is needed. Highly specific and efficient primers for a multiplex polymerase chain reaction (m-PCR) system were designed in silico to detect the 16S rDNA genes of four bacteria that cause genital infections, and the PCR method was developed. Methods The Genosensor Probe Designer (GPD) (version 1.0a) software was initially used to design highly specific and efficient primers for in-house m-PCR. Single-locus PCR reactions were performed and standardised, and then primers for each locus in turn were added individually in subsequent amplifications until m-PCR was achieved. Amplicons of the expected size were obtained from each of the four bacterial gene fragments. Finally, the analytical specificity and limits of detection were tested. Results Because they did not amplify any product from non-STI tested species, the primers were specific. The detection limits for the Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum primer sets were 5.12 × 105, 3.9 × 103, 61.19 × 106 and 6.37 × 105 copies of a DNA template, respectively. Conclusions The methodology designed and standardised here could be applied satisfactorily for the simultaneous or individual detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum. This method is at least as efficient as other previously described methods; however, this method is more affordable for low-income countries. PMID:24997675

  9. Use of 16S rRNA Gene-Targeted Group-Specific Primers for Real-Time PCR Analysis of Predominant Bacteria in Mouse Feces.

    PubMed

    Yang, Yun-Wen; Chen, Mang-Kun; Yang, Bing-Ya; Huang, Xian-Jie; Zhang, Xue-Rui; He, Liang-Qiang; Zhang, Jing; Hua, Zi-Chun

    2015-10-01

    Mouse models are widely used for studying gastrointestinal (GI) tract-related diseases. It is necessary and important to develop a new set of primers to monitor the mouse gut microbiota. In this study, 16S rRNA gene-targeted group-specific primers for Firmicutes, Actinobacteria, Bacteroidetes, Deferribacteres, "Candidatus Saccharibacteria," Verrucomicrobia, Tenericutes, and Proteobacteria were designed and validated for quantification of the predominant bacterial species in mouse feces by real-time PCR. After confirmation of their accuracy and specificity by high-throughput sequencing technologies, these primers were applied to quantify the changes in the fecal samples from a trinitrobenzene sulfonic acid-induced colitis mouse model. Our results showed that this approach efficiently predicted the occurrence of colitis, such as spontaneous chronic inflammatory bowel disease in transgenic mice. The set of primers developed in this study provides a simple and affordable method to monitor changes in the intestinal microbiota at the phylum level. PMID:26187967

  10. Establishment and Validation of a Non-Radioactive Method for In Vitro Transcription Assay Using Primer Extension and Quantitative Real Time PCR.

    PubMed

    Wang, Juan; Zhao, Shasha; Zhou, Ying; Wei, Yun; Deng, Wensheng

    2015-01-01

    Primer extension-dependent in vitro transcription assay is one of the most important approaches in the research field of gene transcription. However, conventional in vitro transcription assays incorporates radioactive isotopes that cause environmental and health concerns and restricts its scope of application. Here we report a novel non-radioactive method for in vitro transcription analysis by combining primer extension with quantitative real time PCR (qPCR). We show that the DNA template within the transcription system can be effectively eliminated to a very low level by our specially designed approach, and that the primers uniquely designed for primer extension and qPCR can specifically recognize the RNA transcripts. Quantitative PCR data demonstrate that the novel method has successfully been applied to in vitro transcription analyses using the adenovirus E4 and major late promoters. Furthermore, we show that the TFIIB recognition element inhibits transcription of TATA-less promoters using both conventional and nonradioactive in vitro transcription assays. Our method will benefit the laboratories that need to perform in vitro transcription but either lack of or choose to avoid radioactive facilities.

  11. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

    EPA Science Inventory

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  12. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRna Gene PCR Primers

    EPA Science Inventory

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  13. Simultaneous detection of virulence factors from a colony in diarrheagenic Escherichia coli by a multiplex PCR assay with Alexa Fluor-labeled primers.

    PubMed

    Kuwayama, Masaru; Shigemoto, Naoki; Oohara, Sachiko; Tanizawa, Yukie; Yamada, Hiroko; Takeda, Yoshihiro; Matsuo, Takeshi; Fukuda, Shinji

    2011-07-01

    We have developed simultaneous detection of eight genes associated with the five categories of diarrheagenic Escherichia coli by the multiplex PCR assay with Alexa Fluor-labeled primers. This assay can easily distinguish eight genes based on the size and color of amplified products without gel staining.

  14. Design and testing of multiplex RT-PCR primers for the rapid detection of influenza A virus genomic segments: Application to equine influenza virus.

    PubMed

    Lee, EunJung; Kim, Eun-Ju; Shin, Yeun-Kyung; Song, Jae-Young

    2016-02-01

    The avian influenza A virus causes respiratory infections in animal species. It can undergo genomic recombination with newly obtained genetic material through an interspecies transmission. However, the process is an unpredictable event, making it difficult to predict the emergence of a new pandemic virus and distinguish its origin, especially when the virus is the result of multiple infections. Therefore, identifying a novel influenza is entirely dependent on sequencing its whole genome. Occasionally, however, it can be time-consuming, costly, and labor-intensive when sequencing many influenza viruses. To compensate for the difficulty, we developed a rapid, cost-effective, and simple multiplex RT-PCR to identify the viral genomic segments. As an example to evaluate its performance, H3N8 equine influenza virus (EIV) was studied for the purpose. In developing this protocol to amplify the EIV eight-segments, a series of processes, including phylogenetic analysis based on different influenza hosts, in silico analyses to estimate primer specificity, coverage, and variation scores, and investigation of host-specific amino acids, were progressively conducted to reduce or eliminate the negative factors that might affect PCR amplification. Selectively, EIV specific primers were synthesized with dual priming oligonucleotides (DPO) system to increase primer specificity. As a result, 16 primer pairs were selected to screen the dominantly circulating H3N8 EIV 8 genome segments: PA (3), PB2 (1), PA (3), NP (3), NA8 (2), HA3 (1), NS (1), and M (2). The diagnostic performance of the primers was evaluated with eight sets composing of four segment combinations using viral samples from various influenza hosts. The PCR results suggest that the multiplex RT-PCR has a wide range of applications in detection and diagnosis of newly emerging EIVs. Further, the proposed procedures of designing multiplex primers are expected to be used for detecting other animal influenza A viruses. PMID

  15. Development of 2, 7-Diamino-1, 8-Naphthyridine (DANP) Anchored Hairpin Primers for RT-PCR Detection of Chikungunya Virus Infection.

    PubMed

    Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann

    2016-08-01

    A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP-primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a 'turn-on' system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world. PMID:27571201

  16. Development of 2, 7-Diamino-1, 8-Naphthyridine (DANP) Anchored Hairpin Primers for RT-PCR Detection of Chikungunya Virus Infection

    PubMed Central

    Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann

    2016-01-01

    A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP—primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a ‘turn-on’ system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world. PMID:27571201

  17. A newly designed degenerate PCR primer based on pmoA gene for detection of nitrite-dependent anaerobic methane-oxidizing bacteria from different ecological niches.

    PubMed

    Han, Ping; Gu, Ji-Dong

    2013-12-01

    A new pmoA gene-based PCR primer set was designed for detection of nitrite-dependent anaerobic oxidation of methane (n-damo) bacteria from four different ecosystems, namely rice paddy soil, freshwater reservoir, reed bed, and sludge from wastewater treatment plant. This primer set showed high specificity and efficiency in recovering n-damo bacteria from these diverse samples. The obtained sequences showed 88-94 and 90-96% similarity to nucleotide and amino acid sequences, respectively, with the known NC10 phylum bacterium. According to the UniFrac principal coordinates analysis (PCoA), DNA sequences retrieved by the new PCR primer set in this study formed a separate group from the reported sequences, indicating higher diversity of n-damo in the environment. This newly designed PCR primer is capable of amplifying not only the currently known n-damo bacteria but also those that have not been reported, providing new information on the ecological diversity and distribution of this group of microorganisms in the ecosystem.

  18. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies.

    PubMed

    Klindworth, Anna; Pruesse, Elmar; Schweer, Timmy; Peplies, Jörg; Quast, Christian; Horn, Matthias; Glöckner, Frank Oliver

    2013-01-01

    16S ribosomal RNA gene (rDNA) amplicon analysis remains the standard approach for the cultivation-independent investigation of microbial diversity. The accuracy of these analyses depends strongly on the choice of primers. The overall coverage and phylum spectrum of 175 primers and 512 primer pairs were evaluated in silico with respect to the SILVA 16S/18S rDNA non-redundant reference dataset (SSURef 108 NR). Based on this evaluation a selection of 'best available' primer pairs for Bacteria and Archaea for three amplicon size classes (100-400, 400-1000, ≥ 1000 bp) is provided. The most promising bacterial primer pair (S-D-Bact-0341-b-S-17/S-D-Bact-0785-a-A-21), with an amplicon size of 464 bp, was experimentally evaluated by comparing the taxonomic distribution of the 16S rDNA amplicons with 16S rDNA fragments from directly sequenced metagenomes. The results of this study may be used as a guideline for selecting primer pairs with the best overall coverage and phylum spectrum for specific applications, therefore reducing the bias in PCR-based microbial diversity studies.

  19. Detection by PCR of human papillomavirus in Colombia: Comparison of GP5+/6+ and MY09/11 primer sets.

    PubMed

    Camargo, Milena; Soto-De Leon, Sara; Sanchez, Ricardo; Munoz, Marina; Vega, Erika; Beltran, Magda; Perez-Prados, Antonio; Patarroyo, Manuel Elkin; Patarroyo, Manuel Alfonso

    2011-12-01

    The aims of this study were to determine the prevalence of HPV infection and evaluate the concordance and performance of two primer sets for detecting single and multiple viral infections. A total of 1810 Colombian women were enrolled in the study, and molecular, cytological and epidemiological analyses were performed. Both concordance and performance of two different PCR amplification primer sets (GP5+/6+ and MY09/11) were assessed. The results showed that 60.2% of females with positive HPV DNA were infected by more than one viral type. The OR for multiple infections was 18.2 when using the MY09/11 primer set and 6.52 with the GP5+/6+ primer set. The results also showed an association between GP5+/6+ positivity and the severity of the disease regarding the cytological findings. It was also found that using a single primer set led to underestimating the prevalence for HPV infection. The simultaneous use of these primer sets is an important tool for the detection of HPV DNA, being equally relevant for identifying multiple infections and low viral DNA copies. This study highlights the importance of suitable assessment of HPV epidemiological profiles; screening programs must also be strengthened to broaden the coverage of the most vulnerable populations.

  20. Development, validation, and application of PCR primers for detection of tetracycline efflux genes of gram-negative bacteria.

    PubMed

    Aminov, R I; Chee-Sanford, J C; Garrigues, N; Teferedegne, B; Krapac, I J; White, B A; Mackie, R I

    2002-04-01

    Phylogenetic analysis of tetracycline resistance genes, which confer resistance due to the efflux of tetracycline from the cell catalyzed by drug:H(+) antiport and share a common structure with 12 transmembrane segments (12-TMS), suggested the monophyletic origin of these genes. With a high degree of confidence, this tet subcluster unifies 11 genes encoding tet efflux pumps and includes tet(A), tet(B), tet(C), tet(D), tet(E), tet(G), tet(H), tet(J), tet(Y), tet(Z), and tet(30). Phylogeny-aided alignments were used to design a set of PCR primers for detection, retrieval, and sequence analysis of the corresponding gene fragments from a variety of bacterial and environmental sources. After rigorous validation with the characterized control tet templates, this primer set was used to determine the genotype of the corresponding tetracycline resistance genes in total DNA of swine feed and feces and in the lagoons and groundwater underlying two large swine production facilities known to be impacted by waste seepage. The compounded tet fingerprint of animal feed was found to be tetCDEHZ, while the corresponding fingerprint of total intestinal microbiota was tetBCGHYZ. Interestingly, the tet fingerprints in geographically distant waste lagoons were identical (tetBCEHYZ) and were similar to the fecal fingerprint at the third location mentioned above. Despite the sporadic detection of chlortetracycline in waste lagoons, no auxiliary diversity of tet genes in comparison with the fecal diversity could be detected, suggesting that the tet pool is generated mainly in the gut of tetracycline-fed animals, with a negligible contribution from selection imposed by tetracycline that is released into the environment. The tet efflux genes were found to be percolating into the underlying groundwater and could be detected as far as 250 m downstream from the lagoons. With yet another family of tet genes, this study confirmed our earlier findings that the antibiotic resistance gene pool

  1. Identification of new primer binding site mutations at TH01 and D13S317 loci and determination of their corresponding STR alleles by allele-specific PCR.

    PubMed

    Li, Fengrui; Xuan, Jinfeng; Xing, Jiaxin; Ding, Mei; Wang, Baojie; Pang, Hao

    2014-01-01

    Several commercial multiplex PCR kits for the amplification of short tandem repeat (STR) loci have been extensively applied in forensic genetics. Consequently, large numbers of samples have been genotyped, and the number of discordant genotypes observed has also increased. We observed allele dropout with two novel alleles at the STR loci TH01 and D13S317 during paternity testing using the AmpFℓSTR Identifiler PCR Amplification Kit. The lost alleles reappeared when alternative PCR primer pairs were used. A sequence analysis revealed a G-to-A substitution 82 bases downstream of the last TCAT motif of the repeat region at the TH01 locus (GenBank accession: D00269) and a G-to-T substitution 90 bases upstream of the first TATC motif of the repeat region at the D13S317 locus (GenBank accession: G09017). The frequencies of these two point mutations were subsequently investigated in the Chinese population using sequence-specific primer PCR (SSP-PCR), but neither of these mutations was detected in any of the samples tested. In addition, the DNA samples in which the mutations were identified were amplified to type the point mutations by SSP-PCR to determine the corresponding STR alleles at the two loci. Subsequently, the amplified PCR products with different point mutations and STR repeat numbers were directly sequenced because this strategy overcomes the appearance overlapping peaks generated by different STR alleles and accurately characterizes genotypes. Thus, our findings not only provide useful information for DNA databases and forensic identification but also establish an effective strategy for typing STR alleles with primer binding site mutations.

  2. Characterization of the inhabitancy of mouse intestinal bacteria (MIB) in rodents and humans by real-time PCR with group-specific primers.

    PubMed

    Kibe, Ryoko; Sakamoto, Mitsuo; Yokota, Hiroshi; Benno, Yoshimi

    2007-01-01

    Mouse intestinal bacteria (MIB) is a new operational taxonomic unit (OTU) belonging to the Bacteroides subgroup in the Cytophaga-Flavobacter-Bacteroides (CFB) phylum recently found in the intestine of mice, rats and humans. However, their characters are still unknown since they have not yet been isolated by culture. To understand their habitat characteristics in intestinal tracts, the quantification assays of MIB were established using MIB group-specific primers. The MIB population in the intestine was evaluated as a percentage of the number of 16S rRNA gene copy of MIB. A real-time PCR assay using group specific primers showed the fluctuation of MIB inhabitancy and revealed that the MIB population in the small intestine of mice was significantly lower than the large intestinal contents. Moreover, MIB was found in human feces though the number was lower than in murine. This assay using group-specific primers revealed new information about host-preference of MIB. PMID:17446674

  3. Patho‐Genes.org: a website dedicated to gene sequences of potential bioterror bacteria and PCR primers used to amplify them

    PubMed Central

    Gardès, Julien; Bachar, Dipankar; Croce, Olivier; Christen, Richard

    2012-01-01

    Summary Pathogenic agents can be very hard to detect, and usually they do not cause illness for several hours or days. To improve the speed and the accuracy of detection tests and satisfy the needs of early diagnosis, molecular biology methods such as PCR are now used. However, selecting a proper target gene and designing good primers is often not easy. We present a dedicated website, http://patho‐genes.org, where we provide every sequence, functional annotation, published primer and relevant article for every annotated gene of major pathogenic bacterial species listed as key agents to be used for a bioterrorism attack. Each published primer was analysed to determine its melting temperature, its specificity and its coverage (i.e. its sensitivity against every allele of its target gene). Data generated have been organized in the form of data sheet for each gene, which are available through multiple browser panels and query systems. PMID:22681780

  4. Use of conserved genomic regions and degenerate primers in a PCR-based assay for the detection of members of the genus Caulimovirus.

    PubMed

    Pappu, H R; Druffel, K L

    2009-04-01

    The genus Caulimovirus consists of several distinct virus species with a double-stranded DNA genome that infect diverse plant species. A comparative analysis of the sequences of known Caulimovirus species revealed two regions that are conserved in all Caulimovirus species with the exception of Strawberry vein banding virus. Degenerate primers based on these two regions were designed and tested in a polymerase chain reaction-based assay for broad spectrum detection of members of this genus. Cauliflower mosaic virus, Figwort mosaic virus and three distinct caulimoviruses associated with dahlia (Dahlia variabilis) were used to show the utility of this test in detecting diverse caulimoviruses. The primer pair gave an amplicon of expected size (840bp). Amplicons from each virus were cloned and sequenced to verify their identity. The primer pair and the PCR assay provide approach for the broad spectrum detection of several members of the genus Caulimovirus.

  5. Use of conserved genomic regions and degenerate primers in a PCR-based assay for the detection of members of the genus Caulimovirus.

    PubMed

    Pappu, H R; Druffel, K L

    2009-04-01

    The genus Caulimovirus consists of several distinct virus species with a double-stranded DNA genome that infect diverse plant species. A comparative analysis of the sequences of known Caulimovirus species revealed two regions that are conserved in all Caulimovirus species with the exception of Strawberry vein banding virus. Degenerate primers based on these two regions were designed and tested in a polymerase chain reaction-based assay for broad spectrum detection of members of this genus. Cauliflower mosaic virus, Figwort mosaic virus and three distinct caulimoviruses associated with dahlia (Dahlia variabilis) were used to show the utility of this test in detecting diverse caulimoviruses. The primer pair gave an amplicon of expected size (840bp). Amplicons from each virus were cloned and sequenced to verify their identity. The primer pair and the PCR assay provide approach for the broad spectrum detection of several members of the genus Caulimovirus. PMID:19100290

  6. Evaluation of cells and biological reagents for adventitious agents using degenerate primer PCR and massively parallel sequencing.

    PubMed

    McClenahan, Shasta D; Uhlenhaut, Christine; Krause, Philip R

    2014-12-12

    We employed a massively parallel sequencing (MPS)-based approach to test reagents and model cell substrates including Chinese hamster ovary (CHO), Madin-Darby canine kidney (MDCK), African green monkey kidney (Vero), and High Five insect cell lines for adventitious agents. RNA and DNA were extracted either directly from the samples or from viral capsid-enriched preparations, and then subjected to MPS-based non-specific virus detection with degenerate oligonucleotide primer (DOP) PCR. MPS by 454, Illumina MiSeq, and Illumina HiSeq was compared on independent samples. Virus detection using these methods was reproducibly achieved. Unclassified sequences from CHO cells represented cellular sequences not yet submitted to the databases typically used for sequence identification. The sensitivity of MPS-based virus detection was consistent with theoretically expected limits based on dilution of virus in cellular nucleic acids. Capsid preparation increased the number of viral sequences detected. Potential viral sequences were detected in several samples; in each case, these sequences were either artifactual or (based on additional studies) shown not to be associated with replication-competent viruses. Virus-like sequences were more likely to be identified in BLAST searches using virus-specific databases that did not contain cellular sequences. Detected viral sequences included previously described retrovirus and retrovirus-like sequences in CHO, Vero, MDCK and High Five cells, and nodavirus and endogenous bracovirus sequences in High Five insect cells. Bovine viral diarrhea virus, bovine hokovirus, and porcine circovirus sequences were detected in some reagents. A recently described parvo-like virus present in some nucleic acid extraction resins was also identified in cells and extraction controls from some samples. The present study helps to illustrate the potential for MPS-based strategies in evaluating the presence of viral nucleic acids in various sample types

  7. Evaluation of cells and biological reagents for adventitious agents using degenerate primer PCR and massively parallel sequencing.

    PubMed

    McClenahan, Shasta D; Uhlenhaut, Christine; Krause, Philip R

    2014-12-12

    We employed a massively parallel sequencing (MPS)-based approach to test reagents and model cell substrates including Chinese hamster ovary (CHO), Madin-Darby canine kidney (MDCK), African green monkey kidney (Vero), and High Five insect cell lines for adventitious agents. RNA and DNA were extracted either directly from the samples or from viral capsid-enriched preparations, and then subjected to MPS-based non-specific virus detection with degenerate oligonucleotide primer (DOP) PCR. MPS by 454, Illumina MiSeq, and Illumina HiSeq was compared on independent samples. Virus detection using these methods was reproducibly achieved. Unclassified sequences from CHO cells represented cellular sequences not yet submitted to the databases typically used for sequence identification. The sensitivity of MPS-based virus detection was consistent with theoretically expected limits based on dilution of virus in cellular nucleic acids. Capsid preparation increased the number of viral sequences detected. Potential viral sequences were detected in several samples; in each case, these sequences were either artifactual or (based on additional studies) shown not to be associated with replication-competent viruses. Virus-like sequences were more likely to be identified in BLAST searches using virus-specific databases that did not contain cellular sequences. Detected viral sequences included previously described retrovirus and retrovirus-like sequences in CHO, Vero, MDCK and High Five cells, and nodavirus and endogenous bracovirus sequences in High Five insect cells. Bovine viral diarrhea virus, bovine hokovirus, and porcine circovirus sequences were detected in some reagents. A recently described parvo-like virus present in some nucleic acid extraction resins was also identified in cells and extraction controls from some samples. The present study helps to illustrate the potential for MPS-based strategies in evaluating the presence of viral nucleic acids in various sample types

  8. Diversity of reductive dehalogenase genes from environmental samples and enrichment cultures identified with degenerate primer PCR screens.

    PubMed

    Hug, Laura A; Edwards, Elizabeth A

    2013-01-01

    Reductive dehalogenases are the critical enzymes for anaerobic organohalide respiration, a microbial metabolic process that has been harnessed for bioremediation efforts to resolve chlorinated solvent contamination in groundwater and is implicated in the global halogen cycle. Reductive dehalogenase sequence diversity is informative for the dechlorination potential of the site or enrichment culture. A suite of degenerate PCR primers targeting a comprehensive curated set of reductive dehalogenase genes was designed and applied to 12 DNA samples extracted from contaminated and pristine sites, as well as six enrichment cultures capable of reducing chlorinated compounds to non-toxic end-products. The amplified gene products from four environmental sites and two enrichment cultures were sequenced using Illumina HiSeq, and the reductive dehalogenase complement of each sample determined. The results indicate that the diversity of the reductive dehalogenase gene family is much deeper than is currently accounted for: one-third of the translated proteins have less than 70% pairwise amino acid identity to database sequences. Approximately 60% of the sequenced reductive dehalogenase genes were broadly distributed, being identified in four or more samples, and often in previously sequenced genomes as well. In contrast, 17% of the sequenced reductive dehalogenases were unique, present in only a single sample and bearing less than 90% pairwise amino acid identity to any previously identified proteins. Many of the broadly distributed reductive dehalogenases are uncharacterized in terms of their substrate specificity, making these intriguing targets for further biochemical experimentation. Finally, comparison of samples from a contaminated site and an enrichment culture derived from the same site 8 years prior allowed examination of the effect of the enrichment process.

  9. Multiplexed one-step RT-PCR VP7 and VP4 genotyping assays for rotaviruses using updated primers.

    PubMed

    Esona, Mathew D; Gautam, Rashi; Tam, Ka Ian; Williams, Alice; Mijatovic-Rustempasic, Slavica; Bowen, Michael D

    2015-10-01

    The current two-step VP7 and VP4 genotyping RT-PCR assays for rotaviruses have been linked consistently to genotyping failure in an estimated 30% of RVA positive samples worldwide. We have developed a VP7 and VP4 multiplexed one-step genotyping assays using updated primers generated from contemporary VP7 and VP4 sequences. To determine assay specificity and sensitivity, 17 reference virus strains, 6 non-target gastroenteritis viruses and 725 clinical samples carrying the most common VP7 (G1, G2, G3, G4, G9, and G12) and VP4 (P[4], P[6], P[8], P[9] and P[10]) genotypes were tested in this study. All reference RVA strain targets yielded amplicons of the expected sizes and non-target genotypes and gastroenteritis viruses were not detected by either assay. Out of the 725 clinical samples tested, the VP7 and VP4 assays were able to assigned specific genotypes to 711 (98.1%) and 714 (98.5%), respectively. The remaining unassigned samples were re-tested for RVA antigen using EIA and qRT-PCR assays and all were found to be negative. The overall specificity, sensitivity and limit of detection of the VP7 assay were in the ranges of 99.0-100%, 94.0-100% and 8.6×10(1) to 8.6×10(2) copies of RNA/reaction, respectively. For the VP4 assay, the overall specificity, sensitivity and limit of detection assay were in the ranges of 100%, 94.0-100% and ≤1 to 8.6×10(2) copies of RNA/reaction, respectively. Here we report two highly robust, accurate, efficient, affordable and documentable gel-based genotyping systems which are capable of genotyping 97.8% of the six common VP7 and 98.3% of the five common VP4 genotypes of RVA strains which are responsible for approximately 88.2% of all RVA infections worldwide.

  10. Several concerns about the primer design in the universal molecular beacon real-time PCR assay and its application in HBV DNA detection.

    PubMed

    Li, Xiaomin; Huang, Yong; Song, Chen; Zhao, Meiping; Li, Yuanzong

    2007-06-01

    A universal hepatitis B virus (HBV) DNA detection kit is appealing for the worldwide diagnosis and monitoring of the treatment of different mutant types of hepatitis B virus. A sensitive and reproducible real-time PCR assay based on the universal molecular beacon (U-MB) technique was developed for the detection of HBV DNA in serum. The U-MB probe used in the assay has no interaction with the HBV DNA sequence. The U-MB technique not only reduced the cost of HBV detection but also had the potential for the development of a universal detection kit for different mutant HBV types and other DNA systems. To demonstrate its clinical utility, 90 serum samples were analyzed using the U-MB real-time PCR method. In the experiments we found that several crucial factors needed to be considered in the primer design, such as the avoidance of formation of severe primer-dimer and primer self-hairpin structure. With the optimized primer sets, satisfactory results were obtained for all the tested samples. We concluded that this assay would be an excellent candidate for a universal HBV DNA detection method.

  11. Primers to block the amplification of symbiotic apostome ciliate 18S rRNA gene in a PCR-based copepod diet study

    NASA Astrophysics Data System (ADS)

    Yi, Xiaoyan; Zhang, Huan; Liu, Guangxing

    2014-05-01

    Pelagic copepods play an important role in the marine food web. However, a full understanding of the ecological status of this zooplankton group depends on the careful study of their natural diets. In previous PCR-based copepod diet studies, we found many apostome ciliates that live symbiotically under the exoskeleton of the copepods, and their sequences were often over-represented in the 18S rRNA gene (18S rDNA) libraries. As a first step to address this issue, we designed three apostome ciliate 18S rDNA blocking primers, and tested their blocking efficiency against apostome ciliate 18s rDNA under various PCR conditions. Using a semi-quantitative PCR method, we optimized the conditions to efficiently amplify the 18S rDNA of the prey while simultaneously excluding the symbiotic apostome ciliates. This technique will facilitate PCR-based diet studies of copepods and other zooplankton in their natural environments.

  12. Development of PCR primers and a DNA macroarray for the simultaneous detection of major Staphylococcus species using groESL gene.

    PubMed

    Chiang, Yu-Cheng; Lu, Hsi-Chi; Li, Sheng-Chih; Chang, Yu-Hsin; Chen, Hsin-Yen; Lin, Chia-Wei; Tsen, Hau-Yang

    2012-03-01

    Staphylococcus spp., including S. aureus, S. intermedius, S. hyicus, S. epidermidis, S. saprophyticus, S. haemolyticus, S. xylosus, and S. carnosus, are major bacterial species associated with food poisoning, and human and veterinary clinics. Traditional methods for the identification of these staphylococci are time-consuming, laborious, or inaccurate. Therefore, rapid and accurate diagnostic methods are needed. In this study, we designed the DNA probes and polymerase chain reaction (PCR) primers for the detection of the aforementioned Staphylococcus species. These primers were proved to be specific for the detection of their corresponding target strains. Furthermore, by using a consensus primer pair, we were able to co-amplify the intergenic region of groES-groEL for these staphylococci. Followed by a chromogenic macroarray system with the specific probes on the plastic chips, these staphylococci in milk products or clinical samples could be simultaneously detected. When the system was used for the inspection of milk or urine samples containing N × 10⁰ target cells per milliliter of the sample, all these staphylococcal species could be identified after an 8-h pre-enrichment step. This system also allowed the adequate diagnosis of bacteremia, since N × 10⁰ target cells per milliliter of the blood samples could be detected after a 12-h pre-enrichment. Compared to the multiplex PCR method, this approach has the additional advantage that it allowed the discrimination of more bacterial strains-even some bacterial strains that may generate PCR products with the same molecular sizes.

  13. Development of PCR primers and a DNA macroarray for the simultaneous detection of major Staphylococcus species using groESL gene.

    PubMed

    Chiang, Yu-Cheng; Lu, Hsi-Chi; Li, Sheng-Chih; Chang, Yu-Hsin; Chen, Hsin-Yen; Lin, Chia-Wei; Tsen, Hau-Yang

    2012-03-01

    Staphylococcus spp., including S. aureus, S. intermedius, S. hyicus, S. epidermidis, S. saprophyticus, S. haemolyticus, S. xylosus, and S. carnosus, are major bacterial species associated with food poisoning, and human and veterinary clinics. Traditional methods for the identification of these staphylococci are time-consuming, laborious, or inaccurate. Therefore, rapid and accurate diagnostic methods are needed. In this study, we designed the DNA probes and polymerase chain reaction (PCR) primers for the detection of the aforementioned Staphylococcus species. These primers were proved to be specific for the detection of their corresponding target strains. Furthermore, by using a consensus primer pair, we were able to co-amplify the intergenic region of groES-groEL for these staphylococci. Followed by a chromogenic macroarray system with the specific probes on the plastic chips, these staphylococci in milk products or clinical samples could be simultaneously detected. When the system was used for the inspection of milk or urine samples containing N × 10⁰ target cells per milliliter of the sample, all these staphylococcal species could be identified after an 8-h pre-enrichment step. This system also allowed the adequate diagnosis of bacteremia, since N × 10⁰ target cells per milliliter of the blood samples could be detected after a 12-h pre-enrichment. Compared to the multiplex PCR method, this approach has the additional advantage that it allowed the discrimination of more bacterial strains-even some bacterial strains that may generate PCR products with the same molecular sizes. PMID:22300167

  14. Novel method for preparation of the template DNA and selection of primers to differentiate the material rice cultivars of rice wine by PCR.

    PubMed

    Ohtsubo, Ken'ichi; Suzuki, Keitaro; Haraguchi, Kazutomo; Nakamura, Sumiko

    2008-04-24

    As many rice wine brewers label the name of the cultivar of the material rice, authentication technology is necessary. The problems are (1) decomposition of DNAs during the fermentation, (2) contamination of DNAs from microorganisms, (3) co-existence of PCR inhibitors, such as polyphenols. The present authors improved the PCR method by (1) lyophilizing and pulverizing the rice wine to concentrate DNAs, (2) decomposition of starches and proteins so as not to inhibit DNA extraction by the use of heat-resistant amylase and proteinase K, (3) purification of the template DNA by the combination of CTAB method and fractional precipitation by 70% EtOH. To prevent the amplification of microorganism's DNAs during PCR, the present authors selected the suitable plant-specific primers. It became possible to prepare the template DNAs for PCR from the rice wine. The sequences of the amplified DNAs by PCR were ascertained to be same with those of material rice. Mislabeling of material rice cultivar was detected by PCR using the commercial rice wine. It became possible to extract and purify the template DNAs for PCR from the rice wine and to differentiate the material rice cultivars by the PCR using the rice wine as a sample.

  15. Marker production by PCR amplification with primer pairs from conserved sequences of WRKY genes in chili pepper.

    PubMed

    Kim, Hyoun-Joung; Lee, Heung-Ryul; Han, Jung-Heon; Yeom, Seon-In; Harn, Chee-Hark; Kim, Byung-Dong

    2008-04-30

    Despite increasing awareness of the importance of WRKY genes in plant defense signaling, the locations of these genes in the Capsicum genome have not been established. To develop WRKY-based markers, primer sequences were deduced from the conserved sequences of the DNA binding motif within the WRKY domains of tomato and pepper genes. These primers were derived from upstream and downstream parts of the conserved sequences of the three WRKY groups. Six primer combinations of each WRKY group were tested for polymorphisms between the mapping parents, C. annuum 'CM334' and C. annuum 'Chilsungcho'. DNA fragments amplified by primer pairs deduced from WRKY Group II genes revealed high levels of polymorphism. Using 32 primer pairs to amplify upstream and downstream parts of the WRKY domain of WRKY group II genes, 60 polymorphic bands were detected. Polymorphisms were not detected with primer pairs from downstream parts of WRKY group II genes. Half of these primers were subjected to F2 genotyping to construct a linkage map. Thirty of 41 markers were located evenly spaced on 20 of the 28 linkage groups, without clustering. This linkage map also consisted of 199 AFLP and 26 SSR markers. This WRKY-based marker system is a rapid and simple method for generating sequence-specific markers for plant gene families.

  16. The allele-specific probe and primer amplification assay, a new real-time PCR method for fine quantification of single-nucleotide polymorphisms in pooled DNA.

    PubMed

    Billard, A; Laval, V; Fillinger, S; Leroux, P; Lachaise, H; Beffa, R; Debieu, D

    2012-02-01

    The evolution of fungicide resistance within populations of plant pathogens must be monitored to develop management strategies. Such monitoring often is based on microbiological tests, such as microtiter plate assays. Molecular monitoring methods can be considered if the mutations responsible for resistance have been identified. Allele-specific real-time PCR approaches, such as amplification refractory mutation system (ARMS) PCR and mismatch amplification mutation assay (MAMA) PCR, are, despite their moderate efficacy, among the most precise methods for refining SNP quantification. We describe here a new real-time PCR method, the allele-specific probe and primer amplification assay (ASPPAA PCR). This method makes use of mixtures of allele-specific minor groove binder (MGB) TaqMan probes and allele-specific primers for the fine quantification of SNPs from a pool of DNA extracted from a mixture of conidia. It was developed for a single-nucleotide polymorphism (SNP) that is responsible for resistance to the sterol biosynthesis inhibitor fungicide fenhexamid, resulting in the replacement of the phenylalanine residue (encoded by the TTC codon) in position 412 of the enzymatic target (3-ketoreductase) by a serine (TCC), valine (GTC), or isoleucine (ATC) residue. The levels of nonspecific amplification with the ASPPAA PCR were reduced at least four times below the level of currently available allele-specific real-time PCR approaches due to strong allele specificity in amplification cycles, including two allele selectors. This new method can be used to quantify a complex quadriallelic SNP in a DNA pool with a false discovery rate of less than 1%.

  17. An improved, high-throughput method for detection of bluetongue virus RNA in Culicoides midges utilizing infrared-dye-labeled primers for reverse transcriptase PCR.

    PubMed

    Kato, Cecilia Y; Mayer, Richard T

    2007-03-01

    A new rapid (less than 6h from insect-to-results) high-throughput assay that is sensitive and specific for detecting BTV RNA in Culicoides biting midges is reported. Homogenization and extraction of nucleic acids from individual Culicoides specimens were performed in a 96-well plate format using specialized beads in a homogenization buffer compatible with cell culture and RNA extraction. A portion of homogenate (10%) from each specimen was retained for confirmatory infectious virus isolation, while the remaining 90% was used for RNA extraction. The RNA was used in a single step reverse transcriptase PCR (RT-PCR) reaction with infrared (IR)-dye-labeled primers. The RT-PCR products were visualized in agarose gels with an infrared scanner. The adaptation of IR-dye-labeled primers in combination with a one step RT-PCR resulted in a detection limit of 0.5 pfu of purified BTV RNA. All 24 serotypes of BTV prototype strains and none of the 8 serotypes of the closely related epizootic hemorrhagic disease virus (EHDV) prototype strains were detected.

  18. Novel PCR primers for the archaeal phylum Thaumarchaeota designed based on the comparative analysis of 16S rRNA gene sequences.

    PubMed

    Hong, Jin-Kyung; Kim, Hye-Jin; Cho, Jae-Chang

    2014-01-01

    Based on comparative phylogenetic analysis of 16S rRNA gene sequences deposited in an RDP database, we constructed a local database of thaumarchaeotal 16S rRNA gene sequences and developed a novel PCR primer specific for the archaeal phylum Thaumarchaeota. Among 9,727 quality-filtered (chimeral-checked, size >1.2 kb) archaeal sequences downloaded from the RDP database, 1,549 thaumarchaeotal sequences were identified and included in our local database. In our study, Thaumarchaeota included archaeal groups MG-I, SAGMCG-I, SCG, FSCG, RC, and HWCG-III, forming a monophyletic group in the phylogenetic tree. Cluster analysis revealed 114 phylotypes for Thaumarchaeota. The majority of the phylotypes (66.7%) belonged to the MG-I and SCG, which together contained most (93.9%) of the thaumarchaeotal sequences in our local database. A phylum-directed primer was designed from a consensus sequence of the phylotype sequences, and the primer's specificity was evaluated for coverage and tolerance both in silico and empirically. The phylum-directed primer, designated THAUM-494, showed >90% coverage for Thaumarchaeota and <1% tolerance to non-target taxa, indicating high specificity. To validate this result experimentally, PCRs were performed with THAUM-494 in combination with a universal archaeal primer (ARC917R or 1017FAR) and DNAs from five environmental samples to construct clone libraries. THAUM-494 showed a satisfactory specificity in empirical studies, as expected from the in silico results. Phylogenetic analysis of 859 cloned sequences obtained from 10 clone libraries revealed that >95% of the amplified sequences belonged to Thaumarchaeota. The most frequently sampled thaumarchaeotal subgroups in our samples were SCG, MG-I, and SAGMCG-I. To our knowledge, THAUM-494 is the first phylum-level primer for Thaumarchaeota. Furthermore, the high coverage and low tolerance of THAUM-494 will make it a potentially valuable tool in understanding the phylogenetic diversity and

  19. Comparative evaluation of the GP5+/6+, MY09/11 and PGMY09/11 primer sets for HPV detection by PCR in oral squamous cell carcinomas.

