The introduction of new vaccines into developing countries. III. The role of intellectual property.

PubMed

Mahoney, Richard T; Pablos-Mendez, Ariel; Ramachandran, S

2004-01-26

The development of new vaccines that address the particular needs of developing countries has been proceeding slowly. A number of new public sector vaccine research and development initiatives have been launched to address this problem. These new initiatives find that they often wish to collaborate with the private sector and, in collaborating with the private sector, they must address issues of intellectual property (IP) management. It has not been well understood why IP management is important and how such management by public sector groups can best be conducted. IP management has become very important because vaccine research and development is driven by the regulatory process. The regulatory process has increased the cost of vaccine development to very high levels especially for the highly sophisticated new vaccines currently under development. Thus, investors seek IP protection for the required large investments. Conversely, we assert this concept as a new insight, IP rights are essential for mobilizing the significant funds necessary to meet regulatory requirements. Thus, IP rights are of value not only for investors but also for the public at large. In the absence of public sector mechanisms to carry out the functions that the private sector currently conducts, the public sector needs to increase its sophistication in IP management and needs to identify and implement strategies that will help the public sector to achieve its public health goals, especially for the poor and, among these individuals, the poor in developing countries. This paper suggests some strategies that might be used by the public sector to help achieve its public health goals, especially for the poor.

Securing Real-Time Sessions in an IMS-Based Architecture

NASA Astrophysics Data System (ADS)

Cennamo, Paolo; Fresa, Antonio; Longo, Maurizio; Postiglione, Fabio; Robustelli, Anton Luca; Toro, Francesco

The emerging all-IP mobile network infrastructures based on 3rd Generation IP Multimedia Subsystem philosophy are characterised by radio access technology independence and ubiquitous connectivity for mobile users. Currently, great focus is being devoted to security issues since most of the security threats presently affecting the public Internet domain, and the upcoming ones as well, are going to be suffered by mobile users in the years to come. While a great deal of research activity, together with standardisation efforts and experimentations, is carried out on mechanisms for signalling protection, very few integrated frameworks for real-time multimedia data protection have been proposed in a context of IP Multimedia Subsystem, and even fewer experimental results based on testbeds are available. In this paper, after a general overview of the security issues arising in an advanced IP Multimedia Subsystem scenario, a comprehensive infrastructure for real-time multimedia data protection, based on the adoption of the Secure Real-Time Protocol, is proposed; then, the development of a testbed incorporating such functionalities, including mechanisms for key management and cryptographic context transfer, and allowing the setup of Secure Real-Time Protocol sessions is presented; finally, experimental results are provided together with quantitative assessments and comparisons of system performances for audio sessions with and without the adoption of the Secure Real-Time Protocol framework.

Multi-service terminal adapter based on IP technology applications in rural area

NASA Astrophysics Data System (ADS)

Gao, Li; Li, Xiaobo; Yan, Juntao; Ren, Xupeng

Take advantage of ample modern existing telecom network resources to rural areas may achieve it's information society gradually. This includes the establishment of integrated rural information service platform, modern remote education center and electronic administration management platform for rural areas. The geographical and economic constraints must be overcome for structuring the rural service support system, in order to provide technical support, information products and information services to modern rural information service system. It is important that development an access platform based IP technology, which supports multi-service access in order to implement a variety of types of mobile terminal equipment adapter access and to reduce restrictions on mobile terminal equipment.

A Mechanism for Reliable Mobility Management for Internet of Things Using CoAP

PubMed Central

Chun, Seung-Man; Park, Jong-Tae

2017-01-01

Under unreliable constrained wireless networks for Internet of Things (IoT) environments, the loss of the signaling message may frequently occur. Mobile Internet Protocol version 6 (MIPv6) and its variants do not consider this situation. Consequently, as a constrained device moves around different wireless networks, its Internet Protocol (IP) connectivity may be frequently disrupted and power can be drained rapidly. This can result in the loss of important sensing data or a large delay for time-critical IoT services such as healthcare monitoring and disaster management. This paper presents a reliable mobility management mechanism in Internet of Things environments with lossy low-power constrained device and network characteristics. The idea is to use the Internet Engineering Task Force (IETF) Constrained Application Protocol (CoAP) retransmission mechanism to achieve both reliability and simplicity for reliable IoT mobility management. Detailed architecture, algorithms, and message extensions for reliable mobility management are presented. Finally, performance is evaluated using both mathematical analysis and simulation. PMID:28085109

A Mechanism for Reliable Mobility Management for Internet of Things Using CoAP.

PubMed

Chun, Seung-Man; Park, Jong-Tae

2017-01-12

Under unreliable constrained wireless networks for Internet of Things (IoT) environments, the loss of the signaling message may frequently occur. Mobile Internet Protocol version 6 (MIPv6) and its variants do not consider this situation. Consequently, as a constrained device moves around different wireless networks, its Internet Protocol (IP) connectivity may be frequently disrupted and power can be drained rapidly. This can result in the loss of important sensing data or a large delay for time-critical IoT services such as healthcare monitoring and disaster management. This paper presents a reliable mobility management mechanism in Internet of Things environments with lossy low-power constrained device and network characteristics. The idea is to use the Internet Engineering Task Force (IETF) Constrained Application Protocol (CoAP) retransmission mechanism to achieve both reliability and simplicity for reliable IoT mobility management. Detailed architecture, algorithms, and message extensions for reliable mobility management are presented. Finally, performance is evaluated using both mathematical analysis and simulation.

Location Management in a Transport Layer Mobility Architecture

NASA Technical Reports Server (NTRS)

Eddy, Wesley M.; Ishac, Joseph

2005-01-01

Mobility architectures that place complexity in end nodes rather than in the network interior have many advantageous properties and are becoming popular research topics. Such architectures typically push mobility support into higher layers of the protocol stack than network layer approaches like Mobile IP. The literature is ripe with proposals to provide mobility services in the transport, session, and application layers. In this paper, we focus on a mobility architecture that makes the most significant changes to the transport layer. A common problem amongst all mobility protocols at various layers is location management, which entails translating some form of static identifier into a mobile node's dynamic location. Location management is required for mobile nodes to be able to provide globally-reachable services on-demand to other hosts. In this paper, we describe the challenges of location management in a transport layer mobility architecture, and discuss the advantages and disadvantages of various solutions proposed in the literature. Our conclusion is that, in principle, secure dynamic DNS is most desirable, although it may have current operational limitations. We note that this topic has room for further exploration, and we present this paper largely as a starting point for comparing possible solutions.

Effect of wrist and interphalangeal thumb movement on zone T2 flexor pollicis longus tendon tension in a human cadaver model.

PubMed

Rappaport, Patricia O; Thoreson, Andrew R; Yang, Tai-Hua; Reisdorf, Ramona L; Rappaport, Stephen M; An, Kai-Nan; Amadio, Peter C

2015-01-01

Therapy after flexor pollicis longus (FPL) repair typically mimics finger flexor management, but this ignores anatomic and biomechanical features unique to the FPL. We measured FPL tendon tension in zone T2 to identify biomechanically appropriate exercises for mobilizing the FPL. Eight human cadaver hands were studied to identify motions that generated enough force to achieve FPL movement without exceeding hypothetical suture strength. With the carpometacarpal and metacarpophalangeal joints blocked, appropriate forces were produced for both passive interphalangeal (IP) motion with 30° wrist extension and simulated active IP flexion from 0° to 35° with the wrist in the neutral position. This work provides a biomechanical basis for safely and effectively mobilizing the zone T2 FPL tendon. Our cadaver study suggests that it is safe and effective to perform early passive and active exercise to an isolated IP joint. NA. Copyright © 2015 Hanley & Belfus. Published by Elsevier Inc. All rights reserved.

Protein kinase C (PKC) phosphorylates human platelet inositol trisphosphate 5/sup +/-/-phosphomonoesterase (IP/sub 3/ 5'-p'tase) increasing phosphatase activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Connolly, T.M.; Majerus, P.W.

1986-05-01

Phosphoinositide breakdown in response to thrombin stimulation of human platelets generates messenger molecules that activate PKC (diglyceride) and mobilize Ca/sup + +/ (inositol tris-phosphates). The water soluble products of phospholipase C-mediated metabolism of phosphatidylinositol 4,5-diphosphate are inositol 1,4,5 P/sub 3/ (IP/sub 3/) and inositol 1:2-cyclic 4,5 P/sub 3/ (cIP/sub 3/). A specific phosphatase, IP/sub 3/ 5'-p'tase, cleaves the 5 phosphate from IP/sub 3/ or cIP/sub 3/ to form IP/sub 2/ or cIP/sub 2/ and P/sub i/, none of which mobilizes Ca/sup + +/. Thus, the IP/sub 3/ 5'-p'tase may regulate cellular responses to IP/sub 3/ or cIP/sub 3/. The authorsmore » find that IP/sub 3/ 5'-p'tase isolated from human platelets is phosphorylated by rat brain PKC, resulting in a 4-fold increase in IP/sub 3/ 5'-p'tase activity. The authors phosphorylated IP/sub 3/ 5'-p'tase using ..gamma.. /sup 32/P-ATP and found that the labeled enzyme comigrated on SDS-PAGE with the previously described 40K protein phosphorylated in response to thrombin stimulation of platelets. The similarity of the PKC-phosphorylated IP/sub 3/ 5'-p'tase observed in vitro and the thrombin-stimulated phosphorylated 40K protein known to be phosphorylated by PKC in vivo, suggests that these proteins may be the same. These results suggest that platelet Ca/sup + +/ mobilization maybe regulated by PKC phosphorylation of the IP/sub 3/ 5'-p'tase and can explain the observation that phorbol ester treatment of intact human platelets results in decreased production of IP/sub 3/ and decreased Ca/sup + +/ mobilization upon subsequent thrombin addition.« less

Inhibition of muscarinic-stimulated polyphosphoinositide hydrolysis and Ca2+ mobilization in cat iris sphincter smooth muscle cells by cAMP-elevating agents.

PubMed

Ding, K H; Husain, S; Akhtar, R A; Isales, C M; Abdel-Latif, A A

1997-09-01

The effects of carbachol (CCh) on inositol 1,4,5-trisphosphate (IP3) production and intracellular calcium ([Ca2+]i) mobilization, and their regulation by cAMP-elevating agents were investigated in SV-40 transformed cat iris sphincter smooth muscle (SV-CISM-2) cells. CCh produced time- and dose-dependent increases in IP3 production; the t1/2 and EC50 values were 68 s and 0.5 microM, respectively. The muscarinic agonist provoked a transient increase in [Ca2+]i which reached maximum within 77 s, and increased [Ca2+]i mobilization in a concentration-dependent manner with an EC50 of 1.4 microM. Thapsigargin, a Ca(2+)-pump inhibitor, caused a rapid rise in [Ca2+]i and subsequent addition of CCh was without effect. Both CCh-induced IP3 production and CCh-induced [Ca2+]i mobilization were more potently antagonized by 4-DAMP, an M3 muscarinic receptor antagonist, than by pirenzepine, an M1 receptor antagonist, suggesting that both responses are mediated through the M3 receptor subtype. Treatment of the cells with U73122, a phospholipase C (PLC) inhibitor, resulted in a concentration-dependent decrease in both CCh-stimulated IP3 production and [Ca2+]i mobilization. These data indicate close correlation between enhanced IP3 production and [Ca2+]i mobilization in these smooth muscle cells and suggest that the CCh-stimulated increase in [Ca2+]i could be mediated through increased IP3 production. Isoproterenol (ISO) inhibited CCh-induced IP3 production (IC50 = 80 nM) and [Ca2+]i mobilization (IC50 = 0.17 microM) in a concentration-dependent manner. Microsomal fractions isolated from SV-CISM-2 cells contained phospholipase C (PLC) which was stimulated by CCh (10 microM) and GTP gamma S (0.1 microM). Pretreatment of the cells with ISO or forskolin, 5 microM each, produced membrane fractions in which CCh-stimulated PLC activity was significantly attenuated. Furthermore, when microsomal fractions isolated from SV-CISM-2 cells were phosphorylated with Protein kinase A (PKA), the CCh- and GTP gamma S-stimulated IP3 production were significantly inhibited. It can be concluded from these studies that in SV-CISM-2 cells, activation of M3 muscarinic receptors results in stimulation of PLC-mediated PIP2 hydrolysis, generating IP3 which mobilizes [Ca2+]i. Furthermore, elevation of cAMP may inhibit IP3 production and [Ca2+]i mobilization through mechanisms involving PKA-dependent phosphorylation of PLC, G-proteins, IP3 receptor and/or IP3 metabolizing enzymes.

Distributed Dynamic Host Configuration Protocol (D2HCP)

PubMed Central

Villalba, Luis Javier García; Matesanz, Julián García; Orozco, Ana Lucila Sandoval; Díaz, José Duván Márquez

2011-01-01

Mobile Ad Hoc Networks (MANETs) are multihop wireless networks of mobile nodes without any fixed or preexisting infrastructure. The topology of these networks can change randomly due to the unpredictable mobility of nodes and their propagation characteristics. In most networks, including MANETs, each node needs a unique identifier to communicate. This work presents a distributed protocol for dynamic node IP address assignment in MANETs. Nodes of a MANET synchronize from time to time to maintain a record of IP address assignments in the entire network and detect any IP address leaks. The proposed stateful autoconfiguration scheme uses the OLSR proactive routing protocol for synchronization and guarantees unique IP addresses under a variety of network conditions, including message losses and network partitioning. Simulation results show that the protocol incurs low latency and communication overhead for IP address assignment. PMID:22163856

Distributed Dynamic Host Configuration Protocol (D2HCP).

PubMed

Villalba, Luis Javier García; Matesanz, Julián García; Orozco, Ana Lucila Sandoval; Díaz, José Duván Márquez

2011-01-01

Mobile Ad Hoc Networks (MANETs) are multihop wireless networks of mobile nodes without any fixed or preexisting infrastructure. The topology of these networks can change randomly due to the unpredictable mobility of nodes and their propagation characteristics. In most networks, including MANETs, each node needs a unique identifier to communicate. This work presents a distributed protocol for dynamic node IP address assignment in MANETs. Nodes of a MANET synchronize from time to time to maintain a record of IP address assignments in the entire network and detect any IP address leaks. The proposed stateful autoconfiguration scheme uses the OLSR proactive routing protocol for synchronization and guarantees unique IP addresses under a variety of network conditions, including message losses and network partitioning. Simulation results show that the protocol incurs low latency and communication overhead for IP address assignment.

Mobile Virtual Private Networking

NASA Astrophysics Data System (ADS)

Pulkkis, Göran; Grahn, Kaj; Mårtens, Mathias; Mattsson, Jonny

Mobile Virtual Private Networking (VPN) solutions based on the Internet Security Protocol (IPSec), Transport Layer Security/Secure Socket Layer (SSL/TLS), Secure Shell (SSH), 3G/GPRS cellular networks, Mobile IP, and the presently experimental Host Identity Protocol (HIP) are described, compared and evaluated. Mobile VPN solutions based on HIP are recommended for future networking because of superior processing efficiency and network capacity demand features. Mobile VPN implementation issues associated with the IP protocol versions IPv4 and IPv6 are also evaluated. Mobile VPN implementation experiences are presented and discussed.

Overview of NASA Glenn Aero/Mobile Communications Demonstrations

NASA Technical Reports Server (NTRS)

Brooks, David; Hoder, Doug; Wilkins, Ryan

2004-01-01

The Glenn Research Center at Lewis Field (GRC) has been involved with several other NASA field centers on various networking and RF communications demonstrations and experiments since 1998. These collaborative experiments investigated communications technologies new to aviation, such as wideband Ku satcom, L-band narrowband satcom, and IP (Internet Protocol), using commercial off-the-shelf (COTS) components These technologies can be used to distribute weather and hazard data, air traffic management and airline fleet management information, and passenger cabin Internet service.

Overview of NASA Glenn Aero/Mobile Communication Demonstrations

NASA Technical Reports Server (NTRS)

Brooks, David; Hoder, Doug; Wilkins, Ryan

2004-01-01

The Glenn Research Center at Lewis Field (GRC) has been involved with several other NASA field centers on various networking and RF communications demonstrations and experiments since 1998. These collaborative experiments investigated communications technologies new to aviation, such as wideband Ku satcom, L-band narrowband satcom, and IP (Internet Protocol), using commercial off-the-shelf (COTS) components These technologies can be used to distribute weather and hazard data, air traffic management and airline fleet management information, and passenger cabin Internet service.

Myo-Inositol trisphosphate mobilizes calcium from fusogenic carrot (Daucus carota L. ) protoplasts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rincon, M.; Boss, W.F.

1987-02-01

To determine whether or not inositol trisphosphate (IP/sub 3/) mobilizes calcium in higher plant cells; they investigated the effect of IP/sub 3/ on Ca/sup 2 +/ fluxes in fusogenic carrot (Daucus carota L.) protoplasts. The protoplasts were incubated in /sup 45/Ca/sup 2 +/-containing medium and the /sup 45/Ca/sup 2 +/ associated with the protoplasts was monitored with time. Addition of IP/sub 3/ (20 micromolar) caused a 17% net loss of the accumulated /sup 45/Ca/sup 2 +/ within 4 minutes. There was a reuptake of /sup 45/Ca/sup 2 +/ and the protoplasts recovered to their initial value by 10 minutes. Phyticmore » acid (IP/sub 6/), also stimulated /sup 45/Ca/sup 2 +/ efflux from the protoplasts. Both the IP/sub 3/- and the IP/sub 6/-induced /sup 45/Ca/sup 2 +/ efflux were inhibited by the calmodulin antagonist, trifluoperazine.« less

Security for IP Multimedia Services in the 3GPP Third Generation Mobile System.

ERIC Educational Resources Information Center

Horn, G.; Kroselberg, D.; Muller, K.

2003-01-01

Presents an overview of the security architecture of the IP multimedia core network subsystem (IMS) of the third generation mobile system, known in Europe as UMTS. Discusses IMS security requirements; IMS security architecture; authentication between IMS user and home network; integrity and confidentiality for IMS signalling; and future aspects of…

Fast rerouting schemes for protected mobile IP over MPLS networks

NASA Astrophysics Data System (ADS)

Wen, Chih-Chao; Chang, Sheng-Yi; Chen, Huan; Chen, Kim-Joan

2005-10-01

Fast rerouting is a critical traffic engineering operation in the MPLS networks. To implement the Mobile IP service over the MPLS network, one can collaborate with the fast rerouting operation to enhance the availability and survivability. MPLS can protect critical LSP tunnel between Home Agent (HA) and Foreign Agent (FA) using the fast rerouting scheme. In this paper, we propose a simple but efficient algorithm to address the triangle routing problem for the Mobile IP over the MPLS networks. We consider this routing issue as a link weighting and capacity assignment (LW-CA) problem. The derived solution is used to plan the fast restoration mechanism to protect the link or node failure. In this paper, we first model the LW-CA problem as a mixed integer optimization problem. Our goal is to minimize the call blocking probability on the most congested working truck for the mobile IP connections. Many existing network topologies are used to evaluate the performance of our scheme. Results show that our proposed scheme can obtain the best performance in terms of the smallest blocking probability compared to other schemes.

Design of a multimedia gateway for mobile devices

NASA Astrophysics Data System (ADS)

Hens, Raf; Goeminne, Nico; Van Hoecke, Sofie; Verdickt, Tom; Bouve, Thomas; Gielen, Frank; Demeester, Piet

2005-03-01

Although mobile users are currently offered a lot more capabilities on their mobile devices, they still experience some limitations. They can surf the Internet, read their e-mail and receive MMS messages, but they have limited processing power, storage capacity and bandwidth and are limited in their access to peripherals (e.g. printers). We have designed and implemented a multimedia gateway for mobile devices that reduces these limitations. It gives the mobile devices transparent access to high capacity devices connected to the gateway, which is built around a central, modularly extensible server that can run on any PC or home gateway. It manages two sets of modules: one set offering the actual services and another set handling the IP-based wireless interaction with the client applications on the mobile devices. These modules can be added and removed dynamically, offering new services on the fly. Currently services for storage, printing, domotics and playing music are provided. Others can easily be added later on. This paper discusses the architecture and development, the management of modules, the actual services and their benefits. Besides a proprietary implementation, it also looks into OSGi and how both platforms compare to each other, concerning design, architecture, ease of development, functionality, ...

78 FR 76189 - Supplemental Environmental Impact Statement for the Route 460 Location Study, Prince George...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-16

... Army Individual Permit (IP) Application. The purpose of this SEIS is to evaluate new information... the document as part of its evaluation of the IP application submitted by U.S. Route 460 Mobility... available to the USACE for the proposed project are to issue the IP, issue the IP with special conditions...

Mobile Router Developed and Tested

NASA Technical Reports Server (NTRS)

Ivancic, William D.

2002-01-01

The NASA Glenn Research Center, under a NASA Space Act Agreement with Cisco Systems, has been performing joint networking research to apply Internet-based technologies and protocols to space-based communications. As a result of this research, NASA performed stringent performance testing of the mobile router, including the interaction of routing and the transport-level protocol. In addition, Cisco Systems developed the mobile router for both commercial and Government markets. The code has become part of the Cisco Systems Internetworking Operating System (IOS) as of release 12.2 (4) T--which will make this capability available to the community at large. The mobile router is software code that resides in a network router and enables entire networks to roam while maintaining connectivity to the Internet. This router code is pertinent to a myriad of applications for both Government and commercial sectors, including the "wireless battlefield." NASA and the Department of Defense will utilize this technology for near-planetary observation and sensing spacecraft. It is also a key enabling technology for aviation-based information applications. Mobile routing will make it possible for information such as weather, air traffic control, voice, and video to be transmitted to aircraft using Internet-based protocols. This technology shows great promise in reducing congested airways and mitigating aviation disasters due to bad weather. The mobile router can also be incorporated into emergency vehicles (such as ambulances and life-flight aircraft) to provide real-time connectivity back to the hospital and health-care experts, enabling the timely application of emergency care. Commercial applications include entertainment services, Internet protocol (IP) telephone, and Internet connectivity for cruise ships, commercial shipping, tour buses, aircraft, and eventually cars. A mobile router, which is based on mobile IP, allows hosts (mobile nodes) to seamlessly "roam" among various IP subnetworks. This is essential in many wireless networks. A mobile router, unlike a mobile IP node, allows entire networks to roam. Hence, a device connected to the mobile router does not need to be a mobile node because the mobile router provides the roaming capabilities. There are three basic elements in the mobile IP: the home agent, the foreign agent, and the mobile node. The home agent is a router on a mobile node's home network that tunnels datagrams for delivery to the mobile node when it is away from home. The foreign agent is a router on a remote network that provides routing services to a registered mobile node. The mobile node is a host or router that changes its point of attachment from one network or subnetwork to another. In mobile routing, virtual communications are maintained by the home agent, which forwards all packets for the mobile networks to the foreign agent. The foreign agent passes the packets to the mobile router, which then forwards the packets to the devices on its networks. As the mobile router moves, it will register with its home agent on its whereabouts via the foreign agent to assure continuous connectivity.

Implementation of fast handover for proxy mobile IPv6: Resolving out-of-order packets

PubMed Central

Anh, Khuong Quoc; Choo, Hyunseung

2017-01-01

Mobile IP allows for location-independent routing of IP datagrams on the Internet. Mobile IP specifies how a mobile node (MN) registers with its home agent and how the home agent routes datagrams to the MN through the tunnel. Current Mobile IP protocols have difficulties meeting the stringent handover delay requirements of future wireless networks. Fast handover for Proxy Mobile IPv6 (FPMIPv6) is used to resolve handover latency and packet loss problems that occur in the Proxy Mobile IPv6 (PMIPv6) protocol. However, while implementing the FPMIPv6 scheme in a testbed, we encounter the out-of-order packet (OoOP) problem. The cause of this problem is the existence of two paths for data transmitted from a correspondent node (CN) to an MN. Since the problem affects the quality of service (QoS) of the network and the performance of the MN, we propose a new scheme using the last packet marker and packet buffering to solve this problem in FPMIPv6. The new Mobile Access Gateway (MAG) can control and deliver the data transmitted via the old path or the new path to an MN in order, using the last packet marker to notify the end of the data delivery in the old path and the packet buffering for holding the data delivered in the new path. We implement both the proposed scheme and FPMIPv6 in a testbed as a real network environment to demonstrate the correctness, cost effectiveness, and performance of the proposed scheme. A performance evaluation reveals that the proposed scheme can handle the OoOP problem efficiently. PMID:28968450

Implementation of fast handover for proxy mobile IPv6: Resolving out-of-order packets.

PubMed

Kang, Byungseok; Anh, Khuong Quoc; Choo, Hyunseung

2017-01-01

Mobile IP allows for location-independent routing of IP datagrams on the Internet. Mobile IP specifies how a mobile node (MN) registers with its home agent and how the home agent routes datagrams to the MN through the tunnel. Current Mobile IP protocols have difficulties meeting the stringent handover delay requirements of future wireless networks. Fast handover for Proxy Mobile IPv6 (FPMIPv6) is used to resolve handover latency and packet loss problems that occur in the Proxy Mobile IPv6 (PMIPv6) protocol. However, while implementing the FPMIPv6 scheme in a testbed, we encounter the out-of-order packet (OoOP) problem. The cause of this problem is the existence of two paths for data transmitted from a correspondent node (CN) to an MN. Since the problem affects the quality of service (QoS) of the network and the performance of the MN, we propose a new scheme using the last packet marker and packet buffering to solve this problem in FPMIPv6. The new Mobile Access Gateway (MAG) can control and deliver the data transmitted via the old path or the new path to an MN in order, using the last packet marker to notify the end of the data delivery in the old path and the packet buffering for holding the data delivered in the new path. We implement both the proposed scheme and FPMIPv6 in a testbed as a real network environment to demonstrate the correctness, cost effectiveness, and performance of the proposed scheme. A performance evaluation reveals that the proposed scheme can handle the OoOP problem efficiently.

Space Network IP Services (SNIS): An Architecture for Supporting Low Earth Orbiting IP Satellite Missions

NASA Technical Reports Server (NTRS)

Israel, David J.

2005-01-01

The NASA Space Network (SN) supports a variety of missions using the Tracking and Data Relay Satellite System (TDRSS), which includes ground stations in White Sands, New Mexico and Guam. A Space Network IP Services (SNIS) architecture is being developed to support future users with requirements for end-to-end Internet Protocol (IP) communications. This architecture will support all IP protocols, including Mobile IP, over TDRSS Single Access, Multiple Access, and Demand Access Radio Frequency (RF) links. This paper will describe this architecture and how it can enable Low Earth Orbiting IP satellite missions.

Impact of VoIP and QoS on Open and Distance Learning

ERIC Educational Resources Information Center

Saxena, P. C.; Jasola, Sanjay; Sharma, Ramesh C.

2006-01-01

Voice over Internet Protocol (VoIP) is becoming a reality in many organizations. The potential for mobility in voice over wi-fi networks will derive demand for the technology. Wireless VoIP is poised to rival VoIP as an alternative telephony tool. Internet has been used to transport data in the form of packet. In the past, Internet did not support…

Design of an eMonitor system to transport electronic patient care report (ePCR) information in unstable MobileIP wireless environment.

PubMed

Giovanni, Mazza G; Shenvi, Rohit; Battles, Marcie; Orthner, Helmuth F

2008-11-06

The eMonitor is a component of the ePatient system; a prototype system used by emergency medical services (EMS) personnel in the field to record and transmits electronic patient care report (ePCR) information interactively. The eMonitor component allows each Mobile Data Terminal (MDT) on an unreliable Cisco MobileIP wireless network to securely send and received XML messages used to update patient information to and from the MDT before, during and after the transport of a patient.

Specific receptor for inositol-1,4,5-trisphosphate in permeabilized rabbit neutrophils

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bradford, P.G.; Spat, A.; Rubin, R.P.

1986-03-05

Neutrophil chemotaxis and degranulation are resultant, in part, from the mobilization of intracellular calcium by inositol-1,4,5-trisphosphate ((1,4,5)IP/sub 3/), one of the products of chemoattractant-stimulated phospholipase C activity. High specific activity (ca. 40 Ci/mmol) (/sup 32/P)(1,4,5)IP/sub 3/ was prepared from (..gamma..-/sup 32/P)ATP-labeled human erythrocyte ghosts and was used in binding assays with saponin-permeabilized rabbit peritoneal neutrophils. At 4/sup 0/C and in the presence of inhibitors of the IP/sub 3/ 5-phosphomonoesterase, (/sup 32/P)(1,4,5)IP/sub 3/ rapidly associated with a specific binding component which saturated within 60s. Nonspecific binding, taken as the residual binding in the presence of 10 ..mu..M (1,4,5)IP/sub 3/, was 15%more » of the total. No specific binding was detected using intact cells. The specific binding to permeable cells was reversible (t/sup 1/2/ approx. 60s) and could be inhibited in a dose-dependent manner by (1,4,5)IP/sub 3/ (EC/sub 50/ = 30 nM) and by other calcium mobilizing inositol phosphates ((2,4,5)IP/sub 3/) but not by inactive analogs ((1,4)IP/sub 2/, (4,5)IP/sub 2/, (1)IP). The dose-responses of (1,4,5)IP/sub 3/ and (2,4,5)IP/sub 3/ in inhibiting (/sup 32/P)(1,4,5)IP/sub 3/ specific binding correlated well with their abilities to release Ca/sup 2 +/ from nonmitochondrial vesicular stores in the same preparation of cells, suggesting that the authors have identified the physiological receptor for (1,4,5)IP/sub 3/.« less

An overview of the DII-HEP OpenStack based CMS data analysis

NASA Astrophysics Data System (ADS)

Osmani, L.; Tarkoma, S.; Eerola, P.; Komu, M.; Kortelainen, M. J.; Kraemer, O.; Lindén, T.; Toor, S.; White, J.

2015-05-01

An OpenStack based private cloud with the Cluster File System has been built and used with both CMS analysis and Monte Carlo simulation jobs in the Datacenter Indirection Infrastructure for Secure High Energy Physics (DII-HEP) project. On the cloud we run the ARC middleware that allows running CMS applications without changes on the job submission side. Our test results indicate that the adopted approach provides a scalable and resilient solution for managing resources without compromising on performance and high availability. To manage the virtual machines (VM) dynamically in an elastic fasion, we are testing the EMI authorization service (Argus) and the Execution Environment Service (Argus-EES). An OpenStackplugin has been developed for Argus-EES. The Host Identity Protocol (HIP) has been designed for mobile networks and it provides a secure method for IP multihoming. HIP separates the end-point identifier and locator role for IP address which increases the network availability for the applications. Our solution leverages HIP for traffic management. This presentation gives an update on the status of the work and our lessons learned in creating an OpenStackbased cloud for HEP.

Effectiveness of an interprofessional workshop on pain management for medical and nursing students.

PubMed

Erickson, Jeanne M; Brashers, Valentina; Owen, John; Marks, Jennifer R; Thomas, Shannon M

2016-07-01

Interprofessional (IP) care is critical for effective pain management, but evidence is lacking about the best way to teach pain management skills to medical and nursing students using IP strategies. In 2013 and 2014, 307 medical and 169 nursing students participated in an IP case-based pain management workshop. The aims of this study were to determine (1) if students who participate in IP case-based learning groups will have improved pain management skills compared to students who participate in uniprofessional case-based learning groups, and (2) if students mentored by faculty with IP training will have improved pain management skills compared to students who are not mentored by IP-trained faculty. Student learning was assessed and compared using scored checklists for each group's pain management plans. Findings show that IP mentorship and IP group participation improved medical students' pain management skills but did not have the same effect on nursing student performance. Continued work is needed to develop, refine, and integrate innovative and tailored IP strategies into the curricula of medical and nursing schools to advance the pain management competencies of students before they enter clinical practice.

Systems Modeling of Ca2+ Homeostasis and Mobilization in Platelets Mediated by IP3 and Store-Operated Ca2+ Entry

PubMed Central

Dolan, Andrew T.; Diamond, Scott L.

2014-01-01

Resting platelets maintain a stable level of low cytoplasmic calcium ([Ca2+]cyt) and high dense tubular system calcium ([Ca2+]dts). During thrombosis, activators cause a transient rise in inositol trisphosphate (IP3) to trigger calcium mobilization from stores and elevation of [Ca2+]cyt. Another major source of [Ca2+]cyt elevation is store-operated calcium entry (SOCE) through plasmalemmal calcium channels that open in response to store depletion as [Ca2+]dts drops. A 34-species systems model employed kinetics describing IP3-receptor, DTS-plasmalemma puncta formation, SOCE via assembly of STIM1 and Orai1, and the plasmalemma and sarco/endoplasmic reticulum Ca2+-ATPases. Four constraints were imposed: calcium homeostasis before activation; stable in zero extracellular calcium; IP3-activatable; and functional SOCE. Using a Monte Carlo method to sample three unknown parameters and nine initial concentrations in a 12-dimensional space near measured or expected values, we found that model configurations that were responsive to stimuli and demonstrated significant SOCE required high inner membrane electric potential (>−70 mV) and low resting IP3 concentrations. The absence of puncta in resting cells was required to prevent spontaneous store depletion in calcium-free media. Ten-fold increases in IP3 caused saturated calcium mobilization. This systems model represents a critical step in being able to predict platelets’ phenotypes during hemostasis or thrombosis. PMID:24806937

The potential of Internet of m-health Things "m-IoT" for non-invasive glucose level sensing.

PubMed

Istepanian, R S H; Hu, S; Philip, N Y; Sungoor, A

2011-01-01

An amalgamated concept of Internet of m-health Things (m-IoT) has been introduced recently and defined as a new concept that matches the functionalities of m-health and IoT for a new and innovative future (4G health) applications. It is well know that diabetes is a major chronic disease problem worldwide with major economic and social impact. To-date there have not been any studies that address the potential of m-IoT for non-invasive glucose level sensing with advanced opto-physiological assessment technique and diabetes management. In this paper we address the potential benefits of using m-IoT in non-invasive glucose level sensing and the potential m-IoT based architecture for diabetes management. We expect to achieve intelligent identification and management in a heterogeneous connectivity environment from the mobile healthcare perspective. Furthermore this technology will enable new communication connectivity routes between mobile patients and care services through innovative IP based networking architectures.

Ambipolar nature of dimethyl benzo difuran (DMBDF) molecule: A charge transport study

NASA Astrophysics Data System (ADS)

Sahoo, Smruti Ranjan; Sahu, Sridhar

2017-05-01

We describe a theoretical study of the charge transport properties of the organic dimethyl benzo difuran (DMBDF) molecule based on density functional theory (DFT). Reorganization energy, ionization potential (IP), electron affinity (EA), energy gaps, transfer integral (t) and charge mobility (μ) has been studied to depict the transport properties in the conjugated organic molecules. We computed, large homo transfer integral and IP value leading to high hole mobility (4.46 cm2/V sec). However, the electron reorganization energy (0.34 eV) and the electron mobility of 1.62 cm2/V sec, infers that the DMBDF organic molecule bears an ambipolar character.

Separation of a chemically modified DNA oligomer bound by the carcinogen 2-Amino-1-methy-6-phenylimidazo [4,5-{beta}]pyridine using capillary gel electrophoresis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nguyen, T.N.

1994-05-06

We have optimized the reaction conditions under which unactivated metabolite of the food borne carcinogen 2-amino-1-methyl-6-phenylimidazo [4,5-{beta}]pyridine (PhIP) is covalently bound to the oligodeoxynucleotide d(CCTACGCATCC). Capillary electrophoresis (CE) was used to separate and characterize this DNA oligomer bound by PhIP. We observed 2 major and several minor PhIP adduct species. The 2 major adducts had different absorbance maxima; the major adduct eluates with faster and slower mobilities had absorbance maxima of 360 and 340 nm, respectively. One of the two major PhIP adduct species was resolvable but the peak was broad. Using detection at 260 nm, the other major PhIPmore » adduct with fastest electrophoretic mobility was not resolvable, but coelute with the huge broad unmodified DNA oligomer peak. However, at higher wavelengths (>320 nm) where DNA does not absorb, electropherograms generated by detection at these higher wavelengths showed very heterogeneous binding by PhIP to the DNA oligomer with no interfering absorbance by the DNA.« less

Efficient eNB inter-communication scheme in converged mobile and NG-PON2 system

NASA Astrophysics Data System (ADS)

Xiao, Simiao; Sun, Xiao; Zhang, Kaibin

2016-02-01

In LTE, a new X2-interface is defined to facilitate direct communication between neighboring eNBs. Since LTE is an all-IP network, the X2-interface traffic currently needs to be routed and transponded in L3 at the edge router by IP addressing. As mobile data increases, it is a promising trend to backhaul mobile services based on PON. In this paper, an effective approach for eNB inter-communication over TWDM-PON is proposed. By associating the IP address of eNB and the MAC address of ONU, the "inter-eNB communication in L3" can be mapped into "inter-ONU communication in L2" and transponded via the protocol of PON at the OLT. Thus, fast and cost-effective eNB inter-communication can be realized based on TWDM-PON within one wavelength channel and between different wavelength channels. The increasing data traffic pressure to the core network can also be alleviated.

An Experimental Performance Measurement of Implemented Wireless Access Point for Interworking Wi-Fi and HSDPA Networks

NASA Astrophysics Data System (ADS)

Byun, Tae-Young

This paper presents a prototype of WAP(Wireless Access Point) that provides the wireless Internet access anywhere. Implemented WAP can be equipped with various wireless WAN interfaces such as WCDMA and HSDPA. WAP in the IP mechanism has to process connection setup procedure to one wireless WAN. Also, WAP can provide connection management procedures to reconnect interrupted connection automatically. By using WAP, several mobile devices such as netbook, UMPC and smart-phone in a moving vehicle can access to HSDPA network simultaneously. So, it has more convenient for using the WAP when there are needs to access wireless Internet more than two mobile devices in restricted spaces such as car, train and ship.

Mobile telephones: a comparison of radiated power between 3G VoIP calls and 3G VoCS calls.

PubMed

Jovanovic, Dragan; Bragard, Guillaume; Picard, Dominique; Chauvin, Sébastien

2015-01-01

The purpose of this study is to assess the mean RF power radiated by mobile telephones during voice calls in 3G VoIP (Voice over Internet Protocol) using an application well known to mobile Internet users, and to compare it with the mean power radiated during voice calls in 3G VoCS (Voice over Circuit Switch) on a traditional network. Knowing that the specific absorption rate (SAR) is proportional to the mean radiated power, the user's exposure could be clearly identified at the same time. Three 3G (High Speed Packet Access) smartphones from three different manufacturers, all dual-band for GSM (900 MHz, 1800 MHz) and dual-band for UMTS (900 MHz, 1950 MHz), were used between 28 July and 04 August 2011 in Paris (France) to make 220 two-minute calls on a mobile telephone network with national coverage. The places where the calls were made were selected in such a way as to describe the whole range of usage situations of the mobile telephone. The measuring equipment, called "SYRPOM", recorded the radiation power levels and the frequency bands used during the calls with a sampling rate of 20,000 per second. In the framework of this study, the mean normalised power radiated by a telephone in 3G VoIP calls was evaluated at 0.75% maximum power of the smartphone, compared with 0.22% in 3G VoCS calls. The very low average power levels associated with use of 3G devices with VoIP or VoCS support the view that RF exposure resulting from their use is far from exceeding the basic restrictions of current exposure limits in terms of SAR.

A cost-effective traffic data collection system based on the iDEN mobile telecommunication network.

DOT National Transportation Integrated Search

2008-10-01

This report describes a cost-effective data collection system for Caltrans 170 traffic signal : controller. The data collection system is based on TCP/IP communication over existing : low-cost mobile communication networks and Motorola iDEN1 mobile...

Traffic Management for Satellite-ATM Networks

NASA Technical Reports Server (NTRS)

Goyal, Rohit; Jain, Raj; Fahmy, Sonia; Vandalore, Bobby; Goyal, Mukul

1998-01-01

Various issues associated with "Traffic Management for Satellite-ATM Networks" are presented in viewgraph form. Specific topics include: 1) Traffic management issues for TCP/IP based data services over satellite-ATM networks; 2) Design issues for TCP/IP over ATM; 3) Optimization of the performance of TCP/IP over ATM for long delay networks; and 4) Evaluation of ATM service categories for TCP/IP traffic.

Pseudo-random dynamic address configuration (PRDAC) algorithm for mobile ad hoc networks

NASA Astrophysics Data System (ADS)

Wu, Shaochuan; Tan, Xuezhi

2007-11-01

By analyzing all kinds of address configuration algorithms, this paper provides a new pseudo-random dynamic address configuration (PRDAC) algorithm for mobile ad hoc networks. Based on PRDAC, the first node that initials this network randomly chooses a nonlinear shift register that can generates an m-sequence. When another node joins this network, the initial node will act as an IP address configuration sever to compute an IP address according to this nonlinear shift register, and then allocates this address and tell the generator polynomial of this shift register to this new node. By this means, when other node joins this network, any node that has obtained an IP address can act as a server to allocate address to this new node. PRDAC can also efficiently avoid IP conflicts and deal with network partition and merge as same as prophet address (PA) allocation and dynamic configuration and distribution protocol (DCDP). Furthermore, PRDAC has less algorithm complexity, less computational complexity and more sufficient assumption than PA. In addition, PRDAC radically avoids address conflicts and maximizes the utilization rate of IP addresses. Analysis and simulation results show that PRDAC has rapid convergence, low overhead and immune from topological structures.

IDMA: improving the defense against malicious attack for mobile ad hoc networks based on ARIP protocol

NASA Astrophysics Data System (ADS)

Peng, Chaorong; Chen, Chang Wen

2008-04-01

Malicious nodes are mounting increasingly sophisticated attacking operations on the Mobile Ad Hoc Networks (MANETs). This is mainly because the IP-based MANETs are vulnerable to attacks by various malicious nodes. However, the defense against malicious attack can be improved when a new layer of network architecture can be developed to separate true IP address from disclosing to the malicious nodes. In this paper, we propose a new algorithm to improve the defense against malicious attack (IDMA) that is based on a recently developed Assignment Router Identify Protocol (ARIP) for the clustering-based MANET management. In the ARIP protocol, we design the ARIP architecture based on the new Identity instead of the vulnerable IP addresses to provide the required security that is embedded seamlessly into the overall network architecture. We make full use of ARIP's special property to monitor gateway forward packets by Reply Request Route Packets (RREP) without additional intrusion detection layer. We name this new algorithm IDMA because of its inherent capability to improve the defense against malicious attacks. Through IDMA, a watching algorithm can be established so as to counterattack the malicious node in the routing path when it unusually drops up packets. We provide analysis examples for IDMA for the defense against a malicious node that disrupts the route discovery by impersonating the destination, or by responding with state of corrupted routing information, or by disseminating forged control traffic. The IDMA algorithm is able to counterattack the malicious node in the cases when the node lunch DoS attack by broadcast a large number of route requests, or make Target traffic congestion by delivering huge mount of data; or spoof the IP addresses and send forge packets with a fake ID to the same Target causing traffic congestion at that destination. We have implemented IDMA algorism using the GloMoSim simulator and have demonstrated its performance under a variety of operational conditions.

Designing of routing algorithms in autonomous distributed data transmission system for mobile computing devices with ‘WiFi-Direct’ technology

NASA Astrophysics Data System (ADS)

Nikitin, I. A.; Sherstnev, V. S.; Sherstneva, A. I.; Botygin, I. A.

2017-02-01

The results of the research of existent routing protocols in wireless networks and their main features are discussed in the paper. Basing on the protocol data, the routing protocols in wireless networks, including search routing algorithms and phone directory exchange algorithms, are designed with the ‘WiFi-Direct’ technology. Algorithms without IP-protocol were designed, and that enabled one to increase the efficiency of the algorithms while working only with the MAC-addresses of the devices. The developed algorithms are expected to be used in the mobile software engineering with the Android platform taken as base. Easier algorithms and formats of the well-known route protocols, rejection of the IP-protocols enables to use the developed protocols on more primitive mobile devices. Implementation of the protocols to the engineering industry enables to create data transmission networks among working places and mobile robots without any access points.

Mobile Router Testing with Diverse RF Communications Links

NASA Technical Reports Server (NTRS)

Brooks, David; Hoder, Doug; Wilkins, Ryan

2004-01-01

This is a short report on demonstrations using Mobile IP and several diverse physical communications links to connect a mobile network to a fixed IPv4 internet. The first section is a description of the equipment used, followed by descriptions of the tests, the theoretical results, and finally conclusions and the actual data.

A TOTP-based enhanced route optimization procedure for mobile IPv6 to reduce handover delay and signalling overhead.

PubMed

Shah, Peer Azmat; Hasbullah, Halabi B; Lawal, Ibrahim A; Aminu Mu'azu, Abubakar; Tang Jung, Low

2014-01-01

Due to the proliferation of handheld mobile devices, multimedia applications like Voice over IP (VoIP), video conferencing, network music, and online gaming are gaining popularity in recent years. These applications are well known to be delay sensitive and resource demanding. The mobility of mobile devices, running these applications, across different networks causes delay and service disruption. Mobile IPv6 was proposed to provide mobility support to IPv6-based mobile nodes for continuous communication when they roam across different networks. However, the Route Optimization procedure in Mobile IPv6 involves the verification of mobile node's reachability at the home address and at the care-of address (home test and care-of test) that results in higher handover delays and signalling overhead. This paper presents an enhanced procedure, time-based one-time password Route Optimization (TOTP-RO), for Mobile IPv6 Route Optimization that uses the concepts of shared secret Token, time based one-time password (TOTP) along with verification of the mobile node via direct communication and maintaining the status of correspondent node's compatibility. The TOTP-RO was implemented in network simulator (NS-2) and an analytical analysis was also made. Analysis showed that TOTP-RO has lower handover delays, packet loss, and signalling overhead with an increased level of security as compared to the standard Mobile IPv6's Return-Routability-based Route Optimization (RR-RO).

76 FR 59916 - Interconnected VoIP Service; Wireless E911 Location Accuracy Requirements; E911 Requirements for...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-09-28

... FEDERAL COMMUNICATIONS COMMISSION 47 CFR Part 20 [PS Docket No. 07-114, GN Docket No. 11-117, WC...; E911 Requirements for IP-Enabled Service Providers AGENCY: Federal Communications Commission. ACTION...-based standard over time. We also require all Commercial Mobile Radio Service (CMRS) providers...

All-IP wireless sensor networks for real-time patient monitoring.

PubMed

Wang, Xiaonan; Le, Deguang; Cheng, Hongbin; Xie, Conghua

2014-12-01

This paper proposes the all-IP WSNs (wireless sensor networks) for real-time patient monitoring. In this paper, the all-IP WSN architecture based on gateway trees is proposed and the hierarchical address structure is presented. Based on this architecture, the all-IP WSN can perform routing without route discovery. Moreover, a mobile node is always identified by a home address and it does not need to be configured with a care-of address during the mobility process, so the communication disruption caused by the address change is avoided. Through the proposed scheme, a physician can monitor the vital signs of a patient at any time and at any places, and according to the IPv6 address he can also obtain the location information of the patient in order to perform effective and timely treatment. Finally, the proposed scheme is evaluated based on the simulation, and the simulation data indicate that the proposed scheme might effectively reduce the communication delay and control cost, and lower the packet loss rate. Copyright © 2014 Elsevier Inc. All rights reserved.

Mobility of students, academic and administrative staff: a basis for establishing a European higher education area (Berlin communiqué 2003).

PubMed

Chantrain, Hilde

2010-01-01

This article aims to highlight the possibilities of the Intensive Programme (IP), one of the items of the Lifelong Learning Programme of the European Commission. The benefits of organizing an IP in a specific discipline-related area is illustrated by a case study of the speech-language therapy IP, which has been coordinated for 16 years by the Department of Speech-Language Therapy of the Lessius Hogeschool Antwerp, Belgium. 2010 S. Karger AG, Basel.

Transfer Error and Correction Approach in Mobile Network

NASA Astrophysics Data System (ADS)

Xiao-kai, Wu; Yong-jin, Shi; Da-jin, Chen; Bing-he, Ma; Qi-li, Zhou

With the development of information technology and social progress, human demand for information has become increasingly diverse, wherever and whenever people want to be able to easily, quickly and flexibly via voice, data, images and video and other means to communicate. Visual information to the people direct and vivid image, image / video transmission also been widespread attention. Although the third generation mobile communication systems and the emergence and rapid development of IP networks, making video communications is becoming the main business of the wireless communications, however, the actual wireless and IP channel will lead to error generation, such as: wireless channel multi- fading channels generated error and blocking IP packet loss and so on. Due to channel bandwidth limitations, the video communication compression coding of data is often beyond the data, and compress data after the error is very sensitive to error conditions caused a serious decline in image quality.

Cordycepin-enriched WIB801C from Cordyceps militaris inhibits ADP-induced [Ca(2+)] i mobilization and fibrinogen binding via phosphorylation of IP 3R and VASP.

PubMed

Lee, Dong-Ha; Kwon, Hyuk-Woo; Kim, Hyun-Hong; Lim, Deok Hwi; Nam, Gi Suk; Shin, Jung-Hae; Kim, Yun-Yi; Kim, Jong-Lae; Lee, Jong-Jin; Kwon, Ho-Kyun; Park, Hwa-Jin

2015-01-01

In this study, we investigated the effect of cordycepin-enriched (CE)-WIB801C from Cordyceps militaris on ADP (20 µM)-stimulated platelet aggregation. CE-WIB801C dose-dependently inhibited ADP-induced platelet aggregation, and its IC50 value was 18.5 μg/mL. CE-WIB801C decreased TXA2 production, but did not inhibit the activities of COX-1 and thromboxane synthase (TXAS) in ADP-activated platelets, which suggests that the inhibition of TXA2 production by CE-WIB801C is not resulted from the direct inhibition of COX-1 and TXAS. CE-WIB801C inhibited ATP release and [Ca(2+)]i mobilization, and increased cAMP level and IP3RI (Ser(1756)) phosphorylation in ADP-activated platelets. cAMP-dependent protein kinase (A-kinase) inhibitor Rp-8-Br-cAMPS increased CE-WIB801C-inhibited [Ca(2+)]i mobilization, and strongly inhibited CE-WIB801C-increased IP3RI (Ser(1756)) phosphorylation. CE-WIB801C elevated the phosphorylation of VASP (Ser(157)), an A-kinase substrate, but inhibited fibrinogen binding to αIIb/β3. These results suggest that CE-WIB801C-elevated cAMP involved in IP3RI (Ser(1756)) phosphorylation to inhibit [Ca(2+)]i mobilization and, VASP (Ser(157)) phosphorylation to inhibit αIIb/β3 activation. Therefore, in this study, we demonstrate that CE-WIB801C may have a preventive or therapeutic potential for platelet aggregation-mediated diseases, such as thrombosis, myocardial infarction, atherosclerosis, and ischemic cerebrovascular disease.

Peripheral and spinal activation of cannabinoid receptors by joint mobilization alleviates postoperative pain in mice.

PubMed

Martins, D F; Mazzardo-Martins, L; Cidral-Filho, F J; Gadotti, V M; Santos, A R S

2013-01-01

The present study was undertaken to investigate the relative contribution of cannabinoid receptors (CBRs) subtypes and to analyze cannabimimetic mechanisms involved in the inhibition of anandamide (AEA) and 2-arachidonoyl glycerol degradation on the antihyperalgesic effect of ankle joint mobilization (AJM). Mice (25-35g) were subjected to plantar incision (PI) and 24h after surgery animals received the following treatments, AJM for 9min, AEA (10mg/kg, intraperitoneal [i.p.]), WIN 55,212-2 (1.5mg/kg, i.p.), URB937 (0.01-1mg/kg, i.p.; a fatty acid amide hydrolase [FAAH] inhibitor) or JZL184 (0.016-16mg/kg, i.p.; a monoacylglycerol lipase [MAGL] inhibitor). Withdrawal frequency to mechanical stimuli was assessed 24h after PI and at different time intervals after treatments. Receptor specificity was investigated using selective CB1R (AM281) and CB2R (AM630) antagonists. In addition, the effect of the FAAH and MAGL inhibitors on the antihyperalgesic action of AJM was investigated. AJM, AEA, WIN 55,212-2, URB937 and JZL184 decreased mechanical hyperalgesia induced by PI. The antihyperalgesic effect of AJM was reversed by pretreatment with AM281 given by intraperitoneal and intrathecal routes, but not intraplantarly. Additionally, intraperitoneal and intraplantar, but not intrathecal administration of AM630 blocked AJM-induced antihyperalgesia. Interestingly, in mice pretreated with FAAH or the MAGL inhibitor the antihyperalgesic effect of AJM was significantly longer. This article presents data addressing the CBR mechanisms underlying the antihyperalgesic activity of joint mobilization as well as of the endocannabinoid catabolic enzyme inhibitors in the mouse postoperative pain model. Joint mobilization and these enzymes offer potential targets to treat postoperative pain. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.

Metabotropic glutamate receptors coupled to IP3 production mediate inhibition of IAHP in rat dentate granule neurons.

PubMed

Abdul-Ghani, M A; Valiante, T A; Carlen, P L; Pennefather, P S

1996-10-01

1. Whole cell recordings from dentate granule neurons in the hippocampal slice preparation reveal that (1 S, 3R)-1-aminocyclopentane-1,3-dicarboxylic acid (ACPD), a selective agonist at metabotropic glutamate receptors (mGluRs), inhibits a calcium-activated potassium current (IAHP) responsible for the postspike after-hyperpolarization. Inclusion of 1 mM of the Ca2+ chelator ethylene glycol-bis (beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid in the patch pipette reduced the inhibitory action of ACPD on IAHP while having no effect on a similar action of serotonin (5-HT). Thus the known action of ACPD of mobilizing intracellular Ca2+ may be involved in this inhibitor action of ACPD. 2. Inhibition of IAHP is not secondary to effects on Ca2+ currents, because 10 microM ACPD, which inhibits IAHP by 95 +/- 5% (mean +/- SE), reduced the Ca2+ current by only 8 +/- 4%. 3. Activation of mGluRs accelerates the irreversible inhibition of IAHP that develops when 88 microM GTP-gamma-S is included in the pipette filling solution, whereas inclusion of 1 mM GDP-beta-S attenuated the inhibitory action of ACPD. These results indicate that the response to mGluR activation is G protein mediated. 4. Group I mGluRs, which includes mGluR1 and mGluR5, are G-protein-coupled receptors that are known to stimulate phospholipase C (PLC)-mediated hydrolysis of phosphoinositides to produce 1,4,5-triphosphate (IP3), which in turn is known to mobilize the release of intracellular Ca2+. The weak but selective mGluR1 agonist (S)-3-hydroxyphenylglycine (100 microM) completely inhibited IAHP, and the mGluR1 antagonist (S)-4-carboxyphenylglycine (500 microM) reduced IAHP inhibition produced by 5 microM ACPD from 73 +/- 6% to 22 +/- 4%. These results indicate that the mGluR responsible for IAHP inhibition has a similar pharmacological profile to that of those coupled to IP3 production. 5. The effects of agents known to interfere with IP3 production and action also support IP3 involvement in ACPD action. Neomycin (1 mM in pipette solution), which should reduce IP3 production through inhibition of PLC, reduced the ability of 10 microM ACPD to inhibit IAHP from almost 100% to 57 +/- 8% (n = 8). Heparin, an IP3 receptor antagonist that reduces Ca2+ mobilization, attenuated the inhibitory action 10 microM ACPD from almost 100% to 39 +/- 5% (n = 5). Heparin by itself increased the amplitude and duration of IAHP, suggesting that resting levels of IP3 are sufficient to suppress of IAHP partially. 6. In addition to the pool of intracellular Ca2+ that is mobilized by IP3, there is a distinct pool that is responsible for Ca(2+)-triggered Ca2+ release and is blocked by ryanodine or dantrolene. These drugs caused a small reduction of both IAHP and the inhibitory action of ACPD. Possibly the Ca2+ signal mobilized by IP3 is partially amplified by Ca2+ released from the ryanodine-sensitive stores. 7. Activation of PLC can also lead to the production of diacylglycerol and activation of protein kinase C (PKC). However, the inhibitory action of ACPD on IAHP was not affected by staurosporine at a concentration (1 microM) that inhibits both protein kinase A (PKA) and PKC and blocks the action of 5-HT to inhibit IAHP. 8. Activation of PKA by the adenylate cyclase activator forskolin led to inhibition of IAHP. Although activation of mGluR1 agonists can also stimulate adenylate cyclase and activate PKA, inhibition of PKA and the effect of forskolin on IAHP with the Walsh peptide did not affect ACPD inhibition of IAHP. 9. All of our results support the hypothesis that mGluR-mediated inhibition of IAHP is initiated by the production of IP3 and the mobilization of intracellular Ca2+.

Control of IP3-mediated Ca2+ puffs in Xenopus laevis oocytes by the Ca2+-binding protein parvalbumin

PubMed Central

John, Linu M; Mosquera-Caro, Monica; Camacho, Patricia; Lechleiter, James D

2001-01-01

Elementary events of Ca2+ release (Ca2+ puffs) can be elicited from discrete clusters of inositol 1,4,5 trisphosphate receptors (IP3Rs) at low concentrations of IP3. Ca2+ puffs have rarely been observed unless elicited by either hormone treatment or introduction of IP3 into the cell. However, cells appear to have sufficient concentrations of IP3 (0.1-3.0 μM) to induce Ca2+ release under resting conditions. Here, we investigated Ca2+ puff activity in non-stimulated Xenopus oocytes using confocal microscopy. The fluorescent Ca2+ dye indicators Calcium Green 1 and Oregon Green 488 BAPTA-2 were injected into oocytes to monitor basal Ca2+ activity. In this preparation, injection or overexpression of parvalbumin, an EF-hand Ca2+-binding protein (CaBP), induced Ca2+ puffs in resting Xenopus oocytes. This activity was inhibited by heparin, an IP3R channel blocker, and by mutation of the Ca2+-binding sites in parvalbumin. Ca2+ puff activity was also evoked by injection of low concentrations of the Ca2+ chelator EGTA, but not by calbindin D28k, another member of the EF-hand CaBP superfamily. BAPTA and the Ca2+ indicator dye Oregon Green 488 BAPTA-1 evoked Ca2+ puff activity, while the dextran conjugate of Oregon Green 488 BAPTA-1 did not. These data indicate that a Ca2+ buffer must be mobile in order to increase Ca2+ puff activity. Together, the data indicate that some IP3Rs spontaneously release Ca2+ under resting concentrations of IP3. These elementary Ca2+ events appear to be below the level of detection of current imaging techniques. We suggest that parvalbumin evokes Ca2+ puffs by coordinating the activity of elementary IP3R channel openings. We conclude that Ca2+ release can be evoked not only by hormone-induced increases in IP3, but also by expression of mobile cytosolic CaBPs under resting concentrations of IP3. PMID:11507154

A TOTP-Based Enhanced Route Optimization Procedure for Mobile IPv6 to Reduce Handover Delay and Signalling Overhead

PubMed Central

Shah, Peer Azmat; Hasbullah, Halabi B.; Lawal, Ibrahim A.; Aminu Mu'azu, Abubakar; Tang Jung, Low

2014-01-01

Due to the proliferation of handheld mobile devices, multimedia applications like Voice over IP (VoIP), video conferencing, network music, and online gaming are gaining popularity in recent years. These applications are well known to be delay sensitive and resource demanding. The mobility of mobile devices, running these applications, across different networks causes delay and service disruption. Mobile IPv6 was proposed to provide mobility support to IPv6-based mobile nodes for continuous communication when they roam across different networks. However, the Route Optimization procedure in Mobile IPv6 involves the verification of mobile node's reachability at the home address and at the care-of address (home test and care-of test) that results in higher handover delays and signalling overhead. This paper presents an enhanced procedure, time-based one-time password Route Optimization (TOTP-RO), for Mobile IPv6 Route Optimization that uses the concepts of shared secret Token, time based one-time password (TOTP) along with verification of the mobile node via direct communication and maintaining the status of correspondent node's compatibility. The TOTP-RO was implemented in network simulator (NS-2) and an analytical analysis was also made. Analysis showed that TOTP-RO has lower handover delays, packet loss, and signalling overhead with an increased level of security as compared to the standard Mobile IPv6's Return-Routability-based Route Optimization (RR-RO). PMID:24688398

Integrating QoS and security functions in an IP-VPN gateway

NASA Astrophysics Data System (ADS)

Fan, Kuo-Pao; Chang, Shu-Hsin; Lin, Kuan-Ming; Pen, Mau-Jy

2001-10-01

IP-based Virtual Private Network becomes more and more popular. It can not only reduce the enterprise communication cost but also increase the revenue of the service provider. The common IP-VPN application types include Intranet VPN, Extranet VPN, and remote access VPN. For the large IP-VPN market, some vendors develop dedicated IP-VPN devices; while some vendors add the VPN functions into their existing network equipment such as router, access gateway, etc. The functions in the IP-VPN device include security, QoS, and management. The common security functions supported are IPSec (IP Security), IKE (Internet Key Exchange), and Firewall. The QoS functions include bandwidth control and packet scheduling. In the management component, policy-based network management is under standardization in IETF. In this paper, we discuss issues on how to integrate the QoS and security functions in an IP-VPN Gateway. We propose three approaches to do this. They are (1) perform Qos first (2) perform IPSec first and (3) reserve fixed bandwidth for IPSec. We also compare the advantages and disadvantages of the three proposed approaches.

Performance Analysis of the Mobile IP Protocol (RFC 3344 and Related RFCS)

DTIC Science & Technology

2006-12-01

Encapsulation HMAC Keyed-Hash Message Authentication Code ICMP Internet Control Message Protocol IEEE Institute of Electrical and Electronics Engineers IETF...Internet Engineering Task Force IOS Internetwork Operating System IP Internet Protocol ITU International Telecommunication Union LAN Local Area...network computing. Most organizations today have sophisticated networks that are connected to the Internet. The major benefit reaped from such a

A typology of intellectual property management for public health innovation and access: design considerations for policymakers.

PubMed

Taubman, Antony

2010-01-19

This paper seeks to set the practical discipline of public interest intellectual property (IP) management in public health into its broader policy context. The most immediate and direct impact of IP systems on public welfare results not from international standards nor from national legislation - though these norms are fundamentally important - but rather from the accumulated impact of numerous practical choices whether or not to seek IP protection; where and where not; and how any exclusive rights are deployed, by whom, and to what end. IP management is the essentially practical exercise of limited exclusive rights over protected subject matter, the judicious use of those rights to leverage outcomes that advance an institution's or a firm's objectives. Exclusive rights are used to construct and define knowledge-based relationships, to leverage access to technology and other necessary resources, and to enhance market-based incentives. IP management choices range across a broad spectrum, spanning public domain strategies, open or exclusive licensing, and strong exclusivity. The idea of 'exclusive rights', as a specific legal mechanism, can run counter to expectations of greater openness and accessibility, but actual outcomes will depend very much on how these mechanisms are used in practice. For public interest or public sector institutions concerned with health research and development, particularly the development of new medicines, IP management choices can be just as critical as they are for private firms, although a predominant institutional concentration on advancing direct public interest objectives may lead to significantly different approaches in weighing and exercising practical choices for IP management: even so, a private sector approach should not be conflated with exclusivity as an end in itself, nor need public interest IP management eschew all leverage over IP. This paper offers a tentative framework for a richer typology of those choices, to give a sense of practical options available and the factors that might guide their application, but without advocating any particular approach.

A Typology of Intellectual Property Management for Public Health Innovation and Access: Design Considerations for Policymakers§

PubMed Central

Taubman, Antony

2010-01-01

This paper seeks to set the practical discipline of public interest intellectual property (IP) management in public health into its broader policy context. The most immediate and direct impact of IP systems on public welfare results not from international standards nor from national legislation – though these norms are fundamentally important - but rather from the accumulated impact of numerous practical choices whether or not to seek IP protection; where and where not; and how any exclusive rights are deployed, by whom, and to what end. IP management is the essentially practical exercise of limited exclusive rights over protected subject matter, the judicious use of those rights to leverage outcomes that advance an institution's or a firm's objectives. Exclusive rights are used to construct and define knowledge-based relationships, to leverage access to technology and other necessary resources, and to enhance market-based incentives. IP management choices range across a broad spectrum, spanning public domain strategies, open or exclusive licensing, and strong exclusivity. The idea of ‘exclusive rights’, as a specific legal mechanism, can run counter to expectations of greater openness and accessibility, but actual outcomes will depend very much on how these mechanisms are used in practice. For public interest or public sector institutions concerned with health research and development, particularly the development of new medicines, IP management choices can be just as critical as they are for private firms, although a predominant institutional concentration on advancing direct public interest objectives may lead to significantly different approaches in weighing and exercising practical choices for IP management: even so, a private sector approach should not be conflated with exclusivity as an end in itself, nor need public interest IP management eschew all leverage over IP. This paper offers a tentative framework for a richer typology of those choices, to give a sense of practical options available and the factors that might guide their application, but without advocating any particular approach. PMID:20517487

77 FR 74677 - Chemical Facility Anti-Terrorism Standards (CFATS)

Federal Register 2010, 2011, 2012, 2013, 2014

2012-12-17

... Protection (IP), Infrastructure Security Compliance Division (ISCD) will submit the following Information... should be forwarded to DHS/NPPD/IP/ISCD CFATS Program Manager, 245 Murray Lane SW., Mail Stop 0610... should be appropriately marked and submitted by mail to the DHS/NPPD/IP/ISCD CFATS Program Manager, 245...

Policy-Based Middleware for QoS Management and Signaling in the Evolved Packet System

NASA Astrophysics Data System (ADS)

Good, Richard; Gouveia, Fabricio; Magedanz, Thomas; Ventura, Neco

The 3GPP are currently finalizing their Evolved Packet System (EPS) with the Evolved Packet Core (EPC) central to this framework. The EPC is a simplified, flat, all IP-based architecture that supports mobility between heterogeneous access networks and incorporates an evolved QoS concept based on the 3GPP Policy Control and Charging (PCC) framework. The IP Multimedia Subsystem (IMS) is an IP service element within the EPS, introduced for the rapid provisioning of innovative multimedia services. The evolved PCC framework extends the scope of operation and defines new interactions - in particular the S9 reference point is introduced to facilitate inter-domain PCC communication. This paper proposes an enhancement to the IMS/PCC framework that uses SIP routing information to discover signaling and media paths. This mechanism uses standardized IMS/PCC operations and allows applications to effectively issue resource requests from their home domain enabling QoS-connectivity across multiple domains. Because the mechanism operates at the service control layer it does not require any significant transport layer modifications or the sharing of potentially sensitive internal topology information. The evolved PCC architecture and inter-domain route discovery mechanisms were implemented in an evaluation testbed and performed favorably without adversely effecting end user experience.

Design of real-time voice over internet protocol system under bandwidth network

NASA Astrophysics Data System (ADS)

Zhang, Li; Gong, Lina

2017-04-01

With the increasing bandwidth of the network and network convergence accelerating, VoIP means of communication across the network is becoming increasingly popular phenomenon. The real-time identification and analysis for VOIP flow over backbone network become the urgent needs and research hotspot of network operations management. Based on this, the paper proposes a VoIP business management system over backbone network. The system first filters VoIP data stream over backbone network and further resolves the call signaling information and media voice. The system can also be able to design appropriate rules to complete real-time reduction and presentation of specific categories of calls. Experimental results show that the system can parse and process real-time backbone of the VoIP call, and the results are presented accurately in the management interface, VoIP-based network traffic management and maintenance provide the necessary technical support.

