Highly compact circulators in square-lattice photonic crystal waveguides.

PubMed

Jin, Xin; Ouyang, Zhengbiao; Wang, Qiong; Lin, Mi; Wen, Guohua; Wang, Jingjing

2014-01-01

We propose, demonstrate and investigate highly compact circulators with ultra-low insertion loss in square-lattice- square-rod-photonic-crystal waveguides. Only a single magneto- optical square rod is required to be inserted into the cross center of waveguides, making the structure very compact and ultra efficient. The square rods around the center defect rod are replaced by several right-angled-triangle rods, reducing the insertion loss further and promoting the isolations as well. By choosing a linear-dispersion region and considering the mode patterns in the square magneto-optical rod, the operating mechanism of the circulator is analyzed. By applying the finite-element method together with the Nelder-Mead optimization method, an extremely low insertion loss of 0.02 dB for the transmitted wave and ultra high isolation of 46 dB∼48 dB for the isolated port are obtained. The idea presented can be applied to build circulators in different wavebands, e.g., microwave or Tera-Hertz.

Improvement of perpendicular anisotropy of columnar FePt-ZrO2-C films with FePt insert layer

NASA Astrophysics Data System (ADS)

Dong, Kaifeng; Mo, Wenqin; Jin, Fang; Song, Junlei; Cheng, Weimin; Wang, Haiwei

2018-05-01

The effects of various thicknesses of FePt insert layer on the microstructure and magnetic properties of FePt-ZrO2-C thin films have been investigated. It is found that with inserting 0.4 nm FePt films between the TiON intermediate layer and FePt-ZrO2-C layer, the perpendicular anisotropy indicated by Hc⊥/Hc//ratio would increase from 4 to 13.1, suggesting the perpendicular anisotropy could be improved a lot with using FePt insert layer. Simultaneously, the FePt grains of FePt-ZrO2-C thin films maintained columnar structure and the grain isolation could also be improved in a certain degree. With further increase of the FePt insert layer thickness, although the perpendicular anisotropy was still larger than that without FePt insert layer, the grain size of the FePt-ZrO2-C films would increase and the isolation would be deteriorated.

Whole Genome Sequence Analysis of Mutations Accumulated in rad27Δ Yeast Strains with Defects in the Processing of Okazaki Fragments Indicates Template-Switching Events

PubMed Central

Omer, Sumita; Lavi, Bar; Mieczkowski, Piotr A.; Covo, Shay; Hazkani-Covo, Einat

2017-01-01

Okazaki fragments that are formed during lagging strand DNA synthesis include an initiating primer consisting of both RNA and DNA. The RNA fragment must be removed before the fragments are joined. In Saccharomyces cerevisiae, a key player in this process is the structure-specific flap endonuclease, Rad27p (human homolog FEN1). To obtain a genomic view of the mutational consequence of loss of RAD27, a S. cerevisiae rad27Δ strain was subcultured for 25 generations and sequenced using Illumina paired-end sequencing. Out of the 455 changes observed in 10 colonies isolated the two most common types of events were insertions or deletions (INDELs) in simple sequence repeats (SSRs) and INDELs mediated by short direct repeats. Surprisingly, we also detected a previously neglected class of 21 template-switching events. These events were presumably generated by quasi-palindrome to palindrome correction, as well as palindrome elongation. The formation of these events is best explained by folding back of the stalled nascent strand and resumption of DNA synthesis using the same nascent strand as a template. Evidence of quasi-palindrome to palindrome correction that could be generated by template switching appears also in yeast genome evolution. Out of the 455 events, 55 events appeared in multiple isolates; further analysis indicates that these loci are mutational hotspots. Since Rad27 acts on the lagging strand when the leading strand should not contain any gaps, we propose a mechanism favoring intramolecular strand switching over an intermolecular mechanism. We note that our results open new ways of understanding template switching that occurs during genome instability and evolution. PMID:28974572

Novel insertion sequence- and transposon-mediated genetic rearrangements in genomic island SGI1 of Salmonella enterica serovar Kentucky.

PubMed

Doublet, Benoît; Praud, Karine; Bertrand, Sophie; Collard, Jean-Marc; Weill, François-Xavier; Cloeckaert, Axel

2008-10-01

Salmonella genomic island 1 (SGI1) is an integrative mobilizable element that harbors a multidrug resistance (MDR) gene cluster. Since its identification in epidemic Salmonella enterica serovar Typhimurium DT104 strains, variant SGI1 MDR gene clusters conferring different MDR phenotypes have been identified in several S. enterica serovars and classified as SGI1-A to -O. A study was undertaken to characterize SGI1 from serovar Kentucky strains isolated from travelers returning from Africa. Several strains tested were found to contain the partially characterized variant SGI1-K, recently described in a serovar Kentucky strain isolated in Australia. This variant contained only one cassette array, aac(3)-Id-aadA7, and an adjacent mercury resistance module. Here, the uncharacterized part of SGI1-K was sequenced. Downstream of the mer module similar to that found in Tn21, a mosaic genetic structure was found, comprising (i) part of Tn1721 containing the tetracycline resistance genes tetR and tet(A); (ii) part of Tn5393 containing the streptomycin resistance genes strAB, IS1133, and a truncated tnpR gene; and (iii) a Tn3-like region containing the tnpR gene and the beta-lactamase bla(TEM-1) gene flanked by two IS26 elements in opposite orientations. The rightmost IS26 element was shown to be inserted into the S044 open reading frame of the SGI1 backbone. This variant MDR region was named SGI1-K1 according to the previously described variant SGI1-K. Other SGI1-K MDR regions due to different IS26 locations, inversion, and partial deletions were characterized and named SGI1-K2 to -K5. Two new SGI1 variants named SGI1-P1 and -P2 contained only the Tn3-like region comprising the beta-lactamase bla(TEM-1) gene flanked by the two IS26 elements inserted into the SGI1 backbone. Three other new variants harbored only one IS26 element inserted in place of the MDR region of SGI1 and were named SGI1-Q1 to -Q3. Thus, in serovar Kentucky, the SGI1 MDR region undergoes recombinational and insertional events of transposon and insertion sequences, resulting in a higher diversity of MDR gene clusters than previously reported and consequently a higher diversity of MDR phenotypes.

Co-complexes derived from alkene insertion to alkyne-dicobaltpentacarbonyl complexes: insight into the regioselectivity of pauson-khand reactions of cyclopropenes.

PubMed

Pallerla, Mahesh K; Yap, Glenn P A; Fox, Joseph M

2008-08-15

Described are the X-ray crystallographic and spectral properties of Co-complexes that were isolated from two Pauson-Khand reactions of chiral cyclopropenes. These are the first examples of isolated Co-complexes derived from the putative alkene-insertion intermediates of Pauson-Khand reactions. The binuclear Co-complexes are coordinated to mu-bonded, five-carbon "flyover" carbene ligands. It is proposed that the complexes result from cyclopropane fragmentation subsequent to alkene insertion. The observation of these metal complexes provides a rationale for the origin of regioselectivity in Pauson-Khand reactions of cyclopropenes.

Insertional inactivation of oprD in carbapenem-resistant Pseudomonas aeruginosa strains isolated from burn patients in Tehran, Iran.

PubMed

Shariati, A; Azimi, T; Ardebili, A; Chirani, A S; Bahramian, A; Pormohammad, A; Sadredinamin, M; Erfanimanesh, S; Bostanghadiri, N; Shams, S; Hashemi, A

2018-01-01

In this study, we report the insertion sequence IS Ppu 21 in the opr D porin gene of carbapenem-resistant Pseudomonas aeruginosa isolates from burn patients in Tehran, Iran. Antibiotic susceptibility tests for P. aeruginosa isolates were determined. Production of metallo-β-lactamases (MBLs) and carbapenemase was evaluated and the β-lactamase-encoding and aminoglycoside-modifying enzyme genes were investigated by PCR and sequencing methods. The mRNA transcription level of oprD and mex efflux pump genes were evaluated by real-time PCR. The outer membrane protein profile was determined by SDS-PAGE. The genetic relationship between the P. aeruginosa isolates was assessed by random amplified polymorphic DNA PCR. In all, 10.52% (10/95) of clinical isolates of P. aeruginosa harboured the IS Ppu 21 insertion element in the opr D gene. The extended-spectrum β-lactamase-encoding gene in IS Ppu 21-carrying isolates was bla TEM . PCR assays targeting MBL and carbapenemase-encoding genes were also negative in all ten isolates. The rmt A, aad A, aad B and arm A genes were positive in all IS Ppu 21 harbouring isolates. The relative expression levels of the mex X, mex B, mex T and mex D genes in ten isolates ranged from 0.1- to 1.4-fold, 1.1- to 3.68-fold, 0.3- to 8.22-fold and 1.7- to 35.17-fold, respectively. The relative expression levels of the oprD in ten isolates ranged from 0.57- to 35.01-fold, which was much higher than those in the control strain P. aeruginosa PAO1. Evaluation of the outer membrane protein by SDS-PAGE suggested that opr D was produced at very low levels by all isolates. Using random amplified polymorphic DNA PCR genotyping, eight of the ten isolates containing IS Ppu 21 were shown to be clonally related. The present study describes a novel molecular mechanism, IS Ppu 21 insertion of the opr D gene, associated with carbapenem resistance in clinical P. aeruginosa isolates.

Genetic basis for loss of immuno-reactive O-chain in Salmonella enterica serovar Enteritidis veterinary isolates.

PubMed

Szabo, Istvan; Grafe, Marianne; Kemper, Nicole; Junker, Ernst; Malorny, Burkhard

2017-05-01

Fifty-two rough Salmonella enterica serovar Enteritidis (S. Enteritidis) isolates from broilers and the environment were characterized for their serological and genotypic properties. Under routine diagnostic serotyping methods such isolates lack the immuno-reactivity of the O-chain of the lipopolysaccharide (LPS), and are referred to as non-typeable. Using a modified slide agglutination method, the isolates could be differentiated into three different serological variants. Twenty-six isolates (50%) were defined as semi-rough, nineteen isolates (37%) as deep-rough, four isolates (8%) as rough and three isolates could not be assigned. Genetically, all semi-rough isolates lacked the wzyB gene encoding the O-antigen polymerase. Two isolates carried a frameshift mutation in wzyB. In 15 of 23 cases deep-rough or rough isolates had a single point mutation, a single - or double-nucleotide insert or deletion in the wbaP gene. The mutational changes lead to expression of truncated (premature) protein, resulting in the loss of the immuno-reactive O-chain. Both rough and smooth S. Enteritidis isolates showed identical or highly similar XbaI-PFGE profiles. Our results indicate that the loss of a functional LPS in S. Enteritidis isolates is caused by a variety of different mutation events within the wzyB (semi-rough) or the wbaP (deep-rough) gene and is not a result of a vertical spread of a specific S. Enteritidis subtype. The defect of the LPS may be a common evolutionary mechanism through which host defence can be escaped. Copyright © 2017. Published by Elsevier B.V.

48 CFR 2452.216-74 - Distribution of award fee.

Code of Federal Regulations, 2012 CFR

2012-10-01

...: Evaluation Period: [insert time period] Available Award Fee: [insert dollar amount] (b) In the event of...-rata distribution associated with evaluation period activities or events as determined by the Fee... 2416.406(e)(3), add paragraph (c): (c) The contract clauses required for cost-reimbursement contracts...

48 CFR 2452.216-74 - Distribution of award fee.

Code of Federal Regulations, 2010 CFR

2010-10-01

...: Evaluation Period: [insert time period] Available Award Fee: [insert dollar amount] (b) In the event of...-rata distribution associated with evaluation period activities or events as determined by the Fee... 2416.406(e)(3), add paragraph (c): (c) The contract clauses required for cost-reimbursement contracts...

48 CFR 2452.216-74 - Distribution of award fee.

Code of Federal Regulations, 2014 CFR

2014-10-01

...: Evaluation Period: [insert time period] Available Award Fee: [insert dollar amount] (b) In the event of...-rata distribution associated with evaluation period activities or events as determined by the Fee... 2416.406(e)(3), add paragraph (c): (c) The contract clauses required for cost-reimbursement contracts...

48 CFR 2452.216-74 - Distribution of award fee.

Code of Federal Regulations, 2013 CFR

2013-10-01

...: Evaluation Period: [insert time period] Available Award Fee: [insert dollar amount] (b) In the event of...-rata distribution associated with evaluation period activities or events as determined by the Fee... 2416.406(e)(3), add paragraph (c): (c) The contract clauses required for cost-reimbursement contracts...

48 CFR 2452.216-74 - Distribution of award fee.

Code of Federal Regulations, 2011 CFR

2011-10-01

...: Evaluation Period: [insert time period] Available Award Fee: [insert dollar amount] (b) In the event of...-rata distribution associated with evaluation period activities or events as determined by the Fee... 2416.406(e)(3), add paragraph (c): (c) The contract clauses required for cost-reimbursement contracts...

Co-complexes Derived from Alkene Insertion to Alkyne-dicobaltpentacarbonyl complexes: Insight into the Regioselectivity of Pauson-Khand Reactions of Cyclopropenes

PubMed Central

Pallerla, Mahesh K.; Yap, Glenn P. A.; Fox, Joseph M.

2009-01-01

Described are the X-ray crystallographic and spectral properties of Co-complexes that were isolated from two Pauson-Khand reactions of chiral cyclopropenes. These are the first examples of isolated Co-complexes derived from the putative alkene-insertion intermediates of Pauson-Khand reactions. The binuclear Co-complexes are coordinated to μ-bonded, five-carbon “flyover” carbene ligands. It is proposed that the complexes result from cyclopropane fragmentation subsequent to alkene insertion. The observation of these metal complexes provides a rationale for the origin of regioselectivity in Pauson-Khand reactions of cyclopropenes. PMID:18637694

Teaching basic lung isolation skills on human anatomy simulator: attainment and retention of lung isolation skills.

PubMed

Latif, Rana K; VanHorne, Edgar M; Kandadai, Sunitha Kanchi; Bautista, Alexander F; Neamtu, Aurel; Wadhwa, Anupama; Carter, Mary B; Ziegler, Craig H; Memon, Mohammed Faisal; Akça, Ozan

2016-01-20

Lung isolation skills, such as correct insertion of double lumen endobronchial tube and bronchial blocker, are essential in anesthesia training; however, how to teach novices these skills is underexplored. Our aims were to determine (1) if novices can be trained to a basic proficiency level of lung isolation skills, (2) whether video-didactic and simulation-based trainings are comparable in teaching lung isolation basic skills, and (3) whether novice learners' lung isolation skills decay over time without practice. First, five board certified anesthesiologist with experience of more than 100 successful lung isolations were tested on Human Airway Anatomy Simulator (HAAS) to establish Expert proficiency skill level. Thirty senior medical students, who were naive to bronchoscopy and lung isolation techniques (Novice) were randomized to video-didactic and simulation-based trainings to learn lung isolation skills. Before and after training, Novices' performances were scored for correct placement using pass/fail scoring and a 5-point Global Rating Scale (GRS); and time of insertion was recorded. Fourteen novices were retested 2 months later to assess skill decay. Experts' and novices' double lumen endobronchial tube and bronchial blocker passing rates showed similar success rates after training (P >0.99). There were no differences between the video-didactic and simulation-based methods. Novices' time of insertion decayed within 2 months without practice. Novices could be trained to basic skill proficiency level of lung isolation. Video-didactic and simulation-based methods we utilized were found equally successful in training novices for lung isolation skills. Acquired skills partially decayed without practice.

In-office insertion of a miniaturized insertable cardiac monitor: Results from the Reveal LINQ In-Office 2 randomized study.

PubMed

Rogers, John D; Sanders, Prashanthan; Piorkowski, Christopher; Sohail, M Rizwan; Anand, Rishi; Crossen, Karl; Khairallah, Farhat S; Kaplon, Rachelle E; Stromberg, Kurt; Kowal, Robert C

2017-02-01

Recent miniaturization of an insertable cardiac monitor (ICM) may make it possible to move device insertion from a hospital to office setting. However, the safety of this strategy is unknown. The primary objective was to compare the safety of inserting the Reveal LINQ ICM in an office vs a hospital environment. Ancillary objectives included summarizing device- and procedure-related adverse events and responses to a physician questionnaire. Five hundred twenty-one patients indicated for an ICM were randomized (1:1 ratio) to undergo ICM insertion in a hospital or office environment at 26 centers in the United States in the Reveal LINQ In-Office 2 study (ClinicalTrials.gov identifier NCT02395536). Patients were followed for 90 days. ICM insertion was successful in all 482 attempted patients (office: 251; hospital: 231). The untoward event rate (composite of unsuccessful insertion and ICM- or insertion-related complications) was 0.8% (2 of 244) in the office and 0.9% (2 of 227) in the hospital (95% confidence interval, -3.0% to 2.9%; 5% noninferiority: P < .001). In addition, adverse events occurred during 2.5% (6 of 244) of office and 4.4% (10 of 227) of hospital insertions (95% confidence interval [office minus inhospital rates], -5.8% to 1.9%; 5% noninferiority: P < .001). Physicians indicated that for procedures performed in an office vs a hospital, there were fewer delays >15 minutes (16% vs 35%; P < .001) and patient response was more often "very positive." Physicians considered the office location "very convenient" more frequently than the hospital location (85% vs 27%; P < .001). The safety profile for the insertion of the Reveal LINQ ICM is excellent irrespective of insertion environment. These results may expand site of service options for LINQ insertion. Copyright © 2016 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

Interfamilial recombination between viruses led to acquisition of a novel translation-enhancing RNA element that allows resistance breaking

PubMed Central

Miras, Manuel; Sempere, Raquel N.; Kraft, Jelena J.; Miller, W. Allen; Aranda, Miguel A.; Truniger, Veronica

2015-01-01

Summary Many plant viruses depend on functional RNA elements, called 3′-UTR cap-independent translation enhancers (3′-CITEs), for translation of their RNAs. In this manuscript we provide direct proof for the existing hypothesis that 3′-CITEs are modular and transferable by recombination in nature, and that this is associated with an advantage for the created virus. By characterizing a newly identified Melon necrotic spot virus (MNSV; Tombusviridae) isolate, which is able to overcome eukaryotic translation initiation factor 4E (eIF4E)-mediated resistance, we found that it contains a 55 nucleotide insertion in its 3′-UTR. We provide strong evidence that this insertion was acquired by interfamilial recombination with the 3′-UTR of an Asiatic Cucurbit aphid-borne yellows virus (CABYV; Luteoviridae). By constructing chimeric viruses, we showed that this recombined sequence is responsible for resistance breaking. Analysis of the translational efficiency of reporter constructs showed that this sequence functions as a novel 3′-CITE in both resistant and susceptible plants, being essential for translation control in resistant plants. In conclusion, we showed that a recombination event between two clearly identified viruses from different families led to the transfer of exactly the sequence corresponding to a functional RNA element, giving rise to a new isolate with the capacity to infect an otherwise non-susceptible host. PMID:24372390

Interfamilial recombination between viruses led to acquisition of a novel translation-enhancing RNA element that allows resistance breaking.

PubMed

Miras, Manuel; Sempere, Raquel N; Kraft, Jelena J; Miller, W Allen; Aranda, Miguel A; Truniger, Veronica

2014-04-01

Many plant viruses depend on functional RNA elements, called 3'-UTR cap-independent translation enhancers (3'-CITEs), for translation of their RNAs. In this manuscript we provide direct proof for the existing hypothesis that 3'-CITEs are modular and transferable by recombination in nature, and that this is associated with an advantage for the created virus. By characterizing a newly identified Melon necrotic spot virus (MNSV; Tombusviridae) isolate, which is able to overcome eukaryotic translation initiation factor 4E (eIF4E)-mediated resistance, we found that it contains a 55 nucleotide insertion in its 3'-UTR. We provide strong evidence that this insertion was acquired by interfamilial recombination with the 3'-UTR of an Asiatic Cucurbit aphid-borne yellows virus (CABYV; Luteoviridae). By constructing chimeric viruses, we showed that this recombined sequence is responsible for resistance breaking. Analysis of the translational efficiency of reporter constructs showed that this sequence functions as a novel 3'-CITE in both resistant and susceptible plants, being essential for translation control in resistant plants. In conclusion, we showed that a recombination event between two clearly identified viruses from different families led to the transfer of exactly the sequence corresponding to a functional RNA element, giving rise to a new isolate with the capacity to infect an otherwise nonsusceptible host. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

Time- and Cost-Efficient Identification of T-DNA Insertion Sites through Targeted Genomic Sequencing

PubMed Central

Lepage, Étienne; Zampini, Éric; Boyle, Brian; Brisson, Normand

2013-01-01

Forward genetic screens enable the unbiased identification of genes involved in biological processes. In Arabidopsis, several mutant collections are publicly available, which greatly facilitates such practice. Most of these collections were generated by agrotransformation of a T-DNA at random sites in the plant genome. However, precise mapping of T-DNA insertion sites in mutants isolated from such screens is a laborious and time-consuming task. Here we report a simple, low-cost and time efficient approach to precisely map T-DNA insertions simultaneously in many different mutants. By combining sequence capture, next-generation sequencing and 2D-PCR pooling, we developed a new method that allowed the rapid localization of T-DNA insertion sites in 55 out of 64 mutant plants isolated in a screen for gyrase inhibition hypersensitivity. PMID:23951038

Mutants in three novel complementation groups inhibit membrane protein insertion into and soluble protein translocation across the endoplasmic reticulum membrane of Saccharomyces cerevisiae

PubMed Central

1992-01-01

We have isolated mutants that inhibit membrane protein insertion into the ER membrane of Saccharomyces cerevisiae. The mutants were contained in three complementation groups, which we have named SEC70, SEC71, and SEC72. The mutants also inhibited the translocation of soluble proteins into the lumen of the ER, indicating that they pleiotropically affect protein transport across and insertion into the ER membrane. Surprisingly, the mutants inhibited the translocation and insertion of different proteins to drastically different degrees. We have also shown that mutations in SEC61 and SEC63, which were previously isolated as mutants inhibiting the translocation of soluble proteins, also affect the insertion of membrane proteins into the ER. Taken together our data indicate that the process of protein translocation across the ER membrane involves a much larger number of gene products than previously appreciated. Moreover, different translocation substrates appear to have different requirements for components of the cellular targeting and translocation apparatus. PMID:1730771

Alu repeat discovery and characterization within human genomes

PubMed Central

Hormozdiari, Fereydoun; Alkan, Can; Ventura, Mario; Hajirasouliha, Iman; Malig, Maika; Hach, Faraz; Yorukoglu, Deniz; Dao, Phuong; Bakhshi, Marzieh; Sahinalp, S. Cenk; Eichler, Evan E.

2011-01-01

Human genomes are now being rapidly sequenced, but not all forms of genetic variation are routinely characterized. In this study, we focus on Alu retrotransposition events and seek to characterize differences in the pattern of mobile insertion between individuals based on the analysis of eight human genomes sequenced using next-generation sequencing. Applying a rapid read-pair analysis algorithm, we discover 4342 Alu insertions not found in the human reference genome and show that 98% of a selected subset (63/64) experimentally validate. Of these new insertions, 89% correspond to AluY elements, suggesting that they arose by retrotransposition. Eighty percent of the Alu insertions have not been previously reported and more novel events were detected in Africans when compared with non-African samples (76% vs. 69%). Using these data, we develop an experimental and computational screen to identify ancestry informative Alu retrotransposition events among different human populations. PMID:21131385

CRISPR/Cas9 cleavages in budding yeast reveal templated insertions and strand-specific insertion/deletion profiles.

PubMed

Lemos, Brenda R; Kaplan, Adam C; Bae, Ji Eun; Ferrazzoli, Alexander E; Kuo, James; Anand, Ranjith P; Waterman, David P; Haber, James E

2018-02-27

Harnessing CRISPR-Cas9 technology provides an unprecedented ability to modify genomic loci via DNA double-strand break (DSB) induction and repair. We analyzed nonhomologous end-joining (NHEJ) repair induced by Cas9 in budding yeast and found that the orientation of binding of Cas9 and its guide RNA (gRNA) profoundly influences the pattern of insertion/deletions (indels) at the site of cleavage. A common indel created by Cas9 is a 1-bp (+1) insertion that appears to result from Cas9 creating a 1-nt 5' overhang that is filled in by a DNA polymerase and ligated. The origin of +1 insertions was investigated by using two gRNAs with PAM sequences located on opposite DNA strands but designed to cleave the same sequence. These templated +1 insertions are dependent on the X-family DNA polymerase, Pol4. Deleting Pol4 also eliminated +2 and +3 insertions, which are biased toward homonucleotide insertions. Using inverted PAM sequences, we also found significant differences in overall NHEJ efficiency and repair profiles, suggesting that the binding of the Cas9:gRNA complex influences subsequent NHEJ processing. As with events induced by the site-specific HO endonuclease, CRISPR-Cas9-mediated NHEJ repair depends on the Ku heterodimer and DNA ligase 4. Cas9 events are highly dependent on the Mre11-Rad50-Xrs2 complex, independent of Mre11's nuclease activity. Inspection of the outcomes of a large number of Cas9 cleavage events in mammalian cells reveals a similar templated origin of +1 insertions in human cells, but also a significant frequency of similarly templated +2 insertions.

Bacteriology of urinary tract infection associated with indwelling J ureteral stents.

PubMed

Kehinde, Elijah O; Rotimi, Vincent O; Al-Hunayan, Adel; Abdul-Halim, Hamdy; Boland, Fareeda; Al-Awadi, Khaleel A

2004-11-01

To investigate the microorganisms responsible for urinary tract infection (UTI) and stent colonization in patients with indwelling J ureteral stents and to compare the antimicrobial susceptibility pattern of the isolates from urine and J stents in order to establish the etiologic agents of bacteriuria and colonized stents in such patients and provide baseline data on an antibiotic policy for the urology unit. Midstream urine from 250 patients requiring J stent insertion was investigated microbiologically prior to stent insertion and on the day of stent removal. After stent removal, 3 to 5 cm of the tip located in the bladder was also sent for culture. Patients' bio-data and underlying diseases were documented. Those with no known systemic diseases ("normal patients") were also studied as controls. Of the 250 patients studied, 152 (61%) were normal, while 27 (11%), 53 (21%), and 18 (7%) had diabetes mellitus (DM), chronic renal failure (CRF), and diabetic nephropathy (DN), respectively. The mean duration of stent retention was 27 days. All microbial isolates were tested for their susceptibility to a panel of 10 antibiotics. Twelve patients (5%) before stent insertion and 42 patients (17%; P < 0.001) on the day of stent removal had positive urine cultures. One hundred four stents (42%) were culture positive. Of the 104 patients with positive stent cultures, in 62 patients (60%), urine culture was sterile. The commonest isolates were Escherichia coli, Enterococcus spp., Staphylococcus spp., Pseudomonas, and Candida spp. On the day of stent removal, urine culture was positive in 28% of the normal patients compared with 57% (P = 0.11), 78% (P < 0.001), and 62% (P < 0.001) of patients with CRF, DM, and DN, respectively. Stent isolates were more resistant to antibiotics than the organism isolated before stent insertion. An indwelling J ureteral stent carries a significant risk of bacteriuria and stent colonization. The sensitivity of urine culture to stent colonization is low, and therefore, a negative culture does not rule out a colonized stent. Bacteria cultured from urine after stent insertion and from the stents are more resistant to antibiotics than are those cultured from urine before stent insertion. Norfloxacin or ciprofloxacin is recommended as prophylaxis prior to stent insertion, and an aminoglycoside can be added to treat symptomatic patients with severe infections.

Risk factors for central line-associated bloodstream infection in pediatric oncology patients with a totally implantable venous access port: A cohort study.

PubMed

Viana Taveira, Michelle Ribeiro; Lima, Luciana Santana; de Araújo, Cláudia Corrêa; de Mello, Maria Júlia Gonçalves

2017-02-01

Totally implantable venous access ports (TIVAPs) are used for prolonged central venous access, allowing the infusion of chemotherapy and other fluids and improving the quality of life of children with cancer. TIVAPs were developed to reduce the infection rates associated with central venous catheters; however, infectious events remain common and have not been fully investigated in pediatric oncology patients. A retrospective cohort was formed to investigate risk factors for central line-associated bloodstream infection (CLABSI) in pediatric cancer patients. Sociodemographic, clinical, and TIVAP insertion-related variables were evaluated, with the endpoint being the first CLABSI. A Kaplan-Meier analysis was performed to determine CLABSI-free catheter survival. Overall, 188 children were evaluated over 77,541 catheter days, with 94 being diagnosed with CLABSI (50%). Although coagulase-negative staphylococci were the pathogens most commonly isolated, Gram-negative microorganisms (46.8%) were also prevalent. In the multivariate analysis, factors that increased the risk for CLABSI were TIVAP insertion prior to chemotherapy (risk ratio [RR] = 1.56; P < 0.01), white blood cell count less than 1,000 mm -3 on the day of implantation (RR = 1.64; P < 0.01), and chronic malnutrition (RR = 1.41; P < 0.05). Median time without CLABSI following TIVAP insertion was 74.5 days. Risk factors for CLABSI in pediatric cancer patients with a TIVAP may be related to the severity of the child's condition at catheter insertion. Insertion of the catheter before chemotherapy and unfavorable conditions such as malnutrition and bone marrow aplasia can increase the risk of CLABSI. Protocols must be revised and surveillance increased over the first 10 weeks of treatment. © 2016 Wiley Periodicals, Inc.

Insertion sequence ISRP10 inactivation of the oprD gene in imipenem-resistant Pseudomonas aeruginosa clinical isolates.

PubMed

Sun, Qinghui; Ba, Zhaofen; Wu, Guoying; Wang, Wei; Lin, Shuxiang; Yang, Hongjiang

2016-05-01

Carbapenem resistance mechanisms were investigated in 32 imipenem-resistant Pseudomonas aeruginosa clinical isolates recovered from hospitalised children. Sequence analysis revealed that 31 of the isolates had an insertion sequence element ISRP10 disrupting the porin gene oprD, demonstrating that ISRP10 inactivation of oprD conferred imipenem resistance in the majority of the isolates. Multilocus sequence typing (MLST) was used to discriminate the isolates. In total, 11 sequence types (STs) were identified including 3 novel STs, and 68.3% (28/41) of the tested strains were characterised as clone ST253. In combination with random amplified polymorphic DNA (RAPD) analysis, the imipenem-resistant isolates displayed a relatively high degree of genetic variability and were unlikely associated with nosocomial infections. Copyright © 2016 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

Isolated avulsion of the vastus lateralis tendon insertion in a weightlifter: a case report.

PubMed

Phadnis, Joideep; Trikha, Paul S; Wood, David G

2009-08-25

We report a case of isolated, unilateral avulsion of the vastus lateralis tendon from its insertion at the patella. This was diagnosed by magnetic resonance imaging, and underwent successful surgical repair. A healthy 32-year-old national level power lifter presented with an isolated avulsion of the vastus lateralis tendon. After a failed course of conservative therapy he underwent surgical repair and a graded physical therapy programme. One year later he returned to full training with no evidence of re-rupture. This is the first reported case of an isolated vastus lateralis avulsion. Our experience suggests that magnetic resonance imaging is invaluable in the diagnosis of this condition and that surgical repair provides a good outcome in high demand patients.

Dissemination of streptococcal pyrogenic exotoxin G (spegg) with an IS-like element in fish isolates of Streptococcus dysgalactiae.

PubMed

Abdelsalam, Mohamed; Chen, Shih-Chu; Yoshida, Terutoyo

2010-08-01

The Lancefield group C alpha-hemolytic Streptococcus dysgalactiae ssp. dysgalactiae (GCSD) causes systemic granulomatous inflammatory disease and high mortality rates in infected fish. Superantigen and streptolysin S genes are the most important virulence factors contributing to an invasive streptococcal infection. PCR amplification revealed that all strains isolated from moribund fish harbored the streptolysin S structural gene (sagA). GCSD fish isolates were PCR negative for emm, speA, speB, speC, speM, smeZ, and ssa. However, the size of the streptococcal pyrogenic exotoxin G (spegg) locus, a superantigen, in positive S. dysgalactiae fish and pig strains was variable. The ORF of the spegg locus of 26 GCSD fish strains and one GCSD pig strain was inserted with IS981SC. Interestingly, the ORF of the spegg locus of two fish strains of GCSD collected in Malaysia was inserted with an IS981SC-IS1161 hybrid IS element. The hybrid IS element was found in all of the GCSD fish isolates and one GCSD pig through PCR screening. Although no insertion sequence (IS) was detected in the spegg locus of S. dysgalactiae ssp. equisimilis (GCSE) strains, a five-nucleotide deletion mutation was detected in the ORF of the spegg locus of one GCSE strain at the supposed site of IS981SC insertion, resulting in a frameshift mutation.

Current microbiology of percutaneous endoscopic gastrostomy tube (PEG tube) insertion site infections in patients with cancer.

PubMed

Rolston, Kenneth V I; Mihu, Coralia; Tarrand, Jeffrey J

2011-08-01

Percutaneous endoscopic gastrostomy (PEG) is frequently used to provide enteral access in cancer patients who are unable to swallow. Infection is an important complication in this setting. Current microbiological data are needed to guide infection prevention and treatment strategies. The microbiological records of our institution (a 550-bed comprehensive cancer center) were retrospectively reviewed over an 8-month study period in order to identify patients who developed PEG tube insertion site infections, and review their microbiological details and susceptibility/resistance data. Fifty-eight episodes of PEG tube insertion site infections were identified. Of these, 31 (53%) were monomicrobial, and the rest were polymicrobial. The most common organisms isolated were Candida species, Staphylococcus aureus, and Pseudomonas aeruginosa. All infections were local (cellulitis, complicated skin, and skin structure infections including abdominal wall abscess) with no cases of concomitant bacteremia being documented. Most of the organisms isolated were susceptible to commonly used antimicrobial agents, although some quinolone-resistant and some multidrug-resistant organisms were isolated. This retrospective study provides descriptive data regarding PEG tube insertion site infections. These data have helped us update institutional guidelines for infection prevention and treatment as part of our focus on antimicrobial stewardship.

Insights into the Dekkera bruxellensis Genomic Landscape: Comparative Genomics Reveals Variations in Ploidy and Nutrient Utilisation Potential amongst Wine Isolates

PubMed Central

Borneman, Anthony R.; Zeppel, Ryan; Chambers, Paul J.; Curtin, Chris D.

2014-01-01

The yeast Dekkera bruxellensis is a major contaminant of industrial fermentations, such as those used for the production of biofuel and wine, where it outlasts and, under some conditions, outcompetes the major industrial yeast Saccharomyces cerevisiae. In order to investigate the level of inter-strain variation that is present within this economically important species, the genomes of four diverse D. bruxellensis isolates were compared. While each of the four strains was shown to contain a core diploid genome, which is clearly sufficient for survival, two of the four isolates have a third haploid complement of chromosomes. The sequences of these additional haploid genomes were both highly divergent from those comprising the diploid core and divergent between the two triploid strains. Similar to examples in the Saccharomyces spp. clade, where some allotriploids have arisen on the basis of enhanced ability to survive a range of environmental conditions, it is likely these strains are products of two independent hybridisation events that may have involved multiple species or distinct sub-species of Dekkera. Interestingly these triploid strains represent the vast majority (92%) of isolates from across the Australian wine industry, suggesting that the additional set of chromosomes may confer a selective advantage in winery environments that has resulted in these hybrid strains all-but replacing their diploid counterparts in Australian winery settings. In addition to the apparent inter-specific hybridisation events, chromosomal aberrations such as strain-specific insertions and deletions and loss-of-heterozygosity by gene conversion were also commonplace. While these events are likely to have affected many phenotypes across these strains, we have been able to link a specific deletion to the inability to utilise nitrate by some strains of D. bruxellensis, a phenotype that may have direct impacts in the ability for these strains to compete with S. cerevisiae. PMID:24550744

Genetic structure of Plasmodium vivax using the merozoite surface protein 1 icb5-6 fragment reveals new hybrid haplotypes in southern Mexico

PubMed Central

2014-01-01

Background Plasmodium vivax is a protozoan parasite with an extensive worldwide distribution, being highly prevalent in Asia as well as in Mesoamerica and South America. In southern Mexico, P. vivax transmission has been endemic and recent studies suggest that these parasites have unique biological and genetic features. The msp1 gene has shown high rate of nucleotide substitutions, deletions, insertions, and its mosaic structure reveals frequent events of recombination, maybe between highly divergent parasite isolates. Methods The nucleotide sequence variation in the polymorphic icb5-6 fragment of the msp1 gene of Mexican and worldwide isolates was analysed. To understand how genotype diversity arises, disperses and persists in Mexico, the genetic structure and genealogical relationships of local isolates were examined. To identify new sequence hybrids and their evolutionary relationships with other P. vivax isolates circulating worldwide two haplotype networks were constructed questioning that two portions of the icb5-6 have different evolutionary history. Results Twelve new msp1 icb5-6 haplotypes of P. vivax from Mexico were identified. These nucleotide sequences show mosaic structure comprising three partially conserved and two variable subfragments and resulted into five different sequence types. The variable subfragment sV1 has undergone recombination events and resulted in hybrid sequences and the haplotype network allocated the Mexican haplotypes to three lineages, corresponding to the Sal I and Belem types, and other more divergent group. In contrast, the network from icb5-6 fragment but not sV1 revealed that the Mexican haplotypes belong to two separate lineages, none of which are closely related to Sal I or Belem sequences. Conclusions These results suggest that the new hybrid haplotypes from southern Mexico were the result of at least three different recombination events. These rearrangements likely resulted from the recombination between haplotypes of highly divergent lineages that are frequently distributed in South America and Asia and diversified rapidly. PMID:24472213

Disruption of tetR type regulator adeN by mobile genetic element confers elevated virulence in Acinetobacter baumannii.

PubMed

Saranathan, Rajagopalan; Pagal, Sudhakar; Sawant, Ajit R; Tomar, Archana; Madhangi, M; Sah, Suresh; Satti, Annapurna; Arunkumar, K P; Prashanth, K

2017-10-03

Acinetobacter baumannii is an important human pathogen and considered as a major threat due to its extreme drug resistance. In this study, the genome of a hyper-virulent MDR strain PKAB07 of A. baumannii isolated from an Indian patient was sequenced and analyzed to understand its mechanisms of virulence, resistance and evolution. Comparative genome analysis of PKAB07 revealed virulence and resistance related genes scattered throughout the genome, instead of being organized as an island, indicating the highly mosaic nature of the genome. Many intermittent horizontal gene transfer events, insertion sequence (IS) element insertions identified were augmenting resistance machinery and elevating the SNP densities in A. baumannii eventually aiding in their swift evolution. ISAba1, the most widely distributed insertion sequence in A. baumannii was found in multiple sites in PKAB07. Out of many ISAba1 insertions, we identified novel insertions in 9 different genes wherein insertional inactivation of adeN (tetR type regulator) was significant. To assess the significance of this disruption in A. baumannii, adeN mutant and complement strains were constructed in A. baumannii ATCC 17978 strain and studied. Biofilm levels were abrogated in the adeN knockout when compared with the wild type and complemented strain of adeN knockout. Virulence of the adeN knockout mutant strain was observed to be high, which was validated by in vitro experiments and Galleria mellonella infection model. The overexpression of adeJ, a major component of AdeIJK efflux pump observed in adeN knockout strain could be the possible reason for the elevated virulence in adeN mutant and PKB07 strain. Knocking out of adeN in ATCC strain led to increased resistance and virulence at par with the PKAB07. Disruption of tetR type regulator adeN by ISAba1 consequently has led to elevated virulence in this pathogen.

The Tc1/mariner transposable element family shapes genetic variation and gene expression in the protist Trichomonas vaginalis

PubMed Central

2014-01-01

Background Trichomonas vaginalis is the most prevalent non-viral sexually transmitted parasite. Although the protist is presumed to reproduce asexually, 60% of its haploid genome contains transposable elements (TEs), known contributors to genome variability. The availability of a draft genome sequence and our collection of >200 global isolates of T. vaginalis facilitate the study and analysis of TE population dynamics and their contribution to genomic variability in this protist. Results We present here a pilot study of a subset of class II Tc1/mariner TEs that belong to the T. vaginalis Tvmar1 family. We report the genetic structure of 19 Tvmar1 loci, their ability to encode a full-length transposase protein, and their insertion frequencies in 94 global isolates from seven regions of the world. While most of the Tvmar1 elements studied exhibited low insertion frequencies, two of the 19 loci (locus 1 and locus 9) show high insertion frequencies of 1.00 and 0.96, respectively. The genetic structuring of the global populations identified by principal component analysis (PCA) of the Tvmar1 loci is in general agreement with published data based on genotyping, showing that Tvmar1 polymorphisms are a robust indicator of T. vaginalis genetic history. Analysis of expression of 22 genes flanking 13 Tvmar1 loci indicated significantly altered expression of six of the genes next to five Tvmar1 insertions, suggesting that the insertions have functional implications for T. vaginalis gene expression. Conclusions Our study is the first in T. vaginalis to describe Tvmar1 population dynamics and its contribution to genetic variability of the parasite. We show that a majority of our studied Tvmar1 insertion loci exist at very low frequencies in the global population, and insertions are variable between geographical isolates. In addition, we observe that low frequency insertion is related to reduced or abolished expression of flanking genes. While low insertion frequencies might be expected, we identified two Tvmar1 insertion loci that are fixed across global populations. This observation indicates that Tvmar1 insertion may have differing impacts and fitness costs in the host genome and may play varying roles in the adaptive evolution of T. vaginalis. PMID:24834134

Molecular Characteristics of the Mycobacterium tuberculosis LAM-RUS Family Prevalent in Central Russia▿ †

PubMed Central

Dubiley, Svetlana; Kirillov, Eugene; Ignatova, Anna; Stepanshina, Valentina; Shemyakin, Igor

2007-01-01

We analyzed IS6110-associated polymorphisms in the phospholipase C genes of 107 isolates of Mycobacterium tuberculosis selected to be representative of isolates circulating in central Russia. We found that the majority of Latin American-Mediterranean family strains contained an insertion in a unique position in the plcA gene, suggesting a common ancestor. This insertion can serve as a specific genetic marker for this group, which we designate the LAM-RUS family. PMID:17942651

Isolation of an insertion sequence (IS1051) from Xanthomonas campestris pv. dieffenbachiae with potential use for strain identification and characterization.

PubMed Central

Berthier, Y; Thierry, D; Lemattre, M; Guesdon, J L

1994-01-01

A new insertion sequence was isolated from Xanthomonas campestris pv. dieffenbachiae. Sequence analysis showed that this element is 1,158 bp long and has 15-bp inverted repeat ends containing two mismatches. Comparison of this sequence with sequences in data bases revealed significant homology with Escherichia coli IS5. IS1051, which detected multiple restriction fragment length polymorphisms, was used as a probe to characterize strains from the pathovar dieffenbachiae. Images PMID:7906933

A ribosomal orphon sequence from Xenopus laevis flanked by novel low copy number repetitive elements.

PubMed

Guimond, A; Moss, T

1999-02-01

We have used a differential cloning approach to isolate ribosomal/non-ribosomal frontier sequences from Xenopus laevis. A ribosomal intergenic spacer sequence (IGS) was cloned and shown not to be physically linked with the ribosomal locus. This ribosomal orphon contained the IGS sequences found immediately downstream of the 28S gene and included an array of enhancer repetitions and a non-functional spacer promoter. The orphon sequence was flanked by a member of the novel 'Frt' low copy repetitive element family. Three individual Frt repeats were sequenced and all members of this family were shown to lie clustered at two chromosomal sites, one of which contained the ribosomal orphon. One of the Frt elements contained an insertion of 297 bp that showed extensive homology to sequences within at least three other Xenopus genes. Each homology region was flanked by members of the T2 family of short interspersed repetitive elements, (SINEs), and by its target insertion sequence, suggesting multiple translocation events. The data are discussed in terms of the evolution of the ribosomal gene locus.

Isolated avulsion of the vastus lateralis tendon insertion in a weightlifter: a case report

PubMed Central

Trikha, Paul S; Wood, David G

2009-01-01

Introduction We report a case of isolated, unilateral avulsion of the vastus lateralis tendon from its insertion at the patella. This was diagnosed by magnetic resonance imaging, and underwent successful surgical repair. Case presentation A healthy 32-year-old national level power lifter presented with an isolated avulsion of the vastus lateralis tendon. After a failed course of conservative therapy he underwent surgical repair and a graded physical therapy programme. One year later he returned to full training with no evidence of re-rupture. Conclusion This is the first reported case of an isolated vastus lateralis avulsion. Our experience suggests that magnetic resonance imaging is invaluable in the diagnosis of this condition and that surgical repair provides a good outcome in high demand patients. PMID:19918436

Antigenic Diversity of the Plasmodium vivax Circumsporozoite Protein in Parasite Isolates of Western Colombia

PubMed Central

Hernández-Martínez, Miguel Ángel; Escalante, Ananías A.; Arévalo-Herrera, Myriam; Herrera, Sócrates

2011-01-01

Circumsporozoite (CS) protein is a malaria antigen involved in sporozoite invasion of hepatocytes, and thus considered to have good vaccine potential. We evaluated the polymorphism of the Plasmodium vivax CS gene in 24 parasite isolates collected from malaria-endemic areas of Colombia. We sequenced 27 alleles, most of which (25/27) corresponded to the VK247 genotype and the remainder to the VK210 type. All VK247 alleles presented a mutation (Gly → Asn) at position 28 in the N-terminal region, whereas the C-terminal presented three insertions: the ANKKAGDAG, which is common in all VK247 isolates; 12 alleles presented the insertion GAGGQAAGGNAANKKAGDAG; and 5 alleles presented the insertion GGNAGGNA. Both repeat regions were polymorphic in gene sequence and size. Sequences coding for B-, T-CD4+, and T-CD8+ cell epitopes were found to be conserved. This study confirms the high polymorphism of the repeat domain and the highly conserved nature of the flanking regions. PMID:21292878

Distinct Bacteriophages Encoding Panton-Valentine Leukocidin (PVL) among International Methicillin-Resistant Staphylococcus aureus Clones Harboring PVL▿

PubMed Central

Boakes, E.; Kearns, A. M.; Ganner, M.; Perry, C.; Hill, R. L.; Ellington, M. J.

2011-01-01

Genetically diverse community-associated methicillin resistant Staphylococcus aureus (CA-MRSA) can harbor a bacteriophage encoding Panton-Valentine leukocidin (PVL) lysogenized into its chromosome (prophage). Six PVL phages (ΦPVL, Φ108PVL, ΦSLT, ΦSa2MW, ΦSa2USA, and ΦSa2958) are known, and single-nucleotide polymorphisms (SNPs) in the PVL genes have been reported. We sought to determine the distribution of lysogenized PVL phages among MRSA strains with PVL (PVL-MRSA strains), the PVL gene sequences, and the chromosomal phage insertion sites in 114 isolates comprising nine clones of PVL-MRSA that were selected for maximal underlying genetic diversity. The six PVL phages were identified by PCR; ΦSa2USA was present in the highest number of different lineages (multilocus sequence type clonal complex 1 [CC1], CC5, CC8, and sequence type 93 [ST93]) (n = 37 isolates). Analysis of 92 isolates confirmed that PVL phages inserted into the same chromosomal insertion locus in CC22, -30, and -80 but in a different locus in isolates of CC1, -5, -8, -59, and -88 and ST93 (and CC22 in two isolates). Within the two different loci, specific attachment motifs were found in all cases, although some limited inter- and intralineage sequence variation occurred. Overall, lineage-specific relationships between the PVL phage, the genes that encode the toxin, and the position at which the phage inserts into the host chromosome were identified. These analyses provide important insights into the microepidemiology of PVL-MRSA, will prove a valuable adjunct in outbreak investigation, and may help predict the emergence of new strains. PMID:21106787

Hemodialysis tunneled central venous catheters: five-year outcome analysis.