    PubMed

    Erhart, Sibele Morais Miyata; Rivero, Elena Riet Correa; Bazzo, Maria Luiza; Onofre, Alexandre Sherlley Casimiro

    2016-02-01

    The aim of this study was to evaluate the use of GP5+/6+, MY09/11 and PGMY09/11 primer sets for the detection of human papillomavirus (HPV) DNA by single step polymerase chain reaction (PCR) and nested PCR in formalin-fixed and paraffin-embedded (FFPE) tissues from oral squamous cell carcinomas (OSCCs). DNA extracted from FFPE tissues were tested for amplification of the human beta globin gene with PCO3/4 primers. Positive samples for this gene were tested for HPV DNA using single step PCR with GP5+/6+, MY09/11 and PGMY09/11 primer sets. All negative samples at single step PCR with MY09/11 and PGMY09/11 were subjected to a further PCR with GP5+/6+ primers using the non-amplified product in the previously reactions (nested PCR) as samples. Among 26 samples, 23 were positive for the human beta globin gene and were considered viable for HPV DNA detection by PCR. Single step PCR with GP5+/6+ and MY09/11 primers and MY/GP+ nested PCR did not amplify HPV DNA in any samples. PGMY09/11 primers detected HPV DNA in 13.0% of OSCC cases and this rate was raise to 17.4% with the use of PGMY/GP+ nested PCR. According to our results the PGMY/GP+ nested PCR is the most appropriate primer set for the detection of HPV DNA using FFPE samples from OSCC.

  20. Design and application of specific 16S rDNA-targeted primers for assessing endophytic diversity in Dendrobium officinale using nested PCR-DGGE.

    PubMed

    Yu, Jie; Zhou, Xiao-Feng; Yang, Sui-Juan; Liu, Wen-Hong; Hu, Xiu-Fang

    2013-11-01

    Novel specific 16S rDNA-targeted primers were successfully designed and applied to the characterization of endophytic diversity in Dendrobium officinale. Using the popular universal bacterial primers 27f/1492r, the fragments of chloroplast and mitochondrion 16S/18S rDNA were amplified from D. officinale. They shared high nucleotide identity with the chloroplast 16S rDNAs (99-100 %) and with the mitochondrion 18S rDNAs (93-100 %) from various plants, respectively, and both shared 73-86 % identities with the bacterial 16S rDNA sequences in GenBank. The current bacterial universal primers, including 27f/1492r, match well with the chloroplast and mitochondrion 16S/18S rDNAs, which accordingly renders these primers not useful for endophytic diversity analysis. Novel 16S rDNA-targeted primers fM1 (5'-CCGCGTGNRBGAHGAAGGYYYT-3') and rC5 (5'-TAATCCTGTTTGCTCC CCAC-3') were designed, which show good specificity compared to the 16S/18S rDNAs of D. officinale, and perfect universality within bacteria except for Cyanobacteria. The primers fM1/rC5, together with 515f-GC/rC5, which overlaps the whole V4 region of 16S rDNA, were subjected to nested polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) to analyze the diversity of endophytic bacteria in D. officinale from three different sources in China. The results showed diversities in roots and stems of the plants from all three locations. Altogether, 29 bands were identified as bacteria, with the dominant group being Proteobacteria and the dominant genus being Burkholderia, some of which commonly has the function of nitrogen fixation and thus may play potentially important roles in D. officinale. Therefore, the nested PCR-DGGE method based on the novel primers provides a good alternative for investigating the communities and roles of endophytes in D. officinale.

  1. Detection of minimal residual disease in patients with multiple myeloma using clonotype-specific PCR primers designed from DNA extracted from archival bone marrow slides.

    PubMed

    Takamatsu, Hiroyuki; Ogawa, Yoshiyasu; Kobayashi, Noriko; Obata, Kazue; Narisawa, Tadashi; Nakayama, Kouji; Munemoto, Saori; Aoki, Go; Ohata, Kinya; Kumano, Yoshihisa; Ozaki, Jun; Murata, Ryoichi; Kondo, Yukio; Terasaki, Yasushi; Kurokawa, Toshiro; Miyamoto, Toshihiro; Shimizu, Naomi; Fukushima, Toshihiro; Yoshida, Akira; Ueda, Takanori; Yoshida, Takashi; Nakao, Shinji

    2013-10-01

    Polymerase chain reaction (PCR)-negative molecular complete remission (mCR) can be induced by stem cell transplantation in some patients with multiple myeloma (MM) and is associated with long-term progression-free survival (PFS). The detection of molecular minimal residual disease (MRD), however, requires fresh or frozen materials for designing clone-specific primers, which are not always readily available. In this study, we used DNA extracted from archival bone marrow (BM) slides for PCR to detect MRD in 50 patients with MM who received various induction therapies and autologous peripheral blood stem cell transplantation (ASCT). Clonotype-specific immunoglobulin (Ig) H PCR primers were prepared for 32 of 50 cases (64%) using BM slides, and for 9 of 14 cases (64%) using fresh BM cells. DNA in peripheral blood stem cell autografts of the 22 patients who achieved at least a partial response after ASCT was subjected to PCR to amplify clonotype-specific rearranged IgH gene sequences. The median PFS of the eight patients with MRD-positive autografts was 18 months, whereas that of 14 patients with MRD-negative autografts was not reached at a median follow-up of 27 months (p = 0.012). Post-ASCT PFS of the four patients who achieved mCR was 100% at a median follow-up of 47 months. These results indicate that archival BM slides can serve as a source of DNA for preparing clonotype-specific primers for MRD monitoring in patients with MM whose cryopreserved myeloma cells are not available for DNA preparation. Our results also suggest that patients with MM who received MRD-negative autografts and achieved mCR have a long PFS.

  2. An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

    ERIC Educational Resources Information Center

    Elkins, Kelly M.; Kadunc, Raelynn E.

    2012-01-01

    In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

  3. Real-time PCR detection of Staphylococcus aureus in milk and meat using new primers designed from the heat shock protein gene htrA sequence.

    PubMed

    Chiang, Yu-Cheng; Fan, Chih-Ming; Liao, Wan-Wen; Lin, Chien-Ku; Tsen, Hau-Yang

    2007-12-01

    Staphylococcus aureus may cause foodborne disease outbreaks and staphylococcal infections and is one of the major causes of mastitis. Rapid and reliable methods for detection of this microorganism in milk and other foods are needed. In this study, we designed a primer set from the sequence of the heat shock protein gene htrA, a gene coding for high-temperature-requirement A (HtrA) protein, and used it for real-time PCR detection of S. aureus isolates: 16 reference strains and 40 strains isolated from food-poisoning cases. All strains tested generated positive results. Bacterial strains other than S. aureus, including strains of other Staphylococcus species, did not produce positive results. When this primer set was used for the real-time PCR detection of S. aureus in milk and meat samples without the preenrichment step, samples with target cell numbers greater than 10(3) CFU/ml or CFU/g could be detected, indicating the potential quantitative ability of this real-time PCR assay. With a 10-h preenrichment step, however, a detection limit of 1 CFU/ml or CFU/g could be obtained.

  4. Use of tuf gene-based primers for the PCR detection of probiotic Bifidobacterium species and enumeration of bifidobacteria in fermented milk by cultural and quantitative real-time PCR methods.

    PubMed

    Sheu, Sen-Je; Hwang, Wen-Zhe; Chiang, Yu-Cheng; Lin, Wen-Hsin; Chen, Hsin-Chih; Tsen, Hau-Yang

    2010-10-01

    Due to the increasing use of bifidobacteria in probiotic products, it is essential to establish a rapid method for the qualitative and quantitative assay of the bifidobacteria in commercial products. In this study, partial sequences of the tuf gene for 18 Bifidobacterium strains belonging to 14 species were determined. Alignment of these sequences showed that the similarities among these Bifidobacterium species were 82.24% to 99.72%. Based on these tuf gene sequences, 6 primer sets were designed for the polymerase chain reaction (PCR) assay of B. animalis subsp. animalis, B. animalis subsp. lactis, B. bifidum, B. breve, B. longum subsp. infantis, B. longum subsp. longum, and the genus of Bifidobacterium, respectively. These Bifidobacterium species are common probiotic species present in dairy and probiotic products. When each target Bifidobacterium spp. was assayed with the designed primers, PCR product with expected size was generated. In addition, for each target species, more than 70 bacterial strains other than the target species, including strains of other Bifidobacterium species, strains of Lactobacillus spp., Enterococcus spp., and other bacterial species, all generated negative results. PCR assay with primers specific to B. animalis subsp. lactis and B. longum subsp. longum confirmed the presence of these Bifidobacterium species in commercial yogurt products. In addition, for each product, enumeration of the bifidobacteria cells by culture method with BIM-25 agar and the quantitative real-time PCR showed similar cell counts. Such results indicated that within 15-d storage (4 °C) after manufacture, all the bifidobacteria cells originally present in yogurt products were viable and culturable during the storage.

  5. Diversity of Methane-Cycling Archaea in Hydrothermal Sediment Investigated by General and Group-Specific PCR Primers

    PubMed Central

    Teske, Andreas P.

    2014-01-01

    The zonation of anaerobic methane-cycling Archaea in hydrothermal sediment of Guaymas Basin was studied by general primer pairs (mcrI, ME1/ME2, mcrIRD) targeting the alpha subunit of methyl coenzyme M reductase gene (mcrA) and by new group-specific mcrA and 16S rRNA gene primer pairs. The mcrIRD primer pair outperformed the other general mcrA primer pairs in detection sensitivity and phylogenetic coverage. Methanotrophic ANME-1 Archaea were the only group detected with group-specific primers only. The detection of 14 mcrA lineages surpasses the diversity previously found in this location. Most phylotypes have high sequence similarities to hydrogenotrophs, methylotrophs, and anaerobic methanotrophs previously detected at Guaymas Basin or at hydrothermal vents, cold seeps, and oil reservoirs worldwide. Additionally, five mcrA phylotypes belonging to newly defined lineages are detected. Two of these belong to deeply branching new orders, while the others are new species or genera of Methanopyraceae and Methermicoccaceae. Downcore diversity decreases from all groups detected in the upper 6 cm (∼2 to 40°C, sulfate measurable to 4 cm) to only two groups below 6 cm (>40°C). Despite the presence of hyperthermophilic genera (Methanopyrus, Methanocaldococcus) in cooler surface strata, no genes were detected below 10 cm (≥60°C). While mcrA-based and 16S rRNA gene-based community compositions are generally congruent, the deeply branching mcrA cannot be assigned to specific 16S rRNA gene lineages. Our study indicates that even among well-studied metabolic groups and in previously characterized model environments, major evolutionary branches are overlooked. Detecting these groups by improved molecular biological methods is a crucial first step toward understanding their roles in nature. PMID:25527539

  6. Undergraduate Virology Exercises Demonstrate Conventional and Real-Time PCR Using Commercially Available HIV Primers and Noninfectious Target

    ERIC Educational Resources Information Center

    Sulzinski, Michael A.; Wasilewski, Melissa A.; Farrell, James C.; Glick, David L.

    2009-01-01

    It is an extraordinary challenge to offer an undergraduate laboratory course in virology that teaches hands-on, relevant molecular biology techniques using nonpathogenic models of human virus detection. To our knowledge, there exists no inexpensive kits or reagent sets that are appropriate for demonstrating real-time PCR (RT-PCR) in an…

  7. Construction of PCR primers to detect and distinguish Eimeria spp. in northern bobwhites and a survey of Eimeria on gamebird farms in the United States.

    PubMed

    Gerhold, Richard W; McDougald, Larry R; Beckstead, Robert B

    2011-10-01

    Coccidiosis is an important disease in captive gamebirds, including northern bobwhites (Colinusvirginianus). Three Eimeria species, Eimeria lettyae, Eimeria dispersa, and Eimeria colini, have been described in bobwhites. Distinguishing the various Eimeria spp. is often problematic because of similarity in oocyst morphology and site of infection and thus requires live bird infections to distinguish between the coccidian species. To aid in identification and diagnosis, PCR specific primers were generated against the internal transcribed spacer region 1 (ITS-1) of the ribosomal RNA gene using sequences obtained from coccidian-positive samples collected from diagnostic cases or litter from captive bobwhites. Three distinct Eimeria spp. were detected. Species-specific primers were constructed and used to survey the prevalence of the species in 31 samples collected from 13 states. The primers survey results identified E. lettyae, E. dispersa, and Eimeria sp. in 20 (64.5%), 22 (71%), and 29 (93.5%) of the samples, respectively. Mixed infections were common: 13 (41.9%) samples had 3 Eimeria spp., 14 (45.2%) had 2 spp., and 4 (12.9%) samples had only 1 species. The species were widely distributed over the area sampled and were not associated with the age of the flock.

  8. Small subunit ribosomal RNA gene sequence of Minchinia teredinis (Haplosporidia: Haplosporidiidae) and a specific DNA probe and PCR primers for its detection.

    PubMed

    Stokes, N A; Siddall, M E; Burreson, E M

    1995-05-01

    Minchinia teredinis is a pathogen of wood-boring molluscs (shipworms), Teredo spp., along the middle Atlantic coast of the U.S. Genomic DNA was extracted from M. teredinis spores and small subunit (SSU) rDNA was amplified by PCR, cloned, and sequenced. The sequence of M. teredinis SSU rDNA was aligned with that of Haplosporidium nelsoni and various protists in GenBank. A 22-base oligonucleotide probe unique to M. teredinis, designated MIN702, was commercially synthesized and tested for sensitivity and specificity. In dot-blot hybridizations the probe detected 500 pg of cloned M. teredinis rDNA. The probe did not hybridize with cloned SSU rDNA of Teredo spp. or H. nelsoni. The probe was further tested for specificity with in situ hybridizations on AFA-fixed, paraffin-embedded tissue sections. The probe hybridized well with M. teredinis plasmodia and immature spores, but poorly with mature spores. The probe did not hybridize with shipworm tissue or with the haplosporidians Haplosporidium louisiana from mud crabs (Panopeus spp.) or H. nelsoni and H. costale from Crassostrea virginica. The probe and a second 18-base oligonucleotide, when used as PCR primers, amplified a 536-bp fragment of the M. teredinis SSU rRNA gene. The PCR assay was able to detect 10 fg of the cloned gene and also detected the presence of M. teredinis DNA in shipworms in which infections were observed microscopically. The 536-bp amplification product was not obtained in one Teredo sp. or in one Bankia gouldi, both categorized as uninfected after microscopic inspection. The DNA probe and PCR primers appear to be specific for M. teredinis and should be useful as diagnostic tools and for life cycle investigations.

  9. Diversity of methane-cycling archaea in hydrothermal sediment investigated by general and group-specific PCR primers.

    PubMed

    Lever, Mark A; Teske, Andreas P

    2015-02-01

    The zonation of anaerobic methane-cycling Archaea in hydrothermal sediment of Guaymas Basin was studied by general primerpairs (mcrI, ME1/ME2, mcrIRD) targeting the alpha subunit of methyl coenzyme M reductase gene (mcrA) and by new group specific mcrA and 16S rRNA gene primer pairs. The mcrIRD primer pair outperformed the other general mcrA primer pairs indetection sensitivity and phylogenetic coverage. Methanotrophic ANME-1 Archaea were the only group detected with group specific primers only. The detection of 14 mcrA lineages surpasses the diversity previously found in this location. Most phylotypes have high sequence similarities to hydrogenotrophs, methylotrophs, and anaerobic methanotrophs previously detected at Guaymas Basin or at hydrothermal vents, cold seeps, and oil reservoirs worldwide. Additionally, five mcrA phylotypes belonging to newly defined lineages are detected. Two of these belong to deeply branching new orders, while the others are new species or genera of Methanopyraceae and Methermicoccaceae. Downcore diversity decreases from all groups detected in the upper 6 cm(2 to 40 °C, sulfate measurable to 4 cm) to only two groups below 6 cm (>40 °C). Despite the presence of hyperthermophilic genera (Methanopyrus, Methanocaldococcus) in cooler surface strata, no genes were detected below 10 cm (>60 °C). While mcrAbased and 16S rRNA gene-based community compositions are generally congruent, the deeply branching mcrA cannot be assigned to specific 16S rRNA gene lineages. Our study indicates that even among well-studied metabolic groups and in previously characterized model environments, major evolutionary branches are overlooked. Detecting these groups by improved molecular biological methods is a crucial first step toward understanding their roles in nature.

  10. Broad detection of diverse H5 and H7 hemagglutinin genes of avian influenza viruses by real-time reverse transcription-PCR using primer and probe sets containing mixed bases.

    PubMed

    Tsukamoto, Kenji; Noguchi, Daigo; Suzuki, Koutaro; Shishido, Makiko; Ashizawa, Takayoshi; Kim, Min-Chul; Lee, Youn-Jeong; Tada, Tatsuya

    2010-11-01

    Real-time reverse transcription-PCR (RT-PCR) was developed for broad detection of diverse H5 and H7 genes in Eurasian and American lineages of avian influenza viruses by using primer and probe sets containing mixed bases. Optimal use of the mixed bases enabled us to minimize sequence mismatches and to broaden the gene detection spectrum without decreasing sensitivity.

  11. Emaravirus-specific degenerate PCR primers allowed the identification of partial RNA-dependent RNA polymerase sequences of Maize red stripe virus and Pigeonpea sterility mosaic virus.

    PubMed

    Elbeaino, Toufic; Whitfield, Anna; Sharma, Mamta; Digiaro, Michele

    2013-03-01

    Emaravirus is a recently established viral genus that includes two approved virus species: European mountain ash ringspot-associated virus (EMARaV) and Fig mosaic virus (FMV). Other described but unclassified viruses appear to share biological characteristics similar to emaraviruses, including segmented, negative-single stranded RNA genomes with enveloped virions approximately 80-200nm in diameter. Sequence analysis of emaravirus genomes revealed the presence of conserved amino acid sequences in the RNA-dependent RNA polymerase gene (RdRp) denoted as pre-motif A, motifs A and C. Degenerate oligonucleotide primers were developed to these conserved sequences and were shown to amplify in reverse transcription-polymerase chain reaction assay (RT-PCR) DNA fragments of 276bp and 360bp in size. These primers efficiently detected emaraviruses with known sequences available in the database (FMV and EMARaV); they also detected viruses with limited sequence information such as Pigeonpea sterility mosaic virus (PPSMV) and Maize red stripe virus (MRSV). The degenerate primers designed on pre-motif A and motif A sequences successfully amplified the four species used as positive controls (276bp), whereas those of motifs A and C failed to detect only MRSV. The amino acid sequences obtained from PPSMV and MRSV shared the highest identity with those of two other tentative species of the Emaravirus genus, Rose rosette virus (RRV) (69%) and Redbud yellow ringspot virus (RYRV) (60%), respectively. The phylogenetic tree constructed with 92 amino acid-long portions of polypeptide putatively encoded by RNA1 of definitive and tentative emaravirus species clustered PPSMV and MRSV in two separate clades close to RRV and Raspberry leaf blotch virus (RLBV), respectively. The newly developed degenerate primers have proved their efficacy in amplifying new emaravirus-specific sequences; accordingly, they could be useful in identifying new emaravirus-like species in nature.

  12. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species

    PubMed Central

    Miya, M.; Sato, Y.; Fukunaga, T.; Sado, T.; Poulsen, J. Y.; Sato, K.; Minamoto, T.; Yamamoto, S.; Yamanaka, H.; Araki, H.; Kondoh, M.; Iwasaki, W.

    2015-01-01

    We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163–185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales. PMID:26587265

  13. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species.

    PubMed

    Miya, M; Sato, Y; Fukunaga, T; Sado, T; Poulsen, J Y; Sato, K; Minamoto, T; Yamamoto, S; Yamanaka, H; Araki, H; Kondoh, M; Iwasaki, W

    2015-07-01

    We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163-185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales. PMID:26587265

  14. PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid.

    PubMed Central

    Greisen, K; Loeffelholz, M; Purohit, A; Leong, D

    1994-01-01

    A set of broad-range PCR primers for the 16S rRNA gene in bacteria were tested, along with three series of oligonucleotide probes to detect the PCR product. The first series of probes is broad in range and consists of a universal bacterial probe, a gram-positive probe, a Bacteroides-Flavobacterium probe, and two probes for other gram-negative species. The second series was designed to detect PCR products from seven major bacterial species or groups frequently causing meningitis: Neisseria meningitidis, Haemophilus influenzae, Streptococcus pneumoniae, S. agalactiae, Escherichia coli and other enteric bacteria, Listeria monocytogenes, and Staphylococcus aureus. The third series was designed for the detection of DNA from species or genera commonly considered potential contaminants of clinical samples, including cerebrospinal fluid (CSF): Bacillus, Corynebacterium, Propionibacterium, and coagulase-negative Staphylococcus spp. The primers amplified DNA from all 124 different species of bacteria tested. Southern hybridization testing of the broad-range probes with washes containing 3 M tetramethylammonium chloride indicated that this set of probes correctly identified all but two of the 102 bacterial species tested, the exceptions being Deinococcus radiopugnans and Gardnerella vaginalis. The gram-negative and gram-positive probes hybridized to isolates of two newly characterized bacteria, Alloiococcus otitis and Rochalimaea henselii, as predicted by Gram stain characteristics. The CSF pathogen and contaminant probe sequences were compared with available sequence information and with sequencing data for 32 different species. Testing of the CSF pathogen and contaminant probes against DNA from over 60 different strains indicated that, with the exception of the coagulase-negative Staphylococcus probes, these probes provided the correct identification of bacterial species known to be found in CSF. Images PMID:7512093

  15. A Molecular Approach to Nested RT-PCR Using a New Set of Primers for the Detection of the Human Immunodeficiency Virus Protease Gene

    PubMed Central

    Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab

    2016-01-01

    Background The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. Objectives This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. Patients and Methods In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher’s exact test, and SPSS17 software. Results The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. Conclusions These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1. PMID:27679699

  16. A Molecular Approach to Nested RT-PCR Using a New Set of Primers for the Detection of the Human Immunodeficiency Virus Protease Gene

    PubMed Central

    Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab

    2016-01-01

    Background The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. Objectives This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. Patients and Methods In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher’s exact test, and SPSS17 software. Results The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. Conclusions These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1.

  17. A novel usage of random primers for multiplex RT-PCR detection of virus and viroid in aphids, leaves, and tubers.

    PubMed

    Nie, X; Singh, R P

    2001-01-01

    A multiplex reverse transcription polymerase chain reaction (m-RT-PCR) was developed for the simultaneous detection of five potato viruses and a viroid. The synthesis of cDNAs used for amplification was primed by hexanucleotides (random primers, RP). An RNA extraction procedure employing DNase I, is routinely used to isolate potato viruses and viroid (Potato virus S, PVS; Potato leafroll virus, PLRV; Potato virus X, PVX; Potato virus A and Y, PVA, PVY; and Potato spindle tuber viroid, PSTVd) from infected tissues. This extraction method produced deoxy-oligonucleotides, which in turn were used to prime the reverse transcription of RNA templates of all the viruses and the viroid. A time-course study from 15 s to 30 min showed optimal oligonucleotide generation by DNase I occurred at 10 min, an incubation time already incorporated in the extraction protocol. The presence of oligonucleotides capable of priming cDNA synthesis was also demonstrated in RNA preparations from aphids, leaves, and tubers. In order to duplicate the priming of templates by oligonucleotides, commercially available hexanucleotides were used as RP. When fragments were amplified from 5'- and 3'-ends of the random primed cDNA of PVY genome, bands of similar intensity were observed. In contrast, when two fragments (short and long) from the P1 gene region of the PVA genome were amplified, the yield of the short fragment was significantly higher in intensity than that of the long fragment in random primed cDNA. Irrespective of the origin of the primers (generated during extraction vs. commercially purchased), single or multiple viruses or the viroid were detected by amplification of random primed cDNAs present individually in the reaction or in a cDNA pool consisting of five viruses and the viroid. The cDNA produced by RP or virus specific primers (SP) was used to detect PLRV and PVY from infected tubers in a duplex reverse transcription polymerase chain reaction (d-RT-PCR). The RP cDNA gave increased

  18. A combined method for rescue of modified enteroviruses by mutagenic primers, long PCR and T7 RNA polymerase-driven in vivo transcription.

    PubMed

    Heikkilä, Outi; Kainulainen, Markus; Susi, Petri

    2011-01-01

    The current methods for manipulation of enteroviral RNA genomes and production of modified virus particles include stepwise subcloning procedures and in vitro transcription and RNA transfection steps that are both time-consuming and inefficient. Several enteroviral cDNA clones with 5'-terminal T7 promoter and coxsackievirus A9 (CAV9) PCR product with the T7 promoter were transfected successfully into target cells expressing T7 RNA polymerase for the rescue of virus particles. This demonstrated the overall feasibility of the in vivo transcription method. Furthermore, a rapid method using high-fidelity DNA polymerase, Phusion™, for amplification and mutagenesis of CAV9 cDNA was generated. A long PCR method was employed together with mutagenic primers for direct introduction of a unique restriction enzyme site into the VP1-2A junction of the CAV9 cDNA clone during the PCR amplification process. Enhanced green fluorescent protein was subcloned to that site, and CAV9-eGFP cDNA was transfected to the target cells for in vivo transcription and successful rescue of CAV9-eGFP particles. The method allowed a straightforward mutagenesis and in vivo production of infectious enteroviral particles, and may be applicable routinely for rapid production of the modified picornaviruses over the use of the traditional subcloning protocols.

  19. A combined method for rescue of modified enteroviruses by mutagenic primers, long PCR and T7 RNA polymerase-driven in vivo transcription.

    PubMed

    Heikkilä, Outi; Kainulainen, Markus; Susi, Petri

    2011-01-01

    The current methods for manipulation of enteroviral RNA genomes and production of modified virus particles include stepwise subcloning procedures and in vitro transcription and RNA transfection steps that are both time-consuming and inefficient. Several enteroviral cDNA clones with 5'-terminal T7 promoter and coxsackievirus A9 (CAV9) PCR product with the T7 promoter were transfected successfully into target cells expressing T7 RNA polymerase for the rescue of virus particles. This demonstrated the overall feasibility of the in vivo transcription method. Furthermore, a rapid method using high-fidelity DNA polymerase, Phusion™, for amplification and mutagenesis of CAV9 cDNA was generated. A long PCR method was employed together with mutagenic primers for direct introduction of a unique restriction enzyme site into the VP1-2A junction of the CAV9 cDNA clone during the PCR amplification process. Enhanced green fluorescent protein was subcloned to that site, and CAV9-eGFP cDNA was transfected to the target cells for in vivo transcription and successful rescue of CAV9-eGFP particles. The method allowed a straightforward mutagenesis and in vivo production of infectious enteroviral particles, and may be applicable routinely for rapid production of the modified picornaviruses over the use of the traditional subcloning protocols. PMID:20974179

  20. Selection of primers for polymerase chain reaction.

    PubMed

    Rychlik, W

    1995-04-01

    One of the most important factors affecting the quality of PCR is the choice of primers. In general, the longer the PCR product the more difficult it is to select efficient primers and set appropriate designing primers, and in general, the more DNA sequence information is available, the better the chance of finding an optimal primer pair. Efficient primers can be designed by avoiding the following flaws: primer-dimer formation, self-complementarity, too low Tm of the primers, and/or their incorrect internal stability profile. Tips on subcloning PCR products, calculating duplex stability (predicting dimer formation strength), and designing degenerate primers are given.

  1. [A variant of DDRT-PCR using anchored mini-exon primers for identification of differentially expressed sequences in Leishmania infantum].

    PubMed

    Turki-Mannoubi, L; Kbaier-Hachemi, H; Barhoumi, M; Chakroun, A S; Guizani, I

    2008-01-01

    Leishmania infantum (L.i) is responsible for visceral (VL) or cutaneous (CL) leishmaniasis. Previous studies done in Honduras by differential display reverse transcriptase-polymerase chain reaction (DDRT-PCR) failed to demonstrate differences in expression profiles among L. infantum VL and CL parasites. For purpose of comparing expression among L. infantum isolates in Tunisia, a variant of this technique adapted from a commercial kit was developed involving pairs of random and anchored mini-exon primers for isolation and identification of differentially displayed cDNAs. To assess the efficiency of this variant, 34 pairs were applied to 2 consecutive dilutions of cDNAs from promastigotes at end of in vitro exponential growth of 2 visceral (LV50) and cutaneous (DREP14) isolates from Tunisia, thus increasing chance for observing differences among the cDNAs. Profiles were compared and analyzed as regards number and phenotype of bands displayed in 4 types of highly similar amplification profiles among the 2 cDNAs; 26 primer pair combinations generated in total 6.8% differentially displayed bands that had variable intensities or were present/absent, in comparable proportions in the 2 isolates. Analysis further demonstrated differences in amplification efficiency of some primers, emphasizing on qualitative and quantitative impact of relative proximity of the priming sites. Nine present/absent bands were cloned, sequenced and analyzed in silico. Mismatches at priming sites seem to underlie amplification of such bands. Only five products could be referred to annotated gene. Among the genes identified, we list histone H4, largely known to be differentially expressed among L.i stages, and "NTF2-like" for which overexpression in one cDNA was here confirmed. To conclude, the variant developed could be used further in Leishmania expression analysis with appropriate cautions about false positives.

  2. A comparison of two 16S rRNA gene-based PCR primer sets in unraveling anammox bacteria from different environmental samples.

    PubMed

    Han, Ping; Huang, Yu-Tzu; Lin, Jih-Gaw; Gu, Ji-Dong

    2013-12-01

    Two 16S rRNA gene-based PCR primer sets (Brod541F/Amx820R and A438f/A684r) for detecting anammox bacteria were compared using sediments from Mai Po wetlands (MP), the South China Sea (SCS), a freshwater reservoir (R2), and sludge granules from a wastewater treatment plant (A2). By comparing their ability in profiling anammox bacteria, the recovered diversity, community structure, and abundance of anammox bacteria among all these diverse samples indicated that A438f/A684r performed better than Brod541F/Amx820R in retrieving anammox bacteria from these different environmental samples. Five Scalindua subclusters (zhenghei-I, SCS-I, SCS-III, arabica, and brodae) dominated in SCS whereas two Scalindua subclusters (zhenghei-II and wagneri) and one cluster of Kuenenia dominated in MP. R2 showed a higher diversity of anammox bacteria with two new retrieved clusters (R2-New-1 and R2-New-2), which deserves further detailed study. The dominance of Brocadia in sample A2 was supported by both of the primer sets used. Results collectively indicate strongly niche-specific community structures of anammox bacteria in different environments, and A438f/A684r is highly recommended for screening anammox bacteria from various environments when dealing with a collection of samples with diverse physiochemical characteristics.

  3. Partial sequence analysis of the L1 gene of bovine papillomavirus type 1 detected by PCR with MY09/MY11 primers in equine sarcoids in Poland.

    PubMed

    Szczerba-Turek, A; Siemionek, J; Wasowicz, K; Szweda, W; Raś, A; Platt-Samoraj, A

    2010-01-01

    BPV-1 is now recognized as a main etiological agent of equine sarcoids. The etiopathogenesis of the equine sarcoids is equivocal and is not yet fully understood. The aim of the present study was to analyse a partial sequence of the L1 gene of BPV associated with equine sarcoids in Polish horses. After clinical diagnosis, 40 skin lesions obtained from 29 horses were collected. The amplicons of a fragment of BPV L1 DNA were detected using PCR with MY09/MY11 primers in 31 specimens. All of them were recognized as BPV-1. Phylogenetic analysis has allowed the amplicons of partial L1 gene to be divided into 3 phylogenetic groups (A, B, C) and one separate isolate (20c). Sequence variants from phylogenetic groups B, C and isolate 20c represented new genetic variants of BPV-1 L1. Sequence variants from groups B and C were submitted to GenBank NCBI. PMID:20731177

  4. Designing Polymerase Chain Reaction Primers Using Primer3Plus.

    PubMed

    Hung, Jui-Hung; Weng, Zhiping

    2016-01-01

    Designing oligonucleotide primers is a crucial step for successful molecular biology experiments that require the use of the polymerase chain reaction (PCR). PCR involves cycles of three steps: denaturation, annealing, and extension. During denaturation, double-stranded DNA (dsDNA) molecules (templates) are separated into single strands. During annealing, a pair of primers is annealed to the complementary regions of the single-stranded molecules. In the extension step, DNA polymerase extends the primers to produce DNA molecules that correspond to the region bracketed by the primers (the amplicons). All of these steps are temperature sensitive, and the common choice of temperatures is 94°C, 60°C, and 70°C, respectively. Poorly designed primers may lead to no amplification product or additional undesired amplified fragments. The goals of primer design include good primer specificity, high annealing efficiency, appropriate melting temperature, proper GC content, and the prevention of primer hairpins or primer dimers. PMID:27574202

  5. Accuracy of Conventional PCR Targeting the 16S rRNA Gene with the Ot-16sRF1 and Ot-16sRR1 Primers for Diagnosis of Scrub Typhus: a Case-Control Study.

    PubMed

    Kim, Choon-Mee; Cho, Min Keun; Kim, Dong-Min; Yun, Na-Ra; Kim, Seok Won; Jang, Sook Jin; Ahn, Young-Joon; Lim, Donghoon

    2016-01-01

    We retrospectively evaluated the accuracy of conventional PCR targeting the 16S rRNA gene (16S C-PCR) using the Ot-16sRF1/Ot-16sRR1 primers for diagnosing scrub typhus. The diagnosis of Orientia tsutsugamushi infection by 16S C-PCR presented an increased sensitivity of 87.0% and specificity of 100% compared with those obtained with other targets and is thus a simple and clinically useful method with good diagnostic accuracy.

  6. Phylogenetic relationships of the soybean sudden death syndrome pathogen Fusarium solani f. sp. phaseoli inferred from rDNA sequence data and PCR primers for its identification.

    PubMed

    O'Donnell, K; Gray, L E

    1995-01-01

    Phylogenetic relationships of several species within the Fusarium solani-complex were investigated using characters from the nuclear ribosomal DNA. Genetic variation within 24 isolates, including 5 soybean sudden death syndrome (SDS) strains, was assessed using rDNA sequence data and restriction fragment length polymorphic markers. By these techniques, the causal agent of soybean SDS was identified as F. solani f. sp. phaseoli. In separate cladistic analyses, Plectosphaerella cucumerina and Nectria cinnabarina or F. ventricosum were used for rooting purposes. Monophyly of the F. solani-complex was strongly supported by bootstrap and decay analyses. Parsimony analysis indicates that this complex is composed of a number of phylogenetically distinct species, including Neocosmospora vasinfecta, F. solani f. sp. phaseoli, and biological species designated as MPI, MPV, and MPVI of N. haematococca. The results demonstrate complete congruence between biological and phylogenetic species within the N. haematococca-complex. In addition, DNA sequence data were used to design a PCR primer pair which could specifically amplify DNA from isolates of the SDS pathogen from infected plants. PMID:7579615

  7. Genetic structure of soil population of fungus Fusarium oxysporum Schlechtend.: Fr.: Molecular reidentification of the species and genetic differentiation of isolates using polymerase chain reaction technique with universal primers (UP-PCR)

    SciTech Connect

    Bulat, S.A.; Mironenko, N.V.; Zholkevich, Yu.G.

    1995-07-01

    The genetic structure of three soil populations of fungus Fusarium oxysporum was analyzed using polymerase chain reaction with universal primers (UP-PCR). Distinct UP-PCR variants revealed by means of cross-dot hybridization of amplified DNA and restriction analysis of nuclear ribosomal DNA represent subspecies or sibling species of F. oxysporum. The remaining isolates of F. oxysporum showed moderate UP-PCR polymorphism characterized by numerous types, whose relatedness was analyzed by computer treatment of the UP-PCR patterns. The genetic distance trees based on the UP-PCR patterns, which were obtained with different universal primers, demonstrated similar topology. This suggests that evolutionarily important genome rearrangements correlatively occur within the entire genome. Isolates representing different UP-PCR polymorphisms were encountered in all populations, being distributed asymmetrically in two of these. In general, soil populations of F. oxysporum were represented by numerous genetically isolated groups with a similar genome structure. The genetic heterogeneity of the isolates within these groups is likely to be caused by the parasexual process. The usefulness of the UP-PCR technique for population studies of F. oxysporum was demonstrated. 39 refs., 7 figs., 2 tabs.

  8. Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant–Associated Fungi

    PubMed Central

    Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

    2016-01-01

    The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant–associated fungi due to the similar homologies of sequences in primer–annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3′ end of the primer–binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant–associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant–associated fungi. PMID:27600711

  9. Correlation Between Pneumocystis jirovecii Mitochondrial Genotypes and High and Low Fungal Loads Assessed by Single Nucleotide Primer Extension Assay and Quantitative Real-Time PCR.