76 FR 81955 - Assessment Questionnaire-IP Sector Specific Agency Risk Self Assessment Tool (IP-SSARSAT)

Federal Register 2010, 2011, 2012, 2013, 2014

2011-12-29

... DEPARTMENT OF HOMELAND SECURITY [Docket No. DHS-2011-0069] Assessment Questionnaire--IP Sector Specific Agency Risk Self Assessment Tool (IP-SSARSAT) AGENCY: National Protection and Programs Directorate...), Office of Infrastructure Protection (IP), Sector Specific Agency Executive Management Office (SSA EMO...

Running TCP/IP over ATM Networks.

ERIC Educational Resources Information Center

Witt, Michael

1995-01-01

Discusses Internet protocol (IP) and subnets and describes how IP may operate over asynchronous transfer mode (ATM). Topics include TCP (transmission control protocol), ATM cells and adaptation layers, a basic architectural model for IP over ATM, address resolution, mapping IP to a subnet technology, and connection management strategy. (LRW)

Characterization of inositol phosphates in carrot (Daucus carota L. ) cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rincon, M.; Chen, Q.; Boss, W.F.

1989-01-01

We have shown previously that inositol-1,4,5-trisphosphate (IP{sub 3}) stimulates an efflux of {sup 45}Ca{sup 2+} from fusogenic carrot protoplasts. In light of these results, we suggested that IP{sub 3} might serve as a second messenger for the mobilization of intracellular Ca{sup 2+} in higher plant cells. To determine whether or not IP{sub 3} and other inositol phosphates were present in the carrot cells, the cells were labeled with myo-(2-{sup 3}H)inositol for 18 hours and extracted with ice-cold 10% trichloroacetic acid. The inositol metabolites were separated by anion exchange chromatography and by paper electrophoresis. We found that ({sup 3}H)inositol metabolites coelutedmore » with inositol bisphosphate (IP{sub 2}) and IP{sub 3} when separated by anion exchange chromatography. However, we could not detect IP{sub 2} or IP{sub 3} when the inositol metabolites were analyzed by paper electrophoresis even though the polyphosphoinositides, which are the source of IP{sub 2} and IP{sub 3}, were present in these cells. Thus, ({sup 3}H)inositol metabolites other than IP{sub 2} and IP{sub 3} had coeluted on the anion exchange columns. The data indicate that either IP{sub 3} is rapidly metabolized or that it is not present at a detectable level in the carrot cells.« less

Motion patterns and phase-transition of a defender-intruder problem and optimal interception strategy of the defender

NASA Astrophysics Data System (ADS)

Wang, Jiangliu; Li, Wei

2015-10-01

In this paper, we consider a defense-intrusion interaction, in which an intruder is attracted by a protected stationary target but repulsed by a defender; while the defender tries to move towards an appropriate interception position (IP) between the intruder and the target in order to intercept the intruder and expel the intruder away from the target as maximum as possible. Intuitionally, to keep the intruder further away, one may wonder that: is it a better strategy for the defender trying to approach the intruder as near as possible? Unexpectedly and interestingly enough, this is not always the case. We first introduce the flexibility for IP selection, then investigate the system dynamics and the stable motion patterns, and characterize the phase-transition surface for the motion patterns. We show that, the phase-transition surface just defines the optimal interception strategy of the defender for IP selection; and from the perspective of mobility of agents, the optimal strategy just depends on relative mobility of the two agents.

Cross talk between cyclic AMP and the polyphosphoinositide signaling cascade in iris sphincter and other nonvascular smooth muscle.

PubMed

Abdel-Latif, A A

1996-02-01

Nonvascular smooth muscle, such as the iris sphincter, receives double reciprocal innervation: stimulation of the parasympathetic nervous system (cholinergic muscarinic), which functions through the polyphosphoinositide (PPI) signaling pathway, contracts it, while activation of the sympathetic nervous system (beta-adrenergic), which functions through the cAMP system, relaxes it. Interactions between the two second messenger systems are important in regulation of smooth muscle tone and represent an important focal point for pharmacological manipulation. Here, I have summarized the experimental evidence in support of the hypothesis that the cross talk between cAMP and the PPI cascade could constitute a biochemical correlate for this functional antagonism. Recent studies suggest that cAMP inhibition is on Ca2+ mobilization rather than myosin light chain phosphorylation. Thus, cAMP-elevating agents, which inhibit agonist-induced PPI hydrolysis, are effective relaxants. Furthermore, inositol 1,4,5-trisphosphate (IP3) appears to be involved in both Ca2+ release from the sarcoplasmic reticulum and in Ca2+ influx through the plasma membrane, and since a reduction in intracellular Ca2+ ([Ca2+]i) is the underlying mechanism for cAMP-mediated relaxation, an important target for cAMP inhibition would be either to inhibit IP3 production or to stimulate IP3 inactivation. In the iris sphincter and other nonvascular smooth muscle there is reasonable experimental evidence that shows that cAMP inhibits phospholipase C activation and stimulates IP3 3-kinase activity, both of which can result in: [i) reduction in IP3 concentrations and (ii) reduction in IP3-dependent Ca2+ mobilization, which may lead to muscle relaxation. In addition to IP3-induced Ca2+ mobilization, changes in [Ca2+]i are the result of the interplay of many processes which may also serve as potential sites for cAMP inhibition. A great deal of progress has been made on the cross talk between cAMP and the PPI signaling cascade in the past decade, and there will be more on the regulation of the second messenger systems and their involvement in smooth muscle tone in the coming years. Clearly, an understanding of the physiological and pathophysiological regulation of smooth muscle tone is central to the development of novel therapeutic agents for the treatment of diseases such as asthma and glaucoma, where cAMP-elevating drugs are currently employed.

Towards a 21st century telephone exchange at CERN

NASA Astrophysics Data System (ADS)

Valentín, F.; Hesnaux, A.; Sierra, R.; Chapron, F.

2015-12-01

The advent of mobile telephony and Voice over IP (VoIP) has significantly impacted the traditional telephone exchange industry—to such an extent that private branch exchanges are likely to disappear completely in the near future. For large organisations, such as CERN, it is important to be able to smooth this transition by implementing new multimedia platforms that can protect past investments and the flexibility needed to securely interconnect emerging VoIP solutions and forthcoming developments such as Voice over LTE (VoLTE). We present the results of ongoing studies and tests at CERN of the latest technologies in this area.

Autoconfiguration and Service Discovery

NASA Astrophysics Data System (ADS)

Manner, Jukka

To be useful, IP networking requires various parameters to be set up. A network node needs at least an IP address, routing information, and name services. In a fixed network this configuration is typically done with a centralized scheme, where a server hosts the configuration information and clients query the server with the Dynamic Host Configuration Protocol (DHCP). Companies, university campuses and even home broadband use the DHCP system to configure hosts. This signaling happens in the background, and users seldom need to think about it; only when things are not working properly, manual intervention is needed. The same protocol can be used in mobile networks, where the client device communicates with the access network provider and his DHCP service. The core information provided by DHCP includes a unique IP address for the host, the IP address of the closest IP router for routing messages to other networks, and the location of domain name servers.

Nuclear inositol 1,4,5-trisphosphate is a necessary and conserved signal for the induction of both pathological and physiological cardiomyocyte hypertrophy.

PubMed

Arantes, Lilian A M; Aguiar, Carla J; Amaya, Maria Jimena; Figueiró, Núbia C G; Andrade, Lídia M; Rocha-Resende, Cibele; Resende, Rodrigo R; Franchini, K G; Guatimosim, Silvia; Leite, M Fatima

2012-10-01

It is well established that inositol 1,4,5-trisphosphate (IP3) dependent Ca(2+) signaling plays a crucial role in cardiomyocyte hypertrophy. However, it is not yet known whether nuclear IP3 represents a Ca(2+) mobilizing pathway involved in this process. The goal of the current work was to investigate the specific role of nuclear IP3 in cardiomyocyte hypertrophic response. In this work, we used an adenovirus construct that selectively buffers IP3 in the nuclear region of neonatal cardiomyocytes. We showed for the first time that nuclear IP3 mediates endothelin-1 (ET-1) induced hypertrophy. We also found that both calcineurin (Cn)/nuclear factor of activated T Cells (NFAT) and histone deacetylase-5 (HDAC5) pathways require nuclear IP3 to mediate pathological cardiomyocyte growth. Additionally, we found that nuclear IP3 buffering inhibited insulin-like growth factor-1 (IGF-1) induced hypertrophy and prevented reexpression of fetal gene program. Together, these results demonstrated that nuclear IP3 is an essential and a conserved signal for both pathological and physiological forms of cardiomyocyte hypertrophy. Copyright © 2012. Published by Elsevier Ltd.

The potential of technology for enhancing individual placement and support supported employment.

PubMed

Lord, Sarah E; McGurk, Susan R; Nicholson, Joanne; Carpenter-Song, Elizabeth A; Tauscher, Justin S; Becker, Deborah R; Swanson, Sarah J; Drake, Robert E; Bond, Gary R

2014-06-01

The potential of technology to enhance delivery and outcomes of Individual Placement and Support (IPS) supported employment. IPS supported employment has demonstrated robust success for improving rates of competitive employment among individuals with psychiatric disabilities. Still, a majority of those with serious mental illnesses are not employed (Bond, Drake, & Becker, 2012). The need to promote awareness of IPS and expand services is urgent. In this study, we describe ways that technologies may enhance delivery of IPS supported employment across the care continuum and stakeholder groups. Directions for research are highlighted. published literature, clinical observations, IPS learning collaborative. Technology has the potential to enhance direct service as well as workflow in the IPS supported employment process, which may lead to improved fidelity and client outcomes. Mobile and cloud technologies open opportunities for collaboration, self-directed care, and ongoing support to help clients obtain and maintain meaningful employment. Research is needed to evaluate efficacy of technology-based approaches for promoting client employment outcomes, to identify provider and organization barriers to using technology for IPS delivery, and to determine effective strategies for implementing technology with IPS in different settings and with diverse client audiences.

The Potential of Technology for Enhancing Individual Placement and Support Supported Employment

PubMed Central

Lord, Sarah E.; McGurk, Susan R.; Nicholson, Joanne; Carpenter-Song, Elizabeth A.; Tauscher, Justin S.; Becker, Deborah R.; Swanson, Sarah J.; Drake, Robert E.; Bond, Gary R.

2015-01-01

Topic The potential of technology to enhance delivery and outcomes of Individual Placement and Support (IPS) supported employment. Purpose IPS supported employment has demonstrated robust success for improving rates of competitive employment among individuals with psychiatric disabilities. Still, a majority of those with serious mental illnesses are not employed (Bond, Drake, & Becker, 2012). The need to promote awareness of IPS and expand services is urgent. In this study, we describe ways that technologies may enhance delivery of IPS supported employment across the care continuum and stakeholder groups. Directions for research are highlighted. Sources Used published literature, clinical observations, IPS learning collaborative. Conclusions and Implications for Practice Technology has the potential to enhance direct service as well as workflow in the IPS supported employment process, which may lead to improved fidelity and client outcomes. Mobile and cloud technologies open opportunities for collaboration, self-directed care, and ongoing support to help clients obtain and maintain meaningful employment. Research is needed to evaluate efficacy of technology-based approaches for promoting client employment outcomes, to identify provider and organization barriers to using technology for IPS delivery, and to determine effective strategies for implementing technology with IPS in different settings and with diverse client audiences. PMID:24912058

Intellectual property, commercial needs and humanitarian benefits: must there be a conflict?

PubMed

Krattiger, Anatole

2010-11-30

'By far the best proof is experience,' wrote Francis Bacon. Given the experience of countries - both developing and developed - that have used intellectual property (IP), IP protection and IP management to stimulate innovation, there is ample proof that good IP management has benefited multitudes of people around the world with new technologies, products and services. Innovations in health and agriculture have greatly enriched lives. But does this experience apply to all countries? If the best proof is experience, then what can be said authoritatively about the effects of using IP systems wisely in developing countries? Copyright © 2010 Elsevier B.V. All rights reserved.

76 FR 17934 - Infrastructure Protection Data Call

Federal Register 2010, 2011, 2012, 2013, 2014

2011-03-31

...), National Protection and Programs Directorate (NPPD), Office of Infrastructure Protection (IP), will submit... Collection Request should be forwarded to DHS/NPPD/IP, 245 Murray Lane, SW., Mail Stop 0602, Arlington, VA..., this responsibility is managed by IP within NPPD. Beginning in Fiscal Year 2006, IP engaged in the...

Intelligent Advanced Communications IP Telephony Feasibility for the U.S. Navy: Phase 2

DTIC Science & Technology

2009-03-31

PDAs) and smart phones. In addition, it considers how solutions integrate on-premise enterprise functions with the functions of mobile operators...and Control System GIG Global Information Grid GigE Gigabit Ethernet GIPS Global IP Solutions Inc. GMSK Gaussian Minimum Shift Keying GPHY Gigabit...Feasibility for the U.S. Navy – Phase 2 UAC User Agent Client UART Universal Asynchronous Receiver/Transmitter UAS User Agent Server UCR

A Conjoint Analysis of Voice Over IP Attributes.

ERIC Educational Resources Information Center

Zubey, Michael L.; Wagner, William; Otto, James R.

2002-01-01

Managers need to understand the tradeoffs associated with voice over Internet protocol (VoIP) networks as compared to the Public Switched Telephone Network (PSTN). This article measures the preference structures between IP telephony and PSTN services using conjoint analysis. The purpose is to suggest VoIP technology attributes that best meet…

76 FR 47114 - Wireless E911 Location Accuracy Requirements; E911 Requirements for IP-Enabled Service Providers

Federal Register 2010, 2011, 2012, 2013, 2014

2011-08-04

... desktop computers and mobile devices, we expect significant innovation to continue in the provision of... inside of buildings.'' 47. Discussion. Publicly available reports, such as a March 2011 study from J. D... installed Wi-Fi access points, and a growing number of mobile devices (e.g., smartphones, laptops, and...

A Novel Addressing Scheme for PMIPv6 Based Global IP-WSNs

PubMed Central

Islam, Md. Motaharul; Huh, Eui-Nam

2011-01-01

IP based Wireless Sensor Networks (IP-WSNs) are being used in healthcare, home automation, industrial control and agricultural monitoring. In most of these applications global addressing of individual IP-WSN nodes and layer-three routing for mobility enabled IP-WSN with special attention to reliability, energy efficiency and end to end delay minimization are a few of the major issues to be addressed. Most of the routing protocols in WSN are based on layer-two approaches. For reliability and end to end communication enhancement the necessity of layer-three routing for IP-WSNs is generating significant attention among the research community, but due to the hurdle of maintaining routing state and other communication overhead, it was not possible to introduce a layer-three routing protocol for IP-WSNs. To address this issue we propose in this paper a global addressing scheme and layer-three based hierarchical routing protocol. The proposed addressing and routing approach focuses on all the above mentioned issues. Simulation results show that the proposed addressing and routing approach significantly enhances the reliability, energy efficiency and end to end delay minimization. We also present architecture, message formats and different routing scenarios in this paper. PMID:22164084

A novel addressing scheme for PMIPv6 based global IP-WSNs.

PubMed

Islam, Md Motaharul; Huh, Eui-Nam

2011-01-01

IP based Wireless Sensor Networks (IP-WSNs) are being used in healthcare, home automation, industrial control and agricultural monitoring. In most of these applications global addressing of individual IP-WSN nodes and layer-three routing for mobility enabled IP-WSN with special attention to reliability, energy efficiency and end to end delay minimization are a few of the major issues to be addressed. Most of the routing protocols in WSN are based on layer-two approaches. For reliability and end to end communication enhancement the necessity of layer-three routing for IP-WSNs is generating significant attention among the research community, but due to the hurdle of maintaining routing state and other communication overhead, it was not possible to introduce a layer-three routing protocol for IP-WSNs. To address this issue we propose in this paper a global addressing scheme and layer-three based hierarchical routing protocol. The proposed addressing and routing approach focuses on all the above mentioned issues. Simulation results show that the proposed addressing and routing approach significantly enhances the reliability, energy efficiency and end to end delay minimization. We also present architecture, message formats and different routing scenarios in this paper.

Design and implementation of a VoIP broadcasting service over embedded systems in a heterogeneous network environment.

PubMed

Leu, Jenq-Shiou; Lin, Wei-Hsiang; Hsieh, Wen-Bin; Lo, Chien-Chih

2014-01-01

As the digitization is integrated into daily life, media including video and audio are heavily transferred over the Internet nowadays. Voice-over-Internet Protocol (VoIP), the most popular and mature technology, becomes the focus attracting many researches and investments. However, most of the existing studies focused on a one-to-one communication model in a homogeneous network, instead of one-to-many broadcasting model among diverse embedded devices in a heterogeneous network. In this paper, we present the implementation of a VoIP broadcasting service on the open source-Linphone-in a heterogeneous network environment, including WiFi, 3G, and LAN networks. The proposed system featuring VoIP broadcasting over heterogeneous networks can be integrated with heterogeneous agile devices, such as embedded devices or mobile phones. VoIP broadcasting over heterogeneous networks can be integrated into modern smartphones or other embedded devices; thus when users run in a traditional AM/FM signal unreachable area, they still can receive the broadcast voice through the IP network. Also, comprehensive evaluations are conducted to verify the effectiveness of the proposed implementation.

Design and Implementation of a VoIP Broadcasting Service over Embedded Systems in a Heterogeneous Network Environment

PubMed Central

Lin, Wei-Hsiang; Hsieh, Wen-Bin; Lo, Chien-Chih

2014-01-01

As the digitization is integrated into daily life, media including video and audio are heavily transferred over the Internet nowadays. Voice-over-Internet Protocol (VoIP), the most popular and mature technology, becomes the focus attracting many researches and investments. However, most of the existing studies focused on a one-to-one communication model in a homogeneous network, instead of one-to-many broadcasting model among diverse embedded devices in a heterogeneous network. In this paper, we present the implementation of a VoIP broadcasting service on the open source—Linphone—in a heterogeneous network environment, including WiFi, 3G, and LAN networks. The proposed system featuring VoIP broadcasting over heterogeneous networks can be integrated with heterogeneous agile devices, such as embedded devices or mobile phones. VoIP broadcasting over heterogeneous networks can be integrated into modern smartphones or other embedded devices; thus when users run in a traditional AM/FM signal unreachable area, they still can receive the broadcast voice through the IP network. Also, comprehensive evaluations are conducted to verify the effectiveness of the proposed implementation. PMID:25300280

Design and implementation of a unified certification management system based on seismic business

NASA Astrophysics Data System (ADS)

Tang, Hongliang

2018-04-01

Many business software for seismic systems are based on web pages, users can simply open a browser and enter their IP address. However, how to achieve unified management and security management of many IP addresses, this paper introduces the design concept based on seismic business and builds a unified authentication management system using ASP technology.

Effective Leadership and Management of an ACS Injury Prevention Program: Current Opinions and Perspectives From Where the Rubber Meets the Road.

PubMed

Wolfe, Elizabeth S; Bryant, Elizabeth A

The American College of Surgeons (ACS) mandates that each verified trauma center must have an injury prevention coordinator (IPC); however, Chapter 18 in the Resources for Optimal Care of the Injured Patient (2014) provides minimal information on how to effectively lead or manage an injury prevention (IP) program. This opinion article addresses 3 fundamental components of an effective IP program: (1) construction of an innovative vision of IP programming using current technology; (2) intentional investment and involvement; and (3) stakeholder leadership, engagement, and sustainability. This article also provides leadership and management methods from other professions both within and outside of the health care field that can be translated into sustainable IP program planning, implementation, and longevity.

Improvement of the course “Management of intellectual property” based on the mixed state contract in the field of scientific R&D

NASA Astrophysics Data System (ADS)

Yakovlev, D.; Ageev, A.; Yushkov, E.; Bogatyreova, M.

2017-01-01

Intellectual property (IP) is one of the forms of storing knowledge - intangible assets of knowledge economy. The translation of IP knowledge to the young generation is one of the challenges of nuclear knowledge management. At the NRNU MEPhI (National Research Nuclear University MEPhI), the subject is studied within the framework of the academic course “Management of intellectual property. The aim of the course is to train qualified specialists, ready to use modern methods of strategic management of IP in commercial firms. The article is devoted to the strengthening and transfer of IP rights for scientific output application in industry and commerce. The state remains the main source that finances all the significant developments in the field of science and technology. Therefore, the primary task is to effectively utilize the R&D output created at the expense of the Federal budget, both within the state order and the estimated budget financing. Currently, there exist contradictions in the area of strengthening and transfer of rights for R&D in the field of science. The newly borne concept dealing with the strengthening of IP rights for the scientific R&D output, centers on the theory of a mixed state contract and is conveniently integrated with the academic course mentioned. Knowledge itself takes the form of IP, as soon as it becomes formalized. The academic course when supplemented with various approaches to strengthening and transfer of IP rights for the scientific R&D output certainly gives a better understanding of the commercialization process of the intellectual capital and structures relevance to intellectual property. The research material is integrated with the educational process, and the academic course “Management of intellectual property” is designed both for economic and engineering specialties.

Effects of inositol trisphosphate on calcium mobilization in high-voltage and saponin-permeabilized platelets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gear, A.R.L.; Hallam, T.J.

1986-03-01

Interest in phosphatidylinositol metabolism has been greatly stimulated by the findings that diglyceride and inositol phosphates may serve as second messengers in modulating cellular function. Formation of 1,4,5-inositol trisphosphate (IP/sub 3/), in particular, has been linked to mobilization of intracellular calcium in a number of cell types. The authors have examined the ability of IP/sub 3/ to mobilize calcium in human platelets permeabilized by either saponin or high-voltage discharge. Saponin at 15 ..mu..g/ml effectively permeabilized platelets to exogenous inositol 1,4,5-trisphosphate which released bound (/sup 45/Ca) within 1 min and with a Ka of 7.4 +/- 4.1 ..mu..M. A small (25%)more » azide-sensitive pool was also responsive to inositol trisphosphate. The calcium pools were completely discharged by A-23187 and the ATP-dependent uptake was prevented by dinitrophenol. In contrast to the result with saponin, platelets accessed by high-voltage discharge were insensitive to challenge by inositol 1,4,5-trisphosphate. The data suggest that while inositol 1,4,5-trisphosphate can rapidly mobilize platelet calcium, the ability to demonstrate this depends on the method of permeabilization.« less

An IMS-Based Middleware Solution for Energy-Efficient and Cost-Effective Mobile Multimedia Services

NASA Astrophysics Data System (ADS)

Bellavista, Paolo; Corradi, Antonio; Foschini, Luca

Mobile multimedia services have recently become of extreme industrial relevance due to the advances in both wireless client devices and multimedia communications. That has motivated important standardization efforts, such as the IP Multimedia Subsystem (IMS) to support session control, mobility, and interoperability in all-IP next generation networks. Notwithstanding the central role of IMS in novel mobile multimedia, the potential of IMS-based service composition for the development of new classes of ready-to-use, energy-efficient, and cost-effective services is still widely unexplored. The paper proposes an original solution for the dynamic and standard-compliant redirection of incoming voice calls towards WiFi-equipped smart phones. The primary design guideline is to reduce energy consumption and service costs for the final user by automatically switching from the 3G to the WiFi infrastructure whenever possible. The proposal is fully compliant with the IMS standard and exploits the recently released IMS presence service to update device location and current communication opportunities. The reported experimental results point out that our solution, in a simple way and with full compliance with state-of-the-art industrially-accepted standards, can significantly increase battery lifetime without negative effects on call initiation delay.

An interprofessional approach to shared decision making: an exploratory case study with family caregivers of one IP home care team.

PubMed

Légaré, France; Stacey, Dawn; Brière, Nathalie; Robitaille, Hubert; Lord, Marie-Claude; Desroches, Sophie; Drolet, Renée

2014-07-02

Within the context of an exploratory case study, the authors assessed the perceptions of family caregivers about the decision-making process regarding relocating their relative and about the applicability of an interprofessional approach to shared decision making (IP-SDM). They also assessed perceptions of health professionals and health managers about IP-SDM. From November 2010 to October 2011, we worked with one IP home care team dedicated to older adults (the case) from a large primary health care organization in Quebec City, Canada. We identified six of their clients who had faced a decision about whether to stay at home or move to a long-term care facility in the past year and interviewed their family caregivers. We explored the decision-making process they had experienced regarding relocating their relative and their perceptions about the applicability of IP-SDM in this context. Attitudes towards IP-SDM and potential barriers to this approach were explored using a focus group with the participating IP home care team, individual interviews with 8 managers and a survey of 272 health professionals from the primary care organization. A hybrid process of inductive and deductive thematic analysis was used and data were triangulated across all sources. Family caregivers reported lack of agreement on the nature of the decision to be made, a disconnection between home care services and relatives' needs, and high cost of long-term care alternatives. Factors influencing their decision included their ability to provide care for their relative. While they felt somewhat supported by the IP home care team, they also felt pressured in the decision. Overall, they did not perceive they had been exposed to IP-SDM but agreed that it was applicable in this context. Results from the survey, focus group and interviews with health professionals and managers indicated they all had a favourable attitude towards IP-SDM but many barriers hampered its implementation in their practice. The family caregivers in this study did not experience IP-SDM when relocating their relative. Added to results obtained with health professionals and managers, this highlights the need for an effective intervention targeting identified barriers to implementing IP-SDM in this context.

Association of University Technology Managers Asia 2013 conference.

PubMed

Komatani, Takeshi S

2013-07-01

The Association of University Technology Managers is a nonprofit association of technology managers and business executives who manage IP. This year's Asian meeting was held in Japan for the first time. A number of participants and delegates not only from Asia but also from all over the world attended, and had a number of sessions dealing with R&D in universities, and IP derived from this.

Mobile Vehicle Teleoperated Over Wireless IP

DTIC Science & Technology

2007-06-13

VideoLAN software suite. The VLC media player portion of this suite handles net- work streaming of video, as well as the receipt and display of the video...is found in appendix C.7. Video Display The video feed is displayed for the operator using VLC opened independently from the control sending program...This gives the operator the most choice in how to configure the display. To connect VLC to the feed all you need is the IP address from the Java

The Use of Phosphate Amendments for Chemical Immobilization of Uranium in Contaminated Soil.

NASA Astrophysics Data System (ADS)

Baker, M.; Coutelot, F.; Seaman, J. C.

2017-12-01

Past Department of Energy (DOE) production of nuclear materials has resulted in uranium (U) contaminated soil and groundwater posing a significant risk to the environment and human health. In situ remediation strategies are typically less expensive and rely on the introduction of chemical additives in order to reduce contaminant migration and ultimately the associated exposure hazard. Phosphate addition to U-contaminated subsurface environments has been proposed as a U remediation strategy. Saturated and unsaturated batch experiments were performed to investigate the ability of three different phosphate source treatments: hydroxyapatite (HA), phytic acid (IP6) and sodium tripolyphosphate (TPP) to chemically immobilize U in contaminated Savannah River Site (SRS) soil (2,040 mg U/kg soil). Amendment treatments ranged from 925 to 4620 mg P /kg soil. Unsaturated test samples were equilibrated for 3 weeks at 60% of the soil's field capacity, followed by pore-water extraction by centrifugation to provide an indication of the remaining mobile U fraction. Saturated batch experiments were equilibrated on an orbital shaker for 30 days under both oxic and anoxic conditions, with aliquots taken at specific intervals for chemical analysis. In the saturated microcosms, HA decreased the mobile U concentration by 98% in both redox environments and at all treatment levels. IP6 and TPP were able to decrease the soluble U concentration at low treatment levels, but tended to release U at higher treatment levels compared to the control. Unsaturated microcosms also showed HA to be the most effective treatment for immobilizing U, but IP6 and TPP were as effective as HA at the lowest treatment level. The limited contaminant immobilization following TPP and IP6 amendments correlated with the dispersion of organic matter and organo-mineral colloids. For both experiment types, TPP and IP6 samples showed a very limited ortho-phosphate (PO4-) in the solution, indicating the slow mineralization of TPP and IP6.

IP/sub 3/ stimulates CA/sup + +/ efflux from fusogenic carrot protoplasts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rincon, M.; Boss, W.F.

1986-04-01

Polyphosphoinositide breakdown plays an important role in signal transduction in animal cells (Berridge and Irvine, 1984, Nature, 312:315). Upon stimulation, phospholipase C hydrolyzes phosphatidylinositol 4,5-bisphosphate to inositol 1,4,5-trisphosphate (IP/sub 3/) and diacylglycerol both of which act as cellular second messengers. IP/sub 3/ mobilizes Ca/sup + +/ from internal stores, hence the cytosolic free Ca/sup + +/ concentration increases and those physiological activities regulated by Ca/sup + +/ are stimulated. To test if plant cells also responded to IP/sub 3/, Ca/sup + +/ efflux studies were done with fusogenic carrot protoplasts released in EGTA. The protoplasts were preloaded with /sup 45/Ca/supmore » + +/ placed in a Ca/sup + +/-free medium, and efflux determined as /sup 45/Ca/sup + +/ loss from the protoplasts. IP/sub 3/ (10-20..mu..M) caused enhanced /sup 45/Ca/sup + +/ efflux and the response was sustained for at least 15 min. In plants, as in animals, the observed IP/sub 3/-enhanced /sup 45/Ca/sup + +/ efflux suggested that IP/sub 3/ released Ca/sup + +/ from internal stores, and the increased free cytosolic Ca/sup + +/ activated Ca/sup + +/ pumping mechanisms which restored the Ca/sup + +/ concentration in the cytosol to the normal level.« less

Providing QoS guarantee in 3G wireless networks

NASA Astrophysics Data System (ADS)

Chuah, MooiChoo; Huang, Min; Kumar, Suresh

2001-07-01

The third generation networks and services present opportunities to offer multimedia applications and services that meet end-to-end quality of service requirements. In this article, we present UMTS QoS architecture and its requirements. This includes the definition of QoS parameters, traffic classes, the end-to-end data delivery model, and the mapping of end-to-end services to the services provided by the network elements of the UMTS. End-to-end QoS of a user flow is achieved by the combination of the QoS control over UMTS Domain and the IP core Network. In the Third Generation Wireless network, UMTS bearer service manager is responsible to manage radio and transport resources to QoS-enabled applications. The UMTS bearer service consists of the Radio Access Bearer Service between Mobile Terminal and SGSN and Core Network bearer service between SGSN and GGSN. The Radio Access Bearer Service is further realized by the Radio Bearer Service (mostly air interface) and Iu bearer service. For the 3G air interface, one can provide differentiated QoS via intelligent burst allocation scheme, adaptive spreading factor control and weighted fair queueing scheduling algorithms. Next, we discuss the requirements for the transport technologies in the radio access network to provide differentiated QoS to multiple classes of traffic. We discuss both ATM based and IP based transport solutions. Last but not least, we discuss how QoS mechanism is provided in the core network to ensure e2e quality of service requirements. We discuss how mobile terminals that use RSVP as QoS signaling mechanisms can be are supported in the 3G network which may implement only IETF diffserv mechanism. . We discuss how one can map UMTS QoS classes with IETF diffserv code points. We also discuss 2G/3G handover scenarios and how the 2G/3G QoS parameters can be mapped.

77 FR 74678 - Chemical Security Assessment Tool (CSAT)

Federal Register 2010, 2011, 2012, 2013, 2014

2012-12-17

...), National Protection and Programs Directorate (NPPD), Office of Infrastructure Protection (IP.../IP/ISCD Chemical Facility Anti-Terrorism Standards Program Manager, 245 Murray Lane SW., Mail Stop... should be appropriately marked and submitted by mail to the DHS/NPPD/IP/ISCD Chemical Facility Anti...

Formation of Polymer Networks for Fast In-Plane Switching of Liquid Crystals at Low Temperatures

NASA Astrophysics Data System (ADS)

Yu, Byeong-Hun; Song, Dong Han; Kim, Ki-Han; Wok Park, Byung; Choi, Sun-Wook; Park, Sung Il; Kang, Sung Gu; Yoon, Jeong Hwan; Kim, Byeong Koo; Yoon, Tae-Hoon

2013-09-01

We formed a polymer structure to enable fast in-plane switching of liquid crystals at low temperatures. The problem of the inevitable slow response at low temperatures was reduced by the formation of in-cell polymer networks in in-plane switching (IPS) cells. The electro-optic characteristics of polymer-networked IPS cells were measured at temperatures ranging from -10 to 20 °C. The turn-on and turn-off times of an IPS cell were reduced by 44.5 and 47.2% at -10 °C by the formation of polymer networks. We believe that the proposed technology can be applied to emerging display devices such as mobile phones and automotive displays that may be used at low temperatures.

Networks - The Air Force’s Newest Weapon Systems

DTIC Science & Technology

2006-02-17

Force networks. Marshall T. Rose, The Simple Book: An Introduction to Management of TCP/IP based internets, (Englewood Cliffs, New Jersey: Prentice...18 November 2005 19. Rose, Marshall T. The Simple Book: An Introduction to Management of TCP/IP based internets, (Englewood Cliffs, New Jersey

Computer Networks and Information Warfare: Implications for Military Operations

DTIC Science & Technology

2000-07-01

specifically referring to this network.” Marshall T. Rose, The Simple Book: An Introduction to Management of TCP/IP based internets (Englewood...Cliffs, New Jersey: Prentice Hall, 1991), p. 2. 22. Marshall T. Rose, The Simple Book: An Introduction to Management of TCP/IP based internets

Participation of a coordinating center pharmacy in a multicenter international study.

PubMed

Jeon, Jihyun Esther; Mighty, Janet; Lane, Karen; McBee, Nichol; Majkowski, Ryan; Mayo, Steven; Hanley, Daniel

2016-11-15

The activities of a coordinating center pharmacy (CCP) supporting a multicenter, international clinical trial are described. Serving in a research support role comparable to that of a commercial clinical trial supply company, a CCP within the Johns Hopkins Hospital Investigational Drug Service (JHH IDS) uses its management expertise and infrastructure to support multicenter trials, such as the recently completed Clot Lysis: Evaluating Accelerated Resolution of Intraventricular Hemorrhage, Phase III (CLEAR III) trial. The role of the CCP staff in supporting the CLEAR III trial was overall investigational product (IP) management through coordination of IP-related operations to ensure high-quality care for study participants at study sites in the United States and abroad. For the CLEAR III trial, the CCP coordinated IP supply activities; provided education to site pharmacists; developed study-specific documents, including pharmacy manuals; communicated with trial stakeholders, including third-party IP distributors; monitored treatment assignments; and performed quality assurance monitoring to ensure compliance with institutional, state, federal, and international regulations regarding IP procurement and storage. Acting as a CCP for a multicenter international study poses a number of operational challenges while providing opportunities for the CCP to contribute to research of global importance and enrich the skill sets of its personnel. The development and implementation of the CCP at JHH IDS for the CLEAR III trial included several responsibilities, such as IP supply management, communication, and database, regulatory, and finance management. Copyright © 2016 by the American Society of Health-System Pharmacists, Inc. All rights reserved.

Performance of a Regional Aeronautical Telecommunications Network

NASA Technical Reports Server (NTRS)

Bretmersky, Steven C.; Ripamonti, Claudio; Konangi, Vijay K.; Kerczewski, Robert J.

2001-01-01

This paper reports the findings of the simulation of the ATN (Aeronautical Telecommunications Network) for three typical average-sized U.S. airports and their associated air traffic patterns. The models of the protocols were designed to achieve the same functionality and meet the ATN specifications. The focus of this project is on the subnetwork and routing aspects of the simulation. To maintain continuous communication between the aircrafts and the ground facilities, a model based on mobile IP is used. The results indicate that continuous communication is indeed possible. The network can support two applications of significance in the immediate future FTP and HTTP traffic. Results from this simulation prove the feasibility of development of the ATN concept for AC/ATM (Advanced Communications for Air Traffic Management).

Automobile inspection system based on wireless communication

NASA Astrophysics Data System (ADS)

Miao, Changyun; Ye, Chunqing

2010-07-01

This paper aims to research the Automobile Inspection System based on Wireless Communication, and suggests an overall design scheme which uses GPS for speed detection and Bluetooth and GPRS for communication. The communication between PDA and PC was realized by means of GPRS and TCP/IP; and the hardware circuit and software for detection terminal were devised by means of JINOU-3264 Bluetooth Module after analyzing the Bluetooth and its communication protocol. According to the results of debugging test, this system accomplished GPRS based data communication and management as well as the real-time detection on auto safety performance parameters in crash test via PC, whereby the need for mobility and reliability was met and the efficiency and level of detection was improved.

77 FR 74685 - Chemical Facility Anti-Terrorism Standards (CFATS) Chemical-Terrorism Vulnerability Information...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-12-17

... Programs Directorate (NPPD), Office of Infrastructure Protection (IP), Infrastructure Security Compliance... questions about this Information Collection Request should be forwarded to DHS/NPPD/IP/ISCD CFATS Program... to the DHS/NPPD/IP/ISCD CFATS Program Manager at the Department of Homeland Security, 245 Murray Lane...

77 FR 37060 - Critical Infrastructure and Key Resources (CIKR) Asset Protection Technical Assistance Program...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-06-20

...), National Protection and Programs Directorate (NPPD), Office of Infrastructure Protection (IP.../IP/IICD, 245 Murray Lane SW., Mailstop 0602, Arlington, VA 20598-0602. Email requests should go to... Technical Assistance Program (CAPTAP) is offered jointly by the NPPD/IP and the Federal Emergency Management...

75 FR 13775 - Agency Information Collection Activities: Proposed Collection; Comment Request, 1660-NEW...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-23

... Security Exercise and Evaluation Program (HSEEP) After Action Report (AAR) Improvement Plan (IP) AGENCY... (HSEEP) After Action Report (AAR) Improvement Plan (IP). SUMMARY: The Federal Emergency Management Agency... (HSEEP) After Action Report (AAR) Improvement Plan (IP). DATES: Comments must be submitted on or before...

Transition plan.

DOT National Transportation Integrated Search

2009-02-02

Although the 9-1-1 system has been a success for nearly 40 years, changes in the publics use of : technology, the saturation of the mobile market, and the spread of Voice over Internet Protocol (VoIP) : telephony over broadband are contributing to...

Aorta: a management layer for mobile peer-to-peer massive multiplayer games

NASA Astrophysics Data System (ADS)

Edlich, Stefan; Hoerning, Henrik; Brunnert, Andreas; Hoerning, Reidar

2005-03-01

The development of massive multiplayer games (MMPGs) for personal computers is based on a wide range of frameworks and technologies. In contrast, MMPG development for cell phones lacks the availability of framework support. We present Aorta as a multi-purpose lightweight MIDP 2.0 framework to support the transparent and equal API usage of peer-to-peer communication via http, IP and Bluetooth. Special experiments, such as load-tests on Nokia 6600s, have been carried out with Bluetooth support in using a server-as-client architecture to create ad-hoc networks by using piconet functionalities. Additionally, scatternet functionalities, which will be supported in upcoming devices, have been tested in a simulated environment on more than 12 cell phones. The core of the Aorta framework is the Etherlobby, which manages connections, peers, the game lobby, game policies and much more. The framework itself was developed to enable the fast development of mobile games, regardless of the distance between users, which might be within the schoolyard or much further away. The earliest market-ready application shown here is a multimedia game for cell phones utilizing all of the frameworks features. This game, called Micromonster, acts as platform for developer tests, as well as providing valuable information about interface usability and user acceptance.

Multimedia information processing in the SWAN mobile networked computing system

NASA Astrophysics Data System (ADS)

Agrawal, Prathima; Hyden, Eoin; Krzyzanowsji, Paul; Srivastava, Mani B.; Trotter, John

1996-03-01

Anytime anywhere wireless access to databases, such as medical and inventory records, can simplify workflow management in a business, and reduce or even eliminate the cost of moving paper documents. Moreover, continual progress in wireless access technology promises to provide per-user bandwidths of the order of a few Mbps, at least in indoor environments. When combined with the emerging high-speed integrated service wired networks, it enables ubiquitous and tetherless access to and processing of multimedia information by mobile users. To leverage on this synergy an indoor wireless network based on room-sized cells and multimedia mobile end-points is being developed at AT&T Bell Laboratories. This research network, called SWAN (Seamless Wireless ATM Networking), allows users carrying multimedia end-points such as PDAs, laptops, and portable multimedia terminals, to seamlessly roam while accessing multimedia data streams from the wired backbone network. A distinguishing feature of the SWAN network is its use of end-to-end ATM connectivity as opposed to the connectionless mobile-IP connectivity used by present day wireless data LANs. This choice allows the wireless resource in a cell to be intelligently allocated amongst various ATM virtual circuits according to their quality of service requirements. But an efficient implementation of ATM in a wireless environment requires a proper mobile network architecture. In particular, the wireless link and medium-access layers need to be cognizant of the ATM traffic, while the ATM layers need to be cognizant of the mobility enabled by the wireless layers. This paper presents an overview of SWAN's network architecture, briefly discusses the issues in making ATM mobile and wireless, and describes initial multimedia applications for SWAN.

A General Purpose Connections type CTI Server Based on SIP Protocol and Its Implementation

NASA Astrophysics Data System (ADS)

Watanabe, Toru; Koizumi, Hisao

In this paper, we propose a general purpose connections type CTI (Computer Telephony Integration) server that provides various CTI services such as voice logging where the CTI server communicates with IP-PBX using the SIP (Session Initiation Protocol), and accumulates voice packets of external line telephone call flowing between an IP telephone for extension and a VoIP gateway connected to outside line networks. The CTI server realizes CTI services such as voice logging, telephone conference, or IVR (interactive voice response) with accumulating and processing voice packets sampled. Furthermore, the CTI server incorporates a web server function which can provide various CTI services such as a Web telephone directory via a Web browser to PCs, cellular telephones or smart-phones in mobile environments.

Buffer kinetics shape the spatiotemporal patterns of IP3-evoked Ca2+ signals

PubMed Central

Dargan, Sheila L; Parker, Ian

2003-01-01

Ca2+ liberation through inositol 1,4,5-trisphosphate receptors (IP3Rs) plays a universal role in cell regulation, and specificity of cell signalling is achieved through the spatiotemporal patterning of Ca2+ signals. IP3Rs display Ca2+-induced Ca2+ release (CICR), but are grouped in clusters so that regenerative Ca2+ signals may remain localized to individual clusters, or propagate globally between clusters by successive cycles of Ca2+ diffusion and CICR. We used confocal microscopy and photoreleased IP3 in Xenopus oocytes to study how these properties are modulated by mobile cytosolic Ca2+ buffers. EGTA (a buffer with slow ‘on-rate’) speeded Ca2+ signals and ‘balkanized’ Ca2+ waves by dissociating them into local signals. In contrast, BAPTA (a fast buffer with similar affinity) slowed Ca2+ responses and promoted ‘globalization’ of spatially uniform Ca2+ signals. These actions are likely to arise through differential effects on Ca2+ feedback within and between IP3R clusters, because Ca2+ signals evoked by influx through voltage-gated channels were little affected. We propose that cell-specific expression of Ca2+-binding proteins with distinct kinetics may shape the time course and spatial distribution of IP3-evoked Ca2+ signals for specific physiological roles. PMID:14555715

Integrating policy-based management and SLA performance monitoring

NASA Astrophysics Data System (ADS)

Liu, Tzong-Jye; Lin, Chin-Yi; Chang, Shu-Hsin; Yen, Meng-Tzu

2001-10-01

Policy-based management system provides the configuration capability for the system administrators to focus on the requirements of customers. The service level agreement performance monitoring mechanism helps system administrators to verify the correctness of policies. However, it is difficult for a device to process the policies directly because the policies are the management concept. This paper proposes a mechanism to decompose a policy into rules that can be efficiently processed by a device. Thus, the device may process the rule and collect the performance statistics information efficiently; and the policy-based management system may collect these performance statistics information and report the service-level agreement performance monitoring information to the system administrator. The proposed policy-based management system achieves both the policy configuration and service-level agreement performance monitoring requirements. A policy consists of a condition part and an action part. The condition part is a Boolean expression of a source host IP group, a destination host IP group, etc. The action part is the parameters of services. We say that an address group is compact if it only consists of a range of IP address that can be denoted by a pair of IP address and corresponding IP mask. If the condition part of a policy only consists of the compact address group, we say that the policy is a rule. Since a device can efficiently process a compact address and a system administrator prefers to define a range of IP address, the policy-based management system has to translate policy into rules and supplements the gaps between policy and rules. The proposed policy-based management system builds the relationships between VPN and policies, policy and rules. Since the system administrator wants to monitor the system performance information of VPNs and policies, the proposed policy-based management system downloads the relationships among VPNs, policies and rules to the SNMP agents. The SNMP agents build the management information base (MIB) of all VPNs, policies and rules according to the relationships obtained from the management server. Thus, the proposed policy-based management system may get all performance monitoring information of VPNs and policies from agents. The proposed policy-based manager achieves two goals: a) provide a management environment for the system administrator to configure their network only considering the policy requirement issues and b) let the device have only to process the packet and then collect the required performance information. These two things make the proposed management system satisfy both the user and device requirements.

Objective Speech Quality Assessment Based on Payload Discrimination of Lost Packets for Cellular Phones in NGN Environment

NASA Astrophysics Data System (ADS)

Uemura, Satoshi; Fukumoto, Norihiro; Yamada, Hideaki; Nakamura, Hajime

A feature of services provided in a Next Generation Network (NGN) is that the end-to-end quality is guaranteed. This is quite a challenging issue, given the considerable fluctuation in network conditions within a Fixed Mobile Convergence (FMC) network. Therefore, a novel approach, whereby a network node and a mobile terminal such as a cellular phone cooperate with each other to control service quality is essential. In order to achieve such cooperation, the mobile terminal needs to become more intelligent so it can estimate the service quality, including the user's perceptual quality, and notify the measurement result to the network node. Subsequently, the network node implements some kind of service control function, such as a resource and admission control function, based on the notification from the mobile terminal. In this paper, the role of the mobile terminal in such collaborative system is focused on. As a part of a QoS/QoE measurement system, we describe an objective speech quality assessment with payload discrimination of lost packets to measure the user's perceptual quality of VoIP. The proposed assessment is so simple that it can be implemented on a cellular phone. We therefore did this as part of the QoS/QoE measurement system. By using the implemented system, we can measure the user's perceptual quality of VoIP as well as the network QoS metrics, in terms of criteria such as packet loss rate, jitter and burstiness in real time.

Patent data mining: a tool for accelerating HIV vaccine innovation.

PubMed

Clark, K; Cavicchi, J; Jensen, K; Fitzgerald, R; Bennett, A; Kowalski, S P

2011-05-31

Global access to advanced vaccine technologies is challenged by the interrelated components of intellectual property (IP) management strategies, technology transfer (legal and technical) capabilities and the capacity necessary for accelerating R&D, commercialization and delivery of vaccines. Due to a negative association with the management of IP, patents are often overlooked as a vast resource of freely available, information akin to scientific journals as well as business and technological information and trends fundamental for formulating policies and IP management strategies. Therefore, a fundamental step towards facilitating global vaccine access will be the assembly, organization and analysis of patent landscapes, to identify the amount of patenting, ownership (assignees) and fields of technology covered. This is critical for making informed decisions (e.g., identifying licensees, building research and product development collaborations, and ascertaining freedom to operate). Such information is of particular interest to the HIV vaccine community where the HIV Vaccine Enterprise, have voiced concern that IP rights (particularly patents and trade secrets) may prevent data and materials sharing, delaying progress in research and development of a HIV vaccine. We have compiled and analyzed a representative HIV vaccine patent landscape for a prime-boost, DNA/adenoviral vaccine platform, as an example for identifying obstacles, maximizing opportunities and making informed IP management strategy decisions towards the development and deployment of an efficacious HIV vaccine. Copyright © 2011 Elsevier Ltd. All rights reserved.

Using a CLIPS expert system to automatically manage TCP/IP networks and their components

NASA Technical Reports Server (NTRS)

Faul, Ben M.

1991-01-01

A expert system that can directly manage networks components on a Transmission Control Protocol/Internet Protocol (TCP/IP) network is described. Previous expert systems for managing networks have focused on managing network faults after they occur. However, this proactive expert system can monitor and control network components in near real time. The ability to directly manage network elements from the C Language Integrated Production System (CLIPS) is accomplished by the integration of the Simple Network Management Protocol (SNMP) and a Abstract Syntax Notation (ASN) parser into the CLIPS artificial intelligence language.

Milrinone attenuates thromboxane receptor-mediated hyperresponsiveness in hypoxic pulmonary arterial myocytes

PubMed Central

Santhosh, KT; Elkhateeb, O; Nolette, N; Outbih, O; Halayko, AJ; Dakshinamurti, S

2011-01-01

BACKGROUND AND PURPOSE Neonatal pulmonary hypertension (PPHN) is characterized by pulmonary vasoconstriction, due in part to dysregulation of the thromboxane prostanoid (TP) receptor. Hypoxia induces TP receptor–mediated hyperresponsiveness, whereas serine phosphorylation mediates desensitization of TP receptors. We hypothesized that prostacyclin (IP) receptor activity induces TP receptor phosphorylation and decreases ligand affinity; that TP receptor sensitization in hypoxic myocytes is due to IP receptor inactivation; and that this would be reversible by the cAMP-specific phosphodiesterase inhibitor milrinone. EXPERIMENTAL APPROACH We examined functional regulation of TP receptors by serine phosphorylation and effects of IP receptor stimulation and protein kinase A (PKA) activity on TP receptor sensitivity in myocytes from neonatal porcine resistance pulmonary arteries after 72 h hypoxia in vitro. Ca2+ response curves to U46619 (TP receptor agonist) were determined in hypoxic and normoxic myocytes incubated with or without iloprost (IP receptor agonist), forskolin (adenylyl cyclase activator), H8 (PKA inhibitor) or milrinone. TP and IP receptor saturation binding kinetics were measured in presence of iloprost or 8-bromo-cAMP. KEY RESULTS Ligand affinity for TP receptors was normalized in vitro by IP receptor signalling intermediates. However, IP receptor affinity was compromised in hypoxic myocytes, decreasing cAMP production. Milrinone normalized TP receptor sensitivity in hypoxic myocytes by restoring PKA-mediated regulatory TP receptor phosphorylation. CONCLUSIONS AND IMPLICATIONS TP receptor sensitivity and EC50 for TP receptor agonists was regulated by PKA, as TP receptor serine phosphorylation by PKA down-regulated Ca2+ mobilization. Hypoxia decreased IP receptor activity and cAMP generation, inducing TP receptor hyperresponsiveness, which was reversed by milrinone. PMID:21385177

Intelligent device management in the selfcare marketplace.

PubMed

Biniaris, Christos G; Marsh, Andrew J

2008-01-01

Over the last ten years the Internet has emerged as a key infrastructure for service innovation, enabling IP (Internet Protocol) to become the wide area network communication protocol of choice. The natural result of this choice is that service providers and their customers are looking for ways to optimise costs by migrating existing services and applications onto IP as well. A good example is the medical industry, which is transitioning to Internet-based communications as the field of telemedicine broadens to preventative and self healthcare. However, technology is changing quickly and consumers face an array of choices to satisfy their healthcare needs with numerous devices from different vendors. Seamless healthcare device networking can play a major role in automating and safeguarding the process of collecting and transferring medical data, remote patient monitoring and reducing costs through remote equipment monitoring. In this scope, we describe an approach augmenting the Session Initiation Protocol (SIP) with healthcare services in order to form a framework for efficient collection and storage of measurements, aiming to address the issues of the lack of a standardised data interface for consumer healthcare technologies (including hardware and protocols) and the lack of a standardised format for self-collected healthcare data (including the storage medium). In this framework, measurements can be seamlessly collected and stored as XML notes located virtually anywhere, such as the user's home or mobile device. Additionally, these notes can be accessed locally or remotely by doctors and specialists. Also, we discuss how this approach supports user mobility by proxying and redirecting requests to the user's current location and how it can remove the complexity of using consumer healthcare technologies from different vendors connected to different devices and the opportunities for Independent Software Vendors to develop additional services.

An Android Communication App Forensic Taxonomy.

PubMed

Azfar, Abdullah; Choo, Kim-Kwang Raymond; Liu, Lin

2016-09-01

Due to the popularity of Android devices and applications (apps), Android forensics is one of the most studied topics within mobile forensics. Communication apps, such as instant messaging and Voice over IP (VoIP), are one popular app category used by mobile device users, including criminals. Therefore, a taxonomy outlining artifacts of forensic interest involving the use of Android communication apps will facilitate the timely collection and analysis of evidentiary materials from such apps. In this paper, 30 popular Android communication apps were examined, where a logical extraction of the Android phone images was collected using XRY, a widely used mobile forensic tool. Various information of forensic interest, such as contact lists and chronology of messages, was recovered. Based on the findings, a two-dimensional taxonomy of the forensic artifacts of the communication apps is proposed, with the app categories in one dimension and the classes of artifacts in the other dimension. Finally, the artifacts identified in the study of the 30 communication apps are summarized using the taxonomy. It is expected that the proposed taxonomy and the forensic findings in this paper will assist forensic investigations involving Android communication apps. © 2016 American Academy of Forensic Sciences.

Telebation: next-generation telemedicine in remote airway management using current wireless technologies.

PubMed

Mosier, Jarrod; Joseph, Bellal; Sakles, John C

2013-02-01

Since the first remote intubation with telemedicine guidance, wireless technology has advanced to enable more portable methods of telemedicine involvement in remote airway management. Three voice over Internet protocol (VoIP) services were evaluated for quality of image transmitted, data lag, and audio quality with remotely observed and assisted intubations in an academic emergency department. The VoIP clients evaluated were Apple (Cupertino, CA) FaceTime(®), Skype™ (a division of Microsoft, Luxembourg City, Luxembourg), and Tango(®) (TangoMe, Palo Alto, CA). Each client was tested over a Wi-Fi network as well as cellular third generation (3G) (Skype and Tango). All three VoIP clients provided acceptable image and audio quality. There is a significant data lag in image transmission and quality when VoIP clients are used over cellular broadband (3G) compared with Wi-Fi. Portable remote telemedicine guidance is possible with newer technology devices such as a smartphone or tablet, as well as VoIP clients used over Wi-Fi or cellular broadband.

Applying a gaming approach to IP strategy.

PubMed

Gasnier, Arnaud; Vandamme, Luc

2010-02-01

Adopting an appropriate IP strategy is an important but complex area, particularly in the pharmaceutical and biotechnology sectors, in which aspects such as regulatory submissions, high competitive activity, and public health and safety information requirements limit the amount of information that can be protected effectively through secrecy. As a result, and considering the existing time limits for patent protection, decisions on how to approach IP in these sectors must be made with knowledge of the options and consequences of IP positioning. Because of the specialized nature of IP, it is necessary to impart knowledge regarding the options and impact of IP to decision-makers, whether at the level of inventors, marketers or strategic business managers. This feature review provides some insight on IP strategy, with a focus on the use of a new 'gaming' approach for transferring the skills and understanding needed to make informed IP-related decisions; the game Patentopolis is discussed as an example of such an approach. Patentopolis involves interactive activities with IP-related business decisions, including the exploitation and enforcement of IP rights, and can be used to gain knowledge on the impact of adopting different IP strategies.

78 FR 16692 - Chemical Facility Anti-Terrorism Standards (CFATS)

Federal Register 2010, 2011, 2012, 2013, 2014

2013-03-18

... Protection (IP), Infrastructure Security Compliance Division (ISCD) will submit the following Information... submissions of responses. FOR FURTHER INFORMATION CONTACT: CFATS Program Manager, DHS/NPPD/IP/ ISCD, [email protected

Design and implementation of embedded un-interruptible power supply system (EUPSS) for web-based mobile application

NASA Astrophysics Data System (ADS)

Zhang, De-gan; Zhang, Xiao-dan

2012-11-01

With the growth of the amount of information manipulated by embedded application systems, which are embedded into devices and offer access to the devices on the internet, the requirements of saving the information systemically is necessary so as to fulfil access from the client and the local processing more efficiently. For supporting mobile applications, a design and implementation solution of embedded un-interruptible power supply (UPS) system (in brief, EUPSS) is brought forward for long-distance monitoring and controlling of UPS based on Web. The implementation of system is based on ATmega161, RTL8019AS and Arm chips with TCP/IP protocol suite for communication. In the embedded UPS system, an embedded file system is designed and implemented which saves the data and index information on a serial EEPROM chip in a structured way and communicates with a microcontroller unit through I2C bus. By embedding the file system into UPS system or other information appliances, users can access and manipulate local data on the web client side. Embedded file system on chips will play a major role in the growth of IP networking. Based on our experiment tests, the mobile users can easily monitor and control UPS in different places of long-distance. The performance of EUPSS has satisfied the requirements of all kinds of Web-based mobile applications.

Analysis of Optimal Jitter Buffer Size for VoIP QoS under WiMAX Power-Saving Mode

NASA Astrophysics Data System (ADS)

Kim, Hyungsuk; Kim, Taehyoun

VoIP service is expected as one of the key applications of Mobile WiMAX, but the speech quality of VoIP service often suffers deterioration due to the fluctuating transmission delay called jitter. This is commonly ameliorated by a de-jitter buffer, and we aim to find the optimal size of de-jitter buffer to achieve speech quality comparable to PSTN. We developed a new model of the packet drops at the de-jitter buffer and the end-to-end packet delay which takes account of the additional delay introduced by the WiMAX power-saving mode. Using our model, we analyzed the optimal size of the de-jitter buffer for various network parameters, and showed that the results obtained by analysis accord with simulation results.

NG9-1-1 preliminary transition plan.

DOT National Transportation Integrated Search

2008-04-01

Although the 9-1-1 system has been an unqualified success story for more than 30 years, changes in the : publics use of technology, the saturation of the mobile market, and the spread of Voice over Internet : Protocol (VoIP) telephony over broadba...

BlueDetect: An iBeacon-Enabled Scheme for Accurate and Energy-Efficient Indoor-Outdoor Detection and Seamless Location-Based Service

PubMed Central

Zou, Han; Jiang, Hao; Luo, Yiwen; Zhu, Jianjie; Lu, Xiaoxuan; Xie, Lihua

2016-01-01

The location and contextual status (indoor or outdoor) is fundamental and critical information for upper-layer applications, such as activity recognition and location-based services (LBS) for individuals. In addition, optimizations of building management systems (BMS), such as the pre-cooling or heating process of the air-conditioning system according to the human traffic entering or exiting a building, can utilize the information, as well. The emerging mobile devices, which are equipped with various sensors, become a feasible and flexible platform to perform indoor-outdoor (IO) detection. However, power-hungry sensors, such as GPS and WiFi, should be used with caution due to the constrained battery storage on mobile device. We propose BlueDetect: an accurate, fast response and energy-efficient scheme for IO detection and seamless LBS running on the mobile device based on the emerging low-power iBeacon technology. By leveraging the on-broad Bluetooth module and our proposed algorithms, BlueDetect provides a precise IO detection service that can turn on/off on-board power-hungry sensors smartly and automatically, optimize their performances and reduce the power consumption of mobile devices simultaneously. Moreover, seamless positioning and navigation services can be realized by it, especially in a semi-outdoor environment, which cannot be achieved by GPS or an indoor positioning system (IPS) easily. We prototype BlueDetect on Android mobile devices and evaluate its performance comprehensively. The experimental results have validated the superiority of BlueDetect in terms of IO detection accuracy, localization accuracy and energy consumption. PMID:26907295

78 FR 29759 - Chemical Facility Anti-Terrorism Standards Personnel Surety Program

Federal Register 2010, 2011, 2012, 2013, 2014

2013-05-21

...), National Protection and Programs Directorate (NPPD), Office of Infrastructure Protection (IP... requirements and submitted by mail to the DHS/NPPD/IP/ ISCD CFATS Program Manager at the Department of Homeland...

Hybrid evolutionary computing model for mobile agents of wireless Internet multimedia

NASA Astrophysics Data System (ADS)

Hortos, William S.

2001-03-01

The ecosystem is used as an evolutionary paradigm of natural laws for the distributed information retrieval via mobile agents to allow the computational load to be added to server nodes of wireless networks, while reducing the traffic on communication links. Based on the Food Web model, a set of computational rules of natural balance form the outer stage to control the evolution of mobile agents providing multimedia services with a wireless Internet protocol WIP. The evolutionary model shows how mobile agents should behave with the WIP, in particular, how mobile agents can cooperate, compete and learn from each other, based on an underlying competition for radio network resources to establish the wireless connections to support the quality of service QoS of user requests. Mobile agents are also allowed to clone themselves, propagate and communicate with other agents. A two-layer model is proposed for agent evolution: the outer layer is based on the law of natural balancing, the inner layer is based on a discrete version of a Kohonen self-organizing feature map SOFM to distribute network resources to meet QoS requirements. The former is embedded in the higher OSI layers of the WIP, while the latter is used in the resource management procedures of Layer 2 and 3 of the protocol. Algorithms for the distributed computation of mobile agent evolutionary behavior are developed by adding a learning state to the agent evolution state diagram. When an agent is in an indeterminate state, it can communicate to other agents. Computing models can be replicated from other agents. Then the agents transitions to the mutating state to wait for a new information-retrieval goal. When a wireless terminal or station lacks a network resource, an agent in the suspending state can change its policy to submit to the environment before it transitions to the searching state. The agents learn the facts of agent state information entered into an external database. In the cloning process, two agents on a host station sharing a common goal can be merged or married to compose a new agent. Application of the two-layer set of algorithms for mobile agent evolution, performed in a distributed processing environment, is made to the QoS management functions of the IP multimedia IM sub-network of the third generation 3G Wideband Code-division Multiple Access W-CDMA wireless network.

Evaluation of AL-FEC performance for IP television services QoS

NASA Astrophysics Data System (ADS)

Mammi, E.; Russo, G.; Neri, A.

2010-01-01

The IP television services quality is a critical issue because of the nature of transport infrastructure. Packet loss is the main cause of service degradation in such kind of network platforms. The use of forward error correction (FEC) techniques in the application layer (AL-FEC), between the source of TV service (video server) and the user terminal, seams to be an efficient strategy to counteract packet losses alternatively or in addiction to suitable traffic management policies (only feasible in "managed networks"). A number of AL-FEC techniques have been discussed in literature and proposed for inclusion in TV over IP international standards. In this paper a performance evaluation of the AL-FEC defined in SMPTE 2022-1 standard is presented. Different typical events occurring in IP networks causing different types (in terms of statistic distribution) of IP packet losses have been studied and AL-FEC performance to counteract these kind of losses have been evaluated. The performed analysis has been carried out in view of fulfilling the TV services QoS requirements that are usually very demanding. For managed networks, this paper envisages a strategy to combine the use of AL-FEC with the set-up of a transport quality based on FEC packets prioritization. Promising results regard this kind of strategy have been obtained.

Performance Analysis of Inter-Domain Handoff Scheme Based on Virtual Layer in PMIPv6 Networks for IP-Based Internet of Things.

PubMed

Cho, Chulhee; Choi, Jae-Young; Jeong, Jongpil; Chung, Tai-Myoung

2017-01-01

Lately, we see that Internet of things (IoT) is introduced in medical services for global connection among patients, sensors, and all nearby things. The principal purpose of this global connection is to provide context awareness for the purpose of bringing convenience to a patient's life and more effectively implementing clinical processes. In health care, monitoring of biosignals of a patient has to be continuously performed while the patient moves inside and outside the hospital. Also, to monitor the accurate location and biosignals of the patient, appropriate mobility management is necessary to maintain connection between the patient and the hospital network. In this paper, a binding update scheme on PMIPv6, which reduces signal traffic during location updates by Virtual LMA (VLMA) on the top original Local Mobility Anchor (LMA) Domain, is proposed to reduce the total cost. If a Mobile Node (MN) moves to a Mobile Access Gateway (MAG)-located boundary of an adjacent LMA domain, the MN changes itself into a virtual mode, and this movement will be assumed to be a part of the VLMA domain. In the proposed scheme, MAGs eliminate global binding updates for MNs between LMA domains and significantly reduce the packet loss and latency by eliminating the handoff between LMAs. In conclusion, the performance analysis results show that the proposed scheme improves performance significantly versus PMIPv6 and HMIPv6 in terms of the binding update rate per user and average handoff latency.

75 FR 18850 - National Protection and Programs Directorate; Chemical Facility Anti-Terrorism Standards...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-04-13

... Programs Directorate (NPPD), Office of Infrastructure Protection (IP), Infrastructure Security Compliance... submitted by mail to the DHS/NPPD/ IP/ISCD CFATS Program Manager at the Department of Homeland Security, 245...

Managing slash to minimize colonization of residual leave trees by Ips and other bark beetle species following thinning in southwestern ponderosa pine

Treesearch

T. DeGomez; C.J. Fettig; J.D. McMillin; J.A. Anhold; C.J. Hayes

2008-01-01

Due to high fire hazard and perceived reductions in forest health, thinning of small diameter trees has become a prevalent management activity particularly in dense stands. Creation of large amounts of logging slash, however, has created large quantities of habitat for bark beetles primarily in the Ips genus (Coleoptera: Curculionidae,...

Milrinone attenuates thromboxane receptor-mediated hyperresponsiveness in hypoxic pulmonary arterial myocytes.

PubMed

Santhosh, K T; Elkhateeb, O; Nolette, N; Outbih, O; Halayko, A J; Dakshinamurti, S

2011-07-01

Neonatal pulmonary hypertension (PPHN) is characterized by pulmonary vasoconstriction, due in part to dysregulation of the thromboxane prostanoid (TP) receptor. Hypoxia induces TP receptor-mediated hyperresponsiveness, whereas serine phosphorylation mediates desensitization of TP receptors. We hypothesized that prostacyclin (IP) receptor activity induces TP receptor phosphorylation and decreases ligand affinity; that TP receptor sensitization in hypoxic myocytes is due to IP receptor inactivation; and that this would be reversible by the cAMP-specific phosphodiesterase inhibitor milrinone. We examined functional regulation of TP receptors by serine phosphorylation and effects of IP receptor stimulation and protein kinase A (PKA) activity on TP receptor sensitivity in myocytes from neonatal porcine resistance pulmonary arteries after 72 h hypoxia in vitro. Ca(2+) response curves to U46619 (TP receptor agonist) were determined in hypoxic and normoxic myocytes incubated with or without iloprost (IP receptor agonist), forskolin (adenylyl cyclase activator), H8 (PKA inhibitor) or milrinone. TP and IP receptor saturation binding kinetics were measured in presence of iloprost or 8-bromo-cAMP. Ligand affinity for TP receptors was normalized in vitro by IP receptor signalling intermediates. However, IP receptor affinity was compromised in hypoxic myocytes, decreasing cAMP production. Milrinone normalized TP receptor sensitivity in hypoxic myocytes by restoring PKA-mediated regulatory TP receptor phosphorylation. TP receptor sensitivity and EC(50) for TP receptor agonists was regulated by PKA, as TP receptor serine phosphorylation by PKA down-regulated Ca(2+) mobilization. Hypoxia decreased IP receptor activity and cAMP generation, inducing TP receptor hyperresponsiveness, which was reversed by milrinone. © 2011 The Authors. British Journal of Pharmacology © 2011 The British Pharmacological Society.