PubMed

Mandolfo, Salvatore; Acconcia, Pasqualina; Bucci, Raffaella; Corradi, Bruno; Farina, Marco; Rizzo, Maria Antonietta; Stucchi, Andrea

2014-01-01

Tunneled central venous catheters (tCVCs) are considered inferior to arteriovenous fistulas (AVFs) and grafts in all nephrology guidelines. However, they are being increasingly used as hemodialysis vascular access. The purpose of this study was to document the natural history of tCVCs and determine the rate and type of catheter replacement. This was a prospective study of 141 patients who underwent hemodialysis with tCVCs between January 2008 and December 2012. The patients used 154 tCVCs. Standard protocols about management of tCVCs, according to European Renal Best Practice, were well established. All catheters were inserted in the internal jugular vein. Criteria for catheter removal were persistent bloodstream infection, detection of an outbreak of catheter-related bloodstream (CRBS) infections, or catheter dysfunction. Event rates were calculated per 1,000 catheter days; tCVC cumulative survival was estimated by Kaplan-Meier analysis. Catheter replacement occurred in 15 patients (0.29 per 1,000 days); catheter dysfunction was the main cause of replacement (0.18 per 1,000 days), typically within 12 months of surgical insertion. A total of 53 CRBS events in 36 patients were identified (0.82 per 1,000 days); 17 organisms, most commonly Gram-positive pathogens, were isolated; 87% of CVC infections were treated by systemic antibiotics associated with lock therapy. tCVC cumulative survival was 91% at 1 year, 88% at 2 years and 85% at 4 years. Our data show a high survival rate of tCVCs in hemodialysis patients, with low incidence of catheter dysfunction and CRBS events. These data justify tCVC use for hemodialysis vascular access, also as first choice, especially in patients with exhausted peripheral access and limited life expectancy.

Description of Campylobacter fetus subsp. testudinum subsp. nov., isolated from humans and reptiles

USDA-ARS?s Scientific Manuscript database

A polyphasic study was undertaken to determine the taxonomic position of 13 Campylobacter fetus-like isolates from humans (n=8) and reptiles (n=5). Phenotypic characterization, Genusgenus-specific and sap insertion-PCR initially identified all human isolates as type A Campylobacter fetus. Phylogenet...

ATWS at Browns Ferry Unit One - accident sequence analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harrington, R.M.; Hodge, S.A.

1984-07-01

This study describes the predicted response of Unit One at the Browns Ferry Nuclear Plant to a postulated complete failure to scram following a transient occurrence that has caused closure of all Main Steam Isolation Valves (MSIVs). This hypothetical event constitutes the most severe example of the type of accident classified as Anticipated Transient Without Scram (ATWS). Without the automatic control rod insertion provided by scram, the void coefficient of reactivity and the mechanisms by which voids are formed in the moderator/coolant play a dominant role in the progression of the accident. Actions taken by the operator greatly influence themore » quantity of voids in the coolant and the effect is analyzed in this report. The progression of the accident sequence under existing and under recommended procedures is discussed. For the extremely unlikely cases in which equipment failure and wrongful operator actions might lead to severe core damage, the sequence of emergency action levels and the associated timing of events are presented.« less

Complete genome analysis of three Acinetobacter baumannii clinical isolates in China for insight into the diversification of drug resistance elements.

PubMed

Zhu, Lingxiang; Yan, Zhongqiang; Zhang, Zhaojun; Zhou, Qiming; Zhou, Jinchun; Wakeland, Edward K; Fang, Xiangdong; Xuan, Zhenyu; Shen, Dingxia; Li, Quan-Zhen

2013-01-01

The emergence and rapid spreading of multidrug-resistant Acinetobacter baumannii strains has become a major health threat worldwide. To better understand the genetic recombination related with the acquisition of drug-resistant elements during bacterial infection, we performed complete genome analysis on three newly isolated multidrug-resistant A. baumannii strains from Beijing using next-generation sequencing technology. Whole genome comparison revealed that all 3 strains share some common drug resistant elements including carbapenem-resistant bla OXA-23 and tetracycline (tet) resistance islands, but the genome structures are diversified among strains. Various genomic islands intersperse on the genome with transposons and insertions, reflecting the recombination flexibility during the acquisition of the resistant elements. The blood-isolated BJAB07104 and ascites-isolated BJAB0868 exhibit high similarity on their genome structure with most of the global clone II strains, suggesting these two strains belong to the dominant outbreak strains prevalent worldwide. A large resistance island (RI) of about 121-kb, carrying a cluster of resistance-related genes, was inserted into the ATPase gene on BJAB07104 and BJAB0868 genomes. A 78-kb insertion element carrying tra-locus and bla OXA-23 island, can be either inserted into one of the tniB gene in the 121-kb RI on the chromosome, or transformed to conjugative plasmid in the two BJAB strains. The third strains of this study, BJAB0715, which was isolated from spinal fluid, exhibit much more divergence compared with above two strains. It harbors multiple drug-resistance elements including a truncated AbaR-22-like RI on its genome. One of the unique features of this strain is that it carries both bla OXA-23 and bla OXA-58 genes on its genome. Besides, an Acinetobacter lwoffii adeABC efflux element was found inserted into the ATPase position in BJAB0715. Our comparative analysis on currently completed Acinetobacter baumannii genomes revealed extensive and dynamic genome organizations, which may facilitate the bacteria to acquire drug-resistance elements into their genomes.

Occurence of adverse events due to continuous glucose monitoring.

PubMed

Jadviscokova, Tereza; Fajkusova, Zuzana; Pallayova, Maria; Luza, Jiri; Kuzmina, Galina

2007-12-01

Continuous glucose monitoring (CGM) using transcutaneous sensors is becoming a sophisticated method to control and regulate glucose metabolism. The transcutaneous sensor of the CGM system (CGMS Medtronic Minimed, Northridge, CA, USA) is chosen to measure glucose concentration in interstitial fluid up to three days after insertion even though its function remains stable for a longer period. The question arises, which factors really limit the period of sensor insertion without unnecessary risk. The aim of this study was to assess any adverse events occurring in the course of 9 days after the sensor insertion. In a group of 22 healthy volunteers aged 21.8+/-1.30 y (mean +/- SE) a total of 26 sensors was inserted subcutaneously in gluteal or lumbar region for 9 days. Before insertion the site was sprayed with an antiseptic (Cutasept F, Bode Chemie, Hamburg, Germany). Local adverse reactions and disturbances in general condition were examined. In the course of 184 sensor-days, there were only minor local adverse events: hypersensitivity, itching, pain, redness, burning, subcutaneous hemorrhage. Additionally, sleep disturbances, attention deficits, problems related to the CGMS monitor, to adhesive tape and/or sensor were found. None of these resulted in sensor withdrawal. In 12 volunteers (55 %) no complications were observed. The sensor function measured according to electrical signals (ISIG) failed (always on day 1-2) in 4 cases (16 %). The present FDA approved 3-day insertion period for Medtronic transcutaneous sensor does not seem to limit its use and appears to be worth a careful revision.

Vector for IS element entrapment and functional characterization based on turning on expression of distal promoterless genes.

PubMed

Szeverényi, I; Hodel, A; Arber, W; Olasz, F

1996-09-26

We constructed and characterized a novel trap vector for rapid isolation of insertion sequences. The strategy used for the isolation of IS elements is based on the ability of many IS elements to turn on the expression of otherwise silent genes distal to some sites of insertion. The simple transposition of an IS element can sometimes cause the constitutive expression of promoterless antibiotic resistance genes resulting in selectable phenotypes. The trap vector pAW1326 is based on a pBR322 replicon, it carries ampicillin and streptomycin resistance genes, and also silenced genes that confer chloramphenicol and kanamycin resistance once activated. The trap vector pAW1326 proved to be efficient and 85 percent of all isolated mutations were insertions. The majority of IS elements resident in the studied Escherichia coli strains tested became trapped, namely IS2, IS3, IS5, IS150, IS186 and Tn1000. We also encountered an insertion sequence, called IS10L/R-2, which is a hybrid of the two IS variants IS10L and IS10R. IS10L/R-2 is absent from most E. coli strains, but it is detectable in some strains such as JM109 which had been submitted to Tn10 mutagenesis. The distribution of the insertion sequences within the trap region was not random. Rather, the integration of chromosomal mobile genetic elements into the offered target sequence occurred in element-specific clusters. This is explained both by the target specificity and by the specific requirements for the activation of gene transcription by the DNA rearrangement. The employed trap vector pAW1326 proved to be useful for the isolation of mobile genetic elements, for a demonstration of their transposition activity as well as for the further characterization of some of the functional parameters of transposition.

Dissemination of the highly expressed Bx7 glutenin subunit (Glu-B1al allele) in wheat as revealed by novel PCR markers and RP-HPLC.

PubMed

Butow, B J; Gale, K R; Ikea, J; Juhász, A; Bedö, Z; Tamás, L; Gianibelli, M C

2004-11-01

Increased expression of the high molecular weight glutenin subunit (HMW-GS) Bx7 is associated with improved dough strength of wheat (Triticum aestivum L.) flour. Several cultivars and landraces of widely different genetic backgrounds from around the world have now been found to contain this so-called 'over-expressing' allelic form of the Bx7 subunit encoded by Glu-B1al. Using three methods of identification, SDS-PAGE, RP-HPLC and PCR marker analysis, as well as pedigree information, we have traced the distribution and source of this allele from a Uruguayan landrace, Americano 44D, in the mid-nineteenth century. Results are supported by knowledge of the movement of wheat lines with migrants. All cultivars possessing the Glu-B1al allele can be identified by the following attributes: (1) the elution of the By sub-unit peak before the Dx sub-unit peak by RP-HPLC, (2) high expression levels of Bx7 (>39% Mol% Bx), (3) a 43 bp insertion in the matrix-attachment region (MAR) upstream of the gene promoter relative to Bx7 and an 18 bp nucleotide duplication in the coding region of the gene. Evidence is presented indicating that these 18 and 43 bp sequence insertions are not causal for the high expression levels of Bx7 as they were also found to be present in a small number of hexaploid species, including Chinese Spring, and species expressing Glu-B1ak and Glu-B1a alleles. In addition, these sequence inserts were found in different isolates of the tetraploid wheat, T. turgidum, indicating that these insertion/deletion events occurred prior to hexaploidization.

Genetic Control of Plant Root Colonization by the Biocontrol agent, Pseudomonas fluorescens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cole, Benjamin J.; Fletcher, Meghan; Waters, Jordan

Plant growth promoting rhizobacteria (PGPR) are a critical component of plant root ecosystems. PGPR promote plant growth by solubilizing inaccessible minerals, suppressing pathogenic microorganisms in the soil, and directly stimulating growth through hormone synthesis. Pseudomonas fluorescens is a well-established PGPR isolated from wheat roots that can also colonize the root system of the model plant, Arabidopsis thaliana. We have created barcoded transposon insertion mutant libraries suitable for genome-wide transposon-mediated mutagenesis followed by sequencing (TnSeq). These libraries consist of over 105 independent insertions, collectively providing loss-of-function mutants for nearly all genes in the P.fluorescens genome. Each insertion mutant can be unambiguouslymore » identified by a randomized 20 nucleotide sequence (barcode) engineered into the transposon sequence. We used these libraries in a gnotobiotic assay to examine the colonization ability of P.fluorescens on A.thaliana roots. Taking advantage of the ability to distinguish individual colonization events using barcode sequences, we assessed the timing and microbial concentration dependence of colonization of the rhizoplane niche. These data provide direct insight into the dynamics of plant root colonization in an in vivo system and define baseline parameters for the systematic identification of the bacterial genes and molecular pathways using TnSeq assays. Having determined parameters that facilitate potential colonization of roots by thousands of independent insertion mutants in a single assay, we are currently establishing a genome-wide functional map of genes required for root colonization in P.fluorescens. Importantly, the approach developed and optimized here for P.fluorescens>A.thaliana colonization will be applicable to a wide range of plant-microbe interactions, including biofuel feedstock plants and microbes known or hypothesized to impact on biofuel-relevant traits including biomass productivity and pathogen resistance.« less

Isolating USB connections in medical equipment.

PubMed

Broeders, Jan-Hein

2009-01-01

Although offering several benefits, the universal serial bus (USB) port has not been rapidly adopted for connecting medical equipment. This is because it could affect safety procedures, with equipment not operating isolated from the mains. To overcome this, a single package isolation device has been developed that can be inserted directly into the USB signal path.

Visible optical isolator using ZnSe

NASA Technical Reports Server (NTRS)

Wunderlich, J. A.; Deshazer, L. G.

1977-01-01

A compact Faraday effect optical isolator was constructed for visible wavelengths and tested at 5145 A. The nonreciprocal element of the isolator was polycrystalline zinc selenide placed in the magnetic field of a permanent magnet. For 5145 A the isolator had a 2.06-dB insertion loss and a 25.5-dB isolation. Indices of refraction and Verdet constants were measured for zinc selenide in the wavelength region from 4700 to 6300 A.

Lentiviral vector-based insertional mutagenesis identifies genes associated with liver cancer

PubMed Central

Ranzani, Marco; Cesana, Daniela; Bartholomae, Cynthia C.; Sanvito, Francesca; Pala, Mauro; Benedicenti, Fabrizio; Gallina, Pierangela; Sergi, Lucia Sergi; Merella, Stefania; Bulfone, Alessandro; Doglioni, Claudio; von Kalle, Christof; Kim, Yoon Jun; Schmidt, Manfred; Tonon, Giovanni; Naldini, Luigi; Montini, Eugenio

2013-01-01

Transposons and γ-retroviruses have been efficiently used as insertional mutagens in different tissues to identify molecular culprits of cancer. However, these systems are characterized by recurring integrations that accumulate in tumor cells, hampering the identification of early cancer-driving events amongst bystander and progression-related events. We developed an insertional mutagenesis platform based on lentiviral vectors (LVV) by which we could efficiently induce hepatocellular carcinoma (HCC) in 3 different mouse models. By virtue of LVV’s replication-deficient nature and broad genome-wide integration pattern, LVV-based insertional mutagenesis allowed identification of 4 new liver cancer genes from a limited number of integrations. We validated the oncogenic potential of all the identified genes in vivo, with different levels of penetrance. Our newly identified cancer genes are likely to play a role in human disease, since they are upregulated and/or amplified/deleted in human HCCs and can predict clinical outcome of patients. PMID:23314173

Conservation of chromosomal arrangement among three strains of the genetically unstable archaeon Halobacterium salinarium.

PubMed Central

Hackett, N R; Bobovnikova, Y; Heyrovska, N

1994-01-01

Phenotypic variants of Halobacterium salinarium NRC-1 arise at a frequency of 10(-2). These result from transpositions of halobacterial insertion sequences and rearrangements mediated by halobacterial insertion sequences. We have tested the hypothesis that such mutations are confined to only a portion of the genome by comparing the chromosomal restriction map of H. salinarium NRC-1 and that of the derivative S9, which was made in 1969. The two chromosomes were mapped by using two-dimensional pulsed-field gel electrophoresis and the restriction enzymes AflII, AseI, and DraI. A comparison of the two deduced maps showed a domain of about 210 kbp to be subject to many rearrangements, including an inversion in S9 relative to NRC-1. However, the rest of the chromosome was conserved among NRC-1, S9, and an independent Halobacterium isolate, GRB, previously mapped by St. Jean et al. (A. St. Jean, B. A. Trieselmann, and R. L. Charlebois, Nucleic Acids Res. 22:1476-1483, 1994). This concurs with data from eubacteria suggesting strong selective forces maintaining gene order even in the face of rearrangement events occurring at a high frequency. Images PMID:8002597

Conservation of chromosomal arrangement among three strains of the genetically unstable archaeon Halobacterium salinarium.

PubMed

Hackett, N R; Bobovnikova, Y; Heyrovska, N

1994-12-01

Phenotypic variants of Halobacterium salinarium NRC-1 arise at a frequency of 10(-2). These result from transpositions of halobacterial insertion sequences and rearrangements mediated by halobacterial insertion sequences. We have tested the hypothesis that such mutations are confined to only a portion of the genome by comparing the chromosomal restriction map of H. salinarium NRC-1 and that of the derivative S9, which was made in 1969. The two chromosomes were mapped by using two-dimensional pulsed-field gel electrophoresis and the restriction enzymes AflII, AseI, and DraI. A comparison of the two deduced maps showed a domain of about 210 kbp to be subject to many rearrangements, including an inversion in S9 relative to NRC-1. However, the rest of the chromosome was conserved among NRC-1, S9, and an independent Halobacterium isolate, GRB, previously mapped by St. Jean et al. (A. St. Jean, B. A. Trieselmann, and R. L. Charlebois, Nucleic Acids Res. 22:1476-1483, 1994). This concurs with data from eubacteria suggesting strong selective forces maintaining gene order even in the face of rearrangement events occurring at a high frequency.

CRISPR regulation of intraspecies diversification by limiting IS transposition and intercellular recombination.

PubMed

Watanabe, Takayasu; Nozawa, Takashi; Aikawa, Chihiro; Amano, Atsuo; Maruyama, Fumito; Nakagawa, Ichiro

2013-01-01

Mobile genetic elements (MGEs) and genetic rearrangement are considered as major driving forces of bacterial diversification. Previous comparative genome analysis of Porphyromonas gingivalis, a pathogen related to periodontitis, implied such an important relationship. As a counterpart system to MGEs, clustered regularly interspaced short palindromic repeats (CRISPRs) in bacteria may be useful for genetic typing. We found that CRISPR typing could be a reasonable alternative to conventional methods for characterizing phylogenetic relationships among 60 highly diverse P. gingivalis isolates. Examination of genetic recombination along with multilocus sequence typing suggests the importance of such events between different isolates. MGEs appear to be strategically located at the breakpoint gaps of complicated genome rearrangements. Of these MGEs, insertion sequences (ISs) were found most frequently. CRISPR analysis identified 2,150 spacers that were clustered into 1,187 unique ones. Most of these spacers exhibited no significant nucleotide similarity to known sequences (97.6%: 1,158/1,187). Surprisingly, CRISPR spacers exhibiting high nucleotide similarity to regions of P. gingivalis genomes including ISs were predominant. The proportion of such spacers to all the unique spacers (1.6%: 19/1,187) was the highest among previous studies, suggesting novel functions for these CRISPRs. These results indicate that P. gingivalis is a bacterium with high intraspecies diversity caused by frequent insertion sequence (IS) transposition, whereas both the introduction of foreign DNA, primarily from other P. gingivalis cells, and IS transposition are limited by CRISPR interference. It is suggested that P. gingivalis CRISPRs could be an important source for understanding the role of CRISPRs in the development of bacterial diversity.

Implant Evaluation of an Insertable Cardiac Monitor Outside the Electrophysiology Lab Setting

PubMed Central

Pachulski, Roman; Cockrell, James; Solomon, Hemant; Yang, Fang; Rogers, John

2013-01-01

Background To date, insertable cardiac monitors (ICM) have been implanted in the hospital without critical evaluation of other potential settings. Providing alternatives to in-hospital insertion may increase access to ICM, decrease waiting times for patients awaiting diagnosis, and reduce hospital resources. Methods This was a prospective, non-randomized, clinical trial involving nine clinical sites throughout the United States designed to assess the feasibility of ICM implants in a non-hospital setting. Other than the Reveal® ICM, implant supplies and techniques were left to physician discretion in patients who met indications. Patients were followed up to 90 days post-implant. The primary objective was to characterize the number of procedure-related adverse events that required surgical intervention within 90 days. Results Sixty-five patients were implanted at nine out-of-hospital sites. The insertion procedure was well tolerated by all patients. There were no deaths, systemic infections or endocarditis. There were two (3%) procedure-related adverse events requiring device explant and four (6%) adverse events not requiring explant. ICM use led to 16 diagnoses (24.6%) with 9 patients proceeding to alternate cardiac device implants during the course of the 90-day follow up. Conclusion Out-of-hospital ICM insertion can be accomplished with comparable procedural safety and represents a reasonable alternative to the in-hospital setting. Clinicaltrials.gov registration number: NCT01168427 PMID:23977071

Mobile-bearing total knee arthroplasty: a full traumatic rotation of 180°.

PubMed

Sudanese, Alessandra; Castiello, Emanuela; Affatato, Saverio

2013-06-25

From February 2008 to September 2012 we implanted 204 mobile-bearing knee prostheses in 192 patients. All the prostheses were cemented (both femoral and tibial components), and the patella was not replaced. Only one early complication of the implants (1/204 = 0.004%) occurred after a traumatic event as a full 180° rotation of the mobile-bearing polyethylene insert. A 78-year-old woman presented with swelling and severe pain at her right knee. This traumatic event was the only case among our mobile-bearing insert patients. 
The failed polyethylene inserts were retrieved and studied using a scanning electron microscope (SEM, ZEISS EVO 50 EP, Cambridge, UK) operating at 20 kV. 
Scratching and pitting were found on the UHMWPE insert perpendicular to the machining tracks for the concave surface. SEM micrographs of the insert showed burnishing on the concave surfaces and longitudinal scratches were clearly detectable and well-marked on the analyzed surfaces. 
A traumatic, fully rotating, polyethylene insert is rare and our case is the first report describing a traumatic event with a complete 180 degree rotation mobile-bearing in a total knee prosthesis. 
In the literature few reports discuss clinical outcomes after total knee arthroplasty in patients with Parkinson's disease and they cite mixed results. However, some authors suggest that posterior-stabilized and cruciate-retaining TKA should work well while others prefer cruciate-retaining, condylar constrained kinetics, or hinged devices. Although we did not implant a posterior-stabilized mobile-bearing total knee prosthesis or a constrained prosthesis, we obtained good clinical and radiological results at the 2-year followup.

48 CFR 2152.210-71 - Notice of significant events.

Code of Federal Regulations, 2011 CFR

2011-10-01

... events. 2152.210-71 Section 2152.210-71 Federal Acquisition Regulations System OFFICE OF PERSONNEL... events. As prescribed in 2110.7004(b), insert the following clause: Notice of Significant Events (OCT 2005) (a) The Contractor agrees to notify OPM of any significant event within 10 working days after the...

48 CFR 2152.210-71 - Notice of significant events.

Code of Federal Regulations, 2013 CFR

2013-10-01

... events. 2152.210-71 Section 2152.210-71 Federal Acquisition Regulations System OFFICE OF PERSONNEL... events. As prescribed in 2110.7004(b), insert the following clause: Notice of Significant Events (OCT 2005) (a) The Contractor agrees to notify OPM of any significant event within 10 working days after the...

48 CFR 2152.210-71 - Notice of significant events.

Code of Federal Regulations, 2012 CFR

2012-10-01

... events. 2152.210-71 Section 2152.210-71 Federal Acquisition Regulations System OFFICE OF PERSONNEL... events. As prescribed in 2110.7004(b), insert the following clause: Notice of Significant Events (OCT 2005) (a) The Contractor agrees to notify OPM of any significant event within 10 working days after the...

A Truncated AdeS Kinase Protein Generated by ISAba1 Insertion Correlates with Tigecycline Resistance in Acinetobacter baumannii

PubMed Central

Sun, Jun-Ren; Perng, Cherng-Lih; Chan, Ming-Chin; Morita, Yuji; Lin, Jung-Chung; Su, Chih-Mao; Wang, Wei-Yao; Chang, Tein-Yao; Chiueh, Tzong-Shi

2012-01-01

Over-expression of AdeABC efflux pump stimulated continuously by the mutated AdeRS two component system has been found to result in antimicrobial resistance, even tigecycline (TGC) resistance, in multidrug-resistant Acinetobacter baumannii (MRAB). Although the insertion sequence, ISAba1, contributes to one of the AdeRS mutations, the detail mechanism remains unclear. In the present study we collected 130 TGC-resistant isolates from 317 carbapenem resistant MRAB (MRAB-C) isolates, and 38 of them were characterized with ISAba1 insertion in the adeS gene. The relationship between the expression of AdeABC efflux pump and TGC resistant was verified indirectly by successfully reducing TGC resistance with NMP, an efflux pump inhibitor. Further analysis showed that the remaining gene following the ISAba1 insertion was still transcribed to generate a truncated AdeS protein by the Pout promoter on ISAba1 instead of frame shift or pre-termination. Through introducing a series of recombinant adeRS constructs into a adeRS knockout strain, we demonstrated the truncated AdeS protein was constitutively produced and stimulating the expression of AdeABC efflux pump via interaction with AdeR. Our findings suggest a mechanism of antimicrobial resistance induced by an aberrant cytoplasmic sensor derived from an insertion element. PMID:23166700

Complete Genome Sequence of a Novel Newcastle Disease Virus Strain Isolated from a Chicken in West Africa

PubMed Central

Kim, Shin-Hee; Nayak, Subhashree; Paldurai, Anandan; Nayak, Baibaswata; Samuel, Arthur; Aplogan, Gilbert L.; Awoume, Kodzo A.; Webby, Richard J.; Ducatez, Mariette F.; Collins, Peter L.

2012-01-01

The complete genome sequence of an African Newcastle disease virus (NDV) strain isolated from a chicken in Togo in 2009 was determined. The genome is 15,198 nucleotides (nt) in length and is classified in genotype VII in the class II cluster. Compared to common vaccine strains, the African strain contains a previously described 6-nt insert in the downstream untranslated region of the N gene and a novel 6-nt insert in the HN-L intergenic region. Genome length differences are a marker of the natural history of NDV. This is the first description of a class II NDV strain with a genome of 15,198 nt and a 6-nt insert in the HN-L intergenic region. Sequence divergence relative to vaccine strains was substantial, likely contributes to outbreaks, and illustrates the continued evolution of new NDV strains in West Africa. PMID:22997417

Characterization of IS1515, a Functional Insertion Sequence in Streptococcus pneumoniae

PubMed Central

Muñoz, Rosario; López, Rubens; García, Ernesto

1998-01-01

We describe the characterization of a new insertion sequence, IS1515, identified in the genome of Streptococcus pneumoniae I41R, an unencapsulated mutant isolated many years ago (R. Austrian, H. P. Bernheimer, E. E. B. Smith, and G. T. Mills, J. Exp. Med. 110:585–602, 1959). A copy of this element located in the cap1EI41R gene was sequenced. The 871-bp-long IS1515 element possesses 12-bp perfect inverted repeats and generates a 3-bp target duplication upon insertion. The IS encodes a protein of 271 amino acid residues similar to the putative transposases of other insertion sequences, namely IS1381 from S. pneumoniae, ISL2 from Lactobacillus helveticus, IS702 from the cyanobacterium Calothrix sp. strain PCC 7601, and IS112 from Streptomyces albus G. IS1515 appears to be present in the genome of most type 1 pneumococci in a maximum of 13 copies, although it has also been found in the chromosome of pneumococcal isolates belonging to other serotypes. We have found that the unencapsulated phenotype of strain I41R is the result of both the presence of an IS1515 copy and a frameshift mutation in the cap1EI41R gene. Precise excision of the IS was observed in the type 1 encapsulated transformants isolated in experiments designed to repair the frameshift. These results reveal that IS1515 behaves quite differently from other previously described pneumococcal insertion sequences. Several copies of IS1515 were also able to excise and move to another locations in the chromosome of S. pneumoniae. To our knowledge, this is the first report of a functional IS in pneumococcus. PMID:9580131

Sexual Risk-Taking in HIV-Negative Gay and Bisexual Men Increases with Depression: Results from a U.S. National Study

PubMed Central

Millar, Brett M.; Starks, Tyrel J.; Grov, Christian; Parsons, Jeffrey T.

2017-01-01

The link between depression and sexual risk-taking has received mixed findings in the literature. The current study analyzed the links between depression and recent condomless anal sex (CAS) with casual partners among 1033 HIV-negative, non-PrEP-using, gay and bisexual men. When CAS was dichotomized as either none or some, depression was not associated with the odds of CAS (with receptive and insertive combined) or insertive CAS only, but was positively associated with the odds of receptive CAS. When CAS was tallied as a count variable of events, depression was positively associated with total CAS, receptive CAS, and insertive CAS. With the addition of a quadratic term for depression, a positive quadratic effect was only found for total CAS and receptive CAS, but not for insertive CAS. These findings highlight the utility of using count data for CAS events and treating CAS separately with regard to receptive and insertive positioning when considering the role of depression among gay and bisexual men. PMID:27475943

Detection of restriction fragment length polymorphisms in clinical isolates and serially passaged Pseudomonas aeruginosa strains.

PubMed Central

Hjelm, L N; Branstrom, A A; Warren, R L

1990-01-01

An 800-base-pair HindIII-PstI fragment that flanks a hot spot for Tn7 insertion was isolated from the chromosome of Pseudomonas aeruginosa and cloned into pUC12. The fragment was used to probe XhoI digests of genomic DNA from 18 P. aeruginosa isolates collected from sputum samples of seven cystic fibrosis patients. Only two XhoI restriction fragment length polymorphisms (RFLPs), of 3.7 and 7.7 kilobases (kb), were detected. Isolate WSU3531-1 (3.7-kb XhoI fragment) and WSU3860 (7.7-kb XhoI fragment), while isolated from the same patient, showed different RFLPs. Serial passages of isolate WSU3531-1 demonstrated that this strain was phenotypically stable. In contrast, colony and pigment variants were readily isolated at a frequency of 1% from serial passages of isolate WSU3860. When XhoI-digested genomic DNA from phenotypic variants of serially passaged WSU3860 were probed with the 800-base-pair HindIII-PstI fragment, the probe hybridized to a 10.4-kb XhoI fragment from three isolates. Restriction analysis of the genomic DNA digested with a variety of restriction enzymes showed that a 2.7-kb insertion occurred in the same region for all three isolates. There appeared to be no correlation between changes in the RFLP and changes in colony morphology. Images PMID:1977762

Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

PubMed

Beauparlant, Marc A; Drouin, Guy

2014-02-01

Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

Changing molecular epidemiology and high rates of mupirocin resistance among meticillin-resistant Staphylococcus aureus in Singaporean hospitals.

PubMed

Hon, Pei Yun; Koh, Tse Hsien; Tan, Thean Yen; Krishnan, Prabha; Leong, Janice Wai-Yeng; Jureen, Roland; Chan, Joey; Tee, Nancy Wen-Sim; Murugesh, Jagadeesan; Chan, Kian Sing; Hsu, Li Yang

2014-03-01

A prospective cross-sectional study was performed to determine the continuing shift in the molecular epidemiology of meticillin-resistant Staphylococcus aureus (MRSA) in Singapore. In total, 666 MRSA isolates from screening cultures performed between 7 and 20 January 2013 were obtained from all seven public sector hospitals in Singapore and were subjected to molecular typing using multilocus variable-number tandem-repeat fingerprinting with confirmatory multilocus sequencing typing for clustered isolates. Isolates were also tested for the presence of the orfX-ACME insert and the high-level mupirocin resistance gene ileS-2. The major circulating clones in Singaporean hospitals were ST22 (63.2%), ST45 (18.9%) and ST239 (10.7%). The orfX-ACME insert was only found in ST239 isolates (31/71, 43.7%), but ileS-2 was found in 207 (31.1%) of the MRSA isolates, varying between 10.0% and 47.8% among the hospitals. In conclusion, the molecular epidemiology of MRSA in Singaporean hospitals has continued to change, with ST45 now replacing ST239 in addition to the ongoing replacement of the latter by ST22. Although a greater proportion of ST239 isolates carry the orfX-ACME insert, the actual clinical impact may be marginal as ST239 MRSA continues to decline. Finally, high-level mupirocin resistance rates are remarkably high in local healthcare-associated MRSA, with implications for MRSA decolonisation and infection prevention. Further surveillance is required to monitor the changing epidemiological trends. Copyright © 2013 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

Isolation of Erwinia chrysanthemi kduD mutants altered in pectin degradation.

PubMed Central

Condemine, G; Hugouvieux-Cotte-Pattat, N; Robert-Baudouy, J

1986-01-01

Mutants of Erwinia chrysanthemi impaired in pectin degradation were isolated by chemical and Mu d(Ap lac) insertion mutagenesis. A mutation in the kduD gene coding for 2-keto-3-deoxygluconate oxidoreductase prevented the growth of the bacteria on polygalacturonate as the sole carbon source. Analysis of the kduD::Mu d(Ap lac) insertions indicated that kduD is either an isolated gene or the last gene of a polycistronic operon. Some of the Mu d(Ap lac) insertions were kduD-lac fusions in which beta-galactosidase synthesis reflected kduD gene expression. In all these fusions, beta-galactosidase activity was shown to be sensitive to catabolite repression by glucose and to be inducible by polygalacturonate, galacturonate, and other intermediates of polygalacturonate catabolism. Galacturonate-mediated induction was prevented by a mutation which blocked its metabolism to 2-keto-3-deoxygluconate. 2-Keto-3-deoxygluconate appeared to be the true inducer of kduD expression resulting from galacturonate degradation. 5-Keto-4-deoxyuronate or 2,5-diketo-3-deoxygluconate were the true inducers, originating from polygalacturonate cleavage. These three intermediates also appeared to induce pectate lyases, oligogalacturonate lyase, and 5-keto-4-deoxyuronate isomerase synthesis. PMID:3949717

High Isolation Single-Pole Four-Throw RF MEMS Switch Based on Series-Shunt Configuration

PubMed Central

Khaira, Navjot

2014-01-01

This paper presents a novel design of single-pole four-throw (SP4T) RF-MEMS switch employing both capacitive and ohmic switches. It is designed on high-resistivity silicon substrate and has a compact area of 1.06 mm2. The series or ohmic switches have been designed to provide low insertion loss with good ohmic contact. The pull-in voltage for ohmic switches is calculated to be 7.19 V. Shunt or capacitive switches have been used in each port to improve the isolation for higher frequencies. The proposed SP4T switch provides excellent RF performances with isolation better than 70.64 dB and insertion loss less than 0.72 dB for X-band between the input port and each output port. PMID:24711730

Multifunctional Antenna Techniques

DTIC Science & Technology

2015-11-25

the planar structure that can be sufficiently isolated from the radiation mechanism of the antenna and transformed into a TEM transmission line feed...an equivalent transmission line structure, and isolate the physical 5 | P a g e mechanisms responsible for impedance and radiation behavior...gap-fed Archimedean spiral antenna in free space with non-negligible metal width, insertion PMC boundaries to isolate the radiation and propagation

Artificial dielectric polarizing-beamsplitter and isolator for the terahertz region.

PubMed

Mendis, Rajind; Nagai, Masaya; Zhang, Wei; Mittleman, Daniel M

2017-07-19

We demonstrate a simple and effective strategy for implementing a polarizing beamsplitter for the terahertz spectral region, based on an artificial dielectric medium that is scalable to a range of desired frequencies. The artificial dielectric medium consists of a uniformly spaced stack of metal plates, which is electromagnetically equivalent to a stacked array of parallel-plate waveguides. The operation of the device relies on both the lowest-order, transverse-electric and transverse-magnetic modes of the parallel-plate waveguide. This is in contrast to previous work that relied solely on the transverse-electric mode. The fabricated polarizing beamsplitter exhibits extinction ratios as high as 42 dB along with insertion losses as low as 0.18 dB. Building on the same idea, we also demonstrate an isolator with non-reciprocal transmission, providing high isolation and low insertion loss at a select design frequency. The performance of our isolator far exceeds that of other experimentally demonstrated terahertz isolators, and indeed, even rivals that of commercially available isolators for optical wavelengths. Because these waveguide-based artificial dielectrics are low loss, inexpensive, and easy to fabricate, this approach offers a promising new route for polarization control of free-space terahertz beams.

Optimization of figure of merit in magnetoplasmonic waveguides with Fe/Au multilayer for optical isolator based on nonreciprocal coupling on Si waveguides

NASA Astrophysics Data System (ADS)

Shimizu, Hiromasa; Shimodaira, Takahiro

2018-04-01

We report on magnetoplasmonic Si waveguides with a ferromagnetic Fe/conductive metal Au multilayer for realizing a sizable magnetooptic effect with a low propagation loss for integrated optical isolators. By combining the ferromagnetic metal Fe with a highly conductive Au layer, the largest nonreciprocal differences in effective index were estimated for propagation lengths of 1-20 µm. Mode analysis with and without a Au layer clarified that the insertion of a Au layer on an Fe layer improves the optical confinement in the Fe layer with reduced propagation loss and is effective in enlarging the magnetooptic effect for the same propagation length. On the basis of the optimized Fe/Au multilayer structure, we designed waveguide optical isolators based on nonreciprocal coupling by the finite difference time domain (FDTD) method. We estimated an optical isolation of 10.8 dB with a forward insertion loss of 13.4 dB in a 34-µm-long nonreciprocal directional coupler.

48 CFR 1652.222-70 - Notice of significant events.

Code of Federal Regulations, 2013 CFR

2013-10-01

... events. 1652.222-70 Section 1652.222-70 Federal Acquisition Regulations System OFFICE OF PERSONNEL... of FEHBP Clauses 1652.222-70 Notice of significant events. As prescribed in 1622.103-70, the following clause shall be inserted in all FEHBP contracts. Notice of Significant Events (JUL 2005) (a) The...

The Nitrogen-Fixation Island Insertion Site Is Conserved in Diazotrophic Pseudomonas stutzeri and Pseudomonas sp. Isolated from Distal and Close Geographical Regions

PubMed Central

Venieraki, Anastasia; Dimou, Maria; Vezyri, Eleni; Vamvakas, Alexandros; Katinaki, Pagona-Artemis; Chatzipavlidis, Iordanis; Tampakaki, Anastasia; Katinakis, Panagiotis

2014-01-01

The presence of nitrogen fixers within the genus Pseudomonas has been established and so far most isolated strains are phylogenetically affiliated to Pseudomonas stutzeri. A gene ortholog neighborhood analysis of the nitrogen fixation island (NFI) in four diazotrophic P. stutzeri strains and Pseudomonas azotifigens revealed that all are flanked by genes coding for cobalamin synthase (cobS) and glutathione peroxidise (gshP). The putative NFIs lack all the features characterizing a mobilizable genomic island. Nevertheless, bioinformatic analysis P. stutzeri DSM 4166 NFI demonstrated the presence of short inverted and/or direct repeats within both flanking regions. The other P. stutzeri strains carry only one set of repeats. The genetic diversity of eleven diazotrophic Pseudomonas isolates was also investigated. Multilocus sequence typing grouped nine isolates along with P. stutzeri and two isolates are grouped in a separate clade. A Rep-PCR fingerprinting analysis grouped the eleven isolates into four distinct genotypes. We also provided evidence that the putative NFI in our diazotrophic Pseudomonas isolates is flanked by cobS and gshP genes. Furthermore, we demonstrated that the putative NFI of Pseudomonas sp. Gr65 is flanked by inverted repeats identical to those found in P. stutzeri DSM 4166 and while the other P. stutzeri isolates harbor the repeats located in the intergenic region between cobS and glutaredoxin genes as in the case of P. stutzeri A1501. Taken together these data suggest that all putative NFIs of diazotrophic Pseudomonas isolates are anchored in an intergenic region between cobS and gshP genes and their flanking regions are designated by distinct repeats patterns. Moreover, the presence of almost identical NFIs in diazotrophic Pseudomonas strains isolated from distal geographical locations around the world suggested that this horizontal gene transfer event may have taken place early in the evolution. PMID:25251496

The nitrogen-fixation island insertion site is conserved in diazotrophic Pseudomonas stutzeri and Pseudomonas sp. isolated from distal and close geographical regions.

PubMed

Venieraki, Anastasia; Dimou, Maria; Vezyri, Eleni; Vamvakas, Alexandros; Katinaki, Pagona-Artemis; Chatzipavlidis, Iordanis; Tampakaki, Anastasia; Katinakis, Panagiotis

2014-01-01

The presence of nitrogen fixers within the genus Pseudomonas has been established and so far most isolated strains are phylogenetically affiliated to Pseudomonas stutzeri. A gene ortholog neighborhood analysis of the nitrogen fixation island (NFI) in four diazotrophic P. stutzeri strains and Pseudomonas azotifigens revealed that all are flanked by genes coding for cobalamin synthase (cobS) and glutathione peroxidise (gshP). The putative NFIs lack all the features characterizing a mobilizable genomic island. Nevertheless, bioinformatic analysis P. stutzeri DSM 4166 NFI demonstrated the presence of short inverted and/or direct repeats within both flanking regions. The other P. stutzeri strains carry only one set of repeats. The genetic diversity of eleven diazotrophic Pseudomonas isolates was also investigated. Multilocus sequence typing grouped nine isolates along with P. stutzeri and two isolates are grouped in a separate clade. A Rep-PCR fingerprinting analysis grouped the eleven isolates into four distinct genotypes. We also provided evidence that the putative NFI in our diazotrophic Pseudomonas isolates is flanked by cobS and gshP genes. Furthermore, we demonstrated that the putative NFI of Pseudomonas sp. Gr65 is flanked by inverted repeats identical to those found in P. stutzeri DSM 4166 and while the other P. stutzeri isolates harbor the repeats located in the intergenic region between cobS and glutaredoxin genes as in the case of P. stutzeri A1501. Taken together these data suggest that all putative NFIs of diazotrophic Pseudomonas isolates are anchored in an intergenic region between cobS and gshP genes and their flanking regions are designated by distinct repeats patterns. Moreover, the presence of almost identical NFIs in diazotrophic Pseudomonas strains isolated from distal geographical locations around the world suggested that this horizontal gene transfer event may have taken place early in the evolution.

Distribution of Classical and Nonclassical Virulence Genes in Enterotoxigenic Escherichia coli Isolates from Chilean Children and tRNA Gene Screening for Putative Insertion Sites for Genomic Islands▿†

PubMed Central

Del Canto, Felipe; Valenzuela, Patricio; Cantero, Lidia; Bronstein, Jonathan; Blanco, Jesús E.; Blanco, Jorge; Prado, Valeria; Levine, Myron; Nataro, James; Sommerfelt, Halvor; Vidal, Roberto

2011-01-01

Enterotoxigenic Escherichia coli (ETEC) is an important cause of diarrhea. Three adhesins (Tia, TibA, EtpA), an iron acquisition system (Irp1, Irp2, and FyuA), a GTPase (LeoA), and an autotransporter (EatA) are ETEC virulence-related proteins that, in contrast to the classical virulence factors (enterotoxins and fimbrial colonization factors) have not heretofore been targets in characterizing isolates from epidemiological studies. Here, we determined the occurrence of these nonclassical virulence genes in 103 ETEC isolates from Chilean children with diarrhea and described their association with O serogroups and classical virulence determinants. Because tia, leoA, irp2, and fyuA are harbored by pathogenicity islands inserted into the selC and asnT tRNA genes (tDNAs), we analyzed the regions flanking these loci. Ten additional tDNAs were also screened to identify hot spots for genetic insertions. Associations between the most frequent serogroups and classical colonization factor (CF)-toxin profiles included O6/LT-STh/CS1-CS3-CS21 (i.e., O6 serogroup, heat-labile [LT] and human heat-stable [STh] enterotoxins, and CFs CS1, -3 and -21), O6/LT-STh/CS2-CS3-CS21, and O104-O127/STh/CFAI-CS21. The eatA and etpA genes were detected in more than 70% of the collection, including diverse serogroups and virulence profiles. Sixteen percent of the ETEC strains were negative for classical and nonclassical adhesins, suggesting the presence of unknown determinants of adhesion. The leuX, thrW, and asnT tDNAs were disrupted in more than 65% of strains, suggesting they are hot spots for the insertion of mobile elements. Sequences similar to integrase genes were identified next to the thrW, asnT, pheV, and selC tDNAs. We propose that the eatA and etpA genes should be included in characterizations of ETEC isolates in future epidemiological studies to determine their prevalence in other geographical regions. Sequencing of tDNA-associated genetic insertions might identify new ETEC virulence determinants. PMID:21775541

Stx1 prophage excision in Escherichia coli strain PA20 confers strong curli and biofilm formation by restoring native mlrA

USDA-ARS?s Scientific Manuscript database

Prophage insertions in Escherichia coli O157:H7 mlrA contribute to the low expression of curli fimbriae and biofilm observed in many clinical isolates. Varying levels of CsgD-dependent curli/biofilm expression are restored to strains bearing prophage insertions in mlrA by mutation of regulatory gene...

Isolation and molecular characterization of a urease-negative Actinobacillus pleuropneumoniae mutant.

PubMed

Ito, Hiroya; Takahashi, Sayaka; Asai, Tetsuo; Tamura, Yutaka; Yamamoto, Koshi

2018-01-01

An atypical urease-negative mutant of Actinobacillus pleuropneumoniae serovar 2 was isolated in Japan. Nucleotide sequence analysis of the urease gene cluster revealed that the insertion of a short DNA sequence into the cbiM gene was responsible for the urease-negative activity of the mutant. Veterinary diagnostic laboratories should be watchful for the presence of aberrant urease-negative A. pleuropneumoniae isolates.

Comparative Genomics of the Listeria monocytogenes ST204 Subgroup

PubMed Central

Fox, Edward M.; Allnutt, Theodore; Bradbury, Mark I.; Fanning, Séamus; Chandry, P. Scott

2016-01-01

The ST204 subgroup of Listeria monocytogenes is among the most frequently isolated in Australia from a range of environmental niches. In this study we provide a comparative genomics analysis of food and food environment isolates from geographically diverse sources. Analysis of the ST204 genomes showed a highly conserved core genome with the majority of variation seen in mobile genetic elements such as plasmids, transposons and phage insertions. Most strains (13/15) harbored plasmids, which although varying in size contained highly conserved sequences. Interestingly 4 isolates contained a conserved plasmid of 91,396 bp. The strains examined were isolated over a period of 12 years and from different geographic locations suggesting plasmids are an important component of the genetic repertoire of this subgroup and may provide a range of stress tolerance mechanisms. In addition to this 4 phage insertion sites and 2 transposons were identified among isolates, including a novel transposon. These genetic elements were highly conserved across isolates that harbored them, and also contained a range of genetic markers linked to stress tolerance and virulence. The maintenance of conserved mobile genetic elements in the ST204 population suggests these elements may contribute to the diverse range of niches colonized by ST204 isolates. Environmental stress selection may contribute to maintaining these genetic features, which in turn may be co-selecting for virulence markers relevant to clinical infection with ST204 isolates. PMID:28066377

Comparative Genomics of the Listeria monocytogenes ST204 Subgroup.