    PubMed

    Alanio, Alexandre; Olivi, Martine; Cabaret, Odile; Foulet, Françoise; Bellanger, Anne-Pauline; Millon, Laurence; Berceanu, Ana; Cordonnier, Catherine; Costa, Jean-Marc; Bretagne, Stéphane

    2015-01-01

    We designed a single nucleotide primer extension (SNaPshot) assay for Pneumocystis jirovecii genotyping, targeting mt85 SNP of the mitochondrial large subunit ribosomal RNA locus, to improve minority allele detection. We then analyzed 133 consecutive bronchoalveolar lavage (BAL) fluids tested positive for P. jirovecii DNA by quantitative real-time PCR, obtained from two hospitals in different locations (Hospital 1 [n = 95] and Hospital 2 [n = 38]). We detected three different alleles, either singly (mt85C: 39.1%; mt85T: 24.1%; mt85A: 9.8%) or together (27%), and an association between P. jirovecii mt85 genotype and the patient's place of hospitalization (p = 0.011). The lowest fungal loads (median = 0.82 × 10(3) copies/μl; range: 15-11 × 10(3) ) were associated with mt85A and the highest (median = 1.4 × 10(6) copies/μl; range: 17 × 10(3) -1.3 × 10(7) ) with mt85CTA (p = 0.010). The ratios of the various alleles differed between the 36 mixed-genotype samples. In tests of serial BALs (median: 20 d; range 4-525) from six patients with mixed genotypes, allele ratio changes were observed five times and genotype replacement once. Therefore, allele ratio changes seem more frequent than genotype replacement when using a SNaPshot assay more sensitive for detecting minority alleles than Sanger sequencing. Moreover, because microscopy detects only high fungal loads, the selection of microscopy-positive samples may miss genotypes associated with low loads.

  10. Rapid and efficient identification of the mouse leptin receptor mutation (C57BL/KsJ-db/db) by tetra-primer amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) analysis.

    PubMed

    Jung, Harry; Nam, Hajin; Suh, Jun-Gyo

    2016-03-01

    The C57BLKS/J-Lepr(db) mouse has a point mutation in the leptin receptor gene and is one of the most useful animal model for non-insulin dependent diabetes mellitus in human. Since the homozygote of C57BLKS/J-Lepr(db) mouse is infertile, detection of point mutation in the leptin receptor gene is important for efficient maintaining strains as well as mass production of homozygotes. To develop a rapid and efficient genotyping method for C57BLKS/J-Lepr(db) mouse, the tetra-primer amplification-refractory mutation system polymerase chain reaction (ARMS-PCR) was used. The 407 and 199 bp PCR products were amplified from normal (+/+) mice; while the 407 and 268 bp PCR products were amplified from homozygotes (db/db) mice; and the 407, 268, and 199 bp PCR products were amplified from heterozygotes (db/+) mice. This result showed that the tetra-primer ARMS-PCR analysis by us is suitable to detect point mutation of the leptin receptor gene. Taken together, our method will dramatically reduce animal use for maintenance of strains as well as production of homozygote in the C57BLKS/J-Lepr(db) strains. PMID:27051445

  11. Rapid and efficient identification of the mouse leptin receptor mutation (C57BL/KsJ-db/db) by tetra-primer amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) analysis.

    PubMed

    Jung, Harry; Nam, Hajin; Suh, Jun-Gyo

    2016-03-01

    The C57BLKS/J-Lepr(db) mouse has a point mutation in the leptin receptor gene and is one of the most useful animal model for non-insulin dependent diabetes mellitus in human. Since the homozygote of C57BLKS/J-Lepr(db) mouse is infertile, detection of point mutation in the leptin receptor gene is important for efficient maintaining strains as well as mass production of homozygotes. To develop a rapid and efficient genotyping method for C57BLKS/J-Lepr(db) mouse, the tetra-primer amplification-refractory mutation system polymerase chain reaction (ARMS-PCR) was used. The 407 and 199 bp PCR products were amplified from normal (+/+) mice; while the 407 and 268 bp PCR products were amplified from homozygotes (db/db) mice; and the 407, 268, and 199 bp PCR products were amplified from heterozygotes (db/+) mice. This result showed that the tetra-primer ARMS-PCR analysis by us is suitable to detect point mutation of the leptin receptor gene. Taken together, our method will dramatically reduce animal use for maintenance of strains as well as production of homozygote in the C57BLKS/J-Lepr(db) strains.

  12. Rapid and efficient identification of the mouse leptin receptor mutation (C57BL/KsJ-db/db) by tetra-primer amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) analysis

    PubMed Central

    Jung, Harry; Nam, Hajin

    2016-01-01

    The C57BLKS/J-Leprdb mouse has a point mutation in the leptin receptor gene and is one of the most useful animal model for non-insulin dependent diabetes mellitus in human. Since the homozygote of C57BLKS/J-Leprdb mouse is infertile, detection of point mutation in the leptin receptor gene is important for efficient maintaining strains as well as mass production of homozygotes. To develop a rapid and efficient genotyping method for C57BLKS/J-Leprdb mouse, the tetra-primer amplification-refractory mutation system polymerase chain reaction (ARMS-PCR) was used. The 407 and 199 bp PCR products were amplified from normal (+/+) mice; while the 407 and 268 bp PCR products were amplified from homozygotes (db/db) mice; and the 407, 268, and 199 bp PCR products were amplified from heterozygotes (db/+) mice. This result showed that the tetra-primer ARMS-PCR analysis by us is suitable to detect point mutation of the leptin receptor gene. Taken together, our method will dramatically reduce animal use for maintenance of strains as well as production of homozygote in the C57BLKS/J-Leprdb strains. PMID:27051445

  13. Comparison of Flavivirus Universal Primer Pairs and Development of a Rapid, Highly Sensitive Heminested Reverse Transcription-PCR Assay for Detection of Flaviviruses Targeted to a Conserved Region of the NS5 Gene Sequences

    PubMed Central

    Scaramozzino, Natale; Crance, Jean-Marc; Jouan, Alain; DeBriel, Dominique A.; Stoll, Françoise; Garin, Daniel

    2001-01-01

    Arthropod-transmitted flaviviruses are responsible for considerable morbidity and mortality, causing severe encephalitic, hemorrhagic, and febrile illnesses in humans. Because there are no specific clinical symptoms for infection by a determined virus and because different arboviruses could be present in the same area, a genus diagnosis by PCR would be a useful first-line diagnostic method. The six published Flavivirus genus primer pairs localized in the NS1, NS3, NS5, and 3′ NC regions were evaluated in terms of specificity and sensitivity with flaviviruses (including the main viruses pathogenic for humans) at a titer of 105 50% tissue culture infectious doses (TCID50s) ml−1 with a common identification step by agarose gel electrophoresis. Only one NS5 primer pair allowed the detection of all tested flaviviruses with the sensitivity limit of 105 TCID50s ml−1. Using a heminested PCR with new primers designed in the same region after an alignment of 30 different flaviviruses, the sensitivity of reverse transcription-PCR was improved and allowed the detection of about 200 infectious doses ml−1 with all of the tick- and mosquito-borne flaviviruses tested. It was confirmed that the sequenced amplified products in the NS5 region allowed predictability of flavivirus species by dendrogram, including the New York 99 West Nile strain. This technique was successfully performed with a cerebrospinal fluid sample from a patient hospitalized with West Nile virus encephalitis. PMID:11326014

  14. Target-specific PCR primers can detect and differentiate ophiostomatoid fungi from microbial communities associated with the mountain pine beetle Dendroctonus ponderosae.

    PubMed

    Khadempour, Lily; Massoumi Alamouti, Sepideh; Hamelin, Richard; Bohlmann, Jörg; Breuil, Colette

    2010-10-01

    The aim of this study was to develop DNA probes that could identify the major fungal species associated with mountain pine beetles (MPB). The beetles are closely associated with fungal species that include ophiostomatoid fungi that can be difficult to differentiate morphologically. The most frequently isolated associates are the pine pathogens Grosmannia clavigera and Leptographium longiclavatum, the less pathogenic Ophiostoma montium, and an undescribed Ceratocystiopsis species (Cop. sp.). Because growing, isolating and extracting DNA from fungi vectored by MPB can be time and labour intensive, we designed three rDNA primer sets that specifically amplify short rDNA amplicons from O. montium, Cop. sp. and the pine Leptographium clade. We also designed two primer sets on a gene of unknown function that can differentiate G. clavigera and L. longiclavatum. We tested the primers on 76 fungal isolates that included MPB associates. The primers reliably identified their targets from DNA obtained from pure fungal cultures, pulverized beetles, beetle galleries, and tree phloem inoculated with G. clavigera. The primers will facilitate large-scale work on the ecology of the MPB-fungal-lodgepole pine ecosystem, as well as phytosanitary/quarantine sample screening.

  15. Universal primer-multiplex-polymerase chain reaction (UP-M-PCR) and capillary electrophoresis-laser-induced fluorescence analysis for the simultaneous detection of six genetically modified maize lines.

    PubMed

    Zhang, Chunjiao; Xu, Wentao; Zhai, Zhifang; Luo, Yunbo; Yan, Xinghua; Zhang, Nan; Huang, Kunlun

    2011-05-25

    To meet the labeling and traceability requirement of genetically modified (GM) maize and their products for trade and regulation, it is essential to develop a specific detection method for monitoring the presence of GM content. In this work, six GM maize lines, including GA21, Bt11, NK603, Bt176, Mir604, and Mon810, were simultaneously detected by universal primer-multiplex-polymerase chain reaction (UP-M-PCR), and the amplicons for the six event-specific genes as well as the endogenous Ivr gene were successfully separated by the method of capillary electrophoresis-laser-induced fluorescence (CE-LIF). The UP-M-PCR method overcame the disadvantages in conventional M-PCR, such as complex manipulation, lower sensitivity, amplification disparity resulting from different primers, etc., and in combination with CE-LIF, it obtained a high sensitivity of 0.1 ng for both single and mixed DNA samples. The established method can be widely used for the qualitative identification of the GM maize lines.

  16. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    PubMed Central

    Batnyam, Nomin; Lee, Jimin; Lee, Jungnam; Hong, Seung Bok; Oh, Sejong; Han, Kyudong

    2012-01-01

    Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR) assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque) and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors. PMID:22693428

  17. The use of RT-PCR for determination of separate end-points for the strains IB H120 and IB D274 in titration of the combination vaccine Poulvac IB® primer.

    PubMed

    Geerligs, H J; Meinders, C A M; Snel, J; Duyves, W

    2013-11-01

    Poulvac IB® Primer is a lyophilized vaccine containing two attenuated infectious bronchitis strains in one vial, IB H120 and IB D274. For quantification of the viral content of the vaccine, dilution series of the final product are inoculated in embryonated chicken eggs. After the incubation period of seven days standard practice is for the embryos to be taken from each egg and examined visually for IB specific lesions; these readings are used to determine an end-point in viral titrations. The result is a titre value to which both strains contribute. However, it is not clear what the live virus titre is for strain IB H120 and for strain IB D274. In order to determine end-points in the titration for each of the two strains, we collected the allantoic fluids from each egg after the incubation period and tested these for the presence of IB H120 and IB D274 by a strain specific reverse phase PCR. Based on the data obtained by PCR we were able to determine an end-point for each of the two strains. For a given commercial batch of Poulvac IB primer we determined titres of 10(6.31) EID50 per vial for IB H120 and 10(6.59) EID50 for IB D274 using PCR for end-point determination. These end-points matched well with the end-point determined for both strains cumulatively after visual examination, i.e. 10(6.67) EID50 per vial. It is concluded that PCR is a suitable means to determine end-points in titrations of live viruses.

  18. Rapid DNA typing for HLA-C using sequence-specific primers (PCR-SSP): identification of serological and non-serologically defined HLA-C alleles including several new alleles.

    PubMed

    Bunce, M; Welsh, K I

    1994-01-01

    Detection of HLA-C antigens by complement mediated cytotoxicity using human alloantisera is often difficult. Between 20 to 40% of individuals in every race have undetectable HLA-C locus antigens and 9 out of the 29 sequenced HLA-C alleles so far published encode serologically undetected antigens. In addition, HLA-C molecules are expressed at the cell surface at about 10% of the levels of HLA-A and HLA-B. Recently, amplification of DNA using sequence-specific primers (PCR-SSP) has proved a reliable and rapid method for typing HLA-DR, HLA-DQA and HLA-DQB genes. PCR-SSP takes two hours to perform and is therefore suitable for the genotyping of cadaveric donors. We have designed a set of primers which will positively identify the HLA-C alleles corresponding to the serologically defined series HLA-Cw1, Cw2, Cw3, Cw4, Cw5, Cw6, Cw7 and Cw8. The serologically undetectable alleles have also been detected in groups according to sequence homology. In addition, three new unsequenced variants have been identified. DNA samples from 56 International Histocompatibility Workshop reference cell lines and 103 control individuals have been typed by the HLA-C PCR-SSP technique. 4/56 cell line types and 11/103 normal control individuals types were discrepant with the reported serological types. All combinations of serologically detectable and most of the serologically blank HLA-C antigens can be readily identified. DNA typing for HLA-Cw by PCR-SSP can take as little as 130 minutes from start to finish, including DNA preparation.

  19. Detection of bacteria and fungi in blood of patients with febrile neutropenia by real-time PCR with universal primers and probes.

    PubMed

    Teranishi, Hideto; Ohzono, Nanae; Inamura, Norikazu; Kato, Atsushi; Wakabayashi, Tokio; Akaike, Hiroto; Terada, Kihei; Ouchi, Kazunobu

    2015-03-01

    Febrile neutropenia is the main treatment-related cause of mortality in cancer patients. During June 2012 to April 2014, 97 blood culture samples were collected from patients receiving chemotherapy for hematological malignancy and cancer with febrile neutropenia episodes (FNEs). The samples were examined for the presence of bacteria and fungi using real-time PCR amplification and sequencing of 16S and 18S rRNA genes. Bacteria were identified in 20 of 97 samples (20.6%) by the real-time PCR assay and in 10 of 97 (10.3%) samples by blood culture. In 6 blood culture-positive samples, the real-time PCR assay detected the same type of bacteria. No fungi were detected by the real-time PCR assay or blood culture. During antibiotic therapy, all samples were negative by blood culture, but the real-time PCR assay yielded a positive result in 2 cases of 2 (100%). The bacterial DNA copy number was not well correlated with the serum C-reactive protein titer of patients with FNEs. We conclude that a real-time PCR assay could provide better detection of causative microbes' in a shorter time, and with a smaller blood sample than blood culture. Using a real-time PCR assay in combination with blood culture could improve microbiological documentation of FNEs.

  20. Influence of primer sequences and DNA extraction method on detection of non-O157 Shiga toxin-producing Escherichia coli in ground beef by real-time PCR targeting the eae, stx, and serogroup-specific genes.

    PubMed

    Wasilenko, Jamie L; Fratamico, Pina M; Narang, Neelam; Tillman, Glenn E; Ladely, Scott; Simmons, Mustafa; Cray, William C

    2012-11-01

    Non-O157 Shiga toxin-producing Escherichia coli (STEC) infections, particularly those caused by the "big six" or "top six" non-O157 serogroups (O26, O45, O103, O111, O121, and O145) can result in severe illness and complications. Because of their significant public health impact and the notable prevalence of STEC in cattle, methods for detection of the big six non-O157 STEC in ground beef have been established. Currently, the U.S. Department of Agriculture, Food Safety and Inspection Service detection methods for screening beef samples for non-O157 STEC target the stx(1), stx(2), and eae virulence genes, with the 16S rRNA gene as an internal control, in a real-time PCR multiplex assay. Further, the serogroup is determined by PCR targeting genes in the E. coli O-antigen gene clusters of the big six non-O157 serogroups. The method that we previously reported was improved so that additional stx variants, stx(1d), stx(2e), and stx(2g), are detected. Additionally, alignments of the primers targeting the eae gene were used to improve the detection assay so that eae subtypes that could potentially be of clinical significance would also be detected. Therefore, evaluation of alternative real-time PCR assay primers and probes for the stx and eae reactions was carried out in order to increase the stx and eae subtypes detected. Furthermore, a Tris-EDTA DNA extraction method was compared with a previously used procedure that was based on a commercially available reagent. The Tris-EDTA DNA extraction method significantly decreased the cycle threshold values for the stx assay (P < 0.0001) and eae assay (P < 0.0001), thereby increasing the ability to detect the targets. The use of different stx primers and probes increased the subtypes detected to include stx(1d), stx(2e), and stx(2g), and sequence data showed that modification of the eae primer should allow the known eae subtypes to be detected.

  1. Real time RT-PCR with a newly designed set of primers confirmed the presence of 2b and 2x/d myosin heavy chain mRNAs in the rat slow soleus muscle.

    PubMed

    Zurmanová, J; Půta, F; Stopková, R; Soukup, T

    2008-01-01

    In order to re-evaluate the presence and relative quantity of 2b and 2x/d myosin heavy chain (MyHC) transcripts in rat slow soleus muscle by using real time RT-PCR we have compared the available relevant cDNA sequences and designed a new set of primers having similar melting temperatures, matching separate MyHC exons in the regions of maximal differences in MyHC coding sequences, and containing G or C at the 3 -end. These also yielded PCR products of corresponding length, which is an important requirement for real time RT-PCR quantification. The experiments were performed on 8-month-old inbred female Lewis strain rats used in our current study of regenerating transplanted muscles. The real time RT-PCR measurement confirmed the expression of all four MyHC mRNAs (type 1, 2a, 2x/d and 2b) in both fast extensor digitorum longus and slow soleus muscles, although in the soleus muscle of adult rats, only type 1 and 2a protein isoforms can be usually detected.

  2. Comparative analysis of two 16S rRNA gene-based PCR primer sets provides insight into the diversity distribution patterns of anammox bacteria in different environments.

    PubMed

    Wang, Shuailong; Hong, Yiguo; Wu, Jiapeng; Xu, Xiang-Rong; Bin, Liying; Pan, Yueping; Guan, Fengjie; Wen, Jiali

    2015-10-01

    Due to the high divergence among 16S rRNA genes of anammox bacteria, different diversity pattern of the community could be resulted from using different primer set. In this study, the efficiencies and specificities of two commonly used sets, Amx368F/Amx820R and Brod541F/Amx820R, were evaluated by exploring the diversity characteristics of anammox bacteria in sediments from marine, estuary, and freshwater wetland. Statistical analysis indicated that the base mispairing rate between bases on 16S rRNA gene sequences retrieved by Amx368F/Amx820R and their corresponding ones on primer Brod541F was quite high, suggesting the different efficiency and specificity of Amx368F/Amx820R and Brod541F/Amx820R. Further experimental results demonstrated that multiple genera of anammox bacteria, including Ca. Scalindua, Ca. Brocadia, and Ca. Kuenenia, were able to be detected by Amx368F/Amx820R, but only Ca. Scalindua could be retrieved by Brod541F/Amx820R. Moreover, the phylogenetic clusters of Ca. Scalindua by Amx368F/Amx820R were different completely from those by Brod541F/Amx820R, presenting a significant complementary effect. By joint application of these two primer sets, the diversity distribution patterns of anammox bacteria in different environments were analyzed. Almost all retrieved sequences from marine sediments belonged to Ca. Scalindua. Sequences from freshwater wetland were affiliated to Ca. Brocadia and two new clusters, while high diversity of anammox bacteria was found in estuary, including Ca. Scalindua, Ca. Brocadia, and Ca. Kuenenia, corresponding to the river-sea intersection environmental feature. In total, these two prime sets have different characteristic for anammox bacteria detecting from environmental samples, and their combined application could achieve better diversity display of anammox community.

  3. Detection and Analysis of Six Lizard Adenoviruses by Consensus Primer PCR Provides Further Evidence of a Reptilian Origin for the Atadenoviruses

    PubMed Central

    Wellehan, James F. X.; Johnson, April J.; Harrach, Balázs; Benkö, Mária; Pessier, Allan P.; Johnson, Calvin M.; Garner, Michael M.; Childress, April; Jacobson, Elliott R.

    2004-01-01

    A consensus nested-PCR method was designed for investigation of the DNA polymerase gene of adenoviruses. Gene fragments were amplified and sequenced from six novel adenoviruses from seven lizard species, including four species from which adenoviruses had not previously been reported. Host species included Gila monster, leopard gecko, fat-tail gecko, blue-tongued skink, Tokay gecko, bearded dragon, and mountain chameleon. This is the first sequence information from lizard adenoviruses. Phylogenetic analysis indicated that these viruses belong to the genus Atadenovirus, supporting the reptilian origin of atadenoviruses. This PCR method may be useful for obtaining templates for initial sequencing of novel adenoviruses. PMID:15542689

  4. Detection and analysis of six lizard adenoviruses by consensus primer PCR provides further evidence of a reptilian origin for the atadenoviruses.

    PubMed

    Wellehan, James F X; Johnson, April J; Harrach, Balázs; Benkö, Mária; Pessier, Allan P; Johnson, Calvin M; Garner, Michael M; Childress, April; Jacobson, Elliott R

    2004-12-01

    A consensus nested-PCR method was designed for investigation of the DNA polymerase gene of adenoviruses. Gene fragments were amplified and sequenced from six novel adenoviruses from seven lizard species, including four species from which adenoviruses had not previously been reported. Host species included Gila monster, leopard gecko, fat-tail gecko, blue-tongued skink, Tokay gecko, bearded dragon, and mountain chameleon. This is the first sequence information from lizard adenoviruses. Phylogenetic analysis indicated that these viruses belong to the genus Atadenovirus, supporting the reptilian origin of atadenoviruses. This PCR method may be useful for obtaining templates for initial sequencing of novel adenoviruses.

  5. URPD: a specific product primer design tool

    PubMed Central

    2012-01-01

    Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

  6. DETECTION OF STACHYBOTRYS CHARTARUM USING rRNA, tri5, AND Β-TUBULIN PRIMERS AND DETERMINING THEIR RELATIVE COPY NUMBER BY REAL TIME PCR

    EPA Science Inventory

    This research utilizes the quantitative polymerase chain reaction (qPCR) to determine ribosomal copy number of fungal organisms found in unhealthy indoor environments. Knowing specific copy numbers will allow for greater accuracy in quantification when utilizing current pQCR tec...

  7. Phonics Primer

    ERIC Educational Resources Information Center

    Elam, Sandra

    2007-01-01

    This primer lists the 44 sounds in the English language and then gives steps for teaching those 44 sounds and their most common spelling patterns. In addition to learning sounds and spellings, each day the student must read lists of phonetically related words and spell these words from dictation. Phonics instruction must be reinforced by having…

  8. In silico PCR analysis.

    PubMed

    Yu, Bing; Zhang, Changbin

    2011-01-01

    In silico PCR analysis is a useful and efficient complementary method to ensure primer specificity for an extensive range of PCR applications from gene discovery, molecular diagnosis, and pathogen detection to forensic DNA typing. In silico PCR, SNPCheck, and Primer-BLAST are commonly used web-based in silico PCR tools. Their applications are discussed here in stepwise detail along with several examples, which aim to make it easier for the intended users to apply the tools. This virtual PCR method can assist in the selection of newly designed primers, identify potential mismatches in the primer binding sites due to known SNPs, and avoid the amplification of unwanted amplicons so that potential problems can be prevented before any "wet bench" experiment.

  9. Screening of mosquitoes using SYBR Green I-based real-time RT-PCR with group-specific primers for detection of Flaviviruses and Alphaviruses in Taiwan.

    PubMed

    Yang, Cheng-Fen; Chen, Chien-Fu; Su, Chien-Ling; Teng, Hwa-Jen; Lu, Liang-Chen; Lin, Cheo; Wang, Chih-Yuan; Shu, Pei-Yun; Huang, Jyh-Hsiung; Wu, Ho-Sheng

    2010-09-01

    Surveillance for infectious agents carried by mosquitoes is important for predicting the risk of vector-borne infectious diseases. In this study, a method was established to mass-screen mosquitoes for viral infections. The assay detected the viral load of 4 dengue virus (DENV) serotypes (DENV-1, DENV-2, DENV-3, and DENV-4), the Japanese encephalitis virus (JEV), the Sindbis virus and the Chikungunya virus at 1PFU/mL (determined by real-time RT-PCR) in 36.64-43.45 cycles. This method was applied to 75,364 field-captured mosquitoes that were grouped into 10,343 pools. Japanese encephalitis viruses were detected in 25 pools of 906 Culex tritaeniorhynchus females and a single pool of 44 Cx. fuscocephala females. These viruses were isolated from half of the positive pools. Dengue viruses were detected in 2 pools of 43 Aedes aegypti females. Additionally, mosquitoes that were infected orally with dengue viruses in the laboratory were also used to verify the test. The best detection times for individual mosquitoes after being fed virally-contaminated blood were at day 0 and day 10. The number of mosquitoes detected per pool was up to one infected mosquito plus 59 non-infected mosquitoes; the appropriate storage substances for holding samples within 24h included ice cubes and dry ice. This method, combined with a robust and automated RNA-extraction method and a 96 well real-time RT-PCR machine, allows the processing of a large number of samples at once, making it a powerful tool for monitoring simultaneously local and emerging vector-borne infectious diseases of Flaviviruses and Alphaviruses. This study is the first to quantify the viral load in individual mosquitoes over the course of a 16-day extrinsic incubation period. PMID:20471427

  10. [Detection of JAK2V617F mutation rate by real-time fluorescent quantitative PCR using allele specific primer and TaqMan-MGB probe for dual inhibiting amplification of wild type alleles].

    PubMed

    Liang, Guo-Wei; Shao, Dong-Hua; He, Mei-Ling; Cao, Qing-Yun

    2012-12-01

    This study was purposed to develop a real-time PCR assay for sensitive quantification of JAK2V617F allele burden in peripheral blood and to evaluate the clinical value of this method. Both allele-specific mutant reverse primer and wild-type TaqMan-MGB probe were used for dual-inhibiting amplification of wild-type alleles in a real-time PCR, and then the JAK2V617F mutant alleles were amplified specially. The standard curve for quantification of JAK2V617F was established by percentages of JAK2V617F alleles with threshold cycle (Ct) values in a real-time PCR. Furthermore, 89 apparent healthy donors were tested by this method. The results showed that the quantitative lower limit of this method for JAK2V617F was 0.1%, and the intra- and inter-assay average variability for quantifying percentage of JAK2V617F in total DNA was 4.1% and 6.1%, respectively. Two JAK2V617F-positive individuals were identified (the percentage of JAK2V617F alleles were 0.64% and 0.98%, respectively) using this method in blood from 89 apparently healthy donors. It is concluded that the developed method with highly sensitive and reproducible quantification of JAK2V617F mutant burden can be used clinically for diagnosis and evaluation of disease prognosis and efficacy of therapy in patients with myeloproliferative neoplasms. Moreover, this technique can be also used for quantitative detection of variety of single nucleotide mutation.

  11. RATMAC PRIMER

    SciTech Connect

    Munn, R. J.; Stewart, J. M.; Norden, A. P.; Pagoaga, M. Katherine

    1980-10-01

    The language RATMAC is a direct descendant of one of the most successful structured FORTRAN languages, rational FORTRAN, RATFOR. RATMAC has all of the characteristics of RATFOR, but is augmented by a powerful recursive macro processor which is extremely useful in generating transportable FORTRAN programs. A macro is a collection of programming steps which are associated with a keyword. This keyword uniquely identifies the macro, and whenever it appears in a RATMAC program it is replaced by the collection of steps. This primer covers the language's control and decision structures, macros, file inclusion, symbolic constants, and error messages.

  12. Salinas primer.

    SciTech Connect

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2004-08-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis. This capability is required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. General capabilities for modal, statics and transient dynamics are provided. Salinas is similar to commercial codes like Nastran or Abaqus. It has some nonlinear capability, but excels in linear computation. It is different than the above commercial codes in that it is designed to operate efficiently in a massively parallel environment. Even for an experienced analyst, running a new finite element package can be a challenge. This little primer is intended to make part of this task easier by presenting the basic steps in a simple way. The analyst is referred to the theory manual for details of the mathematics behind the work. The User's Notes should be used for more complex inputs, and will have more details about the process (as well as many more examples). More information can be found on our web pages, 3 or 4. Finite element analysis can be deceptive. Any software can give the wrong answers if used improperly, and occasionally even when used properly. Certainly a solid background in structural mechanics is necessary to build an adequate finite element model and interpret the results. This primer should provide a quick start in answering some of the more common questions that come up in using Salinas.

  13. Nucleic acid amplification using modular branched primers

    SciTech Connect

    Ulanovsky, Levy; Raja, Mugasimangalam C.

    2001-01-01

    Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

  14. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.

    1995-02-01

    The differential display of eukaryotic cDNAs using PCR allows for determination of mRNA species differentially expressed when comparing two similar cell populations. This procedure uses a (T){sub 12}XY oligonucleotide as the 3 ft primer and an arbitrary 8-10-mer as the 5 ft primer. Labeling occurs by inclusion of {alpha}[{sup 33}P]-dATP in the PCR reaction. Two artifacts caused by this approach are (1) random printing from dT present from affinity purification of PolyA+RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. In this work, we have developed an approach for both eliminating smearing and identifying nonspecific bands on sequencing gels. By separately using 5 ft-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns rather than including labeled nucleotides in the PCR reaction itself, we can detect only those products incorporating the M{sub 12}XY primer on the 3 ft ends and the arbitrary primer on 5 ft ends. Those bands that are generated randomly in the PCR reaction are readily detectable and can be ignored. If on the other hand, one is interested only in a diagnostic banding pattern for differential display, benefit can be derived from the simplicity of the pattern obtained when labeled (T){sub 12}XY is used.

  15. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design.

    PubMed

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads Tvillinggaard; Genee, Hans Jasper; Holm, Dorte Koefoed; Carlsen, Simon; Hansen, Bjarne Gram; Patil, Kiran Raosaheb; Mortensen, Uffe Hasbro; Wernersson, Rasmus

    2011-07-01

    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (T(m)), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers are individually analysed in terms of GC content, presence of GC clamp at 3'-end, the risk of primer dimer formation, the risk of intra-primer complementarity (secondary structures) and the presence of polyN stretches. Furthermore, PHUSER offers the option to insert linkers between DNA fragments, as well as highly flexible cassette options. PHUSER is publicly available at http://www.cbs.dtu.dk/services/phuser/. PMID:21622660

  16. Virtual PCR

    SciTech Connect

    Gardner, S N; Clague, D S; Vandersall, J A; Hon, G; Williams, P L

    2006-02-23

    The polymerase chain reaction (PCR) stands among the keystone technologies for analysis of biological sequence data. PCR is used to amplify DNA, to generate many copies from as little as a single template. This is essential, for example, in processing forensic DNA samples, pathogen detection in clinical or biothreat surveillance applications, and medical genotyping for diagnosis and treatment of disease. It is used in virtually every laboratory doing molecular, cellular, genetic, ecologic, forensic, or medical research. Despite its ubiquity, we lack the precise predictive capability that would enable detailed optimization of PCR reaction dynamics. In this LDRD, we proposed to develop Virtual PCR (VPCR) software, a computational method to model the kinetic, thermodynamic, and biological processes of PCR reactions. Given a successful completion, these tools will allow us to predict both the sequences and concentrations of all species that are amplified during PCR. The ability to answer the following questions will allow us both to optimize the PCR process and interpret the PCR results: What products are amplified when sequence mixtures are present, containing multiple, closely related targets and multiplexed primers, which may hybridize with sequence mismatches? What are the effects of time, temperature, and DNA concentrations on the concentrations of products? A better understanding of these issues will improve the design and interpretation of PCR reactions. The status of the VPCR project after 1.5 years of funding is consistent with the goals of the overall project which was scoped for 3 years of funding. At half way through the projected timeline of the project we have an early beta version of the VPCR code. We have begun investigating means to improve the robustness of the code, performed preliminary experiments to test the code and begun drafting manuscripts for publication. Although an experimental protocol for testing the code was developed, the preliminary

  17. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.

    1995-01-01

    Two artifacts introduced in using differential display technology are (1) random priming from dT present from affinity purification of PolyA+ RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. We have developed a method eliminating both problems. By separately using 5`-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns, we can detect only those products incorporating the (T){sub 12}XY primer on the 3` ends and the arbitrary primer on 5` ends. Those bands that are generated randomly in the PCR are readily detectable and can be ignored.

  18. Microsatellite primers for red drum (Sciaenops ocellatus)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...

  19. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  20. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi

    1989-01-01

    Hydrophylic polyacids, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests.

  1. Universal multiplexable matK primers for DNA barcoding of angiosperms1

    PubMed Central

    Heckenhauer, Jacqueline; Barfuss, Michael H. J.; Samuel, Rosabelle

    2016-01-01

    Premise of the study: PCR amplification of the matK barcoding region is often difficult when dealing with multiple angiosperm families. We developed a primer cocktail to amplify this region efficiently across angiosperm diversity. Methods and Results: We developed 14 matK primers (seven forward, seven reverse) for multiplex PCR, using sequences available in GenBank for 178 taxa belonging to 123 genera in 41 families and 18 orders. Universality of these new multiplexed primers was tested with 53 specimens from 44 representative angiosperm families in 23 different orders. Our primers showed high PCR amplification and sequencing success. Conclusions: These results show that our newly developed primers are highly effective for multiplex PCR and can be employed in future barcode projects involving taxonomically diverse samples across angiosperms. Using multiplex primers for barcoding will reduce the cost and time needed for PCR amplification. PMID:27347449

  2. Overlap extension PCR cloning.

    PubMed

    Bryksin, Anton; Matsumura, Ichiro

    2013-01-01

    Rising demand for recombinant proteins has motivated the development of efficient and reliable cloning methods. Here we show how a beginner can clone virtually any DNA insert into a plasmid of choice without the use of restriction endonucleases or T4 DNA ligase. Chimeric primers encoding plasmid sequence at the 5' ends and insert sequence at the 3' ends are designed and synthesized. Phusion(®) DNA polymerase is utilized to amplify the desired insert by PCR. The double-stranded product is subsequently employed as a pair of mega-primers in a PCR-like reaction with circular plasmids. The original plasmids are then destroyed in restriction digests with Dpn I. The product of the overlap extension PCR is used to transform competent Escherichia coli cells. Phusion(®) DNA polymerase is used for both the amplification and fusion reactions, so both steps can be monitored and optimized in the same way. PMID:23996437

  3. Education Vouchers. A Primer.

    ERIC Educational Resources Information Center

    Richter, Philip C.; Hollender, Mary Jo

    This document is intended to serve both as a primer and as an annotated bibliography about educational vouchers. As a primer, it introduces the reader to the concept of vouchers and to the variety of issues--including political, economic, legal, and educational issues--associated with vouchers. As an annotated bibliography, it provides a summary…

  4. Barcoded primers used in multiplex amplicon pyrosequencing bias amplification.

    PubMed

    Berry, David; Ben Mahfoudh, Karim; Wagner, Michael; Loy, Alexander

    2011-11-01

    "Barcode-tagged" PCR primers used for multiplex amplicon sequencing generate a thus-far-overlooked amplification bias that produces variable terminal restriction fragment length polymorphism (T-RFLP) and pyrosequencing data from the same environmental DNA template. We propose a simple two-step PCR approach that increases reproducibility and consistently recovers higher genetic diversity in pyrosequencing libraries. PMID:21890669

  5. Quick spacecraft charging primer

    SciTech Connect

    Larsen, Brian Arthur

    2014-03-12

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  6. Association between the p73 gene G4C14-to-A4T14 single nucleotide polymorphism and risk of cervical cancer by high resolution melting and PCR with confronting two-pair primers in a Chinese population

    PubMed Central

    GUO, HAIYAN; YANG, SHAODI; XU, LIJIAN; LI, DING; TANG, JIANXIN; WANG, SHUANGSHAUNG; WEI, BENJIE; LIU, ZHENGCHUN

    2016-01-01

    As a member of the p53 gene family, the p73 gene can affect an individual's susceptibility to cancer through a p53-like manner. DNA sequence variation in the p73 gene has been reported to be associated with cancer risk. The present study aimed to identify whether the p73 gene G4C14-to-A4T14 single nucleotide polymorphism (SNP) is associated with risk of cervical cancer in a Chinese population. The p73 G4C14-to-A4T14 polymorphism was genotyped in 175 cervical cancer and 189 healthy control peripheral blood DNA samples using high resolution melting, polymerase chain reaction with confronting two-pair primers and direct DNA sequencing. The results demonstrated that carriers of the AT/AT genotype were associated with a significantly increased risk of cervical cancer (P=0.042; χ2=4.122; odds ratio = 2.241; 95% confidence interval = 1.013–4.956) compared with the GC/GC genotype carriers. In addition, there was a significant association between p73 genotypes and tumor size in patients with cervical cancer (P=0.014; χ2=8.607). However, no association was identified between p73 genotypes and tumor stage, histological type or lymph node metastasis in patients with cervical cancer. These results suggest that the p73 G4C14-to-A4T14 SNP may function as a marker of genetic susceptibility to cervical cancer in the Chinese population. PMID:27347206

  7. China Energy Primer

    SciTech Connect

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  8. Real-time colorimetric detection of DNA methylation of the PAX1 gene in cervical scrapings for cervical cancer screening with thiol-labeled PCR primers and gold nanoparticles

    PubMed Central

    Huang, Jin; Liou, Yu-Ligh; Kang, Ya-Nan; Tan, Zhi-Rong; Peng, Ming-Jing; Zhou, Hong-Hao

    2016-01-01

    Background DNA methylation can induce carcinogenesis by silencing key tumor suppressor genes. Analysis of aberrant methylation of tumor suppressor genes can be used as a prognostic and predictive biomarker for cancer. In this study, we propose a colorimetric method for the detection of DNA methylation of the paired box gene 1 (PAX1) gene in cervical scrapings obtained from 42 patients who underwent cervical colposcopic biopsy. Methods A thiolated methylation-specific polymerase chain reaction (MSP) primer was used to generate MSP products labeled with the thiol group at one end. After bisulfite conversion and MSP amplification, the unmodified gold nanoparticles (AuNPs) were placed in a reaction tube and NaCl was added to induce aggregation of bare AuNPs without generating polymerase chain reaction products. After salt addition, the color of AuNPs remained red in the methylated PAX1 gene samples because of binding to the MSP-amplified products. By contrast, the color of the AuNP colloid solution changed from red to blue in the non-methylated PAX1 gene samples because of aggregation of AuNPs in the absence of the MSP-amplified products. Furthermore, PAX1 methylation was quantitatively detected in cervical scrapings of patients with varied pathological degrees of cervical cancer. Conventional quantitative MSP (qMSP) was also performed for comparison. Results The two methods showed a significant correlation of the methylation frequency of the PAX1 gene in cervical scrapings with severity of cervical cancer (n=42, P<0.05). The results of the proposed method showed that the areas under the receiver operating characteristic curve (AUCs) of PAX1 were 0.833, 0.742, and 0.739 for the detection of cervical intraepithelial neoplasms grade 2 and worse lesions (CIN2+), cervical intraepithelial neoplasms grade 3 and worse lesions (CIN3+), and squamous cell carcinoma, respectively. The sensitivity and specificity for detecting CIN2+ lesions were 0.941 and 0.600, respectively, with

  9. Primer on Social Economics.

    ERIC Educational Resources Information Center

    Darcy, Robert L.