Incorporating Cs and Sr into blast furnace slag inorganic polymers and their effect on matrix properties

NASA Astrophysics Data System (ADS)

Vandevenne, Niels; Iacobescu, Remus Ion; Pontikes, Yiannis; Carleer, Robert; Thijssen, Elsy; Gijbels, Katrijn; Schreurs, Sonja; Schroeyers, Wouter

2018-05-01

Minimizing harmful effects to the environment in waste-management practices requires continuous innovation. This is especially important in the field of radioactive waste management. Alternatives to the commonly used ordinary Portland cement matrices are being increasingly studied for improved immobilisation purposes. The development of inorganic polymers (IP) from industrial residues has been successfully studied for the immobilisation of caesium (Cs+) and strontium (Sr2+). However, knowledge of the effect of these introduced elements on the IP-matrix is scarce, especially considering that studied effects are dependent on the IP-precursor characteristics and the form in which the Cs+ and Sr2+ are introduced. In this study, IPs containing varying amounts of CsNO3 and Sr(NO3)2 were developed to study the effect of the introduced elements on the IP-characteristics. IP-samples were developed from ground granulated blast furnace slag (GGBFS) and 6 M NaOH activating solution. Cs+ and Sr2+ were added to account for 0.5, 1 and 2 wt% of the total IP-mass. Throughout the entire study, Cs+-addition showed no significant effects on the studied parameters. Calorimetric results showed that Sr2+ severely affects reaction kinetics, consuming hydroxide ions necessary for the alkali activation reaction. Sr2+-addition also caused a severe decrease in compressive strength, increased calcium leaching, and decreased sodium and hydroxide leaching. Micro-chemical analyses showed that Cs+ is almost fully incorporated in the formed IP-matrix, while Sr2+ mainly precipitates as Sr(OH)2 in concentrated regions throughout the IP-structure. The findings presented in this paper give insights on the effect of contaminant elements on the immobilising matrix.

Positive impact of infection prevention on the management of nosocomial outbreaks at an academic hospital.

PubMed

Dik, Jan-Willem H; Sinha, Bhanu; Lokate, Mariëtte; Lo-Ten-Foe, Jerome R; Dinkelacker, Ariane G; Postma, Maarten J; Friedrich, Alexander W

2016-10-01

Infection prevention (IP) measures are vital to prevent (nosocomial) outbreaks. Financial evaluations of these are scarce. An incremental cost analysis for an academic IP unit was performed. On a yearly basis, we evaluated: IP measures; costs thereof; numbers of patients at risk for causing nosocomial outbreaks; predicted outbreak patients; and actual outbreak patients. IP costs rose on average yearly with €150,000; however, more IP actions were undertaken. Numbers of patients colonized with high-risk microorganisms increased. The trend of actual outbreak patients remained stable. Predicted prevented outbreak patients saved costs, leading to a positive return on investment of 1.94. This study shows that investments in IP can prevent outbreak cases, thereby saving enough money to earn back these investments.

Recent advances in ChIP-seq analysis: from quality management to whole-genome annotation.

PubMed

Nakato, Ryuichiro; Shirahige, Katsuhiko

2017-03-01

Chromatin immunoprecipitation followed by sequencing (ChIP-seq) analysis can detect protein/DNA-binding and histone-modification sites across an entire genome. Recent advances in sequencing technologies and analyses enable us to compare hundreds of samples simultaneously; such large-scale analysis has potential to reveal the high-dimensional interrelationship level for regulatory elements and annotate novel functional genomic regions de novo. Because many experimental considerations are relevant to the choice of a method in a ChIP-seq analysis, the overall design and quality management of the experiment are of critical importance. This review offers guiding principles of computation and sample preparation for ChIP-seq analyses, highlighting the validity and limitations of the state-of-the-art procedures at each step. We also discuss the latest challenges of single-cell analysis that will encourage a new era in this field. © The Author 2016. Published by Oxford University Press.

Gigabit Network Communications Research

DTIC Science & Technology

1992-12-31

additional BPF channels, raw bytesync support for video codecs, and others. All source file modifications were logged with RCS. Source and object trees were...34 (RFCs). 20 RFCs were published this quarter: RFC 1366: Gerich, E., " Guidelines for Management of IP Address Space", Merit, October 1992. RFC 1367...Topolcic, C., "Schedule for IP Address Space Management Guidelines ", CNRI, October 1992. RFC 1368: McMaster, D. (Synoptics Communications, Inc.), K

How Maryland increased infection prevention and control activity in long-term care facilities, 2003-2008.

PubMed

Roup, Brenda J; Scaletta, Joseph M

2011-05-01

In January 2003, the Maryland Department of Health and Mental Hygiene (DHMH) assessed the state of infection prevention and control (IPC) resources and practices in all long-term care facilities (LTC) in the state. Only 8.1% of facilities that responded employed a trained IPC professional (IP) who managed the facility IPC program. Between 2003 and 2008, the DHMH partnered with long-term care industry trade associations and spearheaded regulatory, educational, and financial initiatives to improve this situation. In January 2008, all LTC facilities in the state were resurveyed to determine the impact of these initiatives on IPC activities. The 2008 survey indicated that 44% of LTC facilities used a trained IP who managed the IPC program, a 5-fold increase from 2003. Unpublished DHMH outbreak data indicated that LTC facilities with a trained IP recognized and reported outbreaks to the local health department 2 days sooner than facilities without a trained IP, resulting in fewer cases of disease. Multiple initiatives with concerned stakeholders and LTC partners over the course of 5 years resulted in increased numbers of LTC facilities with trained IPs who recognized and responded to outbreaks sooner than facilities without trained IPs. Copyright © 2011 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Mosby, Inc. All rights reserved.

Assessing hospital emergency management plans: a guide for infection preventionists.

PubMed

Rebmann, Terri

2009-11-01

Hospital emergency management plans are essential and must include input from an infection preventionist (IP). Multiple hospital planning documents exist, but many do not address infection prevention issues, combine them with noninfection prevention issues, or are disease/event specific. An all-encompassing emergency management planning guide for IPs is needed. A literature review and Internet search were conducted in December 2008. Data from relevant sources were extracted. A spreadsheet was created that delineated hospital emergency management plan components of interest to IPs. Of the sources screened, 49 were deemed relevant. Eleven domains were identified: (1) having a plan; (2) assessing hospital readiness; (3) having infection prevention policies and procedures; (4) having occupational health policies and procedures; (5) conducting surveillance and triage; (6) reporting incidents, having a communication plan, and managing information; (7) having laboratory support; (8) addressing surge capacity issues; (9) having anti-infective therapy and/or vaccines; (10) providing infection prevention education; and (11) managing physical plant issues. Infection preventionists should use this article as an assessment tool for evaluating their hospital emergency management plan and for developing policies and procedures that will decrease the risk of infection transmission during a mass casualty event.

Internet Access to Spacecraft

NASA Technical Reports Server (NTRS)

Rash, James; Parise, Ron; Hogie, Keith; Criscuolo, Ed; Langston, Jim; Jackson, Chris; Price, Harold; Powers, Edward I. (Technical Monitor)

2000-01-01

The Operating Missions as Nodes on the Internet (OMNI) project at NASA's Goddard Space flight Center (GSFC), is demonstrating the use of standard Internet protocols for spacecraft communication systems. This year, demonstrations of Internet access to a flying spacecraft have been performed with the UoSAT-12 spacecraft owned and operated by Surrey Satellite Technology Ltd. (SSTL). Previously, demonstrations were performed using a ground satellite simulator and NASA's Tracking and Data Relay Satellite System (TDRSS). These activities are part of NASA's Space Operations Management Office (SOMO) Technology Program, The work is focused on defining the communication architecture for future NASA missions to support both NASA's "faster, better, cheaper" concept and to enable new types of collaborative science. The use of standard Internet communication technology for spacecraft simplifies design, supports initial integration and test across an IP based network, and enables direct communication between scientists and instruments as well as between different spacecraft, The most recent demonstrations consisted of uploading an Internet Protocol (IP) software stack to the UoSAT- 12 spacecraft, simple modifications to the SSTL ground station, and a series of tests to measure performance of various Internet applications. The spacecraft was reconfigured on orbit at very low cost. The total period between concept and the first tests was only 3 months. The tests included basic network connectivity (PING), automated clock synchronization (NTP), and reliable file transfers (FTP). Future tests are planned to include additional protocols such as Mobile IP, e-mail, and virtual private networks (VPN) to enable automated, operational spacecraft communication networks. The work performed and results of the initial phase of tests are summarized in this paper. This work is funded and directed by NASA/GSFC with technical leadership by CSC in arrangement with SSTL, and Vytek Wireless.

Cystogram follow-up in the management of traumatic bladder disruption.

PubMed

Inaba, Kenji; McKenney, Mark; Munera, Felipe; de Moya, Marc; Lopez, Peter P; Schulman, Carl I; Habib, Fahim A

2006-01-01

The utility of obtaining a routine cystogram after the repair of intraperitoneal bladder disruption before urethral catheter removal is unknown. This study was designed to examine whether follow-up cystogram evaluation after traumatic bladder disruption affected the clinical management of these injuries. We hypothesized that routine cystograms, after operative repair of intraperitoneal bladder disruptions, provide no clinically useful information and may be eliminated in the management of these injuries. Our prospectively collected trauma database was retrospectively reviewed for all ICD-9 867.0 and 867.1 coded bladder injuries over a 6-year period ending in June 2004. Demographics, clinical injury data, detailed operative records, and imaging studies were reviewed for each patient. Bladder injuries were categorized as intraperitoneal (IP) or extraperitoneal (EP) bladder disruptions based on imaging results and operative exploration. Patients with IP injuries were further subdivided into those with "simple" dome disruptions or through-and-through penetrating injuries and "complex" injuries involving the trigone or ureter reimplantation. All patients sustaining isolated ureteric or urethral injury were excluded from further analysis. In all, 20,647 trauma patients were screened for bladder injury. Out of this group, there were 50 IP (47 simple, 3 complex) and 37 EP injuries available for analysis. All IP injuries underwent operative repair. Eight of the IP injuries (all simple) had no postoperative cystogram and all were doing well at 1- to 4-week follow-up. The remaining 42 patients underwent a postoperative cystogram at 15.3 +/- 7.3 days (range 7 to 36 days). All simple IP injuries had a negative postoperative cystogram. The only positive study was in one of the three complex IP injuries. In the EP group, 21.6% had positive cystograms requiring further follow-up and intervention. Patients sustaining extraperitoneal and complex intraperitoneal bladder disruptions require routine cystogram follow-up. In those patients undergoing repair of a simple intraperitoneal bladder disruption, however, routine follow-up cystograms did not affect clinical management. Further prospective evaluation to determine the optimal timing of catheter removal in this patient population is warranted.

Approaches in highly parameterized inversion - GENIE, a general model-independent TCP/IP run manager

USGS Publications Warehouse

Muffels, Christopher T.; Schreuder, Willem A.; Doherty, John E.; Karanovic, Marinko; Tonkin, Matthew J.; Hunt, Randall J.; Welter, David E.

2012-01-01

GENIE is a model-independent suite of programs that can be used to generally distribute, manage, and execute multiple model runs via the TCP/IP infrastructure. The suite consists of a file distribution interface, a run manage, a run executer, and a routine that can be compiled as part of a program and used to exchange model runs with the run manager. Because communication is via a standard protocol (TCP/IP), any computer connected to the Internet can serve in any of the capacities offered by this suite. Model independence is consistent with the existing template and instruction file protocols of the widely used PEST parameter estimation program. This report describes (1) the problem addressed; (2) the approach used by GENIE to queue, distribute, and retrieve model runs; and (3) user instructions, classes, and functions developed. It also includes (4) an example to illustrate the linking of GENIE with Parallel PEST using the interface routine.

Fostering interprofessional learning in a rehabilitation setting: development of an interprofessional clinical learning unit.

PubMed

Vanderzalm, Jeanne; Hall, Mark D; McFarlane, Lu-Anne; Rutherford, Laurie; Patterson, Steven K

2013-01-01

The development and implementation of interprofessional (IP) clinical learning units as a method to enhance IP clinical education and improve patient care in a rehabilitation setting are described. Using a community-based participatory research approach, academia and healthcare delivery agencies formed a partnership to create an IP clinical learning unit in a rehabilitation setting. Preimplementation data from surveys and focus group data identified areas for improvement to enhance IP understanding and collaboration. A working group developed and implemented initiatives to enhance IP practice. Preimplementation, eight themes emerged from which the working group identified goals and implemented strategies to strengthen IP learning. Goals included Creation of an IP Learning Environment, Increased Awareness of IP Practice, Role Clarification, Enhanced IP Communication, and Reflection and Evaluation. Postimplementation data revealed six themes: Communication, Informal IP Learning, Role Awareness, Positive Learning Environment, Logistics, and Challenges. The development of the IP clinical learning unit was successful and rewarding, but not without its challenges. Formal IP education was necessary to enhance collaborative practice, even in a multidisciplinary environment. Commitment and support from all participants, particularly managers and administrators from the healthcare agency, were critical to success. The focus of this unit was on a stroke rehabilitation unit; however, the development and implementation principles identified may be applicable to any team-based clinical setting. © 2013 Association of Rehabilitation Nurses.

Performance Analysis of Inter-Domain Handoff Scheme Based on Virtual Layer in PMIPv6 Networks for IP-Based Internet of Things

PubMed Central

Choi, Jae-Young; Jeong, Jongpil; Chung, Tai-Myoung

2017-01-01

Lately, we see that Internet of things (IoT) is introduced in medical services for global connection among patients, sensors, and all nearby things. The principal purpose of this global connection is to provide context awareness for the purpose of bringing convenience to a patient’s life and more effectively implementing clinical processes. In health care, monitoring of biosignals of a patient has to be continuously performed while the patient moves inside and outside the hospital. Also, to monitor the accurate location and biosignals of the patient, appropriate mobility management is necessary to maintain connection between the patient and the hospital network. In this paper, a binding update scheme on PMIPv6, which reduces signal traffic during location updates by Virtual LMA (VLMA) on the top original Local Mobility Anchor (LMA) Domain, is proposed to reduce the total cost. If a Mobile Node (MN) moves to a Mobile Access Gateway (MAG)-located boundary of an adjacent LMA domain, the MN changes itself into a virtual mode, and this movement will be assumed to be a part of the VLMA domain. In the proposed scheme, MAGs eliminate global binding updates for MNs between LMA domains and significantly reduce the packet loss and latency by eliminating the handoff between LMAs. In conclusion, the performance analysis results show that the proposed scheme improves performance significantly versus PMIPv6 and HMIPv6 in terms of the binding update rate per user and average handoff latency. PMID:28129355

The Development of the Command and Control Centre for Trial Kondari

DTIC Science & Technology

2010-07-01

the C2 centre inside a blue bubble whose modems have privately assigned IP addresses which are authenticated by Telstra’s radius server. No other sim...cards can communicate on this private network unless authorised by the radius server. The Next IP network is a network bubble within the larger Next...for all machines on the network.  EPLRS Network Manager (ENM) radio – authenticates and manages all the EPLRS radios. The basic plan’s final

Case Report: Using a Remote Presence Robot to Improve Access to Physical Therapy for People with Chronic Back Disorders in an Underserved Community.

PubMed

Lovo Grona, Stacey; Bath, Brenna; Bustamante, Luis; Mendez, Ivar

2017-01-01

Purpose: The purpose of this case study was to evaluate the delivery of an inter-professional (IP) spinal triage management approach to chronic back disorders using remote presence robotic technology as an innovative form of telerehabilitation in a northern Saskatchewan community. Methods: The IP team, consisting of a local nurse practitioner (NP) and a physical therapist in an urban centre, completed a comprehensive neuromusculoskeletal assessment of, and one follow-up visit with, a post-surgical spinal patient. Treatment included detailed education regarding self-management after spinal surgery, provision and progression of home exercises, and reassurance. The patient was then referred to regional, in-person physical therapy care to complete her treatment. Results: A semi-structured interview with the NP revealed a high level of satisfaction; qualitative themes included the value of IP practice and the benefit to the patient of telerehabilitation achieved through patient-centred care. In a post-treatment survey, the patient expressed a high level of satisfaction with and appreciation for the patient-centred approach and the IP team. Objective clinical improvements in spinal and straight-leg raise movements were noted at the final telerehabilitation session. Conclusion: This report demonstrates the feasibility of delivering IP spinal triage management using telerehabilitation, specifically remote presence robotics, in a remote setting. Further research should include larger scale studies that investigate health, system, and economic outcomes as well as comparative studies for other forms of telehealth technology.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akhtar, R.A.; Abdel-Latif, A.A.

Muscarinic cholinergic and ..cap alpha../sub 1/-adrenergic agonists provoke hydrolysis of PIP/sub 2/ into diacylglycerol (DG) and inositol trisphosphate (IP/sub 3/) in a wide variety of tissue. Recently, IP/sub 3/ has been shown to mobilize Ca/sup 2 +/ from ER in several permeabilized tissue preparations. Although rabbit cornea is enriched in ACh and NE, the physiological function of these neurotransmitters is unclear. The present studies were initiated to determine the effects of cholinergic and adrenergic agonists on PIP/sub 2/ turnover in the cornea. Addition of ACh or NE (50 ..mu..M each) to the /sup 32/P-labeled corneas for 10 min decreased themore » radioactivity in PIP/sub 2/ by 33 and 36%, and increased the radioactivity in phosphatidic acid by 72 and 52%, respectively. When the corneas were labeled with myo-(/sup 3/H)inositol, ACh and NE increased the accumulation of IP/sub 3/ by 92 and 48%, respectively. The effects of ACh and NE on phospholipid labeling and IP/sub 3/ accumulation were specifically inhibited by atropine (10 ..mu..M) and prazosin (10 ..mu..M), respectively. The data suggest the presence of muscarinic cholinergic and ..cap alpha../sub 1/-adrenergic receptors in the rabbit cornea. Furthermore, activation of these receptors leads to cleavage of PIP/sub 2/ into DG and IP/sub 3/ which may function as second messengers in this tissue.« less

How 60 Minutes ticked off Illinois Power

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1980-04-01

A November 60 Minutes broadcast on CBS television asserting that costs are out of control at the Illinois Power Co's(IP) Clinton nuclear power project because of management incompetence triggered a series of rebuttals and counter-rebuttals. A review of the events and correspondence during the planning stage and after the broadcast explores the question of construction cost overruns and the economic impact the broadcast had on IP's investors, employees, and customers. A parallel filming by IP was aired to show how the CBS edited the interview with IP officials. IP personnel feel betrayed by what they consider misconceptions and errors inmore » the broadcast and are unhappy that an employee morale problem was worsened. Counter-arguments by both parties indicate a disagreement on both facts and interpretations. (DCK)« less

A Scalable QoS-Aware VoD Resource Sharing Scheme for Next Generation Networks

NASA Astrophysics Data System (ADS)

Huang, Chenn-Jung; Luo, Yun-Cheng; Chen, Chun-Hua; Hu, Kai-Wen

In network-aware concept, applications are aware of network conditions and are adaptable to the varying environment to achieve acceptable and predictable performance. In this work, a solution for video on demand service that integrates wireless and wired networks by using the network aware concepts is proposed to reduce the blocking probability and dropping probability of mobile requests. Fuzzy logic inference system is employed to select appropriate cache relay nodes to cache published video streams and distribute them to different peers through service oriented architecture (SOA). SIP-based control protocol and IMS standard are adopted to ensure the possibility of heterogeneous communication and provide a framework for delivering real-time multimedia services over an IP-based network to ensure interoperability, roaming, and end-to-end session management. The experimental results demonstrate that effectiveness and practicability of the proposed work.

Competitive Exclusion of Dendroctonus rufipennis Induced by Pheromones of Ips tridens and Dryocoetes affaber (Coleoptera: Scolytidae)

Treesearch

Therese M. Poland; John H. Borden

1998-01-01

We tested the feasibility of competitive exclusion as a potential management tactic for the spruce beetle, Dendroctonus rufipennis Kirby, using pre-attack baiting with pheromones of 2 secondary species, Ips tridens Mannerheim and Dryocoetes affaber Mannerheim. Spruce beetle attack densities, gallery lengths per...

Tensions inherent in the evolving role of the infection preventionist.

PubMed

Conway, Laurie J; Raveis, Victoria H; Pogorzelska-Maziarz, Monika; Uchida, May; Stone, Patricia W; Larson, Elaine L

2013-11-01

The role of infection preventionists (IPs) is expanding in response to demands for quality and transparency in health care. Practice analyses and survey research have demonstrated that IPs spend a majority of their time on surveillance and are increasingly responsible for prevention activities and management; however, deeper qualitative aspects of the IP role have rarely been explored. We conducted a qualitative content analysis of in-depth interviews with 19 IPs at hospitals throughout the United States to describe the current IP role, specifically the ways that IPs effect improvements and the facilitators and barriers they face. The narratives document that the IP role is evolving in response to recent changes in the health care landscape and reveal that this progression is associated with friction and uncertainty. Tensions inherent in the evolving role of the IP emerged from the interviews as 4 broad themes: (1) expanding responsibilities outstrip resources, (2) shifting role boundaries create uncertainty, (3) evolving mechanisms of influence involve trade-offs, and (4) the stress of constant change is compounded by chronic recurring challenges. Advances in implementation science, data standardization, and training in leadership skills are needed to support IPs in their evolving role. Copyright © 2013 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Mosby, Inc. All rights reserved.

Management of ATM-based networks supporting multimedia medical information systems

NASA Astrophysics Data System (ADS)

Whitman, Robert A.; Blaine, G. James; Fritz, Kevin; Goodgold, Ken; Heisinger, Patrick

1997-05-01

Medical information systems are acquiring the ability to collect and deliver many different types of medical information. In support of the increased network demands necessitated by these expanded capabilities, asynchronous transfer mode (ATM) based networks are being deployed in medical care systems. While ATM supplies a much greater line rate than currently deployed networks, the management and standards surrounding ATM are yet to mature. This paper explores the management and control issues surrounding an ATM network supporting medical information systems, and examines how management impacts network performance and robustness. A multivendor ATM network at the BJC Health System/Washington University and the applications using the network are discussed. Performance information for specific applications is presented and analyzed. Network management's influence on application reliability is outlined. The information collected is used to show how ATM network standards and management tools influence network reliability and performance. Performance of current applications using the ATM network is discussed. Special attention is given to issues encountered in implementation of hypertext transfer protocol over ATM internet protocol (IP) communications. A classical IP ATM implementation yields greater than twenty percent higher network performance over LANE. Maximum performance for a host's suite of applications can be obtained by establishing multiple individually engineered IP links through its ATM network connection.

VoIP for Telerehabilitation: A Pilot Usability Study for HIPAA Compliance

PubMed Central

Watzlaf, Valerie R.; Ondich, Briana

2012-01-01

Consumer-based, free Voice and video over the Internet Protocol (VoIP) software systems such as Skype and others are used by health care providers to deliver telerehabilitation and other health-related services to clients. Privacy and security applications as well as HIPAA compliance within these protocols have been questioned by practitioners, health information managers, and other healthcare entities. This pilot usability study examined whether four respondents who used the top three, free consumer-based, VoIP software systems perceived these VoIP technologies to be private, secure, and HIPAA compliant; most did not. While the pilot study limitations include the number of respondents and systems assessed, the protocol can be applied to future research and replicated for instructional purposes. Recommendations are provided for VoIP companies, providers, and clients/consumers. PMID:25945194

Facilitation techniques as predictors of crew participation in LOFT debriefings

NASA Technical Reports Server (NTRS)

McDonnell, L. K.

1996-01-01

Based on theories of adult learning and airline industry guidelines for Crew Resource Management (CRM), the stated objective during Line Oriented Flight Training (LOFT) debriefings is for instructor pilots (IP's) to facilitate crew self-analysis of performance. This study reviews 19 LOFT debriefings from two major U.S. airlines to examine the relationship between IP efforts at facilitation and associated characteristics of crew participation. A subjective rating scale called the Debriefing Assessment Battery was developed and utilized to evaluate the effectiveness of IP facilitation and the quality of crew participation. The results indicate that IP content, encouragement, and questioning techniques are highly and significantly correlated with, and can therefore predict, the degree and depth of crew participation.

World Without Wires: Is Your District Ready to Go Wireless?

ERIC Educational Resources Information Center

Villano, Matt

2005-01-01

In this article, the author presents the latest wireless equipments available in market. For starters, wireless networks offer mobility and flexibility: users of laptops, PDAs, tablet PCs, and wireless Voice over IP telephones can move freely about campus while staying connected to the Internet. There are two kinds of wireless networks: ad-hoc, or…

Isotopic Randomness and Maxwell's Demon

NASA Astrophysics Data System (ADS)

Berezin, Alexander A.

2005-03-01

Isotopic disorder in crystals can lead to suppression of thermal conductivity, mobility variations and (weak) Anderson localization on isotopic fluctuations. The latter (AAB, J.ChemPhys.1984) is akin to polaron effect (self-localization due polarization). Possibility of isotopic patterning (IP) increases near melting point (thermally activated isotopic hopping swaps). Crystal near melting threshold become “informationally sensitive” as if its IP is operated by some external Maxwell’s Demon, MD (AAB, URAM J, 2002). At this state short range (e.g. electrostatic inverse square) forces evolve into long-range interactions (due to divergence of order parameter) and information sensitivity can be further amplified by (say) a single fast electron (e.g. beta-particle from decay of 14-C or other radioactive isotope) which may result in cascade of impact ionization events and (short time-scale) enhancement of screening by impact-generated non-equilibrium (non-thermal) electrons. In this state informationally driven (MD-controlled) IP (Eccles effect) can result in decrease of positional entropy signifying emergence of physical complexity out of pure information, similar to peculiar “jinni effect” on closed time loops in relativistic cosmology (R.J.Gott, 2001) or Wheeler’s “it from bit” metaphor. By selecting special IP, MD modifies ergodicity principle in favor of info rich states.

CANOPEN Controller IP Core

NASA Astrophysics Data System (ADS)

Caramia, Maurizio; Montagna, Mario; Furano, Gianluca; Winton, Alistair

2010-08-01

This paper will describe the activities performed by Thales Alenia Space Italia supported by the European Space Agency in the definition of a CAN bus interface to be used on Exomars. The final goal of this activity is the development of an IP core, to be used in a slave node, able to manage both the CAN bus Data Link and Application Layer totally in hardware. The activity has been focused on the needs of the EXOMARS mission where devices with different computational performances are all managed by the onboard computer through the CAN bus.

Integration of FMIPv6 in HMIPv6 to Improve Hand-over Performance

NASA Astrophysics Data System (ADS)

Patil, Dipali P.; Patil, G. A.

2010-11-01

Mobile users move frequently between networks, as they stay connected to the Internet. Thus, as mobility increases across networks, handovers will significantly impact the quality of the connection and user application. Handover performance is very important when evaluating IP mobility protocols. Since handover request are driven by several needs such as cost reduction criteria, network resource optimization and service related requirements. Current works to support seamless mobility in IPv6 network are classified into HMIPv6 and FMIPv6. These two approaches have pros and cons respectively and are being standardized independently in IETF. If one can integrate properly these two approaches, it is expected that the one can get more effective protocols that can provide better handover performance. This paper integrates FHMIPv6 in HMIPv6 (F-HMIPv6) so as to provide effectively fast handover on the hierarchical Mobile IPv6. The simulation performed using Ns-2 extensions to show that a performance of proposed system is better in terms of packet loss and hand-over delay.

Delayed early passive motion is harmless to shoulder rotator cuff healing in a rabbit model.

PubMed

Zhang, Shurong; Li, Hong; Tao, Hongyue; Li, Hongyun; Cho, Samson; Hua, Yinghui; Chen, Jiwu; Chen, Shiyi; Li, Yunxia

2013-08-01

Postoperative passive motion is the most widely accepted rehabilitation protocol after rotator cuff repair; however, a rotator cuff retear remains a frequent surgical complication. Clinical outcomes indicate that early passive motion is harmless to rotator cuff healing, but no laboratory evidence supports this proposition. (1) Immediate postoperative immobilization improves rotator cuff healing in rabbits. (2) Early passive motion after short-term immobilization does not harm rotator cuff healing in rabbits. Controlled laboratory study. An injury to the supraspinatus tendon was created and repaired in 90 New Zealand White rabbits, after which they were randomly separated into 3 groups: (1) nonimmobilization (NI; n = 30), (2) continuous immobilization (IM; n = 30), and (3) immobilization with early passive motion (IP; n = 30). At 3, 6, and 12 weeks postoperatively, 5 rabbits from each group were sacrificed for histological evaluation, biomechanical testing, and magnetic resonance imaging. The histological study demonstrated better postoperative healing in the IM and IP groups, with clusters of chondrocytes accumulated at the tendon-bone junction. Magnetic resonance imaging illustrated that the tendon-bone junction was intact in the IM and IP groups. The magnetic resonance quantification analysis showed that the signal-to-noise quotient (SNQ) of the NI group was not significantly higher than that of the immobilization groups at 3 weeks (P = .232) or 6 weeks (P = .117), but it was significantly different at 12 weeks (NI vs IM, P = .006; NI vs IP, P = .009). At 12 weeks, the failure load was significantly higher in the IM and IP groups than in the NI group (NI vs IM, P = .002; NI vs IP, P = .002), but no difference was found between the IM and IP groups (P = .599). Immediate postoperative immobilization led to better tendon-bone healing than immediate postoperative mobilization, and under immobilization, early passive motion was harmless to tendon-bone healing in this study. The results have an implication in supporting the rehabilitation protocol of early passive motion after rotator cuff repair.

76 FR 45796 - Information Collection Being Submitted to the Office of Management and Budget for Review and...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-08-01

... organizational structure, including the names of its executives, officers, partners, and board of directors; A... Control Number: 3060-1145. Title: Structure and Practices of the Video Relay Service Program, CG Docket No... end times; (5) incoming telephone number and IP address (if call originates with an IP-based device...

Introduction and comparison of next-generation mobile wireless technologies

NASA Astrophysics Data System (ADS)

Zaidi, Syed R.; Hussain, Shahab; Ali, M. A.; Sana, Ajaz; Saddawi, Samir; Carranza, Aparicio

2010-01-01

Mobile networks and services have gone further than voice-only communication services and are rapidly developing towards data-centric services. Emerging mobile data services are expected to see the same explosive growth in demand that Internet and wireless voice services have seen in recent years. To support such a rapid increase in traffic, active users, and advanced multimedia services implied by this growth rate along with the diverse quality of service (QoS) and rate requirements set by these services, mobile operator need to rapidly transition to a simple and cost-effective, flat, all IP-network. This has accelerated the development and deployment of new wireless broadband access technologies including fourth-generation (4G) mobile WiMAX and cellular Long-Term Evolution (LTE). Mobile WiMAX and LTE are two different (but not necessarily competing) technologies that will eventually be used to achieve data speeds of up to 100 Mbps. Speeds that are fast enough to potentially replace wired broadband connections with wireless. This paper introduces both of these next generation technologies and then compares them in the end.

Perioperative haemostatic management of haemophilic mice using normal mouse plasma.

PubMed

Tatsumi, K; Ohashi, K; Kanegae, K; Shim, I K; Okano, T

2013-11-01

Intense haemostatic interventions are required to avoid bleeding complications when surgical procedures are performed on haemophilia patients. The objective of this study was to establish an appropriate protocol for perioperative haemostatic management of haemophilic mice. We assessed the prophylactic haemostatic effects of normal mouse plasma (NMP) on haemophilia B (HB) mice for both a skin flap procedure and a laparotomy. When 500 μL of NMP was administered to the mice, plasma factor IX (FIX:C) levels peaked at 15.1% immediately after intravenous (IV) administration, at 6.1% 2 h after intraperitoneal (IP) administration and at 2.7% 6 h after subcutaneous administration. Administering 500 μL of NMP via IP or IV 30 min in advance enabled the skin flap procedure to be performed safely without any complications. After the laparotomy procedure, several mice in the IP administration group exhibited lethal bleeding, but all mice survived in the IV administration group. Anti-mouse FIX inhibitors did not develop, even after repetitive administrations of NMP. However, human FIX concentrates, especially plasma-derived concentrates, elicited the anti-human FIX inhibitors. The results show that administering 500 μL of NMP via IV or IP 30 min in advance enables surgical procedures to be safely performed on HB mice, and that IV administration is more desirable than IP if the procedure requires opening of the abdominal wall. © 2013 John Wiley & Sons Ltd.

Component Framework for Loosely Coupled High Performance Integrated Plasma Simulations

NASA Astrophysics Data System (ADS)

Elwasif, W. R.; Bernholdt, D. E.; Shet, A. G.; Batchelor, D. B.; Foley, S.

2010-11-01

We present the design and implementation of a component-based simulation framework for the execution of coupled time-dependent plasma modeling codes. The Integrated Plasma Simulator (IPS) provides a flexible lightweight component model that streamlines the integration of stand alone codes into coupled simulations. Standalone codes are adapted to the IPS component interface specification using a thin wrapping layer implemented in the Python programming language. The framework provides services for inter-component method invocation, configuration, task, and data management, asynchronous event management, simulation monitoring, and checkpoint/restart capabilities. Services are invoked, as needed, by the computational components to coordinate the execution of different aspects of coupled simulations on Massive parallel Processing (MPP) machines. A common plasma state layer serves as the foundation for inter-component, file-based data exchange. The IPS design principles, implementation details, and execution model will be presented, along with an overview of several use cases.

Should Project Managers Buy Technical Data

DTIC Science & Technology

2017-04-06

Should Project Managers Buy Technical Data? Jerry Harper April 6, 2017 PUBLISHED BY The Defense...intellectual property (IP) management and technical data rights (TDR) strategies. According to DoD Instruction 5000.02 (DoD, 2017), project managers (PMs...Defense Authorization Act NDI ................nondevelopmental item PM ................. project manager R&D ...............research and development

Safety management of Ethernet broadband access based on VLAN aggregation

NASA Astrophysics Data System (ADS)

Wang, Li

2004-04-01

With broadband access network development, the Ethernet technology is more and more applied access network now. It is different from the private network -LAN. The differences lie in four points: customer management, safety management, service management and count-fee management. This paper mainly discusses the safety management related questions. Safety management means that the access network must secure the customer data safety, isolate the broad message which brings the customer private information, such as ARP, DHCP, and protect key equipment from attack. Virtue LAN (VLAN) technology can restrict network broadcast flow. We can config each customer port with a VLAN, so each customer is isolated with others. The IP address bound with VLAN ID can be routed rightly. But this technology brings another question: IP address shortage. VLAN aggregation technology can solve this problem well. Such a mechanism provides several advantages over traditional IPv4 addressing architectures employed in large switched LANs today. With VLAN aggregation technology, we introduce the notion of sub-VLANs and super-VLANs, a much more optimal approach to IP addressing can be realized. This paper will expatiate the VLAN aggregation model and its implementation in Ethernet access network. It is obvious that the customers in different sub-VLANs can not communication to each other because the ARP packet is isolated. Proxy ARP can enable the communication among them. This paper will also expatiate the proxy ARP model and its implementation in Ethernet access network.

Cyberspace modernization. An interest protocol planning advisory

DOE Office of Scientific and Technical Information (OSTI.GOV)

Keliiaa, Curtis M.; McLane, Victor N.

A common challenge across the communications and information technology (IT) sectors is Internet + modernization + complexity + risk + cost. Cyberspace modernization and cyber security risks, issues, and concerns impact service providers, their customers, and the industry at large. Public and private sectors are struggling to solve the problem. New service opportunities lie in mobile voice, video, and data, and machine-to-machine (M2M) information and communication technologies that are migrating not only to predominant Internet Protocol (IP) communications, but also concurrently integrating IP, version 4 (IPv4) and IP, version 6 (IPv6). With reference to the Second Internet and the Internetmore » of Things, next generation information services portend business survivability in the changing global market. The planning, architecture, and design information herein is intended to increase infrastructure preparedness, security, interoperability, resilience, and trust in the midst of such unprecedented change and opportunity. This document is a product of Sandia National Laboratories Tribal Cyber and IPv6 project work. It is a Cyberspace Modernization objective advisory in support of bridging the digital divide through strategic partnership and an informed path forward.« less

Changes in inositol phosphates in wild carrot cells upon initiation of cell wall digestion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rincon, M.; Boss, W.F.

1987-04-01

Previous studies have shown that inositol trisphosphate (IP/sub 3/) stimulated /sup 45/Ca/sup +2/ efflux from fusogenic carrot protoplasts and it was suggested that IP/sub 3/ may serve as a second messenger for the mobilization of intracellular Ca/sup +2/ in higher plant cells. To determine whether or not inositol phosphate metabolism changes in response to external stimuli, the cells were labeled with myo-(2-/sup 3/H) inositol for 18 h and exposed to cell wall digestion enzymes, Driselase. The inositol phosphates were extracted with ice cold 10% TCA and separated by anion exchange chromatography. The radioactivity of the fraction that contained IP/sub 3/more » increased 2-3.8 fold and that which contained inositol bisphosphate increased 1.9-2.6 fold within 1.5 min of exposure to Driselase. After 6 min, the radioactivity of both fractions increased 6-7.7 fold and an increase in inositol monophosphate was observed. These data indicate that inositol phosphate metabolism is stimulated by Driselase and suggest polyphosphoinositide hydrolysis occurs upon initiation of cell wall digestion.« less

Principal Self-Government and Subjectification: The Exercise of Principal Autonomy in the Western Australian Independent Public Schools Programme

ERIC Educational Resources Information Center

Gobby, Brad

2013-01-01

The launch of the Independent Public Schools (IPS) programme in Western Australia (WA) in 2010 reflects the neoliberal policy discourse of decentralisation and school self-management sweeping across many of the world's education systems. IPS provides WA state school principals with decision-making authority in a range of areas, including the…

How Are School Leaders and Teachers Allocating Their Time in the Intensive Partnership Sites? Working Paper WR-1041-1-BMGF

ERIC Educational Resources Information Center

Chambers, Jay; de los Reyes, Iliana Brodziak; Wang, Antonia; O'Neil, Caitlin

2014-01-01

The goal of the Intensive Partnership (IP) initiative is to improve student success by transforming how teachers are recruited, developed, assigned, rewarded, and retained. RAND and American Institutes for Research (AIR) have been studying the seven IP sites (including three districts and four charter management organizations--CMOs) since the…

Bandwidth Management in Resource Constrained Networks

DTIC Science & Technology

2012-03-01

Postgraduate School OSI Open Systems Interconnection QoS Quality of Service TCP Transmission Control Protocol/Internet Protocol TCP/IP Transmission...filtering. B. NORMAL TCP/IP COMMUNICATIONS The Internet is a “complex network WAN that connects LANs and clients around the globe” (Dean, 2009...of the Open Systems Interconnection ( OSI ) model allowing them to route traffic based on MAC address (Kurose & Ross, 2009). While switching

The Deployment of IPv6 in an IPv4 World and Transition Strategies.

ERIC Educational Resources Information Center

Bouras, C.; Ganos, P.; Karaliotas, A.

2003-01-01

The current version of the IP protocol, IPv4, is the most widely used protocol in computer networks. This article describes mechanisms that can be used to facilitate the transition to the new version of the IP protocol, IPv6, and examines usability, usefulness and manageability. Describes how some of these mechanisms were applied to the Greek…

A decentralized software bus based on IP multicas ting

NASA Technical Reports Server (NTRS)

Callahan, John R.; Montgomery, Todd

1995-01-01

We describe decentralized reconfigurable implementation of a conference management system based on the low-level Internet Protocol (IP) multicasting protocol. IP multicasting allows low-cost, world-wide, two-way transmission of data between large numbers of conferencing participants through the Multicasting Backbone (MBone). Each conference is structured as a software bus -- a messaging system that provides a run-time interconnection model that acts as a separate agent (i.e., the bus) for routing, queuing, and delivering messages between distributed programs. Unlike the client-server interconnection model, the software bus model provides a level of indirection that enhances the flexibility and reconfigurability of a distributed system. Current software bus implementations like POLYLITH, however, rely on a centralized bus process and point-to-point protocols (i.e., TCP/IP) to route, queue, and deliver messages. We implement a software bus called the MULTIBUS that relies on a separate process only for routing and uses a reliable IP multicasting protocol for delivery of messages. The use of multicasting means that interconnections are independent of IP machine addresses. This approach allows reconfiguration of bus participants during system execution without notifying other participants of new IP addresses. The use of IP multicasting also permits an economy of scale in the number of participants. We describe the MULITIBUS protocol elements and show how our implementation performs better than centralized bus implementations.

Conclusion (The Mobile Future)

NASA Astrophysics Data System (ADS)

Marcus, Aaron; Sala, Riccardo; Roibás, Anxo Cereijo

There are a couple of fundamental beliefs that I hold about the future of technology and media. First, I believe that, absolutely, most, if not all, media will be delivered, at least intermittently in its lifecycle, over an IP network. It is an efficient carrier, it is scalable, and it can be organically evolved. Whether this is IPV6 or some other technology is inconsequential, it will just work.

Inspecting the Dangers of Feeling like a Fake: An Empirical Investigation of the Impostor Phenomenon in the World of Work

PubMed Central

Neureiter, Mirjam; Traut-Mattausch, Eva

2016-01-01

To investigate the link between the impostor phenomenon (IP), career self-management (CSM) factors, and work-relevant outcomes, we looked at the IP's impact on career optimism, career adaptability, and knowledge of the job market, as well as on employee- and organizationally-relevant outcomes. We analyzed data from 238 working professionals (57% female) using parallel multiple mediation analyses. The results revealed that the IP was negatively related to all work-relevant outcomes through decreased CSM factors, which were subsequently associated with the outcomes. As hypothesized, employee-relevant subjective outcomes were mediated by optimism and employee-relevant objective (i.e., economic) outcomes by adaptability and knowledge. Additional mediating effects occurred. Regarding organizationally relevant outcomes, adaptability mediated the IP's impact on organizational citizenship behavior. The IP was only indirectly related to continuance commitment through adaptability and to affective commitment through optimism. We discuss the theoretical and practical implications and offer ideas for future research. PMID:27729882

Generic learning skills in academically-at-risk medical students: a development programme bridges the gap.

PubMed

Burch, Vanessa C; Sikakana, Cynthia N T; Gunston, Geney D; Shamley, Delva R; Murdoch-Eaton, Deborah

2013-08-01

Widening access to medical students from diverse educational backgrounds is a global educational mandate. The impact, on students' generic learning skills profiles, of development programmes designed for students at risk of attrition is unknown. This study investigated the impact of a 12-month Intervention Programme (IP) on the generic learning skills profile of academically-at-risk students who, after failing at the end of the first semester, completed the IP before entering the second semester of a conventional medical training programme. This prospective study surveyed medical students admitted in 2009 and 2010, on entry and on completion of first year, on their reported practice and confidence in information handling, managing own learning, technical and numeracy, computer, organisational and presentation skills. Of 414 first year students, 80 (19%) entered the IP. Levels of practice and confidence for five of the six skills categories were significantly poorer at entry for IP students compared to conventional stream students. In four categories these differences were no longer statistically significant after students had completed the IP; 62 IP students (77.5%) progressed to second year. A 12-month development programme, the IP, effectively addressed generic learning skills deficiencies present in academically-at-risk students entering medical school.

Design of SIP transformation server for efficient media negotiation

NASA Astrophysics Data System (ADS)

Pack, Sangheon; Paik, Eun Kyoung; Choi, Yanghee

2001-07-01

Voice over IP (VoIP) is one of the advanced services supported by the next generation mobile communication. VoIP should support various media formats and terminals existing together. This heterogeneous environment may prevent diverse users from establishing VoIP sessions among them. To solve the problem an efficient media negotiation mechanism is required. In this paper, we propose the efficient media negotiation architecture using the transformation server and the Intelligent Location Server (ILS). The transformation server is an extended Session Initiation Protocol (SIP) proxy server. It can modify an unacceptable session INVITE message into an acceptable one using the ILS. The ILS is a directory server based on the Lightweight Directory Access Protocol (LDAP) that keeps userí*s location information and available media information. The proposed architecture can eliminate an unnecessary response and re-INVITE messages of the standard SIP architecture. It takes only 1.5 round trip times to negotiate two different media types while the standard media negotiation mechanism takes 2.5 round trip times. The extra processing time in message handling is negligible in comparison to the reduced round trip time. The experimental results show that the session setup time in the proposed architecture is less than the setup time in the standard SIP. These results verify that the proposed media negotiation mechanism is more efficient in solving diversity problems.

[Has the presence of parents during invasive procedures in the emergency department increased in the last few years?].

PubMed

Angel Solà, J; Sagué Bravo, S; Parra Cotanda, C; Trenchs Sainz de la Maza, V; Luaces Cubells, C

2015-01-01

In the recent years, parents are playing an important role in Pediatric Emergency Department (PED), and wish to be present when invasive procedures (IP) are performed. 1) To compare the presence of parents during IP in PED in Spain between 2008 and 2012. 2) To compare the arguments to restrict the presence and problems arising from this, and 3) To determine whether the views of health personnel have changed on this subject. A descriptive multicenter comparative study was conducted in 2008 and 2012. A total of 42 questionaires were sent by email to PED managers, with the responding hospitals being included in the 2 periods of the study. A total of 22 hospitals participated in the study. The presence of parents in the PED increased between 2008 and 2012 for all IP, significantly in the blood test and urine catheterization. In 2012, managers state that children are not so nervous, and anxiety of the parents and staff fear of a poorer performance, as an argument to restrict family presence. There were few problems during the 2 periods, with the poor behavior of the children decreasing. According to managers, the opinion of health personnel has not changed in the last four years. The presence of parents during the IP in the PED has increased in the last four years, although the presence is low for more invasive procedures. Managers argue the presence of fewer behavior problems to restrict family presence. The opinion of the staff has not changed in the last four years, although more studies are required on this issue. Copyright © 2013 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.

Pros and cons of intraperitoneal chemotherapy in the treatment of epithelial ovarian cancer.

PubMed

Zeimet, Alain G; Reimer, Daniel; Radl, Alice C; Reinthaller, Alexander; Schauer, Christian; Petru, Edgar; Concin, Nicole; Braun, Stephan; Marth, Christian

2009-07-01

Development of the pros and cons of intraperitoneal (IP) chemotherapy in the treatment of epithelial ovarian cancer based on the most prominent data published on the evolution of IP chemotherapy and on experience with this therapeutic strategy in clinical routine. The literature published on IP chemotherapy in ovarian cancer between 1970 and 2008 was identified systematically by computer-based searches in MEDLINE and the Cochrane Library. Furthermore, a preliminary analysis of data recorded during an observational nationwide multicenter study of the Austrian AGO on IP-IV chemotherapy using the GOG-172 treatment regimen was performed. The literature review unequivocally revealed a significantly greater toxicity for IP than for intravenous (IV) cisplatin-based chemotherapy. However, according to a Cochrane meta-analysis, IP-IV administration of chemotherapy is associated with a 21.6% decrease in the risk for death. In agreement with earlier reports, the most frequently mentioned side-effects in the Austria-wide observational study were long-lasting neurotoxicity, abdominal pain, fatigue, gastrointestinal and metabolic toxicities, and catheter-related complications. Most of these toxicities were identified as mirroring the toxicity profile of high-dose IV cisplatin (>or=100 mg/m(2)). In some patients, the classic IP-IV regimen with cisplatin/paclitaxel was changed to an alternative schedule comprising carboplatin AUC 5 (d1) and weekly paclitaxel 60 mg/m(2) (d1, 8, 15) completely administered via the IP route. This treatment was better tolerated and quality of life was significantly less compromised. However, neutropenia and thrombocytopenia were the limiting side-effects of this IP regimen. In cases where optimal cytoreduction with residual disease

Correlation between oestrogen receptor protein expression in infiltrating ductal carcinoma of the breast by immunohistochemistry and cytosol measurements.

PubMed

Looi, L M; Yap, S F; Cheah, P L

1997-11-01

Fresh frozen neoplastic tissues from 70 infiltrating ductal breast carcinomas were analysed for cytosolic oestrogen receptor (ER) protein content using a solid phase enzyme immunoassay (EIA) method based on a "sandwich" principle (Abbott ER-EIA monoclonal). Formalin-fixed, paraffin-embedded sections from the same carcinomas were examined for nuclear immunoreactivity against a monoclonal antibody for ER protein (Dako) using the standard avidin-biotin complex immunoperoxidase (IP) method after microwave antigen retrieval. The degree of ER positivity by IP was also scored according to a visual estimation of the percentage of cells expressing immunopositivity and the intensity of staining. Twenty-eight (40%) of the carcinomas were ER-positive by EIA and 34 (48.6%) were positive by IP. Twenty-five (35.7%) were ER-positive and 33 (47.1%) were ER-negative by both methods. Nine (12.9%) were ER-negative by EIA but were positive by IP, this discrepancy being ascribed to sampling inadequacy for EIA. However, 3 (4.3%) tumours were ER-positive by EIA and negative by IP. This discrepancy may be variously due to inadequate antigen retrieval, faulty technique and the possibility that the two methods do not measure identical ER proteins. IP appears to have an advantage over EIA in that it has a higher pick-up rate, does not require fresh tissue and can be applied to archival material. However, to reduce false negative estimations, it may be necessary to run IP staining using more than one ER antibody. Standardisation of the IP method for ER is desirable before this method is to be widely adopted in Malaysian laboratories. Quantitation of ER positivity by IP scoring correlated poorly with actual cytosolic levels. Caution should be exercised in attaching patient management value to visual IP scoring.

Lunar Applications in Reconfigurable Computing

NASA Technical Reports Server (NTRS)

Somervill, Kevin

2008-01-01

NASA s Constellation Program is developing a lunar surface outpost in which reconfigurable computing will play a significant role. Reconfigurable systems provide a number of benefits over conventional software-based implementations including performance and power efficiency, while the use of standardized reconfigurable hardware provides opportunities to reduce logistical overhead. The current vision for the lunar surface architecture includes habitation, mobility, and communications systems, each of which greatly benefit from reconfigurable hardware in applications including video processing, natural feature recognition, data formatting, IP offload processing, and embedded control systems. In deploying reprogrammable hardware, considerations similar to those of software systems must be managed. There needs to be a mechanism for discovery enabling applications to locate and utilize the available resources. Also, application interfaces are needed to provide for both configuring the resources as well as transferring data between the application and the reconfigurable hardware. Each of these topics are explored in the context of deploying reconfigurable resources as an integral aspect of the lunar exploration architecture.

Realtime Gas Emission Monitoring at Hazardous Sites Using a Distributed Point-Source Sensing Infrastructure.

PubMed

Manes, Gianfranco; Collodi, Giovanni; Gelpi, Leonardo; Fusco, Rosanna; Ricci, Giuseppe; Manes, Antonio; Passafiume, Marco

2016-01-20

This paper describes a distributed point-source monitoring platform for gas level and leakage detection in hazardous environments. The platform, based on a wireless sensor network (WSN) architecture, is organised into sub-networks to be positioned in the plant's critical areas; each sub-net includes a gateway unit wirelessly connected to the WSN nodes, hence providing an easily deployable, stand-alone infrastructure featuring a high degree of scalability and reconfigurability. Furthermore, the system provides automated calibration routines which can be accomplished by non-specialized maintenance operators without system reliability reduction issues. Internet connectivity is provided via TCP/IP over GPRS (Internet standard protocols over mobile networks) gateways at a one-minute sampling rate. Environmental and process data are forwarded to a remote server and made available to authenticated users through a user interface that provides data rendering in various formats and multi-sensor data fusion. The platform is able to provide real-time plant management with an effective; accurate tool for immediate warning in case of critical events.

IP Sample Plan #5 | NCI Technology Transfer Center | TTC

Cancer.gov

A sample Intellectual Property Management Plan in the form of a legal agreement between a University and its collaborators which addresses data sharing, sharing of research tools and resources and intellectual property management.

Inhibitory mechanism of an extract of Althaea officinalis L. on endothelin-1-induced melanocyte activation.

PubMed

Kobayashi, Akemi; Hachiya, Akira; Ohuchi, Atsushi; Kitahara, Takashi; Takema, Yoshinori

2002-02-01

It is known that expression of endothelin-1 (ET-1) increases in the epidermis after UVB irradiation, and that this plays an important role during the induction of pigmentation both as a mitogen and as a melanogen for normal human melanocytes (NHMC). When ET-1 acts on NHMC via the endothelin B receptor (ET(B)R) on their cell surface, mobilization of intracellular calcium is induced, which is followed by activation of Raf-1 located upstream of mitogen activated protein kinase (MAPK). We have continued the search for new agent which inhibit this calcium mobilization and we have found that an extract of Althaea officinalis L. has such an action. In this study, we investigated the precise inhibitory mechanism of this botanical extract on the ET-1-induced activation of melanocytes. Treatment of NHMC with this extract abrogated the stimulatory effect of ET-1 on proliferation and also on activation of MAPK in the intracellular signal transduction pathway, but did not affect the binding of ET-1 to the ET(B)R or the production of Inositol 1,4,5-Trisphosphate (IP3). Further, when this extract was used to treat normal human keratinocytes (NHKC), secretion of ET-1 by those cells was reduced. Taken together, these findings indicate that an extract of A. officinalis inhibits both the secretion of ET-1 from NHKC and the action of ET-1 on NHMC mainly by suppressing the ET-1-induced calcium mobilization without the modification of IP3 production, which in turn suggests that this extract is a useful ingredient for a whitening agent.

Diabetes Management via a Mobile Application: a Case Report.

PubMed

Jo, In-Young; Yoo, Seung-Hyun; Lee, Da Young; Park, Cheol-Young; Kim, Eun Mi

2017-01-01

Recently, mobile health care has been applied to manage diabetes requiring self-management. Health care by mobile applications (apps) has a great advantage when applied to patients with diabetes; the adherence to self-management activities for diabetes can be improved through mobile apps. The Food and Drug Administration (FDA) has cleared and approved the use of some mobile apps as medical devices for the management of diabetes since 2010. However, mobile apps may not be effective for all patients. We here report the effect of use of mobile-based diabetes care app (Healthy-note app) for 2 patients with diabetes, and discuss issues and strategies for effective mobile intervention. Further study is needed on improving patient's participation to increase the effect of management via a mobile app.

The Logistics Equipment Carbon Emission Monitoring System for a Green Logistics

NASA Astrophysics Data System (ADS)

Choi, Hyungrim; Park, Byoungkwon; Lee, Byungha; Park, Yongsung; Lee, Changsup; Ha, Jeongsoo

Recently, due to the global enforcement of obligations to reduce green house gases and various environmental regulations, low carbon green growth strategies are required. Currently, in our country, environment friendly logistics activities are staying in the early stage compared to advanced countries because of our country's large energy consumption type industrial structures. As a measure to respond to the trend of the reinforcement of international environmental regulations in the sector of logistics, active green logistics systems should be established and to solve this problem, this study is intended to develop a monitoring system that can manage the carbon emission of logistics equipment(container truck, discharging equipment etc) in real time using a new technology named IP-RFID. The monitoring system developed in this study can actively manage the carbon emission of individual logistics equipment by attaching IP-Tags that can measure the carbon emission of individual logistics equipment in real time and transmit the information obtained from the measurement directly to users through IP communication. Since carbon emission can be managed by logistics equipment and drivers can check the carbon emission of equipment through this system, the carbon emission generated in the logistics sector may be reduced by using this system.

Adopting Internet Standards for Orbital Use

NASA Technical Reports Server (NTRS)

Wood, Lloyd; Ivancic, William; da Silva Curiel, Alex; Jackson, Chris; Stewart, Dave; Shell, Dave; Hodgson, Dave

2005-01-01

After a year of testing and demonstrating a Cisco mobile access router intended for terrestrial use onboard the low-Earth-orbiting UK-DMC satellite as part of a larger merged ground/space IP-based internetwork, we reflect on and discuss the benefits and drawbacks of integration and standards reuse for small satellite missions. Benefits include ease of operation and the ability to leverage existing systems and infrastructure designed for general use, as well as reuse of existing, known, and well-understood security and operational models. Drawbacks include cases where integration work was needed to bridge the gaps in assumptions between different systems, and where performance considerations outweighed the benefits of reuse of pre-existing file transfer protocols. We find similarities with the terrestrial IP networks whose technologies we have adopted and also some significant differences in operational models and assumptions that must be considered.

Citrus bergamia Risso Elevates Intracellular Ca2+ in Human Vascular Endothelial Cells due to Release of Ca2+ from Primary Intracellular Stores

PubMed Central

Kang, Purum; Han, Seung Ho; Moon, Hea Kyung; Lee, Jeong-Min; Kim, Hyo-Keun; Min, Sun Seek; Seol, Geun Hee

2013-01-01

The purpose of the present study is to examine the effects of essential oil of Citrus bergamia Risso (bergamot, BEO) on intracellular Ca2+ in human umbilical vein endothelial cells. Fura-2 fluorescence was used to examine changes in intracellular Ca2+ concentration [Ca2+]i . In the presence of extracellular Ca2+, BEO increased [Ca2+]i , which was partially inhibited by a nonselective Ca2+ channel blocker La3+. In Ca2+-free extracellular solutions, BEO increased [Ca2+]i in a concentration-dependent manner, suggesting that BEO mobilizes intracellular Ca2+. BEO-induced [Ca2+]i increase was partially inhibited by a Ca2+-induced Ca2+ release inhibitor dantrolene, a phospholipase C inhibitor U73122, and an inositol 1,4,5-triphosphate (IP3)-gated Ca2+ channel blocker, 2-aminoethoxydiphenyl borane (2-APB). BEO also increased [Ca2+]i in the presence of carbonyl cyanide m-chlorophenylhydrazone, an inhibitor of mitochondrial Ca2+ uptake. In addition, store-operated Ca2+ entry (SOC) was potentiated by BEO. These results suggest that BEO mobilizes Ca2+ from primary intracellular stores via Ca2+-induced and IP3-mediated Ca2+ release and affect promotion of Ca2+ influx, likely via an SOC mechanism. PMID:24348719

Unified Charging and Billing Solution. Unified - Next Generation of Charging Systems in Mobile Networks

NASA Astrophysics Data System (ADS)

Donhefner, Daniel

The mobile market evolves from commodity voice and simple messaging services to value-added data and multimedia services. This not only implies to move from pure telecom to IT/IP- environment, but to exploit their markets with innovative and differentiated offerings to keep the churn rate low and attract new customers. Communication Service Providers (CSP) must focus increasingly on meeting individual needs and higher expectations of their subscribers. They expect service packages that can be tailored to meet the specific demands of their personal situation, preferences and lifestyle. This requires a flexible customer-centric approach instead of the legacy historical grown and diversed system architecture and organizations of CSPs.

Bringing HIV partner services into the age of social media and mobile connectivity.

PubMed

Udeagu, Chi-Chi N; Bocour, Angelica; Shah, Sharmila; Ramos, Yasmin; Gutierrez, Rodolfo; Shepard, Colin W

2014-10-01

A substantial proportion of recent sex partners named by persons with sexually transmitted infections are not notified about their exposure despite attempts by public health officials. Although text messaging (texting) and Internet-based communications (dating Web sites, e-mail, etc) are used by a large segment of the public for regular communications, these tools have been underused for partner services (PS). We augmented PS for HIV in New York City using texting and Internet-based means to contact persons for whom traditional information (landline telephone number, postal address) was unavailable. We compared traditional PS (traditionalPS), Internet-based PS (IPS) in January 2011 to October 2012, and texting PS (txtPS) from January 2012 (when txtPS was initiated) through October 2012 on outcomes of contact attempts, notification, and HIV testing. From January 2011 to October 2012, of 3319 partners elicited, 2604 and 275 partners had traditional and only Internet-based contact information and were selected for traditionalPS and IPS, respectively. From January to October 2012, 368 of 1569 partners had only texting-enabled cellphone numbers and were selected for txtPS. The contact rate for txtPS (285/368 [77%]) was significantly higher (P < 0.0001) than the contact rates for traditionalPS (1803/2604 [69%]) and IPS (112/275 [41%]). There was a higher likelihood of notifying contacted IPS (odds ratio, 2.1; 1.2-3.4) and txtPS (odds ratio, 2.4; 1.7-3.2) than traditionalPS partners (P ≤ 0.0001). However, among the notified partners, traditionalPS partners were significantly (P < 0.0001) more likely than txtPS or IPS partners to test for HIV after partner notification (69% vs 45% and 34%, respectively). Augmenting traditionalPS with txtPS and IPS enabled notification of hundreds of previously untraceable partners and several new HIV diagnoses.

Improving Service Management in the Internet of Things

PubMed Central

Sammarco, Chiara; Iera, Antonio

2012-01-01

In the Internet of Things (IoT) research arena, many efforts are devoted to adapt the existing IP standards to emerging IoT nodes. This is the direction followed by three Internet Engineering Task Force (IETF) Working Groups, which paved the way for research on IP-based constrained networks. Through a simplification of the whole TCP/IP stack, resource constrained nodes become direct interlocutors of application level entities in every point of the network. In this paper we analyze some side effects of this solution, when in the presence of large amounts of data to transmit. In particular, we conduct a performance analysis of the Constrained Application Protocol (CoAP), a widely accepted web transfer protocol for the Internet of Things, and propose a service management enhancement that improves the exploitation of the network and node resources. This is specifically thought for constrained nodes in the abovementioned conditions and proves to be able to significantly improve the node energetic performance when in the presence of large resource representations (hence, large data transmissions).

Analytical method development and validation of simultaneous estimation of rabeprazole, pantoprazole, and itopride by reverse-phase high-performance liquid chromatography.

PubMed

Perumal, Senthamil Selvan; Ekambaram, Sanmuga Priya; Raja, Samundeswari

2014-12-01

A simple, selective, rapid, and precise reverse-phase high-performance liquid chromatography (RP-HPLC) method for the simultaneous estimation of rabeprazole (RP), pantoprazole (PP), and itopride (IP) has been developed. The compounds were well separated on a Phenomenex C 18 (Luna) column (250 mm × 4.6 mm, dp = 5 μm) with C 18 guard column (4 mm × 3 mm × 5 μm) with a mobile phase consisting of buffer containing 10 mM potassium dihydrogen orthophosphate (adjusted to pH 6.8): acetonitrile (70:30 v/v) at a flow rate of 1.0 mL/min and ultraviolet detection at 288 nm. The retention time of RP, PP, and IP were 5.35, 7.92, and 11.16 minutes, respectively. Validation of the proposed method was carried out according to International Conference on Harmonisation (ICH) guidelines. Linearity range was obtained for RP, PP, and IP over the concentration range of 2.5-25, 1-30, and 3-35 μg/mL and the r 2 values were 0.994, 0.978, and 0.991, respectively. The calculated limit of detection (LOD) values were 1, 0.3, and 1 μg/mL and limit of quantitation (LOQ) values were 2.5, 1, and 3 μg/mL for RP, PP, and IP correspondingly. Thus, the current study showed that the developed reverse-phase liquid chromatography method is sensitive and selective for the estimation of RP, PP, and IP in combined dosage form. Copyright © 2014. Published by Elsevier B.V.

Mobil`s Energy Management Program

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schoeneborn, F.C.

1997-06-01

Mobil`s Facilities Management Network sponsored a cross-divisional team to reduce energy costs. This team developed an Energy Management Plan to reduce energy costs by $25 million annually throughout all Mobil divisions over the next five years (total of $125 million committed savings). The core of this plan is the belief that energy costs are controllable and should be managed with the expertise that Mobil manages other parts of the business. Areas of focus are economic procurement, efficient consumption, and expertise sharing.

The interaction between intellectual property and drug regulatory systems: global perspectives.

PubMed

Madden, Edward A

2007-02-01

Regulatory compliance in the development, production and sale of new drugs accounts for the largest single expense in bringing a drug product to market. To justify developmental and regulatory compliance costs, drug innovators turn to the intellectual property (IP) system to provide a means for securing returns on investment. Because the drug regulatory system in most countries operates in isolation of the IP system, one of the greatest challenges facing the pharmaceutical industry is the extent to which IP rights can be managed against an independent drug regulatory system. Many regulatory bodies in developed countries have sought to ensure a compromise between the rights of generic companies and IP owners by including safeguards in the regulatory framework, such as patent linking and data protection; however, these efforts are yet to be applied in some of the biggest potential drug markets in emerging economies.

Calcium Domains around Single and Clustered IP3 Receptors and Their Modulation by Buffers

PubMed Central

Rüdiger, S.; Nagaiah, Ch.; Warnecke, G.; Shuai, J.W.

2010-01-01

Abstract We study Ca2+ release through single and clustered IP3 receptor channels on the ER membrane under presence of buffer proteins. Our computational scheme couples reaction-diffusion equations and a Markovian channel model and allows our investigating the effects of buffer proteins on local calcium concentrations and channel gating. We find transient and stationary elevations of calcium concentrations around active channels and show how they determine release amplitude. Transient calcium domains occur after closing of isolated channels and constitute an important part of the channel's feedback. They cause repeated openings (bursts) and mediate increased release due to Ca2+ buffering by immobile proteins. Stationary domains occur during prolonged activity of clustered channels, where the spatial proximity of IP3Rs produces a distinct [Ca2+] scale (0.5–10 μM), which is smaller than channel pore concentrations (>100 μM) but larger than transient levels. While immobile buffer affects transient levels only, mobile buffers in general reduce both transient and stationary domains, giving rise to Ca2+ evacuation and biphasic modulation of release amplitude. Our findings explain recent experiments in oocytes and provide a general framework for the understanding of calcium signals. PMID:20655827

Display Sharing: An Alternative Paradigm

NASA Technical Reports Server (NTRS)

Brown, Michael A.

2010-01-01

The current Johnson Space Center (JSC) Mission Control Center (MCC) Video Transport System (VTS) provides flight controllers and management the ability to meld raw video from various sources with telemetry to improve situational awareness. However, maintaining a separate infrastructure for video delivery and integration of video content with data adds significant complexity and cost to the system. When considering alternative architectures for a VTS, the current system's ability to share specific computer displays in their entirety to other locations, such as large projector systems, flight control rooms, and back supporting rooms throughout the facilities and centers must be incorporated into any new architecture. Internet Protocol (IP)-based systems also support video delivery and integration. IP-based systems generally have an advantage in terms of cost and maintainability. Although IP-based systems are versatile, the task of sharing a computer display from one workstation to another can be time consuming for an end-user and inconvenient to administer at a system level. The objective of this paper is to present a prototype display sharing enterprise solution. Display sharing is a system which delivers image sharing across the LAN while simultaneously managing bandwidth, supporting encryption, enabling recovery and resynchronization following a loss of signal, and, minimizing latency. Additional critical elements will include image scaling support, multi -sharing, ease of initial integration and configuration, integration with desktop window managers, collaboration tools, host and recipient controls. This goal of this paper is to summarize the various elements of an IP-based display sharing system that can be used in today's control center environment.

Safeguarding Copyrighted Contents: Digital Libraries and Intellectual Property Management. CWRU's Rights Management System.

ERIC Educational Resources Information Center

Alrashid, Tareq M.; Barker, James A.; Christian, Brian S.; Cox, Steven C.; Rabne, Michael W.; Slotta, Elizabeth A.; Upthegrove, Luella R.