PubMed

Fox, Edward M; Allnutt, Theodore; Bradbury, Mark I; Fanning, Séamus; Chandry, P Scott

2016-01-01

The ST204 subgroup of Listeria monocytogenes is among the most frequently isolated in Australia from a range of environmental niches. In this study we provide a comparative genomics analysis of food and food environment isolates from geographically diverse sources. Analysis of the ST204 genomes showed a highly conserved core genome with the majority of variation seen in mobile genetic elements such as plasmids, transposons and phage insertions. Most strains (13/15) harbored plasmids, which although varying in size contained highly conserved sequences. Interestingly 4 isolates contained a conserved plasmid of 91,396 bp. The strains examined were isolated over a period of 12 years and from different geographic locations suggesting plasmids are an important component of the genetic repertoire of this subgroup and may provide a range of stress tolerance mechanisms. In addition to this 4 phage insertion sites and 2 transposons were identified among isolates, including a novel transposon. These genetic elements were highly conserved across isolates that harbored them, and also contained a range of genetic markers linked to stress tolerance and virulence. The maintenance of conserved mobile genetic elements in the ST204 population suggests these elements may contribute to the diverse range of niches colonized by ST204 isolates. Environmental stress selection may contribute to maintaining these genetic features, which in turn may be co-selecting for virulence markers relevant to clinical infection with ST204 isolates.

Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health

PubMed Central

Martin, William F.

2017-01-01

Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. PMID:28444372

W-band integrated circuit PIN switches

NASA Astrophysics Data System (ADS)

Tahim, R. S.; Pham, T.; Chang, K.

1986-12-01

Both single-pole single-throw (SPST) and single-pole double-throw (SPDT) PIN switches have been developed at W band using microstrip integrated circuits. In SPST configurations, these switches have less than 1 dB of insertion loss under forward-voltage conditions from 90 to 108 GHz. Isolation greater than 20 dB over 3 GHz and greater than 10 dB over 7 GHz has been achieved. In SPDT configurations, insertion loss of less than 2 dB and isolation of more than 15 dB over 10 GHz (90 to 110 GHz) have been achieved. Beam-lead PIN diodes were used. Major features included mechanical ruggedness, light weight, small size and low-cost manufacturing.

Distribution of Genes Encoding Putative Transmissibility Factors among Epidemic and Nonepidemic Strains of Burkholderia cepacia from Cystic Fibrosis Patients in the United Kingdom

PubMed Central

Clode, Fiona E.; Kaufmann, Mary E.; Malnick, Henry; Pitt, Tyrone L.

2000-01-01

In the last 15 years, Burkholderia cepacia has emerged as a significant pathogen in cystic fibrosis (CF) patients, mainly due to the severity of infection observed in a subset of patients and the fear of transmission of the organism to noncolonized patients. Although patients who deteriorate rapidly cannot be predicted by microbiological characteristics, three genetic markers have been described for strains that spread between patients. These are the cblA gene, encoding giant cable pili; a hybrid of two insertion sequences, IS1356 and IS402; and a 1.4-kb open reading frame known as the B. cepacia epidemic strain marker (BCESM). The latter two are of unknown function. An epidemic strain lineage was previously identified among CF patients in the United Kingdom that apparently had spread from North America and that was characterized by a specific random amplified polymorphic DNA (RAPD) pattern. We searched for the described genetic markers using specific PCR assays with 117 patient isolates of B. cepacia from 40 United Kingdom hospitals. Isolates were grouped according to genomovar and epidemic strain lineage RAPD pattern with a 10-base primer, P272. A total of 41 isolates from patients in 12 hospitals were classified as the epidemic strain, and 40 of these were distributed in genomovars IIIa (11 isolates), IIIb (1 isolate), and IIIc (28 isolates). All isolates of the epidemic strain were positive for the cblA gene and BCESM, but two lacked the insertion sequence hybrid. None of the 76 sporadic isolates contained cblA or the insertion sequence hybrid, but 11 of them were positive for BCESM. Nonepidemic isolates were distributed among genomovars I or IV (9), II (49), IIIa (11), IIIb (3), and IIIc (4). There were three clusters of cross-infection (one involving two patients and two involving three patients) with isolates of genomovar II. We conclude that in the United Kingdom, a single clonal lineage has spread between and within some hospitals providing care for CF patients. The presence of the cblA gene is the most specific marker for the epidemic strain. We recommend that all isolates of B. cepacia from CF patients should be screened by PCR to influence segregation and infection control strategies. PMID:10790095

Dissemination of CTX-M-15 β-Lactamase Genes Carried on Inc FI and FII Plasmids among Clinical Isolates of Escherichia coli in a University Hospital in Istanbul, Turkey▿

PubMed Central

Gonullu, Nevriye; Aktas, Zerrin; Kayacan, Cigdem Bal; Salcioglu, Melek; Carattoli, Alessandra; Yong, Dong Eun; Walsh, Timothy R.

2008-01-01

The CTX-M-1 group was found in 86.8% of the Escherichia coli isolates from Istanbul. A subset study revealed all isolates carrying blaCTX-M-15 genes flanked by the insertion element ISEcp1. Plasmid typing of transconjugates carrying blaCTX-M-15 showed that most isolates belonged to the Inc/rep FII group but that one isolate also belonged to the FI group. PMID:18184851

Evolution and genome specialization of Brucella suis biovar 2 Iberian lineages.

PubMed

Ferreira, Ana Cristina; Tenreiro, Rogério; de Sá, Maria Inácia Corrêa; Dias, Ricardo

2017-09-12

Swine brucellosis caused by B. suis biovar 2 is an emergent disease in domestic pigs in Europe. The emergence of this pathogen has been linked to the increase of extensive pig farms and the high density of infected wild boars (Sus scrofa). In Portugal and Spain, the majority of strains share specific molecular characteristics, which allowed establishing an Iberian clonal lineage. However, several strains isolated from wild boars in the North-East region of Spain are similar to strains isolated in different Central European countries. Comparative analysis of five newly fully sequenced B. suis biovar 2 strains belonging to the main circulating clones in Iberian Peninsula, with publicly available Brucella spp. genomes, revealed that strains from Iberian clonal lineage share 74% similarity with those reference genomes. Besides the 210 kb translocation event present in all biovar 2 strains, an inversion with 944 kb was presented in chromosome I of strains from the Iberian clone. At left and right crossover points, the inversion disrupted a TRAP dicarboxylate transporter, DctM subunit, and an integral membrane protein TerC. The gene dctM is well conserved in Brucella spp. except in strains from the Iberian clonal lineage. Intraspecies comparative analysis also exposed a number of biovar-, haplotype- and strain-specific insertion-deletion (INDELs) events and single nucleotide polymorphisms (SNPs) that could explain differences in virulence and host specificities. Most discriminative mutations were associated to membrane related molecules (29%) and enzymes involved in catabolism processes (20%). Molecular identification of both B. suis biovar 2 clonal lineages could be easily achieved using the target-PCR procedures established in this work for the evaluated INDELs. Whole-genome analyses supports that the B. suis biovar 2 Iberian clonal lineage evolved from the Central-European lineage and suggests that the genomic specialization of this pathogen in the Iberian Peninsula is independent of a specific genomic event(s), but instead driven by allopatric speciation, resulting in the establishment of a new ecovar.

Comparative genotyping of Clostridium thermocellum strains isolated from biogas plants: genetic markers and characterization of cellulolytic potential.

PubMed

Koeck, Daniela E; Zverlov, Vladimir V; Liebl, Wolfgang; Schwarz, Wolfgang H

2014-07-01

Clostridium thermocellum is among the most prevalent of known anaerobic cellulolytic bacteria. In this study, genetic and phenotypic variations among C. thermocellum strains isolated from different biogas plants were determined and different genotyping methods were evaluated on these isolates. At least two C. thermocellum strains were isolated independently from each of nine different biogas plants via enrichment on cellulose. Various DNA-based genotyping methods such as ribotyping, RAPD (Random Amplified Polymorphic DNA) and VNTR (Variable Number of Tandem Repeats) were applied to these isolates. One novel approach - the amplification of unknown target sequences between copies of a previously discovered Random Inserted Mobile Element (RIME) - was also tested. The genotyping method with the highest discriminatory power was found to be the amplification of the sequences between the insertion elements, where isolates from each biogas plant yielded a different band pattern. Cellulolytic potentials, optimal growth conditions and substrate spectra of all isolates were characterized to help identify phenotypic variations. Irrespective of the genotyping method used, the isolates from each individual biogas plant always exhibited identical patterns. This is suggestive of a single C. thermocellum strain exhibiting dominance in each biogas plant. The genotypic groups reflect the results of the physiological characterization of the isolates like substrate diversity and cellulase activity. Conversely, strains isolated across a range of biogas plants differed in their genotyping results and physiological properties. Both strains isolated from one biogas plant had the best specific cellulose-degrading properties and might therefore achieve superior substrate utilization yields in biogas fermenters. Copyright © 2014 Elsevier GmbH. All rights reserved.

Ultrasonic airborne insertion loss measurements at normal incidence (L).

PubMed

Farley, Jayrin; Anderson, Brian E

2010-12-01

Transmission loss and insertion loss measurements of building materials at audible frequencies are commonly made using plane wave tubes or as a panel between reverberant rooms. These measurements provide information for noise isolation control in architectural acoustics and in product development. Airborne ultrasonic sound transmission through common building materials has not been fully explored. Technologies and products that utilize ultrasonic frequencies are becoming increasingly more common, hence the need to conduct such measurements. This letter presents preliminary measurements of the ultrasonic insertion loss levels for common building materials over a frequency range of 28-90 kHz using continuous-wave excitation.

Identification by Subtractive Hybridization of a Novel Insertion Sequence Specific for Virulent Strains of Porphyromonas gingivalis

PubMed Central

Sawada, Koichi; Kokeguchi, Susumu; Hongyo, Hiroshi; Sawada, Satoko; Miyamoto, Manabu; Maeda, Hiroshi; Nishimura, Fusanori; Takashiba, Shogo; Murayama, Yoji

1999-01-01

Subtractive hybridization was employed to isolate specific genes from virulent Porphyromonas gingivalis strains that are possibly related to abscess formation. The genomic DNA from the virulent strain P. gingivalis W83 was subtracted with DNA from the avirulent strain ATCC 33277. Three clones unique to strain W83 were isolated and sequenced. The cloned DNA fragments were 885, 369, and 132 bp and had slight homology with only Bacillus stearothermophilus IS5377, which is a putative transposase. The regions flanking the cloned DNA fragments were isolated and sequenced, and the gene structure around the clones was revealed. These three clones were located side-by-side in a gene reported as an outer membrane protein. The three clones interrupt the open reading frame of the outer membrane protein gene. This inserted DNA, consisting of three isolated clones, was designated IS1598, which was 1,396 bp (i.e., a 1,158-bp open reading frame) in length and was flanked by 16-bp terminal inverted repeats and a 9-bp duplicated target sequence. IS1598 was detected in P. gingivalis W83, W50, and FDC 381 by Southern hybridization. All three P. gingivalis strains have been shown to possess abscess-forming ability in animal models. However, IS1598 was not detected in avirulent strains of P. gingivalis, including ATCC 33277. The IS1598 may interrupt the synthesis of the outer membrane protein, resulting in changes in the structure of the bacterial outer membrane. The IS1598 isolated in this study is a novel insertion element which might be a specific marker for virulent P. gingivalis strains. PMID:10531208

Demonstration of Efficient Nonreciprocity in a Microwave Optomechanical Circuit*

NASA Astrophysics Data System (ADS)

Peterson, G. A.; Lecocq, F.; Cicak, K.; Simmonds, R. W.; Aumentado, J.; Teufel, J. D.

2017-07-01

The ability to engineer nonreciprocal interactions is an essential tool in modern communication technology as well as a powerful resource for building quantum networks. Aside from large reverse isolation, a nonreciprocal device suitable for applications must also have high efficiency (low insertion loss) and low output noise. Recent theoretical and experimental studies have shown that nonreciprocal behavior can be achieved in optomechanical systems, but performance in these last two attributes has been limited. Here, we demonstrate an efficient, frequency-converting microwave isolator based on the optomechanical interactions between electromagnetic fields and a mechanically compliant vacuum-gap capacitor. We achieve simultaneous reverse isolation of more than 20 dB and insertion loss less than 1.5 dB. We characterize the nonreciprocal noise performance of the device, observing that the residual thermal noise from the mechanical environments is routed solely to the input of the isolator. Our measurements show quantitative agreement with a general coupled-mode theory. Unlike conventional isolators and circulators, these compact nonreciprocal devices do not require a static magnetic field, and they allow for dynamic control of the direction of isolation. With these advantages, similar devices could enable programmable, high-efficiency connections between disparate nodes of quantum networks, even efficiently bridging the microwave and optical domains.

Enhanced production of recombinant proteins with Corynebacterium glutamicum by deletion of insertion sequences (IS elements).

PubMed

Choi, Jae Woong; Yim, Sung Sun; Kim, Min Jeong; Jeong, Ki Jun

2015-12-29

In most bacteria, various jumping genetic elements including insertion sequences elements (IS elements) cause a variety of genetic rearrangements resulting in harmful effects such as genome and recombinant plasmid instability. The genetic stability of a plasmid in a host is critical for high-level production of recombinant proteins, and in this regard, the development of an IS element-free strain could be a useful strategy for the enhanced production of recombinant proteins. Corynebacterium glutamicum, which is a workhorse in the industrial-scale production of various biomolecules including recombinant proteins, also has several IS elements, and it is necessary to identify the critical IS elements and to develop IS element deleted strain. From the cultivation of C. glutamicum harboring a plasmid for green fluorescent protein (GFP) gene expression, non-fluorescent clones were isolated by FACS (fluorescent activated cell sorting). All the isolated clones had insertions of IS elements in the GFP coding region, and two major IS elements (ISCg1 and ISCg2 families) were identified. By co-cultivating cells harboring either the isolated IS element-inserted plasmid or intact plasmid, it was clearly confirmed that cells harboring the IS element-inserted plasmids became dominant during the cultivation due to their growth advantage over cells containing intact plasmids, which can cause a significant reduction in recombinant protein production during cultivation. To minimize the harmful effects of IS elements on the expression of heterologous genes in C. glutamicum, two IS element free C. glutamicum strains were developed in which each major IS element was deleted, and enhanced productivity in the engineered C. glutamicum strain was successfully demonstrated with three models: GFP, poly(3-hydroxybutyrate) [P(3HB)] and γ-aminobutyrate (GABA). Our findings clearly indicate that the hopping of IS elements could be detrimental to the production of recombinant proteins in C. glutamicum, emphasizing the importance of developing IS element free host strains.

A major insertion accounts for a significant proportion of mutations underlying human lipoprotein lipase deficiency

DOE Office of Scientific and Technical Information (OSTI.GOV)

Langlois, S.; Kastelein, J.J.; Hayden, M.R.

1989-02-01

Lipoprotein lipase is an important enzyme involved in triacylglycerol metabolism. Primary LPL deficiency is a genetic disorder that is usually manifested by a severe elevation in triacylglycerol levels. The authors have used a recently isolated LPL cDNA clone to study 15 probands from 11 families with this inherited disorder. Surprisingly, 7 of the probands from 4 families, of different ancestries, had a similar insertion in their LPL gene. In contrast to other human genetic disorders, where insertions are rare causes of mutation, this insertion accounts for a significant proportion of the alleles causing LPL deficiency. Detailed restriction mapping of themore » insertion revealed that it was unlikely to be a duplication of neighboring DNA and that it was not similar to the consensus sequence of human L1 repetitive elements. This suggests that there must be other mechanisms of insertional mutagenesis in human genetic disease besides transposition of mobile L1 repetitive elements.« less

Isolation and characterization of microsatellite markers in Fraser fir (Abies fraseri)

Treesearch

S.A. Josserand; K.M. Potter; G. Johnson; J.A. Bowen; J. Frampton; C.D. Nelson

2006-01-01

We describe the isolation and characterization of 14 microsatellite loci from Fraser fir (Abies fraseri). These markers originated from cloned inserts enriched for DNA sequences containing tandem di- and tri-nucleotide repeats. In total, 36 clones were selected, sequenced and evaluated. Polymerase chain reaction (PCR) primers for 14 of these...

Pleural drainage and its role in management of the isolated penetrating chest injuries during the war time in Sarajevo, 1992.-1995.

PubMed

Hadzismajlović, Ademir; Pilav, Alen

2007-05-01

Penetrating chest injuries are the most frequent causes of serious demage and death in wounded indivisuals. In reports from the last wars where wounds caused by high velocity projectiles predominated, thoracotomies were perfomed in about 15% of the wounded individuals, mostly encompassing injuries of the heart and great vessels, accomanied by massive bleeding that could not be resolved by chest tube insertion. This retrospective analysis was performed on the medical records of 477 patients tretaed for isolated penetrating chest injuries in Department of Thoracic Surgery Clinical Center of the University in Sarajevo between april 1992 - june 1995. We analised the ways of their menagement with special view on pleural drainage, indication for this method and results of treatment. 398 (83,4%) wounded individuals have been treated with pleural tube inserting as definitive mesaure and for the urgent thoracotomy there were 79 (16,6%) patients left. Average hospital treatment in wounded drained patients was 7,68 days. With shrapnels there were 357 (74,84%) wounded individuals, and with bullet 120 (25,16%) wounded individuals. The complications of plaural tube inserting were - empyema in 34 (7,13%) patients and there were no other complications. Chest tube inserting as definitive mesaure was used in 398 (83,44%) patients. Chest tube inserting as preoperative measure (urgent thoracotomy) was used in 79 (16,56%) patients. There were 460 (96,44%) healed patients. Death occurred in 17 (3,56%) patients.

Stability, frequency and multiplicity of transposon insertions in the pyoverdine region in the chromosomes of different fluorescent pseudomonads.

PubMed

Cornelis, P; Anjaiah, V; Koedam, N; Delfosse, P; Jacques, P; Thonart, P; Neirinckx, L

1992-07-01

Tn5 mutagenesis of different fluorescent pseudomonads was achieved by conjugational transfer of the suicide vector pSUP 10141. Pyoverdine negative (Pvd-) mutants were detected by the absence of fluorescence on King's B medium and by their inability to grow in the presence of the iron chelator EDDHA [ethylenediamine di(o-hydroxyphenylacetic acid)]. In P. fluorescens ATCC 17400 and three rhizosphere isolates (one P. putida and two P. fluorescens), the percentage of Pvd- mutants ranged between 0 and 0.54%. In a P. chlororaphis rhizosphere isolate, this percentage was higher (4%). In these mutants both of the Tn5 antibiotic resistances (Km and Tc) were stable and the transposon could be detected by hybridization. In Pvd- mutants of P. fluorescens ATCC 17400, the transposon was found to be inserted twice in the chromosome while single insertions were detected in the DNA of other, randomly tested mutants. In P. aeruginosa PAO1, where 13.1% of the mutants were Pvd-, both antibiotic resistances were rapidly lost and accordingly no transposon insertion could be detected by hybridization. However, the Pvd- phenotype was generally stable in these mutants. The plasmid pNK862 containing a mini-Tn10 transposon was introduced by electroporation into P. aeruginosa PAO1 and Kmr mutants were recovered, 89% of which were Pvd- and confirmed to be P. aeruginosa by PCR amplification of the P. aeruginosa lipoprotein gene. The mini-Tn10 insertions were also found to be unstable in PAO1.

The Hairless Stem Phenotype of Cotton (Gossypium barbadense) Is Linked to a Copia-Like Retrotransposon Insertion in a Homeodomain-Leucine Zipper Gene (HD1)

PubMed Central

Ding, Mingquan; Ye, Wuwei; Lin, Lifeng; He, Shae; Du, Xiongming; Chen, Aiqun; Cao, Yuefen; Qin, Yuan; Yang, Fen; Jiang, Yurong; Zhang, Hua; Wang, Xiyin; Paterson, Andrew H.; Rong, Junkang

2015-01-01

Cotton (Gossypium) stem trichomes are mostly single cells that arise from stem epidermal cells. In this study, a homeodomain-leucine zipper gene (HD1) was found to cosegregate with the dominant trichome locus previously designated as T1 and mapped to chromosome 6. Characterization of HD1 orthologs revealed that the absence of stem trichomes in modern Gossypium barbadense varieties is linked to a large retrotransposon insertion in the ninth exon, 2565 bp downstream from the initial codon in the At subgenome HD1 gene (At-GbHD1). In both the At and Dt subgenomes, reduced transcription of GbHD1 genes is caused by this insertion. The disruption of At-HD1 further affects the expression of downstream GbMYB25 and GbHOX3 genes. Analyses of primitive cultivated accessions identified another retrotransposon insertion event in the sixth exon of At-GbHD1 that might predate the previously identified retrotransposon in modern varieties. Although both retrotransposon insertions results in similar phenotypic changes, the timing of these two retrotransposon insertion events fits well with our current understanding of the history of cotton speciation and dispersal. Taken together, the results of genetics mapping, gene expression and association analyses suggest that GbHD1 is an important component that controls stem trichome development and is a promising candidate gene for the T1 locus. The interspecific phenotypic difference in stem trichome traits also may be attributable to HD1 inactivation associated with retrotransposon insertion. PMID:26133897

Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health.

PubMed

Hazkani-Covo, Einat; Martin, William F

2017-05-01

Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

CHARACTERIZATION AND NUCLEOTIDE SEQUENCE DETERMINATION OF A REPEAT ELEMENT ISOLATED FROM A 2,4,5,-T DEGRADING STRAIN OF PSEUDOMONAS CEPACIA

EPA Science Inventory

Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...

Reversible insertion of carbon dioxide into Pt(II)-hydroxo bonds.

PubMed

Lohr, Tracy L; Piers, Warren E; Parvez, Masood

2013-10-01

The reactivity of three monomeric diimine Pt(II) hydroxo complexes, (NN)Pt(OH)R (NN = bulky diimine ligand; R = OH, ; R = C6H5, ; R = CH3, ) towards carbon dioxide has been investigated. Insertion into the Pt-OH bonds was found to be facile and reversible at low temperature for all compounds; the reaction with bis-hydroxide gives an isolable κ(2)-carbonato compound , with elimination of water.

A multicenter comparison of intraaortic balloon pump utilization in isolated coronary artery bypass graft surgery.

PubMed

Baskett, Roger J F; O'Connor, Gerald T; Hirsch, Gregory M; Ghali, William A; Sabadosa, Kathy; Morton, Jeremy R; Ross, Cathy S; Hernandez, Felix; Nugent, William C; Lahey, Stephen J; Sisto, Donato A; Dacey, Lawrence J; Klemperer, John D; Helm, Robert E; Maitland, Andrew

2003-12-01

Single-center studies suggest substantial variation in intraaortic balloon pump (IABP) utilization. Our purpose is to examine IABP utilization over time and across medical centers. This was a prospective cohort of 29,961 consecutive patients undergoing isolated coronary artery bypass graft surgery, between 1995 and 2000, at 10 centers (eight in northern New England and two in Canada). A total of 2,678 (8.9%) patients received an IABP. The rate of preoperative IABP insertion was 6.3%, and that of intra- or postoperative insertion was 2.6%. During the 6 years, IABP use increased from 7.0% to 10.3% (p(trend) <0.001). Preoperative IABP insertion increased from 5.4% to 7.8% (p(trend) < 0.001). There was no significant increase in intra-/postoperative IABP insertion 1.7% to 3.4% (p(trend) = 0.34). Adjustment for changes in patient and disease characteristics did not substantially alter these results. The rate of IABP use varied substantially by center, from 5.9% to 16.4% (p < 0.001). Adjustment for patient and disease characteristics resulted in variation from 4.8% to 12.8% across the 10 centers (p < 0.001). The adjusted rates of preoperative IABP insertion varied from 3.6% to 13.7% (p < 0.001), and the rates of intra-/postoperative IABP insertion ranged from 1.0% to 5.2% (p < 0.001). There was no significant correlation between the rates of preoperative and intra-/postoperative IABP use (r(s) = 0.085, p = 0.815). During the 6 years, there was a 47% increase in the rate of IABP utilization. Even after adjustment, there was almost threefold variation in IABP use across centers. This variation likely reflects lack of consensus on the appropriate use of the IABP in CABG patients.

Molecular and FISH analyses of a 53-kbp intact DNA fragment inserted by biolistics in wheat (Triticum aestivum L.) genome.

PubMed

Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P

2017-10-01

A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.

Human Transposon Tectonics

PubMed Central

Burns, Kathleen H.; Boeke, Jef D.

2012-01-01

Mobile DNAs have had a central role in shaping our genome. More than half of our DNA is comprised of interspersed repeats resulting from replicative copy and paste events of retrotransposons. Although most are fixed, incapable of templating new copies, there are important exceptions to retrotransposon quiescence. De novo insertions cause genetic diseases and cancers, though reliably detecting these occurrences has been difficult. New technologies aimed at uncovering polymorphic insertions reveal that mobile DNAs provide a substantial and dynamic source of structural variation. Key questions going forward include the how and how much new transposition events affect human health and disease. PMID:22579280

Spliceosomal Intron Insertions in Genome Compacted Ray-Finned Fishes as Evident from Phylogeny of MC Receptors, Also Supported by a Few Other GPCRs

PubMed Central

Sinha, Rahul; Goyal, Pankaj; Grapputo, Alessandro

2011-01-01

Background Insertions of spliceosomal introns are very rare events during evolution of vertebrates and the mechanisms governing creation of novel intron(s) remain obscure. Largely, gene structures of melanocortin (MC) receptors are characterized by intron-less architecture. However, recently a few exceptions have been reported in some fishes. This warrants a systematic survey of MC receptors for understanding intron insertion events during vertebrate evolution. Methodology/Principal Findings We have compiled an extended list of MC receptors from different vertebrate genomes with variations in fishes. Notably, the closely linked MC2Rs and MC5Rs from a group of ray-finned fishes have three and one intron insertion(s), respectively, with conserved positions and intron phase. In both genes, one novel insertion was in the highly conserved DRY motif at the end of helix TM3. Further, the proto-splice site MAG↑R is maintained at intron insertion sites in these two genes. However, the orthologs of these receptors from zebrafish and tetrapods are intron-less, suggesting these introns are simultaneously created in selected fishes. Surprisingly, these novel introns are traceable only in four fish genomes. We found that these fish genomes are severely compacted after the separation from zebrafish. Furthermore, we also report novel intron insertions in P2Y receptors and in CHRM3. Finally, we report ultrasmall introns in MC2R genes from selected fishes. Conclusions/Significance The current repository of MC receptors illustrates that fishes have no MC3R ortholog. MC2R, MC5R, P2Y receptors and CHRM3 have novel intron insertions only in ray-finned fishes that underwent genome compaction. These receptors share one intron at an identical position suggestive of being inserted contemporaneously. In addition to repetitive elements, genome compaction is now believed to be a new hallmark that promotes intron insertions, as it requires rapid DNA breakage and subsequent repair processes to gain back normal functionality. PMID:21850219

Pneumothorax complicating isolated clavicle fracture

PubMed Central

Hani, Redouane; Ennaciri, Badr; Jeddi, Idriss; El Bardouni, Ahmed; Mahfoud, Mustapha; Berrada, Mohamed Saleh

2015-01-01

Isolated clavicle fractures are among the commonest of traumatic fractures in the emergency department. Complications of isolated clavicle fractures are rare. Pneumothorax has been described as a complication of a fractured clavicle only rarely in English literature. In all the reported cases, the pneumothorax was treated by a thoracostomy and the clavicle fracture was treated conservatively. In our case, the pneumothorax required a chest drain insertion and the clavicle fracture was treated surgically with good result. PMID:26421097

Pneumothorax complicating isolated clavicle fracture.

PubMed

Hani, Redouane; Ennaciri, Badr; Jeddi, Idriss; El Bardouni, Ahmed; Mahfoud, Mustapha; Berrada, Mohamed Saleh

2015-01-01

Isolated clavicle fractures are among the commonest of traumatic fractures in the emergency department. Complications of isolated clavicle fractures are rare. Pneumothorax has been described as a complication of a fractured clavicle only rarely in English literature. In all the reported cases, the pneumothorax was treated by a thoracostomy and the clavicle fracture was treated conservatively. In our case, the pneumothorax required a chest drain insertion and the clavicle fracture was treated surgically with good result.

Genome Sequence Analysis of New Isolates of the Winona Strain of Plum pox virus and the First Definitive Evidence of Intrastrain Recombination Events.

PubMed

James, Delano; Sanderson, Dan; Varga, Aniko; Sheveleva, Anna; Chirkov, Sergei

2016-04-01

Plum pox virus (PPV) is genetically diverse with nine different strains identified. Mutations, indel events, and interstrain recombination events are known to contribute to the genetic diversity of PPV. This is the first report of intrastrain recombination events that contribute to PPV's genetic diversity. Fourteen isolates of the PPV strain Winona (W) were analyzed including nine new strain W isolates sequenced completely in this study. Isolates of other strains of PPV with more than one isolate with the complete genome sequence available in GenBank were included also in this study for comparison and analysis. Five intrastrain recombination events were detected among the PPV W isolates, one among PPV C strain isolates, and one among PPV M strain isolates. Four (29%) of the PPV W isolates analyzed are recombinants; one of which (P2-1) is a mosaic, with three recombination events identified. A new interstrain recombinant event was identified between a strain M isolate and a strain Rec isolate, a known recombinant. In silico recombination studies and pairwise distance analyses of PPV strain D isolates indicate that a threshold of genetic diversity exists for the detectability of recombination events, in the range of approximately 0.78×10(-2) to 1.33×10(-2) mean pairwise distance. RDP4 analyses indicate that in the case of PPV Rec isolates there may be a recombinant breakpoint distinct from the obvious transition point of strain sequences. Evidence was obtained that indicates that the frequency of PPV recombination is underestimated, which may be true for other RNA viruses where low genetic diversity exists.

The Genetic Analysis of an Acinetobacter johnsonii Clinical Strain Evidenced the Presence of Horizontal Genetic Transfer.

PubMed

Montaña, Sabrina; Schramm, Sareda T J; Traglia, German Matías; Chiem, Kevin; Parmeciano Di Noto, Gisela; Almuzara, Marisa; Barberis, Claudia; Vay, Carlos; Quiroga, Cecilia; Tolmasky, Marcelo E; Iriarte, Andrés; Ramírez, María Soledad

2016-01-01

Acinetobacter johnsonii rarely causes human infections. While most A. johnsonii isolates are susceptible to virtually all antibiotics, strains harboring a variety of β-lactamases have recently been described. An A. johnsonii Aj2199 clinical strain recovered from a hospital in Buenos Aires produces PER-2 and OXA-58. We decided to delve into its genome by obtaining the whole genome sequence of the Aj2199 strain. Genome comparison studies on Aj2199 revealed 240 unique genes and a close relation to strain WJ10621, isolated from the urine of a patient in China. Genomic analysis showed evidence of horizontal genetic transfer (HGT) events. Forty-five insertion sequences and two intact prophages were found in addition to several resistance determinants such as blaPER-2, blaOXA-58, blaTEM-1, strA, strB, ereA, sul1, aacC2 and a new variant of blaOXA-211, called blaOXA-498. In particular, blaPER-2 and blaTEM-1 are present within the typical contexts previously described in the Enterobacteriaceae family. These results suggest that A. johnsonii actively acquires exogenous DNA from other bacterial species and concomitantly becomes a reservoir of resistance genes.

Overproduction of active efflux pump and variations of OprD dominate in imipenem-resistant Pseudomonas aeruginosa isolated from patients with bloodstream infections in Taiwan.

PubMed

Kao, Cheng-Yen; Chen, Shu-Sheng; Hung, Kuei-Hsiang; Wu, Hsiu-Mei; Hsueh, Po-Ren; Yan, Jing-Jou; Wu, Jiunn-Jong

2016-06-13

The emergence of imipenem-resistant Pseudomonas aeruginosa (IRPA) has become a great concern worldwide. The aim of this study was to investigate resistance mechanisms associated with bloodstream isolated IRPA strains in Taiwan. A total of 78 non-duplicated IRPA isolates were isolated from patients with bloodstream infection. The average prevalence of imipenem-resistance in those isolates was 5.9 % during a 10-year longitudinal surveillance in Taiwan. PFGE results showed high clonal diversity among the 78 isolates. VIM-2, VIM-3, OXA-10, and OXA-17 β-lactamases were identified in 2 (2.6 %), 3 (3.8 %), 2 (2.6 %), and 1 (1.3 %) isolates, respectively. Active efflux pumps, AmpC β-lactamase overproduction, and extended-spectrum AmpC cephalosporinases (ESACs) were found in 58 (74.4 %), 25 (32.1 %) and 15 (19.2 %) of IRPA isolates, respectively. oprD mutations with amino acid substitution, shortened putative loop L7, premature stop codon caused by point mutation, frameshift by nucleotide insertion or deletion, and interruption by insertion sequence were found in 19 (24.4 %), 18 (23.1 %), 15 (19.2 %), 14 (17.9 %), and 10 (12.8 %) of isolates, respectively. This study suggests that alterations in the OprD protein and having an active efflux pump are the main mechanisms associated with bloodstream isolated IRPA. Overproduction of AmpC, ESACs, and the presence of VIM- and OXA-type β-lactamases play additional roles in reduced susceptibility to imipenem in P. aeruginosa isolates in Taiwan.

Optical isolators for 2-micron fibre lasers

NASA Astrophysics Data System (ADS)

Stevens, Gary; Legg, Thomas H.; Shardlow, Peter

2015-02-01

We report on the development and testing of optical isolators for use in 2-micron fiber laser systems. A variety of potential Faraday rotator materials were characterised to identify the most suitable materials for use in the 1700-2100nm wavelength range. Isolators based on the three best performing materials were then developed and packaged as fiber-in, fiber-out and fiber-in, beam-out devices. The isolators were then tested in CW, pulsed and ultrafast laser systems. The three different designs produced different performance characteristics, but all designs demonstrated isolation >25dB and insertion losses of <1.2 dB.

Molecular characteristics of Polish field strains of Marek's disease herpesvirus isolated from vaccinated chickens

PubMed Central

2011-01-01

Background Twenty-nine Marek's disease virus (MDV) strains were isolated during a 3 year period (2007-2010) from vaccinated and infected chicken flocks in Poland. These strains had caused severe clinical symptoms and lesions. In spite of proper vaccination with mono- or bivalent vaccines against Marek's disease (MD), the chickens developed symptoms of MD with paralysis. Because of this we decided to investigate possible changes and mutations in the field strains that could potentially increase their virulence. We supposed that such mutations may have been caused by recombination with retroviruses of poultry - especially reticuloendotheliosis virus (REV). Methods In order to detect the possible reasons of recent changes in virulence of MDV strains, polymerase chain reaction (PCR) analyses for meq oncogene and for long-terminal repeat (LTR) region of REV were conducted. The obtained PCR products were sequenced and compared with other MDV and REV strains isolated worldwide and accessible in the GeneBank database. Results Sequencing of the meq oncogene showed a 68 basepair insertion and frame shift within 12 of 24 field strains. Interestingly, the analyses also showed 0.78, 0.8, 0.82, 1.6 kb and other random LTR-REV insertions into the MDV genome in 28 of 29 of strains. These genetic inserts were present after passage in chicken embryo kidney cells suggesting LTR integration into a non-functional region of the MDV genome. Conclusion The results indicate the presence of a recombination between MDV and REV under field conditions in Polish chicken farms. The genetic changes within the MDV genome may influence the virus replication and its features in vivo. However, there is no evidence that meq alteration and REV insertions are related to the strains' virulence. PMID:21320336

Nephric duct insertion is a crucial step in urinary tract maturation that is regulated by a Gata3-Raldh2-Ret molecular network in mice.

PubMed

Chia, Ian; Grote, David; Marcotte, Michael; Batourina, Ekaterina; Mendelsohn, Cathy; Bouchard, Maxime

2011-05-01

Urinary tract development depends on a complex series of events in which the ureter moves from its initial branch point on the nephric duct (ND) to its final insertion site in the cloaca (the primitive bladder and urethra). Defects in this maturation process can result in malpositioned ureters and hydronephrosis, a common cause of renal disease in children. Here, we report that insertion of the ND into the cloaca is an unrecognized but crucial step that is required for proper positioning of the ureter and that depends on Ret signaling. Analysis of Ret mutant mice at birth reveals hydronephrosis and defective ureter maturation, abnormalities that our results suggest are caused, at least in part, by delayed insertion of the ND. We find a similar set of malformations in mutants lacking either Gata3 or Raldh2. We show that these factors act in parallel to regulate ND insertion via Ret. Morphological analysis of ND extension in wild-type embryos reveals elaborate cellular protrusions at ND tips that are not detected in Ret, Gata3 or Raldh2 mutant embryos, suggesting that these protrusions may normally be important for fusion with the cloaca. Together, our studies reveal a novel Ret-dependent event, ND insertion, that, when abnormal, can cause obstruction and hydronephrosis at birth; whether ND defects underlie similar types of urinary tract abnormalities in humans is an interesting possibility.

The effect of intermittent use of occlusal splint devices on sleep bruxism: a 4-week observation with a portable electromyographic recording device.

PubMed

Matsumoto, H; Tsukiyama, Y; Kuwatsuru, R; Koyano, K

2015-04-01

This randomised controlled study investigated the effect of intermittent use of occlusal splints on sleep bruxism compared with that of continuous use by measuring masseter muscle electromyographic activity using a portable electromyographic recording system. Twenty bruxers were randomly allocated to the continuous group and intermittent group. Subjects in the continuous group wore stabilisation splints during sleep for 29 nights continuously, whereas those in the intermittent group wore splints during sleep every other week, that is they used splints on the 1st-7th, 15th-21st and 29th nights. Electromyographic activity of the masseter muscle during sleep was recorded for the following six time points: before (baseline), immediately after, and 1, 2, 3 and 4 weeks after the insertion of a stabilisation splint. The number of nocturnal masseter electromyographic events, duration and the total activity of sleep bruxism were analysed. In the continuous group, nocturnal masseter electromyographic events were significantly reduced immediately and 1 week after the insertion of the stabilisation splint, and duration was reduced immediately after the insertion (P < 0·05, Dunnett's test), but no reduction was observed at 2, 3 and 4 weeks after insertion. In the intermittent group, nocturnal masseter electromyographic events and duration were significantly reduced immediately after and also 4 weeks after insertion of the stabilisation splint (P < 0·05, Dunnett's test). The obtained results of the present exploratory trial indicate that the intermittent use of stabilisation splints may reduce sleep bruxism activity for a longer period compared with that of continuous use. © 2014 John Wiley & Sons Ltd.

Whole-genome sequence of Escherichia coli serotype O157:H7 strain PA20

USDA-ARS?s Scientific Manuscript database

Escherichia coli serotype O157:H7 PA20 is a Pennsylvania Department of Health clinical isolate. It has been used to study biofilm formation in O157:H7 clinical isolates where the high incidence of prophage insertions in the mlrA transcription factor disrupts traditional csgD biofilm regulation. Here...

Transposition of the maize transposable element Ac in barley (Hordeum vulgare L.).

PubMed

Scholz, S; Lörz, H; Lütticke, S

2001-01-01

Transposition of the maize autonomous element Ac (Activator) was investigated in barley (Hordeum vulgare L.) with the aim of developing a transposon tagging system for the latter. The Ac element was introduced into meristematic tissue of barley by microprojectile bombardment. Transposon activity was then examined in the resulting transgenic plants. Multiple excision events were detected in leaf tissue of all plant lines. The mobile elements generated empty donor sites with small DNA sequence alterations, similar to those found in maize. Reintegration of Ac at independent genomic loci in somatic tissue was demonstrated by isolation of new element-flanking regions by AIMS-PCR (amplification of insertion-mutagenized sites). In addition, transmission of transposed Ac elements to progeny plants was confirmed. The results indicate that the introduced Ac element is able to transpose in barley. This is a first step towards the establishment of a transposon tagging system in this economically important crop.

Identification of genomic indels and structural variations using split reads

PubMed Central

2011-01-01

Background Recent studies have demonstrated the genetic significance of insertions, deletions, and other more complex structural variants (SVs) in the human population. With the development of the next-generation sequencing technologies, high-throughput surveys of SVs on the whole-genome level have become possible. Here we present split-read identification, calibrated (SRiC), a sequence-based method for SV detection. Results We start by mapping each read to the reference genome in standard fashion using gapped alignment. Then to identify SVs, we score each of the many initial mappings with an assessment strategy designed to take into account both sequencing and alignment errors (e.g. scoring more highly events gapped in the center of a read). All current SV calling methods have multilevel biases in their identifications due to both experimental and computational limitations (e.g. calling more deletions than insertions). A key aspect of our approach is that we calibrate all our calls against synthetic data sets generated from simulations of high-throughput sequencing (with realistic error models). This allows us to calculate sensitivity and the positive predictive value under different parameter-value scenarios and for different classes of events (e.g. long deletions vs. short insertions). We run our calculations on representative data from the 1000 Genomes Project. Coupling the observed numbers of events on chromosome 1 with the calibrations gleaned from the simulations (for different length events) allows us to construct a relatively unbiased estimate for the total number of SVs in the human genome across a wide range of length scales. We estimate in particular that an individual genome contains ~670,000 indels/SVs. Conclusions Compared with the existing read-depth and read-pair approaches for SV identification, our method can pinpoint the exact breakpoints of SV events, reveal the actual sequence content of insertions, and cover the whole size spectrum for deletions. Moreover, with the advent of the third-generation sequencing technologies that produce longer reads, we expect our method to be even more useful. PMID:21787423

Evaluation of PET Imaging Resolution Using 350 mu{m} Pixelated CZT as a VP-PET Insert Detector

NASA Astrophysics Data System (ADS)

Yin, Yongzhi; Chen, Ximeng; Li, Chongzheng; Wu, Heyu; Komarov, Sergey; Guo, Qingzhen; Krawczynski, Henric; Meng, Ling-Jian; Tai, Yuan-Chuan

2014-02-01

A cadmium-zinc-telluride (CZT) detector with 350 μm pitch pixels was studied in high-resolution positron emission tomography (PET) imaging applications. The PET imaging system was based on coincidence detection between a CZT detector and a lutetium oxyorthosilicate (LSO)-based Inveon PET detector in virtual-pinhole PET geometry. The LSO detector is a 20 ×20 array, with 1.6 mm pitches, and 10 mm thickness. The CZT detector uses ac 20 ×20 ×5 mm substrate, with 350 μm pitch pixelated anodes and a coplanar cathode. A NEMA NU4 Na-22 point source of 250 μm in diameter was imaged by this system. Experiments show that the image resolution of single-pixel photopeak events was 590 μm FWHM while the image resolution of double-pixel photopeak events was 640 μm FWHM. The inclusion of double-pixel full-energy events increased the sensitivity of the imaging system. To validate the imaging experiment, we conducted a Monte Carlo (MC) simulation for the same PET system in Geant4 Application for Emission Tomography. We defined LSO detectors as a scanner ring and 350 μm pixelated CZT detectors as an insert ring. GATE simulated coincidence data were sorted into an insert-scanner sinogram and reconstructed. The image resolution of MC-simulated data (which did not factor in positron range and acolinearity effect) was 460 μm at FWHM for single-pixel events. The image resolutions of experimental data, MC simulated data, and theoretical calculation are all close to 500 μm FWHM when the proposed 350 μm pixelated CZT detector is used as a PET insert. The interpolation algorithm for the charge sharing events was also investigated. The PET image that was reconstructed using the interpolation algorithm shows improved image resolution compared with the image resolution without interpolation algorithm.

Using whole genome sequencing to identify resistance determinants and predict antimicrobial resistance phenotypes for year 2015 invasive pneumococcal disease isolates recovered in the United States.

PubMed

Metcalf, B J; Chochua, S; Gertz, R E; Li, Z; Walker, H; Tran, T; Hawkins, P A; Glennen, A; Lynfield, R; Li, Y; McGee, L; Beall, B

2016-12-01

Our whole genome sequence (WGS) pipeline was assessed for accurate prediction of antimicrobial phenotypes. For 2316 invasive pneumococcal isolates recovered during 2015 we compared WGS pipeline data to broth dilution testing (BDT) for 18 antimicrobials. For 11 antimicrobials categorical discrepancies were assigned when WGS-predicted MICs and BDT MICs predicted different categorizations for susceptibility, intermediate resistance or resistance, ranging from 0.9% (tetracycline) to 2.9% (amoxicillin). For β-lactam antibiotics, the occurrence of at least four-fold differences in MIC ranged from 0.2% (meropenem) to 1.0% (penicillin), although phenotypic retesting resolved 25%-78% of these discrepancies. Non-susceptibility to penicillin, predicted by penicillin-binding protein types, was 2.7% (non-meningitis criteria) and 23.8% (meningitis criteria). Other common resistance determinants included mef (475 isolates), ermB (191 isolates), ermB + mef (48 isolates), tetM (261 isolates) and cat (51 isolates). Additional accessory resistance genes (tetS, tet32, aphA-3, sat4) were rarely detected (one to three isolates). Rare core genome mutations conferring erythromycin-resistance included a two-codon rplD insertion (rplD69-KG-70) and the 23S rRNA A2061G substitution (six isolates). Intermediate cotrimoxazole-resistance was associated with one or two codon insertions within folP (238 isolates) or the folA I100L substitution (38 isolates), whereas full cotrimoxazole-resistance was attributed to alterations in both genes (172 isolates). The two levofloxacin-resistant isolates contained parC and/or gyrA mutations. Of 11 remaining isolates with moderately elevated MICs to both ciprofloxacin and levofloxacin, seven contained parC or gyrA mutations. The two rifampin-resistant isolates contained rpoB mutations. WGS-based antimicrobial phenotype prediction was an informative alternative to BDT for invasive pneumococci. Published by Elsevier Ltd.

OXA-Carbapenemases Present in Clinical Acinetobacter baumannii-calcoaceticus Complex Isolates from Patients in Kurdistan Region, Iraq.

PubMed

Ganjo, Aryann R; Maghdid, Delshad M; Mansoor, Isam Y; Kok, Dik J; Severin, Juliette A; Verbrugh, Henri A; Kreft, Deborah; Fatah, M H; Alnakshabandi, A A; Dlnya, Asad; Hammerum, Anette M; Ng, Kim; Goessens, Wil

2016-12-01

In addition to intrinsic resistance in Acinetobacter baumannii, many different types of acquired resistance mechanisms have been reported, including the presence of VIM and IMP metallo β-lactamases and also of bla OXA-23-like and bla OXA-58-like enzymes. In the Kurdistan region of Iraq, the multiresistant A. baumannii-calcoaceticus complex is prevalent. We characterized the different mechanisms of resistance present in clinical isolates collected from different wards and different hospitals from the Kurdistan region. One hundred twenty clinical nonduplicate A. baumannii-calcoaceticus complex isolates were collected from four hospitals between January 2012 and October 2013. The identification of the isolates was confirmed by MALDI-TOF. The susceptibility to different antibiotics was determined by disk diffusion and analyzed in accordance to EUCAST guidelines. By PCR, the presence of bla OXA-51-like , bla OXA-23-like , bla OXA-24-like , and bla OXA-58-like genes was determined as well as the presence of the insertion element ISAba1. Clonal diversity was analyzed by pulsed-field gel electrophoresis (PFGE) using the restriction enzyme ApaI and, in addition, multilocus sequence typing (MLST) was performed on a selected subset of 15 isolates. All 120 A. baumannii isolates harbored bla OXA-51-like genes. One hundred one out of 110 (92%) imipenem (IMP)-resistant A. baumannii-calcoaceticus complex isolates additionally carried the bla OXA-23-like gene and four isolates (3%) were positive for bla OXA-24-like. All 101 bla OXA-23-like -positive isolates had the ISAba1 insertion sequence, 1,600 bp upstream of the bla OXA-23-like gene. The bla OXA-58-like gene was not detected in any of the 110 IMP-resistant strains. Eight different PFGE clusters were identified and distributed over the different hospitals. MLST analysis performed on a subset of 15 representative isolates revealed the presence of the international clone ST2 (Pasteur). Besides ST2 (Pasteur), also many other STs (Pasteur) were encountered such as ST136, ST94, ST623, ST792, and ST793, all carrying the bla OXA-23 gene. In clinical A. baumannii-calcoaceticus complex isolates from Kurdistan-Iraq, the bla OXA-23 gene in combination with the upstream ISAba1 insertion element is largely responsible for carbapenem resistance. Several small clusters of identical genotypes were found from patients admitted to the same ward and during overlapping time periods, suggesting transmission within the hospital. Identification of source(s) and limiting the transmission of these strains to patients needs to be prioritized.