    An elaboration of the author's booklet entitled "First Steps Toward Economic Understanding," this primer is designed to help the reader develop a functional understanding of the economic process so that he can make wiser decisions on issues of social policy and on matters affecting his economic well-being. The document is not "economics in one…

  10. An SAT® Validity Primer

    ERIC Educational Resources Information Center

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  11. Microsatellite primer resource for Populus developed from

    SciTech Connect

    Yin, Tongming; Yang, Xiaohan; Gunter, Lee E; Tuskan, Gerald A; Wullschleger, Stan D; Huang, Prof. Minren; Li, Shuxian; Zhang, Xinye

    2008-01-01

    In this study, 148 428 simple sequence repeat (SSR) primer pairs were designed from the unambiguously mapped sequence scaffolds of the Nisqually-1 genome. The physical position of the priming sites were identified along each of the 19 Populus chromosomes, and it was specified whether the priming sequences belong to intronic, intergenic, exonic or UTR regions. A subset of 150 SSR loci were amplified and a high amplification success rate (72%) was obtained in P. tremuloides, which belongs to a divergent subgenus of Populus relative to Nisqually-1. PCR reactions showed that the amplification success rate of exonic primer pairs was much higher than that of the intronic/intergenic primer pairs. Applying ANOVA and regression analyses to the flanking sequences of microsatellites, the repeat lengths, the GC contents of the repeats, the repeat motif numbers, the repeat motif length and the base composition of the repeat motif, it was determined that only the base composition of the repeat motif and the repeat motif length significantly affect the microsatellite variability in P. tremuloides samples. The SSR primer resource developed in this study provides a database for selecting highly transferable SSR markers with known physical position in the Populus genome and provides a comprehensive genetic tool to extend the genome sequence of Nisqually-1 to genetic studies in different Populus species.

  12. Identification of bacterial plant pathogens using multilocus PCR and electrospray ionization-mass spectrometry (PCR/ESI-MS)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    PCR/electrospray ionization-mass spectrometry (PCR/ESI-MS, previously known as “TIGER”) utilizes PCR with broad range primers to amplify products from wide array of organisms within a taxonomic group, followed by analysis of PCR amplicons using mass spectrometry. Computer analysis of precise masses ...

  13. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    PubMed

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics. PMID:25229098

  14. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    PubMed Central

    Spandidos, Athanasia; Wang, Xiaowei; Wang, Huajun; Dragnev, Stefan; Thurber, Tara; Seed, Brian

    2008-01-01

    Background Quantitative polymerase chain reaction (QPCR) is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays. PMID:19108745

  15. Crystalline Silica Primer

    USGS Publications Warehouse

    ,

    1992-01-01

    substance and will present a nontechnical overview of the techniques used to measure crystalline silica. Because this primer is meant to be a starting point for anyone interested in learning more about crystalline silica, a list of selected readings and other resources is included. The detailed glossary, which defines many terms that are beyond the scope of this publication, is designed to help the reader move from this presentation to a more technical one, the inevitable next step.

  16. Coal Bed Methane Primer

    SciTech Connect

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  17. Primer on molecular genetics

    SciTech Connect

    Not Available

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  18. SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.

    PubMed

    Villard, Pierre; Malausa, Thibaut

    2013-07-01

    SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php.

  19. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    USGS Publications Warehouse

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  20. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    PubMed

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  1. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    PubMed

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method. PMID:25429503

  2. Laser Doppler velocimetry primer

    NASA Technical Reports Server (NTRS)

    Bachalo, William D.

    1985-01-01

    Advanced research in experimental fluid dynamics required a familiarity with sophisticated measurement techniques. In some cases, the development and application of new techniques is required for difficult measurements. Optical methods and in particular, the laser Doppler velocimeter (LDV) are now recognized as the most reliable means for performing measurements in complex turbulent flows. And such, the experimental fluid dynamicist should be familiar with the principles of operation of the method and the details associated with its application. Thus, the goals of this primer are to efficiently transmit the basic concepts of the LDV method to potential users and to provide references that describe the specific areas in greater detail.

  3. PD5: A General Purpose Library for Primer Design Software

    PubMed Central

    Riley, Michael C.; Aubrey, Wayne; Young, Michael; Clare, Amanda

    2013-01-01

    Background Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. Results The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C++ with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. Conclusions The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design PMID:24278254

  4. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    1998-01-01

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  5. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    2005-04-19

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  6. Limited-life cartridge primers

    DOEpatents

    Makowiecki, D.M.; Rosen, R.S.

    1998-06-30

    A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.

  7. STR primer concordance study.

    PubMed

    Budowle, B; Masibay, A; Anderson, S J; Barna, C; Biega, L; Brenneke, S; Brown, B L; Cramer, J; DeGroot, G A; Douglas, D; Duceman, B; Eastman, A; Giles, R; Hamill, J; Haase, D J; Janssen, D W; Kupferschmid, T D; Lawton, T; Lemire, C; Llewellyn, B; Moretti, T; Neves, J; Palaski, C; Schueler, S; Sgueglia, J; Sprecher, C; Tomsey, C; Yet, D

    2001-12-15

    Over 1500 population database samples comprising African Americans, Caucasians, Hispanics, Native Americans, Chamorros and Filipinos were typed using the PowerPlex 16 and the Profiler Plus/COfiler kits. Except for the D8S1179 locus in Chamorros and Filipinos from Guam, there were eight examples in which a typing difference due to allele dropout was observed. At the D8S1179 locus in the population samples from Guam, there were 13 examples of allele dropout observed when using the Profiler Plus kit. The data support that the primers used in the PowerPlex 16, Profiler Plus, and COfiler kits are reliable for typing reference samples that are for use in CODIS. In addition, allele frequency databases have been established for the STR loci Penta D and Penta E. Both loci are highly polymorphic. PMID:11741760

  8. Recent developments in primer design for DNA polymorphism and mRNA profiling in higher plants

    PubMed Central

    Yang, Xiaohan; Scheffler, Brian E; Weston, Leslie A

    2006-01-01

    Primer design is a critical step in the application of PCR-based technologies in gene expression and genetic diversity analysis. As more plant genomes have been sequenced in recent years, the emphasis of primer design strategy has shifted to genome-wide and high-throughput direction. This paper summarizes recent advances in primer design for profiling of DNA polymorphism and mRNA in higher plants, as well as new primer systems developed for animals that can be adapted for plants. PMID:16509990

  9. Universal primers that amplify RNA from all three flavivirus subgroups

    PubMed Central

    Maher-Sturgess, Sheryl L; Forrester, Naomi L; Wayper, Paul J; Gould, Ernest A; Hall, Roy A; Barnard, Ross T; Gibbs, Mark J

    2008-01-01

    Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5) coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers. PMID:18218114

  10. Inosine at Different Primer Positions to Study Structure and Diversity of Prokaryotic Populations.

    PubMed

    Ben-Dov, Eitan; Kushmaro, Ariel

    2015-01-01

    Culture-independent methods, employed to study the diversity and complexity of microbial communities that are based on amplification of rRNA genes with universal primers, include gradient gel electrophoresis (denaturing or temperature), single-strand-conformation polymorphism, restriction fragment length polymorphism, qPCR and high-throughput DNA sequencing. Substituting one or more base(s) within or at the 3'-termi of the universal primers by inosine can overcome some of their shortcomings improving amplification capacity. Universal primer sets do not usually amplify sequences with nucleotide mismatch to the templates, particularly in the last three bases, whereas inosine-modified primers anneal and amplify a variety of rRNA gene sequences. Inosine-containing primers are therefore might be useful to detect more species in diverse prokaryotic populations. The article summarizes the pros and cons of using inosine especially at the 3' termini of universal primers in nucleic acid amplification for the study of microbial diversity.

  11. Hermetic G-16 percussion primer

    SciTech Connect

    Durand, N.A.; Weinmaster, R.R.; Massis, T.M.

    1988-01-01

    Studies were conducted to optimize a Hermetic percussion primer capable of surviving temperatures of 200/degree/C for up to 48 hours. These studies included work with typical brass percussion primers and the pyrotechnic composition designed G-16. The G-16 mixture is composed of antimony sulfide, calcium silicide, and potassium. The hermetically sealed assembly consists of a brass cup and anvil loaded with G-16 pyrotechnic mixture and assembly includes a steel disc which is laser welded over the sealing mechanisms cause negligible changes. This assembly can be used with other primers and is capable of enhanced output for specialized applications. 4 refs., 8 figs., 4 tabs.

  12. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    PubMed

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%.

  13. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    PubMed

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  14. Optimization of primer design for the detection of variable genomic lesions in cancer.

    PubMed

    Bashir, Ali; Liu, Yu-Tsueng; Raphael, Benjamin J; Carson, Dennis; Bafna, Vineet

    2007-11-01

    Primer approximation multiplex PCR (PAMP) is a new experimental protocol for efficiently assaying structural variation in genomes. PAMP is particularly suited to cancer genomes where the precise breakpoints of alterations such as deletions or translocations vary between patients. The design of PCR primer sets for PAMP is challenging because a large number of primer pairs are required to detect alterations in the hundreds of kilobases range that can occur in cancer. These sets of primers must achieve high coverage of the region of interest, while avoiding primer dimers and satisfying the physico-chemical constraints of good PCR primers. We describe a natural formulation of these constraints as a combinatorial optimization problem. We show that the PAMP primer design problem is NP-hard, and design algorithms based on simulated annealing and integer programming, that provide good solutions to this problem in practice. The algorithms are applied to a test region around the known CDKN2A deletion, which show excellent results even in a 1:49 mixture of mutated:wild-type cells. We use these test results to help set design parameters for larger problems. We can achieve near-optimal designs for regions close to 1 Mb. PMID:17766270

  15. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  16. Variations in the sensitivity of different primers for detecting Wolbachia in Anastrepha (diptera: tephritidae)

    PubMed Central

    Marcon, Helena Sanches; Coscrato, Virgínia Elias; Selivon, Denise; Perondini, André Luiz Paranhos; Marino, Celso Luis

    2011-01-01

    Wolbachia are endosymbiont bacteria of the family Rickettsiacea that are widespread in invertebrates and occur between 20% and 60% of Neotropical insects. These bacteria are responsible for reproductive phenomena such as cytoplasmic incompatibility, male killing, feminization and parthenogenesis. Supergroups A and B of Wolbachia are common in insects and can be identified using primers for 16S rDNA, ftsZ and wsp; these primers vary in their ability to detect Wolbachia. The ftsZ primer was the first primer used to detect Wolbachia in Anastrepha fruit flies. The primers for 16S rDNA, ftsZ and wsp and the corresponding PCR conditions have been optimized to study the distribution of Wolbachia and their effect on the biology of Anastrepha in Brazil. In this work, we examined the ability of these primers to detect Wolbachia in Anastrepha populations from three regions in the State of São Paulo, southeastern Brazil. All of the samples were positive for Wolbachia supergroup A when screened with primers for 16S A rDNA and wsp A; the wsp B primer also gave a positive result, indicating cross-reactivity. The ftsZ primer showed a poor ability to detect Wolbachia in Anastrepha and generated false negatives in 44.9% of the samples. These findings indicate that reliable PCR detection of Wolbachia requires the use of primers for 16S rDNA and wsp to avoid cross-reactions and false negatives, and that the ftsZ primer needs to be redesigned to improve its selectivity. PMID:24031693

  17. Improved Selection of Internal Transcribed Spacer-Specific Primers Enables Quantitative, Ultra-High-Throughput Profiling of Fungal Communities

    PubMed Central

    Bokulich, Nicholas A.

    2013-01-01

    Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949

  18. Sensitivity of PCR and real-time PCR for the diagnosis of human visceral leishmaniasis using peripheral blood

    PubMed Central

    da Costa Lima, Manoel Sebastião; Zorzenon, Denielly Christina Rodrigues; Dorval, Maria Elizabeth Cavalheiros; Pontes, Elenir Rose Jardim Cury; Oshiro, Elisa Teruya; Cunha, Rodrigo; Andreotti, Renato; Matos, Maria de Fatima Cepa

    2013-01-01

    Objective To evaluate the effectiveness of PCR and real-time PCR for the diagnosis of human visceral leishmaniasis using peripheral blood samples. Methods DNA extraction was performed using Promega Wizard® Genomic kits. PCR employing RV1/RV2 primers yielded 145-bp amplicons. Real-time PCR was performed with the same primers and SYBR Green ROX Plus mix. These techniques were used to analyze 100 peripheral blood samples from patients with clinical signs of the disease. Results The sensitivity and specificity levels were 91,3%% and 29,6%, respectively, for real-time PCR and 97.78% and 61.82%, respectively, for PCR. Conclusions Real-time PCR proved to be a satisfactory method for the diagnosis of human visceral leishmaniasis.

  19. ecoPrimers: inference of new DNA barcode markers from whole genome sequence analysis

    PubMed Central

    Riaz, Tiayyba; Shehzad, Wasim; Viari, Alain; Pompanon, François; Taberlet, Pierre; Coissac, Eric

    2011-01-01

    Using non-conventional markers, DNA metabarcoding allows biodiversity assessment from complex substrates. In this article, we present ecoPrimers, a software for identifying new barcode markers and their associated PCR primers. ecoPrimers scans whole genomes to find such markers without a priori knowledge. ecoPrimers optimizes two quality indices measuring taxonomical range and discrimination to select the most efficient markers from a set of reference sequences, according to specific experimental constraints such as marker length or specifically targeted taxa. The key step of the algorithm is the identification of conserved regions among reference sequences for anchoring primers. We propose an efficient algorithm based on data mining, that allows the analysis of huge sets of sequences. We evaluate the efficiency of ecoPrimers by running it on three different sequence sets: mitochondrial, chloroplast and bacterial genomes. Identified barcode markers correspond either to barcode regions already in use for plants or animals, or to new potential barcodes. Results from empirical experiments carried out on a promising new barcode for analyzing vertebrate diversity fully agree with expectations based on bioinformatics analysis. These tests demonstrate the efficiency of ecoPrimers for inferring new barcodes fitting with diverse experimental contexts. ecoPrimers is available as an open source project at: http://www.grenoble.prabi.fr/trac/ecoPrimers. PMID:21930509

  20. Charter School Primer. Peter Lang Primer. Volume 34

    ERIC Educational Resources Information Center

    Tryjankowski, Anne Marie

    2012-01-01

    The "Charter School Primer" presents an overview of public charter schools in the United States. The book discusses what charter schools are; the history of public charter school choice in the United States; the role of teachers, parents, boards, and unions in the charter school movement; and gives examples of innovations in education made…

  1. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    ERIC Educational Resources Information Center

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  2. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.

    PubMed

    Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R

    1994-10-01

    We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.

  3. New primers for detecting and quantifying denitrifying anaerobic methane oxidation archaea in different ecological niches.

    PubMed

    Ding, Jing; Ding, Zhao-Wei; Fu, Liang; Lu, Yong-Ze; Cheng, Shuk H; Zeng, Raymond J

    2015-11-01

    The significance of ANME-2d in methane sink in the environment has been overlooked, and there was no any study evaluating the distribution of ANME-2d in the environment. New primers were thus needed to be designed for following research. In this paper, a pair of primers (DP397F and DP569R) was designed to quantify ANME-2d. The specificity and amplification efficiency of this primer pair were acceptable. PCR amplification of another pair of primers (DP142F and DP779R) generated a single, bright targeted band from the enrichment sample, but yielded faint, multiple bands from the environmental samples. Nested PCR was conducted using the primers DP142F/DP779R in the first round and DP142F/DP569R in the second round, which generated a bright targeted band. Further phylogenetic analysis showed that these targeted bands were ANME-2d-related sequences. Real-time PCR showed that the copies of the 16s ribosomal RNA gene of ANME-2d in these samples ranged from 3.72 × 10(4) to 2.30 × 10(5) copies μg(-1) DNA, indicating that the percentage of ANME-2d was greatest in a polluted river sample and least in a rice paddy sample. These results demonstrate that the newly developed real-time PCR primers could sufficiently quantify ANME-2d and that nested PCR with an appropriate combination of the new primers could successfully detect ANME-2d in environmental samples; the latter finding suggests that ANME-2d may spread in environments.

  4. New Primers for Discovering Fungal Diversity Using Nuclear Large Ribosomal DNA.

    PubMed

    Asemaninejad, Asma; Weerasuriya, Nimalka; Gloor, Gregory B; Lindo, Zoë; Thorn, R Greg

    2016-01-01

    Metabarcoding has become an important tool in the discovery of biodiversity, including fungi, which are the second most speciose group of eukaryotes, with diverse and important ecological roles in terrestrial ecosystems. We have designed and tested new PCR primers that target the D1 variable region of nuclear large subunit (LSU) ribosomal DNA; one set that targets the phylum Ascomycota and another that recovers all other fungal phyla. The primers yield amplicons compatible with the Illumina MiSeq platform, which is cost-effective and has a lower error rate than other high throughput sequencing platforms. The new primer set LSU200A-F/LSU476A-R (Ascomycota) yielded 95-98% of reads of target taxa from environmental samples, and primers LSU200-F/LSU481-R (all other fungi) yielded 72-80% of target reads. Both primer sets have fairly low rates of data loss, and together they cover a wide variety of fungal taxa. We compared our results with these primers by amplifying and sequencing a subset of samples using the previously described ITS3_KYO2/ITS4_KYO3 primers, which amplify the internal transcribed spacer 2 (ITS2) of Ascomycota and Basidiomycota. With approximately equivalent read depth, our LSU primers recovered a greater number and phylogenetic diversity of sequences than the ITS2 primers. For instance, ITS3_KYO2/ITS4_KYO3 primers failed to pick up any members of Eurotiales, Mytilinidiales, Pezizales, Saccharomycetales, or Venturiales within Ascomycota, or members of Exobasidiomycetes, Microbotryomycetes, Pucciniomycetes, or Tremellomycetes within Basidiomycota, which were retrieved in good numbers from the same samples by our LSU primers. Among the OTUs recovered using the LSU primers were 127 genera and 28 species that were not obtained using the ITS2 primers, although the ITS2 primers recovered 10 unique genera and 16 species that were not obtained using either of the LSU primers These features identify the new primer sets developed in this study as useful

  5. New Primers for Discovering Fungal Diversity Using Nuclear Large Ribosomal DNA

    PubMed Central

    Gloor, Gregory B.; Lindo, Zoë

    2016-01-01

    Metabarcoding has become an important tool in the discovery of biodiversity, including fungi, which are the second most speciose group of eukaryotes, with diverse and important ecological roles in terrestrial ecosystems. We have designed and tested new PCR primers that target the D1 variable region of nuclear large subunit (LSU) ribosomal DNA; one set that targets the phylum Ascomycota and another that recovers all other fungal phyla. The primers yield amplicons compatible with the Illumina MiSeq platform, which is cost-effective and has a lower error rate than other high throughput sequencing platforms. The new primer set LSU200A-F/LSU476A-R (Ascomycota) yielded 95–98% of reads of target taxa from environmental samples, and primers LSU200-F/LSU481-R (all other fungi) yielded 72–80% of target reads. Both primer sets have fairly low rates of data loss, and together they cover a wide variety of fungal taxa. We compared our results with these primers by amplifying and sequencing a subset of samples using the previously described ITS3_KYO2/ITS4_KYO3 primers, which amplify the internal transcribed spacer 2 (ITS2) of Ascomycota and Basidiomycota. With approximately equivalent read depth, our LSU primers recovered a greater number and phylogenetic diversity of sequences than the ITS2 primers. For instance, ITS3_KYO2/ITS4_KYO3 primers failed to pick up any members of Eurotiales, Mytilinidiales, Pezizales, Saccharomycetales, or Venturiales within Ascomycota, or members of Exobasidiomycetes, Microbotryomycetes, Pucciniomycetes, or Tremellomycetes within Basidiomycota, which were retrieved in good numbers from the same samples by our LSU primers. Among the OTUs recovered using the LSU primers were 127 genera and 28 species that were not obtained using the ITS2 primers, although the ITS2 primers recovered 10 unique genera and 16 species that were not obtained using either of the LSU primers These features identify the new primer sets developed in this study as useful

  6. Universal primers for amplification of the complete mitochondrial control region in marine fish species.

    PubMed

    Cheng, Y Z; Xu, T J; Jin, X X; Tang, D; Wei, T; Sun, Y Y; Meng, F Q; Shi, G; Wang, R X

    2012-01-01

    Through multiple alignment analysis of mitochondrial tRNA-Thr and tRNA-Phe sequences from 161 fishes, new universal primers specially targeting the entire mitochondrial control region were designed. This new primer set successfully amplified the expected PCR products from various kinds of marine fish species, belonging to various families, and the amplified segments were confirmed to be the control region by sequencing. These primers provide a useful tool to study the control region diversity in economically important fish species, the possible mechanism of control region evolution, and the functions of the conserved motifs in the control region.

  7. A simple procedure eliminating multiple optimization steps required in developing multiplex PCR reactions

    SciTech Connect

    Grondin, V.; Roskey, M.; Klinger, K.; Shuber, T.

    1994-09-01

    The PCR technique is one of the most powerful tools in modern molecular genetics and has achieved widespread use in the analysis of genetic diseases. Typically, a region of interest is amplified from genomic DNA or cDNA and examined by various methods of analysis for mutations or polymorphisms. In cases of small genes and transcripts, amplification of single, small regions of DNA are sufficient for analysis. However, when analyzing large genes and transcripts, multiple PCRs may be required to identify the specific mutation or polymorphism of interest. Ever since it has been shown that PCR could simultaneously amplify multiple loci in the human dystrophin gene, multiplex PCR has been established as a general technique. The properities of multiplex PCR make it a useful tool and preferable to simultaneous uniplex PCR in many instances. However, the steps for developing a multiplex PCR can be laborious, with significant difficulty in achieving equimolar amounts of several different amplicons. We have developed a simple method of primer design that has enabled us to eliminate a number of the standard optimization steps required in developing a multiplex PCR. Sequence-specific oligonucleotide pairs were synthesized for the simultaneous amplification of multiple exons within the CFTR gene. A common non-complementary 20 nucleotide sequence was attached to each primer, thus creating a mixture of primer pairs all containing a universal primer sequence. Multiplex PCR reactions were carried out containing target DNA, a mixture of several chimeric primer pairs and primers complementary to only the universal portion of the chimeric primers. Following optimization of conditions for the universal primer, limited optimization was needed for successful multiplex PCR. In contrast, significant optimization of the PCR conditions were needed when pairs of sequence specific primers were used together without the universal sequence.

  8. Detection of Theileria orientalis in Iran by semi-nested PCR.

    PubMed

    Ghaemi, Peyman; Hoghooghi-Rad, Nasser; Shayan, Parviz; Eckert, Brigitte

    2012-02-01

    In order to identify and differentiate Theileria orientalis in cattle which may be infected with Theileria annulata simultaneously, a semi-nested PCR was performed. Thus, 160 blood samples were collected from apparently healthy native cattle in Golestan province of northern Iran, during 2009 to 2011. The Tbs-S/Tbs-A primer set derived from the 18S rRNA encoding gene was used for first PCR amplification, and the amplified sequence weight by this primer set for Theileria sp. was 426-430 bp. Then, DNA solution from purified PCR product was used for the semi-nested PCR analysis. The first PCR product amplified using T. orientalis primer set (To-S/Tbs-A) derived from the 18SrRNA encoding gene, and this specific primer weight was 235 bp. Also, the first PCR product amplified using T. annulata primer set (Ta-S/Tbs-A) derived from the 18SrRNA encoding gene and this specific primer weight was 193 bp. Having extracted DNA of each sample, using Tbs-S/Tbs-A primer set for PCR and analyzing the PCR products on the 2% agarose gel electrophoresis, 13 out of 160 blood samples (8.12%) were positive for Theileria sp. Meanwhile, performing semi-nested PCR with T. orientalis-specific primers, 9 out of 13 blood samples (5.62%) were positive and performing semi-nested PCR with T. annulata-specific primers, 12 out of 13 blood samples (7.5%) were also positive. This molecular assay approves the presence of T. orientalis in the native cattle of northern parts of Iran for the first time. In addition, this procedure will detect the concurrent infection of T. orientalis and T. annulata in the cattle too.

  9. Primer vector theory and applications

    NASA Technical Reports Server (NTRS)

    Jezewski, D. J.

    1975-01-01

    A method developed to compute two-body, optimal, N-impulse trajectories was presented. The necessary conditions established define the gradient structure of the primer vector and its derivative for any set of boundary conditions and any number of impulses. Inequality constraints, a conjugate gradient iterator technique, and the use of a penalty function were also discussed.

  10. A Hearing Aid Primer 1

    ERIC Educational Resources Information Center

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  11. Freshwater Wetlands: A Citizen's Primer.

    ERIC Educational Resources Information Center

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of wetland…

  12. Coal mining: A petex primer

    SciTech Connect

    Not Available

    1985-01-01

    This book is an introduction to the coal industry - from planning a mine to delivering coal to a power plant. The primer covers what coal is and how it is used, modern underground and surface mining practices, coal preparation and transport, and the relation between coal and the environment.

  13. Postsecondary Data Connections: A Primer

    ERIC Educational Resources Information Center

    Data Quality Campaign, 2011

    2011-01-01

    There is an increasing focus at the state and federal levels on linking data across the P-20/Workforce spectrum to help inform policies and practices. This primer is intended to provide policymakers with: (1) An overview of the status of states vis-a-vis the linking of postsecondary data to K-12 and workforce data; (2) A subset of questions…

  14. Detection and discrimination of four Aspergillus section Nigri species by PCR.

    PubMed

    Palumbo, J D; O'Keeffe, T L

    2015-02-01

    Species of Aspergillus section Nigri are not easily distinguished by traditional morphological techniques, and typically are identified by DNA sequencing methods. We developed four PCR primers to distinguish between Aspergillus niger, Aspergillus welwitschiae, Aspergillus carbonarius and Aspergillus tubingensis, based on species-conserved differences in the calmodulin gene sequence. PCR amplification from total DNA using these primers was species specific; no amplification occurred from nontarget species DNA for each primer pair. Species-specific PCR could distinguish between species in mixed DNA templates, indicating a utility in determining culture uniformity of isolated Aspergillus strains. In addition, with these primer sets, each species could be detected in soil following mixed-species inoculation with Aspergillus spores. This indicates that PCR with these species-specific primers may be useful in determining the distribution of Aspergillus species in environmental samples without the need for species identification from isolated strains, as well as detecting species that may be infrequently isolated by culture-based methods.

  15. Simultaneous multiplex PCR detection of seven cucurbit-infecting viruses.

    PubMed

    Kwon, Ji Yeon; Hong, Jin Sung; Kim, Min Jea; Choi, Sun Hee; Min, Byeong Eun; Song, Eun Gyeong; Kim, Hyun Hee; Ryu, Ki Hyun

    2014-09-01

    Two multiplex polymerase chain reaction (PCR) systems using dual priming oligonucleotide (DPO) primers were developed for the simultaneous detection of seven cucurbit-infecting viruses. One system allows for the detection of papaya ringspot virus, watermelon mosaic virus, and zucchini yellow mosaic virus, whereas the other permits the detection of cucumber green mottle mosaic virus, cucumber fruit mottle mosaic virus, kyuri green mottle mosaic virus, and zucchini green mottle mosaic virus. Viral species-specific DPO primers developed in this study detected as little as 10 fg/μl of viral RNA under monoplex conditions and 10 pg/μl of viral RNA under multiplex conditions. Multiplex PCR using the DPO primer sets was capable of amplifying viral genes at annealing temperatures ranging from 53 °C to 63 °C. Whereas the use of conventional primers gave rise to non-specific bands, the DPO primers detected target viral genes in the absence of non-specific amplification. When these DPO multiplex primer sets were applied to virus-infected cucurbit samples obtained in the field, multiple infection as well as single infection was accurately identified. This novel approach could also detect multiple viruses in infected seeds. The reliability of multiplex PCR systems using DPO primers for plant virus detection is discussed.

  16. Simultaneous multiplex PCR detection of seven cucurbit-infecting viruses.

    PubMed

    Kwon, Ji Yeon; Hong, Jin Sung; Kim, Min Jea; Choi, Sun Hee; Min, Byeong Eun; Song, Eun Gyeong; Kim, Hyun Hee; Ryu, Ki Hyun

    2014-09-01

    Two multiplex polymerase chain reaction (PCR) systems using dual priming oligonucleotide (DPO) primers were developed for the simultaneous detection of seven cucurbit-infecting viruses. One system allows for the detection of papaya ringspot virus, watermelon mosaic virus, and zucchini yellow mosaic virus, whereas the other permits the detection of cucumber green mottle mosaic virus, cucumber fruit mottle mosaic virus, kyuri green mottle mosaic virus, and zucchini green mottle mosaic virus. Viral species-specific DPO primers developed in this study detected as little as 10 fg/μl of viral RNA under monoplex conditions and 10 pg/μl of viral RNA under multiplex conditions. Multiplex PCR using the DPO primer sets was capable of amplifying viral genes at annealing temperatures ranging from 53 °C to 63 °C. Whereas the use of conventional primers gave rise to non-specific bands, the DPO primers detected target viral genes in the absence of non-specific amplification. When these DPO multiplex primer sets were applied to virus-infected cucurbit samples obtained in the field, multiple infection as well as single infection was accurately identified. This novel approach could also detect multiple viruses in infected seeds. The reliability of multiplex PCR systems using DPO primers for plant virus detection is discussed. PMID:24937806

  17. Evaluating Primers for Profiling Anaerobic Ammonia Oxidizing Bacteria within Freshwater Environments

    PubMed Central

    Sonthiphand, Puntipar; Neufeld, Josh D.

    2013-01-01

    Anaerobic ammonia oxidizing (anammox) bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE) fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r) for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r) was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library analysis, A438f/A684r

  18. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    PubMed

    Sonthiphand, Puntipar; Neufeld, Josh D

    2013-01-01

    Anaerobic ammonia oxidizing (anammox) bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE) fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r) for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r) was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library analysis, A438f/A684r

  19. Global RT-PCR and RT-qPCR Analysis of the mRNA Expression of the Human PTPome.

    PubMed

    Nunes-Xavier, Caroline E; Pulido, Rafael

    2016-01-01

    Comprehensive comparative gene expression analysis of the tyrosine phosphatase superfamily members (PTPome) under cell- or tissue-specific growth conditions may help to define their individual and specific role in physiology and disease. Semi-quantitative and quantitative PCR are commonly used methods to analyze and measure gene expression. Here, we describe technical aspects of PTPome mRNA expression analysis by semi-quantitative RT-PCR and quantitative RT-PCR (RT-qPCR). We provide a protocol for each method consisting in reverse transcription followed by PCR using a global platform of specific PTP primers. The chapter includes aspects from primer validation to the setup of the PTPome RT-qPCR platform. Examples are given of PTP-profiling gene expression analysis using a human breast cancer cell line upon long-term or short-term treatment with cell signaling-activation agents. PMID:27514798

  20. Challenges with using primer IDs to improve accuracy of next generation sequencing.

    PubMed

    Brodin, Johanna; Hedskog, Charlotte; Heddini, Alexander; Benard, Emmanuel; Neher, Richard A; Mild, Mattias; Albert, Jan

    2015-01-01

    Next generation sequencing technologies, like ultra-deep pyrosequencing (UDPS), allows detailed investigation of complex populations, like RNA viruses, but its utility is limited by errors introduced during sample preparation and sequencing. By tagging each individual cDNA molecule with barcodes, referred to as Primer IDs, before PCR and sequencing these errors could theoretically be removed. Here we evaluated the Primer ID methodology on 257,846 UDPS reads generated from a HIV-1 SG3Δenv plasmid clone and plasma samples from three HIV-infected patients. The Primer ID consisted of 11 randomized nucleotides, 4,194,304 combinations, in the primer for cDNA synthesis that introduced a unique sequence tag into each cDNA molecule. Consensus template sequences were constructed for reads with Primer IDs that were observed three or more times. Despite high numbers of input template molecules, the number of consensus template sequences was low. With 10,000 input molecules for the clone as few as 97 consensus template sequences were obtained due to highly skewed frequency of resampling. Furthermore, the number of sequenced templates was overestimated due to PCR errors in the Primer IDs. Finally, some consensus template sequences were erroneous due to hotspots for UDPS errors. The Primer ID methodology has the potential to provide highly accurate deep sequencing. However, it is important to be aware that there are remaining challenges with the methodology. In particular it is important to find ways to obtain a more even frequency of resampling of template molecules as well as to identify and remove artefactual consensus template sequences that have been generated by PCR errors in the Primer IDs.

  1. A Guide to Using STITCHER for Overlapping Assembly PCR Applications.

    PubMed

    O'Halloran, Damien M

    2017-01-01

    Overlapping PCR is commonly used in many molecular applications that include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping assembly PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online. PMID:27671928

  2. A Guide to Using STITCHER for Overlapping Assembly PCR Applications.

    PubMed

    O'Halloran, Damien M

    2017-01-01

    Overlapping PCR is commonly used in many molecular applications that include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping assembly PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online.

  3. PCR thermocycler

    DOEpatents

    Benett, William J.; Richards, James B.

    2005-05-17

    A sleeve-type silicon polymerase chain reaction (PCR) chamber or thermocycler having improved thermal performance. The silicon sleeve reaction chamber is improved in thermal performance by etched features therein that reduce thermal mass and increase the surface area of the sleeve for cooling. This improved thermal performance of the thermocycler enables an increase in speed and efficiency of the reaction chamber. The improvement is accomplished by providing grooves in the faces of the sleeve and a series of grooves on the interior surfaces that connect with grooves on the faces of the sleeve. The grooves can be anisotropically etched in the silicon sleeve simultaneously with formation of the chamber.

  4. PCR thermocycler

    DOEpatents

    Benett, William J.; Richards, James B.

    2003-01-01

    A sleeve-type silicon polymerase chain reaction (PCR) chamber or thermocycler having improved thermal performance. The silicon sleeve reaction chamber is improved in thermal performance by etched features therein that reduce thermal mass and increase the surface area of the sleeve for cooling. This improved thermal performance of the thermocycler enables an increase in speed and efficiency of the reaction chamber. The improvement is accomplished by providing grooves in the faces of the sleeve and a series of grooves on the interior surfaces that connect with grooves on the faces of the sleeve. The grooves can be anisotropically etched in the silicon sleeve simultaneously with formation of the chamber.

  5. A pmp genes-based PCR as a valuable tool for the diagnosis of avian chlamydiosis.

    PubMed

    Laroucau, Karine; Trichereau, Alain; Vorimore, Fabien; Mahé, Anne-Marie

    2007-03-31

    In a previous study we described the use of a new set of PCR primers (CpsiA/CpsiB) specific of the conserved pmp-family genes of Chlamydophila abortus as an efficient tool for the detection of these bacteria in ruminants including also preliminary results on avian strains. In this work, the use of this set of primers was extended to representative strains of the six major avian serovars (serovars A-F) and to field isolates of C. psittaci. For all the studied representative strains, using purified genomic DNA as a template, CpsiA/CpsiB primers allowed, as observed for C. abortus, a minimal 10-fold PCR signal increase compared to the one observed with ompA specific primers. In comparison to primers targeting the 16S-23S rRNA intergenic spacer, similar or increased sensitivity was observed depending on the strain. All the field isolates were amplified with CpsiA/CpsiB primers. On clinical samples, our primers are the best among those tested for detection of C. psittaci by simple conventional PCR. RFLP experiments performed using PCR fragments amplified with the CpsiA/CpsiB primers gave promising results demonstrating that these primers may provide an interesting tool for molecular typing when the bacterium cannot be grown from pathological samples.

  6. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of...

  7. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of...

  8. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of...

  9. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  10. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  11. Using Primers to Motivate Your Students

    ERIC Educational Resources Information Center

    Graff, Dan

    2002-01-01

    Primers are used to motivate and uplift your class. They come in many different styles and can be used in a variety of ways. Making primers relevant to students helps them to learn and makes them feel appreciated and knowledgeable when they participate. Using primers in the classroom to make students feel valued brings much success.

  12. Enhancing allele-specific PCR for specifically detecting short deletion and insertion DNA mutations.

    PubMed

    Wang, Yiran; Rollin, Joseph A; Zhang, Y-H Percival

    2010-02-01

    Allele-specific PCR (AS-PCR) has been widely used for the detection of single nucleotide polymorphism. But there are some challenges in using AS-PCR for specifically detecting DNA variations with short deletions or insertions. The challenges are associated with designing selective allele-specific primers as well as the specificity of AS-PCR in distinguishing some types of single base-pair mismatches. In order to address such problems and enhance the applicability of AS-PCR, a general primer design method was developed to create a multiple base-pair mismatch between the primer 3'-terminus and the template DNA. This approach can destabilize the primer-template complex more efficiently than does a single base-pair mismatch, and can dramatically increase the specificity of AS-PCR. As a proof-of-principle demonstration, the method of primer design was applied in colony PCR for identifying plasmid DNA deletion or insertion mutants after site-directed mutagenesis. As anticipated, multiple base-pair mismatches achieved much more specific PCR amplification than single base-pair mismatches. Therefore, with the proposed primer design method, the detection of short nucleotide deletion and insertion mutations becomes simple, accurate and more reliable.