1998-01-01

Describes Case Western Reserve University's (CWRU's) digital library project that examines the networked delivery of full-text materials and high-quality images to provide students excellent supplemental instructional resources delivered directly to their dormitory rooms. Reviews intellectual property (IP) management requirements and describes…

Evaluating an undergraduate interprofessional simulation-based educational module: communication, teamwork, and confidence performing cardiac resuscitation skills

PubMed Central

Luctkar-Flude, Marian; Baker, Cynthia; Pulling, Cheryl; Mcgraw, Robert; Dagnone, Damon; Medves, Jennifer; Turner-Kelly, Carly

2010-01-01

Purpose Interprofessional (IP) collaboration during cardiac resuscitation is essential and contributes to patient wellbeing. The purpose of this study is to evaluate an innovative simulation-based IP educational module for undergraduate nursing and medical students on cardiac resuscitation skills. Methods Nursing and medical trainees participated in a new cardiac resuscitation curriculum involving a 2-hour IP foundational cardiac resuscitation skills lab, followed by three 2-hour IP simulation sessions. Control group participants attended the existing two 2-hour IP simulation sessions. Study respondents (N = 71) completed a survey regarding their confidence performing cardiac resuscitation skills and their perceptions of IP collaboration. Results Despite a consistent positive trend, only one out of 17 quantitative survey items were significantly improved for learners in the new curriculum. They were more likely to report feeling confident managing the airway during cardiac resuscitation (P = 0.001). Overall, quantitative results suggest that senior nursing and medical students were comfortable with IP communication and teamwork and confident with cardiac resuscitation skills. There were no significant differences between nursing students’ and medical students’ results. Through qualitative feedback, participants reported feeling comfortable learning with students from other professions and found value in the IP simulation sessions. Conclusion Results from this study will inform ongoing restructuring of the IP cardiac resuscitation skills simulation module as defined by the action research process. Specific improvements that are suggested by these findings include strengthening the team leader component of the resuscitation skills lab and identifying learners who may benefit from additional practice in the role of team leader and with other skills where they lack confidence. PMID:23745064

Decision-Making Using Real-Time Observations for Environmental Sustainability; an integrated 802.11 sensor network

NASA Astrophysics Data System (ADS)

Dominguez, A.; Kleissl, J.; Farhadi, M.; Kim, D.; Liu, W.; Mao, Y.; Nguyen, H. T.; Roshandell, M.; Sankur, M.; Shiga, Y.; Linden, P.; Hodgkiss, W.

2007-12-01

Meteorological conditions have important implications on human activities. They affect human comfort, productivity, and health, and contribute to material wear and tear. The University of California, San Diego (UCSD)'s proximity to the Pacific Ocean places it in a temperate microclimate which has unique advantages and disadvantages for campus water and energy use and air quality. In particular, the daily sea-breezes provide cool, moist, and salt-laden air to campus. For the Decision-Making Using Real-Time Observations for Environmental Sustainability (DEMROES) project a heterogeneous wireless network of monitoring stations is being set up across the UCSD campus and beyond. Conditions to be monitored include temperature, humidity, wind speed and direction, surface temperatures, solar radiation, particulate matter, CO, NO2, rainfall, and soil moisture. Stations are strategically placed on rooftops and lampposts across campus, as well as select off-campus locations and will transmit data over the UCSD 802.11 wireless network. In addition to rooftop and lamppost stations, mobile stations will be deployed via remotely controlled ground and air units, and stations affixed to campus shuttle busses. These mobile stations will allow for greater spatial resolution of the environmental conditions across campus and inter-sensor calibration. The hardware consists of meteorological, hydrological, and air quality sensors connected to (a) commercial Campbell datalogging systems with serial2IP modules and wireless bridges, and (b) sensor and 802.11 boards based on the dpac technology developed in-house. The measurements will serve campus facilities management with information to feed the energy management system (EMS) for building operation and energy conservation, and irrigation management. The technology developed for this project can be applied elsewhere thereby contributing to hydrologic and ecologic observatories. Through extensive student involvement a new generation of environmental scientists and engineers will be trained to work on the planning and execution of national observatories.

Energy star compliant voice over internet protocol (VoIP) telecommunications network including energy star compliant VoIP devices

DOEpatents

Kouchri, Farrokh Mohammadzadeh

2012-11-06

A Voice over Internet Protocol (VoIP) communications system, a method of managing a communications network in such a system and a program product therefore. The system/network includes an ENERGY STAR (E-star) aware softswitch and E-star compliant communications devices at system endpoints. The E-star aware softswitch allows E-star compliant communications devices to enter and remain in power saving mode. The E-star aware softswitch spools messages and forwards only selected messages (e.g., calls) to the devices in power saving mode. When the E-star compliant communications devices exit power saving mode, the E-star aware softswitch forwards spooled messages.

Application of SNMP on CATV

NASA Astrophysics Data System (ADS)

Huang, Hong-bin; Liu, Wei-ping; Chen, Shun-er; Zheng, Liming

2005-02-01

A new type of CATV network management system developed by universal MCU, which supports SNMP, is proposed in this paper. From the point of view in both hardware and software, the function and method of every modules inside the system, which include communications in the physical layer, protocol process, data process, and etc, are analyzed. In our design, the management system takes IP MAN as data transmission channel and every controlled object in the management structure has a SNMP agent. In the SNMP agent developed, there are four function modules, including physical layer communication module, protocol process module, internal data process module and MIB management module. In the paper, the structure and function of every module are designed and demonstrated while the related hardware circuit, software flow as well as the experimental results are tested. Furthermore, by introducing RTOS into the software programming, the universal MCU procedure can conducts such multi-thread management as fast Ethernet controller driving, TCP/IP process, serial port signal monitoring and so on, which greatly improves efficiency of CPU.

Design and Analysis of a Dynamic Mobility Management Scheme for Wireless Mesh Network

PubMed Central

Roy, Sudipta

2013-01-01

Seamless mobility management of the mesh clients (MCs) in wireless mesh network (WMN) has drawn a lot of attention from the research community. A number of mobility management schemes such as mesh network with mobility management (MEMO), mesh mobility management (M3), and wireless mesh mobility management (WMM) have been proposed. The common problem with these schemes is that they impose uniform criteria on all the MCs for sending route update message irrespective of their distinct characteristics. This paper proposes a session-to-mobility ratio (SMR) based dynamic mobility management scheme for handling both internet and intranet traffic. To reduce the total communication cost, this scheme considers each MC's session and mobility characteristics by dynamically determining optimal threshold SMR value for each MC. A numerical analysis of the proposed scheme has been carried out. Comparison with other schemes shows that the proposed scheme outperforms MEMO, M3, and WMM with respect to total cost. PMID:24311982

ELF exposure from mobile and cordless phones for the epidemiological MOBI-Kids study.

PubMed

Calderón, Carolina; Ichikawa, Hiroki; Taki, Masao; Wake, Kanako; Addison, Darren; Mee, Terry; Maslanyj, Myron; Kromhout, Hans; Lee, Ae-Kyoung; Sim, Malcolm R; Wiart, Joe; Cardis, Elisabeth

2017-04-01

This paper describes measurements and computational modelling carried out in the MOBI-Kids case-control study to assess the extremely low frequency (ELF) exposure of the brain from use of mobile and cordless phones. Four different communication systems were investigated: Global System for Mobile (GSM), Universal Mobile Telecommunications System (UMTS), Digital Enhanced Cordless Telecommunications (DECT) and Wi-Fi Voice over Internet Protocol (VoIP). The magnetic fields produced by the phones during transmission were measured under controlled laboratory conditions, and an equivalent loop was fitted to the data to produce three-dimensional extrapolations of the field. Computational modelling was then used to calculate the induced current density and electric field strength in the brain resulting from exposure to these magnetic fields. Human voxel phantoms of four different ages were used: 8, 11, 14 and adult. The results indicate that the current densities induced in the brain during DECT calls are likely to be an order of magnitude lower than those generated during GSM calls but over twice that during UMTS calls. The average current density during Wi-Fi VoIP calls was found to be lower than for UMTS by 30%, but the variability across the samples investigated was high. Spectral contributions were important to consider in relation to current density, particularly for DECT phones. This study suggests that the spatial distribution of the ELF induced current densities in brain tissues is determined by the physical characteristics of the phone (in particular battery position) while the amplitude is mainly dependent on communication system, thus providing a feasible basis for assessing ELF exposure in the epidemiological study. The number of phantoms was not large enough to provide definitive evidence of an increase of induced current density with age, but the data that are available suggest that, if present, the effect is likely to be very small. Copyright © 2017 Elsevier Ltd. All rights reserved.

Malware Pandemics

DTIC Science & Technology

2010-09-01

in T-Mobile’s ,𔃽G IP range began expe- riencing extortion popup windows. The popup window notifies the victim that the phone has been hacked , and...range, 192.168.0.0/16. Such scanning may be of particular interest when the victim’s iPhone opportunistically connects to a WiFi LAN for Internet...connected to local WiFi networks should understand that the convenience of their Internet-tethered web, media, and email service, comes with a

Straight-wire appliances: standard versus individual prescription.

PubMed

Farronato, Giampietro; Periti, Giulia; Giannini, Lucia; Farronato, Davide; Maspero, Cinzia

2009-01-01

In this article the individual patient (IP) appliance is described. It consists of 250 options of bracket and band variations as the straight wire appliances. Increasing the bracket capabilities means using an increasing number of brackets, each with a specific design created for a treatment situation. The objective of IP appliance is to eliminate wire bending from orthodontic treatment and improve the treatment results. To manage this technique, a computer software is needed. Internet offers significant possibilities in managing each patient by patient basis. The clinician is required to make the diagnosis and treatment plan before ordering the appliance. Two clinical cases are described with the aim to present the advantages of this technique.

Multi-views storage model and access methods of conversation history in converged IP messaging system

NASA Astrophysics Data System (ADS)

Lu, Meilian; Yang, Dong; Zhou, Xing

2013-03-01

Based on the analysis of the requirements of conversation history storage in CPM (Converged IP Messaging) system, a Multi-views storage model and access methods of conversation history are proposed. The storage model separates logical views from physical storage and divides the storage into system managed region and user managed region. It simultaneously supports conversation view, system pre-defined view and user-defined view of storage. The rationality and feasibility of multi-view presentation, the physical storage model and access methods are validated through the implemented prototype. It proves that, this proposal has good scalability, which will help to optimize the physical data storage structure and improve storage performance.

Efficient Mobility Management Signalling in Network Mobility Supported PMIPV6

PubMed Central

Jebaseeli Samuelraj, Ananthi; Jayapal, Sundararajan

2015-01-01

Proxy Mobile IPV6 (PMIPV6) is a network based mobility management protocol which supports node's mobility without the contribution from the respective mobile node. PMIPV6 is initially designed to support individual node mobility and it should be enhanced to support mobile network movement. NEMO-BSP is an existing protocol to support network mobility (NEMO) in PMIPV6 network. Due to the underlying differences in basic protocols, NEMO-BSP cannot be directly applied to PMIPV6 network. Mobility management signaling and data structures used for individual node's mobility should be modified to support group nodes' mobility management efficiently. Though a lot of research work is in progress to implement mobile network movement in PMIPV6, it is not yet standardized and each suffers with different shortcomings. This research work proposes modifications in NEMO-BSP and PMIPV6 to achieve NEMO support in PMIPV6. It mainly concentrates on optimizing the number and size of mobility signaling exchanged while mobile network or mobile network node changes its access point. PMID:26366431

Efficient Mobility Management Signalling in Network Mobility Supported PMIPV6.

PubMed

Samuelraj, Ananthi Jebaseeli; Jayapal, Sundararajan

2015-01-01

Proxy Mobile IPV6 (PMIPV6) is a network based mobility management protocol which supports node's mobility without the contribution from the respective mobile node. PMIPV6 is initially designed to support individual node mobility and it should be enhanced to support mobile network movement. NEMO-BSP is an existing protocol to support network mobility (NEMO) in PMIPV6 network. Due to the underlying differences in basic protocols, NEMO-BSP cannot be directly applied to PMIPV6 network. Mobility management signaling and data structures used for individual node's mobility should be modified to support group nodes' mobility management efficiently. Though a lot of research work is in progress to implement mobile network movement in PMIPV6, it is not yet standardized and each suffers with different shortcomings. This research work proposes modifications in NEMO-BSP and PMIPV6 to achieve NEMO support in PMIPV6. It mainly concentrates on optimizing the number and size of mobility signaling exchanged while mobile network or mobile network node changes its access point.

Distributed network management in the flat structured mobile communities

NASA Astrophysics Data System (ADS)

Balandina, Elena

2005-10-01

Delivering proper management into the flat structured mobile communities is crucial for improving users experience and increase applications diversity in mobile networks. The available P2P applications do application-centric management, but it cannot replace network-wide management, especially when a number of different applications are used simultaneously in the network. The network-wide management is the key element required for a smooth transition from standalone P2P applications to the self-organizing mobile communities that maintain various services with quality and security guaranties. The classical centralized network management solutions are not applicable in the flat structured mobile communities due to the decentralized nature and high mobility of the underlying networks. Also the basic network management tasks have to be revised taking into account specialties of the flat structured mobile communities. The network performance management becomes more dependent on the current nodes' context, which also requires extension of the configuration management functionality. The fault management has to take into account high mobility of the network nodes. The performance and accounting managements are mainly targeted in maintain an efficient and fair access to the resources within the community, however they also allow unbalanced resource use of the nodes that explicitly permit it, e.g. as a voluntary donation to the community or due to the profession (commercial) reasons. The security management must implement the new trust models, which are based on the community feedback, professional authorization, and a mix of both. For fulfilling these and another specialties of the flat structured mobile communities, a new network management solution is demanded. The paper presents a distributed network management solution for flat structured mobile communities. Also the paper points out possible network management roles for the different parties (e.g. operators, service providing hubs/super nodes, etc.) involved in a service providing chain.

Building of communication system for nuclear accident emergency disposal based on IP multimedia subsystem

NASA Astrophysics Data System (ADS)

Wang, Kang; Gao, Guiqing; Qin, Yuanli; He, Xiangyong

2018-05-01

The nuclear accident emergency disposal must be supported by an efficient, real-time modularization and standardization communication system. Based on the analysis of communication system for nuclear accident emergency disposal which included many functions such as the internal and external communication, multiply access supporting and command center. Some difficult problems of the communication system were discussed such as variety access device type, complex composition, high mobility, set up quickly, multiply business support, and so on. Taking full advantages of the IP Multimedia Subsystem (IMS), a nuclear accident emergency communication system was build based on the IMS. It was studied and implemented that some key unit and module functions of communication system were included the system framework implementation, satellite access, short-wave access, load/vehicle-mounted communication units. The application tests showed that the system could provide effective communication support for the nuclear accident emergency disposal, which was of great practical value.

Ambulatory versus inpatient management of severe nausea and vomiting of pregnancy: a randomised control trial with patient preference arm

PubMed Central

Mitchell-Jones, Nicola; Farren, Jessica Alice; Tobias, Aurelio; Bourne, Tom; Bottomley, Cecilia

2017-01-01

Objective To determine whether ambulatory (outpatient (OP)) treatment of severe nausea and vomiting of pregnancy (NVP) is as effective as inpatient (IP) care. Design Non-blinded randomised control trial (RCT) with patient preference arm. Setting Two multicentre teaching hospitals in London. Participants Women less than 20 weeks’ pregnant with severe NVP and associated ketonuria (>1+). Methods Women who agreed to the RCT were randomised via web-based application to either ambulatory or IP treatment. Women who declined randomisation underwent the treatment of their choice in the patient preference trial (PPT) arm. Treatment protocols, data collection and follow-up were the same for all participants. Main outcome measures Primary outcome was reduction in Pregnancy Unique Quantification of Emesis (PUQE) score 48 hours after starting treatment. Secondary outcome measures were duration of treatment, improvement in symptom scores and ketonuria at 48 hours, reattendances within 7 days of discharge and comparison of symptoms at 7 days postdischarge. Results 152/174 eligible women agreed to participate with 77/152 (51%) recruited to the RCT and 75/152 (49%) to the PPT. Patients were initially compared in four groups (randomised IP, randomised OP, non-randomised IP and non-randomised OP). Comprehensive cohort analysis of participants in the randomised group (RCT) and non-randomised group (PPT) did not demonstrate any differences in patient demographics or baseline clinical characteristics. Pooled analysis of IP versus OP groups showed no difference in reduction in PUQE score at 48 hours (p=0.86). There was no difference in change in eating score (p=0.69), drinking score (p=0.77), well-being rating (p=0.64) or reduction in ketonuria (p=0.47) at 48 hours, with no difference in duration of index treatment episode (p=0.83) or reattendances within 7 days (p=0.52). Conclusions Ambulatory management is an effective direct alternative to IP management of severe NVP. The trial also demonstrated that many women requiring treatment for severe NVP have strong preferences regarding treatment setting, which may need to be considered by care providers, especially given the psychological impact of severe NVP. Trial registration number http://www.isrctn.com/ISRCTN24659467 (March 2014). PMID:29222135

An Improved Cross-Layering Design for IPv6 Fast Handover with IEEE 802.16m Entry Before Break Handover

NASA Astrophysics Data System (ADS)

Kim, Ronny Yongho; Jung, Inuk; Kim, Young Yong

IEEE 802.16m is an advanced air interface standard which is under development for IMT-Advanced systems, known as 4G systems. IEEE 802.16m is designed to provide a high data rate and a Quality of Service (QoS) level in order to meet user service requirements, and is especially suitable for mobilized environments. There are several factors that have great impact on such requirements. As one of the major factors, we mainly focus on latency issues. In IEEE 802.16m, an enhanced layer 2 handover scheme, described as Entry Before Break (EBB) was proposed and adopted to reduce handover latency. EBB provides significant handover interruption time reduction with respect to the legacy IEEE 802.16 handover scheme. Fast handovers for mobile IPv6 (FMIPv6) was standardized by Internet Engineering Task Force (IETF) in order to provide reduced handover interruption time from IP layer perspective. Since FMIPv6 utilizes link layer triggers to reduce handover latency, it is very critical to jointly design FMIPv6 with its underlying link layer protocol. However, FMIPv6 based on new handover scheme, EBB has not been proposed. In this paper, we propose an improved cross-layering design for FMIPv6 based on the IEEE 802.16m EBB handover. In comparison with the conventional FMIPv6 based on the legacy IEEE 802.16 network, the overall handover interruption time can be significantly reduced by employing the proposed design. Benefits of this improvement on latency reduction for mobile user applications are thoroughly investigated with both numerical analysis and simulation on various IP applications.

Tyrosine kinase inhibitors suppress prostaglandin F2alpha-induced phosphoinositide hydrolysis, Ca2+ elevation and contraction in iris sphincter smooth muscle.

PubMed

Yousufzai, S Y; Abdel-Latif, A A

1998-11-06

We investigated the effects of the protein tyrosine kinase inhibitors, genistein, tyrphostin 47, and herbimycin on prostaglandin F2alpha- and carbachol-induced inositol-1,4,5-trisphosphate (IP3) production, [Ca2+]i mobilization and contraction in cat iris sphincter smooth muscle. Prostaglandin F2alpha and carbachol induced contraction in a concentration-dependent manner with EC50 values of 0.92 x 10(-9) and 1.75 x 10(-8) M, respectively. The protein tyrosine kinase inhibitors blocked the stimulatory effects of prostaglandin F2alpha, but not those evoked by carbachol, on IP3 accumulation, [Ca2+]i mobilization and contraction, suggesting involvement of protein tyrosine kinase activity in the physiological actions of the prostaglandin. Daidzein and tyrphostin A, inactive negative control compounds for genistein and tyrphostin 47, respectively, were without effect. Latanoprost, a prostaglandin F2alpha analog used as an antiglaucoma drug, induced contraction and this effect was blocked by genistein. Genistein (10 microM) markedly reduced (by 67%) prostaglandin F2alpha-stimulated increase in [Ca2+]i but had little effect on that of carbachol in cat iris sphincter smooth muscle cells. Vanadate, a potent inhibitor of protein tyrosine phosphatase, induced a slow gradual muscle contraction in a concentration-dependent manner with an EC50 of 82 microM and increased IP3 generation in a concentration-dependent manner with an EC50 of 90 microM. The effects of vanadate were abolished by genistein (10 microM). Wortmannin, a myosin light chain kinase inhibitor, reduced prostaglandin F2alpha- and carbachol-induced contraction, suggesting that the involvement of protein tyrosine kinase activity may lie upstream of the increases in [Ca2+]i evoked by prostaglandin F2alpha. Further studies aimed at elucidating the role of protein tyrosine kinase activity in the coupling mechanism between prostaglandin F2alpha receptor activation and increases in intracellular Ca2+ mobilization and identifying the tyrosine-phosphorylated substrates will provide important information about the role of protein tyrosine kinase in the mechanism of smooth muscle contraction, as well as about the mechanism of the intraocular pressure lowering effect of the prostaglandin in glaucoma patients.

Index pregnancy versus post-index pregnancy in patients with recurrent pregnancy loss.

PubMed

Greenberg, Tzlil; Tzivian, Liliana; Harlev, Avi; Serjienko, Ruslan; Mazor, Moshe; Bashiri, Asher

2015-01-01

To compare pregnancy outcomes of two consecutive pregnancies in a cohort of women with recurrent pregnancy loss (RPL), in order to determine the long-term prognosis of women with RPL managed in a dedicated RPL clinic. A retrospective cohort study including 262 patients with two or more consecutive pregnancy losses followed by two subsequent pregnancies--index pregnancy (IP) and post-index pregnancy (PIP). All patients were evaluated and treated in the RPL clinic in the Soroka University Medical Center. Comparing IP with PIP, no significant difference in perinatal outcome was observed. The perinatal outcome remained encouraging with approximately 73% birth rate (73.7% versus 72.5%; p=0.83). Only 11% of the women with RPL continued to experience pregnancy losses for two subsequent pregnancies. In a multivariate logistic regression analysis, number of miscarriages pre-Index was the only factor independently associated with birth in the PIP. There is no significant difference between IP and PIP regarding perinatal outcome. Appropriate management in the RPL clinic conferred a significant beneficial effect on long-term pregnancy outcome of a cohort of women with RPL.

Alteration in 5-HT₂C, NMDA receptor and IP3 in cerebral cortex of epileptic rats: restorative role of Bacopa monnieri.

PubMed

Krishnakumar, Amee; Anju, T R; Abraham, Pretty Mary; Paulose, C S

2015-01-01

Bacopa monnieri is effective in stress management, brain function and a balanced mood. 5-HT2C receptors have been implicated in stress whereas NMDA receptors and mGlu5 play crucial role in memory and cognition. In the present study, we investigated the role of B. monnieri extract in ameliorating pilocarpine induced temporal lobe epilepsy through regulation of 5-HT2C and NMDA receptors in cerebral cortex. Our studies confirmed an increased 5-HT2C receptor function during epilepsy thereby facilitating IP3 release. We also observed an decreased NMDA receptor function with an elevated mGlu5 and GLAST gene expression in epileptic condition indicating the possibility for glutamate mediated excitotoxicity. These alterations lead to impaired behavioural functions as indicated by the Elevated Plus maze test. Carbamazepine and B. monnieri treatments to epileptic rats reversed the alterations in 5-HT2C, NMDA receptor functions and IP3 content thereby effectively managing the neurotransmitter balance in the cerebral cortex.

Enhanced service zone architecture for multiservices over IP

NASA Astrophysics Data System (ADS)

Michaely, Boaz; Mohan, Seshadri

2001-07-01

Recently, the field of IP Telephony has been experienced considerable evolution through the specification of new protocols and introduction of products implementing these protocols. We visualize IP Telephony evolving to soon offer multiservices encompassing not only voice, but also data, video and multimedia. While the progress has focused on refining protocols and architectures, very little attention has been given to business models for offering these services. This paper introduces the concept of a Service Zone, which from a service provider/network operator perspective fits within the operator's administrative domain, but is viewed as an independent zone with its own management and services, requiring minimal integration with the core network services. Besides its own management, the Enhanced Services Zone may also provide provisioning and maintenance features needed to provide the customer services and availability that subscribers expect from a telephony service providers. The platform must provide reliable service over time, be scalable to meet increased capacity demands, and be upgradeable to incorporate advanced services and features as they become available. Signaling flows are illustrated using SIP and H.323.

Chronic alcohol feeding potentiates hormone‐induced calcium signalling in hepatocytes

PubMed Central

Bartlett, Paula J.; Antony, Anil Noronha; Agarwal, Amit; Hilly, Mauricette; Prince, Victoria L.; Combettes, Laurent; Hoek, Jan B.

2017-01-01

Key points Chronic alcohol consumption causes a spectrum of liver diseases, but the pathogenic mechanisms driving the onset and progression of disease are not clearly defined.We show that chronic alcohol feeding sensitizes rat hepatocytes to Ca2+‐mobilizing hormones resulting in a leftward shift in the concentration–response relationship and the transition from oscillatory to more sustained and prolonged Ca2+ increases.Our data demonstrate that alcohol‐dependent adaptation in the Ca2+ signalling pathway occurs at the level of hormone‐induced inositol 1,4,5 trisphosphate (IP3) production and does not involve changes in the sensitivity of the IP3 receptor or size of internal Ca2+ stores.We suggest that prolonged and aberrant hormone‐evoked Ca2+ increases may stimulate the production of mitochondrial reactive oxygen species and contribute to alcohol‐induced hepatocyte injury. Abstract ‘Adaptive’ responses of the liver to chronic alcohol consumption may underlie the development of cell and tissue injury. Alcohol administration can perturb multiple signalling pathways including phosphoinositide‐dependent cytosolic calcium ([Ca2+]i) increases, which can adversely affect mitochondrial Ca2+ levels, reactive oxygen species production and energy metabolism. Our data indicate that chronic alcohol feeding induces a leftward shift in the dose–response for Ca2+‐mobilizing hormones resulting in more sustained and prolonged [Ca2+]i increases in both cultured hepatocytes and hepatocytes within the intact perfused liver. Ca2+ increases were initiated at lower hormone concentrations, and intercellular calcium wave propagation rates were faster in alcoholics compared to controls. Acute alcohol treatment (25 mm) completely inhibited hormone‐induced calcium increases in control livers, but not after chronic alcohol‐feeding, suggesting desensitization to the inhibitory actions of ethanol. Hormone‐induced inositol 1,4,5 trisphosphate (IP3) accumulation and phospholipase C (PLC) activity were significantly potentiated in hepatocytes from alcohol‐fed rats compared to controls. Removal of extracellular calcium, or chelation of intracellular calcium did not normalize the differences in hormone‐stimulated PLC activity, indicating calcium‐dependent PLCs are not upregulated by alcohol. We propose that the liver ‘adapts’ to chronic alcohol exposure by increasing hormone‐dependent IP3 formation, leading to aberrant calcium increases, which may contribute to hepatocyte injury. PMID:28220501

Chronic alcohol feeding potentiates hormone-induced calcium signalling in hepatocytes.

PubMed

Bartlett, Paula J; Antony, Anil Noronha; Agarwal, Amit; Hilly, Mauricette; Prince, Victoria L; Combettes, Laurent; Hoek, Jan B; Gaspers, Lawrence D

2017-05-15

Chronic alcohol consumption causes a spectrum of liver diseases, but the pathogenic mechanisms driving the onset and progression of disease are not clearly defined. We show that chronic alcohol feeding sensitizes rat hepatocytes to Ca 2+ -mobilizing hormones resulting in a leftward shift in the concentration-response relationship and the transition from oscillatory to more sustained and prolonged Ca 2+ increases. Our data demonstrate that alcohol-dependent adaptation in the Ca 2+ signalling pathway occurs at the level of hormone-induced inositol 1,4,5 trisphosphate (IP 3 ) production and does not involve changes in the sensitivity of the IP 3 receptor or size of internal Ca 2+ stores. We suggest that prolonged and aberrant hormone-evoked Ca 2+ increases may stimulate the production of mitochondrial reactive oxygen species and contribute to alcohol-induced hepatocyte injury. ABSTRACT: 'Adaptive' responses of the liver to chronic alcohol consumption may underlie the development of cell and tissue injury. Alcohol administration can perturb multiple signalling pathways including phosphoinositide-dependent cytosolic calcium ([Ca 2+ ] i ) increases, which can adversely affect mitochondrial Ca 2+ levels, reactive oxygen species production and energy metabolism. Our data indicate that chronic alcohol feeding induces a leftward shift in the dose-response for Ca 2+ -mobilizing hormones resulting in more sustained and prolonged [Ca 2+ ] i increases in both cultured hepatocytes and hepatocytes within the intact perfused liver. Ca 2+ increases were initiated at lower hormone concentrations, and intercellular calcium wave propagation rates were faster in alcoholics compared to controls. Acute alcohol treatment (25 mm) completely inhibited hormone-induced calcium increases in control livers, but not after chronic alcohol-feeding, suggesting desensitization to the inhibitory actions of ethanol. Hormone-induced inositol 1,4,5 trisphosphate (IP 3 ) accumulation and phospholipase C (PLC) activity were significantly potentiated in hepatocytes from alcohol-fed rats compared to controls. Removal of extracellular calcium, or chelation of intracellular calcium did not normalize the differences in hormone-stimulated PLC activity, indicating calcium-dependent PLCs are not upregulated by alcohol. We propose that the liver 'adapts' to chronic alcohol exposure by increasing hormone-dependent IP 3 formation, leading to aberrant calcium increases, which may contribute to hepatocyte injury. © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.

Effects of β-hydroxy-β-methylbutyrate free acid and cold water immersion on expression of CR3 and MIP-1β following resistance exercise.

PubMed

Gonzalez, Adam M; Fragala, Maren S; Jajtner, Adam R; Townsend, Jeremy R; Wells, Adam J; Beyer, Kyle S; Boone, Carleigh H; Pruna, Gabriel J; Mangine, Gerald T; Bohner, Jonathan D; Fukuda, David H; Stout, Jeffrey R; Hoffman, Jay R

2014-04-01

The inflammatory response to muscle-damaging exercise requires monocyte mobilization and adhesion. Complement receptor type 3 (CR3) and macrophage inflammatory protein (MIP)-1β enables monocyte recruitment, adhesion, and subsequent infiltration into damaged muscle tissue. The purpose of this study was to examine the effects of cold water immersion (CWI) and/or β-hydroxy-β-methylbutyrate free acid (HMB-FA) on CR3 expression and MIP-1β concentration after four sets of up to 10 repetitions of squat, dead lift, and split squat exercises at 70-80% 1-repetition maximum. Thirty-nine resistance-trained men (22.2 ± 2.5 yr) were randomly divided into four groups: 1) placebo (PL), 2) HMB-FA, 3) HMB-FA-CWI, and 4) PL-CWI. The HMB-FA groups ingested 3 g/day, and CWI groups were submersed into 10-12°C water for 10 min after exercise. Blood was sampled at baseline (PRE), immediately post- (IP), 30 min post- (30P), 24 h post- (24P), and 48 h post (48P)-exercise. Circulating MIP-1β was assayed and CR3 expression on CD14+ monocytes was measured by flow cytometry. Without treatment, CR3 expression significantly elevated at 30P compared with other time points (P = 0.030-0.047). HMB-FA significantly elevated the percentage of monocytes expressing CR3 between IP and 24P (P = 0.046) and between IP and 48P (P = 0.046). No time effect was observed for MIP-1β concentration. The recovery modalities showed to attenuate the rise in CR3 following exercise. Additionally, supplementation with HMB-FA significantly elevated the percentage of monocytes expressing CR3 during recovery. Although the time course that inflammatory responses are most beneficial remains to be determined, recovery modalities may alter immune cell mobilization and adhesion mechanisms during tissue recovery.

Biosphere Reserve for All: Potentials for Involving Underrepresented Age Groups in the Development of a Biosphere Reserve through Intergenerational Practice.

PubMed

Mitrofanenko, Tamara; Snajdr, Julia; Muhar, Andreas; Penker, Marianne; Schauppenlehner-Kloyber, Elisabeth

2018-05-22

Stakeholder participation is of high importance in UNESCO biosphere reserves as model regions for sustainable development; however, certain groups remain underrepresented. The paper proposes Intergenerational Practice (IP) as a means of involving youth and elderly women and explores its options and barriers, using the example of the Salzburger Lungau and Kärntner Nockberge Biosphere Reserve in Austria. Case study analysis is used involving mixed methods. The results reveal obstacles and motivations to participating in biosphere reserve implementation and intergenerational activities for the youth and the elderly women and imply that much potential for IP exists in the biosphere reserve region. The authors propose suitable solutions from the intergenerational field to overcome identified participation obstacles and suggest benefits of incorporating IP as a management tool into biosphere reserve activities. Suggestions for future research include evaluating applications of IP in the context of protected areas, testing of methods used in other contexts, and contribution to theory development.

Sundstrand’s Precision Metal Forming Cell. Industrial Modernization Incentive Program (IMIP). Phase 2

DTIC Science & Technology

1991-03-01

1-2 1.4 CONCLUSIONS AND RECOMMENDATIONS ....................... 1-2 20. PHASE II MANAGEMENT PLAN...2-1 2.1 PROGRAM MANAGEMENT ................................... 2-1 2.2 IM IP TEAM...Barbier, reference Section 2.0 (Phase II Management Plan), is complete and this report provides the results of the Phase II study. 1.2 OBJECTIVES The

[Medical inventions: developments and approaches in employer-employee [correction of worker-employee] relations].

PubMed

Teff, Zvi

2012-11-01

The past twenty years have witnessed a huge increase in research activity on the government health system in Israel. Consequently, a number of questions of enhanced importance arise: to whom the resultant IP (intellectual property) belongs?--to the researcher or the employer? and what compensation should the researcher receive for his inventive efforts? The government found many cases where the IP was registered in the name of the inventor/researcher, thus denying the government ownership of the IP. In 2009, the government sued Omryx over ownership of such an IP. Following these developments, the government issued new rules for management of IP in the government health system. They came into effect in November 2010. In many respects, the new rules are more stringent than the Israeli Patent Law in respect of the inventor. However, the stipulation of awards to the inventor in the new rules is generous. In order for the new rules to be enforceable, the following guidelines are recommended: The new rules should be more aligned with the Patent Law and with the meaning given to the Law by the judicial system, and There is need for the assent and awareness of health system workers to the conditions set out in the new rules, preferably in the form of new work contracts that clearly and concurrently delineate the worker's duties, particularly those pertaining to IP.

Systemic synergism between codeine and morphine in three pain models in mice.

PubMed

Miranda, Hugo F; Noriega, Viviana; Zepeda, Ramiro J; Sierralta, Fernando; Prieto, Juan C

2013-01-01

The combination of two analgesic agents offers advantages in pain treatment. Codeine and morphine analgesia is due to activation of opioid receptor subtypes. This study, performed in mice using isobolographic analysis, evaluated the type of interaction in intraperitoneal (ip) or intrathecal (it) coadministration of codeine and morphine, in three nociceptive behavioral models. Intrathecal morphine resulted to be 7.5 times more potent than ip morphine in the writhing test, 55.6 times in the tail flick test and 1.7 times in phase II of the orofacial formalin test; however, in phase I of the same test ip was 1.2 times more potent than it morphine. Intrathecal codeine resulted being 3.4 times more potent than ip codeine in the writhing test, 1.6 times in the tail flick test, 2.5 times in phase I and 6.7 times in phase II of the orofacial formalin test. Opioid coadministration had a synergistic effect in the acute tonic pain (acetic acid writhing test), acute phasic pain (tail flick test) and inflammatory pain (orofacial formalin test). The interaction index ranged between 0.284 (writhing ip) and 0.440 (orofacial formalin phase II ip). This synergy may relate to the different pathways of pain transmission and to the different intracellular signal transduction. The present findings also raise the possibility of potential clinical advantages in combining opioids in pain management.

The influence of implantoplasty on the diameter, chemical surface composition, and biocompatibility of titanium implants.

PubMed

Schwarz, Frank; John, Gordon; Becker, Jürgen

2017-09-01

The objective of the study was to assess the influence of implantoplasty (IP) on the diameter, chemical surface composition, and biocompatibility of titanium implants in vitro. Twenty soft tissue-level (TL; machined transmucosal-M and rough endosseous part-SLA) and 20 bone-level (BL; SLA) implants were allocated to IP covering 3 or 6 mm of the structured surface (SLA) area. The samples were subjected to diameter, energy-dispersive X-ray spectroscopy (EDX), and cell viability (ginigval fibroblasts, 6 days) assessments. Median diameter reductions varied between 0.1 (TL 3 mm) and 0.2 mm (TL 6 mm). EDX analysis revealed that IP and M surfaces were characterized by a comparable quantity (Wt%) of elements C, O, Na, Cl, K, and Si, but a significantly different quantity of elements Ti and Al. When compared to SLA surfaces, significant differences were noted for elements C, O, Na, Ti, and Al. At BL implants, the extension of IP (i.e., 3 to 6 mm) was associated with a significant increase in cell viability. IP applied to SLA implants was associated with (i) a minimal diameter reduction, (ii) an undisturbed cell viability, and (iii) a chemical elemental composition comparable to M surfaces. This specific IP procedure appears to be suitable for the management of exposed SLA implant surfaces.

Infection prevention workforce: Potential benefits to educational diversity.

PubMed

Reese, Sara M; Gilmartin, Heather M

2017-06-01

Nurses have historically occupied the infection preventionist (IP) role. As the knowledge and skills needed to advance the field expand, professionals from public health and the laboratory sciences have become IPs. Our study describes the characteristics of current IPs and assesses for relationships between background, certification, experience, and type of work performed. The data were drawn from an existing dataset collected in the conduct of the Association for Professionals in Infection Control and Epidemiology (APIC) MegaSurvey. Descriptive statistics were computed. Associations were calculated using χ 2 or Cochran-Mantel-Haenszel tests. Characteristics of IPs were stratified by work-related activities to allow for comparisons between groups. Of the 13,050 active APIC members, 4,079 participated in the survey (31% response rate). The primary job activity for nurses (97.9%; n = 2,434) was preventing and controlling the transmission of infectious agents or health care-associated infections, for laboratory scientists (97.5%; n = 307) it was the interpretation of surveillance data, and for public health professionals (96.1%; n = 136) it was management and communication: feedback. Infection control departments would benefit from hiring IPs with diverse education and training to address the expanding roles and responsibilities of IPs. This may facilitate the implementation of novel and innovative processes that will impact patient care. Copyright © 2017 Association for Professionals in Infection Control and Epidemiology, Inc. All rights reserved.

Long-term Cerec 3D chairside bridges milled from IPS e.max CAD LT blocks.

PubMed

Schneider, Oliver

The experienced Cerec user can manufacture high-quality, esthetic anterior and posterior bridges from IPS e.max CAD in a manageable 3-hour chairside session. On the basis of over 8 years of experience, it can be said that these restorations are clinically very well proven, provided they are used within the range of recommended indications. Experimental retainer bridges with extensions can be seen as highly interesting alternatives, although more clinical data are required for further confirmation.

Workable solutions to FP in Africa.

PubMed

1991-12-01

The 3rd Pan African Conference on the Integrated Family Planning, Nutrition and Parasite Control Project (PANFRICO III) was held in October 1991 and organized by JOICFP, UNFPA and IPPF. The Ghana IP Steering Committee implemented it. In addition to the 5 IP implementing countries--Ethiopia, the Gambia, Ghana, Tanzania, and Zambia--other countries attending were: Kenya, Lesotho, Madagascar, Mali, Nigeria, Senegal, Sierra Leone, Swaziland, Togo, and Uganda. Governmental and nongovernmental organizations (NGOs) and international groups such as UNFPA, IPPF, FAO, and USAID also attended. The theme was seeking a strategic approach to family planning through primary health care. Participants resolved to increase the support and involvement of African governments in IP implementation. It was recognized that self-reliance, cost effectiveness, and efficient use of resources were important to sustainability. It was also agreed that IP should integrate family planning (FP) with Maternal and Child Health (MCH) and Primary Health Care (PHC) in order to overcome traditional and cultural obstacles to FP and to gain full participation of men in the communities. Horizontal integration was the primary thrust. there was agreement that there should be collaboration between UNFPA, IPPF, and JOICFP, and relevant governments and NGOs. Country-specific attention needs to be paid to expanding IP functions within the 5 IP countries. In Ghana, IP pilot areas have been successful in increasing the FP acceptance rate from 17.4% in 1988 to 51.9% in 1991. IP experiences in Indonesia were presented, including the concept of fee-charged PHC services in order to achieve self-reliance in FP/MCH projects. The response was the request for further technical cooperation between developing countries. The workshop activities were particularly beneficial, and requests were made for discussion of IEC, management, service delivery, nutrition, environmental sanitation, self-reliance, community participation, and evaluation. To further regional IP development within the country, it was suggested that national workshops be held. It was emphasized that FP and population are basic elements of socioeconomic development.

The complete genome sequence of Yersinia pseudotuberculosis IP31758, the causative agent of Far East scarlet-like fever.

PubMed

Eppinger, Mark; Rosovitz, M J; Fricke, Wolfgang Florian; Rasko, David A; Kokorina, Galina; Fayolle, Corinne; Lindler, Luther E; Carniel, Elisabeth; Ravel, Jacques

2007-08-01

The first reported Far East scarlet-like fever (FESLF) epidemic swept the Pacific coastal region of Russia in the late 1950s. Symptoms of the severe infection included erythematous skin rash and desquamation, exanthema, hyperhemic tongue, and a toxic shock syndrome. The term FESLF was coined for the infection because it shares clinical presentations with scarlet fever caused by group A streptococci. The causative agent was later identified as Yersinia pseudotuberculosis, although the range of morbidities was vastly different from classical pseudotuberculosis symptoms. To understand the origin and emergence of the peculiar clinical features of FESLF, we have sequenced the genome of the FESLF-causing strain Y. pseudotuberculosis IP31758 and compared it with that of another Y. pseudotuberculosis strain, IP32953, which causes classical gastrointestinal symptoms. The unique gene pool of Y pseudotuberculosis IP31758 accounts for more than 260 strain-specific genes and introduces individual physiological capabilities and virulence determinants, with a significant proportion horizontally acquired that likely originated from Enterobacteriaceae and other soil-dwelling bacteria that persist in the same ecological niche. The mobile genome pool includes two novel plasmids phylogenetically unrelated to all currently reported Yersinia plasmids. An icm/dot type IVB secretion system, shared only with the intracellular persisting pathogens of the order Legionellales, was found on the larger plasmid and could contribute to scarlatinoid fever symptoms in patients due to the introduction of immunomodulatory and immunosuppressive capabilities. We determined the common and unique traits resulting from genome evolution and speciation within the genus Yersinia and drew a more accurate species border between Y. pseudotuberculosis and Y. pestis. In contrast to the lack of genetic diversity observed in the evolutionary young descending Y. pestis lineage, the population genetics of Y. pseudotuberculosis is more heterogenous. Both Y. pseudotuberculosis strains IP31758 and the previously sequenced Y. pseudotuberculosis strain IP32953 have evolved by the acquisition of specific plasmids and by the horizontal acquisition and incorporation of different genetic information into the chromosome, which all together or independently seems to potentially impact the phenotypic adaptation of these two strains.

The Complete Genome Sequence of Yersinia pseudotuberculosis IP31758, the Causative Agent of Far East Scarlet-Like Fever

PubMed Central

Eppinger, Mark; Rosovitz, M. J; Fricke, Wolfgang Florian; Rasko, David A; Kokorina, Galina; Fayolle, Corinne; Lindler, Luther E; Carniel, Elisabeth; Ravel, Jacques

2007-01-01

The first reported Far East scarlet-like fever (FESLF) epidemic swept the Pacific coastal region of Russia in the late 1950s. Symptoms of the severe infection included erythematous skin rash and desquamation, exanthema, hyperhemic tongue, and a toxic shock syndrome. The term FESLF was coined for the infection because it shares clinical presentations with scarlet fever caused by group A streptococci. The causative agent was later identified as Yersinia pseudotuberculosis, although the range of morbidities was vastly different from classical pseudotuberculosis symptoms. To understand the origin and emergence of the peculiar clinical features of FESLF, we have sequenced the genome of the FESLF-causing strain Y. pseudotuberculosis IP31758 and compared it with that of another Y. pseudotuberculosis strain, IP32953, which causes classical gastrointestinal symptoms. The unique gene pool of Y pseudotuberculosis IP31758 accounts for more than 260 strain-specific genes and introduces individual physiological capabilities and virulence determinants, with a significant proportion horizontally acquired that likely originated from Enterobacteriaceae and other soil-dwelling bacteria that persist in the same ecological niche. The mobile genome pool includes two novel plasmids phylogenetically unrelated to all currently reported Yersinia plasmids. An icm/dot type IVB secretion system, shared only with the intracellular persisting pathogens of the order Legionellales, was found on the larger plasmid and could contribute to scarlatinoid fever symptoms in patients due to the introduction of immunomodulatory and immunosuppressive capabilities. We determined the common and unique traits resulting from genome evolution and speciation within the genus Yersinia and drew a more accurate species border between Y. pseudotuberculosis and Y. pestis. In contrast to the lack of genetic diversity observed in the evolutionary young descending Y. pestis lineage, the population genetics of Y. pseudotuberculosis is more heterogenous. Both Y. pseudotuberculosis strains IP31758 and the previously sequenced Y. pseudotuberculosis strain IP32953 have evolved by the acquisition of specific plasmids and by the horizontal acquisition and incorporation of different genetic information into the chromosome, which all together or independently seems to potentially impact the phenotypic adaptation of these two strains. PMID:17784789

Inhibitory Effects of Cytosolic Ca(2+) Concentration by Ginsenoside Ro Are Dependent on Phosphorylation of IP3RI and Dephosphorylation of ERK in Human Platelets.

PubMed

Kwon, Hyuk-Woo; Shin, Jung-Hae; Lee, Dong-Ha; Park, Hwa-Jin

2015-01-01

Intracellular Ca(2+) ([Ca(2+)] i ) is platelet aggregation-inducing molecule and is involved in activation of aggregation associated molecules. This study was carried out to understand the Ca(2+)-antagonistic effect of ginsenoside Ro (G-Ro), an oleanane-type saponin in Panax ginseng. G-Ro, without affecting leakage of lactate dehydrogenase, dose-dependently inhibited thrombin-induced platelet aggregation, and the half maximal inhibitory concentration was approximately 155 μM. G-Ro inhibited strongly thrombin-elevated [Ca(2+)] i , which was strongly increased by A-kinase inhibitor Rp-8-Br-cAMPS compared to G-kinase inhibitor Rp-8-Br-cGMPS. G-Ro increased the level of cAMP and subsequently elevated the phosphorylation of inositol 1, 4, 5-triphosphate receptor I (IP3RI) (Ser(1756)) to inhibit [Ca(2+)] i mobilization in thrombin-induced platelet aggregation. Phosphorylation of IP3RI (Ser(1756)) by G-Ro was decreased by PKA inhibitor Rp-8-Br-cAMPS. In addition, G-Ro inhibited thrombin-induced phosphorylation of ERK 2 (42 kDa), indicating inhibition of Ca(2+) influx across plasma membrane. We demonstrate that G-Ro upregulates cAMP-dependent IP3RI (Ser(1756)) phosphorylation and downregulates phosphorylation of ERK 2 (42 kDa) to decrease thrombin-elevated [Ca(2+)] i , which contributes to inhibition of ATP and serotonin release, and p-selectin expression. These results indicate that G-Ro in Panax ginseng is a beneficial novel Ca(2+)-antagonistic compound and may prevent platelet aggregation-mediated thrombotic disease.

Informing the Design and Evaluation of Superuser Care Management Initiatives: Accounting for Regression-to-the-Mean.

PubMed

Chakravarty, Sujoy; Cantor, Joel C

2016-09-01

Health care spending is concentrated among a small number of high-cost patients, and the popularity of initiatives to improve care and reduce cost among such "superusers" (SUs) is growing. However, SU costs decline naturally over time, even without intervention, a statistical phenomenon known as regression-to-the-mean (RTM). We assess the magnitude of RTM in hospital costs for cohorts of hospital SUs identified on the basis of high inpatient (IP) or emergency department (ED) utilization. We further examine how cost and RTM are associated with patient characteristics including behavioral health (BH) problems, multiple chronic conditions, and indicators of vulnerability. Using longitudinally linked all-payer hospital billing data, we selected patient cohorts with ≥2 IP stays (IP SUs) or ≥6 ED visits (ED SUs) during a 6-month baseline period, and additional subgroups defined by combinations of IP and ED superuse. A total of 289,060 NJ hospital IP and treat-and-release ED patients over 2009-2011. Hospital costs among IP and ED SUs declined 70% and 38%, respectively, over 8 quarters following the baseline period. The decrease occurs more quickly for IP SUs compared with ED SUs. Presence of BH problems was positively associated with costs among patients overall, but the relationship varied by SU cohort. Understanding patterns of RTM among SU populations is important for designing intervention strategies, as there is greater potential for savings among patients with more persistent costs (less RTM). Further, as many SU initiatives lack resources for rigorous evaluation, quantifying the extent of RTM is vital for interpreting program outcomes.

A Novel Resource Management Method of Providing Operating System as a Service for Mobile Transparent Computing

PubMed Central

Huang, Suzhen; Wu, Min; Zhang, Yaoxue; She, Jinhua

2014-01-01

This paper presents a framework for mobile transparent computing. It extends the PC transparent computing to mobile terminals. Since resources contain different kinds of operating systems and user data that are stored in a remote server, how to manage the network resources is essential. In this paper, we apply the technologies of quick emulator (QEMU) virtualization and mobile agent for mobile transparent computing (MTC) to devise a method of managing shared resources and services management (SRSM). It has three layers: a user layer, a manage layer, and a resource layer. A mobile virtual terminal in the user layer and virtual resource management in the manage layer cooperate to maintain the SRSM function accurately according to the user's requirements. An example of SRSM is used to validate this method. Experiment results show that the strategy is effective and stable. PMID:24883353

A novel resource management method of providing operating system as a service for mobile transparent computing.

PubMed

Xiong, Yonghua; Huang, Suzhen; Wu, Min; Zhang, Yaoxue; She, Jinhua

2014-01-01

This paper presents a framework for mobile transparent computing. It extends the PC transparent computing to mobile terminals. Since resources contain different kinds of operating systems and user data that are stored in a remote server, how to manage the network resources is essential. In this paper, we apply the technologies of quick emulator (QEMU) virtualization and mobile agent for mobile transparent computing (MTC) to devise a method of managing shared resources and services management (SRSM). It has three layers: a user layer, a manage layer, and a resource layer. A mobile virtual terminal in the user layer and virtual resource management in the manage layer cooperate to maintain the SRSM function accurately according to the user's requirements. An example of SRSM is used to validate this method. Experiment results show that the strategy is effective and stable.

Realtime Gas Emission Monitoring at Hazardous Sites Using a Distributed Point-Source Sensing Infrastructure

PubMed Central

Manes, Gianfranco; Collodi, Giovanni; Gelpi, Leonardo; Fusco, Rosanna; Ricci, Giuseppe; Manes, Antonio; Passafiume, Marco

2016-01-01

This paper describes a distributed point-source monitoring platform for gas level and leakage detection in hazardous environments. The platform, based on a wireless sensor network (WSN) architecture, is organised into sub-networks to be positioned in the plant’s critical areas; each sub-net includes a gateway unit wirelessly connected to the WSN nodes, hence providing an easily deployable, stand-alone infrastructure featuring a high degree of scalability and reconfigurability. Furthermore, the system provides automated calibration routines which can be accomplished by non-specialized maintenance operators without system reliability reduction issues. Internet connectivity is provided via TCP/IP over GPRS (Internet standard protocols over mobile networks) gateways at a one-minute sampling rate. Environmental and process data are forwarded to a remote server and made available to authenticated users through a user interface that provides data rendering in various formats and multi-sensor data fusion. The platform is able to provide real-time plant management with an effective; accurate tool for immediate warning in case of critical events. PMID:26805832

Enabling private and public sector organizations as agents of homeland security

NASA Astrophysics Data System (ADS)

Glassco, David H. J.; Glassco, Jordan C.

2006-05-01

Homeland security and defense applications seek to reduce the risk of undesirable eventualities across physical space in real-time. With that functional requirement in mind, our work focused on the development of IP based agent telecommunication solutions for heterogeneous sensor / robotic intelligent "Things" that could be deployed across the internet. This paper explains how multi-organization information and device sharing alliances may be formed to enable organizations to act as agents of homeland security (in addition to other uses). Topics include: (i) using location-aware, agent based, real-time information sharing systems to integrate business systems, mobile devices, sensor and actuator based devices and embedded devices used in physical infrastructure assets, equipment and other man-made "Things"; (ii) organization-centric real-time information sharing spaces using on-demand XML schema formatted networks; (iii) object-oriented XML serialization as a methodology for heterogeneous device glue code; (iv) how complex requirements for inter / intra organization information and device ownership and sharing, security and access control, mobility and remote communication service, tailored solution life cycle management, service QoS, service and geographic scalability and the projection of remote physical presence (through sensing and robotics) and remote informational presence (knowledge of what is going elsewhere) can be more easily supported through feature inheritance with a rapid agent system development methodology; (v) how remote object identification and tracking can be supported across large areas; (vi) how agent synergy may be leveraged with analytics to complement heterogeneous device networks.

LoWMob: Intra-PAN Mobility Support Schemes for 6LoWPAN

PubMed Central

Bag, Gargi; Raza, Muhammad Taqi; Kim, Ki-Hyung; Yoo, Seung-Wha

2009-01-01

Mobility in 6LoWPAN (IPv6 over Low Power Personal Area Networks) is being utilized in realizing many applications where sensor nodes, while moving, sense and transmit the gathered data to a monitoring server. By employing IEEE802.15.4 as a baseline for the link layer technology, 6LoWPAN implies low data rate and low power consumption with periodic sleep and wakeups for sensor nodes, without requiring them to incorporate complex hardware. Also enabling sensor nodes with IPv6 ensures that the sensor data can be accessed anytime and anywhere from the world. Several existing mobility-related schemes like HMIPv6, MIPv6, HAWAII, and Cellular IP require active participation of mobile nodes in the mobility signaling, thus leading to the mobility-related changes in the protocol stack of mobile nodes. In this paper, we present LoWMob, which is a network-based mobility scheme for mobile 6LoWPAN nodes in which the mobility of 6LoWPAN nodes is handled at the network-side. LoWMob ensures multi-hop communication between gateways and mobile nodes with the help of the static nodes within a 6LoWPAN. In order to reduce the signaling overhead of static nodes for supporting mobile nodes, LoWMob proposes a mobility support packet format at the adaptation layer of 6LoWPAN. Also we present a distributed version of LoWMob, named as DLoWMob (or Distributed LoWMob), which employs Mobility Support Points (MSPs) to distribute the traffic concentration at the gateways and to optimize the multi-hop routing path between source and destination nodes in a 6LoWPAN. Moreover, we have also discussed the security considerations for our proposed mobility schemes. The performance of our proposed schemes is evaluated in terms of mobility signaling costs, end-to-end delay, and packet success ratio. PMID:22346730

LoWMob: Intra-PAN Mobility Support Schemes for 6LoWPAN.

PubMed

Bag, Gargi; Raza, Muhammad Taqi; Kim, Ki-Hyung; Yoo, Seung-Wha

2009-01-01

Mobility in 6LoWPAN (IPv6 over Low Power Personal Area Networks) is being utilized in realizing many applications where sensor nodes, while moving, sense and transmit the gathered data to a monitoring server. By employing IEEE802.15.4 as a baseline for the link layer technology, 6LoWPAN implies low data rate and low power consumption with periodic sleep and wakeups for sensor nodes, without requiring them to incorporate complex hardware. Also enabling sensor nodes with IPv6 ensures that the sensor data can be accessed anytime and anywhere from the world. Several existing mobility-related schemes like HMIPv6, MIPv6, HAWAII, and Cellular IP require active participation of mobile nodes in the mobility signaling, thus leading to the mobility-related changes in the protocol stack of mobile nodes. In this paper, we present LoWMob, which is a network-based mobility scheme for mobile 6LoWPAN nodes in which the mobility of 6LoWPAN nodes is handled at the network-side. LoWMob ensures multi-hop communication between gateways and mobile nodes with the help of the static nodes within a 6LoWPAN. In order to reduce the signaling overhead of static nodes for supporting mobile nodes, LoWMob proposes a mobility support packet format at the adaptation layer of 6LoWPAN. Also we present a distributed version of LoWMob, named as DLoWMob (or Distributed LoWMob), which employs Mobility Support Points (MSPs) to distribute the traffic concentration at the gateways and to optimize the multi-hop routing path between source and destination nodes in a 6LoWPAN. Moreover, we have also discussed the security considerations for our proposed mobility schemes. The performance of our proposed schemes is evaluated in terms of mobility signaling costs, end-to-end delay, and packet success ratio.

People are satisfied with it.

PubMed

Hata, K

1992-08-01

The success of the integrated Family Planning (FP) and Parasite Control Project (IP) of Indonesia is discussed in terms of the government's view, the major characteristics of IP, the major problem, future funding sources, the purposes of community participation, obstacles encountered, and impact. Ministry policymakers consider IP effective and desirable, and suggest IP in remote areas with poor infrastructure such as Lombok in West Nusa Tenggara Province. Health is improved for parents and children initially. The project is self-reliant with small, affordable fees. Support has come from the Indonesian Planned Parenthood Association and Kusuma Buana Foundation; although external financial assistance has ceased, expansion is possible with the income generated. The Jakarta Municipal government may pick up the cost of implementing it through the public health center Pukesmas, either with existing project staff or local staff in collaboration with IP staff. The government is not ready to implement it because control of intestinal parasites is of low priority. Major problems are the uneven performance particularly in IP bases in Jakarta, which is attributed to lack of concern by managers for community health conditions. Community participation is important because people are eager to learn how to prevent the parasitic invasions after being successfully treated. When success in cleaning houses and toilets and lower incidence of infection is accomplished, then people trust and use the health services more. Obstacles have been the cost of building hygienic latrines and access to safe and potable water, particularly in slum areas of Jakarta, and changing institutional representation on the IP project National Coordinating Forum, the IP policy making group, and officials from government FP and Health and Education Departments. Government officials need to understand the intricacies of how IP operates. Evaluation is difficult with measures such as the fertility rate or infant mortality rate. Project staff are satisfied with the increase in health consciousness of clients, and the use of paid services. A study by the Forum found that FP participation among the target community increased compared with baseline data, but FP information is available from multiple sources in Jakarta and it would be presumptuous to believe that community participation was solely due to IP.

Research of Ad Hoc Networks Access Algorithm

NASA Astrophysics Data System (ADS)

Xiang, Ma

With the continuous development of mobile communication technology, Ad Hoc access network has become a hot research, Ad Hoc access network nodes can be used to expand capacity of multi-hop communication range of mobile communication system, even business adjacent to the community, improve edge data rates. When the ad hoc network is the access network of the internet, the gateway discovery protocol is very important to choose the most appropriate gateway to guarantee the connectivity between ad hoc network and IP based fixed networks. The paper proposes a QoS gateway discovery protocol which uses the time delay and stable route to the gateway selection conditions. And according to the gateway discovery protocol, it also proposes a fast handover scheme which can decrease the handover time and improve the handover efficiency.

A Mobile IPv6 based Distributed Mobility Management Mechanism of Mobile Internet

NASA Astrophysics Data System (ADS)

Yan, Shi; Jiayin, Cheng; Shanzhi, Chen

A flatter architecture is one of the trends of mobile Internet. Traditional centralized mobility management mechanism faces the challenges such as scalability and UE reachability. A MIPv6 based distributed mobility management mechanism is proposed in this paper. Some important network entities and signaling procedures are defined. UE reachability is also considered in this paper through extension to DNS servers. Simulation results show that the proposed approach can overcome the scalability problem of the centralized scheme.

Automated Cartography by an Autonomous Mobile Robot Using Ultrasonic Range Finders

DTIC Science & Technology

1993-09-01

loco.c Temporal Type: Sequential Function (xd, yd, td, 0) dirctix vehicle fou TP S~obstacle IP EP Figure A.24 - The para function Move to a... tp (type POINT), and type (type int). In the case of an fline func- tion, the path element returned is a cubic spiral or an sline depending on the...geu~nst-> tp )) I --no_o...paths; currentsroboLpath.pc = get inst->c; currentLrobot...path.type = getLinst->class; readjinsto; )*end if * if (skipjflag

IPV6 Mobile Network Protocol Weaknesses and a Cryptosystem Approach

NASA Astrophysics Data System (ADS)

Balitanas, Maricel; Kim, Tai-Hoon

This paper reviews some of the improvements associated with the new Internet protocol version 6, an emphasis on its security-related functionality particularly in its authentication and concludes with a hybrid cryptosystem for its authentication issue. Since new generation of Internet protocol is on its way to solve the growth of IP address depletion. It is in a process that may take several years to complete. Thus, as a step to effective solution and efficient implementation this review has been made.

Fire management assessment of Eastern Province, Zambia

Treesearch

L. T. Hollingsworth; D. Johnson; G. Sikaundi; S. Siame

2015-01-01

The mission that produced this assessment was prompted by requests from Forestry Department personnel in Zambia to the United States Agency for International Development (USAID) for formal fire management training. USAID contacted the United States Forest Service's (USFS) International Programs (IP) with the training request. Together, USFS, USAID, and Zambian...

Study of mobile satellite network based on GEO/LEO satellite constellation

NASA Astrophysics Data System (ADS)

Hu, Xiulin; Zeng, Yujiang; Wang, Ying; Wang, Xianhui

2005-11-01

Mobile satellite network with Inter Satellite Links (ISLs), which consists of non-geostationary satellites, has the characteristic of network topology's variability. This is a great challenge to the design and management of mobile satellite network. This paper analyzes the characteristics of mobile satellite network, takes multimedia Quality of Service (QoS) as the chief object and presents a reference model based on Geostationary Earth Orbit (GEO)/ Low Earth Orbit (LEO) satellite constellation which adapts to the design and management of mobile satellite network. In the reference model, LEO satellites constitute service subnet with responsibility for the access, transmission and switch of the multimedia services for mobile users, while GEO satellites constitute management subnet taking on the centralized management to service subnet. Additionally ground control centre realizes the whole monitoring and control via management subnet. Comparing with terrestrial network, the above reference model physically separates management subnet from service subnet, which not only enhances the advantage of centralized management but also overcomes the shortcoming of low reliability in terrestrial network. Routing of mobile satellite network based on GEO/LEO satellite constellation is also discussed in this paper.

The situation of waste mobile phone management in developed countries and development status in China.

PubMed

Xu, Chengjian; Zhang, Wenxuan; He, Wenzhi; Li, Guangming; Huang, Juwen

2016-12-01

With the rapid development of electronic industry and improvement of living standards, a large number of waste mobile phones were generated. According to statistics, approximately 400million waste mobile phones are generated each year in the world, and 25% of that are contributed by China. Irregular disposal of waste mobile phones will do great harm to environment and human health, while at the same time recycling of them has the potential for high profits. Given the enormous quantity, great harm and resource properties, developed countries have taken necessary measures to manage waste mobile phones. As the largest developing country, China has also set out to pay close attention to waste mobile phones. This paper reviewed the situation ofwaste mobile phone management in the developed countries, focused on the development of waste mobile phone management in China, and analyzed existing problems. In light of the successful experience of the developed countries, some suggestions were proposed to promote the waste mobile phone management in China and worked as a valuable reference for other countries. Copyright © 2016 Elsevier Ltd. All rights reserved.

Voice over internet protocol with prepaid calling card solutions

NASA Astrophysics Data System (ADS)

Gunadi, Tri

2001-07-01

The VoIP technology is growing up rapidly, it has big network impact on PT Telkom Indonesia, the bigger telecommunication operator in Indonesia. Telkom has adopted VoIP and one other technology, Intelligent Network (IN). We develop those technologies together in one service product, called Internet Prepaid Calling Card (IPCC). IPCC is becoming new breakthrough for the Indonesia telecommunication services especially on VoIP and Prepaid Calling Card solutions. Network architecture of Indonesia telecommunication consists of three layer, Local, Tandem and Trunck Exchange layer. Network development researches for IPCC architecture are focus on network overlay hierarchy, Internet and PSTN. With this design hierarchy the goal of Interworking PSTN, VoIP and IN calling card, become reality. Overlay design for IPCC is not on Trunck Exchange, this is the new architecture, these overlay on Tandem and Local Exchange, to make the faster call processing. The nodes added: Gateway (GW) and Card Management Center (CMC) The GW do interfacing between PSTN and Internet Network used ISDN-PRA and Ethernet. The other functions are making bridge on circuit (PSTN) with packet (VoIP) based and real time billing process. The CMC used for data storage, pin validation, report activation, tariff system, directory number and all the administration transaction. With two nodes added the IPCC service offered to the market.

Application of Mobile Router to Military Communications

NASA Technical Reports Server (NTRS)

Stewart, David H.; Ivancic, William D.; Bell, Terry L.; Kachmar, Brian A.; Shell, Dan; Leung, Kent

2002-01-01

Cisco Systems and NASA Glenn Research Center under a NASA Space Act Agreement have been performing joint networking research to apply Internet technologies and protocols to space-based communications. During this time, Cisco Systems developed the mobile-router which NASA and Cisco jointly tested. The early field trials of this technology have been successfully completed. The mobile-router is software code that resides in a network router. A Mobile-Router allows entire networks to roam while maintaining connectivity to the Internet. This router code is pertinent to a myriad of applications for both the government and commercial sectors. This technology will be applied to the wireless battlefield. NASA and the Department of Defense will utilize this technology for near-planetary observation and sensing spacecraft. It is the enabling technology for communication via the Internet or Intranets to aircraft. Information such as weather, air traffic control, voice and video can be easily and inexpensively transmitted to the aircraft using Internet protocols. The mobile router can be incorporated into emergency vehicles particularly ambulances and life-flight aircraft to provide real-time connectivity back to the hospital and healthcare experts. Commercial applications include entertainment services, IP telephone, and Internet connectivity for cruise ships, commercial shipping, tour busses, aircraft, and eventually cars. This paper will briefly describe the mobile router operation. An upcoming wide area network field test with application to US Coast Guard communications will be described. The paper will also highlight military and government networks that will benefit from the deployment of mobile router and the associated applications.

Exploring perceptions of occupational competence among participants in Individual Placement and Support (IPS).

PubMed

Nygren, Ulla; Sandlund, Mikael; Bernspång, Birgitta; Fisher, Anne G

2013-11-01

The purpose of this study was to explore perceptions of occupational competence and occupational value among a group of clients engaged in Individual Placement and Support (IPS). The Occupational Self-Assessment (OSA), based on the Model of Human Occupation, was used with 65 men and women with mental illness, and 45 of these completed the study. Rasch analyses showed that the participants perceived "Managing my finances", "Managing my basic needs", and "Doing activities I like" as the most valued occupations. Most competence was perceived in "Taking care of myself". Among the occupations where the participants perceived least competence, "Getting done what I need to do" and "Accomplishing what I set out to do" were the occupations that most stand out. Significant differences were also found between perceived competence and value in most of the occupations. Beyond those occupations valued as most important among the participants, it is essential also to pay attention to those in which they perceived least competence, as they are important for being able to achieve a desired occupation. Support related to perceptions of occupational competence can contribute to enabling clients in IPS to master a desired working life.

The meaning and experience of stress among supported employment clients with mental health problems.

PubMed

Besse, Christine; Poremski, Daniel; Laliberté, Vincent; Latimer, Eric

2018-05-01

Many clinicians are concerned that competitive work may cause excessive stress for people with severe mental health problems. Individual Placement and Support (IPS) is acknowledged as the most effective model of supported employment for this population. The manner in which IPS clients define and experience employment-related stress is poorly understood. This qualitative study aims to explore how people with mental health problems receiving IPS services define and experience employment-related stress. We purposively sampled and interviewed 16 clients of an IPS programme, who had been competitively employed for more than 1 month. Data were collected between September 2014 and July 2015 in Montreal, Canada. Transcripts of semi-structured interviews were analysed using grounded theory methodology. IPS clients often defined stress similar to its common understanding: the result of experiencing prolonged or/and cumulative strains, or of an incongruence between efforts and rewards, hopes and reality. Stress experienced in this way could exacerbate psychiatric symptoms, especially depression or psychotic symptoms. However, when maintained at a more manageable level, stress stimulated learning and improved planning of tasks. Participants described different coping mechanisms, such as sharing their experiences and difficulties with others, focusing on problem resolution and avoidance. The first two of these helped IPS clients remain at work and bolstered their confidence. Work-related stress has potentially positive as well as negative consequences for IPS clients. In order to maximise the potential beneficial effects of stress, employment specialists can help clients anticipate potential stressors and plan how they might cope with them. Further research on the most effective ways of helping clients cope with stress is needed. © 2017 John Wiley & Sons Ltd.