A Naturally Occurring Recombinant Enterovirus Expresses a Torovirus Deubiquitinase.

PubMed

Shang, Pengcheng; Misra, Saurav; Hause, Ben; Fang, Ying

2017-07-15

Enteroviruses (EVs) are implicated in a wide range of diseases in humans and animals. In this study, a novel enterovirus (enterovirus species G [EVG]) (EVG 08/NC_USA/2015) was isolated from a diagnostic sample from a neonatal pig diarrhea case and identified by using metagenomics and complete genome sequencing. The viral genome shares 75.4% nucleotide identity with a prototypic EVG strain (PEV9 UKG/410/73). Remarkably, a 582-nucleotide insertion, flanked by 3C pro cleavage sites at the 5' and 3' ends, was found in the 2C/3A junction region of the viral genome. This insertion encodes a predicted protease with 54 to 68% amino acid identity to torovirus (ToV) papain-like protease (PLP) (ToV-PLP). Structural homology modeling predicts that this protease adopts a fold and a catalytic site characteristic of minimal PLP catalytic domains. This structure is similar to those of core catalytic domains of the foot-and-mouth disease virus leader protease and coronavirus PLPs, which act as deubiquitinating and deISGylating (interferon [IFN]-stimulated gene 15 [ISG15]-removing) enzymes on host cell substrates. Importantly, the recombinant ToV-PLP protein derived from this novel enterovirus also showed strong deubiquitination and deISGylation activities and demonstrated the ability to suppress IFN-β expression. Using reverse genetics, we generated a ToV-PLP knockout recombinant virus. Compared to the wild-type virus, the ToV-PLP knockout mutant virus showed impaired growth and induced higher expression levels of innate immune genes in infected cells. These results suggest that ToV-PLP functions as an innate immune antagonist; enterovirus G may therefore gain fitness through the acquisition of ToV-PLP from a recombination event. IMPORTANCE Enteroviruses comprise a highly diversified group of viruses. Genetic recombination has been considered a driving force for viral evolution; however, recombination between viruses from two different orders is a rare event. In this study, we identified a special case of cross-order recombination between enterovirus G (order Picornavirales ) and torovirus (order Nidovirales ). This naturally occurring recombination event may have broad implications for other picornaviral and/or nidoviral species. Importantly, we demonstrated that the exogenous ToV-PLP gene that was inserted into the EVG genome encodes a deubiquitinase/deISGylase and potentially suppresses host cellular innate immune responses. Our results provide insights into how a gain of function through genetic recombination, in particular cross-order recombination, may improve the ability of a virus to evade host immunity. Copyright © 2017 American Society for Microbiology.

A Naturally Occurring Recombinant Enterovirus Expresses a Torovirus Deubiquitinase

PubMed Central

Shang, Pengcheng; Misra, Saurav

2017-01-01

ABSTRACT Enteroviruses (EVs) are implicated in a wide range of diseases in humans and animals. In this study, a novel enterovirus (enterovirus species G [EVG]) (EVG 08/NC_USA/2015) was isolated from a diagnostic sample from a neonatal pig diarrhea case and identified by using metagenomics and complete genome sequencing. The viral genome shares 75.4% nucleotide identity with a prototypic EVG strain (PEV9 UKG/410/73). Remarkably, a 582-nucleotide insertion, flanked by 3Cpro cleavage sites at the 5′ and 3′ ends, was found in the 2C/3A junction region of the viral genome. This insertion encodes a predicted protease with 54 to 68% amino acid identity to torovirus (ToV) papain-like protease (PLP) (ToV-PLP). Structural homology modeling predicts that this protease adopts a fold and a catalytic site characteristic of minimal PLP catalytic domains. This structure is similar to those of core catalytic domains of the foot-and-mouth disease virus leader protease and coronavirus PLPs, which act as deubiquitinating and deISGylating (interferon [IFN]-stimulated gene 15 [ISG15]-removing) enzymes on host cell substrates. Importantly, the recombinant ToV-PLP protein derived from this novel enterovirus also showed strong deubiquitination and deISGylation activities and demonstrated the ability to suppress IFN-β expression. Using reverse genetics, we generated a ToV-PLP knockout recombinant virus. Compared to the wild-type virus, the ToV-PLP knockout mutant virus showed impaired growth and induced higher expression levels of innate immune genes in infected cells. These results suggest that ToV-PLP functions as an innate immune antagonist; enterovirus G may therefore gain fitness through the acquisition of ToV-PLP from a recombination event. IMPORTANCE Enteroviruses comprise a highly diversified group of viruses. Genetic recombination has been considered a driving force for viral evolution; however, recombination between viruses from two different orders is a rare event. In this study, we identified a special case of cross-order recombination between enterovirus G (order Picornavirales) and torovirus (order Nidovirales). This naturally occurring recombination event may have broad implications for other picornaviral and/or nidoviral species. Importantly, we demonstrated that the exogenous ToV-PLP gene that was inserted into the EVG genome encodes a deubiquitinase/deISGylase and potentially suppresses host cellular innate immune responses. Our results provide insights into how a gain of function through genetic recombination, in particular cross-order recombination, may improve the ability of a virus to evade host immunity. PMID:28490584

Genome-Wide Comparison of Magnaporthe Species Reveals a Host-Specific Pattern of Secretory Proteins and Transposable Elements

PubMed Central

Gowda, Malali

2016-01-01

Blast disease caused by the Magnaporthe species is a major factor affecting the productivity of rice, wheat and millets. This study was aimed at generating genomic information for rice and non-rice Magnaporthe isolates to understand the extent of genetic variation. We have sequenced the whole genome of the Magnaporthe isolates, infecting rice (leaf and neck), finger millet (leaf and neck), foxtail millet (leaf) and buffel grass (leaf). Rice and finger millet isolates infecting both leaf and neck tissues were sequenced, since the damage and yield loss caused due to neck blast is much higher as compared to leaf blast. The genome-wide comparison was carried out to study the variability in gene content, candidate effectors, repeat element distribution, genes involved in carbohydrate metabolism and SNPs. The analysis of repeat element footprints revealed some genes such as naringenin, 2-oxoglutarate 3-dioxygenase being targeted by Pot2 and Occan, in isolates from different host species. Some repeat insertions were host-specific while other insertions were randomly shared between isolates. The distributions of repeat elements, secretory proteins, CAZymes and SNPs showed significant variation across host-specific lineages of Magnaporthe indicating an independent genome evolution orchestrated by multiple genomic factors. PMID:27658241

Impact of the excision of an ancient repeat insertion on Rickettsia conorii guanylate kinase activity.

PubMed

Abergel, Chantal; Blanc, Guillaume; Monchois, Vincent; Renesto, Patricia; Sigoillot, Cécile; Ogata, Hiroyuki; Raoult, Didier; Claverie, Jean-Michel

2006-11-01

The genomic sequencing of Rickettsia conorii revealed a new family of Rickettsia-specific palindromic elements (RPEs) capable of in-frame insertion in preexisting open reading frames (ORFs). Many of these altered ORFs correspond to proteins with well-characterized or essential functions in other microorganisms. Previous experiments indicated that RPE-containing genes are normally transcribed and that no excision of the repeat occurs at the mRNA level. Using mass spectrometry, we now confirmed the retention of the RPE-derived amino acid residues in 4 proteins successfully expressed in Escherichia coli, raising the general question of the consequences of this common insertion event on the fitness of Rickettsia enzymes. The predicted guanylate kinase activity of the R. conorii gmk gene product was measured both on the RPE-containing and RPE-excised recombinant proteins. We show that the 2 proteins are active but exhibit substantial differences in their affinity for adenosine triphosphate, guanosine monophosphate, and catalytic constants. The distribution of the RPEgmk insert among Rickettsia species indicates that the insertion event is ancient and occurred after the divergence of Rickettsia felis and R. conorii but before that of Rickettsia helvetica and R. conorii. We found no evidence that the gmk gene fixed adaptive changes to compensate the RPE peptide insertion. Furthermore, the analysis of the rates of divergence in 23 RPE-containing genes indicates that coding RPE repeats tend to evolve under weak selective constraint, at a rate similar to intergenic noncoding RPE sequences. Altogether, these results suggest that the insertion of RPE-encoded "selfish peptides," although respecting the original fold and activity of the host proteins, might be slightly detrimental to the enzyme efficiency within limits tolerable for slow-growing intracellular parasites such as Rickettsia.

Genetic diversity of ORF3 and spike genes of porcine epidemic diarrhea virus in Thailand.

PubMed

Temeeyasen, Gun; Srijangwad, Anchalee; Tripipat, Thitima; Tipsombatboon, Pavita; Piriyapongsa, Jittima; Phoolcharoen, Waranyoo; Chuanasa, Taksina; Tantituvanont, Angkana; Nilubol, Dachrit

2014-01-01

Porcine epidemic diarrhea virus (PEDV) has become endemic in the Thai swine industry, causing economic losses and repeated outbreaks since its first emergence in 2007. In the present study, 69 Thai PEDV isolates were obtained from 50 swine herds across Thailand during the period 2008-2012. Both partial and complete nucleotide sequences of the spike (S) glycoprotein and the nucleotide sequences of ORF3 genes were determined to investigate the genetic diversity and molecular epidemiology of Thai PEDV. Based on the analysis of the partial S glycoprotein genes, the Thai PEDV isolates were clustered into 2 groups related to Korean and Chinese field isolates. The results for the complete spike genes, however, demonstrated that both groups were grouped in the same cluster. Interestingly, both groups of Thai PEDV isolates had a 4-aa (GENQ) insertion between positions 55 and 56, a 1-aa insertion between positions 135 and 136, and a 2-aa deletion between positions 155 and 156, making them identical to the Korean KNU series and isolates responsible for outbreaks in China in recent years. In addition to the complete S sequences, the ORF3 gene analyses suggested that the isolates responsible for outbreaks in Thailand are not vaccine related. The results of this study suggest that the PEDV isolates responsible for outbreaks in Thailand since its emergence represent a variant of PEDV that was previously reported in China and Korea. Copyright © 2013 Elsevier B.V. All rights reserved.

Phylogenetic inference under varying proportions of indel-induced alignment gaps

PubMed Central

Dwivedi, Bhakti; Gadagkar, Sudhindra R

2009-01-01

Background The effect of alignment gaps on phylogenetic accuracy has been the subject of numerous studies. In this study, we investigated the relationship between the total number of gapped sites and phylogenetic accuracy, when the gaps were introduced (by means of computer simulation) to reflect indel (insertion/deletion) events during the evolution of DNA sequences. The resulting (true) alignments were subjected to commonly used gap treatment and phylogenetic inference methods. Results (1) In general, there was a strong – almost deterministic – relationship between the amount of gap in the data and the level of phylogenetic accuracy when the alignments were very "gappy", (2) gaps resulting from deletions (as opposed to insertions) contributed more to the inaccuracy of phylogenetic inference, (3) the probabilistic methods (Bayesian, PhyML & "MLε, " a method implemented in DNAML in PHYLIP) performed better at most levels of gap percentage when compared to parsimony (MP) and distance (NJ) methods, with Bayesian analysis being clearly the best, (4) methods that treat gapped sites as missing data yielded less accurate trees when compared to those that attribute phylogenetic signal to the gapped sites (by coding them as binary character data – presence/absence, or as in the MLε method), and (5) in general, the accuracy of phylogenetic inference depended upon the amount of available data when the gaps resulted from mainly deletion events, and the amount of missing data when insertion events were equally likely to have caused the alignment gaps. Conclusion When gaps in an alignment are a consequence of indel events in the evolution of the sequences, the accuracy of phylogenetic analysis is likely to improve if: (1) alignment gaps are categorized as arising from insertion events or deletion events and then treated separately in the analysis, (2) the evolutionary signal provided by indels is harnessed in the phylogenetic analysis, and (3) methods that utilize the phylogenetic signal in indels are developed for distance methods too. When the true homology is known and the amount of gaps is 20 percent of the alignment length or less, the methods used in this study are likely to yield trees with 90–100 percent accuracy. PMID:19698168

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Characterization of Tn1546 in vancomycin-resistant Enterococcus faecium isolated from canine urinary tract infections: evidence of gene exchange between human and animal enterococci.

PubMed

Simjee, S; White, D G; McDermott, P F; Wagner, D D; Zervos, M J; Donabedian, S M; English, L L; Hayes, J R; Walker, R D

2002-12-01

Thirty-five enterococcal isolates were recovered from dogs diagnosed with urinary tract infections at the Michigan State University Veterinary Teaching Hospital over a 2-year period (1996 to 1998). Isolated species included Enterococcus faecium (n = 13), Enterococcus faecalis (n = 7), Enterococcus gallinarum (n = 11), and Enterococcus casseliflavus (n = 4). Antimicrobial susceptibility testing revealed several different resistance phenotypes, with the majority of the enterococcal isolates exhibiting resistance to three or more antibiotics. One E. faecium isolate, CVM1869, displayed high-level resistance to vancomycin (MIC > 32 micro g/ml) and gentamicin (MIC > 2,048 micro g/ml). Molecular analysis of this isolate revealed the presence of Tn1546 (vanA), responsible for high-level vancomycin resistance, and Tn5281 carrying aac6'-aph2", conferring high-level aminoglycoside resistance. Pulsed-field gel electrophoresis analysis revealed that CVM1869 was a canine E. faecium clone that had acquired Tn1546, perhaps from a human vancomycin-resistant E. faecium. Transposons Tn5281 and Tn1546 were located on two different conjugative plasmids. Sequence analysis revealed that in Tn1546, ORF1 had an 889-bp deletion and an IS1216V insertion at the 5' end and an IS1251 insertion between vanS and vanH. To date, this particular form of Tn1546 has only been described in human clinical vancomycin-resistant enterococcus isolates unique to the United States. Additionally, this is the first report of a vancomycin-resistant E. faecium isolated from a companion animal in the United States.

A genomic landscape of mitochondrial DNA insertions in the pig nuclear genome provides evolutionary signatures of interspecies admixture.

PubMed

Schiavo, Giuseppina; Hoffmann, Orsolya Ivett; Ribani, Anisa; Utzeri, Valerio Joe; Ghionda, Marco Ciro; Bertolini, Francesca; Geraci, Claudia; Bovo, Samuele; Fontanesi, Luca

2017-10-01

Nuclear DNA sequences of mitochondrial origin (numts) are derived by insertion of mitochondrial DNA (mtDNA), into the nuclear genome. In this study, we provide, for the first time, a genome picture of numts inserted in the pig nuclear genome. The Sus scrofa reference nuclear genome (Sscrofa10.2) was aligned with circularized and consensus mtDNA sequences using LAST software. A total of 430 numt sequences that may represent 246 different numt integration events (57 numt regions determined by at least two numt sequences and 189 singletons) were identified, covering about 0.0078% of the nuclear genome. Numt integration events were correlated (0.99) to the chromosome length. The longest numt sequence (about 11 kbp) was located on SSC2. Six numts were sequenced and PCR amplified in pigs of European commercial and local pig breeds, of the Chinese Meishan breed and in European wild boars. Three of them were polymorphic for the presence or absence of the insertion. Surprisingly, the estimated age of insertion of two of the three polymorphic numts was more ancient than that of the speciation time of the Sus scrofa, supporting that these polymorphic sites were originated from interspecies admixture that contributed to shape the pig genome. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Prophylactic teicoplanin during insertion of Hickman catheters.

PubMed

Lim, S H; Smith, M P; Machin, S J; Goldstone, A H

1990-12-01

With the extensive use of Hickman catheters in patients requiring cytotoxic chemotherapy there is now a resurgence of Gram-positive septicaemia among these patients during the neutropenic periods. We are currently running a prospective randomized study of prophylactic teicoplanin during insertion of Hickman catheters to determine if it reduces the incidence of Gram-positive septicaemia. A total of 44 patients have completed the study (23 in the teicoplanin group and 21 in the control group). The diagnoses were: acute myelogenous leukaemia (13), non-Hodgkin's lymphoma (16), Hodgkin's disease (11), chronic granulocytic leukaemia (3) and acute lymphoblastic leukaemia (1). The number of days between insertion of Hickman catheters and the development of neutropenia was: teicoplanin group: mean 14.7, median 11, range 0-53; control group: mean 11.8, median 10, range 0-37. In the treated patients, there were four episodes of line-associated Gram-positive septicaemia and a total of four organisms were isolated. In the control group, 10 organisms were isolated from a total of nine episodes of line-associated Gram-positive septicaemia. The organisms were: coagulase-negative staphylococci (8), Streptococcus B, (1), Strep. faecalis (1), Strep. mitis (1), alpha streptococcus (1), diphtheriods (1) and Staphylococcus aureus (1). All organisms were sensitive to teicoplanin. No adverse reaction was observed in any patient. Prophylactic teicoplanin during insertion of Hickman catheters may therefore reduce the incidence of line-associated Gram-positive septicaemia in neutropenic patients.

Matrix isolation infrared spectra of O2 and N2 insertion reactions with atomic uranium

NASA Astrophysics Data System (ADS)

Hunt, Rodney D.; Toth, L. Mac; Yustein, Jason T.; Andrews, Lester

1993-10-01

Laser ablation of refractory metals can be an effective source of vapor for matrix isolation IR studies. This combination of techniques was used for the first time to study the mechanisms of U vapor reactions with atmospheric components. U atoms and O2 were codeposited with excess Ar at 12 K. The dominant codeposition products were UO2 and UO3. In contrast, the UO yield was always small because UO2 is formed by an insertion mechanism. This mechanism was verified in the 16O2/18O2 experiments which failed to produce 16OU18O. The effects of UV photolysis and matrix annealings were also examined. The U atoms and O2 reaction requires little or no activation energy since UO2 was formed from cold reagents. New charge-transfer species, (UO2+2)(O2-2) and (UO+2)(O-2), and a weak complex, UO3-O2, were primarily produced under conditions which favored further O2 reactions. Similar U atom and N2 experiments produced only linear NUN which is also produced by an insertion mechanism. This U reaction represents the first time that atom was observed breaking and inserting into the triple bond of N2. Photolysis dramatically increased the NUN yield by 3-fold. Matrix annealings produced weak UN2-N2 and UN2-2N2 complexes.

Endoscopic biliary stent insertion through specialized duodenal stent for combined malignant biliary and duodenal obstruction facilitated by stent or PTBD guidance.

PubMed

Lee, Jong Jin; Hyun, Jong Jin; Choe, Jung Wan; Lee, Dong-Won; Kim, Seung Young; Jung, Sung Woo; Jung, Young Kul; Koo, Ja Seol; Yim, Hyung Joon; Lee, Sang Woo

2017-11-01

Endoscopic stenting for combined malignant biliary and duodenal obstruction is technically demanding. However, this procedure can be facilitated when there is guidance from previously inserted stent or PTBD tube. This study aimed to evaluate the feasibility and clinical success rate of endoscopic placement of biliary self-expandable metal stent (SEMS) through duodenal SEMS in patients with combined biliary and duodenal obstruction due to inoperable or metastatic periampullary malignancy. A total of 12 patients with combined malignant biliary and duodenal stricture underwent insertion of biliary SEMS through the mesh of specialized duodenal SEMS from July 2012 to October 2016. Technical and clinical success rate, adverse events and survival after completion of SEMS insertion were evaluated. The duodenal strictures were located in the first portion of the duodenum in four patients (Type I), in the second portion in three patients (Type II), and in the third portion in five patients (Type III). Technical success rate of combined metallic stenting was 91.7%. Insertion of biliary SEMS was guided by previously inserted biliary SEMS in nine patients, plastic stent in one patient, and PTBD in two patients. Clinical success rate was 90.9%. There were no early adverse events after the procedure. Mean survival period after combined metallic stenting was 91.9 days (range: 15-245 days). Endoscopic placement of biliary SEMS through duodenal SEMS is feasible with high success rates and relatively easy when there is guidance. This method can be a good alternative for palliation in patients with combined biliary and duodenal obstruction.

An Event-Level Analysis of Condomless Anal Intercourse with a HIV-Discordant or HIV Status-Unknown Partner Among Black Men Who Have Sex with Men from a Multi-site Study.

PubMed

Yang, Cui; Latkin, Carl; Tobin, Karin; Seal, David; Koblin, Beryl; Chander, Geetanjali; Siconolfi, Daniel; Flores, Stephen; Spikes, Pilgrim

2018-05-19

Despite the high HIV incidence and prevalence among black men who have sex with men (BMSM), little research has examined partner characteristics, partner seeking venue, sexual position, substance use, and sexual risk behavior at the sex event-level among BMSM. Using the baseline data from a multi-site study of 807 BMSM stratified by their HIV status, the goal of this study was to conduct a detailed event-level analysis of 1577 male anal sex events to assess the factors associated with condomless anal intercourse (CLAI) with a HIV-discordant or HIV status-unknown partner. We found CLAI with an HIV-discordant or unknown HIV status partner among HIV-negative BMSM was negatively associated with having sex with a main partner, and was positively associated with taking both receptive and insertive sexual positions during sex. As compared to a sex partner met at bar, night club or dance club, HIV-positive BMSM were less likely to engage in CLAI with HIV-discordant and unknown HIV status partner met at party or friend's house or at community organizations. HIV-positive BMSM had lower odds of engaging in CLAI with HIV-discordant and unknown HIV status partner if they had insertive sexual position or both receptive and insertive sexual positions. These results underscore the importance of delineating unique sex event-level factors associated with sexual risk behavior depending on individuals' HIV status. Our findings suggest event-level partner characteristics, sexual position, and partner seeking venues may contribute to disparities in HIV incidence.

Site-controlled GaN nanocolumns with InGaN insertions grown by MBE

NASA Astrophysics Data System (ADS)

Nechaev, D. V.; Semenov, A. N.; Koshelev, O. A.; Jmerik, V. N.; Davydov, V. Yu; Smirnov, A. N.; Pozina, G.; Shubina, T. V.; Ivanov, S. V.

2017-11-01

The site-controlled plasma-assisted molecular beam epitaxy (PA MBE) has been developed to fabricate the regular array of GaN nanocolumns (NCs) with InGaN insertions on micro-cone patterned sapphire substrates (μ-CPSSs). Two-stage growth of GaN NCs, including a nucleation layer grown at metal-rich conditions and high temperature GaN growth in strong N-rich condition, has been developed to achieve the selective growth of the NCs. Microcathodoluminescence measurements have demonstrated pronounced emission from the InGaN insertions in 450-600 nm spectral range. The optically isolated NCs can be used as effective nano-emitters operating in the visible range.

Optimization of Second Fault Detection Thresholds to Maximize Mission POS

NASA Technical Reports Server (NTRS)

Anzalone, Evan

2018-01-01

In order to support manned spaceflight safety requirements, the Space Launch System (SLS) has defined program-level requirements for key systems to ensure successful operation under single fault conditions. To accommodate this with regards to Navigation, the SLS utilizes an internally redundant Inertial Navigation System (INS) with built-in capability to detect, isolate, and recover from first failure conditions and still maintain adherence to performance requirements. The unit utilizes multiple hardware- and software-level techniques to enable detection, isolation, and recovery from these events in terms of its built-in Fault Detection, Isolation, and Recovery (FDIR) algorithms. Successful operation is defined in terms of sufficient navigation accuracy at insertion while operating under worst case single sensor outages (gyroscope and accelerometer faults at launch). In addition to first fault detection and recovery, the SLS program has also levied requirements relating to the capability of the INS to detect a second fault, tracking any unacceptable uncertainty in knowledge of the vehicle's state. This detection functionality is required in order to feed abort analysis and ensure crew safety. Increases in navigation state error and sensor faults can drive the vehicle outside of its operational as-designed environments and outside of its performance envelope causing loss of mission, or worse, loss of crew. The criteria for operation under second faults allows for a larger set of achievable missions in terms of potential fault conditions, due to the INS operating at the edge of its capability. As this performance is defined and controlled at the vehicle level, it allows for the use of system level margins to increase probability of mission success on the operational edges of the design space. Due to the implications of the vehicle response to abort conditions (such as a potentially failed INS), it is important to consider a wide range of failure scenarios in terms of both magnitude and time. As such, the Navigation team is taking advantage of the INS's capability to schedule and change fault detection thresholds in flight. These values are optimized along a nominal trajectory in order to maximize probability of mission success, and reducing the probability of false positives (defined as when the INS would report a second fault condition resulting in loss of mission, but the vehicle would still meet insertion requirements within system-level margins). This paper will describe an optimization approach using Genetic Algorithms to tune the threshold parameters to maximize vehicle resilience to second fault events as a function of potential fault magnitude and time of fault over an ascent mission profile. The analysis approach, and performance assessment of the results will be presented to demonstrate the applicability of this process to second fault detection to maximize mission probability of success.

The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.

PubMed

Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix

2014-01-01

The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.

Finite Ground Coplanar Waveguide Shunt MEMS Switches for Switched Line Phase Shifters

NASA Technical Reports Server (NTRS)

Ponchak, George E.; Simons, Rainee N.; Scardelletti, Maximillian; Varaljay, Nicholas C.

2000-01-01

Switches with low insertion loss and high isolation are required for switched line phase shifters and the transmit/receive switch at the front end of communication systems. A Finite Ground Coplanar (FGC) waveguide capacitive, shunt MEMS switch has been implemented on high resistivity Si. The switch has demonstrated an insertion loss of less than 0.3 dB and a return loss greater than 15 dB from 10 to 20, GHz. The switch design, fabrication, and characteristics are presented.

Trans-falcine and contralateral sub-frontal electrode placement in pediatric epilepsy surgery: technical note.

PubMed

Pindrik, Jonathan; Hoang, Nguyen; Tubbs, R Shane; Rocque, Brandon J; Rozzelle, Curtis J

2017-08-01

Phase II monitoring with intracranial electroencephalography (ICEEG) occasionally requires bilateral placement of subdural (SD) strips, grids, and/or depth electrodes. While phase I monitoring often demonstrates a preponderance of unilateral findings, individual studies (video EEG, single photon emission computed tomography [SPECT], and positron emission tomography [PET]) can suggest or fail to exclude a contralateral epileptogenic onset zone. This study describes previously unreported techniques of trans-falcine and sub-frontal insertion of contralateral SD grids and depth electrodes for phase II monitoring in pediatric epilepsy surgery patients when concern about bilateral abnormalities has been elicited during phase I monitoring. Pediatric patients with medically refractory epilepsy undergoing stage I surgery for phase II monitoring involving sub-frontal and/or trans-falcine insertion of SD grids and/or depth electrodes at the senior author's institution were retrospectively reviewed. Intra-operative technical details of sub-frontal and trans-falcine approaches were studied, while intra-operative complications or events were noted. Operative techniques included gentle subfrontal retraction and elevation of the olfactory tracts (while preserving the relationship between the olfactory bulb and cribriform plate) to insert SD grids across the midline for coverage of the contralateral orbito-frontal regions. Trans-falcine approaches involved accessing the inter-hemispheric space, bipolar cauterization of the anterior falx cerebri below the superior sagittal sinus, and sharp dissection using a blunt elevator and small blade scalpel. The falcine window allowed contralateral SD strip, grid, and depth electrodes to be inserted for coverage of the contralateral frontal regions. The study cohort included seven patients undergoing sub-frontal and/or trans-falcine insertion of contralateral SD strip, grid, and/or depth electrodes from February 2012 through June 2015. Five patients (71%) experienced no intra-operative events related to contralateral ICEEG electrode insertion. Intra-operative events of frontal territory venous engorgement (1/7, 14%) due to sacrifice of anterior bridging veins draining into the SSS and avulsion of a contralateral bridging vein (1/7, 14%), probably due to prior anterior corpus callosotomy, each occurred in one patient. There were no intra-operative or peri-operative complications in any of the patients studied. Two patients required additional surgery for supplemental SD strip and/or depth electrodes via burr hole craniectomy to enhance phase II monitoring. All patients proceeded to stage II surgery for resection of ipsilateral epileptogenic onset zones without adverse events. Trans-falcine and sub-frontal insertion of contralateral SD strip, grid, and depth electrodes are previously unreported techniques for achieving bilateral frontal coverage in phase II monitoring in pediatric epilepsy surgery. This technique obviates the need for contralateral craniotomy and parenchymal exposure with limited, remediable risks. Larger case series using the method described herein are now necessary.

Isolation of diapause-regulated transcripts by differential display from the Colorado potato beetle, and their expression in prediapausing and nondiapausing adults. GenBank. Accessions: FG591137-FG591192

USDA-ARS?s Scientific Manuscript database

Using differential display, 56 putatively diapause regulated transcripts were isolated from the Colorado potato beetle, Leptinotarsa decemlineata. The clones insert sizes range from 114 to 795 bp with mean length of 392 ± SD of 191 bp. Fourteen of the transcripts were confirmed by northern blot anal...

Blind bedside postpyloric placement of spiral tube as rescue therapy in critically ill patients: a prospective, tricentric, observational study.

PubMed

Lv, Bo; Hu, Linhui; Chen, Lifang; Hu, Bei; Zhang, Yanlin; Ye, Heng; Sun, Cheng; Zhang, Xiunong; Lan, Huilan; Chen, Chunbo

2017-09-26

Various special techniques for blind bedside transpyloric tube placement have been introduced into clinical practice. However, transpyloric spiral tube placement facilitated by a blind bedside method has not yet been reported. The objective of this prospective study was to evaluate the safety and efficiency of blind bedside postpyloric placement of a spiral tube as a rescue therapy subsequent to failed spontaneous transpyloric migration in critically ill patients. This prospective, tricentric, observational study was conducted in the intensive care units (ICUs) of three tertiary hospitals. A total of 127 consecutive patients with failed spontaneous transpyloric spiral tube migration despite using prokinetic agents and still required enteral nutrition for more than 3 days were included. The spiral tube was inserted postpylorically using the blind bedside technique. All patients received metoclopramide intravenously prior to tube insertion. The exact tube tip position was determined by radiography. The primary efficacy endpoint was the success rate of postpyloric spiral tube placement. Secondary efficacy endpoints were success rate of a spiral tube placed in the third portion of the duodenum (D3) or beyond, success rate of placement in the proximal jejunum, time to insertion, length of insertion, and number of attempts. Safety endpoints were metoclopramide-related and major adverse tube-associated events. In 81.9% of patients, the spiral feeding tubes were placed postpylorically; of these, 55.1% were placed in D3 or beyond and 33.9% were placed in the proximal jejunum, with a median time to insertion of 14 min and an average number of attempts of 1.4. The mean length of insertion was 95.6 cm. The adverse event incidence was 26.0%, and no serious adverse event was observed. Blind bedside postpyloric placement of a spiral tube, as a rescue therapy subsequent to failed spontaneous transpyloric migration in critically ill patients, is safe and effective. This technique may facilitate the early initiation of postpyloric feeding in the ICU. Chinese Clinical Trial Registry, ChiCTR-OPN-16008206 . Registered on 1 April 2016.

Identifying Likely Transmission Pathways within a 10-Year Community Outbreak of Tuberculosis by High-Depth Whole Genome Sequencing

PubMed Central

Sadsad, Rosemarie; Martinez, Elena; Jelfs, Peter; Hill-Cawthorne, Grant A.; Gilbert, Gwendolyn L.; Marais, Ben J.; Sintchenko, Vitali

2016-01-01

Background Improved tuberculosis control and the need to contain the spread of drug-resistant strains provide a strong rationale for exploring tuberculosis transmission dynamics at the population level. Whole-genome sequencing provides optimal strain resolution, facilitating detailed mapping of potential transmission pathways. Methods We sequenced 22 isolates from a Mycobacterium tuberculosis cluster in New South Wales, Australia, identified during routine 24-locus mycobacterial interspersed repetitive unit typing. Following high-depth paired-end sequencing using the Illumina HiSeq 2000 platform, two independent pipelines were employed for analysis, both employing read mapping onto reference genomes as well as de novo assembly, to control biases in variant detection. In addition to single-nucleotide polymorphisms, the analyses also sought to identify insertions, deletions and structural variants. Results Isolates were highly similar, with a distance of 13 variants between the most distant members of the cluster. The most sensitive analysis classified the 22 isolates into 18 groups. Four of the isolates did not appear to share a recent common ancestor with the largest clade; another four isolates had an uncertain ancestral relationship with the largest clade. Conclusion Whole genome sequencing, with analysis of single-nucleotide polymorphisms, insertions, deletions, structural variants and subpopulations, enabled the highest possible level of discrimination between cluster members, clarifying likely transmission pathways and exposing the complexity of strain origin. The analysis provides a basis for targeted public health intervention and enhanced classification of future isolates linked to the cluster. PMID:26938641

Cerebral oxygenation during intermittent hypoxemia and bradycardia in preterm infants.

PubMed

Schmid, Manuel B; Hopfner, Reinhard J; Lenhof, Susanne; Hummler, Helmut D; Fuchs, Hans

2015-01-01

Episodes of hypoxemia and bradycardia frequently occur with apnea of prematurity in preterm infants. Little is known about the impact of different event types on the brain. To describe the influence of hypoxemia and bradycardia, either isolated or in combination, on cerebral oxygenation. In 16 preterm infants with intermittent hypoxemia and/or bradycardia, cerebral tissue oxygen saturation (StO2, as measured by near-infrared spectroscopy), heart rate and pulse oximetric saturation (SpO2) were recorded simultaneously for 16 h. Events were classified as isolated bradycardia (type 1), isolated hypoxemia (type 2) or combined (simultaneous, type 3; bradycardia first, type 4; hypoxemia first, type 5). Primary outcome was a score representing the area below baseline for cerebral StO2 desaturation during an event. Secondary outcomes were duration and depth of cerebral desaturation. Patients had a median (range) gestational age of 25.9 (22.6-30.4) weeks and a postnatal age of 32.5 (7-58) days. The median (quartiles) number of events was 49 (34-58). Isolated hypoxemias were the most frequent events (24; 9-36) and isolated bradycardias the least common (0; 0-1). Cerebral StO2 baseline was not different between event types. Cerebral desaturation score, duration of event and depth of cerebral desaturation were smallest for isolated bradycardias and largest for combined events, especially for those starting with hypoxemia followed by bradycardia. Regardless of event type, 12/16 infants maintained cerebral StO2 >60% despite severe SpO2 desaturations. Isolated bradycardias had the lowest impact on cerebral desaturation, and combined events had the highest. Most infants preserved cerebral oxygenation >60% during events. © 2014 S. Karger AG, Basel.

Cis-acting mutation and duplication: History of molecular evolution in a P450 haplotype responsible for insecticide resistance in Culex quinquefasciatus.

PubMed

Itokawa, Kentaro; Komagata, Osamu; Kasai, Shinji; Masada, Masahiro; Tomita, Takashi

2011-07-01

A cytochrome P450 gene, Cyp9m10, is more than 200-fold overexpressed in a pyrethroid resistant strain of Culex quinquefasciatus, JPal-per. The haplotype of this strain contains two copies of Cyp9m10 resulted from recent tandem duplication. In this study, we discovered and isolated a Cyp9m10 haplotype closely related to this duplicated Cyp9m10 haplotype from JHB, a strain used for the recent genome project for this mosquito species. The isolated haplotype (JHB-NIID-B haplotype) shared the same insertion of a transposable element upstream of the coding region with JPal-per strain but not duplicated. The JHB-NIID-B haplotype was considered to have diverged from the JPal-per lineage just before the duplication event. Cyp9m10 was moderately overexpressed in larvae with the JHB-NIID-B haplotype. The overexpressions in JHB-NIID-B and JPal-per haplotypes were developmentally regulated in similar pattern indicating both haplotypes share a common cis-acting mutation responsible for the overexpressions. The isolated moderately overexpressed haplotype conferred resistance, however, its efficacy was relatively small. We hypothesized that the first cis-acting mutation modified the consequence of the subsequent duplication in JPal-per lineage to confer stronger phenotypic effect than that if it occurred before the first cis-acting mutation. Copyright © 2011 Elsevier Ltd. All rights reserved.

Prosthetic Complications and Maintenance Requirements in Locator-attached Implant-Supported Overdentures: A Retrospective Study.

PubMed

Engelhardt, Frank; Zeman, Florian; Behr, Michael; Hahmel, Sebastian

2016-03-01

Retrospective data of 32 patients supplied with implant-supported and Locator-attached overdentures were screened for prosthetic complications and maintenance requirements, which were recorded and statistically analyzed. Mean observation time was 4.78 ± 1.72) years. Loss of retention was the most frequently observed event (n = 22). Damage and exchange of the insert holders (n = 4) and loosening of locator attachments (n = 2) and fracture of the insert holder (n = 2) were uncommon events; no loss of locator attachments was observed. Loss of retention in Locator-attached overdentures is frequent; correlating patient-specific parameters with prosthetic complications is necessary to define recommendations for the use of Locator attachments.

Increased risk of snoring and adenotonsillectomy in children referred for tympanostomy tube insertion.

PubMed

Tauman, Riva; Derowe, Ari; Ophir, Orna; Greenfeld, Michal; Sivan, Yakov

2010-02-01

Eustachian tube dysfunction and sleep-disordered breathing (SDB) share common pathophysiologic mechanisms. Our objective was to investigate whether children referred for isolated TTI (tympanostomy tube insertion) are at increased risk for snoring and upper airway procedures. Telephone interviews to parents of children who underwent isolated TTI and to age- and gender-matched controls were conducted. Four hundred fifty-seven children were included in the study; 352 had isolated TTI (study group) and 105 children were controls. Twenty-two percent of children in the study group were reported to snore compared with 7.6% in the controls (p=0.001). Eighteen percent of children in the study group were reported to have undergone adenotonsillectomy compared with 4.8% in the controls (p=0.0005). Future SDB, i.e., either snoring or adenotonsillectomy following TTI, was found in 34% of children in the study group compared with 11% in the controls (p=0.0004). Children who underwent isolated TTI were at increased risk for future snoring (OR=3.4, CI: 1.6-7.2) and future adenotonsillectomy (OR=4.4, CI: 1.7-11.2). Children who undergo isolated TTI are at increased risk for snoring and for adenotonsillectomy. We suggest that these children be followed for symptoms of SDB on a scheduled basis to allow for early diagnosis and intervention. 2009 Elsevier B.V. All rights reserved.

Perinatal Outcomes Associated With Isolated Velamentous Cord Insertion in Singleton and Twin Pregnancies.

PubMed

Sinkin, Joshua A; Craig, Wendy Y; Jones, Michael; Pinette, Michael G; Wax, Joseph R

2018-02-01

To evaluate perinatal outcomes in singleton and twin pregnancies with pathologically confirmed velamentous cord insertion without vasa previa. This retrospective case-control study included all nonanomalous singleton and twin pregnancies with pathologically confirmed velamentous cord insertion delivered in a single institution between January 1, 2005, and July 1, 2015, and having an ultrasound examination by maternal-fetal medicine. For each case, the next 2 consecutive deliveries matched for gestational age at delivery ± 1 week and, in twins, amnionicity and chorionicity served as controls. Primary outcomes included surgical delivery for a nonreassuring intrapartum fetal heart rate tracing, umbilical arterial cord pH of less than 7.2, 5-minute Apgar score of less than 7, birth weight below the 10th percentile, neonatal intensive care unit admission, fetal or neonatal death, and cord avulsion necessitating manual placental extraction. Outcomes were available for 53 singletons with 103 matched controls and 33 twin pregnancies with 65 matched controls. In singletons, velamentous cord insertion was associated with cord pH of less than 7.2 (odds ratio [OR] 3.5; 95% confidence interval [CI], 1.1-11.2; P = .039), 5-minute Apgar score of less than 7 (OR, 5.3; 95% CI, 0.99-28.1; P = .045), and cord avulsion requiring manual placental extraction (7.5% versus 0%; P = .012). Associations were suggested with increased surgical delivery for a nonreassuring intrapartum fetal heart rate tracing (OR, 2.4; 95% CI, 0.9-6.9; P = .14), birth weight below the 10th percentile (OR, 2.1; 95% CI, 0.8-5.9; P = .21), and fetal or neonatal death (3.8% versus 0%; P = .11). Velamentous cord insertions were also associated with placental abruption in singletons (7.5% versus 0%; P = .013). Among twins, velamentous cord insertion was associated with fetal or neonatal death (9.1% versus 0%; P = .036). Isolated confirmed velamentous cord insertion is associated with adverse perinatal outcomes in singleton and twin gestations. © 2017 by the American Institute of Ultrasound in Medicine.

A Mutation in the PP2C Phosphatase Gene in a Staphylococcus aureus USA300 Clinical Isolate with Reduced Susceptibility to Vancomycin and Daptomycin

PubMed Central

Passalacqua, Karla D.; Satola, Sarah W.; Crispell, Emily K.

2012-01-01

Methicillin-resistant Staphylococcus aureus (MRSA) strains with reduced susceptibility to vancomycin (MIC of 4 to 8 μg/ml) are referred to as vancomycin-intermediate S. aureus (VISA). In this study, we characterized two isogenic USA300 S. aureus isolates collected sequentially from a single patient with endocarditis where the S. aureus isolate changed from being susceptible to vancomycin (VSSA) (1 μg/ml) to VISA (8 μg/ml). In addition, the VISA isolate lost beta-lactamase activity and showed increased resistance to daptomycin and linezolid. The two strains did not differ in growth rate, but the VISA isolate had a thickened cell wall and was less autolytic. Transcriptome sequencing (RNA-seq) analysis comparing the two isolates grown to late exponential phase showed significant differences in transcription of cell surface protein genes (spa, SBI [second immunoglobulin-binding protein of S. aureus], and fibrinogen-binding proteins), regulatory genes (agrBCA, RNAIII, sarT, and saeRS), and others. Using whole-genome shotgun resequencing, we identified 6 insertion/deletion mutations between the VSSA and VISA isolates. A protein phosphatase 2C (PP2C) family phosphatase had a 6-bp (nonframeshift) insertion mutation in a highly conserved metal binding domain. Complementation of the clinical VISA isolate with a wild-type copy of the PP2C gene reduced the vancomycin and daptomycin MICs and increased autolytic activity, suggesting that this gene contributed to the reduced vancomycin susceptibility phenotype acquired in vivo. Creation of de novo mutants from the VSSA strain resulted in different mutations, demonstrating that reduced susceptibility to vancomycin in USA300 strains can occur via multiple routes, highlighting the complex nature of the VISA phenotype. PMID:22850507

Allexiviruses may have acquired inserted sequences between the CP and CRP genes to change the translation reinitiation strategy of CRP.

PubMed

Yoshida, Naoto; Shimura, Hanako; Masuta, Chikara

2018-06-01

Allexiviruses are economically important garlic viruses that are involved in garlic mosaic diseases. In this study, we characterized the allexivirus cysteine-rich protein (CRP) gene located just downstream of the coat protein (CP) gene in the viral genome. We determined the nucleotide sequences of the CP and CRP genes from numerous allexivirus isolates and performed a phylogenetic analysis. According to the resulting phylogenetic tree, we found that allexiviruses were clearly divided into two major groups (group I and group II) based on the sequences of the CP and CRP genes. In addition, the allexiviruses in group II had distinct sequences just before the CRP gene, while group I isolates did not. The inserted sequence between the CP and CRP genes was partially complementary to garlic 18S rRNA. Using a potato virus X vector, we showed that the CRPs affected viral accumulation and symptom induction in Nicotiana benthamiana, suggesting that the allexivirus CRP is a pathogenicity determinant. We assume that the inserted sequences before the CRP gene may have been generated during viral evolution to alter the termination-reinitiation mechanism for coupled translation of CP and CRP.

Design and fabrication of pHEMT MMIC switches for IEEE 802.11.a/b/g WLAN applications

NASA Astrophysics Data System (ADS)

Mun, Jae Kyoung; Ji, Hong Gu; Ahn, Hyokyun; Kim, Haecheon; Park, Chong-Ook

2005-08-01

In this paper, we propose a channel structure for a promising switch pHEMT with excellent isolation characteristics based on the distribution of electric field intensity beneath the Schottky contact in the transistor. Using the proposed device channel structure, SPST and SPDT switches were designed and fabricated, applicable to 2.4 GHz and 5.8 GHz WLAN systems. We discuss the relationship between dc characteristics and switch parameters in this paper in detail. The developed SPST switch exhibits a low insertion loss of 0.26 dB and a high isolation of 34.3 dB with a control voltage of 0 V/-3 V at 5.8 GHz. The SPDT also shows a good performance of 0.85 dB insertion loss and 31.5 dB isolation under the same conditions. The measured power-handling capability at 2.4 GHz reveals that the SPDT has an output power of 27 dBm at the 1 dB compression point and a third-order intercept point of more than 46 dBm.

Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

PubMed

Amirhaeri, S; Wohlrab, F; Wells, R D

1995-02-17

The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

Essure Permanent Birth Control, Effectiveness and Safety: An Italian 11-Year Survey.

PubMed

Franchini, Mario; Zizolfi, Brunella; Coppola, Carmela; Bergamini, Valentino; Bonin, Cecilia; Borsellino, Giovanni; Busato, Enrico; Calabrese, Stefania; Calzolari, Stefano; Fantin, Gian Piero; Giarrè, Giovanna; Litta, Piero; Luerti, Massimo; Mangino, Francesco Paolo; Marchino, Gian Luigi; Molinari, Maria Antonietta; Scatena, Elisa; Scrimin, Federica; Telloli, Paolo; Di Spiezio Sardo, Attilio

To describe safety, tolerability, and effectiveness results through a minimum 2-year follow-up of patients who underwent permanent sterilization with the Essure insert. A retrospective multicenter study (Canadian Task Force classification II2). Seven general hospitals and 4 clinical teaching centers in Italy. A total of 1968 women, mean age 39.5 years (range, 23-48 years) who underwent office hysteroscopic sterilization using the Essure insert between April 1, 2003, and December 30, 2014. The women underwent office hysteroscopic bilateral Essure insert placement, with satisfactory device location and tube occlusion based on hysterosalpingography or hysterosalpingo-contrast sonography (HyCoSy). Placement rate, successful bilateral tubal occlusion, perioperative adverse events, early postoperative (during the first 3 months of follow-up), and late complications were evaluated. Satisfactory insertion was accomplished in 97.2% of women and, in 4, perforation and 1 expulsion were detected during hysterosalpingography. Three unintended pregnancies occurred before the 3-month confirmation test. Two pregnancies were reported among women relying on the Essure inserts. Postprocedure pain was minimal and brief; in 9 women, pelvic pain became intractable, necessitating removal of the devices via laparoscopy. On telephone interviews, overall satisfaction was rated as "very satisfied" by the majority of women (97.6%), and no long-term adverse events were reported. The findings from this extended Italian survey further support the effectiveness, tolerability, and satisfaction of Essure hysteroscopic sterilization when motivated women are selected and well informed of the potential risks of the device. Moreover, the results do not demonstrate an increased incidence of complications and pregnancies associated with long-term Essure use. Patients with a known hypersensitivity to nickel may be less suitable candidates for the Essure insert. Copyright © 2017 AAGL. Published by Elsevier Inc. All rights reserved.