  13. Establishment of Quantitative Analysis Method for Genetically Modified Maize Using a Reference Plasmid and Novel Primers

    PubMed Central

    Moon, Gi-Seong; Shin, Weon-Sun

    2012-01-01

    For the quantitative analysis of genetically modified (GM) maize in processed foods, primer sets and probes based on the 35S promoter (p35S), nopaline synthase terminator (tNOS), p35S-hsp70 intron, and zSSIIb gene encoding starch synthase II for intrinsic control were designed. Polymerase chain reaction (PCR) products (80~101 bp) were specifically amplified and the primer sets targeting the smaller regions (80 or 81 bp) were more sensitive than those targeting the larger regions (94 or 101 bp). Particularly, the primer set 35F1-R1 for p35S targeting 81 bp of sequence was even more sensitive than that targeting 101 bp of sequence by a 3-log scale. The target DNA fragments were also specifically amplified from all GM labeled food samples except for one item we tested when 35F1-R1 primer set was applied. A reference plasmid pGMmaize (3 kb) including the smaller PCR products for p35S, tNOS, p35S-hsp70 intron, and the zSSIIb gene was constructed for real-time PCR (RT-PCR). The linearity of standard curves was confirmed by using diluents ranging from 2×101~105 copies of pGMmaize and the R2 values ranged from 0.999~1.000. In the RT-PCR, the detection limit using the novel primer/probe sets was 5 pg of genomic DNA from MON810 line indicating that the primer sets targeting the smaller regions (80 or 81 bp) could be used for highly sensitive detection of foreign DNA fragments from GM maize in processed foods. PMID:24471096

  14. Establishment of quantitative analysis method for genetically modified maize using a reference plasmid and novel primers.

    PubMed

    Moon, Gi-Seong; Shin, Weon-Sun

    2012-12-01

    For the quantitative analysis of genetically modified (GM) maize in processed foods, primer sets and probes based on the 35S promoter (p35S), nopaline synthase terminator (tNOS), p35S-hsp70 intron, and zSSIIb gene encoding starch synthase II for intrinsic control were designed. Polymerase chain reaction (PCR) products (80~101 bp) were specifically amplified and the primer sets targeting the smaller regions (80 or 81 bp) were more sensitive than those targeting the larger regions (94 or 101 bp). Particularly, the primer set 35F1-R1 for p35S targeting 81 bp of sequence was even more sensitive than that targeting 101 bp of sequence by a 3-log scale. The target DNA fragments were also specifically amplified from all GM labeled food samples except for one item we tested when 35F1-R1 primer set was applied. A reference plasmid pGMmaize (3 kb) including the smaller PCR products for p35S, tNOS, p35S-hsp70 intron, and the zSSIIb gene was constructed for real-time PCR (RT-PCR). The linearity of standard curves was confirmed by using diluents ranging from 2×10(1)~10(5) copies of pGMmaize and the R(2) values ranged from 0.999~1.000. In the RT-PCR, the detection limit using the novel primer/probe sets was 5 pg of genomic DNA from MON810 line indicating that the primer sets targeting the smaller regions (80 or 81 bp) could be used for highly sensitive detection of foreign DNA fragments from GM maize in processed foods.

  15. DEVELOPMENT OF AN IMPROVED PCR-BASED TECHNIQUE FOR DETECTION OF PHYTOPHTHORA CACTORUM IN STRAWBERRY PLANTS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Specific and rapid plant pathogen detection methods can aid in strawberry disease management decisions. PCR-based diagnostics for Phytophthora cactorum and other strawberry pathogens are hindered by PCR inhibitors and lack of species-specific PCR primers. We developed a DNA extraction and purificati...

  16. Development of allele-specific PCR and RT-PCR assays for clustered resistance genes using a potato late blight resistance transgene as a model.

    PubMed

    Millett, B P; Bradeen, J M

    2007-02-01

    Members of the NBS-LRR gene family impart resistance to a wide variety of pathogens and are often found clustered within a plant genome. This clustering of homologous sequences can complicate PCR-based characterizations, especially the study of transgenes. We have developed allele-specific PCR and RT-PCR assays for the potato late blight resistance gene RB. Our assay utilizes two approaches toward primer design, allowing discrimination between the RB transgene and both the endogenous RB gene and numerous RB homeologs. First, a reverse primer was designed to take advantage of an indel present in the RB transgene but absent in rb susceptibility alleles, enhancing specificity for the transgene, though not fully discriminating against RB homeologs. Second, a forward primer was designed according to the principles of mismatch amplification mutation assay (MAMA) PCR, targeting SNPs introduced during the cloning of RB. Together, the indel reverse primer and the MAMA forward primer provide an assay that is highly specific for the RB transgene, being capable of distinguishing the transgene from all RB endogenous gene copies and from all RB paralogs in a diverse collection of wild and cultivated potato genotypes. These primers have been successfully multiplexed with primers of an internal control. The multiplexed assay is useful for both PCR and RT-PCR applications. Double MAMA-PCR, in which both PCR primers target separate transgene-specific SNPs, was also tested and shown to be equally specific for the RB transgene. We propose extending the use of MAMA for the characterization of resistance transgenes. PMID:17177064

  17. Branched modular primers in DNA sequencing

    SciTech Connect

    Mugasimangalam, R.C.; Shmulevitz, M. |; Ramanathan, V.

    1997-08-01

    The need to synthesize new sequencing primers, such as in primer walking, can be eliminated by assembling modular primers from oligonucleotide modules selected from presynthesized libraries. Our earlier modular primers consisted of 5-mers, 6-mers or 7-mers, annealing to the template contiguously with each other. Here we introduce a novel {open_quotes}branched{close_quotes} type of modular primer with a distinctly different specificity mechanism. The concept of a {open_quotes}branched{close_quotes} primer involves modules that are physically linked by annealing to each other as well as to the target, forming a branched structure of the 3-way junction type. While contiguous modular primers are made specific by the preference of the polymerase for longer primer, branched primers, in contrast, owe their specificity to cooperative annealing of their modules to the intended site on the template. This cooperativity of annealing to the template is provided by mutually complementary segments in the two modules that bind each other. Thus the primer-template complex is no longer limited to linear sequences, but acquires another, second dimension giving the modular primer new functionality.

  18. Water based adhesive primers on aluminum substrates

    SciTech Connect

    Wightman, J.P.; Mori, S.

    1996-12-31

    The number of aluminum alloy bonding applications has been increasing recently in the automobile industry. Primer coating of aluminum substrates is one of the main processes used to promote bond performance. Solvent based organic primers have been used for a long time but environmental regulations now require the substitution of volatile organic compounds (VOC) by alternate materials such as water based adhesive primers. However, the bond strengths obtained with many water based primers are generally lower than for solvent based ones. Water based primers which have some reactive functional groups have been proposed recently but such primers require special treatment. This paper describes a study conducted to optimize bond strength using a water based adhesive as a primer in the adhesive bonding of anodized aluminum.

  19. Real-time PCR detection chemistry.

    PubMed

    Navarro, E; Serrano-Heras, G; Castaño, M J; Solera, J

    2015-01-15

    Real-time PCR is the method of choice in many laboratories for diagnostic and food applications. This technology merges the polymerase chain reaction chemistry with the use of fluorescent reporter molecules in order to monitor the production of amplification products during each cycle of the PCR reaction. Thus, the combination of excellent sensitivity and specificity, reproducible data, low contamination risk and reduced hand-on time, which make it a post-PCR analysis unnecessary, has made real-time PCR technology an appealing alternative to conventional PCR. The present paper attempts to provide a rigorous overview of fluorescent-based methods for nucleic acid analysis in real-time PCR described in the literature so far. Herein, different real-time PCR chemistries have been classified into two main groups; the first group comprises double-stranded DNA intercalating molecules, such as SYBR Green I and EvaGreen, whereas the second includes fluorophore-labeled oligonucleotides. The latter, in turn, has been divided into three subgroups according to the type of fluorescent molecules used in the PCR reaction: (i) primer-probes (Scorpions, Amplifluor, LUX, Cyclicons, Angler); (ii) probes; hydrolysis (TaqMan, MGB-TaqMan, Snake assay) and hybridization (Hybprobe or FRET, Molecular Beacons, HyBeacon, MGB-Pleiades, MGB-Eclipse, ResonSense, Yin-Yang or displacing); and (iii) analogues of nucleic acids (PNA, LNA, ZNA, non-natural bases: Plexor primer, Tiny-Molecular Beacon). In addition, structures, mechanisms of action, advantages and applications of such real-time PCR probes and analogues are depicted in this review.

  20. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    PubMed

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed.

  1. One-step PCR amplification of complete arthropod mitochondrial genomes.

    PubMed

    Hwang, U W; Park, C J; Yong, T S; Kim, W

    2001-06-01

    A new PCR primer set which enables one-step amplification of complete arthropod mitochondrial genomes was designed from two conserved 16S rDNA regions for the long PCR technique. For this purpose, partial 16S rDNAs amplified with universal primers 16SA and 16SB were newly sequenced from six representative arthropods: Armadillidium vulgare and Macrobrachium nipponense (Crustacea), Anopheles sinensis (Insecta), Lithobius forficatus and Megaphyllum sp. (Myriapoda), and Limulus polyphemus (Chelicerata). The genomic locations of two new primers, HPK16Saa and HPK16Sbb, correspond to positions 13314-13345 and 12951-12984, respectively, in the Drosophila yakuba mitochondrial genome. The usefulness of the primer set was experimentally examined and confirmed with five of the representative arthropods, except for A. vulgare, which has a linearized mitochondrial genome. With this set, therefore, we could easily and rapidly amplify complete mitochondrial genomes with small amounts of arthropod DNA. Although the primers suggested here were examined only with arthropod groups, a possibility of successful application to other invertebrates is very high, since the high degree of sequence conservation is shown on the primer sites in other invertebrates. Thus, this primer set can serve various research fields, such as molecular evolution, population genetics, and molecular phylogenetics based on DNA sequences, RFLP, and gene rearrangement of mitochondrial genomes in arthropods and other invertebrates. PMID:11399145

  2. In silico vs in vitro analysis of primer specificity for the detection of Gardnerella vaginalis, Atopobium vaginae and Lactobacillus spp.

    PubMed Central

    2012-01-01

    Background Bacterial vaginosis (BV) is a common pathology of women in reproductive age that can lead to serious health complications, and is associated with shifts in the normal microflora from predominance of Lactobacillus spp. to a proliferation of other anaerobes such as G. vaginalis and A vaginae, which can be detected by PCR. The optimal PCR pathogen detection assay relies mainly on the specificity and sensitivity of the primers used. Findings Here we demonstrate that in silico analytical testing of primer specificity is not a synonym to in vitro analytical specificity by testing a range of published and newly designed primers with both techniques for the detection of BV-associated microorganisms. Conclusions By testing primer in vitro specificity with a sufficient range of bacterial strains, we were able to design primers with higher specificity and sensitivity. Also by comparing the results obtained for the newly designed primers with other previously published primers, we confirmed that in silico analysis is not sufficient to predict in vitro specificity. As such care must be taken when choosing the primers for a detection assay. PMID:23153093

  3. Detection of flaviviruses by reverse transcriptase-polymerase chain reaction with the universal primer set.

    PubMed

    Meiyu, F; Huosheng, C; Cuihua, C; Xiaodong, T; Lianhua, J; Yifei, P; Weijun, C; Huiyu, G

    1997-01-01

    Using a universal primer set designed to match the sequence of the NS1 gene of flaviviruses, the virus RNA of dengue (DEN), Japanese encephalitis (JEV), powassan and langat of Flaviviridae were successfully amplified by polymerase chain reaction (PCR) via cDNA; and with different internal primers, the serotypes of the dengue viruses were identified. Of the 78 clinically diagnosed dengue fever patients, 18 patients were positive for DEN 1, 48 patients for DEN 2 and 8 patients concurrently infected with DEN 4. Of the 52 patients admitted with Japanese encephalitis (JE), 45 were determined to be JEV infections. By nested PCR, we completed the identification of flaviviruses within 2 days. The results show that seven primers have a potential value for rapid clinical diagnosis of flavivirus infections.

  4. Abridged adapter primers increase the target scope of Hi-Plex.

    PubMed

    Nguyen-Dumont, Tú; Hammet, Fleur; Mahmoodi, Maryam; Pope, Bernard J; Giles, Graham G; Hopper, John L; Southey, Melissa C; Park, Daniel J

    2015-01-01

    Previously, we reported Hi-Plex, an amplicon-based method for targeted massively parallel sequencing capable of generating 60 amplicons simultaneously. In further experiments, however, we found our approach did not scale to higher amplicon numbers. Here, we report a modification to the original Hi-Plex protocol that includes the use of abridged adapter oligonucleotides as universal primers (bridge primers) in the initial PCR mixture. Full-length adapter primers (indexing primers) are included only during latter stages of thermal cycling with concomitant application of elevated annealing temperatures. Using this approach, we demonstrate the application of Hi-Plex across a broad range of amplicon numbers (16-plex, 62-plex, 250-plex, and 1003-plex) while preserving the low amount (25 ng) of input DNA required.

  5. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

    PubMed

    Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

  6. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    PubMed Central

    Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  7. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

    PubMed

    Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  8. Sample Return Primer and Handbook

    NASA Technical Reports Server (NTRS)

    Barrow, Kirk; Cheuvront, Allan; Faris, Grant; Hirst, Edward; Mainland, Nora; McGee, Michael; Szalai, Christine; Vellinga, Joseph; Wahl, Thomas; Williams, Kenneth; Lee, Gentry; Duxbury, Thomas

    2007-01-01

    This three-part Sample Return Primer and Handbook provides a road map for conducting the terminal phase of a sample return mission. The main chapters describe element-by-element analyses and trade studies, as well as required operations plans, procedures, contingencies, interfaces, and corresponding documentation. Based on the experiences of the lead Stardust engineers, the topics include systems engineering (in particular range safety compliance), mission design and navigation, spacecraft hardware and entry, descent, and landing certification, flight and recovery operations, mission assurance and system safety, test and training, and the very important interactions with external support organizations (non-NASA tracking assets, landing site support, and science curation).

  9. Blocking primers reduce co-amplification of plant DNA when studying bacterial endophyte communities.

    PubMed

    Arenz, Brett E; Schlatter, Dan C; Bradeen, James M; Kinkel, Linda L

    2015-10-01

    A blocking primer set based on the technique described by Vestheim and Jarman (2008) was developed to reduce amplification of non-target plant DNA when conducting metagenomic studies on bacterial endophyte communities. Bacterial amplification efficiency was increased 300-fold compared to standard PCR in an Illumina-based study of Sorghastrum nutans leaves.

  10. Pyrosequencing protocol using a universal biotinylated primer for mutation detection and SNP genotyping.

    PubMed

    Royo, Jose Luis; Hidalgo, Manuel; Ruiz, Agustin

    2007-01-01

    DNA sequencing has markedly changed the nature of biomedical research, identifying millions of polymorphisms along the human genome that now require further analysis to study the genetic basis of human diseases. Among the DNA-sequencing platforms available, Pyrosequencing has become a useful tool for medium-throughput single nucleotide polymorphism (SNP) genotyping, mutation detection, copy-number studies and DNA methylation analysis. Its 96-well genotyping format allows reliable results to be obtained at reasonable costs in a few minutes. However, a specific biotinylated primer is usually required for each SNP under study to allow the capture of single-stranded DNA template for the Pyrosequencing assay. Here, we present an alternative to the standard labeling of PCR products for analysis by Pyrosequencing that circumvents the requirement of specific biotinylated primers for each SNP of interest. This protocol uses a single biotinylated primer that is simultaneously incorporated into all M13-tagged PCR products during the amplification reaction. The protocol covers all steps from the PCR amplification and capture of single-stranded template, its preparation, and the Pyrosequencing assay itself. Once the correct primer stoichiometry has been determined, the assay takes around 2 h for PCR amplification, followed by 15-20 min (per plate) to obtain the genotypes.

  11. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens.

    PubMed

    Aremu, Bukola Rhoda; Babalola, Olubukola Oluranti

    2015-10-01

    Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI). These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi) and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation. PMID:26437427

  12. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    PubMed Central

    Aremu, Bukola Rhoda; Babalola, Olubukola Oluranti

    2015-01-01

    Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI). These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi) and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation. PMID:26437427

  13. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens.

    PubMed

    Aremu, Bukola Rhoda; Babalola, Olubukola Oluranti

    2015-09-30

    Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI). These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi) and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation.

  14. Effect of primers on bonding agent polymerization.

    PubMed

    Hotta, M; Kondoh, K; Kamemizu, H

    1998-10-01

    The aim of the present study was to evaluate the effect of primers on the polymerization of bonding agent. We measured the degree of conversion (radical production) and mechanical properties (surface hardness and direct tensile strength) of various adhesives/primers mixed at different ratios and the effect of varying the visible-light curing time. With and without primer treatment, the tensile bond strength of adhesive resin to micacious glass ceramic and human enamel was measured. After the tensile bond test, using the Image Capture System, the failure patterns of adhesive resin bonded to micacious glass-ceramic were analysed. The results show that the mixtures containing the higher amounts of primer yielded a lower degree of conversion and inferior mechanical properties when compared with the mixtures containing a lower proportion of primer, except in the experimental bonding system. The adhesive/primer mixtures inhibited free radical polymerization. The value for the Knoop hardness number and the direct tensile strength of the adhesive/primer mixtures were significantly decreased compared with those of the adhesive bonding agent alone with no primer added. The tensile bond strength of adhesive resin bonded to micacious glass-ceramic or human enamel without primer treatment was significantly greater than that of adhesive resin with primer treatment in certain cases. Most of the fractures of ceramic surfaces were cohesive (within resins) and/or interface (at the ceramic surface) failure.

  15. Use of PCR-based methods for rapid differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis.

    PubMed

    Torriani, S; Zapparoli, G; Dellaglio, F

    1999-10-01

    Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.

  16. Design and Validation of Four New Primers for Next-Generation Sequencing To Target the 18S rRNA Genes of Gastrointestinal Ciliate Protozoa

    PubMed Central

    Wright, André-Denis G.

    2014-01-01

    Four new primers and one published primer were used to PCR amplify hypervariable regions within the protozoal 18S rRNA gene to determine which primer pair provided the best identification and statistical analysis. PCR amplicons of 394 to 498 bases were generated from three primer sets, sequenced using Roche 454 pyrosequencing with Titanium, and analyzed using the BLAST database (NCBI) and MOTHUR version 1.29. The protozoal diversity of rumen contents from moose in Alaska was assessed. In the present study, primer set 1, P-SSU-316F and GIC758R (amplicon of 482 bases), gave the best representation of diversity using BLAST classification, and the set amplified Entodinium simplex and Ostracodinium spp., which were not amplified by the other two primer sets. Primer set 2, GIC1080F and GIC1578R (amplicon of 498 bases), had similar BLAST results and a slightly higher percentage of sequences that were identified with a higher sequence identity. Primer sets 1 and 2 are recommended for use in ruminants. However, primer set 1 may be inadequate to determine protozoal diversity in nonruminants. The amplicons created by primer set 1 were indistinguishable for certain species within the genera Bandia, Blepharocorys, Polycosta, and Tetratoxum and between Hemiprorodon gymnoprosthium and Prorodonopsis coli, none of which are normally found in the rumen. PMID:24973070

  17. Design and validation of four new primers for next-generation sequencing to target the 18S rRNA genes of gastrointestinal ciliate protozoa.

    PubMed

    Ishaq, Suzanne L; Wright, André-Denis G

    2014-09-01

    Four new primers and one published primer were used to PCR amplify hypervariable regions within the protozoal 18S rRNA gene to determine which primer pair provided the best identification and statistical analysis. PCR amplicons of 394 to 498 bases were generated from three primer sets, sequenced using Roche 454 pyrosequencing with Titanium, and analyzed using the BLAST database (NCBI) and MOTHUR version 1.29. The protozoal diversity of rumen contents from moose in Alaska was assessed. In the present study, primer set 1, P-SSU-316F and GIC758R (amplicon of 482 bases), gave the best representation of diversity using BLAST classification, and the set amplified Entodinium simplex and Ostracodinium spp., which were not amplified by the other two primer sets. Primer set 2, GIC1080F and GIC1578R (amplicon of 498 bases), had similar BLAST results and a slightly higher percentage of sequences that were identified with a higher sequence identity. Primer sets 1 and 2 are recommended for use in ruminants. However, primer set 1 may be inadequate to determine protozoal diversity in nonruminants. The amplicons created by primer set 1 were indistinguishable for certain species within the genera Bandia, Blepharocorys, Polycosta, and Tetratoxum and between Hemiprorodon gymnoprosthium and Prorodonopsis coli, none of which are normally found in the rumen.

  18. A mathematical model and a computerized simulation of PCR using complex templates.

    PubMed Central

    Rubin, E; Levy, A A

    1996-01-01

    A mathematical model and a computer simulation were used to study PCR specificity. The model describes the occurrences of non-targeted PCR products formed through random primer-template interactions. The PCR simulation scans DNA sequence databases with primers pairs. According to the model prediction, PCR with complex templates should rarely yield non-targeted products under typical reaction conditions. This is surprising as such products are often amplified in real PCR under conditions optimized for stringency. The causes for this 'PCR paradox' were investigated by comparing the model predictions with simulation results. We found that deviations from randomness in sequences from real genomes could not explain the frequent occurrence of non-targeted products in real PCR. The most likely explanation to the 'PCR paradox' is a relatively high tolerance of PCR to mismatches. The model also predicts that mismatch tolerance has the strongest effect on the number of non-targeted products, followed by primer length, template size and product size limit. The model and the simulation can be utilized for PCR studies, primer design and probing DNA uniqueness and randomness. PMID:8836180

  19. Biased Diversity Metrics Revealed by Bacterial 16S Pyrotags Derived from Different Primer Sets

    PubMed Central

    Cai, Lin; Ye, Lin; Tong, Amy Hin Yan; Lok, Si; Zhang, Tong

    2013-01-01

    In recent years, PCR-based pyrosequencing of 16S rRNA genes has continuously increased our understanding of complex microbial communities in various environments of the Earth. However, there is always concern on the potential biases of diversity determination using different 16S rRNA gene primer sets and covered regions. Here, we first report how bacterial 16S rRNA gene pyrotags derived from a series of different primer sets resulted in the biased diversity metrics. In total, 14 types of pyrotags were obtained from two-end pyrosequencing of 7 amplicon pools generated by 7 primer sets paired by 1 of 4 forward primers (V1F, V3F, V5F, and V7F) and 1 of 4 reverse primers (V2R, V4R, V6R, and V9R), respectively. The results revealed that: i) the activated sludge exhibited a large bacterial diversity that represented a broad range of bacterial populations and served as a good sample in this methodology research; ii) diversity metrics highly depended on the selected primer sets and covered regions; iii) paired pyrotags obtained from two-end pyrosequencing of each short amplicon displayed different diversity metrics; iv) relative abundance analysis indicated the sequencing depth affected the determination of rare bacteria but not abundant bacteria; v) the primer set of V1F and V2R significantly underestimated the diversity of activated sludge; and vi) the primer set of V3F and V4R was highly recommended for future studies due to its advantages over other primer sets. All of these findings highlight the significance of this methodology research and offer a valuable reference for peer researchers working on microbial diversity determination. PMID:23341963

  20. The novel primers for sex identification in the brown eared-pheasant and their application to other species.

    PubMed

    Wang, N; Zhang, Z-W

    2009-01-01

    We designed a pair of primers for sex identification in the brown eared-pheasant (Crossoptilon mantchuricum) based on the mechanism of PCR amplification of CHD fragments, and identified the number of products. The new primers were considered to have more sensitivity than P2/P8, and cross-species application indicated that they can also be used for sex identification in other species of Phasianidae and Passeriformes.

  1. Detection of the glmM Gene in Helicobacter pylori Isolates with a Novel Primer by PCR▿

    PubMed Central

    Córdova Espinoza, Maria Guadalupe; González Vazquez, Rosa; Morales Mendez, Iyari; Ruelas Vargas, Consuelo; Giono Cerezo, Silvia

    2011-01-01

    A novel reverse primer (GLM MR1) was designed for detection of the glmM gene in Helicobacter pylori by PCR. The percentage of amplification in clinical isolates using GLM MR1 was 100% for detection of the glmM gene and 86.36% for the ureA gene. The primer designed is useful for the identification of H. pylori. PMID:21289140

  2. Linear elastic fracture mechanics primer

    NASA Technical Reports Server (NTRS)

    Wilson, Christopher D.

    1992-01-01

    This primer is intended to remove the blackbox perception of fracture mechanics computer software by structural engineers. The fundamental concepts of linear elastic fracture mechanics are presented with emphasis on the practical application of fracture mechanics to real problems. Numerous rules of thumb are provided. Recommended texts for additional reading, and a discussion of the significance of fracture mechanics in structural design are given. Griffith's criterion for crack extension, Irwin's elastic stress field near the crack tip, and the influence of small-scale plasticity are discussed. Common stress intensities factor solutions and methods for determining them are included. Fracture toughness and subcritical crack growth are discussed. The application of fracture mechanics to damage tolerance and fracture control is discussed. Several example problems and a practice set of problems are given.

  3. A Practical Primer on Geostatistics

    USGS Publications Warehouse

    Olea, Ricardo A.

    2009-01-01

    significant methodological implications. HISTORICAL REMARKS As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields. PIONEERS Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorology CALCULATIONS Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations. SOFTWARE For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics. ORGANIZATION OF THE PRIMER The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of th

  4. Monitoring gene expression: quantitative real-time rt-PCR.

    PubMed

    Wagner, Elke M

    2013-01-01

    Two-step quantitative real-time RT-PCR (RT-qPCR), also known as real-time RT-PCR, kinetic RT-PCR, or quantitative fluorescent RT-PCR, has become the method of choice for gene expression analysis during the last few years. It is a fast and convenient PCR method that combines traditional RT-PCR with the phenomenon of fluorescence resonance energy transfer (FRET) using fluorogenic primers. The detection of changes in fluorescence intensity during the reaction enables the user to follow the PCR reaction in real time.RT-qPCR comprises several steps: (1) RNA is isolated from target tissue/cells; (2) mRNA is reverse-transcribed to cDNA; (3) modified gene-specific PCR primers are used to amplify a segment of the cDNA of interest, following the reaction in real time; and (4) the initial concentration of the selected transcript in a specific tissue or cell type is calculated from the exponential phase of the reaction. Relative quantification or absolute quantification compared to standards that are run in parallel can be performed.This chapter describes the entire procedure from isolation of total RNA from liver and fatty tissues/cells to the use of RT-qPCR to study gene expression in these tissues. We perform relative quantification of transcripts to calculate the fold-difference of a certain mRNA level between different samples. In addition, tips for choosing primers and performing analyses are provided to help the beginner in understanding the technique.

  5. Application of real time PCR for diagnosis of Swine Dysentery.

    PubMed

    Akase, Satoru; Uchitani, Yumi; Sohmura, Yoshiko; Tatsuta, Keikichi; Sadamasu, Kenji; Adachi, Yoshikazu

    2009-03-01

    Evaluation of a genetic diagnostic technique using real time PCR of Swine Dysentery (SD) was performed using nox primers. Culture, ordinary PCR and real time PCR were compared in this experiment. Sixty-seven specimens from pigs with clinical signs of SD brought to a slaughterhouse in Shibaura, Tokyo, were used. B. hyodysenteriae was isolated from 49 of the pigs, was detected by ordinary PCR in 49 of the pigs and was detected by real time PCR in 54 of the pigs. Furthermore, we were able to determine the numbers of B. hyodysenteriae cells in all positive specimens by real time PCR. The rapid diagnostic technique established in this experiment was useful for detection of B. hyodysenteriae because it was more effective than ordinary PCR and culture.

  6. Specific Polymerase Chain Reaction Primers for the Detection of Plasmodiophora brassicae in Soil and Water.

    PubMed

    Faggian, R; Bulman, S R; Lawrie, A C; Porter, I J

    1999-05-01

    ABSTRACT The development of specific oligonucleotide primers for Plasmodiophora brassicae has led to a nested polymerase chain reaction (PCR) detection method for P. brassicae in soil and water. Initially, the PCR was used to amplify a section of the rDNA repeat. The PCR products were sequenced and the data used to design primers that were directed at the ribosomal RNA genes and internal transcribed spacer regions. Specificity was tested against more than 40 common soil organisms, host plants, and spore suspension contaminants, as well as P. brassicae isolates from around Australia and the world. Sensitivity was determined to be 0.1 fentograms (fg; 10(-15) g) for pure template and as low as 1,000 spores per g of potting mix. In soil, P. brassicae was detected in all soils where the inoculum was sufficient to result in clubroot symptoms. Also outlined is a simple method of DNA extraction from soil. PMID:18944752

  7. Genus-Specific Primers for Study of Fusarium Communities in Field Samples.

    PubMed

    Karlsson, Ida; Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-10-30

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology.

  8. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    PubMed

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode.

  9. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    PubMed Central

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  10. Improved sensitivity of PCR for Chlamydophila using pmp genes.

    PubMed

    Laroucau, K; Souriau, A; Rodolakis, A

    2001-09-20

    Primers targeting the conserved pmp gene family of Chlamydophila abortus were evaluated for their ability to improve the polymerase chain reaction (PCR) sensitivity. In purified DNA, specific pmp primers (named CpsiA and CpsiB) allowed at least a 10-fold increase of the PCR sensitivity compared to the specific ompA primers for C. abortus, but also for C. psittaci and C. caviae strains. No amplification was observed on C. felis, C. pecorum, C. pneumoniae and Chlamydia trachomatis strains. Tested on contaminated specimens such as genital swabs, the PCR sensitivity observed with CpsiA/CpsiB was also better than with the ompA primers. This study demonstrated that these specific pmp primers could serve as valuable, sensitive and common tools for a specific Chlamydophila diagnosis in ruminant, avian and human diseases. Digestion by AluI of the CpsiA/CpsiB fragments allowed a specific discrimination of the strains in function of their hosts and/or their serotypes.

  11. Modeling PCR in Natural Convection Systems

    NASA Astrophysics Data System (ADS)

    Dorfman, Kevin; Yariv, Ehud; Ben Dov, Guy

    2007-03-01

    Polymerase chain reaction (PCR) is a biochemical protocol for making many copies of a DNA template by thermal cycling between a hot temperature (where the strands are separated) and a cool temperature (where primers are annealed). In natural convection PCR, the requisite thermal cycling is provided by a buoyancy-driven circulating flow of the carrying buffer between a lower hot plate (at the denaturing temperature) and an upper cold plate (at the annealing temperature). We present a multi-component convection-diffusion-reaction model for natural convection-driven PCR when both primers and PCR enzyme are in excess. The evolution of the DNA population achieves a stationary state, wherein the problem is recast as an eigenvalue problem for computing the exponential amplification rate. With a realistic choice of parameters, the model predicts a doubling time on the order of two minutes, in agreement with experiments and much slower than the fluid cycling time. In contrast to what might be expected, the doubling time increases monotonically with the diffusion coefficient.

  12. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on...

  13. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on...

  14. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on...

  15. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-UNDERGROUND METAL AND NONMETAL MINES Explosives... primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters) in... of water to protect the primer from impact. Slit packages of prill, water gel, or emulsions are...

  16. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-SURFACE METAL AND NONMETAL MINES Explosives Use § 56.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... impact. Slit packages of prill, water gel, or emulsions are not considered rigid cartridges and may...

  17. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-SURFACE METAL AND NONMETAL MINES Explosives Use § 56.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... impact. Slit packages of prill, water gel, or emulsions are not considered rigid cartridges and may...

  18. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-UNDERGROUND METAL AND NONMETAL MINES Explosives... primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters) in... of water to protect the primer from impact. Slit packages of prill, water gel, or emulsions are...

  19. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys

    SciTech Connect

    Walters , William; Hyde, Embriette R.; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada , Alma; Gilbert, Jack A.; Jansson, Janet K.; Caporaso, Greg; Fuhrman, Jed A.; Apprill, Amy; Knight, Rob

    2015-12-22

    Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of datasets amplified with varied primers requires attention. Here we examine the performance of modified 16S rRNA gene and ITS primers for archaea/bacteria and fungi, respectively, with non-aquatic samples. We moved primer barcodes to the 5’-end, allowing for a range of different 3’ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4-5 of the 16S rRNA gene. We additionally demonstrate that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection of Thaumarchaeota and SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies.

  20. Electrostatic Discharge testing of propellants and primers

    SciTech Connect

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  1. Primer and platform effects on 16S rRNA tag sequencing

    DOE PAGES

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  2. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    PubMed

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  3. Primer and platform effects on 16S rRNA tag sequencing

    SciTech Connect

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as well as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.

  4. Species identification of cattle and buffalo fat through PCR assay.

    PubMed

    Vaithiyanathan, S; Kulkarni, V V

    2016-04-01

    A method was standardized to isolate quality DNA from cattle and buffalo fat for species identification using QIAamp DNA stool mini kit. The quality of the DNA was sufficient enough to amplify universal primers viz., mt 12S rRNA and mt 16S rRNA, and species specific D loop primers for cattle and buffalo. The sensitivity of the PCR assay in the species specific D loop primer amplification was with a detection level of 0. 47 ng cattle DNA and 0.23 ng buffalo DNA in simplex and, 0. 47 ng cattle DNA and 0.12 ng buffalo DNA in duplex PCR. It is a potentially reliable method for DNA detection to authenticate animal fat. PMID:27413237

  5. Reverse-transcription PCR (RT-PCR).

    PubMed

    Bachman, Julia

    2013-01-01

    RT-PCR is commonly used to test for genetic diseases and to characterize gene expression in various tissue types, cell types, and over developmental time courses. This serves as a form of expression profiling, but typically as a candidate approach. RT-PCR is also commonly used to clone cDNAs for further use with other molecular biology techniques (e.g., see Oligo(dT)-primed RT-PCR isolation of polyadenylated RNA degradation intermediates and Circularized RT-PCR (cRT-PCR): analysis of RNA 5' ends, 3' ends, and poly(A) tails).

  6. SBE primer : multiplexing minisequencing-based genotyping

    SciTech Connect

    Kaderali, L.; Deshpande, A.; Uribe-Romeo, F. J.; Schliep, A.; Torney, D. C.

    2002-01-01

    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Most of the known genetic diseases are caused by point mutations, and a growing number of SNPs will be routinely analyzed to diagnose genetic disorders. Mutation analysis by polymerase mediated single-base primer extension (minisequencing) can be massively parallelized using for example DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5-inch end of the minisequencing primer and attaching the complementary anti-tag to the array or bead surface, the assay can be 'demultiplexed'. However, such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. Primers can be chosen from either the plus or the minus strand, and primers used in the same experiment must not bind to one another. To genotype a given number of polymorphic sites, the question is which primer to use for each SNP, and which primers to group into the same experiment. Furthermore, a crosshybridization-free tag/anti-tag code is required in order to sort the extended primers to the corresponding microspheres or chip spots. These problems pose challenging algorithmic questions. We present a computer program lo automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/anti-tag system is generated, and the pairing of primers and DNA-Tags is automatically done in a way to avoid any crossreactivity. We report first results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping.

  7. Oligoribonucleotide (ORN) interference-PCR (ORNi-PCR): a simple method for suppressing PCR amplification of specific DNA sequences using ORNs.

    PubMed

    Tanigawa, Naoki; Fujita, Toshitsugu; Fujii, Hodaka

    2014-01-01

    Polymerase chain reaction (PCR) amplification of multiple templates using common primers is used in a wide variety of molecular biological techniques. However, abundant templates sometimes obscure the amplification of minor species containing the same primer sequences. To overcome this challenge, we used oligoribonucleotides (ORNs) to inhibit amplification of undesired template sequences without affecting amplification of control sequences lacking complementarity to the ORNs. ORNs were effective at very low concentrations, with IC50 values for ORN-mediated suppression on the order of 10 nM. DNA polymerases that retain 3'-5' exonuclease activity, such as KOD and Pfu polymerases, but not those that retain 5'-3' exonuclease activity, such as Taq polymerase, could be used for ORN-mediated suppression. ORN interference-PCR (ORNi-PCR) technology should be a useful tool for both molecular biology research and clinical diagnosis.

  8. Multiplex PCR Method for Identifying Recombinant Vaccine-Related Polioviruses

    PubMed Central

    Kilpatrick, David R.; Ching, Karen; Iber, Jane; Campagnoli, Ray; Freeman, Christopher J.; Mishrik, Nada; Liu, Hong-Mei; Pallansch, Mark A.; Kew, Olen M.