Chromatin immunoprecipitation (ChIP) method for non-model fruit flies (Diptera: Tephritidae) and evidence of histone modifications.

PubMed

Nagalingam, Kumaran; Lorenc, Michał T; Manoli, Sahana; Cameron, Stephen L; Clarke, Anthony R; Dudley, Kevin J

2018-01-01

Interactions between DNA and proteins located in the cell nucleus play an important role in controlling physiological processes by specifying, augmenting and regulating context-specific transcription events. Chromatin immunoprecipitation (ChIP) is a widely used methodology to study DNA-protein interactions and has been successfully used in various cell types for over three decades. More recently, by combining ChIP with genomic screening technologies and Next Generation Sequencing (e.g. ChIP-seq), it has become possible to profile DNA-protein interactions (including covalent histone modifications) across entire genomes. However, the applicability of ChIP-chip and ChIP-seq has rarely been extended to non-model species because of a number of technical challenges. Here we report a method that can be used to identify genome wide covalent histone modifications in a group of non-model fruit fly species (Diptera: Tephritidae). The method was developed by testing and refining protocols that have been used in model organisms, including Drosophila melanogaster. We demonstrate that this method is suitable for a group of economically important pest fruit fly species, viz., Bactrocera dorsalis, Ceratitis capitata, Zeugodacus cucurbitae and Bactrocera tryoni. We also report an example ChIP-seq dataset for B. tryoni, providing evidence for histone modifications in the genome of a tephritid fruit fly for the first time. Since tephritids are major agricultural pests globally, this methodology will be a valuable resource to study taxa-specific evolutionary questions and to assist with pest management. It also provides a basis for researchers working with other non-model species to undertake genome wide DNA-protein interaction studies.

Hydroethanolic extract of Carthamus tinctorius induces antidepressant-like effects: modulation by dopaminergic and serotonergic systems in tail suspension test in mice.

PubMed

Abbasi-Maleki, Saeid; Mousavi, Zahra

2017-09-01

Studies indicate that major deficiency in the levels of monoaminergic transmitters is a reason for severe depression. On the other hand, it is shown that Carthamus tinctorius L. (CT) may improve neuropsychological injuries by regulation of the monoamine transporter action. Hence, the present study was undertaken to evaluate the involvement of monoaminergic systems in antidepressant-like effect of CT extract in the tail suspension test (TST) in mice. The mice were intraperitoneally (IP) treated with CT extract (100-400 mg/kg) 1 hr before the TST. To investigate the involvement of monoaminergic systems in antidepressant-like effect, the mice were treated with receptor antagonists 15 min before CT extract treatment (400 mg/kg, IP) and 1 hr before the TST. Findings showed that CT extract (100-400 mg/kg, IP), dose-dependently induced antidepressant-like effect ( P <0.001), but it was not accompanied by alterations in spontaneous locomotor activity in the open-field test. Pretreatment of mice with SCH23390, sulpiride, haloperidol, WAY100135, cyproheptadine, ketanserin and p-chlorophenylalanine (PCPA) inhibited the antidepressant-like effect of CT extract (400 mg/kg, IP), but not with prazosin and yohimbine. Co-administration of CT extract (100 mg/kg, IP) with sub-effective doses of fluoxetine (5 mg/kg, IP) or imipramine (5 mg/kg, IP) increased their antidepressant-like response. Our findings firstly showed that components (especially N-Hexadecanoic acid) of CT extract induce antidepressant-like effects by interaction with dopaminergic (D1 and D2) and serotonergic (5HT1A, 5-HT2A receptors) systems. These findings validate the folk use of CT extract for the management of depression.

Work-related thumb pain in physiotherapists is associated with thumb alignment during performance of PA pressures.

PubMed

Wajon, Anne; Ada, Louise; Refshauge, Kathryn

2007-02-01

Pain is common in the thumbs of physiotherapists. The purpose of this observational study was to investigate whether there is an association between the alignment of the thumb during performance of postero-anterior (PA) pressures and the presence of thumb pain. One hundred and twenty-nine physiotherapists who attended the Musculoskeletal Physiotherapy Association Conference (2003) participated. After providing a history of any work-related thumb pain, participants applied a PA pressure mimicking the technique they would use on a cervical spine, while the position of their metacarpophalangeal (MP) and interphalangeal (IP) joints was photographed. There was an association (p<0.05) between work-related thumb pain and alignment of the thumb during performance of PA pressures: participants who were able to maintain their MP and IP joints in extension were less likely to report pain. These findings serve as a guide to the safe performance of mobilization techniques, both for beginning practitioners and for experienced therapists complaining of thumb pain.

In-plane g factor of low-density two-dimensional holes in a Ge quantum well.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Tzu-Ming; Harris, Charles Thomas; Huang, Shih-Hsien

High-mobility two-dimensional (2D) holes residing in a Ge quantum well are a new electronic system with potentials in quantum computing and spintronics. Since for any electronic material, the effective mass and the g factor are two fundamental material parameters that determine the material response to electric and magnetic fields, measuring these two parameters in this material system is thus an important task that needs to be completed urgently. Because of the quantum confinement in the crystal growth direction (z), the biaxial strain of epitaxial Ge on SiGe, and the valance band nature, both the effective mass and the g factormore » can show very strong anisotropy. In particular, the in-plane g factor (g ip) can be vanishingly small while the perpendicular g factor (g z) can be much larger than 2. Here we report the measurement of g ip at very low hole densities using in-plane magneto-resistance measurement performed at the NHMFL.« less

Operating a terrestrial Internet router onboard and alongside a small satellite

NASA Astrophysics Data System (ADS)

Wood, L.; da Silva Curiel, A.; Ivancic, W.; Hodgson, D.; Shell, D.; Jackson, C.; Stewart, D.

2006-07-01

After twenty months of flying, testing and demonstrating a Cisco mobile access router, originally designed for terrestrial use, onboard the low-Earth-orbiting UK-DMC satellite as part of a larger merged ground/space IP-based internetwork, we use our experience to examine the benefits and drawbacks of integration and standards reuse for small satellite missions. Benefits include ease of operation and the ability to leverage existing systems and infrastructure designed for general use with a large set of latent capabilities to draw on when needed, as well as the familiarity that comes from reuse of existing, known, and well-understood security and operational models. Drawbacks include cases where integration work was needed to bridge the gaps in assumptions between different systems, and where performance considerations outweighed the benefits of reuse of pre-existing file transfer protocols. We find similarities with the terrestrial IP networks whose technologies have been taken to small satellites—and also some significant differences between the two in operational models and assumptions that must be borne in mind.

Infusing informatics into interprofessional education: the iTEAM (Interprofessional Technology Enhanced Advanced practice Model) project.

PubMed

Skiba, Diane J; Barton, Amy J; Knapfel, Sarah; Moore, Gina; Trinkley, Katy

2014-01-01

The iTEAM goal is to prepare advanced practice nurses, physicians and pharmacists with the interprofessional (IP) core competencies (informatics, patient centric, quality-focused, evidence based care) to provide technology enhanced collaborative care by: offering technology enhanced learning opportunities through a required informatics course, advanced practice courses (team based experiences with both standardized and virtual patients) and team based clinical experiences including e-health experiences. The innovative features of iTEAM project will be achieved through use of social media strategies, a web accessible Electronic Health Records (EHRs) system, a Virtual Clinic/Hospital in Second Life, various e-health applications including traditional telehealth tools and consumer oriented tools such as patient portals, social media consumer groups and mobile health (m-health) applications for health and wellness functions. It builds upon the schools' rich history of IP education and includes clinical partners, such as the VA and other clinical sites focused on care for underserved patient populations.

Temperature dependence of the positronium yields in polar and nonpolar pure liquids; an experimental test of a phenomenological model

NASA Astrophysics Data System (ADS)

Lévay, B.

2004-08-01

A phenomenological model describing the temperature dependence of the positronium yields ( IPs, %) was tested in pure liquids of different polarity. The investigated solvents were: m-xylene (m-Xy) and iso-octane (i-C8) as aromatic and aliphatic nonpolar hydrocarbons, methanol (MeOH), water and dimethyl formamide as polar solvents with and without OH group. Arrhenius type linear relationship predicted by the model for the ln Q vs 1/ T function, where Q=(100/ IPs-1), was found to be valid in all cases. The slopes of the lines correspond to the activation energy differences (Δ E*= Erec- EPs) between the two main competing reaction pathways in the positron spur, i.e., solvent recombination (e - + M +) and positronium formation (e - + e +). The slopes were positive, i.e., Δ E*<0 and Erec< EPs. For polar liquids, correlation seems to exists between Δ E* and the electron mobility ( μ) or the activation energy of the viscosity ( Eη).

Superconductivity in metal coated graphene

NASA Astrophysics Data System (ADS)

Uchoa, Bruno; Castro Neto, Antonio

2007-03-01

Graphene, a single atomic layer of graphite, is a two dimensional (2D) zero gap insulator with a high electronic mobility between nearest neighbor carbon sites. The unique electronic properties of graphene, from the semi-metallic behavior to the observation of an anomalous quantum Hall effect and a zero field quantized minimum of conductivity derive from the relativistic nature of its quasiparticles. By doping graphene, it behaves in several aspects as a conventional Fermi liquid, where electrons may form Cooper pairs by coupling with a bosonic mode. In this talk, we develop a mean-field phenomenology of superconductivity in a honeycomb lattice. We predict the possibility of two distinct phases, a singlet s-wave phase and a novel p+ip wave phase in the singlet channel. At half filling, the p+ip phase is gapless and superconductivity is a hidden order. We propose a few possible sources of Cooper pairing instability in graphene coated with alkaline and transition metals, and similar low dimensional graphene based devices.

Characteristics of individuals with high information potential in government research and development organizations.

NASA Technical Reports Server (NTRS)

Holland, W. E.

1972-01-01

In order to study focal individuals within informal communications networks, a special variable was constructed: information potential (IP) was defined as the information-source value placed on an individual by his colleagues. Four hypotheses involving IP were tested in three R&D organizations using questionnaires and pencil-and-paper tests. Results indicated that the individual with high IP used more and different sources of technical information, was seen to be a credible information source and to have a strong ability to associate seemingly unrelated ideas, and was as approachable as the other members of his organization. Four tentative conclusions may be drawn from this study concerning the person with high IP. He is (1) an identifiable individual in several different kinds of organizations; (2) a distinctive information transceiver (transmitter and receiver); (3) both a producer and a catalyst in his own organization; and (4) an extender and an amplifier of information search. To affect the efficiency of informal information flow, the research manager's best hope for positively influencing informal networks lies in the identification and motivation of the special communicators in his organization.

Identifying and Validating Requirements of a Mobile-Based Self-Management System for People Living with HIV.

PubMed

Mehraeen, Esmaeil; Safdari, Reza; Seyedalinaghi, Seyed Ahmad; Mohammadzadeh, Niloofar; Arji, Goli

2018-01-01

Due to the widespread use of mobile technology and the low cost of this technology, implementing a mobile-based self-management system can lead to adherence to the medication regimens and promotion of the health of people living with HIV (PLWH). We aimed to identify requirements of a mobile-based self-management system, and validate them from the perspective of infectious diseases specialists. This is a mixed-methods study that carried out in two main phases. In the first phase, we identified requirements of a mobile-based self-management system for PLWH. In the second phase, identified requirements were validated using a researcher made questionnaire. The statistical population was infectious diseases specialists affiliated to Tehran University of Medical Sciences. The collected data were analyzed using SPSS statistical software (version 19), and descriptive statistics. By full-text review of selected studies, we determined requirements of a mobile-based self-management system in four categories: demographic, clinical, strategically and technical capabilities. According to the findings, 6 data elements for demographic category, 11 data elements for clinical category, 10 items for self-management strategies, and 11 features for technical capabilities were selected. Using the identified preferences, it is possible to design and implement a mobile-based self-management system for HIV-positive people. Developing a mobile-based self-management system is expected to progress the skills of self-management PLWH, improve of medication regimen adherence, and facilitate communication with healthcare providers.

Dynamic optical resource allocation for mobile core networks with software defined elastic optical networking.

PubMed

Zhao, Yongli; Chen, Zhendong; Zhang, Jie; Wang, Xinbo

2016-07-25

Driven by the forthcoming of 5G mobile communications, the all-IP architecture of mobile core networks, i.e. evolved packet core (EPC) proposed by 3GPP, has been greatly challenged by the users' demands for higher data rate and more reliable end-to-end connection, as well as operators' demands for low operational cost. These challenges can be potentially met by software defined optical networking (SDON), which enables dynamic resource allocation according to the users' requirement. In this article, a novel network architecture for mobile core network is proposed based on SDON. A software defined network (SDN) controller is designed to realize the coordinated control over different entities in EPC networks. We analyze the requirement of EPC-lightpath (EPCL) in data plane and propose an optical switch load balancing (OSLB) algorithm for resource allocation in optical layer. The procedure of establishment and adjustment of EPCLs is demonstrated on a SDON-based EPC testbed with extended OpenFlow protocol. We also evaluate the OSLB algorithm through simulation in terms of bandwidth blocking ratio, traffic load distribution, and resource utilization ratio compared with link-based load balancing (LLB) and MinHops algorithms.

NAADP Activates Two-Pore Channels on T Cell Cytolytic Granules to Stimulate Exocytosis and Killing

PubMed Central

Davis, Lianne C.; Morgan, Anthony J.; Chen, Ji-Li; Snead, Charlotte M.; Bloor-Young, Duncan; Shenderov, Eugene; Stanton-Humphreys, Megan N.; Conway, Stuart J.; Churchill, Grant C.; Parrington, John; Cerundolo, Vincenzo; Galione, Antony

2012-01-01

Summary A cytotoxic T lymphocyte (CTL) kills an infected or tumorigenic cell by Ca2+-dependent exocytosis of cytolytic granules at the immunological synapse formed between the two cells. Although inositol 1,4,5-trisphosphate (IP3)-mediated Ca2+ release from the endoplasmic reticulum activates the store-operated Ca2+-influx pathway that is necessary for exocytosis, it is not a sufficient stimulus [1–4]. Here we identify the Ca2+-mobilizing messenger nicotinic acid adenine dinucleotide phosphate (NAADP) and its recently identified molecular target, two-pore channels (TPCs) [5–7], as being important for T cell receptor signaling in CTLs. We demonstrate that cytolytic granules are not only reservoirs of cytolytic proteins but are also the acidic Ca2+ stores mobilized by NAADP via TPC channels on the granules themselves, so that TPCs migrate to the immunological synapse upon CTL activation. Moreover, NAADP activates TPCs to drive exocytosis in a way that is not mimicked by global Ca2+ signals induced by IP3 or ionomycin, suggesting that critical, local Ca2+ nanodomains around TPCs stimulate granule exocytosis. Hence, by virtue of the NAADP/TPC pathway, cytolytic granules generate Ca2+ signals that lead to their own exocytosis and to cell killing. This study highlights a selective role for NAADP in stimulating exocytosis crucial for immune cell function and may impact on stimulus-secretion coupling in wider cellular contexts. PMID:23177477

Epidermal growth factor (EGF) stimulated Ca/sup 2 +/ mobilization in hepatocytes is abolished by phorbol esters, pertussis toxin and partial hepatectomy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, R.M.; Garrison, J.C.

1986-05-01

EGF has been demonstrated to increase free intracellular Ca/sup 2 +/ levels in isolated hepatocytes putatively by generation of the second messenger inositol trisphosphate (IP/sub 3/). Pretreatment of cells with phorbol 12-myristate 13-acetate (PMA) inhibited the EGF (66 nM) stimulated Ca/sup 2 +/ response as measured by quin2. Inhibition by PMA was maximal within 3 min and was concentration dependent (IC/sub 50/ = 13.5 nM). Four other active phorbol ester analogues blocked the Ca/sup 2 +/ response while inactive analogues did not. EGF was unable to increase intracellular Ca/sup 2 +/ levels in hepatocytes isolated from rats treated with pertussismore » toxin for 72 hrs. Neither PMA nor toxin pretreatment was able to inhibit the Ca/sup 2 +/ response to angiotensin II (Ang II). In hepatocytes isolated 24 hrs after partial hepatectomy, the Ca/sup 2 +/ response to EGF (as measured by phosphorylase activity, EC/sub 50/ = 5 nM) was completely abolished and remained attenuated for 7 days post-hepatectomy. The Ca/sup 2 +/ response to Ang II in this model system was also blunted but required 3 days for development of the full effect and within 7 days full activity is nearly restored. The results suggest that fundamental differences exist in the transduction mechanisms used by these two Ca/sup 2 +/-linked hormones to mobilize intracellular Ca/sup 2 +/ (and putatively increase IP/sub 3/ formation).« less

Calcium pathway machinery at fertilization in echinoderms

PubMed Central

Ramos, Isabela; Wessel, Gary M.

2016-01-01

Calcium signaling in cells directs diverse physiological processes. The calcium waves triggered by fertilization is a highly conserved calcium signaling event essential for egg activation, and has been documented in every egg tested. This activity is one of the few highly conserved events of egg activation through the course of evolution. Echinoderm eggs, as well as many other cell types, have three main intracellular Ca2+ mobilizing messengers – IP3, cADPR and NAADP. Both cADPR and NAADP were identified as Ca2+ mobilizing messengers using the sea urchin egg homogenate, and this experimental system, along with the intact urchin and starfish oocyte/egg, continues to be a vital tool for investigating the mechanism of action of calcium signals. While many of the major regulatory steps of the IP3 pathway are well resolved, both cADPR and NAADP remain understudied in terms of our understanding of the fundamental process of egg activation at fertilization. Recently, NAADP has been shown to trigger Ca2+ release from acidic vesicles, separately from the ER, and a new class of calcium channels, the two-pore channels (TPCs), was identified as the likely targets for this messenger. Moreover, it was found that both cADPR and NAADP can be synthesized by the same family of enzymes, the ADP-rybosyl cyclases (ARCs). In this context of increasing amount of information, the potential coupling and functional roles of different messengers, intracellular stores and channels in the formation of the fertilization calcium wave in echinoderms will be critically evaluated. PMID:23218671

Akt/PKB activation and insulin signaling: a novel insulin signaling pathway in the treatment of type 2 diabetes.

PubMed

Mackenzie, Richard Wa; Elliott, Bradley T

2014-01-01

Type 2 diabetes is a metabolic disease categorized primarily by reduced insulin sensitivity, β-cell dysfunction, and elevated hepatic glucose production. Treatments reducing hyperglycemia and the secondary complications that result from these dysfunctions are being sought after. Two distinct pathways encourage glucose transport activity in skeletal muscle, ie, the contraction-stimulated pathway reliant on Ca(2+)/5'-monophosphate-activated protein kinase (AMPK)-dependent mechanisms and an insulin-dependent pathway activated via upregulation of serine/threonine protein kinase Akt/PKB. Metformin is an established treatment for type 2 diabetes due to its ability to increase peripheral glucose uptake while reducing hepatic glucose production in an AMPK-dependent manner. Peripheral insulin action is reduced in type 2 diabetics whereas AMPK signaling remains largely intact. This paper firstly reviews AMPK and its role in glucose uptake and then focuses on a novel mechanism known to operate via an insulin-dependent pathway. Inositol hexakisphosphate (IP6) kinase 1 (IP6K1) produces a pyrophosphate group at the position of IP6 to generate a further inositol pyrophosphate, ie, diphosphoinositol pentakisphosphate (IP7). IP7 binds with Akt/PKB at its pleckstrin homology domain, preventing interaction with phosphatidylinositol 3,4,5-trisphosphate, and therefore reducing Akt/PKB membrane translocation and insulin-stimulated glucose uptake. Novel evidence suggesting a reduction in IP7 production via IP6K1 inhibition represents an exciting therapeutic avenue in the treatment of insulin resistance. Metformin-induced activation of AMPK is a key current intervention in the management of type 2 diabetes. However, this treatment does not seem to improve peripheral insulin resistance. In light of this evidence, we suggest that inhibition of IP6K1 may increase insulin sensitivity and provide a novel research direction in the treatment of insulin resistance.

Influence of temperature on spring flight initiation for southwestern ponderosa pine bark beetles (Coleoptera: Curculionidae, Scolytinae)

Treesearch

M. L. Gaylord; K. K. Williams; R. W. Hofstetter; J. D. McMillin; T. E. Degomez; M. R. Wagner

2008-01-01

Determination of temperature requirements for many economically important insects is a cornerstone of pest management. For bark beetles (Coleoptera: Curculionidae, Scolytinae), this information can facilitate timing of management strategies. Our goals were to determine temperature predictors for flight initiation of three species of Ips bark beetles...

FK506 binding proteins: cellular regulators of intracellular Ca2+ signalling.

PubMed

MacMillan, Debbi

2013-01-30

In many cell types the intracellular Ca(2+) store performs a central role in the regulation of the cytosolic Ca(2+) concentration ([Ca(2+)](c)), the elevation of which triggers diverse and fundamental activities from reproduction to apoptosis, as well as being the major trigger for contraction. Two distinct classes of Ca(2+) release channels, which mobilize Ca(2+) from the store, exist; the inositol 1,4,5-trisphosphate (IP(3)) receptor and the ryanodine receptor. Considerable attention has been directed towards the importance of modulatory proteins that interact with these channels including, FK506 binding proteins (FKBPs), FKBP12 and its isoform, FKBP12.6. Although FKBP12 was first identified as the principal intracellular target for the immunosuppressive drugs, FK506 and rapamycin, new insights into the role of FKBPs have since emerged. These regulatory proteins are reportedly important modulators of intracellular Ca(2+) release. FKBPs may regulate ryanodine and IP(3) receptors either directly, by binding to the cytoplasmic aspect of the channel, or indirectly via modulation of two targets, the phosphatase, calcineurin or the kinase, mammalian target of rapamycin (mTOR). Dissociation of FKBP12 or FKBP12.6 from either Ca(2+) release channel may increase, decrease or have no effect on ryanodine receptor- or IP(3) receptor-mediated Ca(2+) release. These important controversies may be attributed to FKBPs' ability to regulate the receptor indirectly via the kinase and phosphatase pathways modulated by the accessory proteins. This brief review discusses the regulation of intracellular ryanodine and IP(3) receptor Ca(2+) release channels by accessory FKBPs, with important implications for the role of FKBPs in the pathophysiology of a number of diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

PubMed

Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

2008-07-01

Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

44 CFR 321.3 - Maintaining the mobilization base.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Maintaining the mobilization base. 321.3 Section 321.3 Emergency Management and Assistance FEDERAL EMERGENCY MANAGEMENT AGENCY, DEPARTMENT OF HOMELAND SECURITY PREPAREDNESS MAINTENANCE OF THE MOBILIZATION BASE (DEPARTMENT OF DEFENSE...

A Service Oriented Architecture to Integrate Mobile Assessment in Learning Management Systems

ERIC Educational Resources Information Center

Riad, A. M.; El-Ghareeb, H. A.

2008-01-01

Mobile Learning (M-Learning) is an approach to E-Learning that utilizes mobile devices. Learning Management System (LMS) should enable M-Learning. Unfortunately, M-Learning is not the same at each educational institution. Assessment is one of the learning activities that can be achieved electronically and via mobile device. Mobile assessment…

Business innovation symposium ‘At what price? IP-related thoughts on new business models for space information’

NASA Astrophysics Data System (ADS)

Smith, Lesley Jane

2011-09-01

Spatial data and imagery generators are set to become tomorrow's key players in the information society. This is why satellite owners and operators are examining new revenue-producing models for developing space-related products and services. The use and availability of broadband internet width and satellite data-based services will continue to increase in the future. With the capacity to deliver real time precision downstream data, space agencies and the satellite industry can respond to the demand for high resolution digital space information which, with the appropriate technology, can be integrated into a variety of web-based applications. At a time when the traditional roles of space agencies are becoming more hybrid, largely as a result of the greater drive towards commercial markets, new value-added markets for space-related information products are continuing to attract attention. This paper discusses whether traditional data policies on space data access and IP licensing schemes stand to remain the feasible prototype for distributing and marketing space data, and how this growth market might benefit from looking at an 'up and running' global IP management system already operating to manage end user digital demand. PrefaceThe terminology describing the various types of spatial data and space-based information is not uniformly used within the various principles, laws and policies that govern space data. For convenience only this paper refers to primary or raw data gathered by the space-based industry as spatial or raw data, and the data as processed and sold on or distributed by ground-based companies as space information products and services. In practise, spatial data range from generic to specific data sets, digital topography, through to pictures and imagery services at various resolutions, with 3-D perspectives underway. The paper addresses general IP considerations relating to spatial data, with some reference to remote sensing itself. Exact IP details will depend at all times on the final product and service in question.

Remote Memory Access Protocol Target Node Intellectual Property

NASA Technical Reports Server (NTRS)

Haddad, Omar

2013-01-01

The MagnetoSpheric Multiscale (MMS) mission had a requirement to use the Remote Memory Access Protocol (RMAP) over its SpaceWire network. At the time, no known intellectual property (IP) cores were available for purchase. Additionally, MMS preferred to implement the RMAP functionality with control over the low-level details of the design. For example, not all the RMAP standard functionality was needed, and it was desired to implement only the portions of the RMAP protocol that were needed. RMAP functionality had been previously implemented in commercial off-the-shelf (COTS) products, but the IP core was not available for purchase. The RMAP Target IP core is a VHDL (VHSIC Hardware Description Language description of a digital logic design suitable for implementation in an FPGA (field-programmable gate array) or ASIC (application-specific integrated circuit) that parses SpaceWire packets that conform to the RMAP standard. The RMAP packet protocol allows a network host to access and control a target device using address mapping. This capability allows SpaceWire devices to be managed in a standardized way that simplifies the hardware design of the device, as well as the development of the software that controls the device. The RMAP Target IP core has some features that are unique and not specified in the RMAP standard. One such feature is the ability to automatically abort transactions if the back-end logic does not respond to read/write requests within a predefined time. When a request times out, the RMAP Target IP core automatically retracts the request and returns a command response with an appropriate status in the response packet s header. Another such feature is the ability to control the SpaceWire node or router using RMAP transactions in the extended address range. This allows the SpaceWire network host to manage the SpaceWire network elements using RMAP packets, which reduces the number of protocols that the network host needs to support.

Changeable HA to improve MIPv6 protocol

NASA Astrophysics Data System (ADS)

Hu, Qing-gui

2015-12-01

For mobile IPv6, home agent (HA) plays an important role. Each mobile node (MN) has a home IP address, it will be not changeable. Also, the home agent (HA) of MN is not changeable. This rule provides the convenient for the ongoing communication without interruption. But it has some obvious drawbacks. Here, the new variable HA scheme is proposed. Every MN has a dynamic cache table, recording the information such as its home address, care-of address, and history address etc. If the accumulated time in one region exceeds that in the hometown, the foreign agent (FA) could become home agent (HA), the home agent could become history agent. Later, the performance of the new protocol is simulated with OPNET software, whose result shows the performance of the new protocol works better than that of the traditional protocol.

[Mobile phone-computer wireless interactive graphics transmission technology and its medical application].

PubMed

Huang, Shuo; Liu, Jing

2010-05-01

Application of clinical digital medical imaging has raised many tough issues to tackle, such as data storage, management, and information sharing. Here we investigated a mobile phone based medical image management system which is capable of achieving personal medical imaging information storage, management and comprehensive health information analysis. The technologies related to the management system spanning the wireless transmission technology, the technical capabilities of phone in mobile health care and management of mobile medical database were discussed. Taking medical infrared images transmission between phone and computer as an example, the working principle of the present system was demonstrated.

44 CFR 321.2 - Selection of the mobilization base.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Selection of the mobilization base. 321.2 Section 321.2 Emergency Management and Assistance FEDERAL EMERGENCY MANAGEMENT AGENCY, DEPARTMENT OF HOMELAND SECURITY PREPAREDNESS MAINTENANCE OF THE MOBILIZATION BASE (DEPARTMENT OF DEFENSE...

Expression of a truncated form of the endoplasmic reticulum chaperone protein, σ1 receptor, promotes mitochondrial energy depletion and apoptosis.

PubMed

Shioda, Norifumi; Ishikawa, Kiyoshi; Tagashira, Hideaki; Ishizuka, Toru; Yawo, Hiromu; Fukunaga, Kohji

2012-07-06

The σ1 receptor (σ(1)R) regulates endoplasmic reticulum (ER)/mitochondrial interorganellar Ca(2+) mobilization through the inositol 1,4,5-trisphosphate receptor (IP(3)R). Here, we observed that expression of a novel splice variant of σ(1)R, termed short form σ(1)R (σ(1)SR), has a detrimental effect on mitochondrial energy production and cell survival. σ(1)SR mRNA lacks 47 ribonucleotides encoding exon 2, resulting in a frameshift and formation of a truncated receptor. σ(1)SR localizes primarily in the ER at perinuclear regions and forms a complex with σ(1)R but not with IP(3)R in the mitochondrion-associated ER membrane. Overexpression of both σ(1)R and the truncated isoform promotes mitochondrial elongation with increased ER mitochondrial contact surface. σ(1)R overexpression increases the efficiency of mitochondrial Ca(2+) uptake in response to IP(3)R-driven stimuli, whereas σ(1)SR overexpression reduces it. Most importantly, σ(1)R promotes ATP production via increased mitochondrial Ca(2+) uptake, promoting cell survival in the presence of ER stress. By contrast, σ(1)SR suppresses ATP production following ER stress, enhancing cell death. Taken together, the newly identified σ(1)SR isoform interferes with σ(1)R function relevant to mitochondrial energy production under ER stress conditions, promoting cellular apoptosis.

Intellectual property : national and international perspectives.

DOT National Transportation Integrated Search

2009-06-01

A consistent approach to managing intellectual property (IP) permits the effective transfer of the results of research : and encourages the use of products and services by client organizations. This Preliminary Investigation seeks to : capture curren...

Evaluation of QoS supported in Network Mobility NEMO environments

NASA Astrophysics Data System (ADS)

Hussien, L. F.; Abdalla, A. H.; Habaebi, M. H.; Khalifa, O. O.; Hassan, W. H.

2013-12-01

Network mobility basic support (NEMO BS) protocol is an entire network, roaming as a unit which changes its point of attachment to the Internet and consequently its reachability in the network topology. NEMO BS doesn't provide QoS guarantees to its users same as traditional Internet IP and Mobile IPv6 as well. Typically, all the users will have same level of services without considering about their application requirements. This poses a problem to real-time applications that required QoS guarantees. To gain more effective control of the network, incorporated QoS is needed. Within QoS-enabled network the traffic flow can be distributed to various priorities. Also, the network bandwidth and resources can be allocated to different applications and users. Internet Engineering Task Force (IETF) working group has proposed several QoS solutions for static network such as IntServ, DiffServ and MPLS. These QoS solutions are designed in the context of a static environment (i.e. fixed hosts and networks). However, they are not fully adapted to mobile environments. They essentially demands to be extended and adjusted to meet up various challenges involved in mobile environments. With existing QoS mechanisms many proposals have been developed to provide QoS for individual mobile nodes (i.e. host mobility). In contrary, research based on the movement of the whole mobile network in IPv6 is still undertaking by the IETF working groups (i.e. network mobility). Few researches have been done in the area of providing QoS for roaming networks. Therefore, this paper aims to review and investigate (previous /and current) related works that have been developed to provide QoS in mobile network. Consequently, a new proposed scheme will be introduced to enhance QoS within NEMO environment, achieving by which seamless mobility to users of mobile network node (MNN).

Inter-Domain Roaming Mechanism Transparent to Mobile Nodes among PMIPv6 Networks

NASA Astrophysics Data System (ADS)

Park, Soochang; Lee, Euisin; Jin, Min-Sook; Kim, Sang-Ha

In Proxy Mobile IPv6 (PMIPv6), when a Mobile Node (MN) enters a PMIPv6 domain and attaches to an access link, the router on the access link detects attachment of the MN by the link-layer access. All elements of PMIPv6 including the router then provide network-based mobility management service for the MN. If the MN moves to another router in this PMIPv6 domain, the new router emulates attachment to the previous router by providing same network prefix to the MN. In other words, PMIPv6 provides rapid mobility management based on layer-2 attachment and transparent mobility support to the MN by emulating layer-3 attachment with respect to intra-domain roaming. However, when the MN moves to other PMIPv6 domains, although the domains also provide the network-based mobility management service, the MN should exploit the host-based mobility management protocol, i.e. Mobile IPv6 (MIPv6), for the inter-domain roaming. Hence, this letter proposes the rapid and transparent inter-domain roaming mechanism controlled by the networks adopting PMIPv6.

Introducing an M-Commerce Course into the Business Management Curriculum: Experiences and Recommendations

ERIC Educational Resources Information Center

Nandi, Santosh; Nandi, Madhavi L.

2015-01-01

Mobility has become an important extension to the business strategies of present-day organizations. Thus, organizations are increasingly seeking managers with knowledge of value chain related to mobile-oriented business activities, usually referred to as mobile commerce (m-commerce). Accordingly, business management schools are interesting in…

77 FR 19408 - Dynamic Mobility Applications and Data Capture Management Programs; Notice of Public Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2012-03-30

... DEPARTMENT OF TRANSPORTATION Dynamic Mobility Applications and Data Capture Management Programs...) Intelligent Transportation System Joint Program Office (ITS JPO) will host a free public meeting to provide stakeholders an update on the Data Capture and Management (DCM) and Dynamic Mobility Applications (DMA...

Dynamic Trust Management for Mobile Networks and Its Applications

ERIC Educational Resources Information Center

Bao, Fenye

2013-01-01

Trust management in mobile networks is challenging due to dynamically changing network environments and the lack of a centralized trusted authority. In this dissertation research, we "design" and "validate" a class of dynamic trust management protocols for mobile networks, and demonstrate the utility of dynamic trust management…

IP{sub 3}-dependent intracellular Ca{sup 2+} release is required for cAMP-induced c-fos expression in hippocampal neurons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Wenting; Tingare, Asmita; Ng, David Chi-Heng

2012-08-24

Highlights: Black-Right-Pointing-Pointer cAMP-induced c-fos expression in hippocampal neurons requires a submembraneous Ca{sup 2+} pool. Black-Right-Pointing-Pointer The submembraneous Ca{sup 2+} pool derives from intracellular ER stores. Black-Right-Pointing-Pointer Expression of IP{sub 3}-metabolizing enzymes inhibits cAMP-induced c-fos expression. Black-Right-Pointing-Pointer SRE-mediated and CRE-mediated gene expression is sensitive to IP{sub 3}-metabolizing enzymes. Black-Right-Pointing-Pointer Intracellular Ca{sup 2+} release is required for cAMP-induced nuclear translocation of TORC1. -- Abstract: Ca{sup 2+} and cAMP are widely used in concert by neurons to relay signals from the synapse to the nucleus, where synaptic activity modulates gene expression required for synaptic plasticity. Neurons utilize different transcriptional regulators to integrate informationmore » encoded in the spatiotemporal dynamics and magnitude of Ca{sup 2+} and cAMP signals, including some that are Ca{sup 2+}-responsive, some that are cAMP-responsive and some that detect coincident Ca{sup 2+} and cAMP signals. Because Ca{sup 2+} and cAMP can influence each other's amplitude and spatiotemporal characteristics, we investigated how cAMP acts to regulate gene expression when increases in intracellular Ca{sup 2+} are buffered. We show here that cAMP-mobilizing stimuli are unable to induce expression of the immediate early gene c-fos in hippocampal neurons in the presence of the intracellular Ca{sup 2+} buffer BAPTA-AM. Expression of enzymes that attenuate intracellular IP{sub 3} levels also inhibited cAMP-dependent c-fos induction. Synaptic activity induces c-fos transcription through two cis regulatory DNA elements - the CRE and the SRE. We show here that in response to cAMP both CRE-mediated and SRE-mediated induction of a luciferase reporter gene is attenuated by IP{sub 3} metabolizing enzymes. Furthermore, cAMP-induced nuclear translocation of the CREB coactivator TORC1 was inhibited by depletion of intracellular Ca{sup 2+} stores. Our data indicate that Ca{sup 2+} release from IP{sub 3}-sensitive pools is required for cAMP-induced transcription in hippocampal neurons.« less

Mobile Phone Based System Opportunities to Home-based Managing of Chemotherapy Side Effects.

PubMed

Davoodi, Somayeh; Mohammadzadeh, Zeinab; Safdari, Reza

2016-06-01

Applying mobile base systems in cancer care especially in chemotherapy management have remarkable growing in recent decades. Because chemotherapy side effects have significant influences on patient's lives, therefore it is necessary to take ways to control them. This research has studied some experiences of using mobile phone based systems to home-based monitor of chemotherapy side effects in cancer. In this literature review study, search was conducted with keywords like cancer, chemotherapy, mobile phone, information technology, side effects and self managing, in Science Direct, Google Scholar and Pub Med databases since 2005. Today, because of the growing trend of the cancer, we need methods and innovations such as information technology to manage and control it. Mobile phone based systems are the solutions that help to provide quick access to monitor chemotherapy side effects for cancer patients at home. Investigated studies demonstrate that using of mobile phones in chemotherapy management have positive results and led to patients and clinicians satisfactions. This study shows that the mobile phone system for home-based monitoring chemotherapy side effects works well. In result, knowledge of cancer self-management and the rate of patient's effective participation in care process improved.

Interprofessional teamwork among students in simulated codes: a quasi-experimental study.

PubMed

Garbee, Deborah D; Paige, John; Barrier, Kendra; Kozmenko, Valeriy; Kozmenko, Lyubov; Zamjahn, John; Bonanno, Laura; Cefalu, Jean

2013-01-01

The purpose of this study was to evaluate the efficacy of using crisis resource management (CRM) principles and high-fidelity human patient simulation (HFHPS) for interprofessional (IP) team training of students from undergraduate nursing, nurse anesthesia, medical, and respiratory therapy. IP education using simulation-based training has the potential to transform education by improving teamwork and communication and breaking down silos in education. This one-year study used a quasi-experimental design to evaluate students' acquisition and retention of teamwork and communication skills. A convenience sample consisted of 52 students in the fall semester, with 40 students returning in the spring. Mean scores increased after training, and skills were retained fairly well. Any loss was regained with repeat training in the spring. The results suggest that using CRM and HFHPS is an effective pedagogy for teaching communication and teamwork skills to IP student teams.

Freedom-to-operate analysis of a transgenic multivitamin corn variety.

PubMed

Zanga, Daniela; Capell, Teresa; Zhu, Changfu; Christou, Paul; Thangaraj, Harry

2016-05-01

In this article, we explore the intellectual property (IP) landscape relevant to the production and commercialization of Carolight(™) , a transgenic multivitamin corn variety created on humanitarian grounds to address micronutrient deficiencies in low-and-middle-income countries. The successful production of this variety requires IP rights risk management because there is a strong protection on inventions and processes via patent portfolios in both developing and industrialized countries. The IP framework is complex, and specialist patent lawyers are usually employed to perform such analysis, but the costs cannot always be met by small, publicly funded projects. We report an alternative strategy, a do-it-yourself patent analysis, to produce a review with limited legal value that can nevertheless lay the foundations for a subsequent more in-depth professional freedom-to-operate opinion. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Interoperation of an UHF RFID Reader and a TCP/IP Device via Wired and Wireless Links

PubMed Central

Lee, Sang Hoon; Jin, Ik Soo

2011-01-01

A main application in radio frequency identification (RFID) sensor networks is the function that processes real-time tag information after gathering the required data from multiple RFID tags. The component technologies that contain an RFID reader, called the interrogator, which has a tag chip, processors, coupling antenna, and a power management system have advanced significantly over the last decade. This paper presents a system implementation for interoperation between an UHF RFID reader and a TCP/IP device that is used as a gateway. The proposed system consists of an UHF RFID tag, an UHF RFID reader, an RF end-device, an RF coordinator, and a TCP/IP I/F. The UHF RFID reader, operating at 915 MHz, is compatible with EPC Class-0/Gen1, Class-1/Gen1 and 2, and ISO18000-6B. In particular, the UHF RFID reader can be combined with the RF end-device/coordinator for a ZigBee (IEEE 802.15.4) interface, which is a low-power wireless standard. The TCP/IP device communicates with the RFID reader via wired links. On the other hand, it is connected to the ZigBee end-device via wireless links. The web based test results show that the developed system can remotely recognize information of multiple tags through the interoperation between the RFID reader and the TCP/IP device. PMID:22346665

Interoperation of an UHF RFID reader and a TCP/IP device via wired and wireless links.

PubMed

Lee, Sang Hoon; Jin, Ik Soo

2011-01-01

A main application in radio frequency identification (RFID) sensor networks is the function that processes real-time tag information after gathering the required data from multiple RFID tags. The component technologies that contain an RFID reader, called the interrogator, which has a tag chip, processors, coupling antenna, and a power management system have advanced significantly over the last decade. This paper presents a system implementation for interoperation between an UHF RFID reader and a TCP/IP device that is used as a gateway. The proposed system consists of an UHF RFID tag, an UHF RFID reader, an RF end-device, an RF coordinator, and a TCP/IP I/F. The UHF RFID reader, operating at 915 MHz, is compatible with EPC Class-0/Gen1, Class-1/Gen1 and 2, and ISO18000-6B. In particular, the UHF RFID reader can be combined with the RF end-device/coordinator for a ZigBee (IEEE 802.15.4) interface, which is a low-power wireless standard. The TCP/IP device communicates with the RFID reader via wired links. On the other hand, it is connected to the ZigBee end-device via wireless links. The web based test results show that the developed system can remotely recognize information of multiple tags through the interoperation between the RFID reader and the TCP/IP device.

Developing a Mobile Learning Management System for Outdoors Nature Science Activities Based on 5E Learning Cycle

ERIC Educational Resources Information Center

Lai, Ah-Fur; Lai, Horng-Yih; Chuang, Wei-Hsiang; Wu, Zih-Heng

2015-01-01

Traditional outdoor learning activities such as inquiry-based learning in nature science encounter many dilemmas. Due to prompt development of mobile computing and widespread of mobile devices, mobile learning becomes a big trend on education. The main purpose of this study is to develop a mobile-learning management system for overcoming the…

Mobile phone technology in chronic disease management.

PubMed

Blake, Holly

Mobile phones are being used to improve nurse-patient communication and monitor health outcomes in chronic disease. Innovative applications of mobile technology are expected to increase over time in community management of cancer, heart disease, asthma and diabetes. This article focuses on mobile phone technology and its contribution to health care.

Anticonvulsant effect of Persea americana Mill (Lauraceae) (Avocado) leaf aqueous extract in mice.

PubMed

Ojewole, John A O; Amabeoku, George J

2006-08-01

Various morphological parts of Persea americana Mill (Lauraceae) (avocado) are widely used in African traditional medicines for the treatment, management and/or control of a variety of human ailments, including childhood convulsions and epilepsy. This study examined the anticonvulsant effect of the plant's leaf aqueous extract (PAE, 50-800 mg/kg i.p.) against pentylenetetrazole (PTZ)-, picrotoxin (PCT)- and bicuculline (BCL)-induced seizures in mice. Phenobarbitone and diazepam were used as reference anticonvulsant drugs for comparison. Like the reference anticonvulsant agents used, Persea americana leaf aqueous extract (PAE, 100-800 mg/kg i.p.) significantly (p < 0.05-0.001) delayed the onset of, and antagonized, pentylenetetrazole (PTZ)-induced seizures. The plant's leaf extract (PAE, 100-800 mg/kg i.p.) also profoundly antagonized picrotoxin (PCT)-induced seizures, but only weakly antagonized bicuculline (BCL)-induced seizures. Although the data obtained in the present study do not provide conclusive evidence, it would appear that 'avocado' leaf aqueous extract (PAE) produces its anticonvulsant effect by enhancing GABAergic neurotransmission and/or action in the brain. The findings of this study indicate that Persea americana leaf aqueous extract possesses an anticonvulsant property, and thus lends pharmacological credence to the suggested ethnomedical uses of the plant in the management of childhood convulsions and epilepsy.

IP access networks with QoS support

NASA Astrophysics Data System (ADS)

Sargento, Susana; Valadas, Rui J. M. T.; Goncalves, Jorge; Sousa, Henrique

2001-07-01

The increasing demand of new services and applications is pushing for drastic changes on the design of access networks targeted mainly for residential and SOHO users. Future access networks will provide full service integration (including multimedia), resource sharing at the packet level and QoS support. It is expected that using IP as the base technology, the ideal plug-and-play scenario, where the management actions of the access network operator are kept to a minimum, will be achieved easily. This paper proposes an architecture for access networks based on layer 2 or layer 3 multiplexers that allows a number of simplifications in the network elements and protocols (e.g. in the routing and addressing functions). We discuss two possible steps in the evolution of access networks towards a more efficient support of IP based services. The first one still provides no QoS support and was designed with the goal of reusing as much as possible current technologies; it is based on tunneling to transport PPP sessions. The second one introduces QoS support through the use of emerging technologies and protocols. We illustrate the different phases of a multimedia Internet access session, when using SIP for session initiation, COPS for the management of QoS policies including the AAA functions and RSVP for resource reservation.

Guidelines for Lifelong Education Management to Mobilize Learning Community

ERIC Educational Resources Information Center

Charungkaittikul, Suwithida

2018-01-01

This article is a study of the guidelines for lifelong education management to mobilize learning communities in the social-cultural context of Thailand is intended to 1) analyze and synthesize the management of lifelong learning to mobilize learning community in the social-cultural context of Thailand; and 2) propose guidelines for lifelong…

Skull Base Inverted Papilloma: A Comprehensive Review

PubMed Central

Wassef, Shafik N.; Batra, Pete S.; Barnett, Samuel

2012-01-01

Skull base inverted papilloma (IP) is an unusual entity for many neurosurgeons. IP is renowned for its high rate of recurrence, its ability to cause local destruction, and its association with malignancy. This paper is a comprehensive review of the reports, studies, and reviews published in the current biomedical literature from 1947 to September 2010 and synthesize this information to focus on its potential invasion to the base of the skull and possible intradural extension. The objective is to familiarize the clinician with the different aspects of this unusual disease. The role of modern diagnostic tools in medical imaging in order to assess clearly the limits of the tumors and to enhance the efficiency and the safety in the choice of a surgical approach is pointed out. The treatment guidelines for IP have undergone a complex evolution that continues today. Radical excision of the tumour is technically difficult and often incomplete. Successful management of IP requires resection of the affected mucosa which could be achieved with open surgery, endoscopic, or combined approach. Radio and chemotherapy were used for certain indications. More optimally research would be a multicenter randomized trials with large size cohorts. PMID:23346418

The UNITAID Patent Pool Initiative: Bringing Patents Together for the Common Good.

PubMed

Bermudez, Jorge; 't Hoen, Ellen

2010-01-19

Developing and delivering appropriate, affordable, well-adapted medicines for HIV/AIDS remains an urgent challenge: as first-line therapies fail, increasing numbers of people require costly second-line therapy; one-third of ARVs are not available in pediatric formulations; and certain key first- and second-line triple fixed-dose combinations do not exist or sufficient suppliers are lacking. UNITAID aims to help solve these problems through an innovative initiative for the collective management of intellectual property (IP) rights - a patent pool for HIV medicines. The idea behind a patent pool is that patent holders - companies, governments, researchers or universities - voluntarily offer, under certain conditions, the IP related to their inventions to the patent pool. Any company that wants to use the IP to produce or develop medicines can seek a license from the pool against the payment of royalties, and may then produce the medicines for use in developing countries (conditional upon meeting agreed quality standards). The patent pool will be a voluntary mechanism, meaning its success will largely depend on the willingness of pharmaceutical companies to participate and commit their IP to the pool. Generic producers must also be willing to cooperate. The pool has the potential to provide benefits to all.

Evaluation of Mobile Assessment in a Learning Management System

ERIC Educational Resources Information Center

Bogdanovic, Zorica; Barac, Dušan; Jovanic, Branislav; Popovic, Snežana; Radenkovic, Božidar

2014-01-01

This article discusses the problem of using and delivering educational content from the Moodle learning management system to mobile devices. The primary goal of this study was to investigate the students' habits, motivations and technical possibilities in order to incorporate mobile-learning activities in the e-learning process. A mobile quiz has…

The 10 Hottest Technologies in Telecom.

ERIC Educational Resources Information Center

Flanagan, Patrick

1997-01-01

Presents the fourth annual listing of the 10 "hottest" telecommunications technologies. Describes Web broadcasting, remote-access servers, extranets, Internet telephony, enterprise network directory services, Web site management tools, IP (Internet Protocols) switching, wavelength division multiplexing, digital subscriber lines, and…

X-Windows Socket Widget Class

NASA Technical Reports Server (NTRS)

Barry, Matthew R.

2006-01-01

The X-Windows Socket Widget Class ("Class" is used here in the object-oriented-programming sense of the word) was devised to simplify the task of implementing network connections for graphical-user-interface (GUI) computer programs. UNIX Transmission Control Protocol/Internet Protocol (TCP/IP) socket programming libraries require many method calls to configure, operate, and destroy sockets. Most X Windows GUI programs use widget sets or toolkits to facilitate management of complex objects. The widget standards facilitate construction of toolkits and application programs. The X-Windows Socket Widget Class encapsulates UNIX TCP/IP socket-management tasks within the framework of an X Windows widget. Using the widget framework, X Windows GUI programs can treat one or more network socket instances in the same manner as that of other graphical widgets, making it easier to program sockets. Wrapping ISP socket programming libraries inside a widget framework enables a programmer to treat a network interface as though it were a GUI.

Rapid Assessment of Contrast Sensitivity with Mobile Touch-screens

NASA Technical Reports Server (NTRS)

Mulligan, Jeffrey B.

2013-01-01

The availability of low-cost high-quality touch-screen displays in modern mobile devices has created opportunities for new approaches to routine visual measurements. Here we describe a novel method in which subjects use a finger swipe to indicate the transition from visible to invisible on a grating which is swept in both contrast and frequency. Because a single image can be swiped in about a second, it is practical to use a series of images to zoom in on particular ranges of contrast or frequency, both to increase the accuracy of the measurements and to obtain an estimate of the reliability of the subject. Sensitivities to chromatic and spatio-temporal modulations are easily measured using the same method. We will demonstrate a prototype for Apple Computer's iPad-iPod-iPhone family of devices, implemented using an open-source scripting environment known as QuIP (QUick Image Processing,

HNP renumbering support in PMIPv6

NASA Astrophysics Data System (ADS)

Yan, Zhiwei; Geng, Guanggang; Lee, Xiaodong

2015-12-01

In the basic PMIPv6 (Proxy Mobile IPv6), the MN (Mobile Node) is assigned with a 64-bit HNP (Home Network Prefix) during the initial attachment for the HoA (Home Address) configuration. During the movements of MN, this prefix is assumed to be unchanged and then the upper layer applications do not have to use the reconfigured HoA and then the handover is transparent at the IP and above layers. However, the current protocol does not specify the related operation to support the MN to timely receive the new HNP and configure the new HoA when its HNP is renumbered. In this paper, this problem is discussed and a possible solution is proposed based on some simple extensions of the basic PMIPv6. Our analysis demonstrates that the proposed scheme can effectively discover the HNP renumbering and keep lower signaling cost, compared with the basic PMIPv6.

77 FR 2734 - Proposed Collection; Comment Request: Solar Cell: A Mobile UV Manager for Smart Phones (NCI)

Federal Register 2010, 2011, 2012, 2013, 2014

2012-01-19

... Request: Solar Cell: A Mobile UV Manager for Smart Phones (NCI) SUMMARY: In compliance with the... Management and Budget (OMB) for review and approval. Proposed Collection: Title: Solar Cell: A Mobile UV... Collection: The overall goal of the study is to design a smart phone application, Solar Cell, which uses...

Design and development of an IoT-based web application for an intelligent remote SCADA system

NASA Astrophysics Data System (ADS)

Kao, Kuang-Chi; Chieng, Wei-Hua; Jeng, Shyr-Long

2018-03-01

This paper presents a design of an intelligent remote electrical power supervisory control and data acquisition (SCADA) system based on the Internet of Things (IoT), with Internet Information Services (IIS) for setting up web servers, an ASP.NET model-view- controller (MVC) for establishing a remote electrical power monitoring and control system by using responsive web design (RWD), and a Microsoft SQL Server as the database. With the web browser connected to the Internet, the sensing data is sent to the client by using the TCP/IP protocol, which supports mobile devices with different screen sizes. The users can provide instructions immediately without being present to check the conditions, which considerably reduces labor and time costs. The developed system incorporates a remote measuring function by using a wireless sensor network and utilizes a visual interface to make the human-machine interface (HMI) more instinctive. Moreover, it contains an analog input/output and a basic digital input/output that can be applied to a motor driver and an inverter for integration with a remote SCADA system based on IoT, and thus achieve efficient power management.

Inoculum Potential of Fusarium spp. Relates to Tillage and Straw Management in Norwegian Fields of Spring Oats

PubMed Central

Hofgaard, Ingerd S.; Seehusen, Till; Aamot, Heidi U.; Riley, Hugh; Razzaghian, Jafar; Le, Vinh H.; Hjelkrem, Anne-Grete R.; Dill-Macky, Ruth; Brodal, Guro

2016-01-01

The increased occurrence of Fusarium-mycotoxins in Norwegian cereals over the last decade, is thought to be caused by increased inoculum resulting from more cereal residues at the soil surface as a result of reduced tillage practices. In addition, weather conditions have increasingly promoted inoculum development and infection by Fusarium species. The objective of this work was to elucidate the influence of different tillage regimes (autumn plowing; autumn harrowing; spring plowing; spring harrowing) on the inoculum potential (IP) and dispersal of Fusarium spp. in spring oats. Tillage trials were conducted at two different locations in southeast Norway from 2010 to 2012. Oat residues from the previous year’s crop were collected within a week after sowing for evaluation. IP was calculated as the percentage of residues infested with Fusarium spp. multiplied by the proportion of the soil surface covered with residues. Fusarium avenaceum and F. graminearum were the most common Fusarium species recovered from oat residues. The IP of Fusarium spp. was significantly lower in plowed plots compared to those that were harrowed. Plowing in either the autumn or spring resulted in a low IP. Harrowing in autumn was more effective in reducing IP than the spring harrowing, and IP levels for the spring harrowed treatments were generally higher than all other tillage treatments examined. Surprisingly low levels of F. langsethiae were detected in the residues, although this species is a common pathogen of oat in Norway. The percentage of the residues infested with F. avenaceum, F. graminearum, F. culmorum, and F. langsethiae generally related to the quantity of DNA of the respective Fusarium species determined using quantitative PCR (qPCR). Fusarium dispersal, quantified by qPCR analysis of spore trap samples collected at and after heading, generally corresponded to the IP. Fusarium dispersal was also observed to increase after rainy periods. Our findings are in line with the general understanding that plowing is a means to reduce the IP of Fusarium spp. in cereal fields. The main inoculum source for F. langsethiae remains unclear. Our results will be useful in the development of forecasting tools to calculate the risk of Fusarium in cereals. PMID:27148236

The anaemia control model: Does it help nephrologists in therapeutic decision-making in the management of anaemia?

PubMed

Bucalo, María Laura; Barbieri, Carlo; Roca, Susana; Ion Titapiccolo, Jasmine; Ros Romero, Maria Soledad; Ramos, Rosa; Albaladejo, Mercedes; Manzano, Diana; Mari, Flavio; Molina, Manuel

2018-06-03

Anaemia is common in haemodialysis patients and treating it with erythropoiesis-stimulating agents (ESAs) is complex due to many factors. To assess the usefulness of the Anaemia Control Model (ACM) in the treatment of anaemia in haemodialysis. ACM is a software that predicts the optimal dose of darbepoetin and iron sucrose to achieve target haemoglobin (Hb) and ferritin levels, and makes prescription suggestions. Study conducted in dialysis clinics lasting 18months with two intervention phases (IPs) with ACM (IP1, n:213; IP2, n:218) separated by a control phase (CP, n:219). The primary outcome was the percentage of Hb in range and the median dose of ESAs, and the secondary outcomes were transfusion, hospitalisation and cardiovascular events. Clinical and patient analyses were performed. Hb variability was assessed by the standard deviation (SD) of the Hb. We also analysed the patients with most of the suggestions confirmed (ACM compliant group). ACM increased the percentage of Hb in range: 80.9% in IP2, compared with 72.7% in the CP and reduced the intake of darbepoetin (IP1: 20 [70]; CP 30 [80] μg P=0.032) with less Hb fluctuation (0.91±0.49 in the CP to 0.82±0.37g/dl in IP2, P<0.05), improving in the ACM compliant group. The secondary outcomes decreased with the use of ACM. ACM helps to obtain better anaemia results in haemodialysis patients, minimising the risks of treatment with ESAs and reducing costs. Copyright © 2018 Sociedad Española de Nefrología. Published by Elsevier España, S.L.U. All rights reserved.

Telemedicine in the management of chronic pain: a cost analysis study.

PubMed

Pronovost, Antoine; Peng, Philip; Kern, Ralph

2009-08-01

Telemedicine provides patients with easy and remote access to consultant expertise irrespective of geographic location. In a randomized controlled trial, this study has applied a rigorous costing methodology to the use of telemedicine in chronic pain management. We performed a randomized two-period crossover trial comparing in-person (IP) consultation with telemedicine (TM) consultation in the management of chronic pain. Over an 18-month period, 26 patients each completed two diaries capturing their direct and indirect travel costs, daily pain scores, and satisfaction with physician consultation. Costing models were developed to account for direct, indirect, fixed, and variable costs in order to perform break-even analyses. Sensitivity analysis was performed over a broad range of assumptions. Direct patient costs were significantly lower in the TM group than in the IP group, with median cost and interquartile range 133 dollars (28-377) vs 443 dollars (292-1075), respectively (P = 0.001). More patients were highly satisfied with the TM consultation than with the IP consultation (56 and 24%, respectively; P < 0.05). Break-even annual patient volume was estimated at 57 patients. A two-way sensitivity analysis controlling for annual patient volume and round-trip distance indicated that TM remains cost-effective at volumes >50 patients/year or at round-trip distances >200 km. Telemedicine is cost-effective over a broad range of assumptions, including annual patient volumes, travel distance, fuel costs, amortization, and discount rates. This study provides data from a real-world setting to determine relevant thresholds and targets for establishing a TM program for patients who are undergoing chronic pain therapy.

Mobile crisis management teams as part of an effective crisis management system for rural communities.

PubMed

Trantham, Doug; Sherry, Anne

2012-01-01

Mobile crisis management teams provide crisis prevention and intervention services in community settings. The Appalachian Community Services crisis management program shows how such teams can be used to effectively serve rural communities.

Current status and future prospects of hyperthermic intraoperative intraperitoneal chemotherapy (HIPEC) clinical trials in ovarian cancer.

PubMed

Cowan, Renee A; O'Cearbhaill, Roisin E; Zivanovic, Oliver; Chi, Dennis S

2017-08-01

The natural history of advanced-stage epithelial ovarian cancer is one of clinical remission after surgery and platinum/taxane-based intravenous (IV) and/or intraperitoneal (IP) chemotherapy followed by early or late recurrence in the majority of patients. Prevention of progression and recurrence remains a major hurdle in the management of ovarian cancer. Recently, many investigators have evaluated the use of normothermic and hyperthermic intraoperative IP drug delivery as a management strategy. This is a narrative review of the current status of clinical trials of hyperthermic intraoperative intraperitoneal chemotherapy (HIPEC) in ovarian cancer and the future directions for this treatment strategy. The existing studies on HIPEC in patients with epithelial ovarian cancer are mostly retrospective in nature, are heterogeneous with regards to combined inclusion of primary and recurrent disease and lack unbiased data. Until data are available from evidence-based trials, it is reasonable to conclude that surgical cytoreduction and HIPEC is a rational and interesting, though still investigative, approach in the management of epithelial ovarian cancer, whose use should be employed within prospective clinical trials.

Directory of Federal Contacts on Environmental Protection,

DTIC Science & Technology

1982-01-01

Director D. M. Hannemann 111B 0362 Energy Coordinator D. K. Bain f1IP 0102 Support Services W. E. Elgin 1111 0102 Head, Management Branch E. E. Hoover... Hannemann , D. M................................................. 8 Ilannesslager, R.............................................. ... 76 Hansen, A.J

49 CFR 173.427 - Transport requirements for low specific activity (LSA) Class 7 (radioactive) materials and...

Code of Federal Regulations, 2010 CFR

2010-10-01

... package (IP-1, IP-2 or IP-3; § 173.411), subject to the limitations of Table 6; (2) In a DOT Specification... use shipment 1. LSA-I: Solid IP-1 IP-1 Liquid IP-1 IP-2 2. LSA-II: Solid IP-2 IP-2 Liquid and gas IP-2 IP-3 3. LSA-III IP-2 IP-3 4. SCO-I IP-1 IP-1 5. SCO-II IP-2 IP-2 [69 FR 3676, Jan. 26, 2004; 69 FR...

49 CFR 173.427 - Transport requirements for low specific activity (LSA) Class 7 (radioactive) materials and...

Code of Federal Regulations, 2011 CFR

2011-10-01

... package (IP-1, IP-2 or IP-3; § 173.411), subject to the limitations of Table 6; (2) In a DOT Specification... use shipment 1. LSA-I: Solid IP-1 IP-1 Liquid IP-1 IP-2 2. LSA-II: Solid IP-2 IP-2 Liquid and gas IP-2 IP-3 3. LSA-III IP-2 IP-3 4. SCO-I IP-1 IP-1 5. SCO-II IP-2 IP-2 [69 FR 3676, Jan. 26, 2004; 69 FR...

Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

PubMed Central

Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

2010-01-01

Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

PubMed

Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

2010-04-01

Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

Endoscopic treatment of inverted papilloma attached in the frontal sinus/recess.

PubMed

Adriaensen, G F J P M; van der Hout, M W; Reinartz, S M; Georgalas, C; Fokkens, W J

2015-12-01

Inverted papilloma (IP) is a benign sinonasal tumour for which endoscopic surgery, with complete removal of the underlying and surrounding mucoperiosteum at the attachment site followed by drilling and/or coagulation of this area, is the treatment of choice. This can be challenging in the frontal sinus. To report on the outcome of treatment for IPs involving the frontal sinus. To propose the possible use of topical 5-fluorouracil 5% (5-FU) in the postoperative management of challenging IPs. This is a retrospective cohort evaluation of patients with IPs attached in the frontal sinus or in the frontal recess and growing into the frontal sinus. Data on primary or revision surgery, uni- or bilaterality, attachment site, surgical procedure, 5-FU usage, recurrence and follow-up are provided. The end points are disease-free follow-up in months and recurrence. Twenty cases, including fifteen revision cases, were retrieved over a period of ten years. All cases were treated endoscopically. Two cases recurred (10%) and the intervention was repeated. In eight cases, 5-FU was applied at the end of surgery. None of these cases recurred. The mean follow-up after the last intervention was 42 months (standard deviation (SD) 22.1). IP involving the frontal sinus is a surgical challenge that can be successfully addressed endoscopically. The topical application of 5-FU could have a place in postoperative treatment when it is difficult to be absolutely sure that all diseased mucoperichondrium or mucoperiosteum at the attachment site(s) has been completely removed.

[Innate immune response to RNA virus infection].

PubMed

Oshiumi, Hiroyuki; Matsumoto, Misako; Seya, Tsukasa

2011-12-01

Viral RNA is recognized by RIG-I-like receptors and Toll-like receptors. RIG-I is a cytoplasmic viral RNA sensor. High Mobility Group Box (HMGB) proteins and DExD/H box RNA helicases, such as DDX3 and 60, associate with viral RNA. Those proteins promotes the RIG-I binding to viral RNA. RIG-I triggers the signal via IPS-1 adaptor molecule to induce type I IFN. RIG-I harbors Lys63-linked polyubiquitination by Riplet and TRIM25 ubiquitin ligases. The polyubiquitination is essential for RIG-I-mediated signaling. Toll-like receptors are located in endosome. TLR3 recognizes viral double-stranded RNA, and TLR7 and 8 recognize single-strand RNA. Virus has the ability to suppress these innate immune response. For example, to inhibit RIG-I-mediated signaling, HCV core protein suppresses the function of DDX3. In addition, HCV NS3-4A protein cleaves IPS-1 to inhibit the signal. Molecular mechanism of how viral RNA is recognized by innate immune system will make great progress on our understanding of how virus escapes from host immune system.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Connected vehicle data capture and management (DCM) and dynamic mobility applications (DMA) : focused standards coordination plan.

DOT National Transportation Integrated Search

2012-11-01

The Connected Vehicle Mobility Standards Coordination Plan project links activities in three programs (Data Capture and Management, Dynamic Mobility Applications, and ITS Standards). The plan coordinates the timing, intent and relationship of activit...

Using mobile phones in healthcare management for the elderly.

PubMed

Kim, Hun-Sung; Lee, Kye-Hwa; Kim, Hyunah; Kim, Ju Han

2014-12-01

The increasing average life expectancy is simultaneously increasing the incidence of chronic diseases and the number of healthy elderly people, consequently leading to an increased demand for healthcare management methods that do not involve hospital visits. The development of health management services involving mobile phones will change the focus of medical services from hospital visits and treatments to managing the health decisions made by individuals in their daily lives. However, the elderly may experience specific difficulties in adapting to constantly evolving services. This study reviews various health-related devices such as mobile phones that are available for providing healthcare to the elderly, and the different ways of using them. As the use of mobile phone increases, it is expected that elderly mobile phone users will also be able to regularly check their health status at any time and place. The issues of an ageing population pertain to the entire society rather than only to the elderly, which make mobile-phone-based medical informatics as a health management service a worthy goal. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Performance measures for public transit mobility management.

DOT National Transportation Integrated Search

2011-12-01

"Mobility management is an innovative approach for managing and delivering coordinated public : transportation services that embraces the full family of public transit options. At a national level, there are : currently no industry recognized perform...

41 CFR 302-10.5 - May I transport a mobile home over water?

Code of Federal Regulations, 2010 CFR

2010-07-01

... 41 Public Contracts and Property Management 4 2010-07-01 2010-07-01 false May I transport a mobile home over water? 302-10.5 Section 302-10.5 Public Contracts and Property Management Federal Travel... transport a mobile home over water? Yes, you may transport a mobile home over water when both the points of...

41 CFR 302-10.5 - May I transport a mobile home over water?

Code of Federal Regulations, 2011 CFR

2011-07-01

... 41 Public Contracts and Property Management 4 2011-07-01 2011-07-01 false May I transport a mobile home over water? 302-10.5 Section 302-10.5 Public Contracts and Property Management Federal Travel... transport a mobile home over water? Yes, you may transport a mobile home over water when both the points of...

Antiinflammatory, analgesic and hypoglycemic effects of Mangifera indica Linn. (Anacardiaceae) stem-bark aqueous extract.