Risk of venous thromboembolism in hospitalized patients with peripherally inserted central catheters.

PubMed

Lobo, Bob L; Vaidean, Georgeta; Broyles, Joyce; Reaves, Anne B; Shorr, Ronald I

2009-09-01

Peripherally inserted central catheters (PICC) are increasingly used in hospitalized patients. The benefit can be offset by complications such as upper extremity deep vein thrombosis (UEDVT). Retrospective study of patients who received a PICC while hospitalized at the Methodist University Hospital (MUH) in Memphis, TN. All adult consecutive patients who had PICCs inserted during the study period and who did not have a UEDVT at the time of PICC insertion were included in the study. A UEDVT was defined as a symptomatic event in the ipsilateral extremity, leading to the performance of duplex ultrasonography, which confirmed the diagnosis of UEDVT. Pulmonary embolism (PE) was defined as a symptomatic event prompting the performance of ventilation-perfusion lung scan or spiral computed tomography (CT). Among 777 patients, 38 patients experienced 1 or more venous thromboembolisms (VTEs), yielding an incidence of 4.89%. A total of 7444 PICC-days were recorded for 777 patients. This yields a rate of 5.10 VTEs/1000 PICC-days. Compared to patients whose PICC was inserted in the SVC, patients whose PICC was in another location had an increased risk (odds ratio = 2.61 [95% CI = 1.28-5.35]) of VTE. PICC related VTE was significantly more common among patients with a past history of VTE (odds ratio = 10.83 [95% CI = 4.89-23.95]). About 5% of patients undergoing PICC placement in acute care hospitals will develop thromboembolic complications. Thromboembolic complications were especially common among persons with a past history of VTE. Catheter tip location at the time of insertion may be an important modifiable risk factor. Copyright 2009 Society of Hospital Medicine.

Comparative sequence analysis revealed altered chromosomal organization and a novel insertion sequence encoding DNA modification and potentially stress-related functions in an Escherichia coli O157:H7 foodborne isolate

USDA-ARS?s Scientific Manuscript database

We recently described the complete genome of enterohemorrhagic Escherichia coli (EHEC) O157:H7 strain NADC 6564, an isolate of strain 86-24 linked to the 1986 disease outbreak. In the current study, we compared the chromosomal sequence of NADC 6564 to the well-characterized chromosomal sequences of ...

Genomic Comparison of Two O111:H- Enterohemorrhagic Escherichia coli Isolates from a Historic Hemolytic-Uremic Syndrome Outbreak in Australia.

PubMed

McAllister, Lauren J; Bent, Stephen J; Petty, Nicola K; Skippington, Elizabeth; Beatson, Scott A; Paton, James C; Paton, Adrienne W

2016-01-04

Enterohemorrhagic Escherichia coli (EHEC) is an important cause of diarrhea and hemolytic-uremic syndrome (HUS) worldwide. Australia's worst outbreak of HUS occurred in Adelaide in 1995 and was one of the first major HUS outbreaks attributed to a non-O157 Shiga-toxigenic E. coli (STEC) strain. Molecular analyses conducted at the time suggested that the outbreak was caused by an O111:H(-) clone, with strains from later in the outbreak harboring an extra copy of the genes encoding the potent Shiga toxin 2 (Stx2). Two decades later, we have used next-generation sequencing to compare two isolates from early and late in this important outbreak. We analyzed genetic content, single-nucleotide polymorphisms (SNPs), and prophage insertion sites; for the latter, we demonstrate how paired-end sequence data can be leveraged to identify such insertion sites. The two strains are genetically identical except for six SNP differences and the presence of not one but two additional Stx2-converting prophages in the later isolate. Isolates from later in the outbreak were associated with higher levels of morbidity, suggesting that the presence of the additional Stx2-converting prophages is significant in terms of the virulence of this clone. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Evolution in Oryctes baculovirus: rate and types of genomic change.

PubMed

Crawford, A M; Zelazny, B

1990-01-01

Three cloned strains of Oryctes baculovirus were released into a previously unexposed population of the host insect, the coconut palm rhinoceros beetle, Oryctes rhinoceros. The experiment was conducted on Meemu Atoll in the Maldive Islands. Viruses were isolated from the beetle population at 1 year, 1.75 years, and 4 years after release. No changes in genotype were observed in viruses isolated after 1 and 1.75 years. After 4 years, however, three types of genomic change had occurred. A recombinant derived from two of the released strains, an isolate containing a 100-bp insert, and one example of a point mutation were found in the 22 isolates examined.

L1 Retrotransposon Heterogeneity in Ovarian Tumor Cell Evolution.

PubMed

Nguyen, Thu H M; Carreira, Patricia E; Sanchez-Luque, Francisco J; Schauer, Stephanie N; Fagg, Allister C; Richardson, Sandra R; Davies, Claire M; Jesuadian, J Samuel; Kempen, Marie-Jeanne H C; Troskie, Robin-Lee; James, Cini; Beaven, Elizabeth A; Wallis, Tristan P; Coward, Jermaine I G; Chetty, Naven P; Crandon, Alexander J; Venter, Deon J; Armes, Jane E; Perrin, Lewis C; Hooper, John D; Ewing, Adam D; Upton, Kyle R; Faulkner, Geoffrey J

2018-06-26

LINE-1 (L1) retrotransposons are a source of insertional mutagenesis in tumor cells. However, the clinical significance of L1 mobilization during tumorigenesis remains unclear. Here, we applied retrotransposon capture sequencing (RC-seq) to multiple single-cell clones isolated from five ovarian cancer cell lines and HeLa cells and detected endogenous L1 retrotransposition in vitro. We then applied RC-seq to ovarian tumor and matched blood samples from 19 patients and identified 88 tumor-specific L1 insertions. In one tumor, an intronic de novo L1 insertion supplied a novel cis-enhancer to the putative chemoresistance gene STC1. Notably, the tumor subclone carrying the STC1 L1 mutation increased in prevalence after chemotherapy, further increasing STC1 expression. We also identified hypomethylated donor L1s responsible for new L1 insertions in tumors and cultivated cancer cells. These congruent in vitro and in vivo results highlight L1 insertional mutagenesis as a common component of ovarian tumorigenesis and cancer genome heterogeneity. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

cea-kil operon of the ColE1 plasmid.

PubMed Central

Sabik, J F; Suit, J L; Luria, S E

1983-01-01

We isolated a series of Tn5 transposon insertion mutants and chemically induced mutants with mutations in the region of the ColE1 plasmid that includes the cea (colicin) and imm (immunity) genes. Bacterial cells harboring each of the mutant plasmids were tested for their response to the colicin-inducing agent mitomycin C. All insertion mutations within the cea gene failed to bring about cell killing after mitomycin C treatment. A cea- amber mutation exerted a polar effect on killing by mitomycin C. Two insertions beyond the cea gene but within or near the imm gene also prevented the lethal response to mitomycin C. These findings suggest the presence in the ColE1 plasmid of an operon containing the cea and kil genes whose product is needed for mitomycin C-induced lethality. Bacteria carrying ColE1 plasmids with Tn5 inserted within the cea gene produced serologically cross-reacting fragments of the colicin E1 molecule, the lengths of which were proportional to the distance between the insertion and the promoter end of the cea gene. Images PMID:6298187

The Ontology of Vaccine Adverse Events (OVAE) and its usage in representing and analyzing adverse events associated with US-licensed human vaccines.

PubMed

Marcos, Erica; Zhao, Bin; He, Yongqun

2013-11-26

Licensed human vaccines can induce various adverse events (AE) in vaccinated patients. Due to the involvement of the whole immune system and complex immunological reactions after vaccination, it is difficult to identify the relations among vaccines, adverse events, and human populations in different age groups. Many known vaccine adverse events (VAEs) have been recorded in the package inserts of US-licensed commercial vaccine products. To better represent and analyze VAEs, we developed the Ontology of Vaccine Adverse Events (OVAE) as an extension of the Ontology of Adverse Events (OAE) and the Vaccine Ontology (VO). Like OAE and VO, OVAE is aligned with the Basic Formal Ontology (BFO). The commercial vaccines and adverse events in OVAE are imported from VO and OAE, respectively. A new population term 'human vaccinee population' is generated and used to define VAE occurrence. An OVAE design pattern is developed to link vaccine, adverse event, vaccinee population, age range, and VAE occurrence. OVAE has been used to represent and classify the adverse events recorded in package insert documents of commercial vaccines licensed by the USA Food and Drug Administration (FDA). OVAE currently includes over 1,300 terms, including 87 distinct types of VAEs associated with 63 human vaccines licensed in the USA. For each vaccine, occurrence rates for every VAE in different age groups have been logically represented in OVAE. SPARQL scripts were developed to query and analyze the OVAE knowledge base data. To demonstrate the usage of OVAE, the top 10 vaccines accompanying with the highest numbers of VAEs and the top 10 VAEs most frequently observed among vaccines were identified and analyzed. Asserted and inferred ontology hierarchies classify VAEs in different levels of AE groups. Different VAE occurrences in different age groups were also analyzed. The ontology-based data representation and integration using the FDA-approved information from the vaccine package insert documents enables the identification of adverse events from vaccination in relation to predefined parts of the population (age groups) and certain groups of vaccines. The resulting ontology-based VAE knowledge base classifies vaccine-specific VAEs and supports better VAE understanding and future rational AE prevention and treatment.

CAD of 0.1- to 10-GHz GaAs MMIC SPST switch

NASA Astrophysics Data System (ADS)

Yadav, Ramchandra; Kirty, V. S. R.

1998-04-01

The design of the SPST switch provides an insertion loss less than 2 dB, isolation more than 40 dB and return loss better than 17.5 dB in the frequency range of 0.1 GHz to 10 GHz. The insertion loss is improved by treating SPST switch as a 50 (Omega) artificial transmission line with incorporation of inductor in series arm and the capacitance of MESFET in the shunt arm. High isolation is ensured by the lower value of `ON' resistance of MESFET in shunt arm. Also good return loss is achieved by paralleling a 50 (Omega) resistor with capacitance of MESFET in series arm. The absence of DC blocking capacitors and replacement of large value bias chokes with 5 K(Omega) resistors effectively improved the performance of SPST switch at low frequency and also reduced the chip size. The overall chip dimension is 2.2 mm X 1.7 mm.

Acute changes associated with electrode insertion measured with optical coherence microscopy

NASA Astrophysics Data System (ADS)

Hammer, Daniel X.; Lozzi, Andrea; Boretsky, Adam; Agrawal, Anant; Welle, Cristin G.

2016-03-01

Despite advances in functional neural imaging, penetrating microelectrodes provide the most direct interface for the extraction of neural signals from the nervous system and are a critical component of many high degree-of-freedom braincomputer interface devices. Electrode insertion is a traumatic event that elicits a complex neuroinflammatory response. In this investigation we applied optical coherence microscopy (OCM), particularly optical coherence angiography (OCA), to characterize the immediate tissue response during microelectrode insertion. Microelectrodes of varying dimension and footprint (one-, two-, and four-shank) were inserted into mouse motor cortex beneath a window after craniotomy surgery. The microelectrodes were inserted in 3-4 steps at 15-20°, with approximately 250 μm linear insertion distance for each step. Before insertion and between each step, OCM datasets were collected, including for quantitative capillary velocimetry. A cohort of control animals without microelectrode insertion was also imaged over a similar time period (2-3 hours). Mechanical tissue deformation was observed in all the experimental animals. The quantitative angiography results varied across animals, and were not correlated with device dimensions. In some cases, localized flow drop-out was observed in a small region surrounding the electrode, while in other instances a global disruption in flow occurred, perhaps as a result of large vessel compression caused by mechanical pressure. OCM is a tool that can be used in various neurophotonics applications, including quantification of the neuroinflammatory response to penetrating electrode insertion.

Copy number determination of genetically-modified hematopoietic stem cells.

PubMed

Schuesler, Todd; Reeves, Lilith; Kalle, Christof von; Grassman, Elke

2009-01-01

Human gene transfer with gammaretroviral, murine leukemia virus (MLV) based vectors has been shown to effectively insert and express transgene sequences at a level of therapeutic benefit. However, there are numerous reports of disruption of the normal cellular processes caused by the viral insertion, even of replication deficient gammaretroviral vectors. Current gammaretroviral and lentiviral vectors do not control the site of insertion into the genome, hence, the possibility of disruption of the target cell genome. Risk related to viral insertions is linked to the number of insertions of the transgene into the cellular DNA, as has been demonstrated for replication competent and replication deficient retroviruses in experiments. At high number of insertions per cell, cell transformation due to vector induced activation of proto-oncogenes is more likely to occur, in particular since more than one transforming event is needed for oncogenesis. Thus, determination of the vector copy number in bulk transduced populations, individual colony forming units, and tissue from the recipient of the transduced cells is an increasingly important safety assay and has become a standard, though not straightforward assay, since the inception of quantitative PCR.

The Genetics of a Probable Insertional Translocation in SORDARIA BREVICOLLIS.

PubMed

Bond, D J

1979-05-01

A chromosome rearrangement has been isolated and characterized in Sordaria brevicollis. Crosses to spore color mutants on each of the seven linkage groups have enabled the breakpoints to be mapped. The simplest hypothesis to account for the results is that a piece of linkage group VI has been translocated to linkage group V and inserted 2.7 map units from its centromere. Previous reports of markers on this linkage group with centromere distances greater than 2.7 units make it unlikely that the translocation is quasiterminal.

The Genetics of a Probable Insertional Translocation in SORDARIA BREVICOLLIS

PubMed Central

Bond, D. J.

1979-01-01

A chromosome rearrangement has been isolated and characterized in Sordaria brevicollis. Crosses to spore color mutants on each of the seven linkage groups have enabled the breakpoints to be mapped. The simplest hypothesis to account for the results is that a piece of linkage group VI has been translocated to linkage group V and inserted 2.7 map units from its centromere. Previous reports of markers on this linkage group with centromere distances greater than 2.7 units make it unlikely that the translocation is quasiterminal. PMID:17248927

QTL analysis on rice grain appearance quality, as exemplifying the typical events of transgenic or backcrossing breeding

PubMed Central

Yan, Bao; Liu, Rongjia; Li, Yibo; Wang, Yan; Gao, Guanjun; Zhang, Qinglu; Liu, Xing; Jiang, Gonghao; He, Yuqing

2014-01-01

Rice grain shape and yield are usually controlled by multiple quantitative trait loci (QTL). This study used a set of F9–10 recombinant inbred lines (RILs) derived from a cross of Huahui 3 (Bt/Xa21) and Zhongguoxiangdao, and detected 27 QTLs on ten rice chromosomes. Among them, twelve QTLs responsive for grain shape/ or yield were mostly reproducibly detected and had not yet been reported before. Interestingly, the two known genes involved in the materials, with one insect-resistant Bt gene, and the other disease-resistant Xa21 gene, were found to closely link the QTLs responsive for grain shape and weight. The Bt fragment insertion was firstly mapped on the chromosome 10 in Huahui 3 and may disrupt grain-related QTLs resulting in weaker yield performance in transgenic plants. The introgression of Xa21 gene by backcrossing from donor material into receptor Minghui 63 may also contain a donor linkage drag which included minor-effect QTL alleles positively affecting grain shape and yield. The QTL analysis on rice grain appearance quality exemplified the typical events of transgenic or backcrossing breeding. The QTL findings in this study will in the future facilitate the gene isolation and breeding application for improvement of rice grain shape and yield. PMID:25320558

QTL analysis on rice grain appearance quality, as exemplifying the typical events of transgenic or backcrossing breeding.

PubMed

Yan, Bao; Liu, Rongjia; Li, Yibo; Wang, Yan; Gao, Guanjun; Zhang, Qinglu; Liu, Xing; Jiang, Gonghao; He, Yuqing

2014-09-01

Rice grain shape and yield are usually controlled by multiple quantitative trait loci (QTL). This study used a set of F9-10 recombinant inbred lines (RILs) derived from a cross of Huahui 3 (Bt/Xa21) and Zhongguoxiangdao, and detected 27 QTLs on ten rice chromosomes. Among them, twelve QTLs responsive for grain shape/ or yield were mostly reproducibly detected and had not yet been reported before. Interestingly, the two known genes involved in the materials, with one insect-resistant Bt gene, and the other disease-resistant Xa21 gene, were found to closely link the QTLs responsive for grain shape and weight. The Bt fragment insertion was firstly mapped on the chromosome 10 in Huahui 3 and may disrupt grain-related QTLs resulting in weaker yield performance in transgenic plants. The introgression of Xa21 gene by backcrossing from donor material into receptor Minghui 63 may also contain a donor linkage drag which included minor-effect QTL alleles positively affecting grain shape and yield. The QTL analysis on rice grain appearance quality exemplified the typical events of transgenic or backcrossing breeding. The QTL findings in this study will in the future facilitate the gene isolation and breeding application for improvement of rice grain shape and yield.

Aviation Requirements for Use of Recycled MIL-PRF-680

DTIC Science & Technology

2012-05-24

components – Approximately 1,000 gallons of virgin MIL-PRF-680 Type II used and disposed every 6 months at Fort Rucker Calculated using the full...capacity of the parts washers – Recycling will reduce the need to purchase virgin solvent and reduce disposal costs – Expressed interest received...with virgin solvent Clarus PCS-25 Parts Washer Clarus Tornado Filtration System INSERT EVENT TITLE – INSERT MONTH & YEAR Aviation Requirements for Use

Instrumented Footwear Inserts: A New Tool for Measuring Forces and Biomechanical State Changes During Dynamic Movements

DTIC Science & Technology

2017-03-03

biomechanical gait state changes within prolonged exercise or training events. II. MATERIAL AND METHODS A. Instrumented Insert Design We developed a...beginning and end of each data collection trial using a user interface designed specifically for this purpose in MATLAB. F. Calibration Proces:Static...consisted of walking for several minutes indoors (thin carpeted surface on concrete) and outdoors on several different surfaces ( pavement , gravel and

Increasing genomic diversity and evidence of constrained lifestyle evolution due to insertion sequences in Aeromonas salmonicida.

PubMed

Vincent, Antony T; Trudel, Mélanie V; Freschi, Luca; Nagar, Vandan; Gagné-Thivierge, Cynthia; Levesque, Roger C; Charette, Steve J

2016-01-12

Aeromonads make up a group of Gram-negative bacteria that includes human and fish pathogens. The Aeromonas salmonicida species has the peculiarity of including five known subspecies. However, few studies of the genomes of A. salmonicida subspecies have been reported to date. We sequenced the genomes of additional A. salmonicida isolates, including three from India, using next-generation sequencing in order to gain a better understanding of the genomic and phylogenetic links between A. salmonicida subspecies. Their relative phylogenetic positions were confirmed by a core genome phylogeny based on 1645 gene sequences. The Indian isolates, which formed a sub-group together with A. salmonicida subsp. pectinolytica, were able to grow at either at 18 °C and 37 °C, unlike the A. salmonicida psychrophilic isolates that did not grow at 37 °C. Amino acid frequencies, GC content, tRNA composition, loss and gain of genes during evolution, pseudogenes as well as genes under positive selection and the mobilome were studied to explain this intraspecies dichotomy. Insertion sequences appeared to be an important driving force that locked the psychrophilic strains into their particular lifestyle in order to conserve their genomic integrity. This observation, based on comparative genomics, is in agreement with previous results showing that insertion sequence mobility induced by heat in A. salmonicida subspecies causes genomic plasticity, resulting in a deleterious effect on the virulence of the bacterium. We provide a proof-of-concept that selfish DNAs play a major role in the evolution of bacterial species by modeling genomes.

Direct cloning from enrichment cultures, a reliable strategy for isolation of complete operons and genes from microbial consortia.

PubMed

Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R

2001-01-01

Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).

Genomic Diversity of Type B3 Bacteriophages of Caulobacter crescentus.

PubMed

Ash, Kurt T; Drake, Kristina M; Gibbs, Whitney S; Ely, Bert

2017-07-01

The genomes of the type B3 bacteriophages that infect Caulobacter crescentus are among the largest phage genomes thus far deposited into GenBank with sizes over 200 kb. In this study, we introduce six new bacteriophage genomes which were obtained from phage collected from various water systems in the southeastern United States and from tropical locations across the globe. A comparative analysis of the 12 available genomes revealed a "core genome" which accounts for roughly 1/3 of these bacteriophage genomes and is predominately localized to the head, tail, and lysis gene regions. Despite being isolated from geographically distinct locations, the genomes of these bacteriophages are highly conserved in both genome sequence and gene order. We also identified the insertions, deletions, translocations, and horizontal gene transfer events which are responsible for the genomic diversity of this group of bacteriophages and demonstrated that these changes are not consistent with the idea that modular reassortment of genomes occurs in this group of bacteriophages.

Lexical Selection Differences between Monolingual and Bilingual Listeners

PubMed Central

Friesen, Deanna C.; Chung-Fat-Yim, Ashley; Bialystok, Ellen

2015-01-01

Three studies are reported investigating how monolinguals and bilinguals resolve within-language competition when listening to isolated words. Participants saw two pictures that were semantically-related, phonologically-related, or unrelated and heard a word naming one of them while event-related potentials were recorded. In Studies 1 and 2, the pictures and auditory cue were presented simultaneously and the related conditions produced interference for both groups. Monolinguals showed reduced N400s to the semantically-related pairs but there was no modulation in this component by bilinguals. Study 3 inserted an interval between picture and word onset. For picture onset, both groups exhibited reduced N400s to semantically-related pictures; for word onset, both groups showed larger N400s to phonologically-related pictures. Overall, bilinguals showed less integration of related items in simultaneous (but not sequential) presentation, presumably because of interference from the activated non-English language. Thus, simple lexical selection for bilinguals includes more conflict than it does for monolinguals. PMID:26684415

A Metagenome-Wide Association Study and Arrayed Mutant Library Confirm Acetobacter Lipopolysaccharide Genes Are Necessary for Association with Drosophila melanogaster.

PubMed

White, K Makay; Matthews, Melinda K; Hughes, Rachel C; Sommer, Andrew J; Griffitts, Joel S; Newell, Peter D; Chaston, John M

2018-03-28

A metagenome wide association (MGWA) study of bacterial host association determinants in Drosophila predicted that LPS biosynthesis genes are significantly associated with host colonization. We were unable to create site-directed mutants for each of the predicted genes in Acetobacter , so we created an arrayed transposon insertion library using Acetobacter fabarum DsW_054 isolated from Drosophila Creation of the A. fabarum DsW_054 gene knock-out library was performed by combinatorial mapping and Illumina sequencing of random transposon insertion mutants. Transposon insertion locations for 6,418 mutants were successfully mapped, including hits within 63% of annotated genes in the A. fabarum DsW_054 genome. For 45/45 members of the library, insertion sites were verified by arbitrary PCR and Sanger sequencing. Mutants with insertions in four different LPS biosynthesis genes were selected from the library to validate the MGWA predictions. Insertion mutations in two genes biosynthetically upstream of Lipid-A formation, lpxC and lpxB , show significant differences in host association, whereas mutations in two genes encoding LPS biosynthesis functions downstream of Lipid-A biosynthesis had no effect. These results suggest an impact of bacterial cell surface molecules on the bacterial capacity for host association. Also, the transposon insertion mutant library will be a useful resource for ongoing research on the genetic basis for Acetobacter traits. Copyright © 2018 White et al.

Detection of class 1 and 2 integrons, extended-spectrum β-lactamases and qnr alleles in enterobacterial isolates from the digestive tract of Intensive Care Unit inpatients.

PubMed

Bado, Inés; Cordeiro, Nicolás F; Robino, Luciana; García-Fulgueiras, Virginia; Seija, Verónica; Bazet, Cristina; Gutkind, Gabriel; Ayala, Juan A; Vignoli, Rafael

2010-11-01

In this study, we searched for extended-spectrum β-lactamases (ESBLs), class 1 and 2 integrons, and qnrA, qnrB and qnrS genes in 56 oxyimino-cephalosporin and/or ciprofloxacin-resistant enterobacterial isolates obtained from the gastrointestinal tract of patients admitted in an Intensive Care Unit in Uruguay. ESBLs were detected in 11 isolates (6 CTX-M-2, 3 CTX-M-9, 1 CTX-M-15 and 1 PER-2). qnr genes and integrons were detected in 5 and 24 isolates, respectively. Eight different antibiotic resistance gene cassettes were found within six different genetic arrangements. Two types of complex class 1 integrons carrying insertion sequence ISCR1 were found, one showing bla(CTX-M-2)-orf3 and the other qnrA1-ampR. Ten of the thirteen isolates carrying class 2 integrons presented the element IS5 inserted between intI2 and dfrA1, whereas another class 2 integron lacked the internal stop codon usually present in intI2. This is the first report of the occurrence of qnrA, qnrB and bla(CTX-M-9) in Uruguay. Dissemination of the different groups of CTX-M enzymes (i.e. groups 1, 2 and 9) appears to be a recent phenomenon in South America. Copyright © 2010 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

Impact of Insertion Sequences and Recombination on the Population Structure of Staphylococcus haemolyticus.

PubMed

Bouchami, Ons; de Lencastre, Herminia; Miragaia, Maria

2016-01-01

Staphylococcus haemolyticus is one of the most common pathogens associated with medical-device related infections, but its molecular epidemiology is poorly explored. In the current study, we aimed to better understand the genetic mechanisms contributing to S. haemolyticus diversity in the hospital environment and their impact on the population structure and clinical relevant phenotypic traits. The analysis of a representative S. haemolyticus collection by multilocus sequence typing (MLST) has identified a single highly prevalent and diverse genetic lineage of nosocomial S. haemolyticus clonal complex (CC) 29 accounting for 91% of the collection of isolates disseminated worldwide. The examination of the sequence changes at MLST loci during clonal diversification showed that recombination had a higher impact than mutation in shaping the S. haemolyticus population. Also, we ascertained that another mechanism contributing significantly to clonal diversification and adaptation was mediated by insertion sequence (IS) elements. We found that all nosocomial S. haemolyticus, belonging to different STs, were rich in IS1272 copies, as determined by Southern hybridization of macrorestriction patterns. In particular, we observed that the chromosome of a S. haemolyticus strain within CC29 was highly unstable during serial growth in vitro which paralleled with IS1272 transposition events and changes in clinically relevant phenotypic traits namely, mannitol fermentation, susceptibility to beta-lactams, biofilm formation and hemolysis. Our results suggest that recombination and IS transposition might be a strategy of adaptation, evolution and pathogenicity of the major S. haemolyticus prevalent lineage in the hospital environment.

Impact of Insertion Sequences and Recombination on the Population Structure of Staphylococcus haemolyticus

PubMed Central

Bouchami, Ons; de Lencastre, Herminia; Miragaia, Maria

2016-01-01

Staphylococcus haemolyticus is one of the most common pathogens associated with medical-device related infections, but its molecular epidemiology is poorly explored. In the current study, we aimed to better understand the genetic mechanisms contributing to S. haemolyticus diversity in the hospital environment and their impact on the population structure and clinical relevant phenotypic traits. The analysis of a representative S. haemolyticus collection by multilocus sequence typing (MLST) has identified a single highly prevalent and diverse genetic lineage of nosocomial S. haemolyticus clonal complex (CC) 29 accounting for 91% of the collection of isolates disseminated worldwide. The examination of the sequence changes at MLST loci during clonal diversification showed that recombination had a higher impact than mutation in shaping the S. haemolyticus population. Also, we ascertained that another mechanism contributing significantly to clonal diversification and adaptation was mediated by insertion sequence (IS) elements. We found that all nosocomial S. haemolyticus, belonging to different STs, were rich in IS1272 copies, as determined by Southern hybridization of macrorestriction patterns. In particular, we observed that the chromosome of a S. haemolyticus strain within CC29 was highly unstable during serial growth in vitro which paralleled with IS1272 transposition events and changes in clinically relevant phenotypic traits namely, mannitol fermentation, susceptibility to beta-lactams, biofilm formation and hemolysis. Our results suggest that recombination and IS transposition might be a strategy of adaptation, evolution and pathogenicity of the major S. haemolyticus prevalent lineage in the hospital environment. PMID:27249649

The Chlamydomonas Dhc1 gene encodes a dynein heavy chain subunit required for assembly of the I1 inner arm complex.

PubMed Central

Myster, S H; Knott, J A; O'Toole, E; Porter, M E

1997-01-01

Multiple members of the dynein heavy chain (Dhc) gene family have been recovered in several organisms, but the relationships between these sequences and the Dhc isoforms that they encode are largely unknown. To identify Dhc loci and determine the specific functions of the individual Dhc isoforms, we have screened a collection of motility mutants generated by insertional mutagenesis in Chlamydomonas. In this report, we characterize one strain, pf9-3, in which the insertion event was accompanied by a deletion of approximately 13 kb of genomic DNA within the transcription unit of the Dhc1 gene. Northern blot analysis confirms that pf9-3 is a null mutation. Biochemical and structural studies of isolated axonemes demonstrate that the pf9-3 mutant fails to assemble the I1 inner arm complex, a two-headed dynein isoform composed of two Dhcs (1 alpha and 1 beta) and three intermediate chains. To determine if the Dhc1 gene product corresponds to one of the Dhcs of the I1 complex, antibodies were generated against a Dhc1-specific peptide sequence. Immunoblot analysis reveals that the Dhc1 gene encodes the 1 alpha Dhc subunit. These studies thus, identify the first inner arm Dhc locus to be described in any organism and further demonstrate that the 1 alpha Dhc subunit plays an essential role in the assembly of the I1 inner arm complex. Images PMID:9247642

Sequence analysis of laci mutations obtained from lung cells of radon-exposed big blue{trademark} transgenic mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Layton, A.D.; Cross, F.T.; Steigler, G.L.

1994-12-31

We have exposed Big Blue{trademark} transgenic mice by inhalation to 320, 640 and 960 Working Level Months (WLM) of radon progeny. Mice were sacrificed after 3, 6 and 9 days; the time periods required to obtain the exposures. Control mice were also sacrificed at each time interval. In each case all tissues were excised, flash frozen in liquid nitrogen, and stored at -80{degrees}C for further analysis. Twelve lacI mutations have been isolated from the lung tissue of a mouse from the 960-WLM exposure group; the lacI genes from these mutants have been sequenced. Sequence data indicate that three of themore » mutants have a C;G deletion at BP 978 and are possibly clonal in origin. Two mutants have multiple events within the gene: one has a an A:T to C:G transversion and a C:G insertion separated by 291 BPs; the second has a G:C to A:T transition as well as an A:T deletion followed by 6 base pairs downstream by a T:A insertion. Other mutations include a single G:C to A:T transition, a two base pair deletion, and a C:G to T:A transition. Mutant plaques are being evaluated from individual mice at other dose levels. Time course experiments are also planned. These studies will help define the molecular fine structure of mutations induced by high-LET radiation exposure.« less

Intraoperative seizure and cerebrospinal fluid leak during adult cochlear implant surgery.

PubMed

Musser, Alexander B; Golub, Justin S; Samy, Ravi N; Phero, James C

2016-01-01

To report a rare case of cerebrospinal fluid gusher and subsequent seizure immediately after cochlear implant electrode insertion. After the cochlear implant electrode was inserted, brisk flow of 10 mL of cerebrospinal fluid was seen. The electrode was promptly inserted and the leak was additionally sealed with fascia. Seconds later, the patient had a tonic-clonic seizure lasting 30 seconds. Two additional episodes occurred during the case. Her postoperative course was uneventful with no subsequent seizures. The device has been successfully activated. Intervention & Technique: Postoperative imaging showed correct intracochlear placement of the electrode as well as an incidental enlarged vestibular aqueduct. Neurology consultation including electroencephalogram was unremarkable. To our knowledge, this is the first report of a seizure temporally associated with cochlear implant electrode insertion. The significance and possible casual relationship between these two events is discussed.

Peritoneal Dialysis Catheter Insertion.

PubMed

Crabtree, John H; Chow, Kai-Ming

2017-01-01

The success of peritoneal dialysis as renal-replacement therapy depends on a well-functioning peritoneal catheter. Knowledge of best practices in catheter insertion can minimize the risk of catheter complications that lead to peritoneal dialysis failure. The catheter placement procedure begins with preoperative assessment of the patient to determine the most appropriate catheter type, insertion site, and exit site location. Preoperative preparation of the patient is an instrumental step in facilitating the performance of the procedure, avoiding untoward events, and promoting the desired outcome. Catheter insertion methods include percutaneous needle-guidewire with or without image guidance, open surgical dissection, peritoneoscopic procedure, and surgical laparoscopy. The insertion technique used often depends on the geographic availability of material resources and local provider expertise in placing catheters. Independent of the catheter implantation approach, adherence to a number of universal details is required to ensure the best opportunity for creating a successful long-term peritoneal access. Finally, appropriate postoperative care and catheter break-in enables a smooth transition to dialysis therapy. Copyright © 2017 Elsevier Inc. All rights reserved.

Nonlinear analysis of r.c. framed buildings retrofitted with elastomeric and friction bearings under near-fault earthquakes

NASA Astrophysics Data System (ADS)

Mazza, Mirko

2015-12-01

Reinforced concrete (r.c.) framed buildings designed in compliance with inadequate seismic classifications and code provisions present in many cases a high vulnerability and need to be retrofitted. To this end, the insertion of a base isolation system allows a considerable reduction of the seismic loads transmitted to the superstructure. However, strong near-fault ground motions, which are characterised by long-duration horizontal pulses, may amplify the inelastic response of the superstructure and induce a failure of the isolation system. The above considerations point out the importance of checking the effectiveness of different isolation systems for retrofitting a r.c. framed structure. For this purpose, a numerical investigation is carried out with reference to a six-storey r.c. framed building, which, primarily designed (as to be a fixed-base one) in compliance with the previous Italian code (DM96) for a medium-risk seismic zone, has to be retrofitted by insertion of an isolation system at the base for attaining performance levels imposed by the current Italian code (NTC08) in a high-risk seismic zone. Besides the (fixed-base) original structure, three cases of base isolation are studied: elastomeric bearings acting alone (e.g. HDLRBs); in-parallel combination of elastomeric and friction bearings (e.g. high-damping-laminated-rubber bearings, HDLRBs and steel-PTFE sliding bearings, SBs); friction bearings acting alone (e.g. friction pendulum bearings, FPBs). The nonlinear analysis of the fixed-base and base-isolated structures subjected to horizontal components of near-fault ground motions is performed for checking plastic conditions at the potential critical (end) sections of the girders and columns as well as critical conditions of the isolation systems. Unexpected high values of ductility demand are highlighted at the lower floors of all base-isolated structures, while re-centring problems of the base isolation systems under near-fault earthquakes are expected in case of friction bearings acting alone (i.e. FPBs) or that in combination (i.e. SBs) with HDLRBs.

Insertion sequence typing of Mycobacterium tuberculosis: characterization of a widespread subtype with a single copy of IS6110.

PubMed

Fomukong, N G; Tang, T H; al-Maamary, S; Ibrahim, W A; Ramayah, S; Yates, M; Zainuddin, Z F; Dale, J W

1994-12-01

DNA fingerprinting with the insertion sequence IS6110 (also known as IS986) has become established as a major tool for investigating the spread of tuberculosis. Most strains of Mycobacterium tuberculosis have multiple copies of IS6110, but a small minority carry a single copy only. We have examined selected strains from Malaysia, Tanzania and Oman, in comparison with M. bovis isolates and BCG strains carrying one or two copies of IS6110. The insertion sequence appears to be present in the same position in all these strains, which suggests that in these organisms the element is defective in transposition and that the loss of transposability may have occurred at an early stage in the evolution of the M. tuberculosis complex.

Spin Hall driven domain wall motion in magnetic bilayers coupled by a magnetic oxide interlayer

NASA Astrophysics Data System (ADS)

Liu, Yang; Furuta, Masaki; Zhu, Jian-Gang Jimmy

2018-05-01

mCell, previously proposed by our group, is a four-terminal magnetoresistive device with isolated write- and read-paths for all-spin logic and memory applications. A mCell requires an electric-insulating magnetic layer to couple the spin Hall driven write-path to the magnetic free layer of the read-path. Both paths are magnetic layers with perpendicular anisotropy and their perpendicularly oriented magnetization needs to be maintained with this insertion layer. We have developed a magnetic oxide (FeOx) insertion layer to serve for these purposes. We show that the FeOx insertion layer provides sufficient magnetic coupling between adjacent perpendicular magnetic layers. Resistance measurement shows that this magnetic oxide layer can act as an electric-insulating layer. In addition, spin Hall driven domain wall motion in magnetic bi-layers coupled by the FeOx insertion layer is significantly enhanced compared to that in magnetic single layer; it also requires low voltage threshold that poses possibility for power-efficient device applications.

Mycobacterium smegmatis strain for detection of Mycobacterium tuberculosis by PCR used as internal control for inhibition of amplification and for quantification of bacteria.

PubMed Central

Kolk, A H; Noordhoek, G T; de Leeuw, O; Kuijper, S; van Embden, J D

1994-01-01

For the detection of Mycobacterium tuberculosis by PCR, the IS6110 sequence was used. A modified target was constructed by insertion of 56 nucleotides in the IS6110 insertion element of Mycobacterium bovis BCG. This modified insertion sequence was integrated into the genome of Mycobacterium smegmatis, a mycobacterium species which does not contain the IS6110 element. When DNA from the modified M. smegmatis 1008 strain was amplified with IS6110-specific primers INS1 and INS2, a band of 301 bp was seen on agarose gel, whereas the PCR product of M. tuberculosis complex DNA was a 245-bp fragment with these primers. The addition of a small number of M. smegmatis 1008 cells to clinical samples before DNA purification enables the detection of problems which may be due to the loss of DNA in the isolation procedure or to the presence of inhibitors. The presence of inhibitors of the amplification reaction can be confirmed by the addition of M. smegmatis 1008 DNA after the DNA isolation procedure. Furthermore, competition between the different target DNAs of M. smegmatis 1008 DNA and M. tuberculosis complex DNA enables the estimation of the number of IS6110 elements in the clinical sample. Images PMID:8051267

Isolation and Expression of the Lysis Genes of Actinomyces naeslundii Phage Av-1

PubMed Central

Delisle, Allan L.; Barcak, Gerard J.; Guo, Ming

2006-01-01

Like most gram-positive oral bacteria, Actinomyces naeslundii is resistant to salivary lysozyme and to most other lytic enzymes. We are interested in studying the lysins of phages of this important oral bacterium as potential diagnostic and therapeutic agents. To identify the Actinomyces phage genes encoding these species-specific enzymes in Escherichia coli, we constructed a new cloning vector, pAD330, that can be used to enrich for and isolate phage holin genes, which are located adjacent to the lysin genes in most phage genomes. Cloned holin insert sequences were used to design sequencing primers to identify nearby lysin genes by using whole phage DNA as the template. From partial digestions of A. naeslundii phage Av-1 genomic DNA we were able to clone, in independent experiments, inserts that complemented the defective λ holin in pAD330, as evidenced by extensive lysis after thermal induction. The DNA sequence of the inserts in these plasmids revealed that both contained the complete lysis region of Av-1, which is comprised of two holin-like genes, designated holA and holB, and an endolysin gene, designated lysA. We were able to subclone and express these genes and determine some of the functional properties of their gene products. PMID:16461656

Shock isolator for operating a diode laser on a closed-cycle refrigerator

NASA Technical Reports Server (NTRS)

Jennings, D. E. (Inventor)

1979-01-01

A diode laser mounted within a helium refrigerator is mounted using a braided copper ground strap which provides good impact shock isolation from the refrigerator cold-tip while also providing a good thermal link to the cold-tip. The diode mount also contains a rigid stand-off assembly consisting of alternate sections of nylon and copper which serve as cold stations to improve thermal isolation from the vaccum housing mounting structure. Included in the mount is a Pb-In alloy wafer inserted between the cold-tip and the diode to damp temperature fluctuations occurring at the cold-tip.

Material containment enclosure

DOEpatents

Carlson, David O.

1993-01-01

An isolation enclosure and a group of isolation enclosures useful when a relatively large containment area is required. The enclosure is in the form of a ring having a section removed so that a technician may enter the center area of the ring. In a preferred embodiment, an access zone is located in the transparent wall of the enclosure and extends around the inner perimeter of the ring so that a technician can insert his hands into the enclosure to reach any point within. The inventive enclosures provide more containment area per unit area of floor space than conventional material isolation enclosures.

Spread of Plasmids Carrying Multiple GES Variants

PubMed Central

Cuzon, Gaelle; Bogaerts, Pierre; Bauraing, Caroline; Huang, Te-Din; Glupczynski, Youri

2016-01-01

Five GES-producing Enterobacteriaceae isolates that displayed an extended-spectrum β-lactamase (ESBL) phenotype harbored two GES variants: GES-7 ESBL and GES-6 carbapenemase. In all isolates, the two GES alleles were located on the same integron that was inserted into an 80-kb IncM1 self-conjugative plasmid. Whole-genome sequencing suggested in vivo horizontal gene transfer of the plasmid along with clonal diffusion of Enterobacter cloacae. To our knowledge, this is the first description in Europe of clustered Enterobacteriaceae isolates carrying two GES β-lactamases, of which one has extended activity toward carbapenems. PMID:27216071

Characterization of T-DNA insertion mutants with decreased virulence in the entomopathogenic fungus Beauveria bassiana JEF-007.

PubMed

Kim, Sihyeon; Lee, Se Jin; Nai, Yu-Shin; Yu, Jeong Seon; Lee, Mi Rong; Yang, Yi-Ting; Kim, Jae Su

2016-10-01

The bean bug, Riptortus pedestris, is a major agricultural pest that reduces crop quality and value. Chemical pesticides have contributed to pest management, but resistance to these chemicals has significantly limited their use. Alternative strategies with different modes of action, such as entomopathogenic fungi, are therefore of great interest. Herein, we explored how entomopathogenic fungi can potentially be used to control the bean bug and focused on identifying virulence-related genes. Beauveria bassiana (JEF isolates) were assayed against bean bugs under laboratory conditions. One isolate, JEF-007, showed >80 % virulence by both spray and contact exposure methods. Agrobacterium tumefaciens-mediated transformation (AtMT) of JEF-007 generated 249 random transformants, two of which (B1-06 and C1-49) showed significantly reduced virulence against Tenebrio molitor and R. pedestris immatures. Both species were used for rapid screening of virulence-reduced mutants. The two transformants had different morphologies, conidial production, and thermotolerance than the wild type. To determine the localization of the randomly inserted T-DNA, thermal asymmetric interlaced (TAIL) PCR was conducted and analysis of the two clones found multiple T-DNA insertions (two in B1-06 and three in C1-49). Genes encoding complex I intermediate-associated protein 30 (CIA30) and the autophagy protein (Atg22) were possibly disrupted by the T-DNA insertion and might be involved in the virulence. This work provides a strong platform for future functional genetic studies of bean bug-pathogenic B. bassiana. The genes putatively involved in fungal virulence should be experimentally validated by knockdown in future studies.

A Genetic Screen for Pathogenicity Genes in the Hemibiotrophic Fungus Colletotrichum higginsianum Identifies the Plasma Membrane Proton Pump Pma2 Required for Host Penetration

PubMed Central

Dahl, Marlis; Müller, Susanne; Voll, Lars M.; Koch, Christian

2015-01-01

We used insertional mutagenesis by Agrobacterium tumefaciens mediated transformation (ATMT) to isolate pathogenicity mutants of Colletotrichum higginsianum. From a collection of 7200 insertion mutants we isolated 75 mutants with reduced symptoms. 19 of these were affected in host penetration, while 17 were affected in later stages of infection, like switching to necrotrophic growth. For 16 mutants the location of T-DNA insertions could be identified by PCR. A potential plasma membrane H+-ATPase Pma2 was targeted in five independent insertion mutants. We genetically inactivated the Ku80 component of the non-homologous end-joining pathway in C. higginsianum to establish an efficient gene knockout protocol. Chpma2 deletion mutants generated by homologous recombination in the ΔChku80 background form fully melanized appressoria but entirely fail to penetrate the host tissue and are non-pathogenic. The ChPMA2 gene is induced upon appressoria formation and infection of A. thaliana. Pma2 activity is not important for vegetative growth of saprophytically growing mycelium, since the mutant shows no growth penalty under these conditions. Colletotrichum higginsianum codes for a closely related gene (ChPMA1), which is highly expressed under most growth conditions. ChPMA1 is more similar to the homologous yeast genes for plasma membrane pumps. We propose that expression of a specific proton pump early during infection may be common to many appressoria forming fungal pathogens as we found ChPMA2 orthologs in several plant pathogenic fungi. PMID:25992547

Low jitter, low inductance solid dielectric switches.

PubMed

Guenther, A H; Strickland, D M; Bettis, J R

1979-11-01

It has been shown that the use of graded solid dielectric sandwiches in laser-triggered spark gaps (LTS) can lead to highly desirable multichannel operations while maintaining the low delay and jitter performance characteristics of LTS. As many as ten separate breakdown channels were observed when small circular or hexagonal aluminum inserts were inserted between two Mylar dielectric sheets stressed at 4.1 kV/mil. A reduction in rise time was noted for these multichannel switching events.

Direct Cloning of Yeast Genes from an Ordered Set of Lambda Clones in Saccharomyces Cerevisiae by Recombination in Vivo

PubMed Central

Erickson, J. R.; Johnston, M.

1993-01-01

We describe a technique that facilitates the isolation of yeast genes that are difficult to clone. This technique utilizes a plasmid vector that rescues lambda clones as yeast centromere plasmids. The source of these lambda clones is a set of clones whose location in the yeast genome has been determined by L. Riles et al. in 1993. The Esherichia coli-yeast shuttle plasmid carries URA3, ARS4 and CEN6, and contains DNA fragments from the lambda vector that flank the cloned yeast insert. When yeast is cotransformed with linearized plasmid and lambda clone DNA, Ura(+) transformants are obtained by a recombination event between the lambda clone and the plasmid vector that generates an autonomously replicating plasmid containing the cloned yeast DNA sequences. Genes whose genetic map positions are known can easily be identified and recovered in this plasmid by testing only those lambda clones that map to the relevant region of the yeast genome for their ability to complement the mutant phenotype. This technique facilitates the isolation of yeast genes that resist cloning either because (1) they are underrepresented in yeast genomic libraries amplified in E. coli, (2) they provide phenotypes that are too marginal to allow selection of the gene by genetic complementation or (3) they provide phenotypes that are laborious to score. We demonstrate the utility of this technique by isolating three genes, GAL83, SSN2 and MAK7, each of which presents one of these problems for cloning. PMID:8514124

Transgenic poplars with reduced lignin show impaired xylem conductivity, growth efficiency and survival

Treesearch

Steven L. Voelker; Barbara Lachenbruch; Frederick C. Meinzer; Peter Kitin; Steven H. Strauss

2011-01-01

We studied xylem anatomy and hydraulic architecture in 14 transgenic insertion events and a control line of hybrid poplar (Populus spp.) that varied in lignin content. Transgenic events had different levels of down-regulation of two genes encoding 4-coumarate:coenzyme A ligase (4CL). Two-year-old trees were characterized after...