    2004-01-01

    The recent discovery of recombinant circulating vaccine-derived poliovirus (recombinant cVDPV) has highlighted the need for enhanced global poliovirus surveillance to assure timely detection of any future cVDPV outbreaks. Six pairs of Sabin strain-specific recombinant primers were designed to permit rapid screening for VDPV recombinants by PCR. PMID:15365031

  9. MRI Biosensors: A Short Primer

    PubMed Central

    Louie, Angelique

    2013-01-01

    Interest in Magnetic Resonance Imaging (MRI) contrast agents for molecular imaging of biological function experienced a surge of excitement approximately 20 years ago with the development of the first activatable contrast agents that could act as biosensors and turn “on” in response to a specific biological activity. This brief tutorial, based on a short course lecture from the 2011 ISMRM meeting, provides an overview of underlying principles governing the design of biosensing contrast agents. We describe mechanisms by which a magnetic resonance imaging (MRI) contrast agent can be made into a sensor for both T1 and T2 types contrast agents. Examples of biological activities that can interact with a contrast agent are discussed using specific examples from the recent literature to illustrate the primary mechanisms of action that have been utilized to achieve activation. MRI sensors for pH, ion binding, enzyme cleavage, and oxidation-reduction are presented. This article is not meant to be an exhaustive review, but an illustrative primer to explain how activation can be achieved for an MRI contrast agent. Chemical exchange saturation transfer (CEST) is not covered as these agents were covered in a separate lecture. PMID:23996662

  10. Climate change primer for respirologists.

    PubMed

    Takaro, Tim K; Henderson, Sarah B

    2015-01-01

    Climate change is already affecting the cardiorespiratory health of populations around the world, and these impacts are expected to increase. The present overview serves as a primer for respirologists who are concerned about how these profound environmental changes may affect their patients. The authors consider recent peer-reviewed literature with a focus on climate interactions with air pollution. They do not discuss in detail cardiorespiratory health effects for which the potential link to climate change is poorly understood. For example, pneumonia and influenza, which affect >500 million people per year, are not addressed, although clear seasonal variation suggests climate-related effects. Additionally, large global health impacts in low-resource countries, including migration precipitated by environmental change, are omitted. The major cardiorespiratory health impacts addressed are due to heat, air pollution and wildfires, shifts in allergens and infectious diseases along with respiratory impacts from flooding. Personal and societal choices about carbon use and fossil energy infrastructure should be informed by their impacts on health, and respirologists can play an important role in this discussion.

  11. Specific PCR and real-time PCR assays for detection and quantitation of 'Candidatus Phytoplasma phoenicium'.

    PubMed

    Jawhari, Maan; Abrahamian, Peter; Sater, Ali Abdel; Sobh, Hana; Tawidian, Patil; Abou-Jawdah, Yusuf

    2015-02-01

    Almond witches' broom (AlmWB) is a fast-spreading lethal disease of almond, peach and nectarine associated with 'Candidatus Phytoplasma phoenicium'. The development of PCR and quantitative real-time PCR (qPCR) assays for the sensitive and specific detection of the phytoplasma is of prime importance for early detection of 'Ca. P. phoenicium' and for epidemiological studies. The developed qPCR assay herein uses a TaqMan(®) probe labeled with Black Hole Quencher Plus. The specificity of the PCR and that of the qPCR detection protocols were tested on 17 phytoplasma isolates belonging to 11 phytoplasma 16S rRNA groups, on samples of almond, peach, nectarine, native plants and insects infected or uninfected with the phytoplasma. The developed assays showed high specificity against 'Ca. P. phoenicium' and no cross-reactivity against any other phytoplasma, plant or insect tested. The sensitivity of the developed PCR and qPCR assays was similar to the conventional nested PCR protocol using universal primers. The qPCR assay was further validated by quantitating AlmWB phytoplasma in different hosts, plant parts and potential insect vectors. The highest titers of 'Ca. P. phoenicium' were detected in the phloem tissues of stems and roots of almond and nectarine trees, where they averaged from 10(5) to 10(6) genomic units per nanogram of host DNA (GU/ng of DNA). The newly developed PCR and qPCR protocols are reliable, specific and sensitive methods that are easily applicable to high-throughput diagnosis of AlmWB in plants and insects and can be used for surveys of potential vectors and alternative hosts.

  12. [Identification for genetically modified maize T14/T25 with real time fluorescent PCR method].

    PubMed

    Cao, Ji-Juan; Qin, Wen; Zhu, Shui-Fang; Cao, Yuan-Yin

    2004-09-01

    To identify genetically modified (GM) maize T14/T25 lines, a real-time fluorescent PCR (RTF PCR) assay was performed in this study. Primers and Taqman probes specific for inserted genes in the T14/T25 were used to conduct the real-time fluorescent (RTF) PCR and PCR assays. The RTF PCR method was established to detect and identify GM maize lines. The results show that the TaqMan probe could identify T14/T25 maize used, while other GM and NO-GM maize didn't be detected. The RTF PCR could be a new method for detecting other genetically modified organism.

  13. Amplification of GB virus-C/hepatitis G virus RNA with primers from different regions of the viral genome.

    PubMed

    Kao, J H; Chen, P J; Chen, W; Hsiang, S C; Lai, M Y; Chen, D S

    1997-04-01

    GB virus-C/hepatitis G virus (GBV-C/HGV) is a newly identified RNA virus. The aim of the study was to compare three primer pairs from the 5' untranslated region (5'UTR), envelope region 2 (E 2) and nonstructural region 3 (NS 3) of GBV-C/HGV genome for their ability to detect GBV-C/HGV RNA by polymerase chain reaction (PCR) assays. By using PCR with primers from different regions of the viral genome, serum GBV-C/HGV RNA was assayed in 200 at-risk individuals. The sensitivity of this assay was assessed by a titration experiment, and nucleotide sequences of the amplified products were determined directly. Of 200 serum samples, 43 (21.5%) were positive for GBV-C/HGV RNA with at least one of the primer pairs. The positive rates by 5'UTR, NS 3, and E 2 primers were 100%, 98%, and 84%, respectively, and the sensitivity of PCR assays using 5'UTR primers was 10 to 100 times more likely to detect GBV-C/HGV RNA than that of NS 3 and E 2 primers. The average homology of amplified targets to the prototype HGV genome was 89%, 80%, and 85% and the similarity between each amplified target was up to 100%, 90%, and 92% in the 5'UTR, E 2, and NS 3 regions, respectively. Therefore, the 5'UTR of GBV-C/HGV genome is highly conserved and primers deduced from this region can provideva sensitive and specific PCR assay for GBV-C/HGV RNA.

  14. Primer on spontaneous heating and pyrophoricity

    SciTech Connect

    Not Available

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  15. PCR detection of uncultured rumen bacteria.

    PubMed

    Rosero, Jaime A; Strosová, Lenka; Mrázek, Jakub; Fliegerová, Kateřina; Kopečný, Jan

    2012-07-01

    16S rRNA sequences of ruminal uncultured bacterial clones from public databases were phylogenetically examined. The sequences were found to form two unique clusters not affiliated with any known bacterial species: cluster of unidentified sequences of free floating rumen fluid uncultured bacteria (FUB) and cluster of unidentified sequences of bacteria associated with rumen epithelium (AUB). A set of PCR primers targeting 16S rRNA of ruminal free uncultured bacteria and rumen epithelium adhering uncultured bacteria was designed based on these sequences. FUB primers were used for relative quantification of uncultured bacteria in ovine rumen samples. The effort to increase the population size of FUB group has been successful in sulfate reducing broth and culture media supplied with cellulose.

  16. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    PubMed

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast

  17. Sex Determination Using PCR

    ERIC Educational Resources Information Center

    Kima, Peter E.; Rasche, Madeline E.

    2004-01-01

    PCR has revolutionized many aspects of biochemistry and molecular biology research. In the following exercise, students learn PCR by isolating their own DNA, amplifying specific segments of the X and Y chromosomes, and estimating the sizes of the PCR products using agarose gel electrophoresis. Based on the pattern of PCR products, students can…

  18. Identification and characterization of dermatophyte species and strains with PCR amplification.

    PubMed

    Liu, Guofang; He, Chenghua; Zhang, Haibin

    2014-08-01

    The aim of the present study was to use two polymerase chain reaction (PCR) methods, with (GACA)4 and non-transcribed spacer (NTS) as primers, to identify and characterize dermatophyte isolates from dogs and cats to a species and strain level. A total of 45 isolates from nine dermatophyte species were collected from pet dogs and cats and subjected to PCR amplification with the microsatellite primer (GACA)4. Dermatophyte strains of three of the same species collected from four cities were subjected to PCR amplification with the NTS primer set. These two PCR methods were applied to identify and characterize the dermatophyte isolates to a species and strain level. Regional differences among the strain specificities were also examined. The results from PCR with (GACA)4 demonstrated that strains from the same species produced similar PCR product band patterns. In addition, these patterns differed among species, indicating that (GACA)4 primer-based PCR was able to distinguish between the various dermatophyte species. By contrast, dermatophyte isolates and/or strains within the same species revealed various band patterns with NTS-based PCR. In addition, the results indicated that regional differences contributed to the variations in PCR product band patterns. Therefore, the results of the present study indicate that the NTS-based PCR method is efficient in distinguishing dermatophytes to the strain level, while a combination of (GACA)4 and NTS primer-based PCR methods is able to clarify dermatophyte isolates to a species and strain level. The present study provides information concerning the identification of pathogenic fungi and the epidemiological characteristics of fungal skin diseases.

  19. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

    PubMed

    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

    2016-07-01

    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.

  20. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

    PubMed

    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

    2016-07-01

    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification. PMID:27086303

  1. Molecular diagnostics of the honey bee parasites Lotmaria passim and Crithidia spp. (Trypanosomatidae) using multiplex PCR

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lotmaria passim Schwarz is a recently described trypanosome parasite of honey bees in continental United States, Europe, and Japan. We developed a multiplex PCR technique using a PCR primer specific for L. passim to distinguish this species from C. mellificae. We report the presence of L. passim in ...

  2. Quantitative detection of Listeria monocytogenes in biofilms by real-time PCR.

    PubMed

    Guilbaud, Morgan; de Coppet, Pierre; Bourion, Fabrice; Rachman, Cinta; Prévost, Hervé; Dousset, Xavier

    2005-04-01

    A quantitative method based on a real-time PCR assay to enumerate Listeria monocytogenes in biofilms was developed. The specificity for L. monocytogenes of primers targeting the listeriolysin gene was demonstrated using a SYBR Green I real-time PCR assay. The number of L. monocytogenes detected growing in biofilms was 6 x 10(2) CFU/cm2.

  3. Single Laboratory Comparison of Quantitative Real-time PCR Assays for the Detection of Fecal Pollution

    EPA Science Inventory

    There are numerous quantitative real-time PCR (qPCR) assays available to detect and enumerate fecal pollution in ambient waters. Each assay employs distinct primers and probes that target different rRNA genes and microorganisms leading to potential variations in concentration es...

  4. Streamlining DNA Barcoding Protocols: Automated DNA Extraction and a New cox1 Primer in Arachnid Systematics

    PubMed Central

    Vidergar, Nina; Toplak, Nataša; Kuntner, Matjaž

    2014-01-01

    Background DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences—mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1)—are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1) improving an automated DNA extraction protocol, (2) testing the performance of commonly used primer combinations, and (3) developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. Methodology We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor—an automated high throughput DNA extraction system—and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. Results The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198) that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93%) matched that of C1-J-2183. Conclusions The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding. PMID:25415202

  5. Development of Quantitative Real-time PCR Assays for Different Clades of “Candidatus Accumulibacter”

    NASA Astrophysics Data System (ADS)

    Zhang, An Ni; Mao, Yanping; Zhang, Tong

    2016-05-01

    We designed novel quantitative real-time polymerase chain reaction (qPCR) primers for the polyphosphate kinase 1 (ppk1) gene, targeting eight individual “Candidatus Accumulibacter” (referred to as Accumulibacter) clades. An evaluation of primer sets was conducted regarding the coverage, specificity, and PCR efficiency. (i) All primer sets were designed to cover all available sequences of the target clade. (ii) The phylogenetic analysis of the sequences retrieved from the qPCR products by each primer set demonstrated a high level of specificity. (iii) All calibration curves presented high PCR efficiencies in the range of 85–112% (R2 = 0.962–0.998). In addition, the possible interference of non-target amplicons was individually examined using the qPCR assay for 13 Accumulibacter clades, which were either undetected or showed negligible detection. With the primers designed by other research groups, a highly selective and sensitive qPCR-based method was developed to quantify all Accumulibacter clades, with the exception of Clade IE, in one assay, which enables more comprehensive insights into the community dynamics. The applicability to environmental samples was demonstrated by profiling the Accumulibacter clades in activated sludge samples of nine full-scale wastewater treatment plants.

  6. Development of Quantitative Real-time PCR Assays for Different Clades of “Candidatus Accumulibacter”

    PubMed Central

    Zhang, An Ni; Mao, Yanping; Zhang, Tong

    2016-01-01

    We designed novel quantitative real-time polymerase chain reaction (qPCR) primers for the polyphosphate kinase 1 (ppk1) gene, targeting eight individual “Candidatus Accumulibacter” (referred to as Accumulibacter) clades. An evaluation of primer sets was conducted regarding the coverage, specificity, and PCR efficiency. (i) All primer sets were designed to cover all available sequences of the target clade. (ii) The phylogenetic analysis of the sequences retrieved from the qPCR products by each primer set demonstrated a high level of specificity. (iii) All calibration curves presented high PCR efficiencies in the range of 85–112% (R2 = 0.962–0.998). In addition, the possible interference of non-target amplicons was individually examined using the qPCR assay for 13 Accumulibacter clades, which were either undetected or showed negligible detection. With the primers designed by other research groups, a highly selective and sensitive qPCR-based method was developed to quantify all Accumulibacter clades, with the exception of Clade IE, in one assay, which enables more comprehensive insights into the community dynamics. The applicability to environmental samples was demonstrated by profiling the Accumulibacter clades in activated sludge samples of nine full-scale wastewater treatment plants. PMID:27142574

  7. PCR amplification on microarrays of gel immobilized oligonucleotides

    SciTech Connect

    Strizhkov, Boris; Tillib, Sergei; Mikhailovich, Vladimir; Mirzabekov, Andrei

    2003-11-04

    The invention relates two general methods for performing PCR amplification, combined with the detection and analysis of the PCR products on a microchip. In the first method, the amplification occurs both outside and within a plurality of gel pads on a microchip, with at least one oligonucleotide primer immobilized in a gel pad. In the second method, PCR amplification also takes place within gel pads on a microchip, but the pads are surrounded by a hydrophobic liquid such as that which separates the individual gel pads into environments which resemble micro-miniaturized test tubes.

  8. Methods for producing partially digested restriction DNA fragments and for producing a partially modified PCR product

    DOEpatents

    Wong, Kwong-Kwok

    2000-01-01

    The present invention is an improved method of making a partially modified PCR product from a DNA fragment with a polymerase chain reaction (PCR). In a standard PCR process, the DNA fragment is combined with starting deoxynucleoside triphosphates, a primer, a buffer and a DNA polymerase in a PCR mixture. The PCR mixture is then reacted in the PCR producing copies of the DNA fragment. The improvement of the present invention is adding an amount of a modifier at any step prior to completion of the PCR process thereby randomly and partially modifying the copies of the DNA fragment as a partially modified PCR product. The partially modified PCR product may then be digested with an enzyme that cuts the partially modified PCR product at unmodified sites thereby producing an array of DNA restriction fragments.

  9. Assessment of the specificity of Burkholderia and Pseudomonas qPCR assays for detection of these genera in soil using 454 pyrosequencing.

    PubMed

    Bergmark, Lasse; Poulsen, Pernille Hasse Busk; Al-Soud, Waleed Abu; Norman, Anders; Hansen, Lars Hestbjerg; Sørensen, Søren Johannes

    2012-08-01

    In this study, two highly specific quantitative PCR assays targeting the bacterial genera Burkholderia and Pseudomonas were developed and evaluated on soil samples. The primers were targeting different multivariate regions of the 16S rRNA gene and designed to be compatible with quantitative PCR and the high throughput 454 pyrosequencing technique. The developed assays were validated using the standard methods. All tests with the new developed assays showed very high specificity. Pyrosequencing was used for direct analysis of the PCR product and applied as a specificity measurement of the primers. The Pseudomonas primers showed a 99% primer specificity, which covered 200 different Pseudomonas sequence clusters in 0.5 g of soil. In contrast to that the same approach using the genus-specific Burkholderia primers showed only 8% primer specificity. This discrepancy in primer specificity between the normal procedures compared with pyrosequencing illustrates that the common validation procedures for quantitative PCR primers may be misleading. Our results exemplify the fact that current 16S RNA gene sequence databases might lack resolution within many taxonomic groups and emphasize the necessity for a standardized and functional primer validation protocol. A possible solution to this could be to supplement the normal verification of quantitative PCR assays with a pyrosequencing approach.

  10. Multiplex real-time PCR assays for the identification of the potato cyst and tobacco cyst nematodes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    TaqMan primer-probe sets were developed for the detection and identification of potato cyst nematodes (PCN) Globodera pallida and G. rostochiensis using two-tube, multiplex real-time PCR. One tube contained a primer-probe set specific for G. pallida (pale cyst nematode) multiplexed with another prim...

  11. Protective Coats For Zinc-Rich Primers

    NASA Technical Reports Server (NTRS)

    Macdowell, Louis G, III

    1993-01-01

    Report describes tests of topcoats for inorganic zinc-rich primers on carbon steel. Topcoats intended to provide additional protection against corrosion in acidic, salty seacoast-air/rocket-engine-exhaust environment of Space Shuttle launch site. Tests focused on polyurethane topcoats on epoxy tie coats on primers. Part of study involved comparison between "high-build" coating materials and thin-film coating materials.

  12. A Dozen Primers on Important Information Standards

    ERIC Educational Resources Information Center

    Dempsey, Kathy, Comp.

    2007-01-01

    This is a compilation of 12 primers on important information standards and protocols. These primers are: (1) Atom; (2) COinS; (3) MADS; (4) MARC 21/MARCXML; (5) MIX; (6) MXG; (7) OpenSearch; (8) PREMIS; (9) RESTful HTTP; (10) unAPI; (11) XMPP (aka Jabber); and (12) ZeeRex. The Atom Syndication Format defines a new XML-based syndication format for…

  13. Systematic design of 18S rRNA gene primers for determining eukaryotic diversity in microbial consortia.

    PubMed

    Hugerth, Luisa W; Muller, Emilie E L; Hu, Yue O O; Lebrun, Laura A M; Roume, Hugo; Lundin, Daniel; Wilmes, Paul; Andersson, Anders F

    2014-01-01

    High-throughput sequencing of ribosomal RNA gene (rDNA) amplicons has opened up the door to large-scale comparative studies of microbial community structures. The short reads currently produced by massively parallel sequencing technologies make the choice of sequencing region crucial for accurate phylogenetic assignments. While for 16S rDNA, relevant regions have been well described, no truly systematic design of 18S rDNA primers aimed at resolving eukaryotic diversity has yet been reported. Here we used 31,862 18S rDNA sequences to design a set of broad-taxonomic range degenerate PCR primers. We simulated the phylogenetic information that each candidate primer pair would retrieve using paired- or single-end reads of various lengths, representing different sequencing technologies. Primer pairs targeting the V4 region performed best, allowing discrimination with paired-end reads as short as 150 bp (with 75% accuracy at genus level). The conditions for PCR amplification were optimised for one of these primer pairs and this was used to amplify 18S rDNA sequences from isolates as well as from a range of environmental samples which were then Illumina sequenced and analysed, revealing good concordance between expected and observed results. In summary, the reported primer sets will allow minimally biased assessment of eukaryotic diversity in different microbial ecosystems.

  14. Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers

    PubMed Central

    2009-01-01

    Background The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms. Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. Results The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. Conclusion The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of Bdelloidea and Eutardigrada in

  15. Development of Species-Specific Primers for Agronomical Thrips and Multiplex Assay for Quarantine Identification of Western Flower Thrips.

    PubMed

    Yeh, W B; Tseng, M J; Chang, N T; Wu, S Y; Tsai, Y S

    2014-10-01

    While morphological identification of thrips species has been difficult because of their minute size and a lack of easily recognizable characteristics, molecular identification based on the development of specific molecular markers can be easily and reliably carried out. Among the known molecular markers, the nuclear internal transcribed spacer (ITS) exhibits distinguishable variations among thrips species. In this study, sequences of ITS2 region of 10 agriculturally important thrips were established to design species-specific primers for polymerase chain reaction (PCR). ITS2 sequence variations within these species were far less than those among species, indicating the suitability of this marker for species-specific primers design. These primers, though with one or two sporadically variable positions, showed a good efficacy within species. The specificity of these primers, examined on thrips species belonging to 15 genera, proved satisfactory. Furthermore, a multiplex PCR was used successfully for identifying Frankliniella occidentalis (Pergande), an insect pest monitored for quarantine purpose, and three additional thrips also commonly found in imported agricultural products and field samples, i.e., Thrips tabaci Lindeman, Thrips hawaiiensis (Morgan), and Frankliniella intonsa (Trybom). This study has demonstrated that specific primers and multiplex PCR based on ITS2 are reliable, convenient, and diagnostic tool to discriminate thrips species of quarantine and agricultural importance.

  16. Sequetyping: serotyping Streptococcus pneumoniae by a single PCR sequencing strategy.

    PubMed

    Leung, Marcus H; Bryson, Kevin; Freystatter, Kathrin; Pichon, Bruno; Edwards, Giles; Charalambous, Bambos M; Gillespie, Stephen H

    2012-07-01

    The introduction of pneumococcal conjugate vaccines necessitates continued monitoring of circulating strains to assess vaccine efficacy and replacement serotypes. Conventional serological methods are costly, labor-intensive, and prone to misidentification, while current DNA-based methods have limited serotype coverage requiring multiple PCR primers. In this study, a computer algorithm was developed to interrogate the capsulation locus (cps) of vaccine serotypes to locate primer pairs in conserved regions that border variable regions and could differentiate between serotypes. In silico analysis of cps from 92 serotypes indicated that a primer pair spanning the regulatory gene cpsB could putatively amplify 84 serotypes and differentiate 46. This primer set was specific to Streptococcus pneumoniae, with no amplification observed for other species, including S. mitis, S. oralis, and S. pseudopneumoniae. One hundred thirty-eight pneumococcal strains covering 48 serotypes were tested. Of 23 vaccine serotypes included in the study, most (19/22, 86%) were identified correctly at least to the serogroup level, including all of the 13-valent conjugate vaccine and other replacement serotypes. Reproducibility was demonstrated by the correct sequetyping of different strains of a serotype. This novel sequence-based method employing a single PCR primer pair is cost-effective and simple. Furthermore, it has the potential to identify new serotypes that may evolve in the future.

  17. ANL supplement to the UNICOS primer

    SciTech Connect

    Wiley, M.S.; Karlovsky, S.R.

    1991-06-01

    The ANL Supplement to the UNICOS Primer (ANL/TM 460) introduces the Cray X-MP interactive and batch services available at Argonne National Laboratory. It serves as a companion to the UNICOS Primer (Cray publication SG-2010 6.0). Whereas the UNICOS Primer discusses standard Unix issues of Cray computing, this manual discusses those issues specific to Cray computing at ANL. If this is your first experience on a Unix-based system, we assume that you have read at least Chapters 1 through 3 of the UNICOS Primer. The Glossary at the back of the UNICOS Primer will also be useful to you. If you are already familiar with a Unix system, it should suffice to keep the UNICOS Primer handy as you use this document. To learn about Unix programming in greater detail, we recommend A Practical Guide to the Unix System, by Mark G. Sobell. This manual and all other sources referred to in this document are available for purchase at the Document Distribution Counter in Building 221, Room A-134. We assume that you have already read the Guide to Computing at ANL (ANL/TM 336) to get an overview of all the computing facilities and services available at Argonne National Laboratory. You should also refer to Recommended Documentation for Computer Users at ANL (ANL/TM 379) for additional guidance in selecting available documentation that will best fill your particular computing needs.

  18. Development of PCR and TaqMan PCR Assays to Detect Pseudomonas coronafaciens, a Causal Agent of Halo Blight of Oats

    PubMed Central

    An, Ji-Hye; Noh, Young-Hee; Kim, Yong-Eon; Lee, Hyok-In; Cha, Jae-Soon

    2015-01-01

    Pseudomonas coronafaciens causes halo blight on oats and is a plant quarantine bacterium in many countries, including the Republic of Korea. Using of the certificated seed is important for control of the disease. Since effective detection method of P. coronafaciens is not available yet, PCR and TaqMan PCR assays for specific detection of P. coronafaciens were developed in this study. PCR primers were designed from the draft genome sequence of P. coronafaciens LMG 5060 which was obtained by the next-generation sequencing in this study. The PCR primer set Pc-12-F/Pc-12-R specifically amplified 498 bp from the 13 strains of P. coronafaciens isolated in the seven different countries (Canada, Japan, United Kingdom, Zimbabwe, Kenya, Germany, and New Zealand) and the nested primer set Pc-12-ne-F/Pc-12-ne-R specifically amplified 298 bp from those strains. The target-size PCR product was not amplified from the non-target bacteria with the PCR and nested primer sets. TaqMan PCR with Pc-12-ne-F/Pc-12-ne-R and a TaqMan probe, Pc-taqman, which were designed inside of the nested PCR amplicon, generated Ct values which in a dose-dependent manner to the amount of the target DNA and the Ct values of all the P. coronafaciens strains were above the threshold Ct value for positive detection. The TaqMan PCR generated positive Ct values from the seed extracts of the artificially inoculated oat seeds above 10 cfu/ml inoculation level. PCR and TaqMan PCR assays developed in this study will be useful tools to detect and identify the plant quarantine pathogen, P. coronafaciens. PMID:25774107

  19. DNA Sequence Signatures for Rapid Detection of Six Target Bacterial Pathogens Using PCR Assays

    PubMed Central

    Nagamine, Kenjiro; Hung, Guo-Chiuan; Li, Bingjie; Lo, Shyh-Ching

    2015-01-01

    Using Streptococcus pyogenes as a model, we previously established a stepwise computational workflow to effectively identify species-specific DNA signatures that could be used as PCR primer sets to detect target bacteria with high specificity and sensitivity. In this study, we extended the workflow for the rapid development of PCR assays targeting Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Clostridium difficile, Clostridium tetani, and Staphylococcus aureus, which are of safety concern for human tissue intended for transplantation. Twenty-one primer sets that had sensitivity of detecting 5–50 fg DNA from target bacteria with high specificity were selected. These selected primer sets can be used in a PCR array for detecting target bacteria with high sensitivity and specificity. The workflow could be widely applicable for the rapid development of PCR-based assays for a wide range of target bacteria, including those of biothreat agents. PMID:26279626

  20. Direct colony PCR-SSCP for detection of multiple pythiaceous oomycetes in environmental samples.

    PubMed

    Kong, Ping; Richardson, Patricia A; Hong, Chuanxue

    2005-04-01

    Colony PCR was developed for detection of pythiaceous species recovered on selective agar plates without DNA extraction. A minute amount of mycelia from a single colony was picked up with a pipette tip and added directly to the PCR mix as template for DNA amplification. Successful amplification was achieved in over 95% of the colonies recovered from plant tissues, irrigation water and soil with species-specific primers or oomycete ITS-1 primers. PCR was inhibited in the case of colonies emerging from unwashed pine bark potting mix plates. Direct colony PCR with ITS-1 primers combined with single-strand conformation polymorphism analysis (SSCP) was used to determine population levels of single and multiple species in plant and environmental samples. Application of this technique for disease diagnosis and monitoring pathogen sources was explored, and the potential for studying diversity and population dynamics of other cultivated microbial communities in the environment is discussed. PMID:15676193

  1. Monitoring of geosmin producing Anabaena circinalis using quantitative PCR.

    PubMed

    Tsao, Hsiang-Wei; Michinaka, Atsuko; Yen, Hung-Kai; Giglio, Steven; Hobson, Peter; Monis, Paul; Lin, Tsair-Fuh

    2014-02-01

    Geosmin is one of the most commonly detected off-flavor chemicals present in reservoirs and drinking water systems. Quantitative real-time PCR (qPCR) is useful for quantifying geosmin-producers by focusing on the gene encoding geosmin synthase, which is responsible for geosmin synthesis. In this study, several primers and probes were designed and evaluated to detect the geosmin synthase gene in cyanobacteria. The specificity of primer and probe sets was tested using 21 strains of laboratory cultured cyanobacteria isolated from surface waters in Australia (18) and Taiwan (2), including 6 strains with geosmin producing ability. The results showed that the primers designed in this study could successfully detect all geosmin producing strains tested. The selected primers were used in a qPCR assay, and the calibration curves were linear from 5 × 10(1) to 5 × 10(5) copies mL(-1), with a high correlation coefficient (R(2) = 0.999). This method was then applied to analyze samples taken from Myponga Reservoir, South Australia, during a cyanobacterial bloom event. The results showed good correlations between qPCR techniques and traditional methods, including cell counts determined by microscopy and geosmin concentration measured using gas chromatography (GC) coupled with a mass selective detector (MSD). Results demonstrate that qPCR could be used for tracking geosmin-producing cyanobacteria in drinking water reservoirs. The qPCR assay may provide water utilities with the ability to properly characterize a taste and odor episode and choose appropriate management and treatment options.

  2. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

    DOE PAGES

    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

    2015-12-09

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

  3. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

    SciTech Connect

    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

    2015-12-09

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable region of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.

  4. How Many Microorganisms Are Present? Quantitative Reverse Transcription PCR (qRT-PCR)

    NASA Astrophysics Data System (ADS)

    Price, Andy; Álvarez, Laura Acuña; Whitby, Corinne; Larsen, Jan

    Quantitative reverse transcription PCR (qRT-PCR) is a variation of conventional quantitative or real-time PCR, whereby mRNA is first converted into the complementary DNA (cDNA) by reverse transcription, the cDNA is then subsequently quantified by qPCR. The use of mRNA as the initial template allows the quantification of gene transcripts, rather than gene copy numbers. mRNA is only produced by actively metabolising cells and is produced by its corresponding gene to provide a 'blueprint' in order for a cell to manufacture a specific protein. Conventional qPCR detects not only DNA present in actively metabolising cells but also inactive and dead cells. qRT-PCR has the advantage that only actively metabolising cells are detected, hence provides a more reliable measure of microbial activity in oilfield samples. When qRT-PCR is combined with primers and probes for specific genes, the activity of microbial processes important in the oilfield, such as sulphate reduction, methanogenesis and nitrate reduction can be monitored.

  5. PCR-based diversity estimates of artificial and environmental 18S rRNA gene libraries.

    PubMed

    Potvin, Marianne; Lovejoy, Connie

    2009-01-01

    Environmental clone libraries constructed using small subunit ribosomal RNA (rRNA) or other gene-specific primers have become the standard molecular approach for identifying microorganisms directly from their environment. This technique includes an initial polymerase chain reaction (PCR) amplification step of a phylogenetically useful marker gene using universal primers. Although it is acknowledged that such primers introduce biases, there have been few studies if any to date systematically examining such bias in eukaryotic microbes. We investigated some implications of such bias by constructing clone libraries using several universal primer pairs targeting rRNA genes. Firstly, we constructed artificial libraries using a known mix of small cultured pelagic arctic algae with representatives from five major lineages and secondly we investigated environmental samples using several primer pairs. No primer pair retrieved all of the original algae in the artificial clone libraries and all showed a favorable bias toward the dinoflagellate Polarella glacialis and a bias against the prasinophyte Micromonas and a pennate diatom. Several other species were retrieved by only one primer pair tested. Despite this, sequences from nine environmental libraries were diverse and contained representatives from all major eukaryotic clades expected in marine samples. Further, libraries from the same sample grouped together using Bray-Curtis clustering, irrespective of primer pairs. We conclude that environmental PCR-based techniques are sufficient to compare samples, but the total diversity will probably always be underestimated and relative abundance estimates should be treated with caution.

  6. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    PubMed

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. PMID:26505528

  7. Consensus-degenerate hybrid oligonucleotide primers for amplification of distantly related sequences.

    PubMed

    Rose, T M; Schultz, E R; Henikoff, J G; Pietrokovski, S; McCallum, C M; Henikoff, S

    1998-04-01

    We describe a new primer design strategy for PCR amplification of unknown targets that are related to multiply-aligned protein sequences. Each primer consists of a short 3' degenerate core region and a longer 5' consensus clamp region. Only 3-4 highly conserved amino acid residues are necessary for design of the core, which is stabilized by the clamp during annealing to template molecules. During later rounds of amplification, the non-degenerate clamp permits stable annealing to product molecules. We demonstrate the practical utility of this hybrid primer method by detection of diverse reverse transcriptase-like genes in a human genome, and by detection of C5DNA methyltransferase homologs in various plant DNAs. In each case, amplified products were sufficiently pure to be cloned without gel fractionation. This COnsensus-DEgenerate Hybrid Oligonucleotide Primer (CODEHOP) strategy has been implemented as a computer program that is accessible over the World Wide Web (http://blocks.fhcrc.org/codehop.html) and is directly linked from the BlockMaker multiple sequence alignment site for hybrid primer prediction beginning with a set of related protein sequences.

  8. Amplification with molecular beacon primers and reverse line blotting for the detection and typing of human papillomaviruses.

    PubMed

    Jordens, J Z; Lanham, S; Pickett, M A; Amarasekara, S; Abeywickrema, I; Watt, P J

    2000-09-01

    A novel method for the detection and typing of human papillomavirus (HPV) was developed using molecular beacon primers. The method is based on the use of HPV-specific primers containing a hairpin loop structure in which fluorescent donor and quencher groups are held in close proximity such that fluorescence is quenched. Amplification of the target sequence results in the opening of the loop and the resulting fluorescence can be detected on a sequence detector system (SDS) 7700 (Applied Biosystems), as used for TaqMan assays. Fluorescent amplicons were identified on the SDS 7700 and then typed by a single hybridisation with specific probes immobilised in lines on a nylon membrane and detected on a fluorescent scanner. This novel beacon primer method compared well with conventional PCR for cervical scrape specimens. The combination of the beacon primer method and reverse line blotting should enable large-scale population studies of HPV infection.

  9. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

    SciTech Connect

    Yoon, Hyejin; Leitner, Thomas

    2014-12-17

    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-M finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.

  10. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

    DOE PAGES

    Yoon, Hyejin; Leitner, Thomas

    2014-12-17

    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

  11. Beam shaping for laser initiated optical primers

    NASA Astrophysics Data System (ADS)

    Lizotte, Todd E.

    2008-08-01

    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  12. Single universal primer multiplex ligation-dependent probe amplification with sequencing gel electrophoresis analysis.

    PubMed

    Shang, Ying; Zhu, Pengyu; Xu, Wentao; Guo, Tianxiao; Tian, Wenying; Luo, Yunbo; Huang, Kunlun

    2013-12-15

    In this study, a novel single universal primer multiplex ligation-dependent probe amplification (SUP-MLPA) technique that uses only one universal primer to perform multiplex polymerase chain reaction (PCR) was developed. Two reversely complementary common sequences were designed on the 5' or 3' end of the ligation probes (LPs), which allowed the ligation products to be amplified through only a single universal primer (SUP). SUP-MLPA products were analyzed on sequencing gel electrophoresis with extraordinary resolution. This method avoided the high expenses associated with capillary electrophoresis, which was the commonly used detection instrument. In comparison with conventional multiplex PCR, which suffers from low sensitivity, nonspecificity, and amplification disparity, SUP-MLPA had higher specificity and sensitivity and a low detection limit of 0.1 ng for detecting single crop species when screening the presence of genetically modified crops. We also studied the effect of different lengths of stuffer sequences on the probes for the first time. Through comparing the results of quantitative PCR, the LPs with different stuffer sequences did not affect the ligation efficiency, which further increased the multiplicity of this assay. The improved SUP-MLPA and sequencing gel electrophoresis method will be useful for food and animal feed identification, bacterial detection, and verification of genetic modification status of crops.

  13. Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing

    PubMed Central

    Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki

    2014-01-01

    For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201

  14. Evaluation of a new efficient procedure for single-nucleotide polymorphism genotyping: tetra-primer amplification refractory mutation system-polymerase chain reaction.

    PubMed

    Okayama, Naoko; Fujimura, Kozue; Nakamura, Junji; Suehiro, Yutaka; Hamanaka, Yuichiro; Hinoda, Yuji

    2004-01-01

    Tetra-primer amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) is a new efficient method for single-nucleotide polymorphism (SNP) genotyping. To determine the optimal conditions for ARMS-PCR we attempted to genotype ten SNPs. DNA was extracted from the peripheral blood of 168 unrelated healthy Japanese volunteers. Two problems inhibited uniform efficiency of the amplification of three bands. The first problem was the lower amplification efficiency of the shorter and allele-specific products compared with the largest product. This phenomenon was overcome by increasing the relative concentration of the inner primers. The second problem was non-specific amplification of the shorter products. To reduce the amplification of these non-specific bands, adjusting any one of the following PCR conditions was effective: i) reducing the ratio of the inner primer concentration relative to that of the outer primers; ii) increasing the annealing temperature for the initial 5-10 cycles; iii) hot start PCR. With these procedures all ten of the SNPs were successfully genotyped. Our present data may be useful in the further application of tetra-primer ARMS-PCR to SNP genotyping.

  15. Detection of Morganella morganii, a prolific histamine former, by the polymerase chain reaction assay with 16S rDNA-targeted primers.

    PubMed

    Kim, Shin-Hee; An, Haejung; Field, Katharine G; Wei, Cheng-I; Velazquez, Jorge Barros; Ben-Gigirey, Begoña; Morrissey, Michael T; Price, Robert J; Pitta, Thomas P

    2003-08-01

    A polymerase chain reaction (PCR) assay for the rapid and sensitive detection of the most prolific histamine former, Morganella morganii, was developed. 16S rDNA targeted PCR primers were designed, and the primer specificity and sensitivity of the PCR assay were evaluated. The 16S rDNA sequence (1,503 bp) for M. morganii showed 95% identity to those for enteric bacteria, i.e., Enterobacter spp., Klebsiella spp., Citrobacter spp., Hafnia alvei, Proteus spp., and Providencia spp. The unique primers for M. morganii were designed on the basis of the variable regions in the 16S rDNA sequence. The primers showed positive reactions with all M. morganii strains tested. However, PCR amplification was not detected when the primers were tested with other enteric or marine bacteria. When the sensitivity of the assay was evaluated, M. morganii was detected at levels ranging from 10(6) to 10(8) CFU/ml in albacore homogenate after the PCR amplification. The sensitivity of the assay was greatly improved with the enrichment of samples, and 9 CFU of M. morganii per ml of albacore homogenate was detected after 6 h of enrichment at 37 degrees C.