PubMed

Ojewole, J A O

2005-10-01

Previous studies in our laboratories and elsewhere have shown that some members of Anacardiaceae family possess antiinflammatory, analgesic and hypoglycemic effects in man and mammalian experimental animals. The present study was, therefore, undertaken to examine the antiinflammatory, analgesic and antidiabetic properties of the stem-bark aqueous extract of Mangifera indica Linn., M. indica a member of the Anacardiaceae family, in rats and mice. The stem-bark powder of M. indica was Soxhlet extracted with distilled water and used. The analgesic effect of the plant's extract was evaluated by the hot-plate and acetic acid test models of pain in mice, while the antiinflammatory and antidiabetic effects of the stem-bark extract were investigated in rats, using fresh egg albumin-induced paw edema, and streptozotocin (STZ)-induced diabetes mellitus, respectively. Morphine (MPN, 10 mg/kg i.p.), diclofenac (DIC, 100 mg/kg i.p.), and chlorpropamide (250 mg/kg p.o.) were used respectively as reference analgesic, antiinflammatory, and hypoglycemic agents for comparison. M. indica stem-bark aqueous extract (MIE, 50-800 mg/kg i.p.) produced dose-dependent and significant (p<0.05-0.001) analgesic effects against thermally and chemically induced nociceptive pain stimuli in mice. MIE (50-800 mg/kg i.p.) also significantly (p<0.05-0.001) inhibited fresh egg albumin-induced paw edema, and caused significant (p<0.05-0.001) hypoglycemic effects in rats. It is suggested that the analgesic effects of MIE (50-800 mg/kg i.p.) may be peripherally and centrally mediated. The different chemical constituents of the plant, especially the polyphenolics, flavonoids, triterpenoids, mangiferin, and other chemical compounds present in the plant may be involved in the observed antiinflammatory, analgesic, and hypoglycemic effects of the plant's extract. However, the results of this experimental animal study lend pharmacological credence to the suggested folkloric uses of the plant in the management and control of painful, arthritic and other inflammatory conditions, as well as in the management of adult-onset type 2 diabetes mellitus in some rural African communities. (c) 2005 Prous Science. All rights reserved.

[Support of diabetes dietary management and self-management using mobile applications].

PubMed

Szálka, Brigitta; Kósa, István; Vassányi, István; Mák, Erzsébet

2016-07-01

The key components of successful diabetes therapy are pharmacotherapy, hospital care and lifestyle education. Lifestyle education, self-management, and composing the right diet can be effectively supported with mobile applications. In this paper Hungarian mobile applications are reviewed and compared to some international competitors. Besides plenty of useful functions some deficiencies are identified, based on dietary recommendations. The related improvements together with clinical trials validating effectiveness and reliability can strengthen medical evidence as well as the penetration of such mobile applications. Orv. Hetil., 2016, 157(29), 1147-1153.

Managing mobility outcomes in vulnerable seniors ( MMOVeS): a randomized controlled pilot study.

PubMed

Figueiredo, Sabrina; Morais, Jose A; Mayo, Nancy

2017-12-01

To estimate feasibility and potential for efficacy of an individualized, exercise-focused, self-management program (i.e. Managing Mobility Outcomes In Vulnerable Seniors ( MMOVeS)), in comparison to exercise information in improving mobility after six months among seniors recently discharged from hospital. Randomized pilot study. Two McGill University-teaching hospitals. Community dwelling seniors, aged 70 years and older, recently discharged from either participating hospitals. The physiotherapy-facilitated intervention consisted of (1) evaluation of mobility capacity, (2) setting short- and long-term goals, (3) delineation of an exercise treatment plan, (4) an educational booklet to enhance mobility self-management skills, and (5) six monthly telephone calls. Control group received a booklet with information on exercises targeting mobility limitations in seniors. Mobility, pain, and health status were assessed at baseline and at six months using multiple indicators drawn from Disabilities of the Arm, Shoulder, and Hand (DASH) Score, Lower Extremity Functional Scale (LEFS) and Short-Form (SF)-36. In all, 26 people were randomized to the intervention (mean age: 81 ± 8; 39% women), and 23 were randomized to the control (mean age: 79 ± 7; 33% women). The odds ratio for the mobility outcomes combined was 3.08 and the 95% confidence interval excluded 1 (1.65-5.77). The odds ratio for pain and health perception favored the MMOVeS group, but the 95% confidence interval included the null value. This feasibility study highlights the potential for efficacy of an individualized, exercise-focused, self-management program in comparison to exercise information in improving mobility outcome for seniors. Furthermore, a home-program combining self-management skills and exercise taught with minimal supervision prove to be feasible. Finally, data from this study can be used to estimate sample size for a confirmatory trial.

Distributed Communications Resource Management for Tracking and Surveillance Networks

DTIC Science & Technology

2005-08-01

Principles of Economics , Ludwig von Mises Institute, Auburn, AL, 2004. 13. J. Wang, L. Li, S. H. Low and J. C. Doyle, “Cross-layer Optimization in TCP/IP Networks,” IEEE/ACM Trans. on Networking, 2005, to appear.

Diabetes Professionals Must Seize the Opportunity in Mobile Health

PubMed Central

Brandell, Brian; Ford, Christopher

2013-01-01

The number of diabetes management mobile applications (apps) available on the market has grown exponentially since 2009; however, most patients lack the skills necessary for finding relevant health care information. Thus, clinical best practices emphasize the need for ongoing patient education. Despite the importance of education in clinical guidelines, very few of these apps include education in their top functionalities. Most diabetes management mobile apps are not medical devices by definition, according to the U.S. Food and Drug Administration, and therefore do not require clearance or approval for market, and very few have been subject to clinical evaluation. There has been little research on the use of diabetes management mobile apps, marginalizing the role of diabetes professionals and educators in a burgeoning market, hungry for information and an improved quality of life. Still, mobile technology holds great promise as a platform for self-management. Health care providers must not only educate patients about these resources, but take steps to ensure that mobile apps follow accepted best practices and guidelines. PMID:24351188

Integrating Personalized and Community Services for Mobile Travel Planning and Management

NASA Astrophysics Data System (ADS)

Yu, Chien-Chih

Personalized and community services have been noted as keys to enhance and facilitate e-tourism as well as mobile applications. This paper aims at proposing an integrated service framework for combining personalized and community functions to support mobile travel planning and management. Major mobile tourism related planning and decision support functions specified include personalized profile management, information search and notification, evaluation and recommendation, do-it-yourself planning and design, community and collaboration management, auction and negotiation, transaction and payment, as well as trip tracking and quality control. A system implementation process with an example prototype is also presented for illustrating the feasibility and effectiveness of the proposed system framework, process model, and development methodology.

Classifier fusion for VoIP attacks classification

NASA Astrophysics Data System (ADS)

Safarik, Jakub; Rezac, Filip

2017-05-01

SIP is one of the most successful protocols in the field of IP telephony communication. It establishes and manages VoIP calls. As the number of SIP implementation rises, we can expect a higher number of attacks on the communication system in the near future. This work aims at malicious SIP traffic classification. A number of various machine learning algorithms have been developed for attack classification. The paper presents a comparison of current research and the use of classifier fusion method leading to a potential decrease in classification error rate. Use of classifier combination makes a more robust solution without difficulties that may affect single algorithms. Different voting schemes, combination rules, and classifiers are discussed to improve the overall performance. All classifiers have been trained on real malicious traffic. The concept of traffic monitoring depends on the network of honeypot nodes. These honeypots run in several networks spread in different locations. Separation of honeypots allows us to gain an independent and trustworthy attack information.

Promising practices in vocational services for the community reintegration of returning veterans: The individual placement and support model and beyond.

PubMed

Wewiorski, Nancy J; Gorman, Jay A; Scoglio, Arielle A J; Fukuda, Seiya; Reilly, Erin; Mueller, Lisa; O'Connor, Maureen; Penk, Walter E; Drebing, Charles E

2018-05-01

Supporting returning veterans' job-seeking, hiring, and retention issues has become an essential goal for effective community reintegration. Given both the particular strengths and challenges associated with veterans transitioning from military to civilian life, multiple models for supported employment have become integrated into Veterans Affairs health care facilities across the nation. In this article, we review the state of vocational rehabilitation for veterans, with a particular focus on individual placement and support-supported employment (IPS-SE), the current vocational services model that is considered the gold standard of vocational rehabilitation. Various modifications to the IPS-SE model are presented, including additions such as cognitive rehabilitation, contingency management, motivational interviewing, supported self-employment, and transitional work. Finally, recommendations are made about future directions and strategies to expand access to IPS-SE-based programs and to effectively meet the needs of returning veterans for employment in jobs of their choice. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

mTOR pathway and Ca2+ stores mobilization in aged smooth muscle cells

PubMed Central

Martín-Cano, Francisco E; Camello-Almaraz, Cristina; Hernandez, David; Pozo, Maria J; Camello, Pedro J

2013-01-01

Aging is considered to be driven by the so called senescence pathways, especially the mTOR route, although there is almost no information on its activity in aged tissues. Aging also induces Ca2+ signal alterations, but information regarding the mechanisms for these changes is almost inexistent. We investigated the possible involvement of the mTOR pathway in the age-dependent changes on Ca2+ stores mobilization in colonic smooth muscle cells of young (4 month old) and aged (24 month old) guinea pigs. mTORC1 activity was enhanced in aged smooth muscle, as revealed by phosphorylation of mTOR and its direct substrates S6K1 and 4E-BP1. Mobilization of intracellular Ca2+ stores through IP3R or RyR channels was impaired in aged cells, and it was facilitated by mTOR and by FKBP12, as indicated by the inhibitory effects of KU0063794 (a direct mTOR inhibitor), rapamycin (a FKBP12-mediated mTOR inhibitor) and FK506 (an FKBP12 binding immunosuppressant). Aging suppressed the facilitation of the Ca2+ mobilization by FKBP12 but not by mTOR, without changing the total expression of FKBP12 protein. In conclusion, or study shows that in smooth muscle aging enhances the constitutive activity of mTORC1 pathway and impairs Ca2+ stores mobilization by suppression of the FKBP12-induced facilitation of Ca2+ release. PMID:23661091

A dynamic traction splint for the management of extrinsic tendon tightness.

PubMed

Dovelle, S; Heeter, P K; Phillips, P D

1987-02-01

The dynamic traction splint designed by therapists at Walter Reed Army Medical Center is used for the management of extrinsic extensor tendon tightness commonly seen in brachial plexus injuries and traumatic soft tissue injuries of the upper extremity. The two components of the splint allow for simultaneous maximum flexion of the MCP and IP joints. This simple and economical splint provides an additional modality to any occupational therapy service involved in the management of upper extremity disorders.

The UNITAID Patent Pool Initiative: Bringing Patents Together for the Common Good

PubMed Central

Bermudez, Jorge; 't Hoen, Ellen

2010-01-01

Developing and delivering appropriate, affordable, well-adapted medicines for HIV/AIDS remains an urgent challenge: as first-line therapies fail, increasing numbers of people require costly second-line therapy; one-third of ARVs are not available in pediatric formulations; and certain key first- and second-line triple fixed-dose combinations do not exist or sufficient suppliers are lacking. UNITAID aims to help solve these problems through an innovative initiative for the collective management of intellectual property (IP) rights – a patent pool for HIV medicines. The idea behind a patent pool is that patent holders - companies, governments, researchers or universities - voluntarily offer, under certain conditions, the IP related to their inventions to the patent pool. Any company that wants to use the IP to produce or develop medicines can seek a license from the pool against the payment of royalties, and may then produce the medicines for use in developing countries (conditional upon meeting agreed quality standards). The patent pool will be a voluntary mechanism, meaning its success will largely depend on the willingness of pharmaceutical companies to participate and commit their IP to the pool. Generic producers must also be willing to cooperate. The pool has the potential to provide benefits to all. PMID:20309404

Connected vehicle Data Capture and Management (DCM) and dynamic mobility applications (DMA) : assessment of relevant standards and gaps for candidate applications.

DOT National Transportation Integrated Search

2012-10-01

The Connected Vehicle Mobility Standards Coordination Plan project links activities in three programs (Data Capture and Management, Dynamic Mobility Applications, and ITS Standards). The plan coordinates the timing, intent and relationship of activit...

EMSODEV and EPOS-IP: key findings for effective management of EU research infrastructure projects

NASA Astrophysics Data System (ADS)

Materia, Paola; Bozzoli, Sabrina; Beranzoli, Laura; Cocco, Massimo; Favali, Paolo; Freda, Carmela; Sangianantoni, Agata

2017-04-01

EMSO (European Multidisciplinary Seafloor and water-column Observatory, http://www.emso-eu.org) and EPOS (European Plate Observing System, https://www.epos-ip.org) are pan-European Research Infrastructures (RIs) in the ESFRI 2016 Roadmap. EMSO has recently become an ERIC (European Research Infrastructure Consortium), whilst EPOS application is in progress. Both ERICs will be hosted in Italy and the "Representing Entity" is INGV. EMSO consists of oceanic environment observation systems spanning from the Arctic through the Atlantic and Mediterranean, to the Black Sea for long-term, high-resolution, real-time monitoring of natural and man-induced processes such as hazards, climate, and marine ecosystems changes to study their evolution and interconnections. EPOS aims at creating a pan-European infrastructure for solid Earth science to support a safe and sustainable society. EPOS will enable innovative multidisciplinary research for a better understanding of Earth's physical and chemical processes controlling earthquakes, volcanic eruptions, ground instability, tsunami, and all those processes driving tectonics and Earth's surface dynamics. Following the conclusion of their Preparatory Phases the two RIs are now in their Implementation Phase still supported by the EC through the EMSODEV and EPOS-IP projects, both run by dedicated Project Management Offices at INGV with sound experience in EU projects. EMSODEV (H2020 project, 2015-2018) involves 11 partners and 9 associate partners and aims at improving the harmonization among the EMSO ERIC observation systems through the realization of EMSO Generic Instrument Modules (EGIMs), and a Data Management Platform (DMP) to implement interoperability and standardization. The DMP will provide access to data from all EMSO nodes, providing a unified, homogeneous, infrastructure-scale and user-oriented platform integrated with the increased measurement capabilities and functions provided by the EGIMs. EPOS IP (H2020 project, 2015-2019) is a project of 47 partners, 6 associate partners and several international organizations for a total of 25 countries involved. EPOS IP is a key step in EPOS' mission of a pan-European Earth science integrated platform. It will deliver not only a suite of domain-specific and multidisciplinary data and services in one platform, but also the legal, governance and financial frameworks to ensure the infrastructure future operation and sustainability (EPOS ERIC). INGV experience over the years indicates that effective management of EU RIs projects should contain 5 basic elements: 1.Defined life cycle and milestones: Map of phases, deliverables, key milestones and sufficiency criteria for each group involved in the project using project management tools and software. 2.Shared organization, systems, roles: Defined roles for team members and responsibilities for functional managers are crucial. Similarly, a system of communication and team involvement is essential to success. Leadership and interpersonal/organizational skills are also important. 3.Quality assurance: Quality dimension should be aligned to the project objectives and specific criteria should be identified for each phase of the project. 4.Tracking and variance analysis: Regular reports and periodic meetings of the teams are crucial to identify when things are off target. Schedule slips, cost overruns, open issues, new risks and problems must be dealt with as early as possible. 5.Impact assessment by monitoring the achievement of results and socio-economic impact.

Cancer care management through a mobile phone health approach: key considerations.

PubMed

Mohammadzadeh, Niloofar; Safdari, Reza; Rahimi, Azin

2013-01-01

Greater use of mobile phone devices seems inevitable because the health industry and cancer care are facing challenges such as resource constraints, rising care costs, the need for immediate access to healthcare data of types such as audio video texts for early detection and treatment of patients and increasing remote aids in telemedicine. Physicians, in order to study the causes of cancer, detect cancer earlier, act in prevention measures, determine the effectiveness of treatment and specify the reasons for the treatment ineffectiveness, need to access accurate, comprehensive and timely cancer data. Mobile devices provide opportunities and can play an important role in consulting, diagnosis, treatment, and quick access to health information. There easy carriage make them perfect tools for healthcare providers in cancer care management. Key factors in cancer care management systems through a mobile phone health approach must be considered such as human resources, confidentiality and privacy, legal and ethical issues, appropriate ICT and provider infrastructure and costs in general aspects and interoperability, human relationships, types of mobile devices and telecommunication related points in specific aspects. The successful implementation of mobile-based systems in cancer care management will constantly face many challenges. Hence, in applying mobile cancer care, involvement of users and considering their needs in all phases of project, providing adequate bandwidth, preparation of standard tools that provide maximum mobility and flexibility for users, decreasing obstacles to interrupt network communications, and using suitable communication protocols are essential. It is obvious that identifying and reducing barriers and strengthening the positive points will have a significant role in appropriate planning and promoting the achievements of mobile cancer care systems. The aim of this article is to explain key points which should be considered in designing appropriate mobile health systems in cancer care as an approach for improving cancer care management.

Cyber Infrastructure Protection

DTIC Science & Technology

2011-05-01

274 TOWARD A SOLUTION THAT WORKS Building on our long history of involvement in assuring all types of communications networks, Tel- cordia has...wireless, and security areas. He currently has responsibility for a new Tel- cordia software product in IP network management, and has led all product

Computer and mobile technology interventions to promote medication adherence and disease management in people with thalassemia

PubMed Central

Badawy, Sherif M; Morrone, Kerry; Thompson, Alexis; Palermo, Tonya M

2018-01-01

This is a protocol for a Cochrane Review (Intervention). The objectives are as follows: To identify and assess the effects of computer and mobile technology interventions designed to facilitate medication adherence and disease management in individuals with thalassemia, including: evaluating the effects of using computer and mobile technology interventions for medication adherence and disease management on health and behavioural outcomes;identifying and assessing the effects of computer and mobile technology interventions specific to different age groups (children, adolescents and adults) and type of modality (e.g. cell phone, the Internet). PMID:29861660

Teacher Education Perceptions of a Proposed Mobile Classroom Manager

ERIC Educational Resources Information Center

Marcial, Dave E.

2015-01-01

In a knowledge-driven enterprise, mobile learning introduces new ways for students to learn and educators to teach. This paper investigates the acceptability of a mobile classroom manager among teacher educators in Central Visayas, Philippines. Specifically, this paper presents findings from an empirical investigation on the level of perceived…

A Service-oriented Approach towards Context-aware Mobile Learning Management Systems

DTIC Science & Technology

2010-07-01

towards a pervasive university. Keywords-context-aware computing, service-oriented archi- tecture, mobile computing, elearning , learn management sys- tem I...usage of device- specific features provide support for various ubiquitous and pervasive eLearning scenarios [2][3]. By knowing where the user currently...data from the mobile device towards a context-aware mobile LMS. II. BASIC CONCEPTS For a better understanding of the presented eLearning sce- narios

Performance Analysis of Hierarchical Group Key Management Integrated with Adaptive Intrusion Detection in Mobile ad hoc Networks

DTIC Science & Technology

2016-04-05

applications in wireless networks such as military battlefields, emergency response, mobile commerce , online gaming, and collaborative work are based on the...www.elsevier.com/locate/peva Performance analysis of hierarchical group key management integrated with adaptive intrusion detection in mobile ad hoc...Accepted 19 September 2010 Available online 26 September 2010 Keywords: Mobile ad hoc networks Intrusion detection Group communication systems Group

The Roles of Chronic Disease Complexity, Health System Integration, and Care Management in Post-Discharge Healthcare Utilization in a Low-Income Population.

PubMed

Hewner, Sharon; Casucci, Sabrina; Castner, Jessica

2016-08-01

Economically disadvantaged individuals with chronic disease have high rates of in-patient (IP) readmission and emergency department (ED) utilization following initial hospitalization. The purpose of this study was to explore the relationships between chronic disease complexity, health system integration (admission to accountable care organization [ACO] hospital), availability of care management interventions (membership in managed care organization [MCO]), and 90-day post-discharge healthcare utilization. We used de-identified Medicaid claims data from two counties in western New York. The study population was 114,295 individuals who met inclusion criteria, of whom 7,179 had index hospital admissions in the first 9 months of 2013. Individuals were assigned to three disease complexity segments based on presence of 12 prevalent conditions. The 30-day inpatient (IP) readmission rates ranged from 6% in the non-chronic segment to 12% in the chronic disease complexity segment and 21% in the organ system failure complexity segment. Rehospitalization rates (both inpatient and emergency department [ED]) were lower for patients in MCOs and ACOs than for those in fee-for-service care. Complexity of chronic disease, initial hospitalization in a facility that was part of an ACO, MCO membership, female gender, and longer length of stay were associated with a significantly longer time to readmission in the first 90 days, that is, fewer readmissions. Our results add to evidence that high-value post-discharge utilization (fewer IP or ED rehospitalizations and early outpatient follow-up) require population-based transitional care strategies that improve continuity between settings and take into account the illness complexity of the Medicaid population. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Subarachnoid hemorrhage as complication of phenylephrine injection for the treatment of ischemic priapism in a sickle cell disease patient.

PubMed

Davila, Hugo H; Parker, Justin; Webster, J Christopher; Lockhart, Jorge L; Carrion, Rafael E

2008-04-01

Ischemic priapism (IP) is a urologic condition, which necessitates prompt management. Intracavernosal injection of phenylephrine is a usual treatment modality utilized for the management of these patients. Aim. We present a case of subarachnoid hemorrhage following intracavernosal injection of phenylephrine for IP in a patient with sickle cell disease. We analyzed the degree of subarachnoid hemorrhage in our patient after intracavernosal injection of phenylephrine. The patient had an acute rise in blood pressure during corporal irrigation. This was followed by the onset of severe headache. Computed tomography (CT) scan confirmed the diagnosis of a subarachnoid hemorrhage. Subarachnoid hemorrhage associated with intracavernosal injection of phenylephrine. Result. A 23-year-old African American male with a history of sickle cell disease presented with a painful penile erection. The patient was started on intravenous fluids, oxygen by nasal canula, and analgesic medication. After this, a blood gas was obtained from his left corpora cavernosa. This was followed by normal saline irrigation and injection of phenylephrine. The patient complained of a sudden, severe "terrible headache" immediately following the last injection, and noncontrast CT scan of the head was obtained and a subarachnoid hemorrhage was noted. The patient was admitted for observation and no significant changes were noted. Intracavernosal injection of phenylephrine for the management of IP can be associated with several possible complications. We present our single case complicated with the formation of a subarachnoid hemorrhage. The patient was treated conservatively and had no long-term neurologic sequelae. Davila HH, Parker J, Webster JC, Lockhart JL, and Carrion RE. Subarachnoid hemorrhage as complication of phenylephrine injection for the treatment of ischemic priapism in a sickle cell disease patient.

Dynamic Transportation Navigation

NASA Astrophysics Data System (ADS)

Meng, Xiaofeng; Chen, Jidong

Miniaturization of computing devices, and advances in wireless communication and sensor technology are some of the forces that are propagating computing from the stationary desktop to the mobile outdoors. Some important classes of new applications that will be enabled by this revolutionary development include intelligent traffic management, location-based services, tourist services, mobile electronic commerce, and digital battlefield. Some existing application classes that will benefit from the development include transportation and air traffic control, weather forecasting, emergency response, mobile resource management, and mobile workforce. Location management, i.e., the management of transient location information, is an enabling technology for all these applications. In this chapter, we present the applications of moving objects management and their functionalities, in particular, the application of dynamic traffic navigation, which is a challenge due to the highly variable traffic state and the requirement of fast, on-line computations.

Industry-University Collaborations in Canada, Japan, the UK and USA – With Emphasis on Publication Freedom and Managing the Intellectual Property Lock-Up Problem

PubMed Central

Kneller, Robert; Mongeon, Marcel; Cope, Jeff; Garner, Cathy; Ternouth, Philip

2014-01-01

As industry-university collaborations are promoted to commercialize university research and foster economic growth, it is important to understand how companies benefit from these collaborations, and to ensure that resulting academic discoveries are developed for the benefit of all stakeholders: companies, universities and public. Lock up of inventions, and censoring of academic publications, should be avoided if feasible. This case-study analysis of interviews with 90 companies in Canada, Japan, the UK and USA assesses the scope of this challenge and suggests possible resolutions. The participating companies were asked to describe an important interaction with universities, and most described collaborative research. The most frequently cited tensions concerned intellectual property management and publication freedom. IP disagreements were most frequent in the context of narrowly-focused collaborations with American universities. However, in the case of exploratory research, companies accepted the IP management practices of US universities. It might make sense to let companies have an automatic exclusive license to IP from narrowly defined collaborations, but to encourage universities to manage inventions from exploratory collaborations to ensure development incentives. Although Canada, the UK and US have strong publication freedom guarantees, tensions over this issue arose frequently in focused collaborations, though were rare in exploratory collaborations. The UK Lambert Agreements give sponsors the option to control publications in return for paying the full economic cost of a project. This may offer a model for the other three countries. Uniquely among the four countries, Japan enables companies to control exclusively most collaborative inventions and to censor academic publications. Despite this high degree of control, the interviews suggest many companies do not develop university discoveries to their full potential. The steps suggested above may rebalance the situation in Japan. Overall, the interviews reveal the complexity of these issues and the need for flexibility on the part of universities and companies. PMID:24632805

Hierarchical Trust Management of COI in Heterogeneous Mobile Networks

DTIC Science & Technology

2017-08-01

PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 5c. PROGRAM ELEMENT NUMBER 5b. GRANT NUMBER 5a. CONTRACT NUMBER Form Approved OMB NO. 0704...Report: Hierarchical Trust Management of COI in Heterogeneous Mobile Networks The views, opinions and/or findings contained in this report are those of...Institute & State University Title: Hierarchical Trust Management of COI in Heterogeneous Mobile Networks Report Term: 0-Other Email: irchen@vt.edu

Supporting cancer patients in illness management: usability evaluation of a mobile app.

PubMed

Mirkovic, Jelena; Kaufman, David R; Ruland, Cornelia M

2014-08-13

Mobile phones and tablets currently represent a significant presence in people's everyday lives. They enable access to different information and services independent of current place and time. Such widespread connectivity offers significant potential in different app areas including health care. Our goal was to evaluate the usability of the Connect Mobile app. The mobile app enables mobile access to the Connect system, an online system that supports cancer patients in managing health-related issues. Along with symptom management, the system promotes better patient-provider communication, collaboration, and shared decision making. The Connect Mobile app enables access to the Connect system over both mobile phones and tablets. The study consisted of usability tests of a high fidelity prototype with 7 cancer patients where the objectives were to identify existing design and functionality issues and to provide patients with a real look-and-feel of the mobile system. In addition, we conducted semistructured interviews to obtain participants' feedback about app usefulness, identify the need for new system features and design requirements, and measure the acceptance of the mobile app and its features within everyday health management. The study revealed a total of 27 design issues (13 for mobile apps and 14 for tablet apps), which were mapped to source events (ie, errors, requests for help, participants' concurrent feedback, and moderator observation). We also applied usability heuristics to identify violations of usability principles. The majority of violations were related to enabling ease of input, screen readability, and glanceability (15 issues), as well as supporting an appropriate match between systems and the real world (7 issues) and consistent mapping of system functions and interactions (4 issues). Feedback from participants also showed the cancer patients' requirements for support systems and how these needs are influenced by different context-related factors, such as type of access terminal (eg, desktop computer, tablet, mobile phone) and phases of illness. Based on the observed results, we proposed design and functionality recommendations that can be used for the development of mobile apps for cancer patients to support their health management process. Understanding and addressing users' requirements is one of the main prerequisites for developing useful and effective technology-based health interventions. The results of this study outline different user requirements related to the design of the mobile patient support app for cancer patients. The results will be used in the iterative development of the Connect Mobile app and can also inform other developers and researchers in development, integration, and evaluation of mobile health apps and services that support cancer patients in managing their health-related issues.

It cannot be all about safety: the benefits of prolonged mobility.

PubMed

Oxley, Jennifer; Whelan, Michelle

2008-08-01

While there is much emphasis on managing the safety of older road users, there is limited understanding and recognition of the significance of mobility and transportation needs, mobility changes in later life, and the impact of reduced mobility on quality of life. Moreover, there is little information about the measures that can be taken to increase or at least maintain mobility in older age. A systematic literature review was undertaken to address the issues associated with the transportation and mobility needs of older road users. Articles and publications were selected for relevance and research strength and strategies and measures aimed to manage the safe mobility of older road users were reviewed. The review provides clear evidence that, for older adults who cease driving, quality of life is reduced and that there are a number of adverse consequences of poor mobility. The misconceptions regarding the risks that older drivers pose on the road and how their safe mobility should be managed are discussed, particularly the implications of current licensing procedures on mobility. Evidence is also presented showing there are subgroups of older adults who are more likely to suffer more pronounced mobility consequences including women and financially disadvantaged groups. Moreover, "best-practice" strategies for maintaining at least some level of mobility for older adults are highlighted in four broad categories: safer road users, safer vehicles, safer roads and infrastructure, and provision of new and innovative alternative transport options that are specifically tailored to older adults. Provision of safe travel options that allow easy access to services and amenities is a vital factor in maintaining mobility amongst older road users. An understanding that continued mobility means access to a private vehicle, either as a driver (for as long as possible as it is safe to drive) or as a passenger, and easy and practical access to other forms of transport is essential in the management of health, well-being, and the safe mobility of older road users.

Infectious peritonitis profile in peritoneal dialysis at Ibn Sina University Hospital: a 6-year data report.

PubMed

Bekaoui, Samira; Haddiya, Intissar; Houti, Maria Slimani; Berkchi, Fatima Zahra; Ezaitouni, Fatima; Ouzeddoun, Naima; Bayahia, Rabia; Benamar, Loubna

2014-01-01

Infectious peritonitis (IP) is the most common complication in peritoneal dialysis (PD). The purpose of this study is to assess the prevalence of IP and to determine its clinical, biological, and evolutive characteristics. We conducted a five year, five months retrospective study from July 2006 to December 2011. All patients on peritoneal dialysis that have been followed on PD for a minimum of 3 months and who presented IP during follow-up were included. Data were analyzed using SPSS 17.0. The 76 episodes of IP were identified in 36 patients. The peritonitis rate (months × patients/peritonitis), as calculated by the Registre de Dialyse Péritonéale de Langue Française (RDPLF Registry) [French peritoneal dialysis registry] in December 2011, was 18.59. Time to occurrence of peritonitis from the start of peritoneal exchange was 15.44±10 months. The mean age of our patients was 49.1±16.8 years [10-80]: the youngest patient's age was 10, while the oldest was 80 years old (male to female: sex ratio M/F=1,66). Also, 22% of our patients were diabetic. The mean follow-up in PD was 22.6±14 months. Abdominal pain was present in 79% of the cases. Fever and vomiting were noted in 42% and 38% of cases, respectively. The C-reactive protein rate was elevated in 77% of cases, and leukocytosis was found in 27% of cases. Bacteriological proof was present in 73.68% of cases. Gram-positive cocci were involved in 56.6% of microbiologically proven IP cases. Gram-negative bacilli were represented in 37.7%. The outcome was favorable in 89.4%. The PD catheter was removed in 2.63% of the cases. In addition, 7.89% of our patients were transferred to hemodialysis. The rate of IP remains high in our series. More than one-half of the peritonitis cases with positive cultures (56.6%) were caused by Gram-positive cocci. Gram-negative bacilli ranked second (27.7%). These results agree with data in the literature. Moreover, the rate of culture-negative IP in our series is high (26%). Evolution is good in most cases (89%). Despite the gradual decrease of its rate, peritonitis remains frequent in our center and calls for optimization of means of prevention. The high frequency of negative culture IP in our study urges us toward better collaboration with biologists to target antibiotic therapy and improve IP management.

Phosphorous Speciation in WTR-treated Biosolids Using XANES

NASA Astrophysics Data System (ADS)

Zhang, T. Q.; Huff, D.; Lin, Z.-Q.

2009-04-01

The concept of co-application of biosolids and drinking water treatment residues (DWTRs) represents an environmentally sustainable and economically sound strategy for the management of municipal solid wastes. This study demonstrated the effectiveness of reducing water-soluble P in biosolids-amended agricultural soil by the addition of DWTRs. Results showed that total P in soil leachate was significantly reduced during the initial 42-days of a 200-day greenhouse study when biosolids (50 g kg-1) were applied along with DWTRs (40 g kg-1). Particulate P was the dominant fraction of P in the soil leachate, which decreases with increasing DWTR application rate. The application of DWTRs does not significantly decrease the growth and yield of wheat (Triticum aestivum L.). The primary P chemical composition in biosolids include cupper phytate [Cu(IP6)6], barium phytate [Ba6IP6], and cupper phosphate [Cu3(PO4)2]. The addition of DWTRs to biosolids alternated the P speciation, and the P speciation change became significant with increasing the incubation time of the mixture of biosolids and DWTRs. The chemical component of Cu3(PO4)2 became non significant (<5%) with the addition of DWTRs. During the 14-day incubation time period, the proportion of P that was adsorbed on amorphous Fe(OH)3 increased substantially from 8 to 46% and Ba6IP6 increased steadily from 30 to 50%, while the proportion of Cu(IP6)6 decreased significantly from 53 to 5%. The amorphous Fe(OH)3-adsorbed P and Ba6IP6 formed the dominant P chemical components in the mixture of biosolids and DWTRs.

The antidepressant effects of curcumin in the forced swimming test involve 5-HT1 and 5-HT2 receptors.

PubMed

Wang, Rui; Xu, Ying; Wu, Hong-Li; Li, Ying-Bo; Li, Yu-Hua; Guo, Jia-Bin; Li, Xue-Jun

2008-01-06

Curcuma longa is a main constituent of many traditional Chinese medicines, such as Xiaoyao-san, used to manage mental disorders effectively. Curcumin is a major active component of C. longa and its antidepressant-like effect has been previously demonstrated in the forced swimming test. The purpose of this study was to explore the possible contribution of serotonin (5-HT) receptors in the behavioral effects induced by curcumin in this animal model of depression. 5-HT was depleted by the tryptophan hydroxylase inhibitor p-chlorophenylalanine (PCPA, 100 mg/kg, i.p.) prior to the administration of curcumin, and the consequent results showed that PCPA blocked the anti-immobility effect of curcumin in forced swimming test, suggesting the involvement of the serotonergic system. Moreover, pre-treatment of pindolol (10 mg/kg, i.p., a beta-adrenoceptors blocker/5-HT(1A/1B) receptor antagonist), 4-(2'-methoxy-phenyl)-1-[2'-(n-2''-pyridinyl)-p-iodobenzamino-]ethyl-piperazine (p-MPPI, 1 mg/kg, s.c., a selective 5-HT(1A) receptor antagonist), or 1-(2-(1-pyrrolyl)-phenoxy)-3-isopropylamino-2-propanol (isamoltane, 2.5 mg/kg, i.p., a 5-HT(1B) receptor antagonist) was found to prevent the effect of curcumin (10 mg/kg) in forced swimming test. On the other hand, a sub-effective dose of curcumin (2.5 mg/kg, p.o.) produced a synergistic effect when given jointly with (+)-8-hydroxy-2-(di-n-propylamino)tetralin, (8-OH-DPAT, 1 mg/kg, i.p., a 5-HT(1A) receptor agonist), anpirtoline (0.25 mg/kg, i.p., a 5-HT(1B) receptor agonist) or ritanserin (4 mg/kg, i.p., a 5-HT(2A/2C) receptor antagonist), but not with ketanserin (5 mg/kg, i.p., a 5-HT(2A/2C) receptor antagonist with higher affinity to 5-HT(2A) receptor) or R(-)-1-(2,5-dimethoxy-4-iodophenyl)-2-aminopropane (DOI, 1 mg/kg, i.p., a 5-HT(2A) receptor agonist). Taken together, these results indicate that the antidepressant-like effect of curcumin in the forced swimming test is related to serotonergic system and may be mediated by, at least in part, an interaction with 5-HT(1A/1B) and 5-HT(2C) receptors.

Design and implement of mobile equipment management system based on QRcode

NASA Astrophysics Data System (ADS)

Yu, Runze; Duan, Xiaohui; Jiao, Bingli

2017-08-01

A mobile equipment management system based on QRcode is proposed for remote and convenient device management. Unlike conventional systems, the system here makes managers accessible to real-time information with smart phones. Compared with the conventional method, which can only be operated with specific devices, this lightweight and efficient tele management mode is conducive to the asset management in multiple scenarios.

Protease-Activated Receptor 4 Induces Bladder Pain through High Mobility Group Box-1

PubMed Central

Kouzoukas, Dimitrios E.; Ma, Fei; Meyer-Siegler, Katherine L.; Westlund, Karin N.; Hunt, David E.; Vera, Pedro L.

2016-01-01

Pain is the significant presenting symptom in Interstitial Cystitis/Painful Bladder Syndrome (IC/PBS). Activation of urothelial protease activated receptor 4 (PAR4) causes pain through release of urothelial macrophage migration inhibitory factor (MIF). High Mobility Group Box-1 (HMGB1), a chromatin-binding protein, mediates bladder pain (but not inflammation) in an experimental model (cyclophosphamide) of cystitis. To determine if PAR4-induced bladder hypersensitivity depends on HMGB1 downstream, we tested whether: 1) bladder PAR4 stimulation affected urothelial HMGB1 release; 2) blocking MIF inhibited urothelial HMGB1 release; and 3) blocking HMGB1 prevented PAR4-induced bladder hypersensitivity. HMGB1 release was examined in immortalized human urothelial cultures (UROtsa) exposed to PAR4-activating peptide (PAR4-AP; 100 μM; 2 hours) or scrambled control peptide. Female C57BL/6 mice, pretreated with a HMGB1 inhibitor (glycyrrhizin: 50 mg/kg; ip) or vehicle, received intravesical PAR4-AP or a control peptide (100 μM; 1 hour) to determine 1) HMGB1 levels at 1 hour in the intravesical fluid (released HMGB1) and urothelium, and 2) abdominal hypersensitivity to von Frey filament stimulation 24 hours later. We also tested mice pretreated with a MIF blocker (ISO-1: 20 mg/kg; ip) to determine whether MIF mediated PAR4-induced urothelial HMGB1 release. PAR4-AP triggered HMGB1 release from human (in vitro) and mice (in vivo) urothelial cells. Intravesical PAR4 activation elicited abdominal hypersensitivity in mice that was prevented by blocking HMGB1. MIF inhibition prevented PAR4-mediated HMGB1 release from mouse urothelium. Urothelial MIF and HGMB1 represent novel targets for therapeutic intervention in bladder pain conditions. PMID:27010488

Modulation of Endoplasmic Reticulum Stress Controls CD4+ T-cell Activation and Antitumor Function.

PubMed

Thaxton, Jessica E; Wallace, Caroline; Riesenberg, Brian; Zhang, Yongliang; Paulos, Chrystal M; Beeson, Craig C; Liu, Bei; Li, Zihai

2017-08-01

The endoplasmic reticulum (ER) is an energy-sensing organelle with intimate ties to programming cell activation and metabolic fate. T-cell receptor (TCR) activation represents a form of acute cell stress and induces mobilization of ER Ca 2+ stores. The role of the ER in programming T-cell activation and metabolic fate remains largely undefined. Gp96 is an ER protein with functions as a molecular chaperone and Ca 2+ buffering protein. We hypothesized that the ER stress response may be important for CD4 + T-cell activation and that gp96 may be integral to this process. To test our hypothesis, we utilized genetic deletion of the gp96 gene Hsp90b1 in a CD4 + T cell-specific manner. We show that gp96-deficient CD4 + T cells cannot undergo activation-induced glycolysis due to defective Ca 2+ mobilization upon TCR engagement. We found that activating naïve CD4 + T cells while inhibiting ER Ca 2+ exchange, through pharmacological blockade of the ER Ca 2+ channel inositol trisphosphate receptor (IP 3 R), led to a reduction in cytosolic Ca 2+ content and generated a pool of CD62L high /CD44 low CD4 + T cells compared with wild-type (WT) matched controls. In vivo IP 3 R-inhibited CD4 + T cells exhibited elevated tumor control above WT T cells. Together, these data show that ER-modulated cytosolic Ca 2+ plays a role in defining CD4 + T-cell phenotype and function. Factors associated with the ER stress response are suitable targets for T cell-based immunotherapies. Cancer Immunol Res; 5(8); 666-75. ©2017 AACR . ©2017 American Association for Cancer Research.

Spacewire router IP-core with priority adaptive routing

NASA Astrophysics Data System (ADS)

Shakhmatov, A. V.; Chekmarev, S. A.; Vergasov, M. Y.; Khanov, V. Kh

2015-10-01

Design of modern spacecraft focuses on using network principles of interaction on-board equipment, in particular in network SpaceWire. Routers are an integral part of most SpaceWire networks. The paper presents an adaptive routing algorithm with a prioritization, allowing more flexibility to manage the routing process. This algorithm is designed to transmit SpaceWire packets over a redundant network. Also a method is proposed for rapid restoration of working capacity after power by saving the routing table and the router configuration in an external non-volatile memory. The proposed solutions used to create IP-core router, and then tested in the FPGA device. The results illustrate the realizability and rationality of the proposed solutions.

Past, present, and future of endobronchial laser photoresection

PubMed Central

Khemasuwan, Danai; Wang, Ko-Pen

2015-01-01

Laser photoresection of central airway obstruction is a useful tool for an Interventional Pulmonologist (IP). Endobronchial therapy of the malignant airway obstruction is considered as a palliative measure or a bridge therapy to the definite treatment of cancer. Several ablative therapies such as electrocautery, argon plasma coagulation (APC), cryotherapy and laser photoresection exist in the armamentarium of IP to tackle such presentations. Besides Neodymium-Yttrium, Aluminum, Garnet (Nd:YAG) laser, there are several different types of laser that have been used by the pulmonologist with different coagulative and cutting properties. This chapter focuses on the historical perspective, current status, and potentials of lasers in the management of central airway lesions. PMID:26807285

System services and architecture of the TMI satellite mobile data system

NASA Technical Reports Server (NTRS)

Gokhale, D.; Agarwal, A.; Guibord, A.

1993-01-01

The North American Mobile Satellite Service (MSS) system being developed by AMSC/TMI and scheduled to go into service in early 1995 will include the provision for real time packet switched services (mobile data service - MDS) and circuit switched services (mobile telephony service - MTS). These services will utilize geostationary satellites which provide access to mobile terminals (MT's) through L-band beams. The MDS system utilizes a star topology with a centralized data hub (DH) and will support a large number of mobile terminals. The DH, which accesses the satellite via a single Ku band beam, is responsible for satellite resource management, for providing mobile users with access to public and private data networks, and for comprehensive network management of the system. This paper describes the various MDS services available for the users, the ground segment elements involved in the provisioning of these services, and a summary description of the channel types, protocol architecture, and network management capabilities provided within the system.

Issues in implementing a knowledge-based ECG analyzer for personal mobile health monitoring.

PubMed

Goh, K W; Kim, E; Lavanya, J; Kim, Y; Soh, C B

2006-01-01

Advances in sensor technology, personal mobile devices, and wireless broadband communications are enabling the development of an integrated personal mobile health monitoring system that can provide patients with a useful tool to assess their own health and manage their personal health information anytime and anywhere. Personal mobile devices, such as PDAs and mobile phones, are becoming more powerful integrated information management tools and play a major role in many people's lives. We focus on designing a health-monitoring system for people who suffer from cardiac arrhythmias. We have developed computer simulation models to evaluate the performance of appropriate electrocardiogram (ECG) analysis techniques that can be implemented on personal mobile devices. This paper describes an ECG analyzer to perform ECG beat and episode detection and classification. We have obtained promising preliminary results from our study. Also, we discuss several key considerations when implementing a mobile health monitoring solution. The mobile ECG analyzer would become a front-end patient health data acquisition module, which is connected to the Personal Health Information Management System (PHIMS) for data repository.

Managing Weight: What Do People with an Intellectual Disability Want from Mobile Technology?

PubMed

Smyth, Phil; McDowell, Claire; Leslie, Julian C; Leader, Geraldine; Donnelly, Mark; Simpson, Elizabeth; Skelly, Laura

2017-01-01

Obesity is a significant health challenge. People with Intellectual Disability (ID) are particularly vulnerable to developing obesity. Mobile technology has been developed to support the management of weight and obesity in the form of apps, although not with people with an ID in mind. As a result existing off-the-shelf weight management apps currently available may not be functional in supporting weight reduction within this population. This paper presents the results of consultations with people with ID regarding weight management, comfort with mobile technology and desired characteristics in apps designed for people with ID that target weight management.

A Mobile and Intelligent Patient Diary for Chronic Disease Self-Management.

PubMed

Van Woensel, William; Roy, Patrice C; Abidi, Samina R; Abidi, Syed S R

2015-01-01

By involving patients in their own long-term care, patient self-management approaches aim to increase self-sufficiency and reduce healthcare costs. For example, electronic patient diaries enable patients to collect health data autonomously, increasing self-reliance and reducing strain on health professionals. By deploying patient diaries on mobile platforms, health data collection can occur at any time and place, increasing the mobility of chronic patients who typically need to enter health data frequently. Importantly, an opportunity also arises for mobile clinical decision support, where health feedback is directly issued to patients without relying on connectivity or remote servers. Regardless of the specific self-management strategy, patient and healthcare provider adoption are crucial. Tailoring the system towards the particular patient and toward institution-specific clinical pathways is essential to increasing acceptance. In this paper we discuss a mobile patient diary realizing both the opportunities and challenges of mobile deployment.

Key technologies and concepts for beyond-3G networks

NASA Astrophysics Data System (ADS)

Pehkonen, Kari; Uskela, Sami; Kalliojarvi, Kari; Oksanen, Lauri; Rikkinen, Kari

2001-10-01

Standardization of 3rd Generation (3G) mobile communication systems has produced the first specification releases and the commercial deployment of the 3G systems has started. Whereas 1G and 2G focused on efficiently providing voice services, in 3G a lot of attention has been devoted to solutions that support both Circuit Switched (CS) and Packet Switched (PS) communication. That has called for very flexible air interface and network solutions. 3G will continue to evolve and there are already on-going standardization activities that will, for example, boost the peak data rates up to 5-10 Mbps and improve spectral efficiency by 2-4 times. In the future, 3G evolution will be going towards 10/100 Mbps peak data rates in wide/local are coverage, respectively. This will take place partly because of technical improvements of 3G radio interface solutions, but also due to network evolution which will allow the integration other radio access methods like radio LANs into the 3G system. In longer term the 3G network evolution will be going towards ALL-IP networks. As 3G evolution seems to be going towards 10 Mbps/100 Mbps peak data rates and ALL-IP networks any beyond 3G air interface or network solution should be clearly better in order to justify its technical and commercial feasibility. Given the long evolution time of 3G and integration of other radio access schemes with 3G radio we may not even see a new, complete beyond 3G system being developed. Maybe we will just witness the emergence of a new, more advanced radio access solution which will then be connected to the evolving 3G network. As 3G evolution will continue for several years to come the research targets for any beyond 3G solutions must be set very high. When it comes to air interface, we should aim at 100 Mbps peak data rates for wide area access with high mobility, and at 1 Gbps for local area access with low mobility. Regarding possible commercial launches of any beyond 3G systems or solutions they could then take place around year 2010 or even later.

Anytime-Anywhere? Mobile Communicative Practices and the Management of Relationships in Everyday Life

ERIC Educational Resources Information Center

Moreno Becerra, Tabita Alejandra

2015-01-01

The present study examines how mobile practices of social-media use are integrated into individuals' everyday lives as a way to manage their relationships. Mobile communication technologies and social-media use intersect in people's everyday communicative practices, allowing individuals to engage in continuous interactions that take place on the…

77 FR 36447 - Hazardous Waste Management System; Identification and Listing of Hazardous Waste

Federal Register 2010, 2011, 2012, 2013, 2014

2012-06-19

... the point of waste generation. C. How did ExxonMobil sample and analyze the data in this petition? To support its petition, ExxonMobil submitted: (1) Historical information on waste generation and management... North Landfarm underflow water twice during the first six months of waste generation. ExxonMobil would...

An Integrated Learning Management System for Location-Based Mobile Learning

ERIC Educational Resources Information Center

Sailer, Christian; Kiefer, Peter; Raubal, Martin

2015-01-01

This paper discusses the relevance and challenges of a location-based learning platform that supports mobile learning in education. We present the design of an integrated management system for location-based mobile learning. Independent of the taught subject, the objective of the system is an easy-to-understand user interface for both - teachers…

Mobility based key management technique for multicast security in mobile ad hoc networks.

PubMed

Madhusudhanan, B; Chitra, S; Rajan, C

2015-01-01

In MANET multicasting, forward and backward secrecy result in increased packet drop rate owing to mobility. Frequent rekeying causes large message overhead which increases energy consumption and end-to-end delay. Particularly, the prevailing group key management techniques cause frequent mobility and disconnections. So there is a need to design a multicast key management technique to overcome these problems. In this paper, we propose the mobility based key management technique for multicast security in MANET. Initially, the nodes are categorized according to their stability index which is estimated based on the link availability and mobility. A multicast tree is constructed such that for every weak node, there is a strong parent node. A session key-based encryption technique is utilized to transmit a multicast data. The rekeying process is performed periodically by the initiator node. The rekeying interval is fixed depending on the node category so that this technique greatly minimizes the rekeying overhead. By simulation results, we show that our proposed approach reduces the packet drop rate and improves the data confidentiality.

Diabetes professionals must seize the opportunity in mobile health.

PubMed

Brandell, Brian; Ford, Christopher

2013-11-01

The number of diabetes management mobile applications (apps) available on the market has grown exponentially since 2009; however, most patients lack the skills necessary for finding relevant health care information. Thus, clinical best practices emphasize the need for ongoing patient education. Despite the importance of education in clinical guidelines, very few of these apps include education in their top functionalities. Most diabetes management mobile apps are not medical devices by definition, according to the U.S. Food and Drug Administration, and therefore do not require clearance or approval for market, and very few have been subject to clinical evaluation. There has been little research on the use of diabetes management mobile apps, marginalizing the role of diabetes professionals and educators in a burgeoning market, hungry for information and an improved quality of life. Still, mobile technology holds great promise as a platform for self-management. Health care providers must not only educate patients about these resources, but take steps to ensure that mobile apps follow accepted best practices and guidelines. © 2013 Diabetes Technology Society.

Integrating a mobile health setup in a chronic disease management network.

PubMed

Ding, Hang; Ireland, Derek; Jayasena, Rajiv; Curmi, Jamie; Karunanithi, Mohan

2013-01-01

Supporting self management of chronic disease in collaboration with primary healthcare has been a national priority in order to mitigate the emerging disease burden on the already strained healthcare system. However, in practice, the uptake of self-management programs and compliance with clinical guidelines remain poor. Time constraints due to work commitments and lack of efficient monitoring tools have been the major barrier to the uptake and compliance. In this paper, we present a newly integrated mobile health system with a clinical chronic disease management network called cdmNet, which has already been validated to facilitate General Practitioners (GPs) to provide collaborative disease management services. The newly integrated solution takes advantage of the latest mobile web and wireless Bluetooth communication techniques to enable patients to record health data entries through ubiquitous mobile phones, and allows the data to be simultaneously shared by multidisciplinary care teams. This integration would enable patients to self-manage their chronic disease conditions in collaboration with GPs and hence, improve the uptake and compliance. Additionally, the proposed integration will provide a useful framework encouraging the translation of innovative mobile health technologies into highly regulated healthcare systems.

Instrument for assessing mobile technology acceptability in diabetes self-management: a validation and reliability study.

PubMed

Frandes, Mirela; Deiac, Anca V; Timar, Bogdan; Lungeanu, Diana

2017-01-01

Nowadays, mobile technologies are part of everyday life, but the lack of instruments to assess their acceptability for the management of chronic diseases makes their actual adoption for this purpose slow. The objective of this study was to develop a survey instrument for assessing patients' attitude toward and intention to use mobile technology for diabetes mellitus (DM) self-management, as well as to identify sociodemographic characteristics and quality of life factors that affect them. We first conducted the documentation and instrument design phases, which were subsequently followed by the pilot study and instrument validation. Afterward, the instrument was administered 103 patients (median age: 37 years; range: 18-65 years) diagnosed with type 1 or type 2 DM, who accepted to participate in the study. The reliability and construct validity were assessed by computing Cronbach's alpha and using factor analysis, respectively. The instrument included statements about the actual use of electronic devices for DM management, interaction between patient and physician, attitude toward using mobile technology, and quality of life evaluation. Cronbach's alpha was 0.9 for attitude toward using mobile technology and 0.97 for attitude toward using mobile device applications for DM self-management. Younger patients (Spearman's ρ =-0.429; P <0.001) with better glycemic control (Spearman's ρ =-0.322; P <0.001) and higher education level (Kendall's τ =0.51; P <0.001) had significantly more favorable attitude toward using mobile assistive applications for DM control. Moreover, patients with a higher quality of life presented a significantly more positive attitude toward using modern technology (Spearman's ρ =0.466; P <0.001). The instrument showed good reliability and internal consistency, making it suitable for measuring the acceptability of mobile technology for DM self-management. Additionally, we found that even if most of the patients showed positive attitude toward mobile applications, only a moderate level of intention to indeed use them was observed. Moreover, the study indicated that barriers were truthfulness and easiness to use.

Adaptive Traffic Route Control in QoS Provisioning for Cognitive Radio Technology with Heterogeneous Wireless Systems

NASA Astrophysics Data System (ADS)

Yamamoto, Toshiaki; Ueda, Tetsuro; Obana, Sadao

As one of the dynamic spectrum access technologies, “cognitive radio technology,” which aims to improve the spectrum efficiency, has been studied. In cognitive radio networks, each node recognizes radio conditions, and according to them, optimizes its wireless communication routes. Cognitive radio systems integrate the heterogeneous wireless systems not only by switching over them but also aggregating and utilizing them simultaneously. The adaptive control of switchover use and concurrent use of various wireless systems will offer a stable and flexible wireless communication. In this paper, we propose the adaptive traffic route control scheme that provides high quality of service (QoS) for cognitive radio technology, and examine the performance of the proposed scheme through the field trials and computer simulations. The results of field trials show that the adaptive route control according to the radio conditions improves the user IP throughput by more than 20% and reduce the one-way delay to less than 1/6 with the concurrent use of IEEE802.16 and IEEE802.11 wireless media. Moreover, the simulation results assuming hundreds of mobile terminals reveal that the number of users receiving the required QoS of voice over IP (VoIP) service and the total network throughput of FTP users increase by more than twice at the same time with the proposed algorithm. The proposed adaptive traffic route control scheme can enhance the performances of the cognitive radio technologies by providing the appropriate communication routes for various applications to satisfy their required QoS.

Agmatine attenuates reserpine-induced oral dyskinesia in mice: Role of oxidative stress, nitric oxide and glutamate NMDA receptors.

PubMed

Cunha, Andréia S; Matheus, Filipe C; Moretti, Morgana; Sampaio, Tuane B; Poli, Anicleto; Santos, Danúbia B; Colle, Dirleise; Cunha, Mauricio P; Blum-Silva, Carlos H; Sandjo, Louis P; Reginatto, Flávio H; Rodrigues, Ana Lúcia S; Farina, Marcelo; Prediger, Rui D

2016-10-01

Dyskinesia consists in a series of trunk, limbs and orofacial involuntary movements that can be observed following long-term pharmacological treatment in some psychotic and neurological disorders such as schizophrenia and Parkinson's disease, respectively. Agmatine is an endogenous arginine metabolite that emerges as neuromodulator and a promising agent to manage diverse central nervous system disorders by modulating nitric oxide (NO) pathway, glutamate NMDA receptors and oxidative stress. Herein, we investigated the effects of a single intraperitoneal (i.p.) administration of different agmatine doses (10, 30 or 100mg/kg) against the orofacial dyskinesia induced by reserpine (1mg/kg,s.c.) in mice by measuring the vacuous chewing movements and tongue protusion frequencies, and the duration of facial twitching. The results showed an orofacial antidyskinetic effect of agmatine (30mg/kg, i.p.) or the combined administration of sub-effective doses of agmatine (10mg/kg, i.p.) with the NMDA receptor antagonists amantadine (1mg/kg, i.p.) and MK801 (0.01mg/kg, i.p.) or the neuronal nitric oxide synthase (NOS) inhibitor 7-nitroindazole (7-NI; 0.1mg/kg, i.p.). Reserpine-treated mice displayed locomotor activity deficits in the open field and agmatine had no effect on this response. Reserpine increased nitrite and nitrate levels in cerebral cortex, but agmatine did not reverse it. Remarkably, agmatine reversed the decrease of dopamine and non-protein thiols (NPSH) levels caused by reserpine in the striatum. However, no changes were observed in striatal immunocontent of proteins related to the dopaminergic system including tyrosine hydroxylase, dopamine transporter, vesicular monoamine transporter type 2, pDARPP-32[Thr75], dopamine D1 and D2 receptors. These results indicate that the blockade of NO pathway, NMDAR and oxidative stress are possible mechanisms associated with the protective effects of agmatine against the orofacial dyskinesia induced by reserpine in mice. Copyright © 2016 Elsevier B.V. All rights reserved.

Developing a Behavioral Model for Mobile Phone-Based Diabetes Interventions

PubMed Central

Nundy, Shantanu; Dick, Jonathan J.; Solomon, Marla C.; Peek, Monica E.

2013-01-01

Objectives Behavioral models for mobile phone-based diabetes interventions are lacking. This study explores the potential mechanisms by which a text message-based diabetes program affected self-management among African-Americans. Methods We conducted in-depth, individual interviews among 18 African-American patients with type 2 diabetes who completed a 4-week text message-based diabetes program. Each interview was audio- taped, transcribed verbatim, and imported into Atlas.ti software. Coding was done iteratively. Emergent themes were mapped onto existing behavioral constructs and then used to develop a novel behavioral model for mobile phone-based diabetes self-management programs. Results The effects of the text message-based program went beyond automated reminders. The constant, daily communications reduced denial of diabetes and reinforced the importance of self-management (Rosenstock Health Belief Model). Responding positively to questions about self-management increased mastery experience (Bandura Self-Efficacy). Most surprisingly, participants perceived the automated program as a “friend” and “support group” that monitored and supported their self-management behaviors (Barrera Social Support). Conclusions A mobile phone-based diabetes program affected self-management through multiple behavioral constructs including health beliefs, self-efficacy, and social support. Practice implications: Disease management programs that utilize mobile technologies should be designed to leverage existing models of behavior change and can address barriers to self-management associated with health disparities. PMID:23063349

47 CFR 54.500 - Terms and definitions.

Code of Federal Regulations, 2014 CFR

2014-10-01

... and state agencies that provides free or reduced price lunches to economically disadvantaged children... Management and Budget is eligible for a free lunch. (j) Pre-discount price. The “pre-discount price” means... service such as cellular, interconnected voice over Internet protocol (VoIP), and the circuit capacity...

Antiinflammatory and analgesic effects of Psidium guajava Linn. (Myrtaceae) leaf aqueous extract in rats and mice.

PubMed

Ojewole, J A O

2006-09-01

In many parts of Africa, the leaf, stem-bark, and roots of Psidium guajava Linn. (Family: Myrtaceae) are used traditionally for the management, control, and/or treatment of an array of human disorders. In an effort to scientifically appraise some of the ethnomedical properties of P. guajava leaf, and probe its efficacy and safety, the present study was undertaken to examine the antiinflammatory and analgesic properties of the plant's leaf aqueous extract in some experimental animal paradigms. The antiinflammatory property of the aqueous leaf extract was investigated in rats, using fresh egg albumin-induced pedal (paw) edema, while the analgesic effect of the plant extract was evaluated by the "hot-plate" and "acetic acid" test models of pain in mice. Diclofenac (100 mg/kg, i.p.) and morphine (10 mg/kg, i.p.) were used respectively as standard, reference antiinflammatory and analgesic agents for comparison. P. guajava leaf aqueous extract (PGE, 50-800 mg/kg, i.p.) produced dose-dependent and significant (p < 0.05-0.001) inhibition of fresh egg albumin-induced acute inflammation (edema) in rats. The plant extract (PGE, 50-800 mg/kg, i.p.) also produced dose-dependent and significant (p < 0.05-0.001) analgesic effects against thermally and chemically induced nociceptive pain in mice. The numerous tannins, polyphenolic compounds, flavonoids, ellagic acid, triterpenoids, guiajaverin, quercetin, and other chemical compounds present in the plant are speculated to account for the observed antiinflammatory and analgesic effects of the plant's leaf extract. In summary, the findings of this experimental animal study indicate that the leaf aqueous extract of P. guajava possesses analgesic and antiinflammatory properties, and thus lend pharmacological credence to the suggested ethnomedical, folkloric uses of the plant in the management and/or control of painful, arthritic and other inflammatory conditions in some rural communities of Africa. (c) 2006 Prous Science. All rights reserved.

Location Management in Distributed Mobile Environments

DTIC Science & Technology

1994-09-01

carried out to evaluate the performanceof di erent static strategies for various communica-tion and mobility patterns. Simulation results indi-cate...results ofsimulations carried out to evaluate the performanceof proposed static location management strategies forvarious call and mobility patterns...Systems, Austin, Sept. 1994. U.S. Government or Federal Rights License 14. ABSTRACT 15. SUBJECT TERMS 16. SECURITY CLASSIFICATION OF: 17

The Effectiveness of WhatsApp Mobile Learning Activities Guided by Activity Theory on Students' Knowledge Management

ERIC Educational Resources Information Center

Barhoumi, Chokri

2015-01-01

This research paper explores the effectiveness of using mobile technologies to support a blended learning course titled Scientific Research Methods in Information Science. Specifically, it discusses the effects of WhatsApp mobile learning activities guided by activity theory on students' knowledge Management (KM). During the 2014 academic year,…

Testosterone Stimulates Duox1 Activity through GPRC6A in Skin Keratinocytes*

PubMed Central

Ko, Eunbi; Choi, Hyun; Kim, Borim; Kim, Minsun; Park, Kkot-Nara; Bae, Il-Hong; Sung, Young Kwan; Lee, Tae Ryong; Shin, Dong Wook; Bae, Yun Soo

2014-01-01

Testosterone is an endocrine hormone with functions in reproductive organs, anabolic events, and skin homeostasis. We report here that GPRC6A serves as a sensor and mediator of the rapid action of testosterone in epidermal keratinocytes. The silencing of GPRC6A inhibited testosterone-induced intracellular calcium ([Ca2+]i) mobilization and H2O2 generation. These results indicated that a testosterone-GPRC6A complex is required for activation of Gq protein, IP3 generation, and [Ca2+]i mobilization, leading to Duox1 activation. H2O2 generation by testosterone stimulated the apoptosis of keratinocytes through the activation of caspase-3. The application of testosterone into three-dimensional skin equivalents increased the apoptosis of keratinocytes between the granular and stratified corneum layers. These results support an understanding of the molecular mechanism of testosterone-dependent apoptosis in which testosterone stimulates H2O2 generation through the activation of Duox1. PMID:25164816

Joint Cross-Layer Design for Wireless QoS Content Delivery

NASA Astrophysics Data System (ADS)

Chen, Jie; Lv, Tiejun; Zheng, Haitao

2005-12-01

In this paper, we propose a joint cross-layer design for wireless quality-of-service (QoS) content delivery. Central to our proposed cross-layer design is the concept of adaptation. Adaptation represents the ability to adjust protocol stacks and applications to respond to channel variations. We focus our cross-layer design especially on the application, media access control (MAC), and physical layers. The network is designed based on our proposed fast frequency-hopping orthogonal frequency division multiplex (OFDM) technique. We also propose a QoS-awareness scheduler and a power adaptation transmission scheme operating at both the base station and mobile sides. The proposed MAC scheduler coordinates the transmissions of an IP base station and mobile nodes. The scheduler also selects appropriate transmission formats and packet priorities for individual users based on current channel conditions and the users' QoS requirements. The test results show that our cross-layer design provides an excellent framework for wireless QoS content delivery.

Subtype-selective regulation of IP(3) receptors by thimerosal via cysteine residues within the IP(3)-binding core and suppressor domain.

PubMed

Khan, Samir A; Rossi, Ana M; Riley, Andrew M; Potter, Barry V L; Taylor, Colin W

2013-04-15

IP(3)R (IP(3) [inositol 1,4,5-trisphosphate] receptors) and ryanodine receptors are the most widely expressed intracellular Ca(2+) channels and both are regulated by thiol reagents. In DT40 cells stably expressing single subtypes of mammalian IP(3)R, low concentrations of thimerosal (also known as thiomersal), which oxidizes thiols to form a thiomercurylethyl complex, increased the sensitivity of IP(3)-evoked Ca(2+) release via IP(3)R1 and IP(3)R2, but inhibited IP(3)R3. Activation of IP(3)R is initiated by IP(3) binding to the IBC (IP(3)-binding core; residues 224-604) and proceeds via re-arrangement of an interface between the IBC and SD (suppressor domain; residues 1-223). Thimerosal (100 μM) stimulated IP(3) binding to the isolated NT (N-terminal; residues 1-604) of IP(3)R1 and IP(3)R2, but not to that of IP(3)R3. Binding of a competitive antagonist (heparin) or partial agonist (dimeric-IP(3)) to NT1 was unaffected by thiomersal, suggesting that the effect of thimerosal is specifically related to IP(3)R activation. IP(3) binding to NT1 in which all cysteine residues were replaced by alanine was insensitive to thimerosal, so too were NT1 in which cysteine residues were replaced in either the SD or IBC. This demonstrates that thimerosal interacts directly with cysteine in both the SD and IBC. Chimaeric proteins in which the SD of the IP(3)R was replaced by the structurally related A domain of a ryanodine receptor were functional, but thimerosal inhibited both IP(3) binding to the chimaeric NT and IP(3)-evoked Ca(2+) release from the chimaeric IP(3)R. This is the first systematic analysis of the effects of a thiol reagent on each IP(3)R subtype. We conclude that thimerosal selectively sensitizes IP(3)R1 and IP(3)R2 to IP(3) by modifying cysteine residues within both the SD and IBC and thereby stabilizing an active conformation of the receptor.

Management information system of medical equipment using mobile devices

NASA Astrophysics Data System (ADS)

Núñez, C.; Castro, D.

2011-09-01

The large numbers of technologies currently incorporated into mobile devices transform them into excellent tools for capture and to manage the information, because of the increasing computing power and storage that allow to add many miscellaneous applications. In order to obtain benefits of these technologies, in the biomedical engineering field, it was developed a mobile information system for medical equipment management. The central platform for the system it's a mobile phone, which by a connection with a web server, it's capable to send and receive information relative to any medical equipment. Decoding a type of barcodes, known as QR-Codes, the management process is simplified and improved. These barcodes identified the medical equipments in a database, when these codes are photographed and decoded with the mobile device, you can access to relevant information about the medical equipment in question. This Project in it's actual state is a basic support tool for the maintenance of medical equipment. It is also a modern alternative, competitive and economic in the actual market.

Acceptance of Using an Ecosystem of Mobile Apps for Use in Diabetes Clinic for Self-Management of Gestational Diabetes Mellitus.

PubMed

Pais, Sarita; Parry, Dave; Petrova, Krassie; Rowan, Janet

2017-01-01

Mobile applications (apps) for self-management of diseases such as diabetes and for general well-being, including keeping track of food, diet, and exercise, are widely available. However, consumers face a flood of new mobile apps in the app stores and have no guidance from clinicians about choosing the appropriate app. As much as clinicians would like to support a patient-centered approach and promote health and wellness mobile apps, they may be unable to provide advice due to the lack of comprehensive and reliable app reviews. This research reviewed a selection of health and wellness mobile apps suitable for the self-management of gestational diabetes mellitus (GDM). A prototype of an ecosystem that integrated the data generated by the apps was built and its usefulness and ease of use were evaluated. The results show that the ecosystem can provide support for GDM self-management by sharing health and wellness data across the diabetes clinic.

Prospective evaluation of surgical management of sliding hiatal hernia and gastroesophageal reflux in dogs.