Turnover of R1 (Type I) and R2 (Type Ii) Retrotransposable Elements in the Ribosomal DNA of Drosophila Melanogaster

PubMed Central

Jakubczak, J. L.; Zenni, M. K.; Woodruff, R. C.; Eickbush, T. H.

1992-01-01

R1 and R2 are distantly related non-long terminal repeat retrotransposable elements each of which inserts into a specific site in the 28S rRNA genes of most insects. We have analyzed aspects of R1 and R2 abundance and sequence variation in 27 geographical isolates of Drosophila melanogaster. The fraction of 28S rRNA genes containing these elements varied greatly between strains, 17-67% for R1 elements and 2-28% for R2 elements. The total percentage of the rDNA repeats inserted ranged from 32 to 77%. The fraction of the rDNA repeats that contained both of these elements suggested that R1 and R2 exhibit neither an inhibition of nor preference for insertion into a 28S gene already containing the other type of element. Based on the conservation of restriction sites in the elements of all strains, and sequence analysis of individual elements from three strains, nucleotide divergence is very low for R1 and R2 elements within or between strains (<0.6%). This sequence uniformity is the expected result of the forces of concerted evolution (unequal crossovers and gene conversion) which act on the rRNA genes themselves. Evidence for the role of retrotransposition in the turnover of R1 and R2 was obtained by using naturally occurring 5' length polymorphisms of the elements as markers for independent transposition events. The pattern of these different length 5' truncations of R1 and R2 was found to be diverse and unique to most strains analyzed. Because recombination can only, with time, amplify or eliminate those length variants already present, the diversity found in each strain suggests that retrotransposition has played a critical role in maintaining these elements in the rDNA repeats of D. melanogaster. PMID:1317313

The molecular biology of environmental aromatic hydrocarbons: Progress report for the period September 1, 1986 through July 31, 1987

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weiss, S.B.

Our laboratory has explored the use of short DNA oligomers as targets for activated polycyclic aromatic hydrocarbons, such as benzo(a)pyrene diol epoxide (BPDE), in order to detect alterations in DNA sequence arrangement. In this model system, oligomers alkylated with (+)-BPDE are ligated into M13 viral DNA and used to transfect Escherichia coli. These cells are plated on agar, incubated at 37/sup 0/C, progeny viral clones are selected, amplified, and the viral DNAs isolated are sequenced at the site of oligomer insertion. We have devised a procedure for the preparation of unique duplex DNA oligomers such that the site of oligomermore » alkylation is specific for a single deoxynucleotide species in the two DNA strands. The procedure for oligomer assembly also allows us to vary the position of the alkylated residue in each of the two strands. Using our model system, the results obtained over the past year can be summarized as follows. When nonalkylated oligomer constructs are ligated into M13 viral DNA and used to transfect E. coli, no modifications in DNA sequence arrangement are detected in progeny viral DNAs. On the other hand, with oligomer constructs containing BP-adducts two major types of modifications in DNA sequence arrangement were observed: (1) large deletions, and (2) nonhomologous (illegitimate) recombinants. Both of these DNA modifications result in the complete removal of the oligomer insert. Transfection of E. coli that are recA/sup -/ does not alter these DNA modifications, therefore, it appears that the deletions and recombinants induced by the alkylated inserts are not under control of the RecA gene. As the distance between the alkylated residues in the duplex strands is increased, the number of recombinant events detected is reduced. In addition to the above types of DNA modifications, restoration of the original nucleotide sequence in the alkylated construct was also observed in progeny viral DNAs. 7 refs., 6 figs., 2 tabs.« less

Sequence and Secondary Structure of the Mitochondrial Small-Subunit rRNA V4, V6, and V9 Domains Reveal Highly Species-Specific Variations within the Genus Agrocybe

PubMed Central

Gonzalez, Patrice; Labarère, Jacques

1998-01-01

A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The conservation of the sequences of the V4, V6, and V9 domains of the mitochondrial SSU rRNA within species and the high degree of interspecific variation found in the Agrocybe species studied open the way for these sequences to be used as specific molecular markers of the Basidiomycota. PMID:9797259

Sequence and secondary structure of the mitochondrial small-subunit rRNA V4, V6, and V9 domains reveal highly species-specific variations within the genus Agrocybe.

PubMed

Gonzalez, P; Labarère, J

1998-11-01

A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The conservation of the sequences of the V4, V6, and V9 domains of the mitochondrial SSU rRNA within species and the high degree of interspecific variation found in the Agrocybe species studied open the way for these sequences to be used as specific molecular markers of the Basidiomycota.

Tensiometer and method of determining soil moisture potential in below-grade earthen soil

DOEpatents

Hubbell, J.M.; Mattson, E.D.; Sisson, J.B.

1998-06-02

A tensiometer to in-situ determine below-grade soil moisture, potential of earthen soil includes, (a) an apparatus adapted for insertion into earthen soil below grade, the apparatus having a below-grade portion, and, comprising; (b) a porous material provided in the below-grade portion, the porous material at least in part defining a below-grade first fluid chamber; (c) a first fluid conduit extending outwardly of the first fluid chamber; (d) a first controllable isolation valve provided within the first fluid conduit, the first controllable isolation valve defining a second fluid chamber in fluid communication with the first fluid chamber through the first fluid conduit and the isolation valve, the first controllable isolation valve being received within the below-grade portion; and (e) a pressure transducer in fluid communication with the first fluid chamber, the pressure transducer being received within the below-grade portion. An alternate embodiment includes an apparatus adapted for insertion into earthen soil below grade, the apparatus having a below-grade portion, and including: (1) a porous material provided in the below-grade portion, the porous material at least in part defining a below-grade first fluid chamber; and (2) a pressure sensing apparatus in fluid communication with the first fluid chamber, the pressure sensing apparatus being entirely received within the below-grade portion. A method is also disclosed using the above and other apparatus. 6 figs.

Tensiometer and method of determining soil moisture potential in below-grade earthen soil

DOEpatents

Hubbell, Joel M.; Mattson, Earl D.; Sisson, James B.

1998-01-01

A tensiometer to in situ determine below-grade soil moisture, potential of earthen soil includes, a) an apparatus adapted for insertion into earthen soil below grade, the apparatus having a below-grade portion, and, comprising; b) a porous material provided in the below-grade portion, the porous material at least in part defining a below-grade first fluid chamber; c) a first fluid conduit extending outwardly of the first fluid chamber; d) a first controllable isolation valve provided within the first fluid conduit, the first controllable isolation valve defining a second fluid chamber in fluid communication with the first fluid chamber through the first fluid conduit and the isolation valve, the first controllable isolation valve being received within the below-grade portion; and e) a pressure transducer in fluid communication with the first fluid chamber, the pressure transducer being received within the below-grade portion. An alternate embodiment includes an apparatus adapted for insertion into earthen soil below grade, the apparatus having a below-grade portion, and including: i) a porous material provided in the below-grade portion, the porous material at least in part defining a below-grade first fluid chamber; and ii) a pressure sensing apparatus in fluid communication with the first fluid chamber, the pressure sensing apparatus being entirely received within the below-grade portion. A method is also disclosed using the above and other apparatus.

Evaluation of a high resolution silicon PET insert module

NASA Astrophysics Data System (ADS)

Grkovski, Milan; Brzezinski, Karol; Cindro, Vladimir; Clinthorne, Neal H.; Kagan, Harris; Lacasta, Carlos; Mikuž, Marko; Solaz, Carles; Studen, Andrej; Weilhammer, Peter; Žontar, Dejan

2015-07-01

Conventional PET systems can be augmented with additional detectors placed in close proximity of the region of interest. We developed a high resolution PET insert module to evaluate the added benefit of such a combination. The insert module consists of two back-to-back 1 mm thick silicon sensors, each segmented into 1040 1 mm2 pads arranged in a 40 by 26 array. A set of 16 VATAGP7.1 ASICs and a custom assembled data acquisition board were used to read out the signal from the insert module. Data were acquired in slice (2D) geometry with a Jaszczak phantom (rod diameters of 1.2-4.8 mm) filled with 18F-FDG and the images were reconstructed with ML-EM method. Both data with full and limited angular coverage from the insert module were considered and three types of coincidence events were combined. The ratio of high-resolution data that substantially improves quality of the reconstructed image for the region near the surface of the insert module was estimated to be about 4%. Results from our previous studies suggest that such ratio could be achieved at a moderate technological expense by using an equivalent of two insert modules (an effective sensor thickness of 4 mm).

Successful Demonstration of New Isolated Bridge System at UCB Shaking Table

Science.gov Websites

other events Successful Demonstration of New Isolated Bridge System at UCB Shaking Table PEER Events Successful Demonstration of New Isolated Bridge System at UCB Shaking Table On May 26, 2010 over 100 demonstration of a new isolated bridge system at the PEER Earthquake Simulator Laboratory at UC Berkeley’s

Genetic variation in the 3’ untranslated region of dengue virus serotype 3 strains isolated from mosquitoes and humans in Brazil

PubMed Central

2013-01-01

Summary Background Dengue, a mosquito-borne viral infection caused by one of the four dengue virus (DENV) serotypes (DENV-1 to 4), replicate alternately on the mosquito vector and human host and are responsible for infections throughout tropical and subtropical regions of the world. In Brazil, the disease has become a major public health problem and the introduction of DENV-3 in 2000 in Rio de Janeiro (RJ) was associated with severe dengue epidemics. The potential emergence of strains associated with severe disease highlights the need for the surveillance of DENV in human host and vectors. Methods Aiming to contribute for DENV phylogenetic and vector-virus-human host studies, we sequenced the entire genome of one DENV-3 isolated from naturally infected Aedes aegypti from RJ in 2001 and characterized the 3’ UTR from strains isolated from mosquitoes and humans. Mosquitoes were pooled and submitted to virus isolation in Ae. albopictus C6/36 cells and the infecting serotype was identified by immunofluorescence using type-specific monoclonal antibody. Sequence analysis was performed using BioEdit software, the multiple alignments were performed using CLUSTAL W and the phylogenetic analysis by MEGA 5, using the Neighbor-joining method. Secondary structure prediction was performed by using the MFOLD program. Results Exclusive substitutions and a substitution leading to a stop codon on the NS5 gene were observed in the DENV-3 isolated from a naturally infected Ae. aegypti and fully sequenced. As an 8- nucleotides deletion was observed within the 11- nucleotides (nts) insertion on the variable region (VR) from the 3′UTR in this isolate, we further sequenced other DENV-3 from both mosquitoes and humans. The majority of DENV-3 from RJ analyzed were characterized by the 11-nts insertion in the VR of the 3′UTR, despite the observation of strains carrying the 8-nts deletion. The latter presented similar secondary structures, however not all strains presenting the 11-nts insertion were similar in the predicted secondary structure. Conclusions The phylogeny based on the analysis of the complete genome and 3′UTR characterized the DENV-3 isolated from both vector and human host as belonging to Genotype III (GIII), despite the differences observed on the 3’ UTR. Further studies are needed to address the role of those mutations in the transmission of the different viral populations and vector competence. PMID:23282086

Genetic analyses place most Spanish isolates of Beauveria bassiana in a molecular group with word-wide distribution

PubMed Central

2011-01-01

Background The entomopathogenic anamorphic fungus Beauveria bassiana is currently used as a biocontrol agent (BCA) of insects. Fifty-seven Beauveria bassiana isolates -53 from Spain- were characterized, integrating group I intron insertion patterns at the 3'-end of the nuclear large subunit ribosomal gene (LSU rDNA) and elongation factor 1-alpha (EF1-α) phylogenetic information, in order to assess the genetic structure and diversity of this Spanish collection of B. bassiana. Results Group I intron genotype analysis was based on the four highly conserved insertion sites of the LSU (Ec2653, Ec2449, Ec2066, Ec1921). Of the 16 possible combinations/genotypes, only four were detected, two of which were predominant, containing 44 and 9 members out of 57 isolates, respectively. Interestingly, the members of the latter two genotypes showed unique differences in their growth temperatures. In follow, EF1-α phylogeny served to classify most of the strains in the B. bassiana s.s. (sensu stricto) group and separate them into 5 molecular subgroups, all of which contained a group I intron belonging to the IC1 subtype at the Ec1921 position. A number of parameters such as thermal growth or origin (host, geographic location and climatic conditions) were also examined but in general no association could be found. Conclusion Most Spanish B. bassiana isolates (77.2%) are grouped into a major phylogenetic subgroup with word-wide distribution. However, high phylogenetic diversity was also detected among Spanish isolates from close geographic zones with low climatic variation. In general, no correlation was observed between the molecular distribution and geographic origin or climatic characteristics where the Spanish B. bassiana isolates were sampled. PMID:21521527

Plague in the genomic area.

PubMed

Drancourt, M

2012-03-01

With plague being not only a subject of interest for historians, but still a disease of public health concern in several countries, mainly in Africa, there were hopes that analyses of the Yersinia pestis genomes would put an end to this deadly epidemic pathogen. Genomics revealed that Y. pestis isolates evolved from Yersinia pseudotuberculosis in Central Asia some millennia ago, after the acquisition of two Y. pestis-specific plasmids balanced genomic reduction parallel with the expansion of insertion sequences, illustrating the modern concept that, except for the acquisition of plasmid-borne toxin-encoding genes, the increased virulence of Y. pestis resulted from gene loss rather than gene acquisition. The telluric persistence of Y. pestis reminds us of this close relationship, and matters in terms of plague epidemiology. Whereas biotype Orientalis isolates spread worldwide, the Antiqua and Medievalis isolates showed more limited expansion. In addition to animal ectoparasites, human ectoparasites such as the body louse may have participated in this expansion and in devastating historical epidemics. The recent analysis of a Black Death genome indicated that it was more closely related to the Orientalis branch than to the Medievalis branch. Modern Y. pestis isolates grossly exhibit the same gene content, but still undergo micro-evolution in geographically limited areas by differing in the genome architecture, owing to inversions near insertion sequences and the stabilization of the YpfPhi prophage in Orientalis biotype isolates. Genomics have provided several new molecular tools for the genotyping and phylogeographical tracing of isolates and description of plague foci. However, genomics and post-genomics approaches have not yet provided new tools for the prevention, diagnosis and management of plague patients and the plague epidemics still raging in some sub-Saharan countries. © 2012 The Author. Clinical Microbiology and Infection © 2012 European Society of Clinical Microbiology and Infectious Diseases.

Spacecraft-to-Earth Communications for Juno and Mars Science Laboratory Critical Events

NASA Technical Reports Server (NTRS)

Soriano, Melissa; Finley, Susan; Jongeling, Andre; Fort, David; Goodhart, Charles; Rogstad, David; Navarro, Robert

2012-01-01

Deep Space communications typically utilize closed loop receivers and Binary Phase Shift Keying (BPSK) or Quadrature Phase Shift Keying (QPSK). Critical spacecraft events include orbit insertion and entry, descent, and landing.---Low gain antennas--> low signal -to-noise-ratio.---High dynamics such as parachute deployment or spin --> Doppler shift. During critical events, open loop receivers and Multiple Frequency Shift Keying (MFSK) used. Entry, Descent, Landing (EDL) Data Analysis (EDA) system detects tones in real-time.

Mitochondrial Ceramide-Rich Macrodomains Functionalize Bax upon Irradiation

PubMed Central

Lee, Hyunmi; Rotolo, Jimmy A.; Mesicek, Judith; Penate-Medina, Tuula; Rimner, Andreas; Liao, Wen-Chieh; Yin, Xianglei; Ragupathi, Govind; Ehleiter, Desiree; Gulbins, Erich; Zhai, Dayong; Reed, John C.; Haimovitz-Friedman, Adriana; Fuks, Zvi; Kolesnick, Richard

2011-01-01

Background Evidence indicates that Bax functions as a “lipidic” pore to regulate mitochondrial outer membrane permeabilization (MOMP), the apoptosis commitment step, through unknown membrane elements. Here we show mitochondrial ceramide elevation facilitates MOMP-mediated cytochrome c release in HeLa cells by generating a previously-unrecognized mitochondrial ceramide-rich macrodomain (MCRM), which we visualize and isolate, into which Bax integrates. Methodology/Principal Findings MCRMs, virtually non-existent in resting cells, form upon irradiation coupled to ceramide synthase-mediated ceramide elevation, optimizing Bax insertion/oligomerization and MOMP. MCRMs are detected by confocal microscopy in intact HeLa cells and isolated biophysically as a light membrane fraction from HeLa cell lysates. Inhibiting ceramide generation using a well-defined natural ceramide synthase inhibitor, Fumonisin B1, prevented radiation-induced Bax insertion, oligomerization and MOMP. MCRM deconstruction using purified mouse hepatic mitochondria revealed ceramide alone is non-apoptogenic. Rather Bax integrates into MCRMs, oligomerizing therein, conferring 1–2 log enhanced cytochrome c release. Consistent with this mechanism, MCRM Bax isolates as high molecular weight “pore-forming” oligomers, while non-MCRM membrane contains exclusively MOMP-incompatible monomeric Bax. Conclusions/Significance Our recent studies in the C. elegans germline indicate that mitochondrial ceramide generation is obligate for radiation-induced apoptosis, although a mechanism for ceramide action was not delineated. Here we demonstrate that ceramide, generated in the mitochondrial outer membrane of mammalian cells upon irradiation, forms a platform into which Bax inserts, oligomerizes and functionalizes as a pore. We posit conceptualization of ceramide as a membrane-based stress calibrator, driving membrane macrodomain organization, which in mitochondria regulates intensity of Bax-induced MOMP, and is pharmacologically tractable in vitro and in vivo. PMID:21695182

Guide wire entrapment by inferior vena cava filters: an experimental study.

PubMed

Rosen, Michael J; Burns, Justin M; Cobb, William S; Jacobs, David G; Heniford, B Todd; Sing, Ronald F

2005-09-01

In situ vena cava filters are at risk for complications with the use of J-tipped guide wires. The purpose of this study was to evaluate the impact of two commonly used J-tipped guide wires on the stability of the four most recently released vena cava filters in an in vitro flow model. Four filters (OptEase [F1], Günther Tulip [F2], Vena Tech LP [F3], and Recovery [F4]) were inserted into an in vitro flow model. Two J-tipped guide wires (0.032-inch [GW-1], 0.035-inch [GW-2]) were passed through each filter (n = 50 passes per wire) for a distance of 10 cm. The inserter was blind as to the effects of the wire. The filters were monitored by an independent observer for adverse events occurring between the filters and the guide wires. These were defined as: migrations (>1 cm), change of position (tilt>10 degrees), and entrapment of the wire (unable to remove wire). Descriptive statistics, chi-square, and Fisher's exact test were used (p < 0.05 considered significant). GW-1 resulted in a lower incidence of entrapment, migration, and tilt for all filters compared with GW-2 (F1, p = 0.003; F2, p < 0.0001; F3, p < 0.0001; F4, p = 0.0004). GW-1 resulted in entrapment in 0%, migration in 7.5%, and tilt in 10.5% of insertions. GW-2 resulted in entrapment in 1%, migration in 26.5%, and tilt in 5.5% of insertions. The incidence of adverse events for GW-1 was significantly different compared with all filters (F1, 0%; F2, 46%; F3, 4%; and F4, 22%; p < 0.0001). Similarly, the incidence of adverse events for GW-2 was significantly different when evaluating all filters (F1, 12%; F2, 48%; F3, 22%; F4 60%; p < 0.0001). The smaller-diameter guide wire resulted in a decreased incidence of adverse events for all filters, but there is still risk for complications. Knowledge of potential complications associated with vena cava filters and the postinsertion use of guide wires are essential to avoid potential mishaps.

76 FR 13884 - Special Local Regulation for Marine Event; Temporary Change of Dates for Recurring Marine Event...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-03-15

... DEPARTMENT OF HOMELAND SECURITY Coast Guard 33 CFR Part 100 [Docket No. USCG-2010-1094] RIN 1625... the docket, are part of docket USCG-2010-1094 and are available online by going to http://www.regulations.gov , inserting USCG-2010-1094 in the ``Keyword'' box, and then clicking ``Search.'' This material...

Practical Molecular Biology for Students: An Integrated Approach to Teaching Basic Techniques.

ERIC Educational Resources Information Center

Hames, B. David; And Others

1990-01-01

An activity that introduces students to the correct handling of bacterial recombinants, antibiotic sensitivity testing, insertional inactivation, plasmid DNA isolation, restriction endonuclease digestion, agarose gel electrophoresis, Southern blotting, hybridization, and autoradiography is presented. A list of needed materials, procedures, safety…

Low-Power Consumption InGaAs PIN Diode Switches for V-band Applications

NASA Astrophysics Data System (ADS)

Ziegler, Volker; Berg, Michael; Tobler, Hans; Woelk, Claus; Deufel, Reinhard; Trasser, Andreas; Schumacher, Hermann; Alekseev, Egor; Pavlidis, Dimitris; Dickmann, Juergen

1999-02-01

In this paper, we present the measurement results of two InP-based coplanar SPST (single pole single throw) PIN diode switches operating at V-band frequencies. The switches show excellent mm-wave performance combined with a very low DC-power consumption. The SPST with on-chip biasing and DC-blocking capacitors demonstrates an insertion loss as low as 0.84 dB and a high isolation value of 21.8 dB at a center frequency of 53 GHz with only 0.8 mW of DC-power consumption. A more simple SPST exhibits under equivalent conditions (0.9 mW) an excellent insertion loss of 0.52 dB and an isolation of 21.7 dB. Furthermore the power-handling capability of the InGaAs PIN diodes, which are used as active switching elements, is investigated in this paper and found to exceed 25 dBm at a reverse voltage of -5 V.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gwak, Jng Won, E-mail: jjungwonie@hanmail.net; Lee, Seung Hwa, E-mail: gareureung@daum.net; Chung, Hwan Hoon, E-mail: chungmic@korea.ac.kr

We present a case of isolated calyx that was mistaken for a large cyst. A 47-year-old woman was referred for sclerotherapy of a large cystic lesion on her left kidney. Computed tomography (CT) and ultrasound showed that the cystic lesion was a large cyst. We noticed that the cystic lesion was not a typical simple cyst, even after two sessions of catheter-mediated sclerotherapy. Isolated calyx was presumed by medical history review and was confirmed by aspirated fluid analysis and far delayed-phase CT after intravenous contrast injection. We performed meticulous selective arterial embolization for an isolated calyx and inserted a cathetermore » that could be removed without complication.« less

Isolation of acetate auxotrophs of the methane-producing archaeon Methanococcus maripaludis by random insertional mutagenesis.

PubMed Central

Kim, W; Whitman, W B

1999-01-01

To learn more about autotrophic growth of methanococci, we isolated nine conditional mutants of Methanococcus maripaludis after transformation of the wild type with a random library in pMEB.2, a suicide plasmid bearing the puromycin-resistance cassette pac. These mutants grew poorly in mineral medium and required acetate or complex organic supplements such as yeast extract for normal growth. One mutant, JJ104, was a leaky acetate auxotroph. A plasmid, pWDK104, was recovered from this mutant by electroporation of a plasmid preparation into Escherichia coli. Transformation of wild-type M. maripaludis with pWDK104 produced JJ104-1, a mutant with the same phenotype as JJ104, thus establishing that insertion of pWDK104 into the genome was responsible for the phenotype. pWDK104 contained portions of the methanococcal genes encoding an ABC transporter closely related to MJ1367-MJ1368 of M. jannaschii. Because high levels of molybdate, tungstate, and selenite restored growth to wild-type levels, this transporter may be specific for these oxyanions. A second acetate auxotroph, JJ117, had an absolute growth requirement for either acetate or cobalamin, and wild-type growth was observed only in the presence of both. Cobinamide, 5', 6'-dimethylbenzimidazole, and 2-aminopropanol did not replace cobalamin. This phenotype was correlated with tandem insertions in the genome but not single insertions and appeared to have resulted from an indirect effect on cobamide metabolism. Plasmids rescued from other mutants contained portions of ORFs denoted in M. jannaschii as endoglucanase (MJ0555), transketolase (MJ0681), thiamine biosynthetic protein thiI (MJ0931), and several hypothetical proteins (MJ1031, MJ0835, and MJ0835.1). PMID:10430573

In vitro optimization of truncated stem-loop II variants of the hammerhead ribozyme for cleavage in low concentrations of magnesium under non-turnover conditions.

PubMed Central

Zillmann, M; Limauro, S E; Goodchild, J

1997-01-01

By truncating helix II to two base pairs in a hammerhead ribozyme having long flanking sequences (greater than 30 bases), the rate of cleavage in 1 mM magnesium can be increased roughly 100-fold. Replacing most of the nucleotides in a typical stem-loop II with 1-4 randomized nucleotides gave an RNA library that, even before selection, was more active in 1 mM magnesium than the parent ribozyme, but considerably less active than the truncated stem-loop II ribozyme. A novel, multiround selection for intermolecular cleavage was exploited to optimize this library for cleavage in low concentrations of magnesium. After three rounds of selection at sequentially lower concentrations of magnesium, the library cleaved substrate RNA 20-fold faster than the initial pool and was cloned. This pool was heavily enriched for one particular sequence (5'-CGUG-3') that represented 16 of 52 isolates (the next most common sequence was represented only six times). This sequence also represented the most active sequence, exceeding the activity of the short helix II variant under the conditions of the selection, thereby demonstrating the effectiveness of the selection technique. Analysis of the cleavage rates of RNAs made from eight isolates having different four-base insert sequences allowed assignment of highly preferred bases at each position in the insert. Analysis of pool clones having insert of differing lengths showed that, in general, activity decreased as the length of the insert decreased from 4 to 1. This supports the suggested role of stem-loop II in stabilizing the non-Watson-Crick interactions between the conserved bases of the catalytic core. PMID:9214657

Germ line transformation of the yellow fever mosquito, Aedes aegypti, mediated by transpositional insertion of a piggyBac vector.

PubMed

Lobo, N F; Hua-Van, A; Li, X; Nolen, B M; Fraser, M J

2002-04-01

Mosquito-vectored diseases such as yellow fever and dengue fever continue to have a substantial impact on human populations world-wide. Novel strategies for control of these mosquito vectored diseases can arise through the development of reliable systems for genetic manipulation of the insect vector. A piggyBac vector marked with the Drosophila melanogaster cinnabar (cn) gene was used to transform the white-eyed khw strain of Aedes aegypti. Microinjection of preblastoderm embryos resulted in four families of cinnabar transformed insects. An overall transformation frequency of 4%, with a range of 0% to as high as 13% for individual experiments, was achieved when using a heat-shock induced transposase providing helper plasmid. Southern hybridizations indicated multiple insertion events in three of four transgenic lines, while the presence of duplicated target TTAA sites at either ends of individual insertions confirmed characteristic piggyBac transposition events in these three transgenic lines. The transgenic phenotype has remained stable for more than twenty generations. The transformations effected using the piggyBac element establish the potential of this element as a germ-line transformation vector for Aedine mosquitoes.

QUICK RELEASABLE DRIVE

DOEpatents

Dickson, J.J.

1958-07-01

A quick releasable mechanical drive system suitable for use in a nuclear reactor is described. A small reversible motor positions a control rod by means of a worm and gear speed reducer, a magnetic torque clutch, and a bell crank. As the control rod is raised to the operating position, a heavy coil spring is compressed. In the event of an emergency indicated by either a''scram'' signal or a power failure, the current to the magnetic clutch is cut off, thereby freeing the coil spring and the bell crank positioner from the motor and speed reduction gearing. The coil spring will immediately act upon the bell crank to cause the insertion of the control rod. This arrangement will allow the slow, accurate positioning of the control rod during reactor operation, while providing an independent force to rapidly insert the rod in the event of an emergency.

Unstable transpositions of his4 in yeast.

PubMed Central

Greer, H; Fink, G R

1979-01-01

Unstable transpositions in yeast have been selected in which the his4C gene from chromosome III is inserted into chromosome XII. This event is associated with the generation of a recessive lethal mutation, resulting from the integration of his4C into an essential gene. Strains with these transpositions are viable as diploids or aneuploids for chromosome XII. The event that generates the transpositions does not lead reciprocally to a deletion on chromosome III, implying that synthesis of a new copy of his4C and subsequent transposition may have occurred. The his4C transpositions are unstable and give rise to C- segregants at a high frequency, as a result of either precise excision of the his4C gene (restoring function of the gene into which insertion had occurred) or chromosome loss. PMID:386353

Minimizing Isolate Catalyst Motion in Metal-Assisted Chemical Etching for Deep Trenching of Silicon Nanohole Array.

PubMed

Kong, Lingyu; Zhao, Yunshan; Dasgupta, Binayak; Ren, Yi; Hippalgaonkar, Kedar; Li, Xiuling; Chim, Wai Kin; Chiam, Sing Yang

2017-06-21

The instability of isolate catalysts during metal-assisted chemical etching is a major hindrance to achieve high aspect ratio structures in the vertical and directional etching of silicon (Si). In this work, we discussed and showed how isolate catalyst motion can be influenced and controlled by the semiconductor doping type and the oxidant concentration ratio. We propose that the triggering event in deviating isolate catalyst motion is brought about by unequal etch rates across the isolate catalyst. This triggering event is indirectly affected by the oxidant concentration ratio through the etching rates. While the triggering events are stochastic, the doping concentration of silicon offers a good control in minimizing isolate catalyst motion. The doping concentration affects the porosity at the etching front, and this directly affects the van der Waals (vdWs) forces between the metal catalyst and Si during etching. A reduction in the vdWs forces resulted in a lower bending torque that can prevent the straying of the isolate catalyst from its directional etching, in the event of unequal etch rates. The key understandings in isolate catalyst motion derived from this work allowed us to demonstrate the fabrication of large area and uniformly ordered sub-500 nm nanoholes array with an unprecedented high aspect ratio of ∼12.

Shoe-stiffening inserts for first metatarsophalangeal joint osteoarthritis (the SIMPLE trial): study protocol for a randomised controlled trial.

PubMed

Munteanu, Shannon E; Landorf, Karl B; McClelland, Jodie A; Roddy, Edward; Cicuttini, Flavia M; Shiell, Alan; Auhl, Maria; Allan, Jamie J; Buldt, Andrew K; Menz, Hylton B

2017-04-27

This article describes the design of a parallel-group, participant- and assessor-blinded randomised controlled trial comparing the effectiveness of shoe-stiffening inserts versus sham shoe insert(s) for reducing pain associated with first metatarsophalangeal joint (MTPJ) osteoarthritis (OA). Ninety participants with first MTPJ OA will be randomised to receive full-length shoe-stiffening insert(s) (Carbon Fibre Spring Plate, Paris Orthotics, Vancouver, BC, Canada) plus rehabilitation therapy or sham shoe insert(s) plus rehabilitation therapy. Outcome measures will be obtained at baseline, 4, 12, 24 and 52 weeks; the primary endpoint for assessing effectiveness being 12 weeks. The primary outcome measure will be the foot pain domain of the Foot Health Status Questionnaire (FHSQ). Secondary outcome measures will include the function domain of the FHSQ, severity of first MTPJ pain (using a 100-mm Visual Analogue Scale), global change in symptoms (using a 15-point Likert scale), health status (using the Short-Form-12® Version 2.0 and EuroQol (EQ-5D-5L™) questionnaires), use of rescue medication and co-interventions, self-reported adverse events and physical activity levels (using the Incidental and Planned Activity Questionnaire). Data will be analysed using the intention-to-treat principle. Economic analysis (cost-effectiveness and cost-utility) will also be performed. In addition, the kinematic effects of the interventions will be examined at 1 week using a three-dimensional motion analysis system and multisegment foot model. This study will determine whether shoe-stiffening inserts are a cost-effective intervention for relieving pain associated with first MTPJ OA. The biomechanical analysis will provide useful insights into the mechanism of action of the shoe-stiffening inserts. Australian New Zealand Clinical Trials Registry, identifier: ACTRN12616000552482 . Registered on 28 April 2016.

QuickMap: a public tool for large-scale gene therapy vector insertion site mapping and analysis.

PubMed

Appelt, J-U; Giordano, F A; Ecker, M; Roeder, I; Grund, N; Hotz-Wagenblatt, A; Opelz, G; Zeller, W J; Allgayer, H; Fruehauf, S; Laufs, S

2009-07-01

Several events of insertional mutagenesis in pre-clinical and clinical gene therapy studies have created intense interest in assessing the genomic insertion profiles of gene therapy vectors. For the construction of such profiles, vector-flanking sequences detected by inverse PCR, linear amplification-mediated-PCR or ligation-mediated-PCR need to be mapped to the host cell's genome and compared to a reference set. Although remarkable progress has been achieved in mapping gene therapy vector insertion sites, public reference sets are lacking, as are the possibilities to quickly detect non-random patterns in experimental data. We developed a tool termed QuickMap, which uniformly maps and analyzes human and murine vector-flanking sequences within seconds (available at www.gtsg.org). Besides information about hits in chromosomes and fragile sites, QuickMap automatically determines insertion frequencies in +/- 250 kb adjacency to genes, cancer genes, pseudogenes, transcription factor and (post-transcriptional) miRNA binding sites, CpG islands and repetitive elements (short interspersed nuclear elements (SINE), long interspersed nuclear elements (LINE), Type II elements and LTR elements). Additionally, all experimental frequencies are compared with the data obtained from a reference set, containing 1 000 000 random integrations ('random set'). Thus, for the first time a tool allowing high-throughput profiling of gene therapy vector insertion sites is available. It provides a basis for large-scale insertion site analyses, which is now urgently needed to discover novel gene therapy vectors with 'safe' insertion profiles.

Identifying the viral genes encoding envelope glycoproteins for differentiation of Cyprinid herpesvirus 3 isolates.

PubMed

Han, Jee Eun; Kim, Ji Hyung; Renault, Tristan; Choresca, Casiano; Shin, Sang Phil; Jun, Jin Woo; Park, Se Chang

2013-01-31

Cyprinid herpes virus 3 (CyHV-3) diseases have been reported around the world and are associated with high mortalities of koi (Cyprinus carpio). Although little work has been conducted on the molecular analysis of this virus, glycoprotein genes identified in the present study seem to be valuable targets for genetic comparison of this virus. Three envelope glycoprotein genes (ORF25, 65 and 116) of the CyHV-3 isolates from the USA, Israel, Japan and Korea were compared, and interestingly, sequence insertions or deletions were observed in these target regions. In addition, polymorphisms were presented in microsatellite zones from two glycoprotein genes (ORF65 and 116). In phylogenetic tree analysis, the Korean isolate was remarkably distinguished from USA, Israel, Japan isolates. These findings may be suitable for many applications including isolates differentiation and phylogeny studies.

Flight representative positive isolation disconnect

NASA Technical Reports Server (NTRS)

Rosener, A. A.; Jonkoniec, T. G.

1977-01-01

Resolutions were developed for each problem encountered and a tradeoff analysis was performed to select a final configuration for a flight representative PID (Positive Isolation Disconnect) that is reduced in size and comparable in weight and pressure drop to the developmental PID. A 6.35 mm (1/4-inch) line size PID was fabricated and tested. The flight representative PID consists of two coupled disconnect halves, each capable of fluid isolation with essentially zero clearance between them for zero leakage upon disconnect half disengagement. An interlocking foolproofing technique prevents uncoupling of disconnect halves prior to fluid isolation. Future development efforts for the Space Shuttle subsystems that would benefit from the use of the positive isolation disconnect are also recommended. Customary units were utilized for principal measurements and calculations with conversion factors being inserted in equations to convert the results to the international system of units.

Retroviral insertional mutagenesis identifies Zeb2 activation as a novel leukemogenic collaborating event in CALM-AF10 transgenic mice.

PubMed

Caudell, David; Harper, David P; Novak, Rachel L; Pierce, Rachel M; Slape, Christopher; Wolff, Linda; Aplan, Peter D

2010-02-11

The t(10;11) translocation results in a CALM-AF10 fusion gene in a subset of leukemia patients. Expression of a CALM-AF10 transgene results in leukemia, with prolonged latency and incomplete penetrance, suggesting that additional events are necessary for leukemic transformation. CALM-AF10 mice infected with the MOL4070LTR retrovirus developed acute leukemia, and ligation-mediated polymerase chain reaction was used to identify retroviral insertions at 19 common insertion sites, including Zeb2, Nf1, Mn1, Evi1, Ift57, Mpl, Plag1, Kras, Erg, Vav1, and Gata1. A total of 26% (11 of 42) of the mice had retroviral integrations near Zeb2, a transcriptional corepressor leading to overexpression of the Zeb2-transcript. A total of 91% (10 of 11) of mice with Zeb2 insertions developed B-lineage acute lymphoblastic leukemia, suggesting that Zeb2 activation promotes the transformation of CALM-AF10 hematopoietic precursors toward B-lineage leukemias. More than half of the mice with Zeb2 integrations also had Nf1 integrations, suggesting cooperativity among CALM-AF10, Zeb2, and Ras pathway mutations. We searched for Nras, Kras, and Ptpn11 point mutations in the CALM-AF10 leukemic mice. Three mutations were identified, all of which occurred in mice with Zeb2 integrations, consistent with the hypothesis that Zeb2 and Ras pathway activation promotes B-lineage leukemic transformation in concert with CALM-AF10.

Retroviral insertional mutagenesis identifies Zeb2 activation as a novel leukemogenic collaborating event in CALM-AF10 transgenic mice

PubMed Central

Caudell, David; Harper, David P.; Novak, Rachel L.; Pierce, Rachel M.; Slape, Christopher; Wolff, Linda

2010-01-01

The t(10;11) translocation results in a CALM-AF10 fusion gene in a subset of leukemia patients. Expression of a CALM-AF10 transgene results in leukemia, with prolonged latency and incomplete penetrance, suggesting that additional events are necessary for leukemic transformation. CALM-AF10 mice infected with the MOL4070LTR retrovirus developed acute leukemia, and ligation-mediated polymerase chain reaction was used to identify retroviral insertions at 19 common insertion sites, including Zeb2, Nf1, Mn1, Evi1, Ift57, Mpl, Plag1, Kras, Erg, Vav1, and Gata1. A total of 26% (11 of 42) of the mice had retroviral integrations near Zeb2, a transcriptional corepressor leading to overexpression of the Zeb2-transcript. A total of 91% (10 of 11) of mice with Zeb2 insertions developed B-lineage acute lymphoblastic leukemia, suggesting that Zeb2 activation promotes the transformation of CALM-AF10 hematopoietic precursors toward B-lineage leukemias. More than half of the mice with Zeb2 integrations also had Nf1 integrations, suggesting cooperativity among CALM-AF10, Zeb2, and Ras pathway mutations. We searched for Nras, Kras, and Ptpn11 point mutations in the CALM-AF10 leukemic mice. Three mutations were identified, all of which occurred in mice with Zeb2 integrations, consistent with the hypothesis that Zeb2 and Ras pathway activation promotes B-lineage leukemic transformation in concert with CALM-AF10. PMID:20007546

Predictors of Intra-Aortic Balloon Pump Insertion in Coronary Surgery and Mid-Term Results

PubMed Central

Yurekli, Ismail; Celik, Ersin; Yetkin, Ufuk; Yilik, Levent; Gurbuz, Ali

2013-01-01

Background We aimed to investigate the preoperative, operative, and postoperative factors affecting intra-aortic balloon pump (IABP) insertion in patients undergoing isolated on-pump coronary artery bypass grafting (CABG). We also investigated factors affecting morbidity, mortality, and survival in patients with IABP support. Methods Between January 2002 and December 2009, 1,657 patients underwent isolated CABG in İzmir Katip Celebi University Atatürk Training and Research Hospital. The number of patients requiring support with IABP was 134 (8.1%). Results In a multivariate logistic regression analysis, prolonged cardiopulmonary bypass time and prolonged operation time were independent predictive factors of IABP insertion. The postoperative mortality rate was 35.8% and 1% in patients with and without IABP support, respectively (p=0.000). Postoperative renal insufficiency, prolonged ventilatory support, and postoperative atrial fibrillation were independent predictive factors of postoperative mortality in patients with IABP support. The mean follow-up time was 38.55±22.70 months and 48.78±25.20 months in patients with and without IABP support, respectively. The follow-up mortality rate was 3% (n=4) and 5.3% (n=78) in patients with and without IABP support, respectively. Conclusion The patients with IABP support had a higher postoperative mortality rate and a longer length of intensive care unit and hospital stay. The mid-term survival was good for patients surviving the early postoperative period. PMID:24368971

Mutations at Several Loci Cause Increased Expression of Ribonucleotide Reductase in Escherichia coli

PubMed Central

Feeney, Morgan Anne; Ke, Na

2012-01-01

Production of deoxyribonucleotides for DNA synthesis is an essential and tightly regulated process. The class Ia ribonucleotide reductase (RNR), the product of the nrdAB genes, is required for aerobic growth of Escherichia coli. In catalyzing the reduction of ribonucleotides, two of the cysteines of RNR become oxidized, forming a disulfide bond. To regenerate active RNR, the cell uses thioredoxins and glutaredoxins to reduce the disulfide bond. Strains that lack thioredoxins 1 and 2 and glutaredoxin 1 do not grow because RNR remains in its oxidized, inactive form. However, suppressor mutations that lead to RNR overproduction allow glutaredoxin 3 to reduce sufficient RNR for growth of these mutant strains. We previously described suppressor mutations in the dnaA and dnaN genes that had such effects. Here we report the isolation of new mutations that lead to increased levels of RNR. These include mutations that were not known to influence production of RNR previously, such as a mutation in the hda gene and insertions in the nrdAB promoter region of insertion elements IS1 and IS5. Bioinformatic analysis raises the possibility that IS element insertion in this region represents an adaptive mechanism in nrdAB regulation in E. coli and closely related species. We also characterize mutations altering different amino acids in DnaA and DnaN from those isolated before. PMID:22247510

Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.

PubMed

Schuetz, J D; Guzelian, P S

1995-03-14

We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.

Transposon insertion libraries for the characterization of mutants from the kiwifruit pathogen Pseudomonas syringae pv. actinidiae

PubMed Central

Mesarich, Carl H.; Rees-George, Jonathan; Gardner, Paul P.; Ghomi, Fatemeh Ashari; Gerth, Monica L.; Andersen, Mark T.; Rikkerink, Erik H. A.; Fineran, Peter C.

2017-01-01

Pseudomonas syringae pv. actinidiae (Psa), the causal agent of kiwifruit canker, is one of the most devastating plant diseases of recent times. We have generated two mini-Tn5-based random insertion libraries of Psa ICMP 18884. The first, a ‘phenotype of interest’ (POI) library, consists of 10,368 independent mutants gridded into 96-well plates. By replica plating onto selective media, the POI library was successfully screened for auxotrophic and motility mutants. Lipopolysaccharide (LPS) biosynthesis mutants with ‘Fuzzy-Spreader’-like morphologies were also identified through a visual screen. The second, a ‘mutant of interest’ (MOI) library, comprises around 96,000 independent mutants, also stored in 96-well plates, with approximately 200 individuals per well. The MOI library was sequenced on the Illumina MiSeq platform using Transposon-Directed Insertion site Sequencing (TraDIS) to map insertion sites onto the Psa genome. A grid-based PCR method was developed to recover individual mutants, and using this strategy, the MOI library was successfully screened for a putative LPS mutant not identified in the visual screen. The Psa chromosome and plasmid had 24,031 and 1,236 independent insertion events respectively, giving insertion frequencies of 3.65 and 16.6 per kb respectively. These data suggest that the MOI library is near saturation, with the theoretical probability of finding an insert in any one chromosomal gene estimated to be 97.5%. However, only 47% of chromosomal genes had insertions. This surprisingly low rate cannot be solely explained by the lack of insertions in essential genes, which would be expected to be around 5%. Strikingly, many accessory genes, including most of those encoding type III effectors, lacked insertions. In contrast, 94% of genes on the Psa plasmid had insertions, including for example, the type III effector HopAU1. These results suggest that some chromosomal sites are rendered inaccessible to transposon insertion, either by DNA-binding proteins or by the architecture of the nucleoid. PMID:28249011

Pancreatic stent insertion after an unintentional guidewire cannulation of the pancreatic duct during ERCP.

PubMed

García-Cano, Jesús; Viñuelas Chicano, Miriam; Del Moral Martínez, María; Muñiz Muñoz, Marta; Murillo Matamoros, Claudio; Suárez Matías, Miguel; Valiente González, Laura; Martínez Pérez, Teresa; Martínez Fernández, Raquel; Gómez Ruiz, Carmen Julia; Pérez García, José Ignacio; Morillas Ariño, Julia

2018-04-24

the guidewire (GW) may enter the pancreatic duct during common bile duct (CBD) cannulation attempts in endoscopic retrograde cholangiopancreatography (ERCP). After GW passage into the pancreas, the most effective maneuver for CBD cannulation and pancreatitis prevention has not been determined. to study CBD cannulation and post-ERCP pancreatitis rates when a pancreatic stent is inserted after an unintentional GW cannulation of the pancreatic duct. a retrospective analysis of patients undergoing ERCP for biliary drainage that were included prospectively into a database. After unintentional GW cannulation of the pancreatic duct, a straight 5-Fr and 4-cm long plastic stent was inserted. The stents had no internal flaps to facilitate expulsion. CBD cannulation attempts were made above the stent. A pancreatic sphincterotomy was performed in patients older than 60 years before stent insertion. a total of 46 pancreatic stents were inserted during 154 ERCP (29.8%) procedures. In the stent group, CBD cannulation was accomplished in 44/46 (95.6%) subjects. A total of 21/46 (45.6%) pancreatic sphincterotomies were performed. Only 1/46 (2.17%) mild pancreatitis cases were observed and most stents were spontaneously expelled. in this study, the CBD was eventually reached with the insertion of a plastic pancreatic stent after an unintentional GW passage into the pancreatic duct while attempting a CBD cannulation. No adverse events were observed following pancreatic stent insertion.

“Agrolistic” transformation of plant cells: Integration of T-strands generated in planta

PubMed Central

Hansen, Geneviève; Chilton, Mary-Dell

1996-01-01

We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167

Repair of DNA double-strand breaks by templated nucleotide sequence insertions derived from distant regions of the genome.