  16. PCR-based approach to distinguish group A human rotavirus genotype 1 vs. genotype 2 genes.

    PubMed

    McKell, Allison O; Nichols, Joshua C; McDonald, Sarah M

    2013-12-01

    Group A rotaviruses (RVs) are eleven-segmented, double-stranded RNA viruses and important causes of severe diarrhea in children. A full-genome classification system is readily used to describe the genetic makeup of individual RV strains. In this system, each viral gene is assigned a specific genotype based upon its nucleotide sequence and established percent identity cut-off values. However, a faster and more cost-effective approach to determine RV gene genotypes is to utilize specific oligonucleotide primer sets in RT-PCR/PCR. Such primer sets and PCR-based genotyping methods have already been developed for the VP7-, VP6-, VP4- and NSP4-coding gene segments. In this study, primers were developed for the remaining seven RV gene segments, which encode proteins VP1, VP2, VP3, NSP1, NSP2, NSP3, and NSP5/6. Specifically, primers were designed to distinguish the two most common human RV genotypes (1 vs. 2) for these genes and were validated on several cell culture-adapted human and animal RV strains, as well as on human RVs from clinical fecal specimens. As such, primer sets now exist for all eleven genes of common human RVs, allowing for the identification of reassortant strains with mixed constellations of both genotype 1 and 2 genes using a rapid and economical RT-PCR/PCR method. PMID:24012969

  17. Primers on Special Education and Charter Schools: Compilation of Full Primer Set

    ERIC Educational Resources Information Center

    Ahearn, Eileen M.; Giovannetti, Elizabeth A.; Lange, Cheryl M.; Rhim, Lauren Morando; Warren, Sandra Hopfengardner

    2004-01-01

    This set of primers for charter school authorizers; charter school operators and state-level administrators has been developed to provide background information and resources for the "builders" of charter schools and policymakers to facilitate the successful inclusion of students with disabilities in charter schools. The primers open with a…

  18. Primerize: automated primer assembly for transcribing non-coding RNA domains

    PubMed Central

    Tian, Siqi; Yesselman, Joseph D.; Cordero, Pablo; Das, Rhiju

    2015-01-01

    Customized RNA synthesis is in demand for biological and biotechnological research. While chemical synthesis and gel or chromatographic purification of RNA is costly and difficult for sequences longer than tens of nucleotides, a pipeline of primer assembly of DNA templates, in vitro transcription by T7 RNA polymerase and kit-based purification provides a cost-effective and fast alternative for preparing RNA molecules. Nevertheless, designing template primers that optimize cost and avoid mispriming during polymerase chain reaction currently requires expert inspection, downloading specialized software or both. Online servers are currently not available or maintained for the task. We report here a server named Primerize that makes available an efficient algorithm for primer design developed and experimentally tested in our laboratory for RNA domains with lengths up to 300 nucleotides. Free access: http://primerize.stanford.edu. PMID:25999345

  19. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    PubMed

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail

  20. Identification of Staphylococcus spp. using (GTG)₅-PCR fingerprinting.

    PubMed

    Svec, Pavel; Pantůček, Roman; Petráš, Petr; Sedláček, Ivo; Nováková, Dana

    2010-12-01

    A group of 212 type and reference strains deposited in the Czech Collection of Microorganisms (Brno, Czech Republic) and covering 41 Staphylococcus species comprising 21 subspecies was characterised using rep-PCR fingerprinting with the (GTG)₅ primer in order to evaluate this method for identification of staphylococci. All strains were typeable using the (GTG)₅ primer and generated PCR products ranging from 200 to 4500 bp. Numerical analysis of the obtained fingerprints revealed (sub)species-specific clustering corresponding with the taxonomic position of analysed strains. Taxonomic position of selected strains representing the (sub)species that were distributed over multiple rep-PCR clusters was verified and confirmed by the partial rpoB gene sequencing. Staphylococcus caprae, Staphylococcus equorum, Staphylococcus sciuri, Staphylococcus piscifermentans, Staphylococcus xylosus, and Staphylococcus saprophyticus revealed heterogeneous fingerprints and each (sub)species was distributed over several clusters. However, representatives of the remaining Staphylococcus spp. were clearly separated in single (sub)species-specific clusters. These results showed rep-PCR with the (GTG)₅ primer as a fast and reliable method applicable for differentiation and straightforward identification of majority of Staphylococcus spp.

  1. Climate Change, Health, and Communication: A Primer.

    PubMed

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  2. Climate Change, Health, and Communication: A Primer.

    PubMed

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects. PMID:26580230

  3. Genetic characterization and authentication of Embelia ribes using RAPD-PCR and SCAR marker.

    PubMed

    Devaiah, K M; Venkatasubramanian, Padma

    2008-02-01

    Embelia ribes Burm. f. (Myrsinaceae) is one of the important plants used in Indian traditional medicine. RAPD-PCR analysis was performed to obtain species-specific DNA fragments. A band of 906 bp that was specific to Embelia ribes irrespective of the geographical source was obtained using the random decamer primer OPF 05. SCAR primers ER 1 (27 mer) and ER 2 (26 mer) were designed from the sequence of the RAPD marker which yielded an expected amplicon of 594 bp with the Embelia ribes DNA only. This methodology can be used for species identification of genuine Embelia ribes and to distinguish it from common substitutes and adulterants. BLAST: basic local alignment search tool ER 1: Embelia ribes forward primer ER 2: Embelia ribes reverse primer RAPD-PCR: random amplification of polymorphic DNA polymerase chain reaction SCAR: sequence characterized amplified region.

  4. A novel and simple PCR walking method for rapid acquisition of long DNA sequence flanking a known site in microbial genome.

    PubMed

    Luo, Peng; Su, Ting; Hu, Chaoqun; Ren, Chunhua

    2011-03-01

    Acquisition of flanking sequence adjacent to a known DNA site is an important task in microbial genome-related research. In this study, we developed a new method containing two rounds of PCR followed by cloning and sequencing. Firstly, specific primer (SP) is added into the reaction system for primary locus-specific linear amplification, and then a complex long primer (CLP) is added into the cooled reaction system for only one cycle. Amplification products from the first round of PCR are directly purified without electrophoresis, diluted, and used as the templates of the second PCR. Secondly, one long specific primer (LSP) and one long base-fixed primer (LFP) are adopted. The amplicons are purified for cloning and sequencing. The achievement of specific amplification for long flanking region mainly depends on ingenious and precise settings of PCR programs, structure design of CLP primer, adding of CLP primer after specific linear amplification, concentration ratio of CLP and SP primer, applying long primers, etc. Through this method, we successfully performed the long PCR walkings (>1.5 Kb) on rpoB gene of Vibrio vulnificus, transposon-like gene of V. alginolyticus, and sto gene of V. cholerae. The method provides a robust and simple strategy for rapid amplification of long unknown DNA fragments from microbes.

  5. Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

    NASA Astrophysics Data System (ADS)

    Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam

    2013-11-01

    This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

  6. [Detection of fish DNA in ruminant feed by PCR amplification].

    PubMed

    Nomura, Tetsuya; Kusama, Toyoko; Kadowaki, Koh-ichi

    2006-10-01

    The Japanese Government has prohibited the use of seafood protein, as well as mammalian protein, in ruminant feed. There is an official method to detect meat and bone meal, but no method is yet available to detect fishmeal in ruminant feed. We tried to develop a suitable method to detect fishmeal in ruminant feed, similar to the official method "PCR detection of animal-derived DNA in feed". Our previously reported primers (fishcon5 and fishcon3-1) showed low sensitivity, so we designed new primers based on a DNA sequence from yellowfin tuna mitchondrial DNA. Among the primers, FM5 and FM3 specifically detected fish DNA (sardine, yellowfin tuna, skipjack tuna, chub mackerel, Pacific saury, salmon, rainbow trout, Japanese anchovy, codfish and Japanese horse mackerel) from fish meat, and did not amplify DNA from animals and plants. The sensitivity for detection of the presence of fishmeal in ruminant feed was 0.01-0.001%. PMID:17128872

  7. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    NASA Astrophysics Data System (ADS)

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-03-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  8. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    PubMed Central

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-01-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911

  9. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River.

    PubMed

    Cannon, M V; Hester, J; Shalkhauser, A; Chan, E R; Logue, K; Small, S T; Serre, D

    2016-03-11

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  10. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River.

    PubMed

    Cannon, M V; Hester, J; Shalkhauser, A; Chan, E R; Logue, K; Small, S T; Serre, D

    2016-01-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911

  11. PrimerIdent: A web based tool for conserved primer design

    PubMed Central

    Pessoa, Alberto M; Pereira, Susana; Teixeira, Jorge

    2010-01-01

    Conserved primers across multiple species and simultaneously specific for a certain isozyme can be rare and difficult to find. PrimerIdent was developed aiming to automate this primer design and selection process in a given nucleotide sequence alignment, providing an intuitive, easy to interpret graphical result, which offers a list of all possible primers that meet the user criteria, with a colour-code identity to each sequence in the alignment. The software here presented is a simple and intuitive web based tool that is suitable for distinguishing very similar nucleotide sequences, such as isozymes­coding sequences, to enable the conserved primer design across multiple species, necessary for approaches that rely on knowing if a primer is suitable for a certain set of pre-aligned sequences, to design a specific primer to a certain sequence variation, or a combination thereof. This extremely useful software can, therefore, be used as a tool for the specific amplification of individual members of multigenic families across related species and also to evaluate the differential expression of isogenes for a given species. Availability http://primerident.up.pt PMID:21346862

  12. Simultaneous detection and differentiation of three viruses in pear plants by a multiplex RT-PCR.

    PubMed

    Yao, Bingyu; Wang, Guoping; Ma, Xiaofang; Liu, Wenbin; Tang, Huihui; Zhu, Hui; Hong, Ni

    2014-02-01

    A multiplex RT-PCR (mRT-PCR) assay was developed for detection and differentiation of the Apple stem pitting virus (ASPV), Apple stem grooving virus (ASGV) and Apple chlorotic leaf spot virus (ACLSV), which are viruses frequently occurring in pear trees. Different combinations of mixed primer pairs were tested for their specificity and sensitivity for the simultaneous detection of the three viruses. Three primer pairs were used to amplify their fragments of 247bp, 358bp and 500bp, respectively. The primer pair for ASPV was designed in this work, while the primer pairs for ACLSV and ASGV were from previous reports. The sensitivity and specificity of the mRT-PCR assay for the three viruses were comparable to that of each uniplex RT-PCR. The mRT-PCR was applied successfully for the detection of three viruses in leaves of pear and apple plants, but was unreliable in the detection of ASGV in dormant barks. In conclusion, this mRT-PCR provides a useful tool for the routine and rapid detection and the differentiation of three pear viruses.

  13. GPUDePiCt: A Parallel Implementation of a Clustering Algorithm for Computing Degenerate Primers on Graphics Processing Units.

    PubMed

    Cickovski, Trevor; Flor, Tiffany; Irving-Sachs, Galen; Novikov, Philip; Parda, James; Narasimhan, Giri

    2015-01-01

    In order to make multiple copies of a target sequence in the laboratory, the technique of Polymerase Chain Reaction (PCR) requires the design of "primers", which are short fragments of nucleotides complementary to the flanking regions of the target sequence. If the same primer is to amplify multiple closely related target sequences, then it is necessary to make the primers "degenerate", which would allow it to hybridize to target sequences with a limited amount of variability that may have been caused by mutations. However, the PCR technique can only allow a limited amount of degeneracy, and therefore the design of degenerate primers requires the identification of reasonably well-conserved regions in the input sequences. We take an existing algorithm for designing degenerate primers that is based on clustering and parallelize it in a web-accessible software package GPUDePiCt, using a shared memory model and the computing power of Graphics Processing Units (GPUs). We test our implementation on large sets of aligned sequences from the human genome and show a multi-fold speedup for clustering using our hybrid GPU/CPU implementation over a pure CPU approach for these sequences, which consist of more than 7,500 nucleotides. We also demonstrate that this speedup is consistent over larger numbers and longer lengths of aligned sequences.

  14. GPUDePiCt: A Parallel Implementation of a Clustering Algorithm for Computing Degenerate Primers on Graphics Processing Units.

    PubMed

    Cickovski, Trevor; Flor, Tiffany; Irving-Sachs, Galen; Novikov, Philip; Parda, James; Narasimhan, Giri

    2015-01-01

    In order to make multiple copies of a target sequence in the laboratory, the technique of Polymerase Chain Reaction (PCR) requires the design of "primers", which are short fragments of nucleotides complementary to the flanking regions of the target sequence. If the same primer is to amplify multiple closely related target sequences, then it is necessary to make the primers "degenerate", which would allow it to hybridize to target sequences with a limited amount of variability that may have been caused by mutations. However, the PCR technique can only allow a limited amount of degeneracy, and therefore the design of degenerate primers requires the identification of reasonably well-conserved regions in the input sequences. We take an existing algorithm for designing degenerate primers that is based on clustering and parallelize it in a web-accessible software package GPUDePiCt, using a shared memory model and the computing power of Graphics Processing Units (GPUs). We test our implementation on large sets of aligned sequences from the human genome and show a multi-fold speedup for clustering using our hybrid GPU/CPU implementation over a pure CPU approach for these sequences, which consist of more than 7,500 nucleotides. We also demonstrate that this speedup is consistent over larger numbers and longer lengths of aligned sequences. PMID:26357230

  15. Rapid and Inexpensive Screening of Genomic Copy Number Variations Using a Novel Quantitative Fluorescent PCR Method

    PubMed Central

    Han, Joan C.; Elsea, Sarah H.; Pena, Heloísa B.; Pena, Sérgio Danilo Junho

    2013-01-01

    Detection of human microdeletion and microduplication syndromes poses significant burden on public healthcare systems in developing countries. With genome-wide diagnostic assays frequently inaccessible, targeted low-cost PCR-based approaches are preferred. However, their reproducibility depends on equally efficient amplification using a number of target and control primers. To address this, the recently described technique called Microdeletion/Microduplication Quantitative Fluorescent PCR (MQF-PCR) was shown to reliably detect four human syndromes by quantifying DNA amplification in an internally controlled PCR reaction. Here, we confirm its utility in the detection of eight human microdeletion syndromes, including the more common WAGR, Smith-Magenis, and Potocki-Lupski syndromes with 100% sensitivity and 100% specificity. We present selection, design, and performance evaluation of detection primers using variety of approaches. We conclude that MQF-PCR is an easily adaptable method for detection of human pathological chromosomal aberrations. PMID:24288428

  16. TqPCR: A Touchdown qPCR Assay with Significantly Improved Detection Sensitivity and Amplification Efficiency of SYBR Green qPCR

    PubMed Central

    Zhang, Qian; Wang, Jing; Deng, Fang; Yan, Zhengjian; Xia, Yinglin; Wang, Zhongliang; Ye, Jixing; Deng, Youlin; Zhang, Zhonglin; Qiao, Min; Li, Ruifang; Denduluri, Sahitya K.; Wei, Qiang; Zhao, Lianggong; Lu, Shun; Wang, Xin; Tang, Shengli; Liu, Hao; Luu, Hue H.; Haydon, Rex C.; He, Tong-Chuan; Jiang, Li

    2015-01-01

    The advent of fluorescence-based quantitative real-time PCR (qPCR) has revolutionized the quantification of gene expression analysis in many fields, including life sciences, agriculture, forensic science, molecular diagnostics, and medicine. While SYBR Green-based qPCR is the most commonly-used platform due to its inexpensive nature and robust chemistry, quantifying the expression of genes with low abundance or RNA samples extracted from highly restricted or limited sources can be challenging because the detection sensitivity of SYBR Green-based qPCR is limited. Here, we develop a novel and effective touchdown qPCR (TqPCR) protocol by incorporating a 4-cycle touchdown stage prior to the quantification amplification stage. Using the same cDNA templates, we find that TqPCR can reduce the average Cq values for Gapdh, Rps13, and Hprt1 reference genes by 4.45, 5.47, and 4.94 cycles, respectively, when compared with conventional qPCR; the overall average Cq value reduction for the three reference genes together is 4.95. We further find that TqPCR can improve PCR amplification efficiency and thus increase detection sensitivity. When the quantification of Wnt3A-induced target gene expression in mesenchymal stem cells is analyzed, we find that, while both conventional qPCR and TqPCR can detect the up-regulation of the relatively abundant target Axin2, only TqPCR can detect the up-regulation of the lowly-expressed targets Oct4 and Gbx2. Finally, we demonstrate that the MRQ2 and MRQ3 primer pairs derived from mouse reference gene Tbp can be used to validate the RNA/cDNA integrity of qPCR samples. Taken together, our results strongly suggest that TqPCR may increase detection sensitivity and PCR amplification efficiency. Overall, TqPCR should be advantageous over conventional qPCR in expression quantification, especially when the transcripts of interest are lowly expressed, and/or the availability of total RNA is highly restricted or limited. PMID:26172450

  17. Differential display system with vertebrate-common degenerate oligonucleotide primers: uncovering genes responsive to dioxin in avian embryonic liver.

    PubMed

    Teraoka, Hiroki; Ito, Shino; Ikeda, Haruki; Kubota, Akira; Abou Elmagd, M M; Kitazawa, Takio; Kim, Eun-Young; Iwata, Hisato; Endoh, Daiji

    2012-01-01

    To assess possible impacts of environmental pollutants on gene expression profiles in a variety of organisms, we developed a novel differential display system with primer sets that are common in seven vertebrate species, based on degenerate oligonucleotide-primed PCR (DOP-PCR). An 8-mer inverse repeat motif was found in most transcripts from the seven vertebrates including fish to primates with detailed transcriptome information; more than 10,000 motifs were recognized in common in the transcripts of the seven species. Among them, we selected 275 common motifs that cover about 40-70% of transcripts throughout these species, and designed 275 DOP-PCR primers that were common to seven vertebrate species (common DOP-PCR primers). To detect genes responsive to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in developing embryos, differential display with common DOP-PCR primers was applied to embryonic liver of two avian species, the chicken (Gallus gallus) and the common cormorant (Phalacrocorax carbo), which were exposed in ovo to TCDD. The cDNA bands that showed differences between the control and TCDD-treated groups were sequenced and the mRNA expression levels were confirmed by real-time RT-PCR. This approach succeeded in isolating novel dioxin-responsive genes that include 10 coding genes in the chicken, and 1 coding gene and 1 unknown transcript in the cormorant, together with cytochrome P450 1As that have already been well established as dioxin markers. These results highlighted the usefulness of systematically designed novel differential display systems to search genes responsive to chemicals in vertebrates, including wild species, for which transcriptome information is not available. PMID:21786751

  18. [Mutation detection by PCR-TGGE].

    PubMed

    Shirakawa, T; Nishiyama, K; Matsuo, M

    1995-07-01

    The variants in enterotoxigenic Escherichia coli (ETEC) heat-labile toxin (LT) gene were detected by temperature gradient gel electrophoresis (TGGE). 15 clinical strains isolated from patients and a wild type strain (B2C) were analyzed after the conventional PCR. Although all PCR products (707bp) corresponded to A-subunit of LT, three strains were the different electrophoretic patterns after silver staining as compared to the wild type. For further electrophoretic analyses, the 707bp region was divided into 4 parts. The different ones were localized in the downstream part (183bp), but each those DNA bands was not so clear than DNA bands in 707bp. The clearer patterns were obtained by using a primer attached GC-clamp. The hetero-duplex assays in TGGE were proceeded by a series of procedures in mixing with the equal quantity of PCR products derived from a variant and a wild type, heat-denaturation and then annealing. TGGE of those mixed samples had 4 bands that were 2 front bands as homo-duplex and 2 slower migration bands as hetero-duplex. To Confirm the site of the mutations, the nucleotide sequences in each 183bp PCR products were decided by dideoxynucleotide-fluorescent dye method. Indeed, two variants were recognized four one-base substitutions without deletions and the one was five. Thus, the difference of migration in TGGE depended on the number and the localization in mutation sites.

  19. Highly effective sequencing whole chloroplast genomes of angiosperms by nine novel universal primer pairs.

    PubMed

    Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao

    2014-09-01

    Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms.

  20. Design and Implementation of Degenerate Microsatellite Primers for the Mammalian Clade

    PubMed Central

    Buschiazzo, Emmanuel; Beck, Josephine S.; Gemmell, Neil J.

    2011-01-01

    Microsatellites are popular genetic markers in molecular ecology, genetic mapping and forensics. Unfortunately, despite recent advances, the isolation of de novo polymorphic microsatellite loci often requires expensive and intensive groundwork. Primers developed for a focal species are commonly tested in a related, non-focal species of interest for the amplification of orthologous polymorphic loci; when successful, this approach significantly reduces cost and time of microsatellite development. However, transferability of polymorphic microsatellite loci decreases rapidly with increasing evolutionary distance, and this approach has shown its limits. Whole genome sequences represent an under-exploited resource to develop cross-species primers for microsatellites. Here we describe a three-step method that combines a novel in silico pipeline that we use to (1) identify conserved microsatellite loci from a multiple genome alignments, (2) design degenerate primer pairs, with (3) a simple PCR protocol used to implement these primers across species. Using this approach we developed a set of primers for the mammalian clade. We found 126,306 human microsatellites conserved in mammalian aligned sequences, and isolated 5,596 loci using criteria based on wide conservation. From a random subset of ∼1000 dinucleotide repeats, we designed degenerate primer pairs for 19 loci, of which five produced polymorphic fragments in up to 18 mammalian species, including the distinctly related marsupials and monotremes, groups that diverged from other mammals 120–160 million years ago. Using our method, many more cross-clade microsatellite loci can be harvested from the currently available genomic data, and this ability is set to improve exponentially as further genomes are sequenced. PMID:22216321

  1. Impact of primer choice on characterization of orchid mycorrhizal communities using 454 pyrosequencing.

    PubMed

    Waud, Michael; Busschaert, Pieter; Ruyters, Stefan; Jacquemyn, Hans; Lievens, Bart

    2014-07-01

    Although the number of studies investigating mycorrhizal associations in orchids has increased in recent years, the fungal communities associating with orchids and how they differ between species and sites remain unclear. Recent research has indicated that individual orchid plants may associate with several fungi concurrently, implying that to study mycorrhizal associations in orchids the fungal community should be assessed, rather than the presence of individual dominant fungal species or strains. High-throughput sequencing methods, such as 454 pyrosequencing, are increasingly used as the primary tool for such analyses. However, many studies combine universal primers from previous phylogenetic or ecological studies to generate amplicons suitable for 454 pyrosequencing without first critically evaluating their performance, potentially resulting in biased fungal community descriptions. Here, following in silico primer analysis we evaluated the performance of different combinations of existing PCR primers to characterize orchid mycorrhizal communities using 454 pyrosequencing by analysis of both an artificially assembled community of mycorrhizal fungi isolated from diverse orchid species and root samples from three different orchid species (Anacamptis morio, Ophrys tenthredinifera and Serapias lingua). Our results indicate that primer pairs ITS3/ITS4OF and ITS86F/ITS4, targeting the internal transcribed spacer-2 (ITS-2) region, outperformed other tested primer pairs in terms of number of reads, number of operational taxonomic units recovered from the artificial community and number of different orchid mycorrhizal associating families detected in the orchid samples. Additionally, we show the complementary specificity of both primer pairs, making them highly suitable for tandem use when studying the diversity of orchid mycorrhizal communities.

  2. Specific detection of avian pneumovirus (APV) US isolates by RT-PCR.

    PubMed

    Shin, H J; Rajashekara, G; Jirjis, F F; Shaw, D P; Goyal, S M; Halvorson, D A; Nagaraja, K V

    2000-01-01

    This report details the development of an RT-PCR assay for the specific detection of US isolates of avian pneumovirus (APV). Of the several primer pairs tested, two sets of primers derived from the matrix gene of APV were able to specifically detect the viral RNA of APV. The nucleotide sequence comparison of the PCR products of APV isolates from Minnesota suggested that these viruses were closely related to the Colorado strain of APV, but were distinct from subtypes A and B European isolates of turkey APV (turkey rhinotracheitis: TRT). This M gene-based PCR was found to be very specific and sensitive. APV as low as 8 x 10(-5) TCID50 (0.0323 microg/ml) could be detected using this assay. In addition, the two primers were able to differentiate isolates from turkeys in Minnesota.

  3. Identification of Erwinia species isolated from apples and pears by differential PCR.

    PubMed

    Gehring, I; Geider, K

    2012-04-01

    Many pathogenic and epiphytic bacteria isolated from apples and pears belong to the genus Erwinia; these include the species E. amylovora, E. pyrifoliae, E. billingiae, E. persicina, E. rhapontici and E. tasmaniensis. Identification and classification of freshly isolated bacterial species often requires tedious taxonomic procedures. To facilitate routine identification of Erwinia species, we have developed a PCR method based on species-specific oligonucleotides (SSOs) from the sequences of the housekeeping genes recA and gpd. Using species-specific primers that we report here, differentiation was done with conventional PCR (cPCR) and quantitative PCR (qPCR) applying two consecutive primer annealing temperatures. The specificity of the primers depends on terminal Single Nucleotide Polymorphisms (SNPs) that are characteristic for the target species. These PCR assays enabled us to distinguish eight Erwinia species, as well as to identify new Erwinia isolates from plant surfaces. When performed with mixed bacterial cultures, they only detected a single target species. This method is a novel approach to classify strains within the genus Erwinia by PCR and it can be used to confirm other diagnostic data, especially when specific PCR detection methods are not already available. The method may be applied to classify species within other bacterial genera.

  4. Internet Primer: Workshop Design and Objectives.

    ERIC Educational Resources Information Center

    Laverty, Corinne Y. C.

    1996-01-01

    Outlines the design, objectives, and evaluation of an introductory Internet workshop offered with library instruction classes in an electronic classroom at Queens University (Kingston, Ontario, Canada). Presents teaching tips and frequently-asked questions. The Internet primer handouts are appended. (AEF)

  5. Theme: A Primer for Agricultural Education.

    ERIC Educational Resources Information Center

    Vaughn, Paul, Ed.; And Others

    1998-01-01

    Includes "A Primer for Agricultural Education" (Vaughn); "What Are the Goals and Purposes of Ag Ed?" (Case, Whitaker); "Basics of Supervised Experience" (Lee); "The FFA [Future Farmers of America]: Why Do We Have It?" (Case, Whitaker); "The Council: Providing Visionary Leadership" (Daniel, Vaughn); "Ag Communications" (Lockaby, Vernon); and…

  6. A Primer on Simulation and Gaming.

    ERIC Educational Resources Information Center

    Barton, Richard F.

    In a primer intended for the administrative professions, for the behavioral sciences, and for education, simulation and its various aspects are defined, illustrated, and explained. Man-model simulation, man-computer simulation, all-computer simulation, and analysis are discussed as techniques for studying object systems (parts of the "real…

  7. Forest Interpreter's Primer on Fire Management.

    ERIC Educational Resources Information Center

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  8. Issues Primer. EEE708 Negotiated Study Program.

    ERIC Educational Resources Information Center

    Jennings, Leonie

    This issues primer is structured around a series of 20 contemporary concerns in the changing world of work and training in Australia in the early 1990s. It is part of the study materials for the one-semester distance education unit, Negotiated Study Program, in the Open Campus Program at Deakin University (Australia). Information on each issue is…

  9. Effective PCR-based detection of Naegleria fowleri from cultured sample and PAM-developed mouse.

    PubMed

    Kang, Heekyoung; Seong, Gi-Sang; Sohn, Hae-Jin; Kim, Jong-Hyun; Lee, Sang-Eun; Park, Mi Yeoun; Lee, Won-Ja; Shin, Ho-Joon

    2015-10-01

    Increasing numbers of Primary Amoebic Meningoencephalitis (PAM) cases due to Naegleria fowleri are becoming a serious issue in subtropical and tropical countries as a Neglected Tropical Disease (NTD). To establish a rapid and effective diagnostic tool, a PCR-based detection technique was developed based on previous PCR methods. Four kinds of primer pairs, Nfa1, Nae3, Nf-ITS, and Naegl, were employed in the cultured amoebic trophozoites and a mouse with PAM experimentally developed by N. fowleri inoculation (PAM-mouse). For the extraction of genomic DNA from N. fowleri trophozoites (1×10(6)), simple boiling with 10μl of PBS (pH 7.4) at 100°C for 30min was found to be the most rapid and efficient procedure, allowing amplification of 2.5×10(2) trophozoites using the Nfa-1 primer. The primers Nfa1 and Nae3 amplified only N. fowleri DNA, whereas the ITS primer detected N. fowleri and N. gruberi DNA. Using the PAM-mouse brain tissue, the Nfa1 primer was able to amplify the N. fowleri DNA 4 days post infection with 1ng/μl of genomic DNA being detectable. Using the PAM-mouse CSF, amplification of the N. fowleri DNA with the Nae3 primer was possible 5 days post infection showing a better performance than the Nfa1 primer at day 6. PMID:26322498

  10. Effective PCR-based detection of Naegleria fowleri from cultured sample and PAM-developed mouse.

    PubMed

    Kang, Heekyoung; Seong, Gi-Sang; Sohn, Hae-Jin; Kim, Jong-Hyun; Lee, Sang-Eun; Park, Mi Yeoun; Lee, Won-Ja; Shin, Ho-Joon

    2015-10-01

    Increasing numbers of Primary Amoebic Meningoencephalitis (PAM) cases due to Naegleria fowleri are becoming a serious issue in subtropical and tropical countries as a Neglected Tropical Disease (NTD). To establish a rapid and effective diagnostic tool, a PCR-based detection technique was developed based on previous PCR methods. Four kinds of primer pairs, Nfa1, Nae3, Nf-ITS, and Naegl, were employed in the cultured amoebic trophozoites and a mouse with PAM experimentally developed by N. fowleri inoculation (PAM-mouse). For the extraction of genomic DNA from N. fowleri trophozoites (1×10(6)), simple boiling with 10μl of PBS (pH 7.4) at 100°C for 30min was found to be the most rapid and efficient procedure, allowing amplification of 2.5×10(2) trophozoites using the Nfa-1 primer. The primers Nfa1 and Nae3 amplified only N. fowleri DNA, whereas the ITS primer detected N. fowleri and N. gruberi DNA. Using the PAM-mouse brain tissue, the Nfa1 primer was able to amplify the N. fowleri DNA 4 days post infection with 1ng/μl of genomic DNA being detectable. Using the PAM-mouse CSF, amplification of the N. fowleri DNA with the Nae3 primer was possible 5 days post infection showing a better performance than the Nfa1 primer at day 6.

  11. Identifying of meat species using polymerase chain reaction (PCR)

    NASA Astrophysics Data System (ADS)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  12. Identifying of meat species using polymerase chain reaction (PCR)

    SciTech Connect

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  13. Culture independent PCR: an alternative enzyme discovery strategy.

    PubMed

    Jacobsen, Jonas; Lydolph, Magnus; Lange, Lene

    2005-01-01

    Degenerate primers were designed for use in a culture-independent PCR screening of DNA from composite fungal communities, inhabiting residues of corn stovers and leaves. According to similarity searches and alignments amplified clone sequences affiliated with glycosyl hydrolase family 7 and glycosyl hydrolase family 45 though significant sequence divergence was observed. Glycosyl hydrolases from families 7 and 45 play a crucial role in biomass conversion to fuel ethanol. Research in this renewable energy source has two objectives: (i) To contribute to development of a renewable alternative to world's limited crude fossil oil reserves and (ii) to reduce air pollution. Amplification with 18S rDNA-specific primers revealed species within the ascomycetous orders Sordariales and Hypocreales as well as basidiomycetous order Agaricales to be present in these communities. Our study documents the value of culture-independent PCR in microbial diversity studies and could add to development of a new enzyme screening technology. PMID:15567226

  14. An improved PCR method for gender identification of eagles.

    PubMed

    Chang, Hsueh-Wei; Chou, Ta-Ching; Gu, De-Leung; Cheng, Chun-An; Chang, Chia-Che; Yao, Cheng-Te; Chuang, Li-Yeh; Wen, Cheng-Hao; Chou, Yii-Cheng; Tan, Kock-Yee; Cheng, Chien-Chung

    2008-06-01

    Eagles are sexually monomorphic and therefore it is difficult to determine their gender, which is a crucial need for management purposes. In this study, we have developed an improved gender identification method by exploiting length differences between the Chromo-Helicase-DNA binding protein (CHD)-Z and CHD-W genes of Spilornis cheela hoya. By comparing DNA sequences for CHD-W and CHD-Z from 10 species of Falconiformes eagles we designed universal gender identification PCR primers that exploit differences in product size. Standard agarose gels were shown to easily distinguish between the 148-bp CHD-ZW and the 258-bp CHD-W PCR products. When used with 28 samples of S. cheela hoya, our improved universal primers provided a fast and precise gender identification assay. PMID:18385011

  15. Culture independent PCR: an alternative enzyme discovery strategy.

    PubMed

    Jacobsen, Jonas; Lydolph, Magnus; Lange, Lene

    2005-01-01

    Degenerate primers were designed for use in a culture-independent PCR screening of DNA from composite fungal communities, inhabiting residues of corn stovers and leaves. According to similarity searches and alignments amplified clone sequences affiliated with glycosyl hydrolase family 7 and glycosyl hydrolase family 45 though significant sequence divergence was observed. Glycosyl hydrolases from families 7 and 45 play a crucial role in biomass conversion to fuel ethanol. Research in this renewable energy source has two objectives: (i) To contribute to development of a renewable alternative to world's limited crude fossil oil reserves and (ii) to reduce air pollution. Amplification with 18S rDNA-specific primers revealed species within the ascomycetous orders Sordariales and Hypocreales as well as basidiomycetous order Agaricales to be present in these communities. Our study documents the value of culture-independent PCR in microbial diversity studies and could add to development of a new enzyme screening technology.

  16. Evaluation of new primers for CSF1PO.

    PubMed

    Yoshida, K; Sekiguchi, K; Kasai, K; Sato, H; Seta, S; Sensabaugh, G F

    1997-01-01

    We describe new primers for the detection of the STR polymorphism at the CSF1PO locus. These primers have been designed to produce shorter amplicons (150-182 bp) than the primers in standard use (295-327 bp). The reliability of the new primers for CSF1PO typing has been demonstrated by testing on known samples and by sequence analysis. These primers are superior to the original primers with regard to electrophoretic resolution and utility for typing of severely degraded DNA.

  17. Rust transformation/rust compatible primers

    NASA Technical Reports Server (NTRS)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  18. Rapid duplex PCR assay for the detection of pathogenic Yersinia enterocolitica strains.

    PubMed

    Aarts, H J; Joosten, R G; Henkens, M H; Stegeman, H; van Hoek, A H

    2001-11-01

    For the detection of pathogenic Yersinia enterocolitica strains, a duplex PCR has been developed based on differences observed between the fingerprint profiles of pathogenic and non-pathogenic strains. The profiles were obtained by using a primer derived from the Enterobacterial Repetitive Intergenic Consensus (ERIC) sequences. From the sequence of one pathogen-specific amplified fragment, a discriminative primer has been designed bridging the sequence of the highly conserved core region and 3' end of the ERIC element. In combination with three other primers, all located within the detected open reading frame that resembled the sequence of the bipA gene, this primer was applied in a duplex PCR assay to simultaneously detect Y. enterocolitica and to discriminate between pathogenic and non-pathogenic strains. The same primer combinations were used in an on line rapid cycling real-time PCR assay. The used SYBR Green I format allowed for the easy translation of the PCR conditions and confirmation of the resulting amplicons. The time of analysis was reduced to approximately 60 min. PMID:11576685

  19. A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.

    PubMed

    Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P

    1996-04-15

    A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

  20. Primer Modification Improves Rapid and Sensitive In Vitro and Field-Deployable Assays for Detection of High Plains Virus Variants

    PubMed Central

    Arif, M.; Aguilar-Moreno, G. S.; Wayadande, A.; Fletcher, J.

    2014-01-01

    A high consequence pathogen, High plains virus (HPV) causes considerable damage to wheat if the crop is infected during early stages of development. Methods for the early, accurate, and sensitive detection of HPV in plant tissues are needed for the management of disease outbreaks and reservoir hosts. In this study, the effectiveness of five methods—real-time SYBR green and TaqMan reverse transcription-quantitative PCR (RT-qPCR), endpoint RT-PCR, RT-helicase dependent amplification (RT-HDA) and the Razor Ex BioDetection System (Razor Ex)—for the broad-range detection of HPV variants was evaluated. Specific PCR primer sets and probes were designed to target the HPV nucleoprotein gene. Primer set HPV6F and HPV4R, which amplifies a product of 96 bp, was validated in silico against published sequences and in vitro against an inclusivity panel of infected plant samples and an exclusivity panel of near-neighbor viruses. The primers were modified by adding a customized 22 nucleotide long tail at the 5′ terminus, raising the primers' melting temperature (Tm; ca. 10°C) to make them compatible with RT-HDA (required optimal Tm = 68°C), in which the use of primers lacking such tails gave no amplification. All of the methods allowed the detection of as little as 1 fg of either plasmid DNA carrying the target gene sequence or of infected plant samples. The described in vitro and in-field assays are accurate, rapid, sensitive, and useful for pathogen detection and disease diagnosis, microbial quantification, and certification and breeding programs, as well as for biosecurity and microbial forensics applications. PMID:24162574

  1. Primer modification improves rapid and sensitive in vitro and field-deployable assays for detection of high plains virus variants.