PubMed

Mayhew, Philipp D; Marks, Stanley L; Pollard, Rachel; Culp, William T N; Kass, Philip H

2017-11-01

To evaluate response to surgical management of sliding hiatal hernia (SHH) and gastroesophageal reflux (GER) in dogs using standardized clinical scoring, videofluoroscopic swallow studies, and impedance planimetry. Prospective clinical trial. A total of 17 client-owned dogs. Dogs were included if they had clinical signs and videofluoroscopic evidence of SHH and/or GER. Owners were asked to complete a standardized canine dysphagia assessment tool (CDAT) preoperatively and postoperatively. Conscious videofluoroscopic swallowing studies and impedance planimetry (IP) were used to evaluate esophageal function and lower esophageal sphincter location and geometry preoperatively and in a subsection of dogs postoperatively. Preoperatively, 13/17 dogs included in the study had a history of regurgitation, and 4/17 had radiographic evidence of aspiration pneumonia. Postprandial regurgitation improved in 8/10 dogs with preoperative regurgitation, and for which completed preoperative and postoperative CDAT questionnaires were available (P < .01). The hiatal hernia severity score improved postoperatively (P = .046) in dogs with preoperative and postoperative videofluoroscopic swallowing studies (n = 12). However, hernia frequency score (P = .2) and IP parameters did not differ significantly between time points. Clinical signs of SHH generally improved with surgery but did not consistently resolve. Videofluoroscopic studies provide evidence that GER and SHH can persist postoperatively in some patients. Based on IP findings, clinical improvement may be attributed to a mechanism independent of lower esophageal sphincter attenuation. © 2017 The American College of Veterinary Surgeons.

Policy 2.0 Platform for Mobile Sensing and Incentivized Targeted Shifts in Mobility Behavior

PubMed Central

Semanjski, Ivana; Lopez Aguirre, Angel Javier; De Mol, Johan; Gautama, Sidharta

2016-01-01

Sustainable mobility and smart mobility management play important roles in achieving smart cities’ goals. In this context we investigate the role of smartphones as mobility behavior sensors and evaluate the responsivity of different attitudinal profiles towards personalized route suggestion incentives delivered via mobile phones. The empirical results are based on mobile sensed data collected from more than 3400 people’s real life over a period of six months. The findings show which user profiles are most likely to accept such incentives and how likely they are to result in more sustainable mode choices. In addition we provide insights into tendencies towards accepting more sustainable route options for different trip purposes and illustrate smart city platform potential (for collection of mobility behavior data and delivery of incentives) as a tool for development of personalized mobility management campaigns and policies. PMID:27399700

Supporting Cancer Patients in Illness Management: Usability Evaluation of a Mobile App

PubMed Central

Kaufman, David R; Ruland, Cornelia M

2014-01-01

Background Mobile phones and tablets currently represent a significant presence in people’s everyday lives. They enable access to different information and services independent of current place and time. Such widespread connectivity offers significant potential in different app areas including health care. Objective Our goal was to evaluate the usability of the Connect Mobile app. The mobile app enables mobile access to the Connect system, an online system that supports cancer patients in managing health-related issues. Along with symptom management, the system promotes better patient-provider communication, collaboration, and shared decision making. The Connect Mobile app enables access to the Connect system over both mobile phones and tablets. Methods The study consisted of usability tests of a high fidelity prototype with 7 cancer patients where the objectives were to identify existing design and functionality issues and to provide patients with a real look-and-feel of the mobile system. In addition, we conducted semistructured interviews to obtain participants’ feedback about app usefulness, identify the need for new system features and design requirements, and measure the acceptance of the mobile app and its features within everyday health management. Results The study revealed a total of 27 design issues (13 for mobile apps and 14 for tablet apps), which were mapped to source events (ie, errors, requests for help, participants' concurrent feedback, and moderator observation). We also applied usability heuristics to identify violations of usability principles. The majority of violations were related to enabling ease of input, screen readability, and glanceability (15 issues), as well as supporting an appropriate match between systems and the real world (7 issues) and consistent mapping of system functions and interactions (4 issues). Feedback from participants also showed the cancer patients’ requirements for support systems and how these needs are influenced by different context-related factors, such as type of access terminal (eg, desktop computer, tablet, mobile phone) and phases of illness. Based on the observed results, we proposed design and functionality recommendations that can be used for the development of mobile apps for cancer patients to support their health management process. Conclusions Understanding and addressing users’ requirements is one of the main prerequisites for developing useful and effective technology-based health interventions. The results of this study outline different user requirements related to the design of the mobile patient support app for cancer patients. The results will be used in the iterative development of the Connect Mobile app and can also inform other developers and researchers in development, integration, and evaluation of mobile health apps and services that support cancer patients in managing their health-related issues. PMID:25119490

The management of the acute ischemic priapism: A state of the art review.

PubMed

Falcone, M; Gillo, A; Capece, M; Raheem, A; Ralph, D; Garaffa, G

2017-12-01

To review the current literature on early penile prosthesis implantation in patients with refractory ischemic priapism (IP). A systematic search for the terms "penile prosthesis", "priapism", "impotence", "fibrosis", "downsized prosthesis cylinders", and "patient satisfaction" has been carried out in PubMed, EMBASE, Cochrane, SCOPUS and Science Citation Index databases. Cavernosal tissue damage in IP is time related. Conservative measures and aspiration with or without intracorporeal instillation of α-adrenergic agonists are usually successful in the early stages. Shunt surgery in patients remains debatable, as the lack of response to aspiration and instillation of α-adrenergic agonists indicates that irreversible changes in the cavernosal smooth muscle are likely to have already occurred. Immediate penile prosthesis implantation in patients with refractory IP settles the priapic episode, maintains the long term rigidity necessary to engage in penetrative sexual intercourse and prevents the otherwise inevitable penile shortening. Although complication rates after penile prosthesis implantation in acute priapism are higher than in virgin cases, they are still lower than after implantation in patients with severe corporal fibrosis due to chronic priapism. Regardless of the complication rates, penile prosthesis implantation in refractory IP should be preferred as it allows the preservation of penile length, which is one of the main factors influencing postoperative patient's satisfaction following surgery. Copyright © 2017 AEU. Publicado por Elsevier España, S.L.U. All rights reserved.

The impact of sea surface temperature on winter wheat in Iberian Peninsula

NASA Astrophysics Data System (ADS)

Capa-Morocho, Mirian; Rodríguez-Fonseca, Belen; Ruiz-Ramos, Margarita

2016-04-01

Climate variability is the main driver of changes in crops yield, especially for rainfed production systems. This is also the case of Iberian Peninsula (IP) (Capa-Morocho et al., 2014), where wheat yields are strongly dependent on seasonal rainfall amount and temporal distribution of rainfall during the growing season. Previous works have shown that large-scale oceanic patterns have a significant impact on precipitation over IP (Rodriguez-Fonseca and de Castro, 2002; Rodríguez-Fonseca et al., 2006). The existence of some predictability of precipitation has encouraged us to analyze the possible predictability of the wheat yield in the IP using sea surface temperature (SST) anomalies as predictor. For this purpose, a crop model site specific calibrated for the Northeast of IP and several reanalysis climate datasets have been used to obtain long time series of attainable wheat yield and relate their variability with SST anomalies. The results show that wheat yield anomalies are associated with changes in the Tropical Pacific (El Niño) and Atlantic (TNA) SST. For these events, the regional associated atmospheric pattern resembles the NAO, which also influences directly on the maximum temperatures and precipitation experienced by the crop during flowering and grain filling. Results from this study could have important implications for predictability issues in agricultural planning and management, such as insurance coverage, changes in sowing dates and choice of species and varieties.

Spatial Segregation and Interaction of Calcium Signalling Mechanisms in Rat Hippocampal CA1 Pyramidal Neurons

PubMed Central

Nakamura, Takeshi; Lasser-Ross, Nechama; Nakamura, Kyoko; Ross, William N

2002-01-01

Postsynaptic [Ca2+]i increases result from Ca2+ entry through ligand-gated channels, entry through voltage-gated channels, or release from intracellular stores. We found that these sources have distinct spatial distributions in hippocampal CA1 pyramidal neurons. Large amplitude regenerative release of Ca2+ from IP3-sensitive stores in the form of Ca2+ waves were found almost exclusively on the thick apical shaft. Smaller release events did not extend more than 15 μm into the oblique dendrites. These synaptically activated regenerative waves initiated at points where the stimulated oblique dendrites branch from the apical shaft. In contrast, NMDA receptor-mediated increases were observed predominantly in oblique dendrites where spines are found at high density. These [Ca2+]i increases were typically more than eight times larger than [Ca2+]i from this source on the main aspiny apical shaft. Ca2+ entry through voltage-gated channels, activated by backpropagating action potentials, was detected at all dendritic locations. These mechanisms were not independent. Ca2+ entry through NMDA receptor channels or voltage-gated channels (as previously demonstrated) synergistically enhanced Ca2+ release generated by mGluR mobilization of IP3. PMID:12205182

Interactive Video Coding and Transmission over Heterogeneous Wired-to-Wireless IP Networks Using an Edge Proxy

NASA Astrophysics Data System (ADS)

Pei, Yong; Modestino, James W.

2004-12-01

Digital video delivered over wired-to-wireless networks is expected to suffer quality degradation from both packet loss and bit errors in the payload. In this paper, the quality degradation due to packet loss and bit errors in the payload are quantitatively evaluated and their effects are assessed. We propose the use of a concatenated forward error correction (FEC) coding scheme employing Reed-Solomon (RS) codes and rate-compatible punctured convolutional (RCPC) codes to protect the video data from packet loss and bit errors, respectively. Furthermore, the performance of a joint source-channel coding (JSCC) approach employing this concatenated FEC coding scheme for video transmission is studied. Finally, we describe an improved end-to-end architecture using an edge proxy in a mobile support station to implement differential error protection for the corresponding channel impairments expected on the two networks. Results indicate that with an appropriate JSCC approach and the use of an edge proxy, FEC-based error-control techniques together with passive error-recovery techniques can significantly improve the effective video throughput and lead to acceptable video delivery quality over time-varying heterogeneous wired-to-wireless IP networks.

Polymers for electronics and spintronics.

PubMed

Bujak, Piotr; Kulszewicz-Bajer, Irena; Zagorska, Malgorzata; Maurel, Vincent; Wielgus, Ireneusz; Pron, Adam

2013-12-07

This critical review is devoted to semiconducting and high spin polymers which are of great scientific interest in view of further development of the organic electronics and the emerging organic spintronic fields. Diversified synthetic strategies are discussed in detail leading to high molecular mass compounds showing appropriate redox (ionization potential (IP), electron affinity (EA)), electronic (charge carrier mobility, conductivity), optoelectronic (electroluminescence, photoconductivity) and magnetic (magnetization, ferromagnetic spin interactions) properties and used as active components of devices such as n- and p-channel field effect transistors, ambipolar light emitting transistors, light emitting diodes, photovoltaic cells, photodiodes, magnetic photoswitches, etc. Solution processing procedures developed with the goal of depositing highly ordered and oriented films of these polymers are also described. This is completed by the description of principal methods that are used for characterizing these macromolecular compounds both in solution and in the solid state. These involve various spectroscopic methods (UV-vis-NIR, UPS, pulse EPR), electrochemistry and spectroelectrochemistry, magnetic measurements (SQUID), and structural and morphological investigations (X-ray diffraction, STM, AFM). Finally, four classes of polymers are discussed in detail with special emphasis on the results obtained in the past three years: (i) high IP, (ii) high |EA|, (iii) low band gap and (iv) high spin ones.

Integrated Social and Quality of Service Trust Management of Mobile Groups in Ad Hoc Networks

DTIC Science & Technology

2013-01-01

high resiliency to malicious attacks and misbehaving nodes. Keywords—trust management; mobile ad hoc networks; QoS trust; social trust; trust...paper we address an importance issue of trust management protocol design for MANETs: trust bias minimization despite misbehaving nodes performing

Modeling and performance analysis of an improved movement-based location management scheme for packet-switched mobile communication systems.

PubMed

Chung, Yun Won; Kwon, Jae Kyun; Park, Suwon

2014-01-01

One of the key technologies to support mobility of mobile station (MS) in mobile communication systems is location management which consists of location update and paging. In this paper, an improved movement-based location management scheme with two movement thresholds is proposed, considering bursty data traffic characteristics of packet-switched (PS) services. The analytical modeling for location update and paging signaling loads of the proposed scheme is developed thoroughly and the performance of the proposed scheme is compared with that of the conventional scheme. We show that the proposed scheme outperforms the conventional scheme in terms of total signaling load with an appropriate selection of movement thresholds.

Prime Contract Awards Alphabetically by Contractor, by State or Country, and Place, Fiscal Year 1987. Part 19. United Ameritec Corporation-Waste Management, Incorporated.

DTIC Science & Technology

1987-01-01

MCovvvvvv- 01 00 z0 464 I1 Ip --I-I-- - W r- W I-. 148 on JU 01in M M00()MM M O CIC’)0 64 C’I~t W t "at t I. V 1..0 1.1.0 Ia.0 u. 0 Wa000000000...q -4 M wOD..i~v .. ~y.~~ ’.p oo ao a) -0p 0 C" I I M n ID" "Im0mfn -0 m3 C4 M w (X) (0 to 430004 03CN U S I N I9 I--- -C 203o IP -. 43(000’ in3 ini...4 4 4 4 4 00 I 00 -4 N 0 0C) 4 fl ininr -40 0 -4"D 40 so0C.4 00 000 CCtN(4 0 -I 00 P- 0 0 44M C4 Nco Oc) IP -4 a*0 M’ r- r) 0 v " 0 -4 40 0-40U0 M4 NN

TECHNICAL AND REGULATORY CONSIDERATIONS IN USING FREIGHT CONTAINERS AS INDUSTRIAL PACKAGES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Opperman, E; Mark Hawk, M; Ron Natali, R

2007-10-16

The United States (US) Department of Energy (DOE), Office of Environmental Management (EM), is actively pursuing activities to reduce the radiological risk and clean up the environmental legacy of the nation's nuclear weapons programs. EM has made significant progress in recent years in the clean-up and closure of sites and is also focusing on longer-term activities necessary for the completion of the clean-up program. The packaging and transportation of contaminated demolition debris and low-level waste (LLW) materials in a safe and cost-effective manner are essential in completing this mission. Toward this end, the US Department of Transportation's (DOT) Final Rulemore » on Hazardous Materials Regulation Final Rule issued January 26, 2004, included a new provision authorizing the use of Freight Containers (e.g., 20 and 40-foot ISO Containers) as Industrial Packages Type 1, 2, or 3 (IP-1, IP-2, and IP-3). This paper will discuss the technical and regulatory considerations in using these newly authorized and large packages for the packaging and transportation of LLW materials.« less

Integrating Intellectual Property Concepts into MIS Education: An Empirical Assessment

ERIC Educational Resources Information Center

Mykytyn, Peter P., Jr.; Mykytyn, Kathleen; Harrison, David A.

2005-01-01

The evolving legal environment surrounding intellectual property (IP) and its impact on information systems, especially involving electronic commerce, and the type of education and training provided by management information systems (MIS) faculty to MIS students is a relationship that has not been investigated. Although organizations are…

Changing Trends in LIS Job Advertisements

ERIC Educational Resources Information Center

Wise, Sharyn; Henninger, Maureen; Kennan, Mary Anne

2011-01-01

The study reported in this paper is part of a larger program of studies designed to review and renew the curricula of Library and Information Science (LIS) and the broader Information Management (IM) courses. This paper analysed job advertisements as readily accessible indicators of the knowledge, skills, and competencies required of IPs by…

Improving Information Products for System 2 Decision Support

ERIC Educational Resources Information Center

Gibson, Neal

2010-01-01

The creation, maintenance, and management of Information Product (IP) systems that are used by organizations for complex decisions represent a unique set of challenges. These challenges are compounded when the purpose of such a systems is also for knowledge creation and dissemination. Information quality research to date has focused mainly upon…

Surveillance Jumps on the Network

ERIC Educational Resources Information Center

Raths, David

2011-01-01

Internet protocol (IP) network-based cameras and digital video management software are maturing, and many issues that have surrounded them, including bandwidth, data storage, ease of use, and integration are starting to become clearer as the technology continues to evolve. Prices are going down and the number of features is going up. Many school…

Advanced Cyber Attack Modeling Analysis and Visualization

DTIC Science & Technology

2010-03-01

Graph Analysis Network Web Logs Netflow Data TCP Dump Data System Logs Detect Protect Security Management What-If Figure 8. TVA attack graphs for...Clustered Graphs,” in Proceedings of the Symposium on Graph Drawing, September 1996. [25] K. Lakkaraju, W. Yurcik, A. Lee, “NVisionIP: NetFlow

The Electrolyte Genome project: A big data approach in battery materials discovery

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qu, Xiaohui; Jain, Anubhav; Rajput, Nav Nidhi

2015-06-01

We present a high-throughput infrastructure for the automated calculation of molecular properties with a focus on battery electrolytes. The infrastructure is largely open-source and handles both practical aspects (input file generation, output file parsing, and information management) as well as more complex problems (structure matching, salt complex generation, and failure recovery). Using this infrastructure, we have computed the ionization potential (IP) and electron affinities (EA) of 4830 molecules relevant to battery electrolytes (encompassing almost 55,000 quantum mechanics calculations) at the B3LYP/6-31+G(*) level. We describe automated workflows for computing redox potential, dissociation constant, and salt-molecule binding complex structure generation. We presentmore » routines for automatic recovery from calculation errors, which brings the failure rate from 9.2% to 0.8% for the QChem DFT code. Automated algorithms to check duplication between two arbitrary molecules and structures are described. We present benchmark data on basis sets and functionals on the G2-97 test set; one finding is that a IP/EA calculation method that combines PBE geometry optimization and B3LYP energy evaluation requires less computational cost and yields nearly identical results as compared to a full B3LYP calculation, and could be suitable for the calculation of large molecules. Our data indicates that among the 8 functionals tested, XYGJ-OS and B3LYP are the two best functionals to predict IP/EA with an RMSE of 0.12 and 0.27 eV, respectively. Application of our automated workflow to a large set of quinoxaline derivative molecules shows that functional group effect and substitution position effect can be separated for IP/EA of quinoxaline derivatives, and the most sensitive position is different for IP and EA. Published by Elsevier B.V« less

Prospective evaluation of the utility of routine postoperative cystogram after traumatic bladder injury.

PubMed

Inaba, Kenji; Okoye, Obi T; Browder, Timothy; Best, Charles; Branco, Bernardino C; Teixeira, Pedro G; Barmparas, Galinos; Reddy, Sravanthi; Demetriades, Demetrios

2013-12-01

The value of routinely testing bladder repair integrity with a cystogram before urinary catheter removal is unclear. The purpose of this study was to prospectively evaluate the utility of routine postoperative cystogram after traumatic bladder injury. All patients sustaining a bladder injury requiring operative repair at two Level I trauma centers were prospectively enrolled during a 62-month study period ending on January 2011. Injury demographics, imaging data, and outcomes were extracted. All patients were evaluated with either a plain or a computed tomography cystogram. A total of 127 patients were enrolled (mean [SD] age, 30.4 [13.5] years; blunt trauma, 63.8%, mean [SD] Injury Severity Score [ISS], 17.7 [10.6]). A total of 75 patients (59.1%) had an intraperitoneal (IP) bladder injury, 44 (34.6%) had an extraperitoneal (EP) bladder injury, and 8 had a (6.3%) combined IP/EP bladder injury. All patients with IP and IP/EP injuries (n = 83) underwent operative repair and a postoperative cystogram at 8.6 (1.8) days (range, 5-13 days). Sixty-nine IP injuries (83.1%) were simple (dome or body disruption/penetrating injury), while 14 (16.9%) were complex (trigone/requiring ureter implantation). There were no deaths during the follow-up period. With the exception of one patient (1.2%) with a complex injury requiring ureteric implantation, there were no leaks demonstrated on postoperative cystogram, and the urinary catheters were successfully removed. In this prospective evaluation of the role of bladder evaluation after operative repair, routine use of follow-up cystograms for simple injuries did not impact clinical management. For complex repairs to the trigone or those requiring ureter implantation, a follow-up cystogram should be obtained before catheter removal. Diagnostic study, level II.

Subtype-selective regulation of IP3 receptors by thimerosal via cysteine residues within the IP3-binding core and suppressor domain

PubMed Central

Khan, Samir A.; Rossi, Ana M.; Riley, Andrew M.; Potter, Barry V. L.; Taylor, Colin W.

2013-01-01

IP3R (IP3 [inositol 1,4,5-trisphosphate] receptors) and ryanodine receptors are the most widely expressed intracellular Ca2+ channels and both are regulated by thiol reagents. In DT40 cells stably expressing single subtypes of mammalian IP3R, low concentrations of thimerosal (also known as thiomersal), which oxidizes thiols to form a thiomercurylethyl complex, increased the sensitivity of IP3-evoked Ca2+ release via IP3R1 and IP3R2, but inhibited IP3R3. Activation of IP3R is initiated by IP3 binding to the IBC (IP3-binding core; residues 224–604) and proceeds via re-arrangement of an interface between the IBC and SD (suppressor domain; residues 1–223). Thimerosal (100 μM) stimulated IP3 binding to the isolated NT (N-terminal; residues 1–604) of IP3R1 and IP3R2, but not to that of IP3R3. Binding of a competitive antagonist (heparin) or partial agonist (dimeric-IP3) to NT1 was unaffected by thiomersal, suggesting that the effect of thimerosal is specifically related to IP3R activation. IP3 binding to NT1 in which all cysteine residues were replaced by alanine was insensitive to thimerosal, so too were NT1 in which cysteine residues were replaced in either the SD or IBC. This demonstrates that thimerosal interacts directly with cysteine in both the SD and IBC. Chimaeric proteins in which the SD of the IP3R was replaced by the structurally related A domain of a ryanodine receptor were functional, but thimerosal inhibited both IP3 binding to the chimaeric NT and IP3-evoked Ca2+ release from the chimaeric IP3R. This is the first systematic analysis of the effects of a thiol reagent on each IP3R subtype. We conclude that thimerosal selectively sensitizes IP3R1 and IP3R2 to IP3 by modifying cysteine residues within both the SD and IBC and thereby stabilizing an active conformation of the receptor. PMID:23282150

Managing Mobile Relationships: Children's Perceptions of the Impact of the Mobile Phone on Relationships in Their Everyday Lives

ERIC Educational Resources Information Center

Bond, Emma

2010-01-01

This article explores English children's use of mobile phones in managing and maintaining friendships and relationships in their everyday lives. Based on the accounts of 30 young people aged between 11 and 17, this research adopts a social constructivist perspective to offer a theoretical framework which explores how children themselves actually…

Ubiquitous Mobile Educational Data Management by Teachers, Students and Parents: Does Technology Change School-Family Communication and Parental Involvement?

ERIC Educational Resources Information Center

Blau, Ina; Hameiri, Mira

2017-01-01

Digital educational data management has become an integral part of school practices. Accessing school database by teachers, students, and parents from mobile devices promotes data-driven educational interactions based on real-time information. This paper analyses mobile access of educational database in a large sample of 429 schools during an…

Mobile-Based Applications and Functionalities for Self-Management of People Living with HIV.

PubMed

Mehraeen, Esmaeil; Safdari, Reza; Mohammadzadeh, Niloofar; Seyedalinaghi, Seyed Ahmad; Forootan, Siavash; Mohraz, Minoo

2018-01-01

Due to the chronicity of HIV/AIDS and the increased number of people living with HIV (PLWH), these people need the innovative and practical approaches to take advantage of high-quality healthcare services. The objectives of this scoping review were to identify the mobile-based applications and functionalities for self-management of people living with HIV. We conducted a comprehensive search of PubMed, Scopus, Science direct, Web of Science and Embase databases for literature published from 2010 to 2017. Screening, data abstraction, and methodological quality assessment were done in duplicate. Our search identified 10 common mobile-based applications and 8 functionalities of these applications for self-management of people living with HIV. According to the findings, "text-messaging" and "reminder" applications were more addressed in reviewed articles. Moreover, the results indicated that "medication adherence" was the common functionality of mobile-based applications for PLWH. Inclusive evidence supports the use of text messaging as a mobile-based functionality to improve medication adherence and motivational messaging. Future mobile-based applications in the healthcare industry should address additional practices such as online chatting, social conversations, physical activity intervention, and supply chain management.

Men's mobility into management from blue collar and white collar jobs: race differences across the early work-career.

PubMed

Wilson, George; Maume, David

2014-07-01

Within the context of the "particularistic mobility thesis" we examine racial differences in the incidence, and determinants of, as well as timing to, mobility into management across the critical early career years at a refined level, namely, when groups share similar white collar and blue collar jobs. Findings from a Panel Study of Income Dynamics sample of men support theory and indicate that from both job levels a racial hierarchy exists: African Americans have the lowest rate of mobility, reach management through a route that is relatively formal and structured by a traditional range of stratification-based causal factors and take longest to reach management. Whites, in contrast, have the highest mobility rate, reach management through a relatively informal path that is less structured by traditional stratification-based factors, and reach management the quickest, and, across all three issues Latinos occupy an intermediate ground between African Americans and Latinos. Further, as predicted by theory, racial differences, particularly, relative to whites, are greater among those tracked from blue collar jobs than white collar jobs. Discussed are implications of the findings for understanding racial disadvantage in the American labor market across the work-career and on an inter-generational basis. Copyright © 2014 Elsevier Inc. All rights reserved.

Bandwidth management for mobile mode of mobile monitoring system for Indonesian Volcano

NASA Astrophysics Data System (ADS)

Evita, Maria; Djamal, Mitra; Zimanowski, Bernd; Schilling, Klaus

2017-01-01

Volcano monitoring requires the system which has high-fidelity operation and real-time acquisition. MONICA (Mobile Monitoring System for Indonesian Volcano), a system based on Wireless Sensor Network, mobile robot and satellite technology has been proposed to fulfill this requirement for volcano monitoring system in Indonesia. This system consists of fixed-mode for normal condition and mobile mode for emergency situation. The first and second modes have been simulated in slow motion earthquake cases of Merapi Volcano, Indonesia. In this research, we have investigated the application of our bandwidth management for high-fidelity operation and real time acquisition in mobile mode of a strong motion earthquake from this volcano. The simulation result showed that our system still could manage the bandwidth even when there were 2 died fixed node after had stroked by the lightning. This result (64% to 83% throughput in average) was still better than the bandwidth utilized by the existing equipment (0% throughput because of the broken seismometer).

Integrating mobile technology with routine dietetic practice: the case of myPace for weight management.

PubMed

Harricharan, Michelle; Gemen, Raymond; Celemín, Laura Fernández; Fletcher, David; de Looy, Anne E; Wills, Josephine; Barnett, Julie

2015-05-01

The field of Mobile health (mHealth), which includes mobile phone applications (apps), is growing rapidly and has the potential to transform healthcare by increasing its quality and efficiency. The present paper focuses particularly on mobile technology for body weight management, including mobile phone apps for weight loss and the available evidence on their effectiveness. Translation of behaviour change theory into weight management strategies, including integration in mobile technology is also discussed. Moreover, the paper presents and discusses the myPace platform as a case in point. There is little clinical evidence on the effectiveness of currently available mobile phone apps in enabling behaviour change and improving health-related outcomes, including sustained body weight loss. Moreover, it is unclear to what extent these apps have been developed in collaboration with health professionals, such as dietitians, and the extent to which apps draw on and operationalise behaviour change techniques has not been explored. Furthermore, presently weight management apps are not built for use as part of dietetic practice, or indeed healthcare more widely, where face-to-face engagement is fundamental for instituting the building blocks for sustained lifestyle change. myPace is an innovative mobile technology for weight management meant to be embedded into and to enhance dietetic practice. Developed out of systematic, iterative stages of engagement with dietitians and consumers, it is uniquely designed to complement and support the trusted health practitioner-patient relationship. Future mHealth technology would benefit if engagement with health professionals and/or targeted patient groups, and behaviour change theory stood as the basis for technology development. Particularly, integrating technology into routine health care practice, rather than replacing one with the other, could be the way forward.

The Relationship Between Individual Characteristics and Interest in Using a Mobile Phone App for HIV Self-Management: Observational Cohort Study of People Living With HIV.

PubMed

Lucero, Robert James; Frimpong, Jemima A; Fehlberg, Elizabeth A; Bjarnadottir, Ragnhildur I; Weaver, Michael T; Cook, Christa; Modave, Francois; Rathore, Mobeen H; Morano, Jamie P; Ibanez, Gladys; Cook, Robert L

2017-07-27

The human immunodeficiency virus (HIV) continues to be a major health issue in the United States, and an estimated 1.2 million people in the United States are living with HIV. As part of Healthy People 2020, the Office of Disease Prevention and Health Promotion has targeted the persistent demographic and geographic disparities in HIV prevalence and management. Preliminary evidence suggests that mobile health technology (smartphone apps) may be a promising way to support HIV self-management among vulnerable populations of people living with HIV (PLWH) who lack access to appropriate health care services. This study examines the association between individual characteristics of PLWH and level of interest in using a free mobile phone app for HIV self-management. This study was conducted using cross-sectional survey data collected in the Florida Cohort Study between 2014 and 2016 (N=766). Associations between individual characteristics of PLWH and level of interest in using a free mobile phone app for HIV self-management were examined using bivariate analysis and logistic regression. Overall, 85.5% (655/766) of respondents were interested in using a free mobile phone app that supports HIV self-management. Participants expressed the highest interest in app functions that facilitate communication with health care providers (568/740, 76.8%) or help to identify relevant health care services (556/745 74.6%). Age (OR 0.959, 95% CI 0.936-0.982), education (OR 1.281, 95% CI 1.027-1.598) and disability or inability to work (OR 0.296, 95% CI 0.145-0.606) were all significantly associated with being interested in using a free mobile phone app for HIV self-management. This study indicates that a majority of PLWH are interested in using a free mobile phone app to self-manage their condition. The findings can inform the development of mobile phone apps that support effective HIV self-management. ©Robert James Lucero, Jemima A Frimpong, Elizabeth A Fehlberg, Ragnhildur I Bjarnadottir, Michael T Weaver, Christa Cook, Francois Modave, Mobeen H Rathore, Jamie P Morano, Gladys Ibanez, Robert L Cook. Originally published in JMIR Mhealth and Uhealth (http://mhealth.jmir.org), 27.07.2017.

Guidance Manual for Integrating Hazardous Material Control and Management into System Acquisition Programs

DTIC Science & Technology

1993-04-01

34 in the remainder of this "• IPS. Ensure that system safety, Section refer to the DoD format paragraph health hazards, and environmental for the...hazardous materials is controlled in the manner which protects human health and the environment at the least cost. Hazardous Material Control and Management...of hazardous materials is controlled in a manner which protects human health and the environment at the least cost. Hazardous Material Control and

Inositol Hexakisphosphate Kinase-3 Regulates the Morphology and Synapse Formation of Cerebellar Purkinje Cells via Spectrin/Adducin

PubMed Central

Fu, Chenglai; Xu, Jing; Li, Ruo-Jing; Crawford, Joshua A.; Khan, A. Basit; Ma, Ting Martin; Cha, Jiyoung Y.; Snowman, Adele M.; Pletnikov, Mikhail V.

2015-01-01

The inositol hexakisphosphate kinases (IP6Ks) are the principal enzymes that generate inositol pyrophosphates. There are three IP6Ks (IP6K1, 2, and 3). Functions of IP6K1 and IP6K2 have been substantially delineated, but little is known of IP6K3's role in normal physiology, especially in the brain. To elucidate functions of IP6K3, we generated mice with targeted deletion of IP6K3. We demonstrate that IP6K3 is highly concentrated in the brain in cerebellar Purkinje cells. IP6K3 physiologically binds to the cytoskeletal proteins adducin and spectrin, whose mutual interactions are perturbed in IP6K3-null mutants. Consequently, IP6K3 knock-out cerebella manifest abnormalities in Purkinje cell structure and synapse number, and the mutant mice display deficits in motor learning and coordination. Thus, IP6K3 is a major determinant of cytoskeletal disposition and function of cerebellar Purkinje cells. SIGNIFICANCE STATEMENT We identified and cloned a family of three inositol hexakisphosphate kinases (IP6Ks) that generate the inositol pyrophosphates, most notably 5-diphosphoinositol pentakisphosphate (IP7). Of these, IP6K3 has been least characterized. In the present study we generated IP6K3 knock-out mice and show that IP6K3 is highly expressed in cerebellar Purkinje cells. IP6K3-deleted mice display defects of motor learning and coordination. IP6K3-null mice manifest aberrations of Purkinje cells with a diminished number of synapses. IP6K3 interacts with the cytoskeletal proteins spectrin and adducin whose altered disposition in IP6K3 knock-out mice may mediate phenotypic features of the mutant mice. These findings afford molecular/cytoskeletal mechanisms by which the inositol polyphosphate system impacts brain function. PMID:26245967

Role of Ipsdienol, Ipsenol, and cis-Verbenol in chemical ecology of Ips avulsus, Ips calligraphus, and Ips grandicollis (Coleoptera: Curculionidae: Scolytinae)

Treesearch

Jeremy D. Allison; Jessica I. McKenney; Daniel R. Miller; Matthew L. Gimmel

2012-01-01

ABSTRACT Stressed or damaged pine (Pinus sp.) trees in the southeastern United States are often colonized simultaneously by three southern Ips species (Coleoptera: Curculionidae: Scolytinae): small southern pine engraver, Ips avulsus (Eichhoff); sixspined ips, Ips calligraphus (Germar); and...

Comparison of gating dynamics of different IP3R channels with immune algorithm searching for channel parameter distributions

NASA Astrophysics Data System (ADS)

Cai, Xiuhong; Li, Xiang; Qi, Hong; Wei, Fang; Chen, Jianyong; Shuai, Jianwei

2016-10-01

The gating properties of the inositol 1, 4, 5-trisphosphate (IP3) receptor (IP3R) are determined by the binding and unbinding capability of Ca2+ ions and IP3 messengers. With the patch clamp experiments, the stationary properties have been discussed for Xenopus oocyte type-1 IP3R (Oo-IP3R1), type-3 IP3R (Oo-IP3R3) and Spodoptera frugiperda IP3R (Sf-IP3R). In this paper, in order to provide insights about the relation between the observed gating characteristics and the gating parameters in different IP3Rs, we apply the immune algorithm to fit the parameters of a modified DeYoung-Keizer model. By comparing the fitting parameter distributions of three IP3Rs, we suggest that the three types of IP3Rs have the similar open sensitivity in responding to IP3. The Oo-IP3R3 channel is easy to open in responding to low Ca2+ concentration, while Sf-IP3R channel is easily inhibited in responding to high Ca2+ concentration. We also show that the IP3 binding rate is not a sensitive parameter for stationary gating dynamics for three IP3Rs, but the inhibitory Ca2+ binding/unbinding rates are sensitive parameters for gating dynamics for both Oo-IP3R1 and Oo-IP3R3 channels. Such differences may be important in generating the spatially and temporally complex Ca2+ oscillations in cells. Our study also demonstrates that the immune algorithm can be applied for model parameter searching in biological systems.

Developing an interactive mobile phone self-report system for self-management of hypertension. Part 2: content validity and usability.

PubMed

Bengtsson, Ulrika; Kjellgren, Karin; Höfer, Stefan; Taft, Charles; Ring, Lena

2014-10-01

Self-management support tools using technology may improve adherence to hypertension treatment. There is a need for user-friendly tools facilitating patients' understanding of the interconnections between blood pressure, wellbeing and lifestyle. This study aimed to examine comprehension, comprehensiveness and relevance of items, and further to evaluate the usability and reliability of an interactive hypertension-specific mobile phone self-report system. Areas important in supporting self-management and candidate items were derived from five focus group interviews with patients and healthcare professionals (n = 27), supplemented by a literature review. Items and response formats were drafted to meet specifications for mobile phone administration and were integrated into a mobile phone data-capture system. Content validity and usability were assessed iteratively in four rounds of cognitive interviews with patients (n = 21) and healthcare professionals (n = 4). Reliability was examined using a test-retest. Focus group analyses yielded six areas covered by 16 items. The cognitive interviews showed satisfactory item comprehension, relevance and coverage; however, one item was added. The mobile phone self-report system was reliable and perceived easy to use. The mobile phone self-report system appears efficiently to capture information relevant in patients' self-management of hypertension. Future studies need to evaluate the effectiveness of this tool in improving self-management of hypertension in clinical practice.

Mobile phone health apps for diabetes management: current evidence and future developments.

PubMed

Goyal, S; Cafazzo, J A

2013-12-01

Can an app help manage diabetes? We discuss how the advent of mobile health apps in connecting patients to providers is creating new opportunities for the management of diabetes. Although there are promising outcomes, there is still much to be learned about how such technology could be fully exploited.

Using Instructional Design, Analyze, Design, Develop, Implement, and Evaluate, to Develop e-Learning Modules to Disseminate Supported Employment for Community Behavioral Health Treatment Programs in New York State.

PubMed

Patel, Sapana R; Margolies, Paul J; Covell, Nancy H; Lipscomb, Cristine; Dixon, Lisa B

2018-01-01

Implementation science lacks a systematic approach to the development of learning strategies for online training in evidence-based practices (EBPs) that takes the context of real-world practice into account. The field of instructional design offers ecologically valid and systematic processes to develop learning strategies for workforce development and performance support. This report describes the application of an instructional design framework-Analyze, Design, Develop, Implement, and Evaluate (ADDIE) model-in the development and evaluation of e-learning modules as one strategy among a multifaceted approach to the implementation of individual placement and support (IPS), a model of supported employment for community behavioral health treatment programs, in New York State. We applied quantitative and qualitative methods to develop and evaluate three IPS e-learning modules. Throughout the ADDIE process, we conducted formative and summative evaluations and identified determinants of implementation using the Consolidated Framework for Implementation Research (CFIR). Formative evaluations consisted of qualitative feedback received from recipients and providers during early pilot work. The summative evaluation consisted of levels 1 and 2 (reaction to the training, self-reported knowledge, and practice change) quantitative and qualitative data and was guided by the Kirkpatrick model for training evaluation. Formative evaluation with key stakeholders identified a range of learning needs that informed the development of a pilot training program in IPS. Feedback on this pilot training program informed the design document of three e-learning modules on IPS: Introduction to IPS, IPS Job development, and Using the IPS Employment Resource Book . Each module was developed iteratively and provided an assessment of learning needs that informed successive modules. All modules were disseminated and evaluated through a learning management system. Summative evaluation revealed that learners rated the modules positively, and self-report of knowledge acquisition was high (mean range: 4.4-4.6 out of 5). About half of learners indicated that they would change their practice after watching the modules (range: 48-51%). All learners who completed the level 1 evaluation demonstrated 80% or better mastery of knowledge on the level 2 evaluation embedded in each module. The CFIR was used to identify implementation barriers and facilitators among the evaluation data which facilitated planning for subsequent implementation support activities in the IPS initiative. Instructional design approaches such as ADDIE may offer implementation scientists and practitioners a flexible and systematic approach for the development of e-learning modules as a single component or one strategy in a multifaceted approach for training in EBPs.

An Efficient G-XML Data Management Method using XML Spatial Index for Mobile Devices

NASA Astrophysics Data System (ADS)

Tamada, Takashi; Momma, Kei; Seo, Kazuo; Hijikata, Yoshinori; Nishida, Shogo

This paper presents an efficient G-XML data management method for mobile devices. G-XML is XML based encoding for the transport of geographic information. Mobile devices, such as PDA and mobile-phone, performance trail desktop machines, so some techniques are needed for processing G-XML data on mobile devices. In this method, XML-format spatial index file is used to improve an initial display time of G-XML data. This index file contains XML pointer of each feature in G-XML data and classifies these features by multi-dimensional data structures. From the experimental result, we can prove this method speed up about 3-7 times an initial display time of G-XML data on mobile devices.

Managers' experience of success criteria and barriers to implementing mobile radiography services in nursing homes in Norway: a qualitative study.

PubMed

Kjelle, Elin; Lysdahl, Kristin Bakke; Olerud, Hilde Merete; Myklebust, Aud Mette

2018-04-25

In order to meet the future challenges posed by ageing populations, new technology, telemedicine and a more personalized healthcare system are needed. Earlier research has shown mobile radiography services to be highly beneficial for nursing home residents in addition to being cost-effective. Despite the benefits, mobile radiography services are uncommon in Europe and Norway. The purpose of this study was to explore success criteria and barriers in the process of implementing mobile radiography services, from the point of view of the hospital and municipal managers. Eleven semi-structured interviews were conducted with managers from five hospitals and six municipalities in Norway where mobile radiography services had been implemented. Core issues in the interview guide were barriers and facilitators in the different phases of implementation. The framework method for thematic analysis was used for analysing the data inductively in a research team. Five main categories were developed through the success criteria and barriers experienced by the participants: national health policy, regional and municipal policy and conditions, inter-organizational implementation projects, experienced outcome, and professional skills and personal characteristics. The categories were allocated into three higher-order classifications: macro, meso and micro levels. The main barriers experienced by the managers were financial, procedural and structural. In particular, the reimbursement system, lack of management across healthcare levels and the lack of compatible information systems acted as barriers. The main facilitators were external funding, enthusiastic individuals in the organizations and good collaboration between hospitals and municipalities. The managers experienced financial, structural and procedural barriers. The main success criteria in the process were external funding, and the support and engagement from the individuals in the organizations. This commitment was mainly facilitated by the intuitive appeal of mobile radiography. Changes in healthcare management and in the financial system might facilitate services across healthcare levels. In addition, compatible information systems across healthcare levels are needed in order to facilitate the use of new technology and mobile services.

CrossTalk. The Journal of Defense Software Engineering. Volume 26, Number 5

DTIC Science & Technology

2013-10-01

to a backend domain managed by the cyber criminal. Mobile bots can perform piggybacking on legitimate applications and steal data by controlling...technology infrastructure for managing identities, interfaces (web and/or mobile ), and agreements with service providers. The necessary capabilities and...platforms of unknown or dubious origin, global access by mobile (and largely insecure) devices, eroded trust boundaries, and the possibility of malevolent

Instrument for assessing mobile technology acceptability in diabetes self-management: a validation and reliability study

PubMed Central

Frandes, Mirela; Deiac, Anca V; Timar, Bogdan; Lungeanu, Diana

2017-01-01

Background Nowadays, mobile technologies are part of everyday life, but the lack of instruments to assess their acceptability for the management of chronic diseases makes their actual adoption for this purpose slow. Objective The objective of this study was to develop a survey instrument for assessing patients’ attitude toward and intention to use mobile technology for diabetes mellitus (DM) self-management, as well as to identify sociodemographic characteristics and quality of life factors that affect them. Methods We first conducted the documentation and instrument design phases, which were subsequently followed by the pilot study and instrument validation. Afterward, the instrument was administered 103 patients (median age: 37 years; range: 18–65 years) diagnosed with type 1 or type 2 DM, who accepted to participate in the study. The reliability and construct validity were assessed by computing Cronbach’s alpha and using factor analysis, respectively. Results The instrument included statements about the actual use of electronic devices for DM management, interaction between patient and physician, attitude toward using mobile technology, and quality of life evaluation. Cronbach’s alpha was 0.9 for attitude toward using mobile technology and 0.97 for attitude toward using mobile device applications for DM self-management. Younger patients (Spearman’s ρ=−0.429; P<0.001) with better glycemic control (Spearman’s ρ=−0.322; P<0.001) and higher education level (Kendall’s τ=0.51; P<0.001) had significantly more favorable attitude toward using mobile assistive applications for DM control. Moreover, patients with a higher quality of life presented a significantly more positive attitude toward using modern technology (Spearman’s ρ=0.466; P<0.001). Conclusion The instrument showed good reliability and internal consistency, making it suitable for measuring the acceptability of mobile technology for DM self-management. Additionally, we found that even if most of the patients showed positive attitude toward mobile applications, only a moderate level of intention to indeed use them was observed. Moreover, the study indicated that barriers were truthfulness and easiness to use. PMID:28243069

A mobile system for the improvement of heart failure management: Evaluation of a prototype.

PubMed

Haynes, Sarah C; Kim, Katherine K

2017-01-01

Management of heart failure is complex, often involving interaction with multiple providers, monitoring of symptoms, and numerous medications. Employing principles of user-centered design, we developed a high- fidelity prototype of a mobile system for heart failure self-management and care coordination. Participants, including both heart failure patients and health care providers, tested the mobile system during a one-hour one-on-one session with a facilitator. The facilitator interviewed participants about the strengths and weaknesses of the prototype, necessary features, and willingness to use the technology. We performed a qualitative content analysis using the transcripts of these interviews. Fourteen distinct themes were identified in the analysis. Of these themes, integration, technology literacy, memory, and organization were the most common. Privacy was the least common theme. Our study suggests that this integration is essential for adoption of a mobile system for chronic disease management and care coordination.

Sociotechnical analysis of nurses' use of personal mobile phones at work.

PubMed

Bautista, John Robert; Lin, Trisha T C

2016-11-01

Nurses' use of personal mobiles phones at work is a growing trend in healthcare organizations. Although recent studies have explored the positive and negative implications of nurses using personal mobile phones at work, none has yet analyzed the interactions of sociotechnical components (users, technology and policy) on nurses' use of personal mobile phones at work. Identify sociotechnical interactions by analyzing each sociotechnical component (users, technology and policy) that affects nurses' use of personal mobile phones at work. In-depth interviews were conducted with 30 nurses employed in 13 hospitals in the Philippines. The respondents include staff nurses (n=23), charge nurses (n=4), and nurse managers (n=3). Staff nurses were asked on their use of personal mobile phones at work, while charge and nurse managers were asked on their observations regarding staff nurses' use of personal mobile phones at work. Responses were analyzed qualitatively using sociotechnical analysis. Sociotechnical analysis indicated that staff nurses used their personal mobile phones at work in various ways because its use helped in their nursing work, but inevitably altered a few of their routines. Although most hospitals had policies that prohibit the use of mobile phones, staff nurses justified their use of personal mobile phones by using it for work purposes and for the benefit of their patients. Staff nurses highlighted the absence of hospital-provided mobile phones as a key reason for using personal mobile phones at work. Charge nurses and nurse managers also influenced staff nurses' use of personal mobile phones at work. Nurses could use their personal mobile phones at work for work purposes to enhance their clinical performance and improve patient care. Hospital administrators can leverage on nurses' use of personal mobile phones at work by formulating policies that consider both the benefits and potential drawbacks of mobile phone usage. Recommendations are made for the formulation of hospital policies to optimize the use of personal mobile phones of nurses at work. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

47 CFR 20.22 - Rules governing mobile spectrum holdings.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 47 Telecommunication 2 2014-10-01 2014-10-01 false Rules governing mobile spectrum holdings. 20.22... COMMERCIAL MOBILE SERVICES § 20.22 Rules governing mobile spectrum holdings. (a) Applicants for mobile... spectrum manager leasing arrangements as identified in § 1.9020(e)(1)(ii) must demonstrate that the public...

Active ambulatory care management supported by short message services and mobile phone technology in patients with arterial hypertension.

PubMed

Kiselev, Anton R; Gridnev, Vladimir I; Shvartz, Vladimir A; Posnenkova, Olga M; Dovgalevsky, Pavel Ya

2012-01-01

The use of short message services and mobile phone technology for ambulatory care management is the most accessible and most inexpensive way to transition from traditional ambulatory care management to active ambulatory care management in patients with arterial hypertension (AH). The aim of this study was to compare the clinical efficacy of active ambulatory care management supported by short message services and mobile phone technology with traditional ambulatory care management in AH patients. The study included 97 hypertensive patients under active ambulatory care management and 102 patients under traditional ambulatory care management. Blood pressure levels, body mass, and smoking history of patients were analyzed in the study. The duration of study was 1 year. In the active ambulatory care management group, 36% of patients were withdrawn from the study within a year. At the end of the year, 77% of patients from the active care management group had achieved the goal blood pressure level. That was more than 5 times higher than that in the traditional ambulatory care management group (P < .001). The risk ratio of achieving and maintaining the goal blood pressure in patients of active care management group was 5.44, CI (3.2-9.9; P = .005). Implementation of active ambulatory care management supported by short message services and mobile phone improves the quality of ambulatory care of hypertensive patients. Copyright © 2012 American Society of Hypertension. Published by Elsevier Inc. All rights reserved.

Health worker perceptions of integrating mobile phones into community case management of malaria in Saraya, Senegal.

PubMed

Blanas, Demetri A; Ndiaye, Youssoupha; MacFarlane, Matthew; Manga, Isaac; Siddiqui, Ammar; Velez, Olivia; Kanter, Andrew S; Nichols, Kim; Hennig, Nils

2015-05-01

Although community case management of malaria increases access to life-saving care in isolated settings, it contends with many logistical challenges. Mobile phone health information technology may present an opportunity to address a number of these barriers. Using the wireless adaptation of the technology acceptance model, this study assessed availability, ease of use, usefulness, and job relevance of mobile phones by health workers in Saraya, Senegal. This study conducted seven key informant interviews with government health workers, and three focus groups and 76 surveys with lay health workers. Principal findings included that mobile phones are already widely available and used, and that participants valued using phones to address training, stock management, programme reporting, and transportation challenges. By documenting widespread use of mobile phones and health worker perceptions of their most useful applications, this paper provides a framework for their integration into the community case management of malaria programme in Saraya, Senegal. © The Author 2014. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Examining Correlates of Problematic Internet Pornography Use Among University Students

PubMed Central

Harper, Cody; Hodgins, David C.

2016-01-01

Background and aims The phenomenon of Internet pornography (IP) addiction is gainingincreasing attention in the popular media and psychological research. What has not been tested empirically is how frequency and amount ofIP use, along with other individual characteristics, are related tosymptoms of IP addiction. Methods 105 female and 86 male university students (mean age 21) from Calgary,Canada, were administered measures of IP use, psychosocial functioning (anxiety and depression, life and relationship satisfaction), addictivepropensities, and addictive IP use. Results Men reported earlier age of exposure and more frequent current IP use than women. Individuals not in relationships reported more frequent use than those in relationships. Frequency of IP use wasnot generally correlated with psychosocial functioning but was significantly positively correlated with level of IP addiction. Higher level of IP addiction was associated with poorer psychosocial functioning and problematic alcohol, cannabis, gambling and, in particular, video game use. A curvilinear association was found between frequency of IP use and level of addiction such that daily or greater IP use was associated with a sharp rise in addictive IP scores. Discussion The failure to find a strong significant relationship between IP use and general psychosocial functioning suggests that the overall effect of IP use is not necessarily harmful in and of itself. Addictiveuse of IP, which is associated with poorer psychosocial functioning, emerges when people begin to use IP daily. PMID:27156383

Optimization of OSPF Routing in IP Networks

NASA Astrophysics Data System (ADS)

Bley, Andreas; Fortz, Bernard; Gourdin, Eric; Holmberg, Kaj; Klopfenstein, Olivier; Pióro, Michał; Tomaszewski, Artur; Ümit, Hakan

The Internet is a huge world-wide packet switching network comprised of more than 13,000 distinct subnetworks, referred to as Autonomous Systems (ASs) autonomous system AS . They all rely on the Internet Protocol (IP) internet protocol IP for transport of packets across the network. And most of them use shortest path routing protocols shortest path routing!protocols , such as OSPF or IS-IS, to control the routing of IP packets routing!of IP packets within an AS. The idea of the routing is extremely simple — every packet is forwarded on IP links along the shortest route between its source and destination nodes of the AS. The AS network administrator can manage the routing of packets in the AS by supplying the so-called administrative weights of IP links, which specify the link lengths that are used by the routing protocols for their shortest path computations. The main advantage of the shortest path routing policy is its simplicity, allowing for little administrative overhead. From the network engineering perspective, however, shortest path routing can pose problems in achieving satisfactory traffic handling efficiency. As all routing paths depend on the same routing metric routing!metric , it is not possible to configure the routing paths for the communication demands between different pairs of nodes explicitly or individually; the routing can be controlled only indirectly and only as a whole by modifying the routing metric. Thus, one of the main tasks when planning such networks is to find administrative link weights that induce a globally efficient traffic routing traffic!routing configuration of an AS. It turns out that this task leads to very difficult mathematical optimization problems. In this chapter, we discuss and describe exact integer programming models and solution approaches as well as practically efficient smart heuristics for such shortest path routing problems shortest path routing!problems .

ChIP and ChIP-Related Techniques: Expanding the Fields of Application and Improving ChIP Performance.

PubMed

Visa, Neus; Jordán-Pla, Antonio

2018-01-01

Protein-DNA interactions in vivo can be detected and quantified by chromatin immunoprecipitation (ChIP). ChIP has been instrumental for the advancement of epigenetics and has set the groundwork for the development of a number of ChIP-related techniques that have provided valuable information about the organization and function of genomes. Here, we provide an introduction to ChIP and discuss the applications of ChIP in different research areas. We also review some of the strategies that have been devised to improve ChIP performance.

The prevalence of human papillomavirus infection in Iranian patients with sinonasal inverted papilloma.

PubMed

Jalilvand, Somayeh; Saidi, Masoumeh; Shoja, Zabihollah; Ghavami, Nastaran; Hamkar, Rasool

2016-03-01

Inverted papilloma (IP) is an uncommon disease which arises in the mucosal membrane of the nasal cavity and paranasal sinus. It has been proposed that human papillomavirus (HPV) is the causal agent in the pathogenesis of IP and plays a key role in the progression from benign IP to malignancy. As there are no prior studies that focus on an Iranian population, this study intended to characterize the prevalence of HPV types in benign and malignant forms of IP. In this retrospective study, we included a total of 40 IP patients [37 benign IP and 3 IP/squamous cell carcinoma (SCC)] who were referred to Amiralam Hospital in Tehran from 2004-2006. HPV was detected in 18.9% and 100% of IP and IP/SCC cases, respectively. In all HPV positive cases of IP and IP/SCC cases, HPV6/11 and HPV16/18 were detected, respectively. Therefore, HPV types were different between the IP and IP/SCC patients, and this difference was statistically significant (p = 0.002). This study suggests that HPV6 and 11 may be involved in the development of IP, but HPV16 and 18 likely play an important role in the progression from benign to malignant form of IP. Copyright © 2015. Published by Elsevier Taiwan LLC.

ACUTE EFFECT OF ETHANOL ON HEPATIC RETICULAR G6Pase AND Ca2+ POOL

PubMed Central

Jacobs-Harper, Amy; Crumbly, Ashlee; Romani, Andrea

2012-01-01

Background Hydrolysis of glucose 6-phosphate via glucose 6-phosphatase enlarges the reticular Ca2+ pool of the hepatocyte. Exposure of liver cells to ethanol impairs reticular Ca2+ homeostasis. The present study investigated the effect of acute ethanol administration on glucose 6-phosphate supported Ca2+ accumulation in liver cells. Methods Total microsomes were isolated from rat livers acutely perfused with varying doses of ethanol (0.01%, 0.1%, or 1% v/v) for 8 minutes. Calcium uptake was assessed by 45Ca redistribution. Inorganic phosphate (Pi) formation was measured as an indicator of glucose 6-phosphatase hydrolytic activity. Results Glucose 6-phosphate-supported Ca2+ uptake decreased in a manner directly proportional to the dose of ethanol infused in the liver whereas Ca2+ uptake via SERCA pumps was decreased by ~25% only at the highest dose of alcohol administered. The reduced accumulation of Ca2+ within the microsomes resulted in a smaller IP3-induced Ca2+ release. Kinetic assessment of IP3 and passive Ca2+ release indicated a faster mobilization in microsomes from ethanol-treated livers, suggesting alcohol-induced alteration of Ca2+ releasing mechanisms. Pre-treatment of livers with chloromethiazole or dithio-threitol, but not 4-methyl-pyrazole prevented the inhibitory effect of ethanol on glucose 6-phosphatase activity and Ca2+ homeostasis. Conclusions Liver glucose 6-phosphatase activity and IP3-mediated Ca2+ release are rapidly inhibited following acute (8 min) exposure to ethanol, thus compromising the ability of the endoplasmic reticulum to dynamically modulate Ca2+ homeostasis in the hepatocyte. The protective effect of chloromethiazole and di-thio-threitol suggests that the inhibitory effect of ethanol is mediated through its metabolism via reticular cyP4502E1 and consequent free radicals formation. PMID:22958133

KChIP2 genotype dependence of transient outward current (Ito) properties in cardiomyocytes isolated from male and female mice

PubMed Central

Waldschmidt, Lara; Junkereit, Vera; Bähring, Robert

2017-01-01

The transient outward current (Ito) in cardiomyocytes is largely mediated by Kv4 channels associated with Kv Channel Interacting Protein 2 (KChIP2). A knockout model has documented the critical role of KChIP2 in Ito expression. The present study was conducted to characterize in both sexes the dependence of Ito properties, including current magnitude, inactivation kinetics, recovery from inactivation and voltage dependence of inactivation, on the number of functional KChIP2 alleles. For this purpose we performed whole-cell patch-clamp experiments on isolated left ventricular cardiomyocytes from male and female mice which had different KChIP2 genotypes; i.e., wild-type (KChIP2+/+), heterozygous knockout (KChIP2+/-) or complete knockout of KChIP2 (KChIP2-/-). We found in both sexes a KChIP2 gene dosage effect (i.e., a proportionality between number of alleles and phenotype) on Ito magnitude, however, concerning other Ito properties, KChIP2+/- resembled KChIP2+/+. Only in the total absence of KChIP2 (KChIP2-/-) we observed a slowing of Ito kinetics, a slowing of recovery from inactivation and a negative shift of a portion of the voltage dependence of inactivation. In a minor fraction of KChIP2-/- myocytes Ito was completely lost. The distinct KChIP2 genotype dependences of Ito magnitude and inactivation kinetics, respectively, seen in cardiomyocytes were reproduced with two-electrode voltage-clamp experiments on Xenopus oocytes expressing Kv4.2 and different amounts of KChIP2. Our results corroborate the critical role of KChIP2 in controlling Ito properties. They demonstrate that the Kv4.2/KChIP2 interaction in cardiomyocytes is highly dynamic, with a clear KChIP2 gene dosage effect on Kv4 channel surface expression but not on inactivation gating. PMID:28141821

KChIP2 genotype dependence of transient outward current (Ito) properties in cardiomyocytes isolated from male and female mice.

PubMed

Waldschmidt, Lara; Junkereit, Vera; Bähring, Robert

2017-01-01

The transient outward current (Ito) in cardiomyocytes is largely mediated by Kv4 channels associated with Kv Channel Interacting Protein 2 (KChIP2). A knockout model has documented the critical role of KChIP2 in Ito expression. The present study was conducted to characterize in both sexes the dependence of Ito properties, including current magnitude, inactivation kinetics, recovery from inactivation and voltage dependence of inactivation, on the number of functional KChIP2 alleles. For this purpose we performed whole-cell patch-clamp experiments on isolated left ventricular cardiomyocytes from male and female mice which had different KChIP2 genotypes; i.e., wild-type (KChIP2+/+), heterozygous knockout (KChIP2+/-) or complete knockout of KChIP2 (KChIP2-/-). We found in both sexes a KChIP2 gene dosage effect (i.e., a proportionality between number of alleles and phenotype) on Ito magnitude, however, concerning other Ito properties, KChIP2+/- resembled KChIP2+/+. Only in the total absence of KChIP2 (KChIP2-/-) we observed a slowing of Ito kinetics, a slowing of recovery from inactivation and a negative shift of a portion of the voltage dependence of inactivation. In a minor fraction of KChIP2-/- myocytes Ito was completely lost. The distinct KChIP2 genotype dependences of Ito magnitude and inactivation kinetics, respectively, seen in cardiomyocytes were reproduced with two-electrode voltage-clamp experiments on Xenopus oocytes expressing Kv4.2 and different amounts of KChIP2. Our results corroborate the critical role of KChIP2 in controlling Ito properties. They demonstrate that the Kv4.2/KChIP2 interaction in cardiomyocytes is highly dynamic, with a clear KChIP2 gene dosage effect on Kv4 channel surface expression but not on inactivation gating.

Anticonvulsant activity of Cotyledon orbiculata L. (Crassulaceae) leaf extract in mice.

PubMed

Amabeoku, G J; Green, I; Kabatende, J

2007-05-30

The anticonvulsant activity of Cotyledon orbiculata L. (Crassulaceae) was investigated by studying the effects of both aqueous and methanol extracts of the plant species on seizures induced by pentylenetetrazole, bicuculline, picrotoxin and N-methyl-dl-aspartic in mice. Aqueous extract of Cotyledon orbiculata (50-400mg/kg, i.p.) and methanol extract (100-400mg/kg, i.p.) significantly prolonged the onset of tonic seizures induced by pentylenetetrazole (95mg/kg, i.p.). Methanol extract (400mg/kg, i.p.) also significantly reduced the incidence of the seizures. One hundred to two hundred milligrams/kilogram (i.p.) of aqueous extract of Cotyledon orbiculata significantly delayed the onset of the tonic seizures induced by bicuculline (40mg/kg, i.p.), picrotoxin (12mg/kg, i.p.) and N-methyl-dl-aspartic acid (NMDLA, 400mg/kg, i.p.). Similarly, methanol extract (100-400mg/kg, i.p.) significantly delayed the onset of the tonic seizures induced by bicuculline (40mg/kg, i.p.) and picrotoxin (12mg/kg, i.p.) while 100mg/kg (i.p.) significantly delayed the onset of N-methyl-dl-aspartic acid (NMDLA, 400mg/kg, i.p.)-induced seizures. Methanol extract (200mg/kg, i.p.) significantly reduced the incidence of the seizures induced by bicuculline (40mg/kg, i.p.). Phenobarbitone (12mg/kg, i.p.) and diazepam (0.5mg/kg, i.p.) effectively antagonized only seizures induced by PTZ (95mg/kg, i.p.), bicuculline (40mg/kg, i.p.) and picrotoxin (12mg/kg, i.p.). Phenytoin (30mg/kg, i.p.) did not affect any of the seizures to any significant extent. The data obtained suggest that both aqueous and methanol extracts of Cotyledon orbiculata have anticonvulsant property and may probably be affecting both gabaergic and glutaminergic mechanisms to exert its effect. The phytochemical analysis carried out revealed the presence of cardiac glycosides, saponins, tannins, reducing sugar and triterpene steroids in the plant extract.

Transportation management center data capture for performance and mobility measures guidebook.

DOT National Transportation Integrated Search

2013-03-01

The Guide to Transportation Management Center (TMC) Data Capture for Performance and Mobility Measures is a two-volume document consisting of this summary Guidebook and a Reference Manual. These documents provide technical guidance and recommended pr...

Phorbol 12,13-dibutyrate and 1-oleyl-2-acetyldiacylglycerol stimulate inositol trisphosphate dephosphorylation in human platelets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Molina y Vedia, L.M.; Lapetina, E.G.

1986-08-15

Inositol trisphosphate (IP3) is formed in response to specific agonists that cause activation of phospholipase C and degradation of phosphatidylinositol bisphosphate. IP3 is a second messenger that releases Ca/sup 2 +/ from the dense tubular system to the cytosol in stimulated platelets. Our present information indicates that (/sup 3/H)IP3 is dephosphorylated to (/sup 3/H)inositol bisphosphate (IP2) and (/sup 3/H)inositol monophosphate (IP) by human platelets treated with 0.05-0.10% Triton X-100. This dephosphorylation of (/sup 3/H)IP3 to (/sup 3/H)IP2 and (/sup 3/H)IP is also observed when platelets are permeabilized by electrical stimulation or by 20 micrograms/ml saponin. These detergents or electropermeabilization allowmore » IP3 to access cytosolic IP3 phosphatase. Pretreatment of intact platelets with phorbol dibutyrate and 1-oleyl-2-acetyldiacylglycerol for 30 s, at concentrations that maximally activate protein kinase C, stimulates the conversion of IP3 to IP2 and IP. This suggests a role for protein kinase C in the regulation of IP3 degradation.« less

75 FR 9210 - Notice of Public Information Collection(s) Approved by the Office of Management and Budget

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-01

... privacy of customer proprietary network information and carrier proprietary information from unauthorized... infrastructure will acquire information regarding interconnected VoIP providers and their customers for use in... for the provision of E911 services. To be clear, no entity may use customer information obtained as a...

Managing the University Patent Portfolio and Making It Attractive to Licensees: A Commonsense Approach

ERIC Educational Resources Information Center

Garabedian, Todd E.; Galletta, Elizabeth A.

2005-01-01

Building an attractive patent and technology portfolio for potential licensees requires involvement and diligence by the technology transfer office and the inventors. Steps outlined in this article, such as proper treatment of IP to assure rights are not lost, preventing premature disclosures, assuring proper ownership and inventorship of…

Privacy/Security Policy

Science.gov Websites

automatically is: The Internet Protocol (IP) address of the domain from which you access the Internet (i.e DUF6 Management and Uses DUF6 Conversion EIS Documents News FAQs Internet Resources Glossary Home  , to access, obtain, alter, damage, or destroy information, or otherwise to interfere with the system

Content Analysis of Mobile Health Applications on Diabetes Mellitus.

PubMed

Izahar, Syarafina; Lean, Qi Ying; Hameed, Mohammed Abdul; Murugiah, Muthu Kumar; Patel, Rahul P; Al-Worafi, Yaser Mohammed; Wong, Tin Wui; Ming, Long Chiau

2017-01-01

Diabetes self-management offers an opportunity to patients to be actively involved in managing their conditions and modifying lifestyle behaviors to attain positive health outcomes. With the unprecedented growth of mobile technology, smartphone plays a role in supporting diabetes self-management. Nonetheless, selecting appropriate mobile applications (apps) is challenging for patients. Thus, this study aimed to evaluate and compare the contents and features of mobile medical apps for diabetes self-management. Of 346 commercial apps, 16 (16%) and 19 (7.72%) of the diabetes apps found in Apple and Google Play stores, respectively, were included based on the selection criteria and individually scored for the availability of 8 main features of diabetes self-management. The apps supported self-management by offering features such as free installation, less than 50 MB space used, offline use, automated data entry, data export and sharing, educational tool, and advice. Of the 8 evaluated features, only 11 (31.4%) apps had a score of 5 whereas 7 (20%) apps scored the lowest, with a score of 3. The majority of apps were free, required no Internet connectivity to use and were less than 50 MB in size. Our findings showed that the design of diabetes mobile apps focused on reporting and setting reminders, rather than providing personalized education or therapeutic support. In the future, the design of apps could be improved to integrate patients' needs, usability for disease management, and lifestyle modifications.

Content Analysis of Mobile Health Applications on Diabetes Mellitus

PubMed Central

Izahar, Syarafina; Lean, Qi Ying; Hameed, Mohammed Abdul; Murugiah, Muthu Kumar; Patel, Rahul P.; Al-Worafi, Yaser Mohammed; Wong, Tin Wui; Ming, Long Chiau

2017-01-01

Diabetes self-management offers an opportunity to patients to be actively involved in managing their conditions and modifying lifestyle behaviors to attain positive health outcomes. With the unprecedented growth of mobile technology, smartphone plays a role in supporting diabetes self-management. Nonetheless, selecting appropriate mobile applications (apps) is challenging for patients. Thus, this study aimed to evaluate and compare the contents and features of mobile medical apps for diabetes self-management. Of 346 commercial apps, 16 (16%) and 19 (7.72%) of the diabetes apps found in Apple and Google Play stores, respectively, were included based on the selection criteria and individually scored for the availability of 8 main features of diabetes self-management. The apps supported self-management by offering features such as free installation, less than 50 MB space used, offline use, automated data entry, data export and sharing, educational tool, and advice. Of the 8 evaluated features, only 11 (31.4%) apps had a score of 5 whereas 7 (20%) apps scored the lowest, with a score of 3. The majority of apps were free, required no Internet connectivity to use and were less than 50 MB in size. Our findings showed that the design of diabetes mobile apps focused on reporting and setting reminders, rather than providing personalized education or therapeutic support. In the future, the design of apps could be improved to integrate patients’ needs, usability for disease management, and lifestyle modifications. PMID:29230195

Tenth Goddard Conference on Mass Storage Systems and Technologies in Cooperation with the Nineteenth IEEE Symposium on Mass Storage Systems

NASA Technical Reports Server (NTRS)

Kobler, Benjamin (Editor); Hariharan, P. C. (Editor)

2002-01-01

This document contains copies of those technical papers received in time for publication prior to the Tenth Goddard Conference on Mass Storage Systems and Technologies which is being held in cooperation with the Nineteenth IEEE Symposium on Mass Storage Systems at the University of Maryland University College Inn and Conference Center April 15-18, 2002. As one of an ongoing series, this Conference continues to provide a forum for discussion of issues relevant to the ingest, storage, and management of large volumes of data. The Conference encourages all interested organizations to discuss long-term mass storage requirements and experiences in fielding solutions. Emphasis is on current and future practical solutions addressing issues in data management, storage systems and media, data acquisition, long-term retention of data, and data distribution. This year's discussion topics include architecture, future of current technology, storage networking with emphasis on IP storage, performance, standards, site reports, and vendor solutions. Tutorials will be available on perpendicular magnetic recording, object based storage, storage virtualization and IP storage.