PubMed

Onozawa, Masahiro; Zhang, Zhenhua; Kim, Yoo Jung; Goldberg, Liat; Varga, Tamas; Bergsagel, P Leif; Kuehl, W Michael; Aplan, Peter D

2014-05-27

We used the I-SceI endonuclease to produce DNA double-strand breaks (DSBs) and observed that a fraction of these DSBs were repaired by insertion of sequences, which we termed "templated sequence insertions" (TSIs), derived from distant regions of the genome. These TSIs were derived from genic, retrotransposon, or telomere sequences and were not deleted from the donor site in the genome, leading to the hypothesis that they were derived from reverse-transcribed RNA. Cotransfection of RNA and an I-SceI expression vector demonstrated insertion of RNA-derived sequences at the DNA-DSB site, and TSIs were suppressed by reverse-transcriptase inhibitors. Both observations support the hypothesis that TSIs were derived from RNA templates. In addition, similar insertions were detected at sites of DNA DSBs induced by transcription activator-like effector nuclease proteins. Whole-genome sequencing of myeloma cell lines revealed additional TSIs, demonstrating that repair of DNA DSBs via insertion was not restricted to experimentally produced DNA DSBs. Analysis of publicly available databases revealed that many of these TSIs are polymorphic in the human genome. Taken together, these results indicate that insertional events should be considered as alternatives to gross chromosomal rearrangements in the interpretation of whole-genome sequence data and that this mutagenic form of DNA repair may play a role in genetic disease, exon shuffling, and mammalian evolution.

[Isolation and function of genes regulating aphB expression in Vibrio cholerae].

PubMed

Chen, Haili; Zhu, Zhaoqin; Zhong, Zengtao; Zhu, Jun; Kan, Biao

2012-02-04

We identified genes that regulate the expression of aphB, the gene encoding a key virulence regulator in Vibrio cholerae O1 E1 Tor C6706(-). We constructed a transposon library in V. cholerae C6706 strain containing a P(aphB)-luxCDABE and P(aphB)-lacZ transcriptional reporter plasmids. Using a chemiluminescence imager system, we rapidly detected aphB promoter expression level at a large scale. We then sequenced the transposon insertion sites by arbitrary PCR and sequencing analysis. We obtained two candidate mutants T1 and T2 which displayed reduced aphB expression from approximately 40,000 transposon insertion mutants. Sequencing analysis shows that Tn inserted in vc1585 reading frame in the T1 mutant and Tn inserted in the end of coding sequence of vc1602 in the T2 mutant. By using a genetic screen, we identified two potential genes that may involve in regulation of the expression of the key virulence regulator AphB. This study sheds light on our further investigation to fully understand V. cholerae virulence gene regulatory cascades.

Draft genome sequences of Actinomyces timonensis strain 7400942T and its prophage.

PubMed

Gorlas, Aurore; Gimenez, Grégory; Raoult, Didier; Roux, Véronique

2012-12-01

A draft genome sequence of Actinomyces timonensis, an anaerobic bacterium isolated from a human clinical osteoarticular sample, is described here. CRISPR-associated proteins, insertion sequence, and toxin-antitoxin loci were found on the genome. A new virus or provirus, AT-1, was characterized.

Atypical Aspergillus parasiticus isolates from pistachio with aflR gene nucleotide insertion identical to Aspergillus sojae

USDA-ARS?s Scientific Manuscript database

Aflatoxins are the most toxic and carcinogenic secondary metabolites produced primarily by the filamentous fungi Aspergillus flavus and Aspergillus parasiticus. The toxins cause devastating economic losses because of strict regulations on distribution of contaminated products. Aspergillus sojae are...

Early Strains of Multidrug-Resistant Salmonella enterica Serovar Kentucky Sequence Type 198 from Southeast Asia Harbor Salmonella Genomic Island 1-J Variants with a Novel Insertion Sequence

PubMed Central

Le Hello, Simon; Weill, François-Xavier; Guibert, Véronique; Praud, Karine; Cloeckaert, Axel

2012-01-01

Salmonella genomic island 1 (SGI1) is a 43-kb integrative mobilizable element that harbors a great diversity of multidrug resistance gene clusters described in numerous Salmonella enterica serovars and also in Proteus mirabilis. The majority of SGI1 variants contain an In104-derivative complex class 1 integron inserted between resolvase gene res and open reading frame (ORF) S044 in SGI1. Recently, the international spread of ciprofloxacin-resistant S. enterica serovar Kentucky sequence type 198 (ST198) containing SGI1-K variants has been reported. A retrospective study was undertaken to characterize ST198 S. Kentucky strains isolated before the spread of the epidemic ST198-SGI1-K population in Africa and the Middle East. Here, we characterized 12 ST198 S. Kentucky strains isolated between 1969 and 1999, mainly from humans returning from Southeast Asia (n = 10 strains) or Israel (n = 1 strain) or from meat in Egypt (n = 1 strain). All these ST198 S. Kentucky strains did not belong to the XbaI pulsotype X1 associated with the African epidemic clone but to pulsotype X2. SGI1-J subgroup variants containing different complex integrons with a partial transposition module and inserted within ORF S023 of SGI1 were detected in six strains. The SGI1-J4 variant containing a partially deleted class 1 integron and thus showing a narrow resistance phenotype to sulfonamides was identified in two epidemiologically unrelated strains from Indonesia. The four remaining strains harbored a novel SGI1-J variant, named SGI1-J6, which contained aadA2, floR2, tetR(G)-tetA(G), and sul1 resistance genes within its complex integron. Moreover, in all these S. Kentucky isolates, a novel insertion sequence related to the IS630 family and named ISSen5 was found inserted upstream of the SGI1 complex integron in ORF S023. Thus, two subpopulations of S. Kentucky ST198 independently and exclusively acquired the SGI1 during the 1980s and 1990s. Unlike the ST198-X1 African epidemic subpopulation, the ST198-X2 subpopulation mainly from Asia harbors variants of the SGI1-J subgroup that are encountered mainly in the Far East, as previously described for S. enterica serovars Emek and Virchow. PMID:22802251

Early strains of multidrug-resistant Salmonella enterica serovar Kentucky sequence type 198 from Southeast Asia harbor Salmonella genomic island 1-J variants with a novel insertion sequence.

PubMed

Le Hello, Simon; Weill, François-Xavier; Guibert, Véronique; Praud, Karine; Cloeckaert, Axel; Doublet, Benoît

2012-10-01

Salmonella genomic island 1 (SGI1) is a 43-kb integrative mobilizable element that harbors a great diversity of multidrug resistance gene clusters described in numerous Salmonella enterica serovars and also in Proteus mirabilis. The majority of SGI1 variants contain an In104-derivative complex class 1 integron inserted between resolvase gene res and open reading frame (ORF) S044 in SGI1. Recently, the international spread of ciprofloxacin-resistant S. enterica serovar Kentucky sequence type 198 (ST198) containing SGI1-K variants has been reported. A retrospective study was undertaken to characterize ST198 S. Kentucky strains isolated before the spread of the epidemic ST198-SGI1-K population in Africa and the Middle East. Here, we characterized 12 ST198 S. Kentucky strains isolated between 1969 and 1999, mainly from humans returning from Southeast Asia (n = 10 strains) or Israel (n = 1 strain) or from meat in Egypt (n = 1 strain). All these ST198 S. Kentucky strains did not belong to the XbaI pulsotype X1 associated with the African epidemic clone but to pulsotype X2. SGI1-J subgroup variants containing different complex integrons with a partial transposition module and inserted within ORF S023 of SGI1 were detected in six strains. The SGI1-J4 variant containing a partially deleted class 1 integron and thus showing a narrow resistance phenotype to sulfonamides was identified in two epidemiologically unrelated strains from Indonesia. The four remaining strains harbored a novel SGI1-J variant, named SGI1-J6, which contained aadA2, floR2, tetR(G)-tetA(G), and sul1 resistance genes within its complex integron. Moreover, in all these S. Kentucky isolates, a novel insertion sequence related to the IS630 family and named ISSen5 was found inserted upstream of the SGI1 complex integron in ORF S023. Thus, two subpopulations of S. Kentucky ST198 independently and exclusively acquired the SGI1 during the 1980s and 1990s. Unlike the ST198-X1 African epidemic subpopulation, the ST198-X2 subpopulation mainly from Asia harbors variants of the SGI1-J subgroup that are encountered mainly in the Far East, as previously described for S. enterica serovars Emek and Virchow.

Stressful Life Events as a Predictor for Nonsuicidal Self-Injury in Southern Chinese Adolescence: A Cross-Sectional Study.

PubMed

Tang, Jie; Yang, Wei; Ahmed, Niman Isse; Ma, Ying; Liu, Hui-Yan; Wang, Jia-Ji; Wang, Pei-Xi; Du, Yu-Kai; Yu, Yi-Zhen

2016-03-01

Stressful life events have been implicated in the etiology of kinds of psychopathology related to nonsuicidal self-injury (NSSI); however, few studies have examined the association between NSSI and stressful life events directly in Chinese school adolescents. In this study, we aim to estimate the prevalence rate of NSSI and examine its association with stressful life events in Southern Chinese adolescents. A total sample of 4405 students with age ranged from 10 to 22 years was randomly selected from 12 schools in 3 cities of Guangdong Province, China. NSSI, stressful life events, self-esteem, emotional management, and coping methods were measured by structured questionnaires. Multinomial logistic regression was used to examine the association of NSSI with stressful life events. Results showed the 1 year self-reported NSSI was 29.2%, with 22.6% engaged in "minor" NSSI (including hitting self, pulling hair, biting self, inserting objects under nails or skin, picking at a wound) and 6.6% in "moderate/sever" NSSI (including cutting/carving, burning, self-tattooing, scraping, and erasing skin). Self-hitting (15.9%), pulling hair out (10.9%), and self-inserting objects under nails or skin picking areas to dram blood (18.3%) were the most frequent types of NSSI among adolescents. Results also showed that "Minor NSSI" was associated with stressful life events on interpersonal, loss and health adaption, and "moderate/severe NSSI" was associated with life events on interpersonal, health adaption in Southern Chinese adolescents, even after adjusted for sex, age, residence, self-esteem, coping style, and emotional management. Results further suggested stressful life events were significantly associated with less risk of NSSI in those who had good emotional management ability.

Stressful Life Events as a Predictor for Nonsuicidal Self-Injury in Southern Chinese Adolescence

PubMed Central

Tang, Jie; Yang, Wei; Ahmed, Niman Isse; Ma, Ying; Liu, Hui-Yan; Wang, Jia-Ji; Wang, Pei-Xi; Du, Yu-Kai; Yu, Yi-Zhen

2016-01-01

Abstract Stressful life events have been implicated in the etiology of kinds of psychopathology related to nonsuicidal self-injury (NSSI); however, few studies have examined the association between NSSI and stressful life events directly in Chinese school adolescents. In this study, we aim to estimate the prevalence rate of NSSI and examine its association with stressful life events in Southern Chinese adolescents. A total sample of 4405 students with age ranged from 10 to 22 years was randomly selected from 12 schools in 3 cities of Guangdong Province, China. NSSI, stressful life events, self-esteem, emotional management, and coping methods were measured by structured questionnaires. Multinomial logistic regression was used to examine the association of NSSI with stressful life events. Results showed the 1 year self-reported NSSI was 29.2%, with 22.6% engaged in “minor” NSSI (including hitting self, pulling hair, biting self, inserting objects under nails or skin, picking at a wound) and 6.6% in “moderate/sever” NSSI (including cutting/carving, burning, self-tattooing, scraping, and erasing skin). Self-hitting (15.9%), pulling hair out (10.9%), and self-inserting objects under nails or skin picking areas to dram blood (18.3%) were the most frequent types of NSSI among adolescents. Results also showed that “Minor NSSI” was associated with stressful life events on interpersonal, loss and health adaption, and “moderate/severe NSSI” was associated with life events on interpersonal, health adaption in Southern Chinese adolescents, even after adjusted for sex, age, residence, self-esteem, coping style, and emotional management. Results further suggested stressful life events were significantly associated with less risk of NSSI in those who had good emotional management ability. PMID:26945351

Mesoniviruses are mosquito-specific viruses with extensive geographic distribution and host range

PubMed Central

2014-01-01

Background The family Mesoniviridae (order Nidovirales) comprises of a group of positive-sense, single-stranded RNA ([+]ssRNA) viruses isolated from mosquitoes. Findings Thirteen novel insect-specific virus isolates were obtained from mosquitoes collected in Indonesia, Thailand and the USA. By electron microscopy, the virions appeared as spherical particles with a diameter of ~50 nm. Their 20,129 nt to 20,777 nt genomes consist of positive-sense, single-stranded RNA with a poly-A tail. Four isolates from Houston, Texas, and one isolate from Java, Indonesia, were identified as variants of the species Alphamesonivirus-1 which also includes Nam Dinh virus (NDiV) from Vietnam and Cavally virus (CavV) from Côte d’Ivoire. The eight other isolates were identified as variants of three new mesoniviruses, based on genome organization and pairwise evolutionary distances: Karang Sari virus (KSaV) from Java, Bontag Baru virus (BBaV) from Java and Kalimantan, and Kamphaeng Phet virus (KPhV) from Thailand. In comparison with NDiV, the three new mesoniviruses each contained a long insertion (180 – 588 nt) of unknown function in the 5’ region of ORF1a, which accounted for much of the difference in genome size. The insertions contained various short imperfect repeats and may have arisen by recombination or sequence duplication. Conclusions In summary, based on their genome organizations and phylogenetic relationships, thirteen new viruses were identified as members of the family Mesoniviridae, order Nidovirales. Species demarcation criteria employed previously for mesoniviruses would place five of these isolates in the same species as NDiV and CavV (Alphamesonivirus-1) and the other eight isolates would represent three new mesonivirus species (Alphamesonivirus-5, Alphamesonivirus-6 and Alphamesonivirus-7). The observed spatiotemporal distribution over widespread geographic regions and broad species host range in mosquitoes suggests that mesoniviruses may be common in mosquito populations worldwide. PMID:24884700

Mesoniviruses are mosquito-specific viruses with extensive geographic distribution and host range.

PubMed

Vasilakis, Nikos; Guzman, Hilda; Firth, Cadhla; Forrester, Naomi L; Widen, Steven G; Wood, Thomas G; Rossi, Shannan L; Ghedin, Elodie; Popov, Vsevolov; Blasdell, Kim R; Walker, Peter J; Tesh, Robert B

2014-05-20

The family Mesoniviridae (order Nidovirales) comprises of a group of positive-sense, single-stranded RNA ([+]ssRNA) viruses isolated from mosquitoes. Thirteen novel insect-specific virus isolates were obtained from mosquitoes collected in Indonesia, Thailand and the USA. By electron microscopy, the virions appeared as spherical particles with a diameter of ~50 nm. Their 20,129 nt to 20,777 nt genomes consist of positive-sense, single-stranded RNA with a poly-A tail. Four isolates from Houston, Texas, and one isolate from Java, Indonesia, were identified as variants of the species Alphamesonivirus-1 which also includes Nam Dinh virus (NDiV) from Vietnam and Cavally virus (CavV) from Côte d'Ivoire. The eight other isolates were identified as variants of three new mesoniviruses, based on genome organization and pairwise evolutionary distances: Karang Sari virus (KSaV) from Java, Bontag Baru virus (BBaV) from Java and Kalimantan, and Kamphaeng Phet virus (KPhV) from Thailand. In comparison with NDiV, the three new mesoniviruses each contained a long insertion (180 - 588 nt) of unknown function in the 5' region of ORF1a, which accounted for much of the difference in genome size. The insertions contained various short imperfect repeats and may have arisen by recombination or sequence duplication. In summary, based on their genome organizations and phylogenetic relationships, thirteen new viruses were identified as members of the family Mesoniviridae, order Nidovirales. Species demarcation criteria employed previously for mesoniviruses would place five of these isolates in the same species as NDiV and CavV (Alphamesonivirus-1) and the other eight isolates would represent three new mesonivirus species (Alphamesonivirus-5, Alphamesonivirus-6 and Alphamesonivirus-7). The observed spatiotemporal distribution over widespread geographic regions and broad species host range in mosquitoes suggests that mesoniviruses may be common in mosquito populations worldwide.

10 CFR 50.73 - Licensee event report system.

Code of Federal Regulations, 2013 CFR

2013-01-01

... scram or reactor trip. (2) General containment isolation signals affecting containment isolation valves... plant design; or (2) Normal and expected wear or degradation. (x) Any event that posed an actual threat...

10 CFR 50.73 - Licensee event report system.

Code of Federal Regulations, 2014 CFR

2014-01-01

... scram or reactor trip. (2) General containment isolation signals affecting containment isolation valves... plant design; or (2) Normal and expected wear or degradation. (x) Any event that posed an actual threat...

10 CFR 50.73 - Licensee event report system.

Code of Federal Regulations, 2012 CFR

2012-01-01

... scram or reactor trip. (2) General containment isolation signals affecting containment isolation valves... plant design; or (2) Normal and expected wear or degradation. (x) Any event that posed an actual threat...

Prediction of retrotransposons and assessment of genetic variability based on developed retrotransposon-based insertion polymorphism (RBIP) markers in Pyrus L.

PubMed

Jiang, Shuang; Zong, Yu; Yue, Xiaoyan; Postman, Joseph; Teng, Yuanwen; Cai, Danying

2015-02-01

Interspecific hybridization has been considered the major mode of evolution in Pyrus (pear), and thus, the genetic relationships within this genus have not been well documented. Retrotransposons are ubiquitous components of plant genomes and 42.4 % of the pear genome was reported to be long terminal repeat (LTR) retrotransposons, implying that retrotransposons might be significant in the evolution of Pyrus. In this study, 1,836 putative full-length LTR retrotransposons were isolated and 196 retrotransposon-based insertion polymorphism (RBIP) primers were developed, of which 24 pairs to the Ppcr1 subfamily of copia retrotransposons were used to analyze genetic diversity among 110 Pyrus accessions from Eurasia. Our results showed that Ppcr1 replicated many times in the development of cultivated Asian pears. The genetic structure analysis and the unweighted pair group method with arithmetic mean (UPGMA) dendrogram indicated that all accessions could be divided into Oriental and Occidental groups. In Oriental pears, wild pea pears clustered separately into independent groups in accordance with their morphological classifications. Cultivars of P. ussuriensis Maxim, P. pyrifolia Nakai, and P. pyrifolia Chinese white pear were mingled together, which inferred that hybridization events occurred during the development of the cultivated Asian pears. In Occidental pears, two clades were obtained in the UPGMA dendrogram in accordance with their geographical distribution; one contained the European species and the other included species from North Africa and West Asia. New findings in this study will be important to further understand the phylogeny of Pyrus and origins of cultivated pears.

Characterization of a gene product (Sec53p) required for protein assembly in the yeast endoplasmic reticulum

PubMed Central

1985-01-01

SEC53, a gene that is required for completion of assembly of proteins in the endoplasmic reticulum in yeast, has been cloned, sequenced, and the product localized by cell fractionation. Complementation of a sec53 mutation is achieved with unique plasmids from genomic or cDNA expression banks. These inserts contain the authentic gene, a cloned copy of which integrates at the sec53 locus. An open reading frame in the insert predicts a 29-kD protein with no significant hydrophobic character. This prediction is confirmed by detection of a 28-kD protein overproduced in cells that carry SEC53 on a multicopy plasmid. To follow Sec53p more directly, a LacZ-SEC53 gene fusion has been constructed which allows the isolation of a hybrid protein for use in production of antibody. With such an antibody, quantitative immune decoration has shown that the sec53-6 mutation decreases the level of Sec53p at 37 degrees C, while levels comparable to wild-type are seen at 24 degrees C. An eightfold overproduction of Sec53p accompanies transformation of cells with a multicopy plasmid containing SEC53. Cell fractionation, performed with conditions that preserve the lumenal content of the endoplasmic reticulum (ER), shows Sec53p highly enriched in the cytosol fraction. We suggest that Sec53p acts indirectly to facilitate assembly in the ER, possibly by interacting with a stable ER component, or by providing a small molecule, other than an oligosaccharide precursor, necessary for the assembly event. PMID:3905826

Phosphine-alkene ligands as mechanistic probes in the Pauson-Khand reaction.

PubMed

Ferrer, Catalina; Benet-Buchholz, Jordi; Riera, Antoni; Verdaguer, Xavier

2010-07-26

An alkyne tetracarbonyl dicobalt complex with a chelated phosphine-alkene ligand, in which the phosphorus atom and the alkene from the ligand are attached to the same cobalt atom has been prepared, isolated, and characterized by X-ray crystallography. The complex serves as a mechanistic model for an intermediate of the Pauson-Khand (PK) reaction. Although the alkene fragment is located in an equatorial coordination site with an appropriate orientation, and, therefore, should undergo insertion, it failed to give the PK product upon either thermal or N-methylmorpholine N-oxide activation. However, a phosphine-alkene complex that contains a terminal alkene readily provided the corresponding PK product. We attribute this change in reactivity to the different ability of each olefin to undergo 1,2-insertion. These results provide further insights into the factors that govern a crucial step in the PK reaction, the olefin insertion.

Analysis of metal tolerance in Rhizobium leguminosarum strains isolated from an ultramafic soil.

PubMed

Rubio-Sanz, Laura; Brito, Belén; Palacios, Jose

2018-02-01

Natural habitats containing high amounts of heavy metals provide a valuable source of bacteria adapted to deal with metal toxicity. A functional analysis of the population of legume endosymbiotic bacteria in an ultramafic soil was undertaken by studying a collection of Rhizobium leguminosarum bv viciae (Rlv) isolates obtained using pea as trap plant. One of the isolates, Rlv UPM1137, was selected on the basis of its higher tolerance to nickel and cobalt and presence of inducible mechanisms for such tolerance. A random transposon mutagenesis of Rlv UPM1137 allowed the generation of 14 transposant derivatives with increased nickel sensitivity; five of these transposants were also more sensitive to cobalt. Sequencing of the insertion sites revealed that one of the transposants (D2250) was affected in a gene homologous to the cation diffusion facilitator gene dmeF first identified in the metal-resistant bacterium Cupriavidus metallidurans CH34. The symbiotic performance of D2250 and two other transposants bearing single transposon insertions was unaffected under high-metal conditions, suggesting that, in contrast to previous observations in other Rlv strain, metal tolerance in UPM1137 under symbiotic conditions might be supported by functional redundancy between several mechanisms. © FEMS 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Phenotypic modulation of auto-reactive cells by insertion of tolerogenic molecules via MSC-derived exosomes.

PubMed

Mokarizadeh, Aram; Delirezh, Nowruz; Morshedi, Ahhmad; Mosayebi, Ghasem; Farshid, Amir-Abbas; Dalir-Naghadeh, Bahram

2012-01-01

Auto-reactive cells-mediated immune responses are responsible for the current tissue damages during autoimmunity. Accordingly, functional modulation of auto-reactive cells has been a pivotal aim in many of recent studies. In the current study, we investigated the possibility for insertion of regulatory molecules onto auto-reactive cells through exosomal nano-shuttles as a novel approach for phenotype modification of auto-reactive cells. The exosomes were isolated from supernatant of mesenchymal stem cells culture. Resultant exosomes co-cultured with lymphocytes were harvested from established EAE mice in the presence of antigenic MOG35-55 peptide. After 24 hr, insertion of exosomal tolerogenic molecules (PD-L1, TGF-β, galectin-1) onto auto-reactive cells were explored through flow cytometry. The potency of exosomal inserted membrane molecules to modulate phenotype of auto-reactive lymphocytes was assessed upon ELISA test for their-derived cytokines IFN-γ and IL-17. Incorporation of exosomal molecules into lymohocytes' membrane was confirmed by flow cytometric analyses for surface levels of mentioned molecules. Additionally, the decreased secretion of IFN-γ and IL-17 were detected in exosome pre-treated lymphocytes upon stimulation with MOG peptide. Mesenchymal stem cells -derived exosomes showed to be efficient organelles for insertion of bioactive tolerogenic molecules onto auto-reactive cells and modulation of their phenotypes.

Isolated Avulsion of the Tendon of Insertion of the Infraspinatus and Supraspinatus Muscles in Five Juvenile Labrador Retrievers.

PubMed

Mikola, Karoliina; Piras, Alessandro; Hakala, Laura

2018-06-02

 Five juvenile Labrador Retrievers between the ages of 6 and 8 months were presented to our referral centres with a history of intermittent forelimb lameness.  The clinical examination revealed the presence of bilateral orthopaedic problems in four out of five cases.  Radiographic and computed tomography examinations showed the presence of a radiolucent defect corresponding to the area of insertion of the infraspinatus or supraspinatus tendons on the proximal humerus. Three dogs were concurrently affected by elbow disease on the contralateral forelimb and one dog with bilateral infraspinatus avulsion also had osteochondritis dissecans affecting both shoulder joints.  Avulsion of the insertion of the infraspinatus tendon in four dogs and of the supraspinatus tendon in one dog.  According to the current literature, the incidence of infraspinatus and supraspinatus tendinopathies in adult Labrador Retrievers is higher than in other breeds. In our five cases, the patients were juvenile and the nature of the injury was an avulsion of the tendinous insertion. Avulsion of the tendon of insertion of the infraspinatus or supraspinatus has been poorly described in the veterinary literature, and this would represent the first series of cases affecting juvenile Labrador Retrievers. Schattauer GmbH Stuttgart.

Hydra—The National Earthquake Information Center’s 24/7 seismic monitoring, analysis, catalog production, quality analysis, and special studies tool suite

USGS Publications Warehouse

Patton, John M.; Guy, Michelle R.; Benz, Harley M.; Buland, Raymond P.; Erickson, Brian K.; Kragness, David S.

2016-08-18

This report provides an overview of the capabilities and design of Hydra, the global seismic monitoring and analysis system used for earthquake response and catalog production at the U.S. Geological Survey National Earthquake Information Center (NEIC). Hydra supports the NEIC’s worldwide earthquake monitoring mission in areas such as seismic event detection, seismic data insertion and storage, seismic data processing and analysis, and seismic data output.The Hydra system automatically identifies seismic phase arrival times and detects the occurrence of earthquakes in near-real time. The system integrates and inserts parametric and waveform seismic data into discrete events in a database for analysis. Hydra computes seismic event parameters, including locations, multiple magnitudes, moment tensors, and depth estimates. Hydra supports the NEIC’s 24/7 analyst staff with a suite of seismic analysis graphical user interfaces.In addition to the NEIC’s monitoring needs, the system supports the processing of aftershock and temporary deployment data, and supports the NEIC’s quality assurance procedures. The Hydra system continues to be developed to expand its seismic analysis and monitoring capabilities.

Identification of Genomic Insertion and Flanking Sequence of G2-EPSPS and GAT Transgenes in Soybean Using Whole Genome Sequencing Method.

PubMed

Guo, Bingfu; Guo, Yong; Hong, Huilong; Qiu, Li-Juan

2016-01-01

Molecular characterization of sequence flanking exogenous fragment insertion is essential for safety assessment and labeling of genetically modified organism (GMO). In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS) method. More than 22.4 Gb sequence data (∼21 × coverage) for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundaries of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of genomic insertion sites of G2-EPSPS and GAT transgenes will facilitate the utilization of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS was a cost-effective and rapid method for identifying sites of T-DNA insertions and flanking sequences in soybean.

Transposon tagging of genes for cell-cell interactions in Myxococcus xanthus.

PubMed Central

Kalos, M; Zissler, J

1990-01-01

The prokaryote Myxococcus xanthus is a model for cell interactions important in multicellular behavior. We used the transposon TnphoA to specifically identify genes for cell-surface factors involved in cell interactions. From a library of 10,700 insertions of TnphoA, we isolated 36 that produced alkaline phosphatase activity. Three TnphoA insertions tagged cell motility genes, called cgl, which control the adventurous movement of cells. The products of the tagged cgl genes could function in trans upon other cells and were localized primarily in the cell envelope and extracellular space, consistent with TnphoA tagging genes for extracellular factors controlling motility. Images PMID:2172982

A linear 180 nm SOI CMOS antenna switch module using integrated passive device filters for cellular applications

NASA Astrophysics Data System (ADS)

Jie, Cui; Lei, Chen; Peng, Zhao; Xu, Niu; Yi, Liu

2014-06-01

A broadband monolithic linear single pole, eight throw (SP8T) switch has been fabricated in 180 nm thin film silicon-on-insulator (SOI) CMOS technology with a quad-band GSM harmonic filter in integrated passive devices (IPD) technology, which is developed for cellular applications. The antenna switch module (ASM) features 1.2 dB insertion loss with filter on 2G bands and 0.4 dB insertion loss in 3G bands, less than -45 dB isolation and maximum -103 dB intermodulation distortion for mobile front ends by applying distributed architecture and adaptive supply voltage generator.

Ka-Band, RF MEMS Switches on CMOS Grade Silicon with a Polyimide Interface Layer

NASA Technical Reports Server (NTRS)

Ponchak, George E.; Varaljay, Nicholas C.; Papapolymerou, John

2003-01-01

For the first time, RF MEMS switcbes on CMOS grade Si witb a polyimide interface layer are fabricated and characterized. At Ka-Band (36.6 GHz), an insertion loss of 0.52 dB and an isolation of 20 dB is obtained.

Calculation of the ALMA Risk of Right Ventricular Failure After Left Ventricular Assist Device Implantation.

PubMed

Loforte, Antonio; Montalto, Andrea; Musumeci, Francesco; Amarelli, Cristiano; Mariani, Carlo; Polizzi, Vincenzo; Lilla Della Monica, Paola; Grigioni, Francesco; Di Bartolomeo, Roberto; Marinelli, Giuseppe

2018-05-08

Right ventricular failure after continuous-flow left ventricular assist device (LVAD) implantation is still an unsolved issue and remains a life-threatening event for patients. We undertook this study to determine predictors of the patients who are candidates for isolated LVAD therapy as opposed to biventricular support (BVAD). We reviewed demographic, echocardiographic, hemodynamic, and laboratory variables for 258 patients who underwent both isolated LVAD implantation and unplanned BVAD because of early right ventricular failure after LVAD insertion, between 2006 and 2017 (LVAD = 170 and BVAD = 88). The final study patients were randomly divided into derivation (79.8%, n = 206) and validation (20.1%, n = 52) cohorts. Fifty-seven preoperative risk factors were compared between patients who were successfully managed with an LVAD and those who required a BVAD. Nineteen variables demonstrated statistical significance on univariable analysis. Multivariable logistic regression analysis identified destination therapy (odds ratio [OR] 2.0 [1.7-3.9], p = 0.003), a pulmonary artery pulsatility index <2 (OR 3.3 [1.7-6.1], p = 0.001), a right ventricle/left ventricle end-diastolic diameter ratio >0.75 (OR 2.7 [1.5-5.5], p = 0.001), an right ventricle stroke work index <300 mm Hg/ml/m (OR 4.3 [2.5-7.3], p < 0.001), and a United Network for Organ Sharing modified Model for End-Stage Liver Disease Excluding INR score >17 (OR 3.5 [1.9-6.9], p < 0.001) as the major predictors of the need for BVAD. Using these data, we propose a simple risk calculator to determine the suitability of patients for isolated LVAD support in the era of continuous-flow mechanical circulatory support devices.

Tracing melioidosis back to the source: using whole-genome sequencing to investigate an outbreak originating from a contaminated domestic water supply.

PubMed

McRobb, Evan; Sarovich, Derek S; Price, Erin P; Kaestli, Mirjam; Mayo, Mark; Keim, Paul; Currie, Bart J

2015-04-01

Melioidosis, a disease of public health importance in Southeast Asia and northern Australia, is caused by the Gram-negative soil bacillus Burkholderia pseudomallei. Melioidosis is typically acquired through environmental exposure, and case clusters are rare, even in regions where the disease is endemic. B. pseudomallei is classed as a tier 1 select agent by the Centers for Disease Control and Prevention; from a biodefense perspective, source attribution is vital in an outbreak scenario to rule out a deliberate release. Two cases of melioidosis within a 3-month period at a residence in rural northern Australia prompted an investigation to determine the source of exposure. B. pseudomallei isolates from the property's groundwater supply matched the multilocus sequence type of the clinical isolates. Whole-genome sequencing confirmed the water supply as the probable source of infection in both cases, with the clinical isolates differing from the likely infecting environmental strain by just one single nucleotide polymorphism (SNP) each. For the first time, we report a phylogenetic analysis of genomewide insertion/deletion (indel) data, an approach conventionally viewed as problematic due to high mutation rates and homoplasy. Our whole-genome indel analysis was concordant with the SNP phylogeny, and these two combined data sets provided greater resolution and a better fit with our epidemiological chronology of events. Collectively, this investigation represents a highly accurate account of source attribution in a melioidosis outbreak and gives further insight into a frequently overlooked reservoir of B. pseudomallei. Our methods and findings have important implications for outbreak source tracing of this bacterium and other highly recombinogenic pathogens. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Tracing Melioidosis Back to the Source: Using Whole-Genome Sequencing To Investigate an Outbreak Originating from a Contaminated Domestic Water Supply

PubMed Central

McRobb, Evan; Kaestli, Mirjam; Mayo, Mark; Keim, Paul

2015-01-01

Melioidosis, a disease of public health importance in Southeast Asia and northern Australia, is caused by the Gram-negative soil bacillus Burkholderia pseudomallei. Melioidosis is typically acquired through environmental exposure, and case clusters are rare, even in regions where the disease is endemic. B. pseudomallei is classed as a tier 1 select agent by the Centers for Disease Control and Prevention; from a biodefense perspective, source attribution is vital in an outbreak scenario to rule out a deliberate release. Two cases of melioidosis within a 3-month period at a residence in rural northern Australia prompted an investigation to determine the source of exposure. B. pseudomallei isolates from the property's groundwater supply matched the multilocus sequence type of the clinical isolates. Whole-genome sequencing confirmed the water supply as the probable source of infection in both cases, with the clinical isolates differing from the likely infecting environmental strain by just one single nucleotide polymorphism (SNP) each. For the first time, we report a phylogenetic analysis of genomewide insertion/deletion (indel) data, an approach conventionally viewed as problematic due to high mutation rates and homoplasy. Our whole-genome indel analysis was concordant with the SNP phylogeny, and these two combined data sets provided greater resolution and a better fit with our epidemiological chronology of events. Collectively, this investigation represents a highly accurate account of source attribution in a melioidosis outbreak and gives further insight into a frequently overlooked reservoir of B. pseudomallei. Our methods and findings have important implications for outbreak source tracing of this bacterium and other highly recombinogenic pathogens. PMID:25631791

Development of Si neural probe with piezoresistive force sensor for minimally invasive and precise monitoring of insertion forces

NASA Astrophysics Data System (ADS)

Harashima, Takuya; Morikawa, Takumi; Kino, Hisashi; Fukushima, Takafumi; Tanaka, Tetsu

2017-04-01

A Si neural probe is one of the most important tools for neurophysiology and brain science because of its various functions such as optical stimulation and drug delivery. However, the Si neural probe is not robust compared with a metal tetrode, and could be broken by mechanical stress caused by insertion to the brain. Therefore, the Si neural probe becomes more useful if it has a stress sensor that can measure mechanical forces applied to the probe so as not to be broken. In this paper, we proposed and fabricated the Si neural probe with a piezoresistive force sensor for minimally invasive and precise monitoring of insertion forces. The fabricated piezoresistive force sensor accurately measured forces and successfully detected insertion events without buckling or bending in the shank of the Si neural probe. This Si neural probe with a piezoresistive force sensor has become one of the most versatile tools for neurophysiology and brain science.

An update on insertable cardiac monitors: examining the latest clinical evidence and technology for arrhythmia management.

PubMed

Olsen, Flemming J; Biering-Sørensen, Tor; Krieger, Derk W

2015-05-01

Continuous cardiac rhythm monitoring has undergone compelling progress over the past decades. Cardiac monitoring has emerged from 12-lead electrocardiograms being performed at the discretion of the treating physician to in-hospital telemetry, Holter monitoring, prolonged external event monitoring and most recently toward insertable device monitoring for several years. Significant advantages and disadvantages pertaining to these monitoring options will be addressed in this review. Insertable cardiac monitors have several advantages over external monitoring techniques and may signify a clinical turning point in the field of arrhythmia management. However, their role in the detection of paroxysmal atrial fibrillation after cryptogenic strokes has yet to evolve. This will be the main focus of this review. Issues surrounding patient selection, clinical relevance and determination of cost-effectiveness for prolonged cardiac monitoring require further studies. Furthermore, insertable cardiac monitoring has not only the potential to augment diagnostic capabilities but also to improve the management of paroxysmal atrial fibrillation.

TGS-TB: Total Genotyping Solution for Mycobacterium tuberculosis Using Short-Read Whole-Genome Sequencing

PubMed Central

Sekizuka, Tsuyoshi; Yamashita, Akifumi; Murase, Yoshiro; Iwamoto, Tomotada; Mitarai, Satoshi; Kato, Seiya; Kuroda, Makoto

2015-01-01

Whole-genome sequencing (WGS) with next-generation DNA sequencing (NGS) is an increasingly accessible and affordable method for genotyping hundreds of Mycobacterium tuberculosis (Mtb) isolates, leading to more effective epidemiological studies involving single nucleotide variations (SNVs) in core genomic sequences based on molecular evolution. We developed an all-in-one web-based tool for genotyping Mtb, referred to as the Total Genotyping Solution for TB (TGS-TB), to facilitate multiple genotyping platforms using NGS for spoligotyping and the detection of phylogenies with core genomic SNVs, IS6110 insertion sites, and 43 customized loci for variable number tandem repeat (VNTR) through a user-friendly, simple click interface. This methodology is implemented with a KvarQ script to predict MTBC lineages/sublineages and potential antimicrobial resistance. Seven Mtb isolates (JP01 to JP07) in this study showing the same VNTR profile were accurately discriminated through median-joining network analysis using SNVs unique to those isolates. An additional IS6110 insertion was detected in one of those isolates as supportive genetic information in addition to core genomic SNVs. The results of in silico analyses using TGS-TB are consistent with those obtained using conventional molecular genotyping methods, suggesting that NGS short reads could provide multiple genotypes to discriminate multiple strains of Mtb, although longer NGS reads (≥300-mer) will be required for full genotyping on the TGS-TB web site. Most available short reads (~100-mer) can be utilized to discriminate the isolates based on the core genome phylogeny. TGS-TB provides a more accurate and discriminative strain typing for clinical and epidemiological investigations; NGS strain typing offers a total genotyping solution for Mtb outbreak and surveillance. TGS-TB web site: https://gph.niid.go.jp/tgs-tb/. PMID:26565975

Wild-Type Measles Viruses with Non-Standard Genome Lengths

PubMed Central

Bankamp, Bettina; Liu, Chunyu; Rivailler, Pierre; Bera, Jayati; Shrivastava, Susmita; Kirkness, Ewen F.; Bellini, William J.; Rota, Paul A.

2014-01-01

The length of the single stranded, negative sense RNA genome of measles virus (MeV) is highly conserved at 15,894 nucleotides (nt). MeVs can be grouped into 24 genotypes based on the highly variable 450 nucleotides coding for the carboxyl-terminus of the nucleocapsid protein (N-450). Here, we report the genomic sequences of 2 wild-type viral isolates of genotype D4 with genome lengths of 15,900 nt. Both genomes had a 7 nt insertion in the 3′ untranslated region (UTR) of the matrix (M) gene and a 1 nt deletion in the 5′ UTR of the fusion (F) gene. The net gain of 6 nt complies with the rule-of-six required for replication competency of the genomes of morbilliviruses. The insertions and deletion (indels) were confirmed in a patient sample that was the source of one of the viral isolates. The positions of the indels were identical in both viral isolates, even though epidemiological data and the 3 nt differences in N-450 between the two genomes suggested that the viruses represented separate chains of transmission. Identical indels were found in the M-F intergenic regions of 14 additional genotype D4 viral isolates that were imported into the US during 2007–2010. Viral isolates with and without indels produced plaques of similar size and replicated efficiently in A549/hSLAM and Vero/hSLAM cells. This is the first report of wild-type MeVs with genome lengths other than 15,894 nt and demonstrates that the length of the M-F UTR of wild-type MeVs is flexible. PMID:24748123

The BpeEF-OprC Efflux Pump Is Responsible for Widespread Trimethoprim Resistance in Clinical and Environmental Burkholderia pseudomallei Isolates

PubMed Central

Podnecky, Nicole L.; Wuthiekanun, Vanaporn; Peacock, Sharon J.

2013-01-01

Trimethoprim-sulfamethoxazole (co-trimoxazole) is the primary drug used for oral eradication therapy of Burkholderia pseudomallei infections (melioidosis). Here, we demonstrate that trimethoprim resistance is widespread in clinical and environmental isolates from northeast Thailand and northern Australia. This resistance was shown to be due to BpeEF-OprC efflux pump expression. No dihydrofolate reductase target mutations were involved, although frequent insertion of ISBma2 was noted within the putative folA transcriptional terminator. All isolates tested remained susceptible to trimethoprim-sulfamethoxazole, suggesting that resistance to trimethoprim alone in these strains probably does not affect the efficacy of co-trimoxazole therapy. PMID:23817379

Hybrid graphene/silicon integrated optical isolators with photonic spin–orbit interaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ma, Jingwen; Sun, Xiankai, E-mail: xksun@cuhk.edu.hk; Shun Hing Institute of Advanced Engineering, The Chinese University of Hong Kong, Shatin, New Territories

2016-04-11

Optical isolators are an important building block in photonic computation and communication. In traditional optics, isolators are realized with magneto-optical garnets. However, it remains challenging to incorporate such materials on an integrated platform because of the difficulty in material growth and bulky device footprint. Here, we propose an ultracompact integrated isolator by exploiting graphene's magneto-optical property on a silicon-on-insulator platform. The photonic nonreciprocity is achieved because the cyclotrons in graphene experiencing different optical spins exhibit different responses to counterpropagating light. Taking advantage of cavity resonance effects, we have numerically optimized a device design, which shows excellent isolation performance with themore » extinction ratio over 45 dB and the insertion loss around 12 dB at a wavelength near 1.55 μm. Featuring graphene's CMOS compatibility and substantially reduced device footprint, our proposal sheds light on monolithic integration of nonreciprocal photonic devices.« less

Identifying the Viral Genes Encoding Envelope Glycoproteins for Differentiation of Cyprinid herpesvirus 3 Isolates

PubMed Central

Han, Jee Eun; Kim, Ji Hyung; Renault, Tristan; Choresca, Casiano; Shin, Sang Phil; Jun, Jin Woo; Park, Se Chang

2013-01-01

Cyprinid herpes virus 3 (CyHV-3) diseases have been reported around the world and are associated with high mortalities of koi (Cyprinus carpio). Although little work has been conducted on the molecular analysis of this virus, glycoprotein genes identified in the present study seem to be valuable targets for genetic comparison of this virus. Three envelope glycoprotein genes (ORF25, 65 and 116) of the CyHV-3 isolates from the USA, Israel, Japan and Korea were compared, and interestingly, sequence insertions or deletions were observed in these target regions. In addition, polymorphisms were presented in microsatellite zones from two glycoprotein genes (ORF65 and 116). In phylogenetic tree analysis, the Korean isolate was remarkably distinguished from USA, Israel, Japan isolates. These findings may be suitable for many applications including isolates differentiation and phylogeny studies. PMID:23435236

Techniques for the insertion of the ProSeal laryngeal mask airway: comparison of the Foley airway stylet tool with the introducer tool in a prospective, randomized study.

PubMed

Chen, Mao-Kai; Hsu, Hung-Te; Lu, I-Cheng; Shih, Chih-Kai; Shen, Ya-Chun; Tseng, Kuang-Yi; Cheng, Kuang-I

2014-01-01

Many tools have been developed to facilitate the insertion of the ProSeal laryngeal mask airway (LMA) insertion, which can be impeded by folding of its soft cuff. The aim of this study was to compare the efficiency of ProSeal LMA insertion guided by a soft, direct optical Foley Airway Stylet Tool (FAST) with the standard introducer tool (IT). One hundred sixty patients undergoing general anesthesia using the ProSeal LMA as an airway management device were randomly allocated to either FAST-guided or IT-assisted groups. Following ProSeal LMA insertion, the glottic and esophageal openings were identified using a fiberoptic bronchoscope introduced through the airway and the drain tube. The primary outcomes were time taken to insert the ProSeal LMA and the success rate at the first attempt. Secondary end points included ease of insertion, hemodynamic response to insertion, and postoperative adverse events recorded in the recovery room and on the first postoperative morning. One hundred forty patients were included in the final analysis: 66 in the FAST-guided group and 74 in the IT-assisted group. The success rate of FAST device-guided ProSeal LMA insertion (95.7%) was broadly comparable with IT-assisted insertion (98.7%). However, the time taken to insert the ProSeal LMA was significantly longer when the FAST technique was used (p <0.001). The incidence of correct alignment of the airway tube and the drain tube did not differ significantly between the groups. There were no significant differences in ease of insertion or hemodynamic responses to insertion, except that the incidence of postoperative sore throat was significantly higher in the FAST group on the first postoperative day (22.2% compared with 6.8% in the IT group; p = 0.035). Both FAST-guided and IT-assisted techniques achieved correct ProSeal LMA positioning, but the IT technique was significantly quicker and less likely to cause a sore throat. ClinicalTrials.gov Identifier: NCT02048657.

Molecular Mechanisms of Cytopathogenicity of Primate Lymphotropic Retroviruses: Relevance to Treatment and Vaccine for AIDS

DTIC Science & Technology

1989-03-10

fragment of the HIV-1 genome was isolated from XBH10 and inserted into an M13 phage vector. Mutations were introduced by use of 25-mer oligonucleotides which... M13 by Eco RI and religated into the corresponding position of pHXB2gpt. The mutant AS was prepared directly from pHXB2gpt by digestion with Nde I and...detect immunocomplexes. Molecular Cloning and Sequencing of Proviral DNA A X phage library was constructed from the genomic DNA isolated from Hut78 cells

Priority Queues for Computer Simulations

NASA Technical Reports Server (NTRS)

Steinman, Jeffrey S. (Inventor)

1998-01-01

The present invention is embodied in new priority queue data structures for event list management of computer simulations, and includes a new priority queue data structure and an improved event horizon applied to priority queue data structures. ne new priority queue data structure is a Qheap and is made out of linked lists for robust, fast, reliable, and stable event list management and uses a temporary unsorted list to store all items until one of the items is needed. Then the list is sorted, next, the highest priority item is removed, and then the rest of the list is inserted in the Qheap. Also, an event horizon is applied to binary tree and splay tree priority queue data structures to form the improved event horizon for event management.

The Nucleotide Excision Repair Pathway Limits L1 Retrotransposition

PubMed Central

Servant, Geraldine; Streva, Vincent A.; Derbes, Rebecca S.; Wijetunge, Madushani I.; Neeland, Marc; White, Travis B.; Belancio, Victoria P.; Roy-Engel, Astrid M.; Deininger, Prescott L.