    PubMed

    Arif, M; Aguilar-Moreno, G S; Wayadande, A; Fletcher, J; Ochoa-Corona, F M

    2014-01-01

    A high consequence pathogen, High plains virus (HPV) causes considerable damage to wheat if the crop is infected during early stages of development. Methods for the early, accurate, and sensitive detection of HPV in plant tissues are needed for the management of disease outbreaks and reservoir hosts. In this study, the effectiveness of five methods-real-time SYBR green and TaqMan reverse transcription-quantitative PCR (RT-qPCR), endpoint RT-PCR, RT-helicase dependent amplification (RT-HDA) and the Razor Ex BioDetection System (Razor Ex)-for the broad-range detection of HPV variants was evaluated. Specific PCR primer sets and probes were designed to target the HPV nucleoprotein gene. Primer set HPV6F and HPV4R, which amplifies a product of 96 bp, was validated in silico against published sequences and in vitro against an inclusivity panel of infected plant samples and an exclusivity panel of near-neighbor viruses. The primers were modified by adding a customized 22 nucleotide long tail at the 5' terminus, raising the primers' melting temperature (Tm; ca. 10°C) to make them compatible with RT-HDA (required optimal Tm = 68°C), in which the use of primers lacking such tails gave no amplification. All of the methods allowed the detection of as little as 1 fg of either plasmid DNA carrying the target gene sequence or of infected plant samples. The described in vitro and in-field assays are accurate, rapid, sensitive, and useful for pathogen detection and disease diagnosis, microbial quantification, and certification and breeding programs, as well as for biosecurity and microbial forensics applications. PMID:24162574

  2. Universal and blocking primer mismatches limit the use of high-throughput DNA sequencing for the quantitative metabarcoding of arthropods.

    PubMed

    Piñol, J; Mir, G; Gomez-Polo, P; Agustí, N

    2015-07-01

    The quantification of the biological diversity in environmental samples using high-throughput DNA sequencing is hindered by the PCR bias caused by variable primer-template mismatches of the individual species. In some dietary studies, there is the added problem that samples are enriched with predator DNA, so often a predator-specific blocking oligonucleotide is used to alleviate the problem. However, specific blocking oligonucleotides could coblock nontarget species to some degree. Here, we accurately estimate the extent of the PCR biases induced by universal and blocking primers on a mock community prepared with DNA of twelve species of terrestrial arthropods. We also compare universal and blocking primer biases with those induced by variable annealing temperature and number of PCR cycles. The results show that reads of all species were recovered after PCR enrichment at our control conditions (no blocking oligonucleotide, 45 °C annealing temperature and 40 cycles) and high-throughput sequencing. They also show that the four factors considered biased the final proportions of the species to some degree. Among these factors, the number of primer-template mismatches of each species had a disproportionate effect (up to five orders of magnitude) on the amplification efficiency. In particular, the number of primer-template mismatches explained most of the variation (~3/4) in the amplification efficiency of the species. The effect of blocking oligonucleotide concentration on nontarget species relative abundance was also significant, but less important (below one order of magnitude). Considering the results reported here, the quantitative potential of the technique is limited, and only qualitative results (the species list) are reliable, at least when targeting the barcoding COI region.

  3. Misidentification of Bordetella bronchiseptica as Bordetella pertussis using a Newly Described RT-PCR Targeting the Pertactin Gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recently a real-time PCR (RT-PCT) assay based on sequence from the gene for pertactin was proposed for identification of Bordetella pertussis. Here we report that the B. pertussis pertactin gene sequence for the region encompassing the RT-PCR probe and primers is nearly identical to that of many B....

  4. Single Laboratory Comparison of Quantitative Real-Time PCR Assays for the Detection of Human Fecal Pollution

    EPA Science Inventory

    There are numerous quantitative real-time PCR (qPCR) methods available to detect and enumerate human fecal pollution in ambient waters. Each assay employs distinct primers and/or probes and many target different genes and microorganisms leading to potential variations in method ...

  5. Single Laboratory Comparison of Quantitative Real-Time PCR Assays for the Detection of Human Fecal Pollution - Poster

    EPA Science Inventory

    There are numerous quantitative real-time PCR (qPCR) methods available to detect and enumerate human fecal pollution in ambient waters. Each assay employs distinct primers and/or probes and many target different genes and microorganisms leading to potential variations in method p...

  6. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    ERIC Educational Resources Information Center

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  7. The new LM-PCR/shifter method for the genotyping of microorganisms based on the use of a class IIS restriction enzyme and ligation mediated PCR.

    PubMed

    Krawczyk, Beata; Leibner-Ciszak, Justyna; Stojowska, Karolina; Kur, Józef

    2011-12-01

    This study details and examines a novel ligation-mediated polymerase chain reaction (LM-PCR) method. Named the LM-PCR/Shifter, it relies on the use of a Class IIS restriction enzyme giving restriction fragments with different 4-base, 5' overhangs, this being the Shifter, and the ligation of appropriate oligonucleotide adapters. A sequence of 4-base, 5' overhangs of the adapter and a 4- base sequence of the 3' end of the primer(s) determine a subset of the genomic restriction fragments, which are amplified by PCR. The method permits the differentiation of bacterial species strains on the basis of the different DNA band patterns obtained after electrophoresis in polyacrylamide gels stained with ethidium bromide and visualized in UV light. The usefulness of the LM-PCR/ Shifter method for genotyping is analyzed by a comparison with the restriction endonuclease analysis of chromosomal DNA by the pulsed-field gel electrophoresis (REA-PFGE) and PCR melting profile (PCR MP) methods for isolates of clinical origin. The clustering of the LM-PCR/Shifter fingerprinting data matched those of the REA-PFGE and PCR MP methods. We found that the LM-PCR/Shifter is rapid, and offers good discriminatory power and excellent reproducibility, making it a method that may be effectively applied in epidemiological studies.

  8. New universal primers for genotyping and resistance detection of low HBV DNA levels.

    PubMed

    Tong, Yongqing; Liu, Bei; Liu, Hui; Zheng, Hongyun; Gu, Jian; Liu, Hang; Lin, Min; Ding, Yali; Song, Chunhua; Li, Yan

    2016-08-01

    HBV (hepatitis B virus) genotyping is important in determining the clinical manifestation of disease and treatment response, particularly, in patients with low viral loads. Also, sensitive detection of HBV antiviral drug resistance mutations is essential for monitoring therapy response.Asensitive direct sequencing method for genotyping and the drug resistance mutation detection of low levels of HBV DNA in patients' plasma is developed by PCR amplification of the DNA with novel universal primers.The novel, common, and universal primers were identified by alignment of RT region of all the HBV DNA sequences in databases. These primers could efficiently amplify the RT region of HBV virus at low DNA levels by directly sequencing the resulting PCR products, and mapping with the reference sequence made it possible to clearly obtain the HBV subtypes and identify the resistance mutations in the samples with HBV DNA level as low as 20 IU/mL. We examined the reliability of the method in clinical samples, and found it could detect the HBV subtypes and drug resistance mutations in 80 clinical HBV samples with low HBV DNA levels ranging from 20 to 200 IU/mL.This method is a sensitive and reliable direct sequencing method for HBV genotyping and antiviral drug resistance mutation detection, and is helpful for efficiently monitoring the response to therapy in HBV patients. PMID:27537600

  9. Development of species-specific primers for rapid identification of Debaryomyces hansenii.

    PubMed

    Wrent, Petra; Rivas, Eva-María; Gil de Prado, Elena; Peinado, José M; de Silóniz, María-Isabel

    2015-01-16

    In this work, we developed a specific PCR assay for Debaryomyces hansenii strains that uses a putative homologous PAD1 region (729 bp) present in this yeast species as a target. The amplification of this sequence with the D. hansenii specific primer pair (DhPADF/DhPADR) was found to be a rapid, specific and an affordable method enabling identification of D. hansenii from other yeast strains. Primers were tested in almost 100 strains, 49 strains from Type Culture Collection belonging to the genus Debaryomyces and to other yeast species commonly found in foods or related genera. These primers were able to discriminate between closely related species of Debaryomyces, such as Debaryomyces fabryi and Debaryomyces subglobosus, with a 100% detection rate for D. hansenii. Also, the method was tested in 45 strains from different foods. Results confirmed the specificity of the PCR method and detected two earlier misidentifications of D. hansenii strains obtained by RFLP analysis of the 5.8S ITS rDNA region. Subsequently we confirmed by sequencing the D1/D2 domain of 26S rDNA that these strains belonged to D. fabryi. We call attention in this work to the fact that the RFLPs of the 5.8S ITS rDNA profiles of D. hansenii, D. fabryi and D. subglobosus are the same and this technique will thus lead to incorrect identifications. PMID:25462930

  10. Genetic linkage analysis using pooled DNA and infrared detection of tailed STRP primer patterns

    NASA Astrophysics Data System (ADS)

    Oetting, William S.; Wildenberg, Scott C.; King, Richard A.

    1996-04-01

    The mapping of a disease locus to a specific chromosomal region is an important step in the eventual isolation and analysis of a disease causing gene. Conventional mapping methods analyze large multiplex families and/or smaller nuclear families to find linkage between the disease and a chromosome marker that maps to a known chromosomal region. This analysis is time consuming and tedious, typically requiring the determination of 30,000 genotypes or more. For appropriate populations, we have instead utilized pooled DNA samples for gene mapping which greatly reduces the amount of time necessary for an initial chromosomal screen. This technique assumes a common founder for the disease locus of interest and searches for a region of a chromosome shared between affected individuals. Our analysis involves the PCR amplification of short tandem repeat polymorphisms (STRP) to detect these shared regions. In order to reduce the cost of genotyping, we have designed unlabeled tailed PCR primers which, when combined with a labeled universal primer, provides for an alternative to synthesizing custom labeled primers. The STRP pattern is visualized with an infrared fluorescence based automated DNA sequencer and the patterns quantitated by densitometric analysis of the allele pattern. Differences in the distribution of alleles between pools of affected and unaffected individuals, including a reduction in the number of alleles in the affected pool, indicate the sharing of a region of a chromosome. We have found this method effective for markers 10 - 15 cM away from the disease locus for a recessive genetic disease.

  11. New universal primers for genotyping and resistance detection of low HBV DNA levels.

    PubMed

    Tong, Yongqing; Liu, Bei; Liu, Hui; Zheng, Hongyun; Gu, Jian; Liu, Hang; Lin, Min; Ding, Yali; Song, Chunhua; Li, Yan

    2016-08-01

    HBV (hepatitis B virus) genotyping is important in determining the clinical manifestation of disease and treatment response, particularly, in patients with low viral loads. Also, sensitive detection of HBV antiviral drug resistance mutations is essential for monitoring therapy response.Asensitive direct sequencing method for genotyping and the drug resistance mutation detection of low levels of HBV DNA in patients' plasma is developed by PCR amplification of the DNA with novel universal primers.The novel, common, and universal primers were identified by alignment of RT region of all the HBV DNA sequences in databases. These primers could efficiently amplify the RT region of HBV virus at low DNA levels by directly sequencing the resulting PCR products, and mapping with the reference sequence made it possible to clearly obtain the HBV subtypes and identify the resistance mutations in the samples with HBV DNA level as low as 20 IU/mL. We examined the reliability of the method in clinical samples, and found it could detect the HBV subtypes and drug resistance mutations in 80 clinical HBV samples with low HBV DNA levels ranging from 20 to 200 IU/mL.This method is a sensitive and reliable direct sequencing method for HBV genotyping and antiviral drug resistance mutation detection, and is helpful for efficiently monitoring the response to therapy in HBV patients.

  12. mRNA profiling for body fluid identification by reverse transcription endpoint PCR and realtime PCR.

    PubMed

    Haas, C; Klesser, B; Maake, C; Bär, W; Kratzer, A

    2009-03-01

    mRNA profiling is a promising new method for the identification of body fluids from biological stains. Major advantages of mRNA profiling are the possibility of detecting several body fluids in one multiplex reaction and of simultaneously isolating DNA without loss of material. A reverse transcription endpoint polymerase chain reaction (PCR) method and a realtime PCR assay were established for the identification of blood, saliva, semen, vaginal secretions and menstrual blood, and were compared to conventional enzymatic and immunologic tests. The results for specificity, sensitivity and suitability to biological stains were satisfying and mRNA stability was demonstrated for up to 2-year-old stains. Two novel multiplex assays were created with the endpoint PCR primers: multiplex 1 amplifies two markers for each of the above mentioned body fluids and is suited for screening; multiplex 2 was designed for the detection of blood, vaginal secretions and menstrual blood. The results demonstrate that both endpoint PCR and realtime PCR are suitable for the identification of body fluids in forensic stains and represent an effective alternative to conventional enzymatic and immunologic tests.

  13. Which Microbial Communities Are Present? Importance of Selecting Appropriate Primers and Probes for Use in Molecular Microbiological Methods (MMM) in Oilfields

    NASA Astrophysics Data System (ADS)

    Sørensen, Ketil Bernt

    Molecular microbiology techniques play an increasing role in the oil industry. Most of the current applications are based on either Fluorescence in situ Hybridisation (FISH) or polymerase chain reaction (PCR) or some variation thereof. These types of approaches require the use of oligonucleotide primers and probes (i.e. short fragments of DNA that are complementary to the target DNA/RNA of the microorganism of interest). In the case of FISH, the probes are fluorescently labelled in order to identify the target cells. Before undertaking either FISH or PCR approaches, it is important to select the most appropriate primers or probes for targeting the microorganisms of interest in a given environment.

  14. PCR Assay for Species-Specific Identification of Bacteroides thetaiotaomicron

    PubMed Central

    Teng, Lee-Jene; Hsueh, Po-Ren; Tsai, Jui-Chang; Chiang, Feng-Lin; Chen, Ching-Yi; Ho, Shen-Wu; Luh, Kwen-Tay

    2000-01-01

    Bacteroides thetaiotaomicron is the second most frequently encountered species of the anaerobes isolated from clinical specimens. We developed a PCR-based assay for the rapid identification of B. thetaiotaomicron. Specific primers were based on shared amplicons of about 1.2 kb generated from B. thetaiotaomicron by randomly amplified polymorphic DNA. This 1.2-kb fragment was sequenced and then used to design a set of PCR amplification primers. This PCR generated an amplification product of 721 bp, which was unique to all 65 isolates of B. thetaiotaomicron tested. There was no amplification with isolates of other bacterial species. Restriction enzyme digestion of the amplification product and dot blot hybridization further verified the specificity of the assay. These results suggest that this PCR assay targets a nucleotide sequence that is strongly conserved in B. thetaiotaomicron. This simple and rapid PCR assay provides a rapid and accurate method for identification of B. thetaiotaomicron and shows promise for the detection of B. thetaiotaomicron in clinical samples. PMID:10747167

  15. Multiplex PCR: Optimization and Application in Diagnostic Virology

    PubMed Central

    Elnifro, Elfath M.; Ashshi, Ahmed M.; Cooper, Robert J.; Klapper, Paul E.

    2000-01-01

    PCR has revolutionized the field of infectious disease diagnosis. To overcome the inherent disadvantage of cost and to improve the diagnostic capacity of the test, multiplex PCR, a variant of the test in which more than one target sequence is amplified using more than one pair of primers, has been developed. Multiplex PCRs to detect viral, bacterial, and/or other infectious agents in one reaction tube have been described. Early studies highlighted the obstacles that can jeopardize the production of sensitive and specific multiplex assays, but more recent studies have provided systematic protocols and technical improvements for simple test design. The most useful of these are the empirical choice of oligonucleotide primers and the use of hot start-based PCR methodology. These advances along with others to enhance sensitivity and specificity and to facilitate automation have resulted in the appearance of numerous publications regarding the application of multiplex PCR in the diagnosis of infectious agents, especially those which target viral nucleic acids. This article reviews the principles, optimization, and application of multiplex PCR for the detection of viruses of clinical and epidemiological importance. PMID:11023957

  16. High cyanobacterial diversity in coralloid roots of cycads revealed by PCR fingerprinting.

    PubMed

    Zheng, Weiwen; Song, Tieying; Bao, Xiaodong; Bergman, Birgitta; Rasmussen, Ulla

    2002-06-01

    The genetic diversity of symbiotic cyanobacteria in coralloid roots of cycads was examined using PCR fingerprinting with primers derived from repetitive sequences. The highest genetic resolution was achieved using the primer corresponding to the short tandemly repeated repetitive sequences. The cyanobacteria were collected from the coralloid roots of a large number of indigenous cycad plants and used directly in the PCR. It could be demonstrated that numerous cyanobacteria were present in a single coralloid root. Even within a single cluster in the coralloid root, diversity could be observed between the apical, middle and basal regions.

  17. Widespread use of real-time PCR for rickettsial diagnosis.

    PubMed

    Renvoisé, Aurélie; Rolain, Jean-Marc; Socolovschi, Cristina; Raoult, Didier

    2012-02-01

    We report 2 years of experience with rickettsial molecular diagnosis using real-time PCR at the French National Reference Center. All Rickettsia genomes available were compared to discover specific sequences to design new sets of primers and probes. The specificity was verified in silico and against a panel of 30 rickettsial species. Sensitivity was determined using 10-fold serial dilutions. Finally, primers and probes that were both specific and sensitive were routinely used for the diagnosis of rickettsial infections from clinical specimens. We retained sets of primers and probes to detect spotted fever group Rickettsia, typhus group Rickettsia,Rickettsia conorii,Rickettsia slovaca,Rickettsia africae and Rickettsia australis; 643 clinical samples were screened for the presence of Rickettsia DNA. Overall, 45 positive samples were detected, including 15 Rickettsia africae, nine R. conorii, five Rickettsia sibirica mongolitimonae, four R. slovaca, two R. australis, four Rickettsia massiliae, one Rickettsia honei, one Rickettsia typhi and eight Rickettsia sp. Positive samples were detected mainly from cutaneous biopsies and swabs (31/45). Widespread use of real-time PCR is inexpensive and reduces delay in the diagnosis of rickettsial infections. These real-time PCR assays could be implemented easily in laboratories that have molecular facilities and may be added to existing molecular tools as a point-of-care strategy.

  18. A multiplex PCR protocol for rapid identification of Candida glabrata and its phylogenetically related species Candida nivariensis and Candida bracarensis.

    PubMed

    Romeo, Orazio; Scordino, Fabio; Pernice, Ida; Lo Passo, Carla; Criseo, Giuseppe

    2009-10-01

    We have developed a multiplex PCR protocol for the detection of Candida glabrata and its closely related species Candida nivariensis and Candida bracarensis. The method uses four PCR primers, targeting the ITS1 region and the 5.8S ribosomal RNA gene. The combination of these primers yielded unique results to all Candida species tested. The PCR assay we developed was found to be a rapid, specific and easy to perform method and it will be useful for characterizing large numbers of isolates for epidemiological studies.

  19. New primers for adhesive bonding of aluminum alloys

    NASA Technical Reports Server (NTRS)

    Burrell, B. W.; Port, W. S.

    1971-01-01

    Synthetic polypeptide adhesive primers are effective, with high temperature epoxy resins, at temperatures from 100 deg to 300 deg C. Lap-shear failure loads and lap-shear strength of both primers are discussed.

  20. A strategy for detection of viruses in groundwater by PCR.

    PubMed

    Abbaszadegan, M; Stewart, P; LeChevallier, M

    1999-02-01

    We evaluated the use of the PCR for detection of enteric viruses in groundwater. To do this, we used an improved sample-processing technique and a large-volume amplification protocol. The objective of this study was to use advanced molecular techniques to develop a rapid and simple method which can be used by the water industry for detection of viral contamination in a variety of water samples. The strategy described here fulfills the water industry's need for a rapid, reliable, easily performed method for analyzing groundwater for virus contamination. Viruses were detected after concentration from at least 400 gallons (1,512 liters) of water by a filter adsorption and elution method, which resulted in a concentrate containing viruses. A total of 150 samples were analyzed by performing cell culture assays for enteroviruses and by performing reverse transcription PCR (RT-PCR) analyses for enteroviruses, hepatitis A virus, and rotavirus. Thirteen samples (8.7%) produced cellular cytopathic effects when the Buffalo green monkey cell line was used. When primers specific for enteroviruses were used in RT-PCR, 40 of 133 samples (30.1%) tested positive for the presence of enterovirus RNA. When hepatitis A virus-specific primers were used, 12 of 139 samples (8.6%) were considered positive for the presence of hepatitis A viral RNA. The RT-PCR analysis performed with rotavirus-specific primers identified 18 of 130 samples (13.8%) that were positive for rotavirus RNA sequences. Our sample-processing technique and large-volume PCR protocol (reaction volume, 300 microliter) resulted in sufficient removal or dilution of inhibitors so that more than 95% of the samples could be assayed by PCR. Because of its sensitivity for detecting viral nucleic acid sequences, PCR analysis should produce more positive results than cell culture analysis. Since either cell culture analysis or PCR can reveal only a "snapshot" of the quality of the groundwater being sampled, PCR seems to be a

  1. DNA probes and PCR for diagnosis of parasitic infections.

    PubMed Central

    Weiss, J B

    1995-01-01

    DNA probe and PCR-based assays to identify and detect parasites are technically complex; however, they have high sensitivity, directly detect parasites independent of the immunocompetence or previous clinical history of the patient, and can distinguish between organisms that are morphologically similar. Diagnosis of parasites is often based on direct detection by microscopy, which is insensitive and laborious and can lack specificity. Most PCR-based assays were more sensitive than DNA probe assays. The development of PCR-based diagnostic assays requires multiple steps following the initial selection of oligonucleotide primers and reporter probe. Generally, the ability to detect the DNA of one parasite was attained by PCR; however, advances in the preparation of samples for PCR (extraction of DNA while removing PCR inhibitors) will be required to achieve that sensitivity with human specimens. Preliminary PCR systems have been developed for many different parasites, yet few have been evaluated with a large number of clinical specimens and/or under field conditions. Those evaluations are essential for determination of clinical and field utility and performance and of the most appropriate application of the assay. Several situations in which PCR-based diagnosis will result in epidemiologic, medical, or public health advances have been identified. PMID:7704890

  2. Primer pairs for the specific environmental detection and T-RFLP analysis of the ubiquitous flagellate taxa Chrysophyceae and Kinetoplastea.

    PubMed

    Glaser, Karin; Kuppardt, Anke; Krohn, Sandra; Heidtmann, Anett; Harms, Hauke; Chatzinotas, Antonis

    2014-05-01

    Bacterivorous protists play a key role in microbial soil food webs, however due to the lack of specific PCR protocols targeting selected protist taxa, knowledge on the diversity and dynamics of these groups is scarce. We developed specific PCR primers in combination with a T-RFLP protocol for the cultivation-independent analysis of two important taxa of bacterivorous flagellates, the Chrysophyceae and Kinetoplastea, in soil samples. Sequence analysis of clone libraries originating from two soils in temperate regions demonstrated the specificity of the respective primer pairs. Clone sequences affiliating to the Chrysophyceae mainly clustered within the clade C2, which has been known so far for its presence mainly in cold climatic regions, whereas Kinetoplastea sequences were mainly related to the Neobodonid clade. Based on an in silico restriction analysis of database sequence entries, suitable restriction enzymes for a T-RFLP approach were selected. This in silico approach revealed the necessity to use a combination of two restriction enzymes for T-RFLP analysis of the Chrysophyceae. Soil T-RFLP profiles reflected all T-RFs of the clone library sequences obtained from the same soils and allowed to distinguish flagellate communities from different sites. We propose to use these primer pairs for PCR detection and rapid fingerprint screening in environmental samples and envisage their use also for quantitative PCR or next generation sequencing approaches.

  3. Sex determination using PCR.

    PubMed

    Kima, Peter E; Rasche, Madeline E

    2004-03-01

    PCR has revolutionized many aspects of biochemistry and molecular biology research. In the following exercise, students learn PCR by isolating their own DNA, amplifying specific segments of the X and Y chromosomes, and estimating the sizes of the PCR products using agarose gel electrophoresis. Based on the pattern of PCR products, students can distinguish between male and female samples and determine the gender of an unknown DNA donor. The exercise is presented for upper division undergraduate majors in microbiology, biochemistry, and molecular biology, but can be adapted to different academic levels and disciplines. The use of student samples in the exercise can enhance learning of these techniques by making PCR and agarose gel electrophoresis directly relevant to the students.

  4. A primer for criticality calculations with DANTSYS

    SciTech Connect

    Busch, R.D.

    1997-08-01

    With the closure of many experimental facilities, the nuclear safety analyst has to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. Although deterministic methods often do not provide exact models of a system, a substantial amount of reliable information on nuclear systems can be obtained using these methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico (UNM) in cooperation with the Radiation Transport Group at Los Alamos National Laboratory (LANL) has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. DANTSYS is the new name of the group of codes formerly known as: ONEDANT, TWODANT, TWOHEX, TWOGQ, and THREEDANT. The primer is designed to teach bu example, with each example illustrating two or three DANTSYS features useful in criticality analyses. Starting with a Quickstart chapter, the primer gives an overview of the basic requirements for DANTSYS input and allows the user to quickly run a simple criticality problem with DANTSYS. Each chapter has a list of basic objectives at the beginning identifying the goal of the chapter and the individual DANTSYS features covered in detail in the chapter example problems. On completion of the primer, it is expected that the user will be comfortable doing criticality calculations with DANTSYS and can handle 60--80% of the situations that normally arise in a facility. The primary provides a set of input files that can be selective modified by the user to fit each particular problem.

  5. Isolation of Fungal Pathogens to an Edible Mushroom, Pleurotus eryngii, and Development of Specific ITS Primers.

    PubMed

    Kim, Sang-Woo; Kim, Sinil; Lee, Hyun-Jun; Park, Ju-Wan; Ro, Hyeon-Su

    2013-12-01

    Fungal pathogens have caused severe damage to the commercial production of Pleurotus eryngii, the king oyster mushroom, by reducing production yield, causing deterioration of commercial value, and shortening shelf-life. Four strains of pathogenic fungi, including Trichoderma koningiopsis DC3, Phomopsis sp. MP4, Mucor circinelloides MP5, and Cladosporium bruhnei MP6, were isolated from the bottle culture of diseased P. eryngii. A species-specific primer set was designed for each fungus from the ITS1-5.8S rDNA-ITS2 sequences. PCR using the ITS primer set yielded a unique DNA band for each fungus without any cross-reaction, proving the validity of our method in detection of mushroom fungal pathogens. PMID:24493949

  6. Construction of a Transcription Map for Papillomaviruses using RACE, RNase Protection, and Primer Extension Assays.

    PubMed

    Wang, Xiaohong; Zheng, Zhi-Ming

    2016-01-01

    Papillomaviruses are a family of small, non-enveloped DNA tumor viruses. Knowing a complete transcription map of each papillomavirus genome can provide guidance for various papillomavirus studies. This unit provides detailed protocols to construct a transcription map of human papillomavirus type 18. The same approach can be easily adapted to other transcription map studies of any other papillomavirus genotype due to the high degree of conservation in genome structure, organization, and gene expression among papillomaviruses. The focused methods are 5'- and 3'-rapid amplification of cDNA ends (RACE), which are techniques commonly used in molecular biology to obtain full-length RNA transcript or to map a transcription start site (TSS) or an RNA polyadenylation (pA) cleavage site. Primer walking RT-PCR is a method for studying the splicing junction of RACE products. In addition, RNase protection assay and primer extension are also introduced as alternative methods in the mapping analysis. PMID:26855281

  7. Differentiation of five tuna species by a multiplex primer-extension assay.

    PubMed

    Bottero, Maria Teresa; Dalmasso, Alessandra; Cappelletti, Marco; Secchi, Camillo; Civera, Tiziana

    2007-05-01

    A novel methodology based on analysis of mtDNA-cytb diagnostic sites was performed to discriminate four closely related species of Thunnus (Thunnus alalunga, Thunnus albacares, Thunnus obesus and Thunnus thynnus) and one species of Euthynnus (Katsuwonus pelamis) genus in raw and canned tuna. The primers used in the preliminary PCR designed in well conserved region upstream and downstream of the diagnosis sites successfully amplified a 132bp region from the cytb gene of all the species taken into consideration. The sites of diagnosis have been interrogate simultaneously using a multiplex primer-extension assay (PER) and the results were confirmed by fragment sequencing. The applicability of the multiplex PER assay to commercial canned tuna samples was also demonstrated. The proposed test could be useful for detection of fraud and for seafood traceability. PMID:17353060

  8. Construction of a Transcription Map for Papillomaviruses using RACE, RNase Protection, and Primer Extension Assays.

    PubMed

    Wang, Xiaohong; Zheng, Zhi-Ming

    2016-02-08

    Papillomaviruses are a family of small, non-enveloped DNA tumor viruses. Knowing a complete transcription map of each papillomavirus genome can provide guidance for various papillomavirus studies. This unit provides detailed protocols to construct a transcription map of human papillomavirus type 18. The same approach can be easily adapted to other transcription map studies of any other papillomavirus genotype due to the high degree of conservation in genome structure, organization, and gene expression among papillomaviruses. The focused methods are 5'- and 3'-rapid amplification of cDNA ends (RACE), which are techniques commonly used in molecular biology to obtain full-length RNA transcript or to map a transcription start site (TSS) or an RNA polyadenylation (pA) cleavage site. Primer walking RT-PCR is a method for studying the splicing junction of RACE products. In addition, RNase protection assay and primer extension are also introduced as alternative methods in the mapping analysis.

  9. Universal COI primers for DNA barcoding amphibians.

    PubMed

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians.

  10. Universal COI primers for DNA barcoding amphibians.

    PubMed

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians. PMID:22145866

  11. Identification of a Universally Primed-PCR-Derived Sequence-Characterized Amplified Region Marker for an Antagonistic Strain of Clonostachys rosea and Development of a Strain-Specific PCR Detection Assay

    PubMed Central

    Bulat, Sergey A.; Lübeck, Mette; Alekhina, Irina A.; Jensen, Dan Funck; Knudsen, Inge M. B.; Lübeck, Peter Stephensen

    2000-01-01

    We developed a PCR detection method that selectively recognizes a single biological control agent and demonstrated that universally primed PCR (UP-PCR) can identify strain-specific markers. Antagonistic strains of Clonostachys rosea (syn. Gliocladium roseum) were screened by UP-PCR, and a strain-specific marker was identified for strain GR5. No significant sequence homology was found between this marker and any other sequences in the databases. Southern blot analysis of the PCR product revealed that the marker represented a single-copy sequence specific for strain GR5. The marker was converted into a sequence-characterized amplified region (SCAR), and a specific PCR primer pair was designed. Eighty-two strains, isolated primarily from Danish soils, and 31 soil samples, originating from different localities, were tested, and this specificity was confirmed. Two strains responded to the SCAR primers under suboptimal PCR conditions, and the amplified sequences from these strains were similar, but not identical, to the GR5 marker. Soil assays in which total DNA was extracted from GR5-infested and noninoculated field soils showed that the SCAR primers could detect GR5 in a pool of mixed DNA and that no other soil microorganisms present contained sequences amplified by the primers. The assay developed will be useful for monitoring biological control agents released into natural field soil. PMID:11055920

  12. IDENTIFICATION OF SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    The nucleotide sequence of a 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachybotrys and the related genus Memnoniella. This information was used to infer the phylogenitic relati...

  13. IDENTIFICATION OF PUTATIVE SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    The nucleotide sequence of a c 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachbotrys and the related genus Memnoniella. This information was used to infer the phylogenetic relatio...

  14. PCR primer pairs for 100 microsatellites in red drum (Sciaenops ocellatus)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    One hundred nuclear-encoded microsatellites from a genomic DNA library of red drum (Sciaenops ocellatus) were isolated and characterized. Eight of the microsatellites had tetra-nucleotide motifs, while 92 had di-nucleotide motifs. The average number of alleles at the 100 microsatellites among a sa...

  15. PCR primers for microsatellite loci in the desert tortoise (Gopherus agassizii, Testudinidae)

    USGS Publications Warehouse

    Edwards, T.; Goldberg, C.S.; Kaplan, M.E.; Schwalbe, C.R.; Swann, D.E.

    2003-01-01

    The desert tortoise, Gopherus agassizii, is a threatened species native to the North American desert southwest and is recognized as having distinct Mojave and Sonoran populations. We identified six polymorphic microsatellite loci in the desert tortoise. All six loci were polymorphic in Sonoran samples. Five of the loci were variable in Mojave samples with varying degrees of amplification success. Two of the loci exhibited low allelic variation (2-3 alleles) while four were highly variable (8-27 alleles).

  16. Real-Time PCR

    NASA Astrophysics Data System (ADS)

    Evrard, A.; Boulle, N.; Lutfalla, G. S.

    Over the past few years there has been a considerable development of DNA amplification by polymerase chain reaction (PCR), and real-time PCR has now superseded conventional PCR techniques in many areas, e.g., the quantification of nucleic acids and genotyping. This new approach is based on the detection and quantification of a fluorescent signal proportional to the amount of amplicons generated by PCR. Real-time detection is achieved by coupling a thermocycler with a fluorimeter. This chapter discusses the general principles of quantitative real-time PCR, the different steps involved in implementing the technique, and some examples of applications in medicine. The polymerase chain reaction (PCR) provides a way of obtaining a large number of copies of a double-stranded DNA fragment of known sequence. This DNA amplification technique, developed in 1985 by K. Mullis (Cetus Corporation), saw a spectacular development over the space of a few years, revolutionising the methods used up to then in molecular biology. Indeed, PCR has many applications, such as the detection of small amounts of DNA, cloning, and quantitative analysis (assaying), each of which will be discussed further below.

  17. PriFi: using a multiple alignment of related sequences to find primers for amplification of homologs.

    PubMed

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene H; Sandal, Niels; Stougaard, Jens

    2005-07-01

    Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from phylogenetically related species and outputs a list of possibly degenerate primer pairs fulfilling a number of criteria, such that the primers have a maximal probability of amplifying orthologous sequences in other phylogenetically related species. Operating on a genome-wide scale, PriFi automates the first steps of a procedure for developing general markers serving as common anchor loci across species. To accommodate users with special preferences, configuration settings and criteria can be customized.

  18. Allele Specific Locked Nucleic Acid Quantitative PCR (ASLNAqPCR): An Accurate and Cost-Effective Assay to Diagnose and Quantify KRAS and BRAF Mutation

    PubMed Central

    Morandi, Luca; de Biase, Dario; Visani, Michela; Cesari, Valentina; De Maglio, Giovanna; Pizzolitto, Stefano; Pession, Annalisa; Tallini, Giovanni

    2012-01-01

    The use of tyrosine kinase inhibitors (TKIs) requires the testing for hot spot mutations of the molecular effectors downstream the membrane-bound tyrosine kinases since their wild type status is expected for response to TKI therapy. We report a novel assay that we have called Allele Specific Locked Nucleic Acid quantitative PCR (ASLNAqPCR). The assay uses LNA-modified allele specific primers and LNA-modified beacon probes to increase sensitivity, specificity and to accurately quantify mutations. We designed primers specific for codon 12/13 KRAS mutations and BRAF V600E, and validated the assay with 300 routine samples from a variety of sources, including cytology specimens. All were analyzed by ASLNAqPCR and Sanger sequencing. Discordant cases were pyrosequenced. ASLNAqPCR correctly identified BRAF and KRAS mutations in all discordant cases and all had a mutated/wild type DNA ratio below the analytical sensitivity of the Sanger method. ASLNAqPCR was 100% specific with greater accuracy, positive and negative predictive values compared with Sanger sequencing. The analytical sensitivity of ASLNAqPCR is 0.1%, allowing quantification of mutated DNA in small neoplastic cell clones. ASLNAqPCR can be performed in any laboratory with real-time PCR equipment, is very cost-effective and can easily be adapted to detect hot spot mutations in other oncogenes. PMID:22558339

  19. Allele specific locked nucleic acid quantitative PCR (ASLNAqPCR): an accurate and cost-effective assay to diagnose and quantify KRAS and BRAF mutation.

    PubMed

    Morandi, Luca; de Biase, Dario; Visani, Michela; Cesari, Valentina; De Maglio, Giovanna; Pizzolitto, Stefano; Pession, Annalisa; Tallini, Giovanni

    2012-01-01

    The use of tyrosine kinase inhibitors (TKIs) requires the testing for hot spot mutations of the molecular effectors downstream the membrane-bound tyrosine kinases since their wild type status is expected for response to TKI therapy. We report a novel assay that we have called Allele Specific Locked Nucleic Acid quantitative PCR (ASLNAqPCR). The assay uses LNA-modified allele specific primers and LNA-modified beacon probes to increase sensitivity, specificity and to accurately quantify mutations. We designed primers specific for codon 12/13 KRAS mutations and BRAF V600E, and validated the assay with 300 routine samples from a variety of sources, including cytology specimens. All were analyzed by ASLNAqPCR and Sanger sequencing. Discordant cases were pyrosequenced. ASLNAqPCR correctly identified BRAF and KRAS mutations in all discordant cases and all had a mutated/wild type DNA ratio below the analytical sensitivity of the Sanger method. ASLNAqPCR was 100% specific with greater accuracy, positive and negative predictive values compared with Sanger sequencing. The analytical sensitivity of ASLNAqPCR is 0.1%, allowing quantification of mutated DNA in small neoplastic cell clones. ASLNAqPCR can be performed in any laboratory with real-time PCR equipment, is very cost-effective and can easily be adapted to detect hot spot mutations in other oncogenes.

  20. A Comprehensive Analysis of Primer IDs to Study Heterogeneous HIV-1 Populations.

    PubMed

    Seifert, David; Di Giallonardo, Francesca; Töpfer, Armin; Singer, Jochen; Schmutz, Stefan; Günthard, Huldrych F; Beerenwinkel, Niko; Metzner, Karin J

    2016-01-16

    Determining the composition of viral populations is becoming increasingly important in the field of medical virology. While recently developed computational tools for viral haplotype analysis allow for correcting sequencing errors, they do not always allow for the removal of errors occurring in the upstream experimental protocol, such as PCR errors. Primer IDs (pIDs) are one method to address this problem by harnessing redundant template resampling for error correction. By using a reference mixture of five HIV-1 strains, we show how pIDs can be useful for estimating key experimental parameters, such as the substitution rate of the PCR process and the reverse transcription (RT) error rate. In addition, we introduce a hidden Markov model for determining the recombination rate of the RT PCR process. We found no strong sequence-specific bias in pID abundances (the same RT efficiencies as compared to commonly used short, specific RT primers) and no effects of pIDs on the estimated distribution of the references viruses.