Exploring the Moderating Role of Self-Management of Learning in Mobile English Learning

ERIC Educational Resources Information Center

Huang, Rui-Ting

2014-01-01

Although a considerable number of studies have revealed that self-management of learning (SML) could be closely related to learning achievements, there is still a paucity of research investigating the moderating effect of self-management of learning on mobile learning outcomes. Accordingly, the primary purpose of this study was to explore the…

IP3-mediated gating mechanism of the IP3 receptor revealed by mutagenesis and X-ray crystallography.

PubMed

Hamada, Kozo; Miyatake, Hideyuki; Terauchi, Akiko; Mikoshiba, Katsuhiko

2017-05-02

The inositol 1,4,5-trisphosphate (IP 3 ) receptor (IP 3 R) is an IP 3 -gated ion channel that releases calcium ions (Ca 2+ ) from the endoplasmic reticulum. The IP 3 -binding sites in the large cytosolic domain are distant from the Ca 2+ conducting pore, and the allosteric mechanism of how IP 3 opens the Ca 2+ channel remains elusive. Here, we identify a long-range gating mechanism uncovered by channel mutagenesis and X-ray crystallography of the large cytosolic domain of mouse type 1 IP 3 R in the absence and presence of IP 3 Analyses of two distinct space group crystals uncovered an IP 3 -dependent global translocation of the curvature α-helical domain interfacing with the cytosolic and channel domains. Mutagenesis of the IP 3 R channel revealed an essential role of a leaflet structure in the α-helical domain. These results suggest that the curvature α-helical domain relays IP 3 -controlled global conformational dynamics to the channel through the leaflet, conferring long-range allosteric coupling from IP 3 binding to the Ca 2+ channel.

Briefer assessment of social network drinking: A test of the Important People Instrument-5 (IP-5).

PubMed

Hallgren, Kevin A; Barnett, Nancy P

2016-12-01

The Important People instrument (IP; Longabaugh et al., 2010) is one of the most commonly used measures of social network drinking. Although its reliability and validity are well-supported, the length of the instrument may limit its use in many settings. The present study evaluated whether a briefer, 5-person version of the IP (IP-5) adequately reproduces scores from the full IP. College freshmen (N = 1,053) reported their own past-month drinking, alcohol-related consequences, and information about drinking in their close social networks at baseline and 1 year later. From this we derived network members' drinking frequency, percentage of drinkers, and percentage of heavy drinkers, assessed for up to 10 (full IP) or 5 (IP-5) network members. We first modeled the expected concordance between full-IP scores and scores from simulated shorter IP instruments by sampling smaller subsets of network members from full IP data. Then, using quasi-experimental methods, we administered the full IP and IP-5 and compared the 2 instruments' score distributions and concurrent and year-lagged associations with participants' alcohol consumption and consequences. Most of the full-IP variance was reproduced from simulated shorter versions of the IP (ICCs ≥ 0.80). The full IP and IP-5 yielded similar score distributions, concurrent associations with drinking (r = 0.22 to 0.52), and year-lagged associations with drinking. The IP-5 retains most of the information about social network drinking from the full IP. The shorter instrument may be useful in clinical and research settings that require frequent measure administration, yielding greater temporal resolution for monitoring social network drinking. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Spatial Data Management System (SDMS)

NASA Technical Reports Server (NTRS)

Hutchison, Mark W.

1994-01-01

The Spatial Data Management System (SDMS) is a testbed for retrieval and display of spatially related material. SDMS permits the linkage of large graphical display objects with detail displays and explanations of its smaller components. SDMS combines UNIX workstations, MIT's X Window system, TCP/IP and WAIS information retrieval technology to prototype a means of associating aggregate data linked via spatial orientation. SDMS capitalizes upon and extends previous accomplishments of the Software Technology Branch in the area of Virtual Reality and Automated Library Systems.

Inositol 1,4,5-trisphosphate receptor regulates replication, differentiation, infectivity and virulence of the parasitic protist Trypanosoma cruzi.

PubMed

Hashimoto, Muneaki; Enomoto, Masahiro; Morales, Jorge; Kurebayashi, Nagomi; Sakurai, Takashi; Hashimoto, Tetsuo; Nara, Takeshi; Mikoshiba, Katsuhiko

2013-03-01

In animals, inositol 1,4,5-trisphosphate receptors (IP3 Rs) are ion channels that play a pivotal role in many biological processes by mediating Ca(2+) release from the endoplasmic reticulum. Here, we report the identification and characterization of a novel IP3 R in the parasitic protist, Trypanosoma cruzi, the pathogen responsible for Chagas disease. DT40 cells lacking endogenous IP3 R genes expressing T. cruzi IP3 R (TcIP3 R) exhibited IP3 -mediated Ca(2+) release from the ER, and demonstrated receptor binding to IP3 . TcIP3 R was expressed throughout the parasite life cycle but the expression level was much lower in bloodstream trypomastigotes than in intracellular amastigotes or epimastigotes. Disruption of two of the three TcIP3 R gene loci led to the death of the parasite, suggesting that IP3 R is essential for T. cruzi. Parasites expressing reduced or increased levels of TcIP3 R displayed defects in growth, transformation and infectivity, indicating that TcIP3 R is an important regulator of the parasite's life cycle. Furthermore, mice infected with T. cruzi expressing reduced levels of TcIP3 R exhibited a reduction of disease symptoms, indicating that TcIP3 R is an important virulence factor. Combined with the fact that the primary structure of TcIP3 R has low similarity to that of mammalian IP3 Rs, TcIP3 R is a promising drug target for Chagas disease. © 2013 Blackwell Publishing Ltd.

ChIP-seq.

PubMed

Kim, Tae Hoon; Dekker, Job

2018-05-01

Owing to its digital nature, ChIP-seq has become the standard method for genome-wide ChIP analysis. Using next-generation sequencing platforms (notably the Illumina Genome Analyzer), millions of short sequence reads can be obtained. The densities of recovered ChIP sequence reads along the genome are used to determine the binding sites of the protein. Although a relatively small amount of ChIP DNA is required for ChIP-seq, the current sequencing platforms still require amplification of the ChIP DNA by ligation-mediated PCR (LM-PCR). This protocol, which involves linker ligation followed by size selection, is the standard ChIP-seq protocol using an Illumina Genome Analyzer. The size-selected ChIP DNA is amplified by LM-PCR and size-selected for the second time. The purified ChIP DNA is then loaded into the Genome Analyzer. The ChIP DNA can also be processed in parallel for ChIP-chip results. © 2018 Cold Spring Harbor Laboratory Press.

Infection prevention and control practice for Crimean-Congo hemorrhagic fever-A multi-center cross-sectional survey in Eurasia.

PubMed

Fletcher, Tom E; Gulzhan, Abuova; Ahmeti, Salih; Al-Abri, Seif S; Asik, Zahide; Atilla, Aynur; Beeching, Nick J; Bilek, Heval; Bozkurt, Ilkay; Christova, Iva; Duygu, Fazilet; Esen, Saban; Khanna, Arjun; Kader, Çiğdem; Mardani, Masoud; Mahmood, Faisal; Mamuchishvili, Nana; Pshenichnaya, Natalia; Sunbul, Mustafa; Yalcin, Tuğba Y; Leblebicioglu, Hakan

2017-01-01

Crimean Congo Hemorrhagic Fever (CCHF) is a life threatening acute viral infection that presents significant risk of nosocomial transmission to healthcare workers. Evaluation of CCHF infection prevention and control (IP&C) practices in healthcare facilities that routinely manage CCHF cases in Eurasia. A cross-sectional CCHF IP&C survey was designed and distributed to CCHF centers in 10 endemic Eurasian countries in 2016. Twenty-three responses were received from centers in Turkey, Pakistan, Russia, Georgia, Kosovo, Bulgaria, Oman, Iran, India and Kazakhstan. All units had dedicated isolation rooms for CCHF, with cohorting of confirmed cases in 15/23 centers and cohorting of suspect and confirmed cases in 9/23 centers. There was adequate personal protective equipment (PPE) in 22/23 facilities, with 21/23 facilities reporting routine use of PPE for CCHF patients. Adequate staffing levels to provide care reported in 14/23 locations. All centers reported having a high risk CCHFV nosocomial exposure in last five years, with 5 centers reporting more than 5 exposures. Education was provided annually in most centers (13/23), with additional training requested in PPE use (11/23), PPE donning/doffing (12/23), environmental disinfection (12/23) and waste management (14/23). Staff and patient safety must be improved and healthcare associated CCHF exposure and transmission eliminated. Improvements are recommended in isolation capacity in healthcare facilities, use of PPE and maintenance of adequate staffing levels. We recommend further audit of IP&C practice at individual units in endemic areas, as part of national quality assurance programs.

Infection prevention and control practice for Crimean-Congo hemorrhagic fever—A multi-center cross-sectional survey in Eurasia

PubMed Central

Gulzhan, Abuova; Ahmeti, Salih; Al-Abri, Seif S.; Asik, Zahide; Atilla, Aynur; Beeching, Nick J.; Bilek, Heval; Bozkurt, Ilkay; Christova, Iva; Duygu, Fazilet; Esen, Saban; Khanna, Arjun; Kader, Çiğdem; Mardani, Masoud; Mahmood, Faisal; Mamuchishvili, Nana; Pshenichnaya, Natalia; Sunbul, Mustafa; Yalcin, Tuğba Y.; Leblebicioglu, Hakan

2017-01-01

Background Crimean Congo Hemorrhagic Fever (CCHF) is a life threatening acute viral infection that presents significant risk of nosocomial transmission to healthcare workers. Aim Evaluation of CCHF infection prevention and control (IP&C) practices in healthcare facilities that routinely manage CCHF cases in Eurasia. Methods A cross-sectional CCHF IP&C survey was designed and distributed to CCHF centers in 10 endemic Eurasian countries in 2016. Results Twenty-three responses were received from centers in Turkey, Pakistan, Russia, Georgia, Kosovo, Bulgaria, Oman, Iran, India and Kazakhstan. All units had dedicated isolation rooms for CCHF, with cohorting of confirmed cases in 15/23 centers and cohorting of suspect and confirmed cases in 9/23 centers. There was adequate personal protective equipment (PPE) in 22/23 facilities, with 21/23 facilities reporting routine use of PPE for CCHF patients. Adequate staffing levels to provide care reported in 14/23 locations. All centers reported having a high risk CCHFV nosocomial exposure in last five years, with 5 centers reporting more than 5 exposures. Education was provided annually in most centers (13/23), with additional training requested in PPE use (11/23), PPE donning/doffing (12/23), environmental disinfection (12/23) and waste management (14/23). Conclusions Staff and patient safety must be improved and healthcare associated CCHF exposure and transmission eliminated. Improvements are recommended in isolation capacity in healthcare facilities, use of PPE and maintenance of adequate staffing levels. We recommend further audit of IP&C practice at individual units in endemic areas, as part of national quality assurance programs. PMID:28886039

Assessment of Quality Assurance Measures for Radioactive Material Transport Packages not Requiring Competent Authority Design Approval - 13282

DOE Office of Scientific and Technical Information (OSTI.GOV)

Komann, Steffen; Groeke, Carsten; Droste, Bernhard

The majority of transports of radioactive materials are carried out in packages which don't need a package design approval by a competent authority. Low-active radioactive materials are transported in such packages e.g. in the medical and pharmaceutical industry and in the nuclear industry as well. Decommissioning of NPP's leads to a strong demand for packages to transport low and middle active radioactive waste. According to IAEA regulations the 'non-competent authority approved package types' are the Excepted Packages and the Industrial Packages of Type IP-1, IP-2 and IP-3 and packages of Type A. For these types of packages an assessment bymore » the competent authority is required for the quality assurance measures for the design, manufacture, testing, documentation, use, maintenance and inspection (IAEA SSR 6, Chap. 306). In general a compliance audit of the manufacturer of the packaging is required during this assessment procedure. Their regulatory level in the IAEA regulations is not comparable with the 'regulatory density' for packages requiring competent authority package design approval. Practices in different countries lead to different approaches within the assessment of the quality assurance measures in the management system as well as in the quality assurance program of a special package design. To use the package or packaging in a safe manner and in compliance with the regulations a management system for each phase of the life of the package or packaging is necessary. The relevant IAEA-SSR6 chap. 801 requires documentary verification by the consignor concerning package compliance with the requirements. (authors)« less

Electronic Reading and Digital Library Technologies: Understanding Learner Expectation and Usage Intent for Mobile Learning

ERIC Educational Resources Information Center

Hyman, Jack A.; Moser, Mary T.; Segala, Laura N.

2014-01-01

Mobile information technology is changing the education landscape by offering learners the opportunity to engage in asynchronous, ubiquitous instruction. While there is a proliferation of mobile content management systems being developed for the mobile Web and stand-alone mobile applications, few studies have addressed learner expectations and…

Solid Cattle Manure Less Prone to Phosphorus Loss in Tile Drainage Water.

PubMed

Wang, Y T; Zhang, T Q; Tan, C S; Qi, Z M; Welacky, T

2018-03-01

Forms (e.g., liquid and solid) of manure influence the risk of P loss after land application. The objective of this study was to investigate the effects of P-based application of various forms of cattle manure (liquid, LCM; or solid, SCM) or inorganic P as triple superphosphate (IP) on soil P losses in tile drainage water. A 4-yr field experiment was conducted in a clay loam soil with a corn ( L.)-soybean [ (L.) Merr.] rotation in the Lake Erie basin. Over the 4 yr, the dissolved reactive P (DRP) flow-weighted mean concentration (FWMC) in tile drainage water was greater under SCM fertilization than under either IP or LCM fertilization. Despite its lower value on an annual basis, DRP FWMC rose dramatically immediately after LCM application. However, the differences in DRP FWMC did not result in detectable differences in DRP loads. Regarding particulate P and total P losses during the 4 yr, they were 68 and 47%, respectively, lower in the soils amended with SCM than in those with IP, whereas both values were similar between IP and LCM treatments. Overall, the P contained in solid cattle manure was less prone to P loss after land application. Accordingly, the present results can provide a basis for manure storage and application of best management practices designed to reduce P losses and improve crop growth. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

Transportation management center data capture for performance and mobility measures reference manual.

DOT National Transportation Integrated Search

2013-03-01

The Guide to Transportation Management Center (TMC) Data Capture for Performance and Mobility Measures is a two-volume document consisting of a summary Guidebook and this Reference Manual. These documents provide technical guidance and recommended pr...

JOINT MOBILIZATION IN THE MANAGEMENT OF PERSISTENT INSERTIONAL ACHILLES TENDINOPATHY: A CASE REPORT.

PubMed

Jayaseelan, Dhinu J; Post, Andrew A; Mischke, John J; Sault, Josiah D

2017-02-01

Insertional Achilles tendinopathy (IAT) can be a challenging condition to manage conservatively. Eccentric exercise is commonly used in the management of chronic tendinopathy; however, it may not be as helpful for insertional tendon problems as compared to mid-portion dysfunction. While current evidence describing the physical therapy management of IAT is developing, gaps still exist in descriptions of best practice. The purpose of this case report is to describe the management of a patient with persistent IAT utilizing impairment-based joint mobilization, self-mobilization, and exercise. A 51-year-old male was seen in physical therapy for complaints of posterior heel pain and reduced running capacity. He was seen by multiple physical therapists previously, but reported continued impairment, and functional restriction. Joint-based non-thrust mobilization and self-mobilization exercise were performed to enhance his ability to run and reduce symptoms. The subject was seen for four visits over the course of two months. He made clinically significant improvements on the Foot and Ankle Activity Measure and Victorian Institute of Sport Assessment-Achilles tendon outcomes, was asymptomatic, and participated in numerous marathons. Improvements were maintained at one-year follow-up. Mobility deficits can contribute to the development of tendinopathy, and without addressing movement restrictions, symptoms and functional decline related to tendinopathy may persist. Joint-directed manual therapy may be a beneficial intervention in a comprehensive plan of care in allowing patients with chronic tendon changes to optimize function. Therapy, Level 4.

Mobile healthcare information management utilizing Cloud Computing and Android OS.

PubMed

Doukas, Charalampos; Pliakas, Thomas; Maglogiannis, Ilias

2010-01-01

Cloud Computing provides functionality for managing information data in a distributed, ubiquitous and pervasive manner supporting several platforms, systems and applications. This work presents the implementation of a mobile system that enables electronic healthcare data storage, update and retrieval using Cloud Computing. The mobile application is developed using Google's Android operating system and provides management of patient health records and medical images (supporting DICOM format and JPEG2000 coding). The developed system has been evaluated using the Amazon's S3 cloud service. This article summarizes the implementation details and presents initial results of the system in practice.

Examining Correlates of Problematic Internet Pornography Use Among University Students.

PubMed

Harper, Cody; Hodgins, David C

2016-06-01

Background and aims The phenomenon of Internet pornography (IP) addiction is gainingincreasing attention in the popular media and psychological research.What has not been tested empirically is how frequency and amount ofIP use, along with other individual characteristics, are related tosymptoms of IP addiction. Methods 105 female and 86 male university students (mean age 21) from Calgary,Canada, were administered measures of IP use, psychosocial functioning(anxiety and depression, life and relationship satisfaction), addictivepropensities, and addictive IP use. Results Men reported earlier age of exposure and more frequent currentIP use than women. Individuals not in relationships reported morefrequent use than those in relationships. Frequency of IP use wasnot generally correlated with psychosocial functioning but was significantlypositively correlated with level of IP addiction. Higher level ofIP addiction was associated with poorer psychosocial functioning andproblematic alcohol, cannabis, gambling and, in particular, videogame use. A curvilinear association was found between frequency ofIP use and level of addiction such that daily or greater IP use wasassociated with a sharp rise in addictive IP scores. Discussion The failure to find a strong significant relationship between IPuse and general psychosocial functioning suggests that the overalleffect of IP use is not necessarily harmful in and of itself. Addictiveuse of IP, which is associated with poorer psychosocial functioning,emerges when people begin to use IP daily.

Getting the most out of your IP--patent management along its life cycle.

PubMed

Bader, Martin A; Gassmann, Oliver; Ziegler, Nicole; Ruether, Frauke

2012-04-01

Effectively managing and optimizing the value of the patent portfolio is a major challenge for many firms, especially those in knowledge intensive industries, such as the pharmaceutical, biotechnological and chemical industry. However, insights on effective patent portfolio strategies are rare. Therefore, in this article we investigate in detail how firms successfully manage and optimize their patent portfolios to increase their overall competitiveness. We discover that successful patent portfolio management is rooted in managing the patents along their life cycles. Based on the findings of ten case studies, we develop a holistic patent life cycle management model reflecting five distinctive phases of patent management: explore, generate, protect, optimize and decline. We conclude with how our findings can be used in practice. Copyright © 2011 Elsevier Ltd. All rights reserved.

A Satellite-Based Infrastructure Providing Broadband IP Services on Board High Speed Trains

NASA Astrophysics Data System (ADS)

Feltrin, Eros; Weller, Elisabeth

After the earlier technologies that offered satellite mobile services for civil and military applications, today’s specific antenna design, modulation techniques and most powerful new generation satellites also allow a good level of performance to be achieved on-board high speed modes of transport such as aircraft and trains. This paper reports the Eutelsat’s experience in the developing and deploying architecture based on a spread spectrum system in order to provide broadband connectivity on board of high speed trains. After introducing the adopted technologies, the architecture and the constraints, some results obtained from analysis, testing and measuring of the availability of the service are reported and commented upon.

Protective activity of Lentinan in experimental tuberculosis.

PubMed

Markova, Nadya; Kussovski, Vesselin; Drandarska, Ivanka; Nikolaeva, Sascha; Georgieva, Neli; Radoucheva, Tatyana

2003-10-01

Protective effects of Lentinan (Ajinomoto, Japan) against Mycobacterium tuberculosis infection were studied by in vitro and in vivo mouse models. The effectiveness of Lentinan administrated intraperitoneally (i.p.) before infection at a dose of 1 mg/kg three times at 2-day intervals was monitored in vivo by several parameters (body temperature; spleen weight; CFU counts of M. tuberculosis in spleen, liver and lung; and histomorphological observations). Peritoneal macrophages obtained from animals treated with Lentinan were greatly stimulated, as assayed by establishing their number, acid phosphatase activity, H2O2 production and killing ability against M. tuberculosis in vitro. The in vivo model demonstrated that administration of Lentinan before infection can mobilize host defense potential and reduce mycobacterial infection.

Mapping of transcription factor binding regions in mammalian cells by ChIP: Comparison of array- and sequencing-based technologies

PubMed Central

Euskirchen, Ghia M.; Rozowsky, Joel S.; Wei, Chia-Lin; Lee, Wah Heng; Zhang, Zhengdong D.; Hartman, Stephen; Emanuelsson, Olof; Stolc, Viktor; Weissman, Sherman; Gerstein, Mark B.; Ruan, Yijun; Snyder, Michael

2007-01-01

Recent progress in mapping transcription factor (TF) binding regions can largely be credited to chromatin immunoprecipitation (ChIP) technologies. We compared strategies for mapping TF binding regions in mammalian cells using two different ChIP schemes: ChIP with DNA microarray analysis (ChIP-chip) and ChIP with DNA sequencing (ChIP-PET). We first investigated parameters central to obtaining robust ChIP-chip data sets by analyzing STAT1 targets in the ENCODE regions of the human genome, and then compared ChIP-chip to ChIP-PET. We devised methods for scoring and comparing results among various tiling arrays and examined parameters such as DNA microarray format, oligonucleotide length, hybridization conditions, and the use of competitor Cot-1 DNA. The best performance was achieved with high-density oligonucleotide arrays, oligonucleotides ≥50 bases (b), the presence of competitor Cot-1 DNA and hybridizations conducted in microfluidics stations. When target identification was evaluated as a function of array number, 80%–86% of targets were identified with three or more arrays. Comparison of ChIP-chip with ChIP-PET revealed strong agreement for the highest ranked targets with less overlap for the low ranked targets. With advantages and disadvantages unique to each approach, we found that ChIP-chip and ChIP-PET are frequently complementary in their relative abilities to detect STAT1 targets for the lower ranked targets; each method detected validated targets that were missed by the other method. The most comprehensive list of STAT1 binding regions is obtained by merging results from ChIP-chip and ChIP-sequencing. Overall, this study provides information for robust identification, scoring, and validation of TF targets using ChIP-based technologies. PMID:17568005

IP3-mediated gating mechanism of the IP3 receptor revealed by mutagenesis and X-ray crystallography

PubMed Central

Hamada, Kozo; Miyatake, Hideyuki; Terauchi, Akiko; Mikoshiba, Katsuhiko

2017-01-01

The inositol 1,4,5-trisphosphate (IP3) receptor (IP3R) is an IP3-gated ion channel that releases calcium ions (Ca2+) from the endoplasmic reticulum. The IP3-binding sites in the large cytosolic domain are distant from the Ca2+ conducting pore, and the allosteric mechanism of how IP3 opens the Ca2+ channel remains elusive. Here, we identify a long-range gating mechanism uncovered by channel mutagenesis and X-ray crystallography of the large cytosolic domain of mouse type 1 IP3R in the absence and presence of IP3. Analyses of two distinct space group crystals uncovered an IP3-dependent global translocation of the curvature α-helical domain interfacing with the cytosolic and channel domains. Mutagenesis of the IP3R channel revealed an essential role of a leaflet structure in the α-helical domain. These results suggest that the curvature α-helical domain relays IP3-controlled global conformational dynamics to the channel through the leaflet, conferring long-range allosteric coupling from IP3 binding to the Ca2+ channel. PMID:28416699

Facilitating Stroke Management using Modern Information Technology.

PubMed

Nam, Hyo Suk; Park, Eunjeong; Heo, Ji Hoe

2013-09-01

Information technology and mobile devices may be beneficial and useful in many aspects of stroke management, including recognition of stroke, transport and triage of patients, emergent stroke evaluation at the hospital, and rehabilitation. In this review, we address the contributions of information technology and mobile health to stroke management. Rapid detection and triage are essential for effective thrombolytic treatment. Awareness of stroke warning signs and responses to stroke could be enhanced by using mobile applications. Furthermore, prehospital assessment and notification could be streamlined for use in telemedicine and teleradiology. A mobile telemedicine system for assessing the National Institutes of Health Stroke Scale scores has shown higher correlation and fast assessment comparing with face-to-face method. Because the benefits of thrombolytic treatment are time-dependent, treatment should be initiated as quickly as possible. In-hospital communication between multidisciplinary team members can be enhanced using information technology. A computerized in-hospital alert system using computerized physician-order entry was shown to be effective in reducing the time intervals from hospital arrival to medical evaluations and thrombolytic treatment. Mobile devices can also be used as supplementary tools for neurologic examination and clinical decision-making. In post-stroke rehabilitation, virtual reality and telerehabilitation are helpful. Mobile applications might be useful for public awareness, lifestyle modification, and education/training of healthcare professionals. Information technology and mobile health are useful tools for management of stroke patients from the acute period to rehabilitation. Further improvement of technology will change and enhance stroke prevention and treatment.

Integration of Peer Philosophy into a Standardized Self-Management Mobile Health Intervention.

PubMed

Fortuna, Karen L; Storm, Marianne; Aschbrenner, Kelly A; Bartels, Stephen J

2018-04-19

Description of certified peer specialists integration of peer philosophy into the delivery of a self-management intervention enhanced with mobile health. Qualitative examination of peer case notes that were routinely entered on a peer care management electronic dashboard. This study included consumers with serious mental illness (N = 8) with a mean age of 68.8 years (SD = 4.9). Certified peer specialists (N = 3) were all female and aged 55 years or older. Peers entered 146 case notes on the peer care management notes dashboard. Five themes emerged including encouragement of self-determination, bio-psychosocial-spiritual framework guides practice, sharing lived experience to teach self-management skills, personalized text messages to reinforce self-management skill development, and identifying unmet needs and advocating for human rights. Peers unique perspectives and expertise was complemented with the standardized delivery of evidence-based intervention enhanced with mobile health.

Effect of Withania somnifera on forced swimming test induced immobility in mice and its interaction with various drugs.

PubMed

Shah, P C; Trivedi, N A; Bhatt, J D; Hemavathi, K G

2006-01-01

The objective of the present study was to evaluate the antidepressant action of Withania somnifera (WS) as well as its interaction with the conventional antidepressant drugs and to delineate the possible mechanism of its antidepressant action using forced swimming model in mice. Effect of different doses of WS, fluoxetine and imipramine were studied on forced swimming test induced mean immobility time (MIT). Moreover effect of WS 100 mg/kg, i.p. was observed at different time intervals. Effect produced by combination of sub therapeutic doses of WS with imipramine (2.5 mg/kg, i.p.) as well as fluoxetine (2.5 mg/kg, i.p.) were also observed. Effect of WS (100 mg/kg, i.p.) as well as combination of WS (37.5 mg/kg, i.p.) with either imipramine (2.5 mg/kg, i.p.) or fluoxetine (2.5 mg/kg, i.p.) were observed in mice pretreated with reserpine (2 mg/kg, i.p.) and clonidine (0.15 mg/kg, i.p.). Effects of prazosin (3 mg/kg, i.p.) or haloperidol (0.1 mg/kg, i.p.) pre-treatment were also observed on WS induced decrease in MIT. WS produced dose dependent decrease in MIT. Maximum effect in MIT was observed after 30 min of treatment with WS 100 mg/kg, i.p. Combination of WS (37.5 mg/kg, i.p.) with imipramine (2.5 mg/kg, i.p.) or fluoxetine (2.5 mg/kg, i.p.) also produced significant decrease in the MIT. Clonidine and reserpine induced increase in MIT, was significantly reversed by treatment with WS (100 mg/kg, i.p.) as well as combination of WS (37.5 mg/kg, i.p.) with either imipramine (2.5 mg/kg, i.p.) or fluoxetine (2.5 mg/kg, i.p.). Pre-treatment with prazosin but not haloperidol, significantly antagonized the WS (100 mg/kg, i.p.) induced decrease in MIT. It is concluded that, WS produced significant decrease in MIT in mice which could be mediated partly through a adrenoceptor as well as alteration in the level of central biogenic amines.

An Analysis of Total Quality Management in Aeronautical Systems Division

DTIC Science & Technology

1991-09-01

Annual Review ..... ......... . 3-51 Disease 4: Mobility of Top Management ................... .3-52 Disease 5: Running a Company on Visible Figures...range Planning .................... 5-4 Merit Rating Systems and Annual Evaluation of Performance .. ..... ........... 5-4 Mobility of Management...generations of careful quality-conscious buyers. The indus- trial engine ran on the talents of designers, packagers, and advertisers . Turning out new

Design and implementation of web service-based mobile reply testing management system

NASA Astrophysics Data System (ADS)

Gao, Liang; Han, Yu-min

2013-03-01

This paper introduces the design and implementation of a reply testing management system that based-on C#, Web Service and ASP .Net. With the system, teachers can manage reply site through Windows Mobile, judges can grade onscene by visiting WAP site through GPRS. Then this paper discusses details of the implementation and key technologies of the system.

Improving Data Mobility & Management for International Cosmology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Borrill, Julian; Dart, Eli; Gore, Brooklin

In February 2015 the third workshop in the CrossConnects series, with a focus on Improving Data Mobility & Management for International Cosmology, was held at Lawrence Berkeley National Laboratory. Scientists from fields including astrophysics, cosmology, and astronomy collaborated with experts in computing and networking to outline strategic opportunities for enhancing scientific productivity and effectively managing the ever-increasing scale of scientific data.

Potassium Channel Interacting Protein 2 (KChIP2) is not a transcriptional regulator of cardiac electrical remodeling

PubMed Central

Winther, Sine V.; Tuomainen, Tomi; Borup, Rehannah; Tavi, Pasi; Antoons, Gudrun; Thomsen, Morten B.

2016-01-01

The heart-failure relevant Potassium Channel Interacting Protein 2 (KChIP2) augments CaV1.2 and KV4.3. KChIP3 represses CaV1.2 transcription in cardiomyocytes via interaction with regulatory DNA elements. Hence, we tested nuclear presence of KChIP2 and if KChIP2 translocates into the nucleus in a Ca2+ dependent manner. Cardiac biopsies from human heart-failure patients and healthy donor controls showed that nuclear KChIP2 abundance was significantly increased in heart failure; however, this was secondary to a large variation of total KChIP2 content. Administration of ouabain did not increase KChIP2 content in nuclear protein fractions in anesthetized mice. KChIP2 was expressed in cell lines, and Ca2+ ionophores were applied in a concentration- and time-dependent manner. The cell lines had KChIP2-immunoreactive protein in the nucleus in the absence of treatments to modulate intracellular Ca2+ concentration. Neither increasing nor decreasing intracellular Ca2+ concentrations caused translocation of KChIP2. Microarray analysis did not identify relief of transcriptional repression in murine KChIP2−/− heart samples. We conclude that although there is a baseline presence of KChIP2 in the nucleus both in vivo and in vitro, KChIP2 does not directly regulate transcriptional activity. Moreover, the nuclear transport of KChIP2 is not dependent on Ca2+. Thus, KChIP2 does not function as a conventional transcription factor in the heart. PMID:27349185

44 CFR 334.6 - Department and agency responsibilities.

Code of Federal Regulations, 2012 CFR

2012-10-01

... responsibilities. 334.6 Section 334.6 Emergency Management and Assistance FEDERAL EMERGENCY MANAGEMENT AGENCY, DEPARTMENT OF HOMELAND SECURITY PREPAREDNESS GRADUATED MOBILIZATION RESPONSE § 334.6 Department and agency responsibilities. (a) During Stage 3, each Federal department and agency with mobilization responsibilities will...

One Approach for Transitioning the iNET Standards into the IRIG 106 Telemetry Standards

DTIC Science & Technology

2015-05-26

Protocol Suite. Figure 1 illustrates the Open Systems Interconnection ( OSI ) Model, the corresponding TCP/IP Model, and the major components of the TCP...IP Protocol Suite. Figure 2 represents the iNET-specific protocols layered onto the TCP/IP Model. Figure 1. OSI and TCP/IP Model with TCP/IP...Protocol Suite TCP/IP Protocol Suite Major Components IPv4 IPv6 TCP/IP Model OSI Model Application Presentation

Attraction of Southern Pine Engravers and Associated Bark Beetles (Coleoptera: Scolytidae) to Ipsenol, Ipsdienol, and Lanierone in Southeastern United States

Treesearch

D. R. Miller; C. Asaro; C. W. Berisford

2005-01-01

We determined the response of the small southern pine engraver, Ips avulses (Eichhoff); eastern fivespined ips, Ips grandicollis (Eichhoff); sixspined ips, Ips calligraphus (Germar); and pine engraver, Ips pini (Say) to the pheromones (±)-ipsenol, (±)-ipsdienol, and lanierone in the...

78 FR 49693 - Speech-to-Speech and Internet Protocol (IP) Speech-to-Speech Telecommunications Relay Services...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-15

...] Speech-to-Speech and Internet Protocol (IP) Speech-to-Speech Telecommunications Relay Services...: This is a summary of the Commission's Speech-to-Speech and Internet Protocol (IP) Speech-to-Speech...), Internet Protocol Relay (IP Relay), and IP captioned telephone service (IP CTS) as compensable forms of TRS...

Impact of artifact removal on ChIP quality metrics in ChIP-seq and ChIP-exo data

PubMed Central

Carroll, Thomas S.; Liang, Ziwei; Salama, Rafik; Stark, Rory; de Santiago, Ines

2014-01-01

With the advent of ChIP-seq multiplexing technologies and the subsequent increase in ChIP-seq throughput, the development of working standards for the quality assessment of ChIP-seq studies has received significant attention. The ENCODE consortium's large scale analysis of transcription factor binding and epigenetic marks as well as concordant work on ChIP-seq by other laboratories has established a new generation of ChIP-seq quality control measures. The use of these metrics alongside common processing steps has however not been evaluated. In this study, we investigate the effects of blacklisting and removal of duplicated reads on established metrics of ChIP-seq quality and show that the interpretation of these metrics is highly dependent on the ChIP-seq preprocessing steps applied. Further to this we perform the first investigation of the use of these metrics for ChIP-exo data and make recommendations for the adaptation of the NSC statistic to allow for the assessment of ChIP-exo efficiency. PMID:24782889

Inositol trisphosphate metabolism in carrot (Daucus carota L. ) cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Memon, A.R.; Rincon, M.; Boss, W.F.

1989-10-01

The metabolism of exogenously added D-myo-(1-{sup 3}H)inositol 1,4,5-trisphosphate (IP{sub 3}) has been examined in microsomal membrane and soluble fractions of carrot cells grown in suspension culture. When ({sup 3}H)IP{sub 3} was added to a microsomal membrane fraction, ({sup 3}H)IP{sub 2} was the primary metabolite consisting of approximately 83% of the total recovered ({sup 3}H) by electrophoresis. ({sup 3}H)IP was only 6% of the ({sup 3}H) recovered, and 10% of the ({sup 3}H)IP{sub 3} was not further metabolized. In contrast, when ({sup 3}H)IP{sub 3} was added to the soluble fraction, approximately equal amounts of ({sup 3}H)IP{sub 2} and ({sup 3}H)IP weremore » recovered. Ca{sup 2+} (100 micromolar) tended to enhance IP{sub 3} dephosphorylation but inhibited the IP{sub 2} dephosphorylation in the soluble fraction by about 20%. MoO{sub 4}{sup 2{minus}} (1 millimolar) inhibited the dephosphorylation of IP{sub 3} by the microsomal fraction and the dephosphorylation of IP{sub 2} by the soluble fraction. MoO{sub 4}{sup 2{minus}}, however, did not inhibit the dephosphorylation of IP{sub 3} by the soluble fraction. Li{sup +} (10 and 50 millimolar) had no effect on IP{sub 3} metabolism in either the soluble or membrane fraction; however, Li{sup +} (50 millimolar) inhibited IP{sub 2} dephosphorylation in the soluble fraction about 25%.« less

Stimulation of Inositol 1,4,5-Trisphosphate (IP3) Receptor Subtypes by Adenophostin A and Its Analogues

PubMed Central

Saleem, Huma; Tovey, Stephen C.; Riley, Andrew M.; Potter, Barry V. L.; Taylor, Colin W.

2013-01-01

Inositol 1,4,5-trisphosphate receptors (IP3R) are intracellular Ca2+ channels. Most animal cells express mixtures of the three IP3R subtypes encoded by vertebrate genomes. Adenophostin A (AdA) is the most potent naturally occurring agonist of IP3R and it shares with IP3 the essential features of all IP3R agonists, namely structures equivalent to the 4,5-bisphosphate and 6-hydroxyl of IP3. The two essential phosphate groups contribute to closure of the clam-like IP3-binding core (IBC), and thereby IP3R activation, by binding to each of its sides (the α- and β-domains). Regulation of the three subtypes of IP3R by AdA and its analogues has not been examined in cells expressing defined homogenous populations of IP3R. We measured Ca2+ release evoked by synthetic adenophostin A (AdA) and its analogues in permeabilized DT40 cells devoid of native IP3R and stably expressing single subtypes of mammalian IP3R. The determinants of high-affinity binding of AdA and its analogues were indistinguishable for each IP3R subtype. The results are consistent with a cation-π interaction between the adenine of AdA and a conserved arginine within the IBC α-domain contributing to closure of the IBC. The two complementary contacts between AdA and the α-domain (cation-π interaction and 3″-phosphate) allow activation of IP3R by an analogue of AdA (3″-dephospho-AdA) that lacks a phosphate group equivalent to the essential 5-phosphate of IP3. These data provide the first structure-activity analyses of key AdA analogues using homogenous populations of all mammalian IP3R subtypes. They demonstrate that differences in the Ca2+ signals evoked by AdA analogues are unlikely to be due to selective regulation of IP3R subtypes. PMID:23469136

Biomonitoring the Cooked Meat Carcinogen 2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) in Hair: Impact of Exposure, Pigmentation and Cytochrome P450 1A2 Phenotype

PubMed Central

Turesky, Robert J.; Liu, Lin; Gu, Dan; Yonemori, Kim M.; White, Kami K.; Wilkens, Lynne R.; Marchand, Loic Le

2013-01-01

Background Hair is a promising tissue to assess exposure to 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), a carcinogen formed in cooked meats. However, an understanding of how dietary exposure to PhIP, cytochrome P450 1A2 activity - a key enzyme involved in PhIP metabolism, and hair pigmentation affect the level of PhIP accrued in hair is required in order to determine the reliability of the PhIP hair level as a biomarker of exposure to this carcinogen. Methods We examined the impact of PhIP exposure, cytochrome P450 1A2 activity, and hair pigmentation on the levels of PhIP accumulated in the hair of volunteers on a 4-week semi-controlled diet of cooked meat containing known quantities of PhIP. Results The amount of PhIP in hair increased, on average, 15-fold in light- and dark-haired individuals during consumption of cooked meat. PhIP levels in hair were correlated to PhIP intake (ρ = 0.53; p < 0.001), and the relationship was strengthened when PhIP levels were normalized for the melanin content of hair (ρ = 0.71; p < 0.001). However, PhIP accrual in hair was not correlated to cytochrome P450 1A2 activity, as assessed by the caffeine test, or to the levels of unmetabolized PhIP in urine, or to the metabolic ratio of the major urinary metabolite N2-(ß-1-glucosiduronyl-2-(hydroxyamino)-1-methyl-6-phenylimidazo[4,5-b]pyridine to unmetabolized PhIP. Conclusions The employment of the PhIP hair biomarker should take hair pigmentation into account for accurate exposure assessment. Impact PhIP hair levels can serve as a biomarker in epidemiological studies investigating the association of HAAs, cooked meat and cancer risk. PMID:23329727

Biomonitoring the cooked meat carcinogen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine in hair: impact of exposure, hair pigmentation, and cytochrome P450 1A2 phenotype.

PubMed

Turesky, Robert J; Liu, Lin; Gu, Dan; Yonemori, Kim M; White, Kami K; Wilkens, Lynne R; Le Marchand, Loïc

2013-03-01

Hair is a promising tissue to assess exposure to 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), a carcinogen formed in cooked meats. However, an understanding of how dietary exposure to PhIP, cytochrome P450 1A2 activity-a key enzyme involved in PhIP metabolism, and hair pigmentation affect the level of PhIP accrued in hair is required to determine the reliability of the PhIP hair level as a biomarker of exposure to this carcinogen. We examined the impact of PhIP exposure, cytochrome P450 1A2 activity, and hair pigmentation on the levels of PhIP accumulated in the hair of volunteers on a 4-week semicontrolled diet of cooked meat containing known quantities of PhIP. The amount of PhIP in hair increased, on average, 15-fold in light- and dark-haired individuals during consumption of cooked meat. PhIP levels in hair were correlated to PhIP intake (ρ = 0.53; P < 0.001), and the relationship was strengthened when PhIP levels were normalized for the melanin content of hair (ρ = 0.71; P < 0.001). However, PhIP accrual in hair was not correlated to cytochrome P450 1A2 activity, as assessed by the caffeine test, or to the levels of unmetabolized PhIP in urine or to the metabolic ratio of the major urinary metabolite N(2)-(β-1-glucosiduronyl-2-(hydroxyamino)-1-methyl-6-phenylimidazo[4,5-b]pyridine to unmetabolized PhIP. The use of the PhIP hair biomarker should take hair pigmentation into account for accurate exposure assessment of PhIP. PhIP hair levels can serve as a biomarker in epidemiologic studies investigating the association of heterocyclic aromatic amine (HAA), cooked meat, and cancer risk.

Reflection on Mobile Applications for Blood Pressure Management: A Systematic Review on Potential Effects and Initiatives.

PubMed

Mohammadi, Reyhaneh; Ayatolahi Tafti, Movahhedeh; Hoveidamanesh, Soodabeh; Ghanavati, Reza; Pournik, Omid

2018-01-01

Ischemic heart disease and stroke have been considered as the first global leading cause of death in last decades [1]. Blood pressure (BP) management is one of the easiest ways suggested for preventing and controlling cardiovascular diseases before the patient develops complications and death-following outcomes. Appearance of technology advancements in the health system has motivated researchers and health providers to study its different aspects and applications in order to improve disease prevention and management. Following these efforts, mobile health (mHealth) technologies were presented to provide people with fast and easier-to-use services. Although there are some unsolved challenges, these technologies have become popular among many people. As an important part of mHealth, mobile applications (apps) have been the focused subject of many studies in the last decade. The objective of this systematic review is to assess the potential effects of mobile apps designed for BP management by scrutinizing the related studies. Search methods: We searched the following electronic databases in December 2016: Medline (PubMed), National Center for Biotechnology Information (NCBI), Cochrane Central Register of Controlled Trials (CENTRAL), PsycINFO, Cumulative Index to Nursing and Allied Health Literature (CINAHL), Education Resources Information Center(ERIC), Web of Science, ProQuest, and Google Scholar. No language restriction and start point limitation were imposed. We included studies that evaluated and assessed mobile apps for BP management and related clinical trials that considered mobile app as the only difference between intervention and control groups. Two review authors applied the eligibility criteria, extracted data and assessed the quality of included studies. Literature search resulted in 13 included studies and 27 reviews. 12 records of 13 included studies identified as interventional studies. The review showed that the mobile apps may improve individual's BP condition and medication adherence. Most of the studies had emphasized positive effects of mobile apps in BP management. However, there is a necessity for performing further investigations due to the identified issues in this study such as low number of participants and limited intervention period in randomized controlled trials, and interventions limited to only hypertensive or high-risked individual.

Spacelab

NASA Image and Video Library

1985-07-01

This photograph shows the Instrument Pointing System (IPS) for Spacelab-2 being deployed in the cargo bay of the Space Shuttle Orbiter Challenger. The European Space Agency (ESA) developed this irnovative pointing system for the Spacelab program. Previously, instruments were pointed toward particular celestial objects or areas by maneuvering the Shuttle to an appropriate attitude. The IPS could aim instruments more accurately than the Shuttle and kept them fixed on a target as the Shuttle moved. On the first pallet, three solar instruments and one atmospheric instrument were mounted on the IPS. Spacelab-2 was the first pallet-only mission. One of the goals of the mission was to verify that the pallets' configuration was satisfactory for observations and research. Except for two biological experiments and an experiment that uses ground-based instruments, the Spacelab-2 scientific instruments needed direct exposure to space. The Spacelab-2 mission was designed to capitalize on the Shuttle-Spacelab capabilities to carry very large instruments, launch and retrieve satellites, and point several instruments independently with accuracy and stability. Spacelab-2 (STS-51F, 19th Shuttle mission) was launched on July 29, 1985 aboard the Space Shuttle Orbiter Challenger. The Marshall Space Flight Center had overall management responsibilities of the Spacelab missions.

Spacelab

NASA Image and Video Library

1985-07-01

This photograph shows the Instrument Pointing System (IPS) for Spacelab-2 being deployed in the cargo bay of the Space Shuttle Orbiter Challenger. The European Space Agency (ESA) developed this irnovative pointing system for the Spacelab program. Previously, instruments were pointed toward particular celestial objects or areas by maneuvering the Shuttle to an appropriate attitude. The IPS could aim instruments more accurately than the Shuttle and kept them fixed on a target as the Shuttle moved. On the first pallet, three solar instruments and one atmospheric instrument were mounted on the IPS. Spacelab-2 was the first pallet-only mission. One of the goals of the mission was to verify that the pallets' configuration was satisfactory for observations and research. Except for two biological experiments and an experiment that used ground-based instruments, the Spacelab-2 scientific instruments needed direct exposure to space. The Spacelab-2 mission was designed to capitalize on the Shuttle-Spacelab capabilities to carry very large instruments, launch and retrieve satellites, and point several instruments independently with accuracy and stability. Spacelab-2 (STS-51F, 19th Shuttle mission) was launched on July 29, 1985 aboard the Space Shuttle Orbiter Challenger. The Marshall Space Flight Center had overall management responsibilities of the Spacelab missions.

Collusion issue in video watermarking

NASA Astrophysics Data System (ADS)

Doerr, Gwenael; Dugelay, Jean-Luc

2005-03-01

Digital watermarking has first been introduced as a possible way to ensure intellectual property (IP) protection. However, fifteen years after its infancy, it is still viewed as a young technology and digital watermarking is far from being introduced in Digital Right Management (DRM) frameworks. A possible explanation is that the research community has so far mainly focused on the robustness of the embedded watermark and has almost ignored security aspects. For IP protection applications such as fingerprinting and copyright protection, the watermark should provide means to ensure some kind of trust in a non secure environment. To this end, security against attacks from malicious users has to be considered. This paper will focus on collusion attacks to evaluate security in the context of video watermarking. In particular, security pitfalls will be exhibited when frame-by-frame embedding strategies are enforced for video watermarking. Two alternative strategies will be surveyed: either eavesdropping the watermarking channel to identify some redundant hidden structure, or jamming the watermarking channel to wash out the embedded watermark signal. Finally, the need for a new brand of watermarking schemes will be highlighted if the watermark is to be released in a hostile environment, which is typically the case for IP protection applications.

Curcumin modifies Apc(min) apoptosis resistance and inhibits 2-amino 1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) induced tumour formation in Apc(min) mice.

PubMed

Collett, G P; Robson, C N; Mathers, J C; Campbell, F C

2001-05-01

Curcumin, the active ingredient of the rhizome of Curcuma longa, promotes apoptosis and may have chemopreventive properties. This study investigates the effects of curcumin on apoptosis and tumorigenesis in male Apc(min) mice treated with the human dietary carcinogen, 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP). Intestinal epithelial apoptotic index in response to PhIP treatment was approximately twice as great in the wild-type C57BL/6 APC(+/+) strain than in Apc(min) mice (3.7% Apc(+/+) versus 1.9% Apc(min); P < 0.001). PhIP promoted tumour formation in Apc(min) proximal small intestine (4.6 tumours per mouse, PhIP treated versus 2.1 tumours per mouse, control untreated; P < 0.05). Curcumin enhanced PhIP-induced apoptosis (4.0% curcumin + PhIP versus 2.1% PhIP alone; P < 0.01) and inhibited PhIP-induced tumorigenesis in the proximal small intestine of Apc(min) mice (2.2 tumours per mouse, curcumin + PhIP versus 4.6 tumours per mouse PhIP alone; P < 0.05). This study shows that the Apc(min) genotype is associated with resistance to PhIP-induced apoptosis in intestinal epithelium. Curcumin attenuates Apc(min) resistance to PhIP-induced apoptosis and inhibits PhIP-induced tumorigenesis in proximal Apc(min) mouse small intestine.

Price Based Local Power Distribution Management System (Local Power Distribution Manager) v1.0

DOE Office of Scientific and Technical Information (OSTI.GOV)

BROWN, RICHARD E.; CZARNECKI, STEPHEN; SPEARS, MICHAEL

2016-11-28

A trans-active energy micro-grid controller is implemented in the VOLTTRON distributed control platform. The system uses the price of electricity as the mechanism for conducting transactions that are used to manage energy use and to balance supply and demand. In order to allow testing and analysis of the control system, the implementation is designed to run completely as a software simulation, while allowing the inclusion of selected hardware that physically manages power. Equipment to be integrated with the micro-grid controller must have an IP (Internet Protocol)-based network connection and a software "driver" must exist to translate data communications between themore » device and the controller.« less

Design and Usability Evaluation of Social Mobile Diabetes Management System in the Gulf Region.

PubMed

Alanzi, Turki; Istepanian, Robert; Philip, Nada

2016-09-26

The prevalence of diabetes in the Gulf States is one of the highest globally. It is estimated that 20% of the population in the region has been diagnosed with diabetes and according to the International Diabetes Federation (IDF), five of the IDF's "top 10" countries for diabetes prevalence in 2011 and projected for 2030 are in this region. In recent years, there have been an increasing number of clinical studies advocating the use of mobile phone technology for diabetes self-management with improved clinical outcomes. However, there are few studies to date addressing the application of mobile diabetes management in the Gulf region, particularly in the Kingdom of Saudi Arabia (KSA), where there is exponential increase in mobile phone usage and access to social networking. The objective of this paper is to present the design and development of a new mobile health system for social behavioral change and management tailored for Saudi patients with diabetes called Saudi Arabia Networking for Aiding Diabetes (SANAD). A usability study for the SANAD system is presented to validate the acceptability of using mobile technologies among patients with diabetes in the KSA and the Gulf region. The SANAD system was developed using mobile phone technology with diabetes management and social networking modules. For the usability study the Questionnaire for User Interaction Satisfaction was used to evaluate the usability aspect of the SANAD system. A total of 33 users with type 2 diabetes participated in the study. The key modules of the SANAD system consist of (1) a mobile diabetes management module; (2) a social networking module; and (3) a cognitive behavioral therapy module for behavioral change issues. The preliminary results of the usability study indicated general acceptance of the patients in using the system with higher usability rating in patients with type 2 diabetes. We found that the acceptability of the system was high among Saudi patients with diabetes, and ongoing work in this research area is underway to conduct a clinical pilot study in the KSA for patients with type 2 diabetes. The wide deployment of such a system is timely and required in the Gulf region due to the wide use of mobile phones and social networking mediums.

Design and Usability Evaluation of Social Mobile Diabetes Management System in the Gulf Region

PubMed Central

2016-01-01

Background The prevalence of diabetes in the Gulf States is one of the highest globally. It is estimated that 20% of the population in the region has been diagnosed with diabetes and according to the International Diabetes Federation (IDF), five of the IDF’s “top 10” countries for diabetes prevalence in 2011 and projected for 2030 are in this region. In recent years, there have been an increasing number of clinical studies advocating the use of mobile phone technology for diabetes self-management with improved clinical outcomes. However, there are few studies to date addressing the application of mobile diabetes management in the Gulf region, particularly in the Kingdom of Saudi Arabia (KSA), where there is exponential increase in mobile phone usage and access to social networking. Objective The objective of this paper is to present the design and development of a new mobile health system for social behavioral change and management tailored for Saudi patients with diabetes called Saudi Arabia Networking for Aiding Diabetes (SANAD). A usability study for the SANAD system is presented to validate the acceptability of using mobile technologies among patients with diabetes in the KSA and the Gulf region. Methods The SANAD system was developed using mobile phone technology with diabetes management and social networking modules. For the usability study the Questionnaire for User Interaction Satisfaction was used to evaluate the usability aspect of the SANAD system. A total of 33 users with type 2 diabetes participated in the study. Results The key modules of the SANAD system consist of (1) a mobile diabetes management module; (2) a social networking module; and (3) a cognitive behavioral therapy module for behavioral change issues. The preliminary results of the usability study indicated general acceptance of the patients in using the system with higher usability rating in patients with type 2 diabetes. Conclusions We found that the acceptability of the system was high among Saudi patients with diabetes, and ongoing work in this research area is underway to conduct a clinical pilot study in the KSA for patients with type 2 diabetes. The wide deployment of such a system is timely and required in the Gulf region due to the wide use of mobile phones and social networking mediums. PMID:27670696

Isoproterenol Acts as a Biased Agonist of the Alpha-1A-Adrenoceptor that Selectively Activates the MAPK/ERK Pathway

PubMed Central

Copik, Alicja. J.; Baldys, Aleksander; Nguyen, Khanh; Sahdeo, Sunil; Ho, Hoangdung; Kosaka, Alan; Dietrich, Paul J.; Fitch, Bill; Raymond, John R.; Ford, Anthony P. D. W.; Button, Donald; Milla, Marcos E.

2015-01-01

The α1A-AR is thought to couple predominantly to the Gαq/PLC pathway and lead to phosphoinositide hydrolysis and calcium mobilization, although certain agonists acting at this receptor have been reported to trigger activation of arachidonic acid formation and MAPK pathways. For several G protein-coupled receptors (GPCRs) agonists can manifest a bias for activation of particular effector signaling output, i.e. not all agonists of a given GPCR generate responses through utilization of the same signaling cascade(s). Previous work with Gαq coupling-defective variants of α1A-AR, as well as a combination of Ca2+ channel blockers, uncovered cross-talk between α1A-AR and β2-AR that leads to potentiation of a Gαq-independent signaling cascade in response to α1A-AR activation. We hypothesized that molecules exist that act as biased agonists to selectively activate this pathway. In this report, isoproterenol (Iso), typically viewed as β-AR-selective agonist, was examined with respect to activation of α1A-AR. α1A-AR selective antagonists were used to specifically block Iso evoked signaling in different cellular backgrounds and confirm its action at α1A-AR. Iso induced signaling at α1A-AR was further interrogated by probing steps along the Gαq /PLC, Gαs and MAPK/ERK pathways. In HEK-293/EBNA cells transiently transduced with α1A-AR, and CHO_α1A-AR stable cells, Iso evoked low potency ERK activity as well as Ca2+ mobilization that could be blocked by α1A-AR selective antagonists. The kinetics of Iso induced Ca2+ transients differed from typical Gαq- mediated Ca2+ mobilization, lacking both the fast IP3R mediated response and the sustained phase of Ca2+ re-entry. Moreover, no inositol phosphate (IP) accumulation could be detected in either cell line after stimulation with Iso, but activation was accompanied by receptor internalization. Data are presented that indicate that Iso represents a novel type of α1A-AR partial agonist with signaling bias toward MAPK/ERK signaling cascade that is likely independent of coupling to Gαq. PMID:25606852

Compressive Spectral Embedding: Sidestepping the SVD

DTIC Science & Technology

2015-09-28

of Rn, the distance between the p, q-th rows of f̃(S) can be written as ‖f̃L(S) (ip − iq)‖ = ‖f(S) (ip − iq)− Z (ip − iq)‖ ≤ ‖ ET (ip − iq)‖+ δ √ 2...2) Similarly, we have that ‖f̃L(S) (ip − iq)‖ ≥ ‖ ET (ip − iq)‖ − δ √ 2. Thus pairwise distances be- tween the rows of f̃L(S) approximate those between...iq) ∥∥∥ = ∥∥∥ΩT f̃L(S) (ip − iq) ∥∥∥ ≤ √ 1 + ǫ ∥∥∥f̃L(S) (ip − iq) ∥∥∥ Using (2), we can show that ‖ẼT (ip − iq)‖ ≤ √ 1 + ǫ ( ‖ ET (ip − iq)‖+ δ √ 2

An Exploratory Study of Individual and Organizational Variable Interrelationships in Research and Development Organizations within Air Force Systems Command.

DTIC Science & Technology

1986-09-01

31:493). Farace defines communication as "the exchange of symbols 6 that are commonly shared by the individuals involved, and which evoke 13 Ip...1981). r 9. Evans, C. George. Supervising R&D Personnel. New York: American Management Association, 1969. 10. Farace , Richard V. and others

Bark beetle management after a mass attack - some Swiss experiences

Treesearch

B. Forster; F. Meier; R. Gall

2003-01-01

In 1990 and 1999, heavy storms accompanied by the worst gales ever recorded in Switzerland, struck Europe and left millions of cubic metres of windthrown Norway spruce trees; this provided breeding material for the eight-toothed spruce bark beetle (Ips typographus L.) and led to mass attacks in subsequent years which resulted in the additional loss...

JXTA: A Technology Facilitating Mobile P2P Health Management System

PubMed Central

Rajkumar, Rajasekaran; Nallani Chackravatula Sriman, Narayana Iyengar

2012-01-01

Objectives Mobile JXTA (Juxtapose) gaining momentum and has attracted the interest of doctors and patients through P2P service that transmits messages. Audio and video can also be transmitted through JXTA. The use of mobile streaming mechanism with the support of mobile hospital management and healthcare system would enable better interaction between doctors, nurses, and the hospital. Experimental results demonstrate good performance in comparison with conventional systems. This study evaluates P2P JXTA/JXME (JXTA functionality to MIDP devices.) which facilitates peer-to-peer application+ using mobile-constraint devices. Also a proven learning algorithm was used to automatically send and process sorted patient data to nurses. Methods From December 2010 to December 2011, a total of 500 patients were referred to our hospital due to minor health problems and were monitored. We selected all of the peer groups and the control server, which controlled the BMO (Block Medical Officer) peer groups and BMO through the doctor peer groups, and prescriptions were delivered to the patient’s mobile phones through the JXTA/ JXME network. Results All 500 patients were registered in the JXTA network. Among these, 300 patient histories were referred to the record peer group by the doctors, 100 patients were referred to the external doctor peer group, and 100 patients were registered as new users in the JXTA/JXME network. Conclusion This system was developed for mobile streaming applications and was designed to support the mobile health management system using JXTA/ JXME. The simulated results show that this system can carry out streaming audio and video applications. Controlling and monitoring by the doctor peer group makes the system more flexible and structured. Enhanced studies are needed to improve knowledge mining and cloud-based M health management technology in comparison with the traditional system. PMID:24159509

Integration of a mobile-integrated therapy with electronic health records: lessons learned.

PubMed

Peeples, Malinda M; Iyer, Anand K; Cohen, Joshua L

2013-05-01

Responses to the chronic disease epidemic have predominantly been standardized in their approach to date. Barriers to better health outcomes remain, and effective management requires patient-specific data and disease state knowledge be presented in methods that foster clinical decision-making and patient self-management. Mobile technology provides a new platform for data collection and patient-provider communication. The mobile device represents a personalized platform that is available to the patient on a 24/7 basis. Mobile-integrated therapy (MIT) is the convergence of mobile technology, clinical and behavioral science, and scientifically validated clinical outcomes. In this article, we highlight the lessons learned from functional integration of a Food and Drug Administration-cleared type 2 diabetes MIT into the electronic health record (EHR) of a multiphysician practice within a large, urban, academic medical center. In-depth interviews were conducted with integration stakeholder groups: mobile and EHR software and information technology teams, clinical end users, project managers, and business analysts. Interviews were summarized and categorized into lessons learned using the Architecture for Integrated Mobility® framework. Findings from the diverse stakeholder group of a MIT-EHR integration project indicate that user workflow, software system persistence, environment configuration, device connectivity and security, organizational processes, and data exchange heuristics are key issues that must be addressed. Mobile-integrated therapy that integrates patient self-management data with medical record data provides the opportunity to understand the potential benefits of bidirectional data sharing and reporting that are most valuable in advancing better health and better care in a cost-effective way that is scalable for all chronic diseases. © 2013 Diabetes Technology Society.

Interest in using mobile technology to help self-manage alcohol use among persons living with the human immunodeficiency virus: A Florida Cohort cross-sectional study.

PubMed

Sharpe, J Danielle; Zhou, Zhi; Escobar-Viera, César G; Morano, Jamie P; Lucero, Robert J; Ibañez, Gladys E; Hart, Mark; Cook, Christa L; Cook, Robert L

2018-01-02

Alcohol consumption at hazardous levels is more prevalent and associated with poor health outcomes among persons living with the human immunodeficiency virus (HIV; PLWH). Although PLWH are receptive to using technology to manage health issues, it is unknown whether a cell phone app to self-manage alcohol use would be acceptable among PLWH who drink. The objectives of this study were to determine factors associated with interest in an app to self-manage drinking and to identify differences in baseline mobile technology use among PLWH by drinking level. The study population included 757 PLWH recruited from 2014 to 2016 into the Florida Cohort, an ongoing cohort study investigating the utilization of health services and HIV care outcomes among PLWH. Participants completed a questionnaire examining demographics, substance use, mobile technology use, and other health behaviors. Multivariable logistic regression was used to identify factors significantly associated with interest in an app to self-manage drinking. We also determined whether mobile technology use varied by drinking level. Of the sample, 40% of persons who drink at hazardous levels, 34% of persons who drink at nonhazardous levels, and 19% of persons who do not drink were interested in a self-management app for alcohol use. Multivariable logistic regression analysis indicated that nonhazardous drinking (adjusted odds ratio [AOR] = 1.78; confidence interval [CI 95%]: 1.10-2.88) and hazardous drinking (AOR = 2.58; CI: 1.60-4.16) were associated with interest, controlling for age, gender, education, and drug use. Regarding mobile technology use, most of the sample reported smartphone ownership (56%), text messaging (89%), and at least one cell phone app (69%). Regardless of drinking level, overall mobile technology use among PLWH was moderate, whereas PLWH who consumed alcohol expressed greater interest in a cell phone app to self-manage alcohol use. This indicates that many PLWH who drink would be interested in and prepared for a mobile technology-based intervention to reduce alcohol consumption.

Interest in using mobile technology to help self-manage alcohol use among persons living with HIV: A Florida Cohort cross-sectional study

PubMed Central

Sharpe, J. Danielle; Zhou, Zhi; Escobar-Viera, César G.; Morano, Jamie P.; Lucero, Robert J.; Ibañez, Gladys E.; Hart, Mark; Cook, Christa L.; Cook, Robert L.

2017-01-01

Background Alcohol consumption at hazardous levels is more prevalent and associated with poor health outcomes among persons living with HIV (PLWH). Although PLWH are receptive to using technology to manage health issues, it is unknown whether a cell phone app to self-manage alcohol use would be acceptable among PLWH who drink. The objectives of this study were to determine factors associated with interest in an app to self-manage drinking and to identify differences in baseline mobile technology use among PLWH by drinking level. Methods Our study population included 757 PLWH recruited from 2014–2016 into the Florida Cohort, an ongoing cohort study investigating the utilization of health services and HIV care outcomes among PLWH. Participants completed a questionnaire examining demographics, substance use, mobile technology use, and other health behaviors. We used multivariable logistic regression to identify factors significantly associated with interest in an app to self-manage drinking. We also determined whether mobile technology use varied by drinking level. Results Of the sample, 40% of persons who drink at hazardous levels, 34% of persons who drink at non-hazardous levels, and 19% of persons who do not drink were interested in a self-management app for alcohol use. Multivariable logistic regression analysis indicated that non-hazardous drinking (AOR 1.78; CI: 1.10–2.88) and hazardous drinking (AOR 2.58; CI: 1.60–4.16) were associated with interest, controlling for age, gender, education, and drug use. Regarding mobile technology use, most of the sample reported smartphone ownership (56%), text messaging (89%), and at least one cell phone app (69%). Conclusions Regardless of drinking level, overall mobile technology use among PLWH was moderate, while PLWH who consumed alcohol expressed greater interest in a cell phone app to self-manage alcohol use. This indicates that many PLWH who drink would be interested in and prepared for a mobile technology-based intervention to reduce alcohol consumption. PMID:28723300

A Seamless Handoff Scheme with Access Point Load Balance for Real-Time Services Support in 802.11 Wireless LANs

NASA Astrophysics Data System (ADS)

Manodham, Thavisak; Loyola, Luis; Miki, Tetsuya

IEEE 802.11 wirelesses LANs (WLANs) have been rapidly deployed in enterprises, public areas, and households. Voice-over-IP (VoIP) and similar applications are now commonly used in mobile devices over wireless networks. Recent works have improved the quality of service (QoS) offering higher data rates to support various kinds of real-time applications. However, besides the need for higher data rates, seamless handoff and load balancing among APs are key issues that must be addressed in order to continue supporting real-time services across wireless LANs and providing fair services to all users. In this paper, we introduce a novel access point (AP) with two transceivers that improves network efficiency by supporting seamless handoff and traffic load balancing in a wireless network. In our proposed scheme, the novel AP uses the second transceiver to scan and find neighboring STAs in the transmission range and then sends the results to neighboring APs, which compare and analyze whether or not the STA should perform a handoff. The initial results from our simulations show that the novel AP module is more effective than the conventional scheme and a related work in terms of providing a handoff process with low latency and sharing traffic load with neighbor APs.

Hardware platform for multiple mobile robots

NASA Astrophysics Data System (ADS)

Parzhuber, Otto; Dolinsky, D.

2004-12-01

This work is concerned with software and communications architectures that might facilitate the operation of several mobile robots. The vehicles should be remotely piloted or tele-operated via a wireless link between the operator and the vehicles. The wireless link will carry control commands from the operator to the vehicle, telemetry data from the vehicle back to the operator and frequently also a real-time video stream from an on board camera. For autonomous driving the link will carry commands and data between the vehicles. For this purpose we have developed a hardware platform which consists of a powerful microprocessor, different sensors, stereo- camera and Wireless Local Area Network (WLAN) for communication. The adoption of IEEE802.11 standard for the physical and access layer protocols allow a straightforward integration with the internet protocols TCP/IP. For the inspection of the environment the robots are equipped with a wide variety of sensors like ultrasonic, infrared proximity sensors and a small inertial measurement unit. Stereo cameras give the feasibility of the detection of obstacles, measurement of distance and creation of a map of the room.