2017-01-01

Long interspersed elements 1 (L1) are active mobile elements that constitute almost 17% of the human genome. They amplify through a “copy-and-paste” mechanism termed retrotransposition, and de novo insertions related to these elements have been reported to cause 0.2% of genetic diseases. Our previous data demonstrated that the endonuclease complex ERCC1-XPF, which cleaves a 3′ DNA flap structure, limits L1 retrotransposition. Although the ERCC1-XPF endonuclease participates in several different DNA repair pathways, such as single-strand annealing, or in telomere maintenance, its recruitment to DNA lesions is best characterized in the nucleotide excision repair (NER) pathway. To determine if the NER pathway prevents the insertion of retroelements in the genome, we monitored the retrotransposition efficiencies of engineered L1 elements in NER-deficient cells and in their complemented versions. Core proteins of the NER pathway, XPD and XPA, and the lesion binding protein, XPC, are involved in limiting L1 retrotransposition. In addition, sequence analysis of recovered de novo L1 inserts and their genomic locations in NER-deficient cells demonstrated the presence of abnormally large duplications at the site of insertion, suggesting that NER proteins may also play a role in the normal L1 insertion process. Here, we propose new functions for the NER pathway in the maintenance of genome integrity: limitation of insertional mutations caused by retrotransposons and the prevention of potentially mutagenic large genomic duplications at the site of retrotransposon insertion events. PMID:28049704

High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture.

PubMed

Inagaki, Soichi; Henry, Isabelle M; Lieberman, Meric C; Comai, Luca

2015-01-01

Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA-genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.

Mobile elements reveal small population size in the ancient ancestors of Homo sapiens.

PubMed

Huff, Chad D; Xing, Jinchuan; Rogers, Alan R; Witherspoon, David; Jorde, Lynn B

2010-02-02

The genealogies of different genetic loci vary in depth. The deeper the genealogy, the greater the chance that it will include a rare event, such as the insertion of a mobile element. Therefore, the genealogy of a region that contains a mobile element is on average older than that of the rest of the genome. In a simple demographic model, the expected time to most recent common ancestor (TMRCA) is doubled if a rare insertion is present. We test this expectation by examining single nucleotide polymorphisms around polymorphic Alu insertions from two completely sequenced human genomes. The estimated TMRCA for regions containing a polymorphic insertion is two times larger than the genomic average (P < <10(-30)), as predicted. Because genealogies that contain polymorphic mobile elements are old, they are shaped largely by the forces of ancient population history and are insensitive to recent demographic events, such as bottlenecks and expansions. Remarkably, the information in just two human DNA sequences provides substantial information about ancient human population size. By comparing the likelihood of various demographic models, we estimate that the effective population size of human ancestors living before 1.2 million years ago was 18,500, and we can reject all models where the ancient effective population size was larger than 26,000. This result implies an unusually small population for a species spread across the entire Old World, particularly in light of the effective population sizes of chimpanzees (21,000) and gorillas (25,000), which each inhabit only one part of a single continent.

Sequence Analysis and Characterization of Active Human Alu Subfamilies Based on the 1000 Genomes Pilot Project.

PubMed

Konkel, Miriam K; Walker, Jerilyn A; Hotard, Ashley B; Ranck, Megan C; Fontenot, Catherine C; Storer, Jessica; Stewart, Chip; Marth, Gabor T; Batzer, Mark A

2015-08-29

The goal of the 1000 Genomes Consortium is to characterize human genome structural variation (SV), including forms of copy number variations such as deletions, duplications, and insertions. Mobile element insertions, particularly Alu elements, are major contributors to genomic SV among humans. During the pilot phase of the project we experimentally validated 645 (611 intergenic and 34 exon targeted) polymorphic "young" Alu insertion events, absent from the human reference genome. Here, we report high resolution sequencing of 343 (322 unique) recent Alu insertion events, along with their respective target site duplications, precise genomic breakpoint coordinates, subfamily assignment, percent divergence, and estimated A-rich tail lengths. All the sequenced Alu loci were derived from the AluY lineage with no evidence of retrotransposition activity involving older Alu families (e.g., AluJ and AluS). AluYa5 is currently the most active Alu subfamily in the human lineage, followed by AluYb8, and many others including three newly identified subfamilies we have termed AluYb7a3, AluYb8b1, and AluYa4a1. This report provides the structural details of 322 unique Alu variants from individual human genomes collectively adding about 100 kb of genomic variation. Many Alu subfamilies are currently active in human populations, including a surprising level of AluY retrotransposition. Human Alu subfamilies exhibit continuous evolution with potential drivers sprouting new Alu lineages. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Hadroproduction of t anti-t pair in association with an isolated photon at NLO accuracy matched with parton shower

NASA Astrophysics Data System (ADS)

Kardos, Adam; Trócsányi, Zoltán

2015-05-01

We simulate the hadroproduction of a -pair in association with a hard photon at LHC using the PowHel package. These events are almost fully inclusive with respect to the photon, allowing for any physically relevant isolation of the photon. We use the generated events, stored according to the Les-Houches event format, to make predictions for differential distributions formally at the next-to-leading order (NLO) accuracy and we compare these to existing predictions accurate at NLO using the smooth isolation prescription of Frixione. Our fixed-order predictions include the direct-photon contribution only. We also make predictions for distributions after full parton shower and hadronization using the standard experimental cone-isolation of the photon.

Translation regulation of mammalian selenoproteins.

PubMed

Vindry, Caroline; Ohlmann, Théophile; Chavatte, Laurent

2018-05-09

Interest in selenium research has considerably grown over the last decades owing to the association of selenium deficiencies with an increased risk of several human diseases, including cancers, cardiovascular disorders and infectious diseases. The discovery of a genetically encoded 21 st amino acid, selenocysteine, is a fascinating breakthrough in molecular biology as it is the first addition to the genetic code deciphered in the 1960s. Selenocysteine is a structural and functional analog of cysteine, where selenium replaces sulfur, and its presence is critical for the catalytic activity of selenoproteins. The insertion of selenocysteine is a non-canonical translational event, based on the recoding of a UGA codon in selenoprotein mRNAs, normally used as a stop codon in other cellular mRNAs. Two RNA molecules and associated partners are crucial components of the selenocysteine insertion machinery, the Sec-tRNA [Ser]Sec devoted to UGA codon recognition and the SECIS elements located in the 3'UTR of selenoprotein mRNAs. The translational UGA recoding event is a limiting stage of selenoprotein expression and its efficiency is regulated by several factors. The control of selenoproteome expression is crucial for redox homeostasis and antioxidant defense of mammalian organisms. In this review, we summarize current knowledge on the co-translational insertion of selenocysteine into selenoproteins, and its layers of regulation. Copyright © 2018. Published by Elsevier B.V.

Technical Errors May Affect Accuracy of Torque Limiter in Locking Plate Osteosynthesis.

PubMed

Savin, David D; Lee, Simon; Bohnenkamp, Frank C; Pastor, Andrew; Garapati, Rajeev; Goldberg, Benjamin A

2016-01-01

In locking plate osteosynthesis, proper surgical technique is crucial in reducing potential pitfalls, and use of a torque limiter makes it possible to control insertion torque. We conducted a study of the ways in which different techniques can alter the accuracy of torque limiters. We tested 22 torque limiters (1.5 Nm) for accuracy using hand and power tools under different rotational scenarios: hand power at low and high velocity and drill power at low and high velocity. We recorded the maximum torque reached after each torque-limiting event. Use of torque limiters under hand power at low velocity and high velocity resulted in significantly (P < .0001) different mean (SD) measurements: 1.49 (0.15) Nm and 3.73 (0.79) Nm. Use under drill power at controlled low velocity and at high velocity also resulted in significantly (P < .0001) different mean (SD) measurements: 1.47 (0.14) Nm and 5.37 (0.90) Nm. Maximum single measurement obtained was 9.0 Nm using drill power at high velocity. Locking screw insertion with improper technique may result in higher than expected torque and subsequent complications. For torque limiters, the most reliable technique involves hand power at slow velocity or drill power with careful control of insertion speed until 1 torque-limiting event occurs.

Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma

PubMed Central

Weiser, Keith C.; Liu, Bin; Hansen, Gwenn M.; Skapura, Darlene; Hentges, Kathryn E.; Yarlagadda, Sujatha; Morse III, Herbert C.

2007-01-01

AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFκB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision. PMID:17926094

Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma.

PubMed

Weiser, Keith C; Liu, Bin; Hansen, Gwenn M; Skapura, Darlene; Hentges, Kathryn E; Yarlagadda, Sujatha; Morse Iii, Herbert C; Justice, Monica J

2007-10-01

AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFkappaB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision .

Ceramic hemi-unicondylar arthroplasty in an adolescent patient with idiopathic tibial chondrolysis.

PubMed

Dombroski, Derek; Garino, Jonathan; Lee, Gwo-Chin

2009-06-01

Despite recent advances in cartilage regeneration and restoration procedures, isolated, large, full-thickness cartilage lesions in young patients continue to pose significant challenges to patients and orthopedic surgeons. Treatment options for this difficult problem have traditionally included arthrodesis, osteotomy, osteochondral allograft, and prosthetic reconstruction. We present a case of an adolescent patient with isolated idiopathic lateral tibial chondrolysis treated with a custom ceramic hemi-unicondylar hemiarthroplasty. Preoperatively, a 3-dimensional computed tomography scan of the patient's knee was obtained to begin manufacturing a conforming custom ceramic insert that would articulate between the tibial base plate and the patient's native lateral femoral cartilage. Through a lateral parapatellar approach, the tibial preparation was carried out using the Zimmer M/G unicompartmental knee system (Warsaw, Indiana), and the tibial base plate was cemented into position in the standard fashion. A custom, conforming, prefabricated ceramic insert (CeramTec, Memphis, Tennessee) was then inserted onto the tibial base plate. At 5-year follow-up, this salvage procedure was successful in relieving pain and restoring function in this young patient. There were no signs of implant loosening or lysis. Magnetic resonance imaging of the knee at last follow-up revealed that the cartilage thickness of the patient's lateral femoral condyle remained unchanged. Unicondylar hemiarthroplasty performed in patients with large unipolar lesions in the knee can provide durable and reliable pain relief. Ceramic is a viable material that can be considered for articulation with native cartilage.

Infectious Bovine Viral Diarrhea Virus (Strain NADL) RNA from Stable cDNA Clones: a Cellular Insert Determines NS3 Production and Viral Cytopathogenicity

PubMed Central

Mendez, Ernesto; Ruggli, Nicolas; Collett, Marc S.; Rice, Charles M.

1998-01-01

Bovine viral diarrhea virus (BVDV), strain NADL, was originally isolated from an animal with fatal mucosal disease. This isolate is cytopathic in cell culture and produces two forms of NS3-containing proteins: uncleaved NS2-3 and mature NS3. For BVDV NADL, the production of NS3, a characteristic of cytopathic BVDV strains, is believed to be a consequence of an in-frame insertion of a 270-nucleotide cellular mRNA sequence (called cIns) in the NS2 coding region. In this study, we constructed a stable full-length cDNA copy of BVDV NADL in a low-copy-number plasmid vector. As assayed by transfection of MDBK cells, uncapped RNAs transcribed from this template were highly infectious (>105 PFU/μg). The recovered virus was similar in plaque morphology, growth properties, polyprotein processing, and cytopathogenicity to the BVDV NADL parent. Deletion of cIns abolished processing at the NS2/NS3 site and produced a virus that was no longer cytopathic for MDBK cells. This deletion did not affect the efficiency of infectious virus production or viral protein production, but it reduced the level of virus-specific RNA synthesis and accumulation. Thus, cIns not only modulates NS3 production but also upregulates RNA replication relative to an isogenic noncytopathic derivative lacking the insert. These results raise the possibility of a linkage between enhanced BVDV NADL RNA replication and virus-induced cytopathogenicity. PMID:9573238

Generation of transgenic papaya with double resistance to Papaya ringspot virus and Papaya leaf-distortion mosaic virus.

PubMed

Kung, Yi-Jung; Bau, Huey-Jiunn; Wu, Yi-Ling; Huang, Chiung-Huei; Chen, Tsui-Miao; Yeh, Shyi-Dong

2009-11-01

During the field tests of coat protein (CP)-transgenic papaya lines resistant to Papaya ringspot virus (PRSV), another Potyvirus sp., Papaya leaf-distortion mosaic virus (PLDMV), appeared as an emerging threat to the transgenic papaya. In this investigation, an untranslatable chimeric construct containing the truncated CP coding region of the PLDMV P-TW-WF isolate and the truncated CP coding region with the complete 3' untranslated region of PRSV YK isolate was transferred into papaya (Carica papaya cv. Thailand) via Agrobacterium-mediated transformation to generate transgenic plants with resistance to PLDMV and PRSV. Seventy-five transgenic lines were obtained and challenged with PRSV YK or PLDMV P-TW-WF by mechanical inoculation under greenhouse conditions. Thirty-eight transgenic lines showing no symptoms 1 month after inoculation were regarded as highly resistant lines. Southern and Northern analyses revealed that four weakly resistant lines have one or two inserts of the construct and accumulate detectable amounts of transgene transcript, whereas nine resistant lines contain two or three inserts without significant accumulation of transgene transcript. The results indicated that double virus resistance in transgenic lines resulted from double or more copies of the insert through the mechanism of RNA-mediated posttranscriptional gene silencing. Furthermore, three of nine resistant lines showed high levels of resistance to heterologous PRSV strains originating from Hawaii, Thailand, and Mexico. Our transgenic lines have great potential for controlling a number of PRSV strains and PLDMV in Taiwan and elsewhere.

Room-Temperature C-H Functionalization Sequence under Benchtop Conditions for the Undergraduate Chemistry Laboratory

ERIC Educational Resources Information Center

Chen, Shuming

2018-01-01

An iridium(III)-mediated C-H functionalization sequence involving a concerted cyclometalation-deprotonation/migratory insertion pathway is reported for the undergraduate chemistry laboratory. The air- and water-stable iridacycle intermediates are readily isolated and characterized by NMR spectroscopy. Both steps of the experiment are performed at…

Formation of a Ruthenium-Arene Complex, Cyclometallation with a Substituted Benzylamine, and Insertion of an Alkyne

ERIC Educational Resources Information Center

Chetcuti, Michael J.; Ritleng, Vincent

2007-01-01

The three step synthesis is presented to allow the functionalization of an aromatic amine by forming new C-C and C-N bonds via an intramolecular C-H activation under mild conditions. The reactions are stoichiometric and allow the students to isolate the different organometallic intermediates.

First Report of an Atypical New Aspergillus parasiticus Isolates with Nucleotides Insertion in aflR Gene Identical to Aspergillus sojae

USDA-ARS?s Scientific Manuscript database

Aflatoxins are toxic and carcinogenic secondary metabolites produced primarily by the filamentous fungi Aspergillus favus and Aspergillus parasitic and cause toxin contamination in food chain worldwide. Aspergillus oryzae and Aspergillus sojae are highly valued as koji molds in the traditional prep...

Conservation of nodulation genes between Rhizobium meliloti and a slow-growing Rhizobium strain that nodulates a nonlegume host

PubMed Central

Marvel, Deborah J.; Kuldau, Gretchen; Hirsch, Ann; Richards, Eric; Torrey, John G.; Ausubel, Frederick M.

1985-01-01

Parasponia, a woody member of the elm family, is the only nonlegume genus whose members are known to form an effective nitrogen-fixing symbiosis with a Rhizobium species. The bacterial strain RP501 is a slow-growing strain of Rhizobium isolated from Parasponia nodules. Strain RP501 also nodulates the legumes siratro (Macroptilium atropurpureum) and cowpea (Vigna unguiculata). Using a cosmid clone bank of RP501 DNA, we isolated a 13.4-kilobase (kb) EcoRI fragment that complemented insertion and point mutations in three contiguous nodulation genes (nodABC) of Rhizobium meliloti, the endosymbiont of alfalfa (Medicago sativa). The complemented R. meliloti nod mutants induced effective nitrogen-fixing nodules on alfalfa seedlings but not on siratro, cowpeas, or Parasponia. The cloned RP501 nodulation locus hybridized to DNA fragments carrying the R. meliloti nodABC genes. A 3-kb cluster of Tn5 insertion mutations on the RP501 13.4-kb EcoRI fragment prevented complementation of R. meliloti nodABC mutations. Images PMID:16593600

Effect of severe weather events on the shedding of Shiga toxigenic Escherichia coli in slaughter cattle and phenotype of serogroup O157 isolates.

PubMed

Stanford, Kim; Reuter, Tim; Bach, Susan J; Chui, Linda; Ma, Angela; Conrad, Cheyenne C; Tostes, Renata; McAllister, Tim A

2017-09-01

High-event periods (HEPs) occur sporadically when beef carcasses and meat have episodes of acute contamination with Shiga toxin-producing Escherichia coli (STEC). In this study, severe weather events were investigated as catalysts for HEPs based on PCR and isolate prevalence of seven E. coli serogroups in slaughter cattle feces. Winter ambient temperatures with daily means 10.5oC warmer or 12.3°C colder than seasonal norms (-10.4°C) most altered STEC shedding. Fecal samples yielded increased proportions (P < 0.05) of O26 and O157 isolates during winter warm periods, and reduced (P < 0.05) O45 isolates during cold periods compared to samplings during seasonal norms. Based on changing PCR prevalence and isolates collected, O157 was the serogroup most responsive to severe weather events. Consequently, O157 isolates (n = 219) were evaluated for heat resistance, biofilm-forming potential and virulence gene subtypes. Two isolates had heat-resistant phenotypes with thermal death time at 60°C (D60) > 10 min and one also had strong biofilm-forming potential. However, this isolate lacked eae and stx genes. Severe weather can influence STEC shedding, particularly of O157, and could possibly trigger HEPs. However, our data suggest that it is unlikely for isolates to carry virulence genes and possess phenotypes capable of evading post-harvest microbiological interventions. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Spatial and Temporal Factors Associated with an Increased Prevalence of Listeria monocytogenes in Spinach Fields in New York State

PubMed Central

Weller, Daniel; Wiedmann, Martin

2015-01-01

While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = <0.001), suggesting that irrigation water may be a point source of L. monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. PMID:26116668

Diagnostic and molecular evaluation of three iridovirus-associated salamander mortality events

USGS Publications Warehouse

Docherty, D.E.; Meteyer, C.U.; Wang, Jingyuan; Mao, J.; Case, S.T.; Chinchar, V.G.

2003-01-01

In 1998 viruses were isolated from tiger salamander larvae (Ambystoma tigrinum diaboli and A. tigrinum melanostictum) involved in North Dakota and Utah (USA) mortality events and spotted salamander (A. maculatum) larvae in a third event in Maine (USA). Although sympatric caudates and anurans were present at all three sites only ambystomid larvae appeared to be affected. Mortality at the North Dakota site was in the thousands while at the Utah and Maine sites mortality was in the hundreds. Sick larvae were lethargic and slow moving. They swam in circles with obvious buoyancy problems and were unable to remain upright. On the ventral surface, near the gills and hind limbs, red spots or swollen areas were noted. Necropsy findings included: hemorrhages and ulceration of the skin, subcutaneous and intramuscular edema, swollen and pale livers with multifocal hemorrhage, and distended fluid-filled intestines with areas of hemorrhage. Light microscopy revealed intracytoplasmic inclusions, suggestive of a viral infection, in a variety of organs. Electron microscopy of ultra thin sections of the same tissues revealed iridovirus-like particles within the inclusions. These viruses were isolated from a variety of organs, indicating a systemic infection. Representative viral isolates from the three mortality events were characterized using molecular assays. Characterization confirmed that the viral isolates were iridoviruses and that the two tiger salamander isolates were similar and could be distinguished from the spotted salamander isolate. The spotted salamander isolate was similar to frog virus 3, the type species of the genus Ranavirus, while the tiger salamander isolates were not. These data indicate that different species of salamanders can become infected and die in association with different iridoviruses. Challenge assays are required to determine the fish and amphibian host range of these isolates and to assess the susceptibility of tiger and spotted salamanders to heterologous virus isolates.

Full-length genome analysis of two genetically distinct variants of porcine epidemic diarrhea virus in Thailand.

PubMed

Cheun-Arom, Thaniwan; Temeeyasen, Gun; Tripipat, Thitima; Kaewprommal, Pavita; Piriyapongsa, Jittima; Sukrong, Suchada; Chongcharoen, Wanchai; Tantituvanont, Angkana; Nilubol, Dachrit

2016-10-01

Porcine epidemic diarrhea virus (PEDV) has continued to cause sporadic outbreaks in Thailand since 2007 and a pandemic variant containing an insertion and deletion in the spike gene was responsible for outbreaks. In 2014, there were further outbreaks of the disease occurring within four months of each other. In this study, the full-length genome sequences of two genetically distinct PEDV isolates from the outbreaks were characterized. The two PEDV isolates, CBR1/2014 and EAS1/2014, were 28,039 and 28,033 nucleotides in length and showed 96.2% and 93.6% similarities at nucleotide and amino acid levels respectively. In total, we have observed 1048 nucleotide substitutions throughout the genome. Compared to EAS1/2014, CBR1/2014 has 2 insertions of 4 ((56)GENQ(59)) and 1 ((140)N) amino acid positions 56-59 and 140, and 2 deletions of 2 ((160)DG(161)) and 1 ((1199)Y) amino acid positions 160-161 and 1199. The phylogenetic analysis based on full-length genome of CBR1/2014 isolate has grouped the virus with the pandemic variants. In contrast, EAS1/2014 isolate was grouped with CV777, LZC and SM98, a classical variant. Our findings demonstrated the emergence of EAS1/2014, a classical variant which is novel to Thailand and genetically distinct from the currently circulating endemic variants. This study warrants further investigations into molecular epidemiology and genetic evolution of the PEDV in Thailand. Copyright © 2016 Elsevier B.V. All rights reserved.

An alphavirus temperature-sensitive capsid mutant reveals stages of nucleocapsid assembly

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zheng, Yan, E-mail: yzheng15@students.kgi.edu; Kielian, Margaret, E-mail: margaret.kielian@einstein.yu.edu

2015-10-15

Alphaviruses have a nucleocapsid core composed of the RNA genome surrounded by an icosahedral lattice of capsid protein. An insertion after position 186 in the capsid protein produced a strongly temperature-sensitive growth phenotype. Even when the structural proteins were synthesized at the permissive temperature (28 °C), subsequent incubation of the cells at the non-permissive temperature (37 °C) dramatically decreased mutant capsid protein stability and particle assembly. Electron microscopy confirmed the presence of cytoplasmic nucleocapsids in mutant-infected cells cultured at the permissive temperature, but these nucleocapsids were not stable to sucrose gradient separation. In contrast, nucleocapsids isolated from mutant virus particlesmore » had similar stability to that of wildtype virus. Our data support a model in which cytoplasmic nucleocapsids go through a maturation step during packaging into virus particles. The insertion site lies in the interface between capsid proteins in the assembled nucleocapsid, suggesting the region where such a stabilizing transition occurs. - Highlights: • We characterize an alphavirus capsid insertion mutation. • These capsid mutants are highly temperature sensitive for growth. • The insertion affects nucleocapsid stability. • Results suggest that the nucleocapsid is stabilized during virus budding.« less

Yersinia pestis IS1541 transposition provides for escape from plague immunity.

PubMed

Cornelius, Claire A; Quenee, Lauriane E; Elli, Derek; Ciletti, Nancy A; Schneewind, Olaf

2009-05-01

Yersinia pestis is perhaps the most feared infectious agent due to its ability to cause epidemic outbreaks of plague disease in animals and humans with high mortality. Plague infections elicit strong humoral immune responses against the capsular antigen (fraction 1 [F1]) of Y. pestis, and F1-specific antibodies provide protective immunity. Here we asked whether Y. pestis generates mutations that enable bacterial escape from protective immunity and isolated a variant with an IS1541 insertion in caf1A encoding the F1 outer membrane usher. The caf1A::IS1541 insertion prevented assembly of F1 pili and provided escape from plague immunity via F1-specific antibodies without a reduction in virulence in mouse models of bubonic or pneumonic plague. F1-specific antibodies interfere with Y. pestis type III transport of effector proteins into host cells, an inhibitory effect that was overcome by the caf1A::IS1541 insertion. These findings suggest a model in which IS1541 insertion into caf1A provides for reversible changes in envelope structure, enabling Y. pestis to escape from adaptive immune responses and plague immunity.

Molecular cloning and expression in streptomyces lividans of a hygromycin B phosphotransferase gene from Streptomyces hygroscopicus.

PubMed

Malpartida, F; Zalacaín, M; Jiménez, A; Davies, J

1983-11-30

The gene encoding the phosphotransferase enzyme that modifies hygromycin B in its producing organism Streptomyces hygroscopicus, has been cloned in the Streptomyces vector pIJ41. Two plasmids, pFM4 and pFM6, containing 2.1 and 19.6 kb inserts of Streptomyces hygroscopicus DNA, respectively, which express the modifying enzyme, have been isolated. A 3.1 kb PstI restriction fragment from pFM4 was inserted in the Streptomyces vector pIJ350 and the resulting plasmids, pMZ11.1 and pMZ11.2, express the hygromycin B-resistance phenotype. The utility of this dominant marker for cloning experiments is discussed in the text.

Perturbation of nuclear architecture by long-distance chromosome interactions.

PubMed

Dernburg, A F; Broman, K W; Fung, J C; Marshall, W F; Philips, J; Agard, D A; Sedat, J W

1996-05-31

Position-effect variegation (PEV) describes the stochastic transcriptional silencing of a gene positioned adjacent to heterochromatin. Using FISH, we have tested whether variegated expression of the eye-color gene brown in Drosophila is influenced by its nuclear localization. In embryonic nuclei, a heterochromatic insertion at the brown locus is always spatially isolated from other heterochromatin. However, during larval development this insertion physically associates with other heterochromatic regions on the same chromosome in a stochastic manner. These observations indicate that the brown gene is silenced by specific contact with centromeric heterochromatin. Moreover, they provide direct evidence for long-range chromosome interactions and their impact on three-dimensional nuclear architecture, while providing a cohesive explanation for the phenomenon of PEV.

Management of pancreatic collections with a novel endoscopically placed fully covered self-expandable metal stent: a national experience (with videos).

PubMed

Chandran, Sujievvan; Efthymiou, Marios; Kaffes, Arthur; Chen, John Wei; Kwan, Vu; Murray, Michael; Williams, David; Nguyen, Nam Quoc; Tam, William; Welch, Christine; Chong, Andre; Gupta, Saurabh; Devereaux, Ben; Tagkalidis, Peter; Parker, Frank; Vaughan, Rhys

2015-01-01

Recent medical literature on novel lumen-apposing stents for the treatment of pancreatic fluid collections (PFCs) is limited by small numbers, solo operators, and single-center experience. To evaluate a recently developed lumen-apposing, fully covered self-expandable metal stent (FCSEMS) in the management of PFCs. Retrospective case series. Thirteen tertiary and private health care centers across Australia. Forty-seven patients (median age 51 years) who underwent endoscopic management of PFCs. Insertion of FCSEMS after PFC puncture under EUS guidance. A subgroup of 9 patients underwent direct endoscopic necrosectomy. Technical and clinical success rate, adverse event rate. The technical success rate was 53 of 54 patients (98.1%), and the initial clinical success rate was 36 of 47 (76.6%), which was sustained for more than 6 months in 34 of 36 (94.4%). Early adverse events included 4 cases (7.4%) of stent migration during direct endoscopic necrosectomy, 4 cases (7.4%) of sepsis, 1 case (1.9%) of bleeding, and 1 case (1.9%) of stent migration into the fistula tract. Late adverse events were 6 (11.1%) spontaneous stent migrations, 3 (5.6%) recurrent stent occlusions, 3 (5.6%) tissue ingrowth/overgrowth, and 2 (3.7%) bleeding into PFC. The majority of stents inserted (48 of 54, 88.9%) and removed (31 of 35, 88.6%) in our study were described by the operator as superior to pigtail stents with regard to ease of use. Retrospective study. Although FCSEMSs are technically easier to insert and remove compared with traditional pigtail stents, there are significant limitations to the widespread use of FCSEMSs in the management of PFCs. These include cost, adverse events, and lower-than-expected resolution rates. Copyright © 2015 American Society for Gastrointestinal Endoscopy. Published by Elsevier Inc. All rights reserved.

CTX-M Enzymes: Origin and Diffusion

PubMed Central

Cantón, Rafael; González-Alba, José María; Galán, Juan Carlos

2012-01-01

CTX-M β-lactamases are considered a paradigm in the evolution of a resistance mechanism. Incorporation of different chromosomal blaCTX-M related genes from different species of Kluyvera has derived in different CTX-M clusters. In silico analyses have shown that this event has occurred at least nine times; in CTX-M-1 cluster (3), CTX-M-2 and CTX-M-9 clusters (2 each), and CTX-M-8 and CTX-M-25 clusters (1 each). This has been mainly produced by the participation of genetic mobilization units such as insertion sequences (ISEcp1 or ISCR1) and the later incorporation in hierarchical structures associated with multifaceted genetic structures including complex class 1 integrons and transposons. The capture of these blaCTX-M genes from the environment by highly mobilizable structures could have been a random event. Moreover, after incorporation within these structures, β-lactam selective force such as that exerted by cefotaxime and ceftazidime has fueled mutational events underscoring diversification of different clusters. Nevertheless, more variants of CTX-M enzymes, including those not inhibited by β-lactamase inhibitors such as clavulanic acid (IR-CTX-M variants), only obtained under in in vitro experiments, are still waiting to emerge in the clinical setting. Penetration and the later global spread of CTX-M producing organisms have been produced with the participation of the so-called “epidemic resistance plasmids” often carried in multi-drug resistant and virulent high-risk clones. All these facts but also the incorporation and co-selection of emerging resistance determinants within CTX-M producing bacteria, such as those encoding carbapenemases, depict the currently complex pandemic scenario of multi-drug resistant isolates. PMID:22485109

Ventricular flow dynamics with varying LVAD inflow cannula lengths: In-silico evaluation in a multiscale model.

PubMed

Liao, Sam; Neidlin, Michael; Li, Zhiyong; Simpson, Benjamin; Gregory, Shaun D

2018-04-27

Left ventricular assist devices are associated with thromboembolic events, which are potentially caused by altered intraventricular flow. Due to patient variability, differences in apical wall thickness affects cannula insertion lengths, potentially promoting unfavourable intraventricular flow patterns which are thought to be correlated to the risk of thrombosis. This study aimed to present a 3D multiscale computational fluid dynamic model of the left ventricle (LV) developed using a commercial software, Ansys, and evaluate the risk of thrombosis with varying inflow cannula insertion lengths in a severely dilated LV. Based on a HeartWare HVAD inflow cannula, insertion lengths of 5, 19, 24 and 50 mm represented cases of apical hypertrophy, typical ranges of apical thicknesses and an experimental length, respectively. The risk of thrombosis was evaluated based on blood washout, residence time, instantaneous blood stagnation and a pulsatility index. By introducing fresh blood to displace pre-existing blood in the LV, after 5 cardiac cycles, 46.7%, 45.7%, 45.1% and 41.8% of pre-existing blood remained for insertion lengths of 5, 19, 24 and 50 mm, respectively. Compared to the 50 mm insertion, blood residence time was at least 9%, 7% and 6% higher with the 5, 19 and 24 mm insertion lengths, respectively. No instantaneous stagnation at the apex was observed directly after the E-wave. Pulsatility indices adjacent to the cannula increased with shorter insertion lengths. For the specific scenario studied, a longer insertion length, relative to LV size, may be advantageous to minimise thrombosis by increasing LV washout and reducing blood residence time. Copyright © 2018 Elsevier Ltd. All rights reserved.

Molecular Epidemiology of Colistin-Resistant, Carbapenemase-Producing Klebsiella pneumoniae in Serbia from 2013 to 2016

PubMed Central

Novović, Katarina; Trudić, Anika; Brkić, Snežana; Vasiljević, Zorica; Kojić, Milan; Medić, Deana; Ćirković, Ivana

2017-01-01

ABSTRACT Twenty-seven colistin-resistant, carbapenemase-producing Klebsiella pneumoniae isolates were identified from hospitals in Serbia. All isolates were blaCTX-M-15 positive; ST101, ST888, ST437, ST336, and ST307 were blaOXA-48 positive; and ST340 was blaNDM-1 positive. ST307 had an insertion, and ST336 had a premature stop codon in the mgrB gene. Amino acid substitutions were detected in PmrAB of isolates ST101, ST888, ST336, and ST307. The mcr-1 and mcr-2 were not detected. An increase in phoP, phoQ, and pmrK gene transcription was detected for all sequence types. PMID:28242665

Characterization of consecutive Streptococcus pyogenes isolates from patients with pharyngitis and bacteriological treatment failure: special reference to prtF1 and sic / drs.

PubMed

Brandt, C M; Allerberger, F; Spellerberg, B; Holland, R; Lütticken, R; Haase, G

2001-02-15

To analyze bacteriological treatment failure in streptococcal pharyngitis, 40 consecutive Streptococcus pyogenes isolates from 18 patients were characterized. For 17 patients, isolates were indistinguishable with respect to emm type, random amplified polymorphic DNA pattern, and presence of prtF1 encoding the fibronectin-binding protein F1. prtF1 was detected only in the 11 isolates (4 patients) with emm12 and in the single isolate with emm6. Further analysis by vir(mga) regulon typing, sequencing of sic encoding the streptococcal inhibitor of complement from 19 isolates with emm1 (9 patients), and sequencing of drs (distantly related sic) from 11 isolates with emm12 revealed distinct sic alleles with insertions and/or deletions in sic that corresponded to differences in restriction patterns of the vir(mga) regulon only for paired isolates of 2 patients. Among isolates with emm12, 2 novel drs alleles were found. Analysis of these data suggests that neither the presence of prtF1 nor the diversification of sic / drs is required for the persistence of S. pyogenes in pharyngitis.

Terahertz isolator based on nonreciprocal magneto-metasurface.

PubMed

Chen, Sai; Fan, Fei; Wang, Xianghui; Wu, Pengfei; Zhang, Hui; Chang, Shengjiang

2015-01-26

A magneto-metasurface with nonreciprocal terahertz (THz) transmission has been proposed to form a THz isolator. Importantly, we have discussed the two necessary conditions for THz nonreciprocal transmission in the metasurface: (1) There should be magneto-optical responses for THz waves in the metasurface; (2) The transmission system of the metasurface needs to be asymmetric for forward and backward waves. These two conditions lead to the time reversal symmetry breaking of system, and the magnetoplasmon mode splitting and nonreciprocal resonance enhancement can be observed in the asymmetry magneto-metasurface. Moreover, the isolation dependences and tunability on the external magnetic field and temperature have also been investigated, which shows that the best operating state with a high isolation can be designed. The numerical simulations show a maximum isolation of 43 dB and a 10 dB operating bandwidth of 20 GHz under an external magnetic field of 0.3 T, and the insertion loss is smaller than 1.79 dB. This low-loss, high isolation, easy coupling THz isolator has broadly potentials for THz application systems.

Complete genome sequences of two highly divergent Japanese isolates of Plantago asiatica mosaic virus.

PubMed

Komatsu, Ken; Yamashita, Kazuo; Sugawara, Kota; Verbeek, Martin; Fujita, Naoko; Hanada, Kaoru; Uehara-Ichiki, Tamaki; Fuji, Shin-Ichi

2017-02-01

Plantago asiatica mosaic virus (PlAMV) is a member of the genus Potexvirus and has an exceptionally wide host range. It causes severe damage to lilies. Here we report on the complete nucleotide sequences of two new Japanese PlAMV isolates, one from the eudicot weed Viola grypoceras (PlAMV-Vi), and the other from the eudicot shrub Nandina domestica Thunb. (PlAMV-NJ). Their genomes contain five open reading frames (ORFs), which is characteristic of potexviruses. Surprisingly, the isolates showed only 76.0-78.0 % sequence identity with each other and with other PlAMV isolates, including isolates from Japanese lily and American nandina. Amino acid alignments of the replicase coding region encoded by ORF1 showed that the regions between the methyltransferase and helicase domains were less conserved than other regions, with several insertions and/or deletions. Phylogenetic analyses of the full-length nucleotide sequences revealed a moderate correlation between phylogenetic clustering and the original host plants of the PlAMV isolates. This study revealed the presence of two highly divergent PlAMV isolates in Japan.

Phenotypic and Genotypic Characterization of Enterobacteriaceae Producing Oxacillinase-48–Like Carbapenemases, United States

PubMed Central

Zhu, Wenming; de Man, Tom J.B.; Avillan, Johannetsy J.; Anderson, Karen F.; Lonsway, David R.; Rowe, Lori A.; Batra, Dhwani; Rasheed, J. Kamile; Limbago, Brandi M.

2018-01-01

Oxacillinase (OXA)–48–like carbapenemases remain relatively uncommon in the United States. We performed phenotypic and genotypic characterization of 30 Enterobacteriaceae producing OXA-48–like carbapenemases that were recovered from patients during 2010–2014. Isolates were collected from 12 states and not associated with outbreaks, although we could not exclude limited local transmission. The alleles β-lactamase OXA-181 (blaOXA-181) (43%), blaOXA-232 (33%), and blaOXA-48 (23%) were found. All isolates were resistant to ertapenem and showed positive results for the ertapenem and meropenem modified Hodge test and the modified carbapenem inactivation method; 73% showed a positive result for the Carba Nordmann–Poirel test. Whole-genome sequencing identified extended-spectrum β-lactamase genes in 93% of isolates. In all blaOXA-232 isolates, the gene was on a ColKP3 plasmid. A total of 12 of 13 isolates harboring blaOXA-181 contained the insertion sequence ΔISEcp1. In all isolates with blaOXA-48, the gene was located on a TN1999 transposon; these isolates also carried IncL/M plasmids. PMID:29553324

Serial recall and presentation schedule: a micro-analysis of local distinctiveness.

PubMed

Lewandowsky, Stephan; Brown, Gordon D A

2005-01-01

According to temporal distinctiveness theories, items that are temporally isolated from their neighbours during presentation are more distinct and thus are recalled better. Event-based theories, which deny that elapsed time plays a role at encoding, explain isolation effects by assuming that temporal isolation provides extra time for rehearsal or consolidation of encoding. The two classes of theories can be differentiated by examining the symmetry of isolation effects: Event-based accounts predict that performance should be affected only by pauses following item presentation (because they allow time for rehearsal or consolidation), whereas distinctiveness predicts that items should also benefit from preceding pauses. The first experiment manipulated inter-item intervals and showed an effect of intervals following but not preceding presentation, in line with event-based accounts. The second experiment showed that the effect of following interval was abolished by articulatory suppression. The data are consistent with event-based theories but can be handled by time-based distinctiveness models if they allow for additional encoding during inter-item pauses.

Cas9-Guide RNA Directed Genome Editing in Soybean[OPEN

PubMed Central

Li, Zhongsen; Liu, Zhan-Bin; Xing, Aiqiu; Moon, Bryan P.; Koellhoffer, Jessica P.; Huang, Lingxia; Ward, R. Timothy; Clifton, Elizabeth; Falco, S. Carl; Cigan, A. Mark

2015-01-01

Recently discovered bacteria and archaea adaptive immune system consisting of clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) endonuclease has been explored in targeted genome editing in different species. Streptococcus pyogenes Cas9-guide RNA (gRNA) was successfully applied to generate targeted mutagenesis, gene integration, and gene editing in soybean (Glycine max). Two genomic sites, DD20 and DD43 on chromosome 4, were mutagenized with frequencies of 59% and 76%, respectively. Sequencing randomly selected transgenic events confirmed that the genome modifications were specific to the Cas9-gRNA cleavage sites and consisted of small deletions or insertions. Targeted gene integrations through homology-directed recombination were detected by border-specific polymerase chain reaction analysis for both sites at callus stage, and one DD43 homology-directed recombination event was transmitted to T1 generation. T1 progenies of the integration event segregated according to Mendelian laws and clean homozygous T1 plants with the donor gene precisely inserted at the DD43 target site were obtained. The Cas9-gRNA system was also successfully applied to make a directed P178S mutation of acetolactate synthase1 gene through in planta gene editing. PMID:26294043

The Transposable Element Mariner Mediates Germline Transformation in Drosophila Melanogaster

PubMed Central

Lidholm, D. A.; Lohe, A. R.; Hartl, D. L.

1993-01-01

A vector for germline transformation in Drosophila melanogaster was constructed using the transposable element mariner. The vector, denoted pMlwB, contains a mariner element disrupted by an insertion containing the wild-type white gene from D. melanogaster, the β-galactosidase gene from Escherichia coli and sequences that enable plasmid replication and selection in E. coli. The white gene is controlled by the promoter of the D. melanogaster gene for heat-shock protein 70, and the β-galactosidase gene is flanked upstream by the promoter of the transposable element P as well as that of mariner. The MlwB element was introduced into the germline of D. melanogaster by co-injection into embryos with an active mariner element, Mos1, which codes for a functional transposase and serves as a helper. Two independent germline insertions were isolated and characterized. The results show that the MlwB element inserted into the genome in a mariner-dependent manner with the termini of the inverted repeats inserted at a TA dinucleotide. Both insertions exhibit an unexpected degree of germline and somatic stability, even in the presence of an active mariner element in the genetic background. These results demonstrate that the mariner transposable element, which is small (1286 bp) and relatively homogeneous in size among different copies, is nevertheless capable of promoting the insertion of the large (13.2 kb) MlwB element. Because of the widespread phylogenetic distribution of mariner among insects, these results suggest that mariner might provide a wide hostrange transformation vector for insects. PMID:8394264

Genomic diversity and adaptation of Salmonella enterica serovar Typhimurium from analysis of six genomes of different phage types

PubMed Central

2013-01-01

Background Salmonella enterica serovar Typhimurium (or simply Typhimurium) is the most common serovar in both human infections and farm animals in Australia and many other countries. Typhimurium is a broad host range serovar but has also evolved into host-adapted variants (i.e. isolated from a particular host such as pigeons). Six Typhimurium strains of different phage types (defined by patterns of susceptibility to lysis by a set of bacteriophages) were analysed using Illumina high-throughput genome sequencing. Results Variations between strains were mainly due to single nucleotide polymorphisms (SNPs) with an average of 611 SNPs per strain, ranging from 391 SNPs to 922 SNPs. There were seven insertions/deletions (indels) involving whole or partial gene deletions, four inactivation events due to IS200 insertion and 15 pseudogenes due to early termination. Four of these inactivated or deleted genes may be virulence related. Nine prophage or prophage remnants were identified in the six strains. Gifsy-1, Gifsy-2 and the sopE2 and sspH2 phage remnants were present in all six genomes while Fels-1, Fels-2, ST64B, ST104 and CP4-57 were variably present. Four strains carried the 90-kb plasmid pSLT which contains several known virulence genes. However, two strains were found to lack the plasmid. In addition, one strain had a novel plasmid similar to Typhi strain CT18 plasmid pHCM2. Conclusion The genome data suggest that variations between strains were mainly due to accumulation of SNPs, some of which resulted in gene inactivation. Unique genetic elements that were common between host-adapted phage types were not found. This study advanced our understanding on the evolution and adaptation of Typhimurium at genomic level. PMID:24138507

Heterogeneity in Induction Level, Infection Ability, and Morphology of Shiga Toxin-Encoding Phages (Stx Phages) from Dairy and Human Shiga Toxin-Producing Escherichia coli O26:H11 Isolates

PubMed Central

Bonanno, Ludivine; Petit, Marie-Agnès; Loukiadis, Estelle; Michel, Valérie

2016-01-01

Shiga toxin (Stx)-producing Escherichia coli (STEC) bacteria are foodborne pathogens responsible for diarrhea and hemolytic-uremic syndrome (HUS). Shiga toxin, the main STEC virulence factor, is encoded by the stx gene located in the genome of a bacteriophage inserted into the bacterial chromosome. The O26:H11 serotype is considered to be the second-most-significant HUS-causing serotype worldwide after O157:H7. STEC O26:H11 bacteria and their stx-negative counterparts have been detected in dairy products. They may convert from the one form to the other by loss or acquisition of Stx phages, potentially confounding food microbiological diagnostic methods based on stx gene detection. Here we investigated the diversity and mobility of Stx phages from human and dairy STEC O26:H11 strains. Evaluation of their rate of in vitro induction, occurring either spontaneously or in the presence of mitomycin C, showed that the Stx2 phages were more inducible overall than Stx1 phages. However, no correlation was found between the Stx phage levels produced and the origin of the strains tested or the phage insertion sites. Morphological analysis by electron microscopy showed that Stx phages from STEC O26:H11 displayed various shapes that were unrelated to Stx1 or Stx2 types. Finally, the levels of sensitivity of stx-negative E. coli O26:H11 to six Stx phages differed among the 17 strains tested and our attempts to convert them into STEC were unsuccessful, indicating that their lysogenization was a rare event. PMID:26826235

Mutations in CG8878, a Novel Putative Protein Kinase, Enhance P Element Dependent Silencing (PDS) and Position Effect Variegation (PEV) in Drosophila melanogaster

PubMed Central

McCracken, Allen; Locke, John

2014-01-01

Genes in multicellular organisms are expressed as part of a developmental program that is largely dependent on self-perpetuating higher-order chromatin states. The mechanism of establishing and maintaining these epigenetic events is well studied in Drosophila. The first known example of an epigenetic effect was that of (PEV) in Drosophila, which has been shown to be due to gene silencing via heterochromatin formation. We are investigating a process similar to Position Effect Variegation (PEV) using a mini-w transgene, called Pci, inserted in the upstream regulatory region of ci. The mini-white + transgene in Pci is expressed throughout the adult eye; however, when other P or KP elements are present, a variegated eye phenotype results indicating random w + silencing during development. This P element dependent silencing (PDS) can be modified by the haplo-suppressors/triplo-enhancers, Su(var)205 and Su(var)3–7, indicating that these heterochromatic modifiers also act dose dependently in PDS. Here we use a spontaneous derivative mutation of Pci called PciE1 (E1) that variegates like PDS in the absence of P elements, presumably due to an adjacent gypsy element insertion, to screen for second-site modifier mutations that enhance variable silencing of white + in E1. We isolated 7 mutations in CG8878, an essential gene, that enhance the E1 variegated phenotype. CG8878, a previously uncharacterized gene, potentially encodes a serine/threonine kinase whose closest Drosophila paralogue, ballchen (nhk-1), phosphorylates histones. These mutant alleles enhance both PDS at E1 and Position Effect Variegation (PEV) at wm4, indicating a previously unknown common silencing mechanism between the two. PMID:24614804

Complexity of resistance mechanisms to imipenem in intensive care unit strains of Pseudomonas aeruginosa.

PubMed

Fournier, Damien; Richardot, Charlotte; Müller, Emeline; Robert-Nicoud, Marjorie; Llanes, Catherine; Plésiat, Patrick; Jeannot, Katy

2013-08-01

Pseudomonas aeruginosa can become resistant to carbapenems by both intrinsic (mutation-driven) and transferable (β-lactamase-based) mechanisms. Knowledge of the prevalence of these various mechanisms is important in intensive care units (ICUs) in order to define optimal prevention and therapeutic strategies. A total of 109 imipenem-non-susceptible (MIC >4 mg/L) strains of P. aeruginosa were collected in June 2010 from the ICUs of 26 French public hospitals. Their resistance mechanisms were characterized by phenotypic, enzymatic, western blotting and molecular methods. Single or associated imipenem resistance mechanisms were identified among the 109 strains. Seven isolates (6.4%) were found to produce a metallo-β-lactamase (one VIM-1, four VIM-2, one VIM-4 and one IMP-29). Porin OprD was lost in 94 (86.2%) strains as a result of mutations or gene disruption by various insertion sequences (ISPa1635, ISPa1328, IS911, ISPs1, IS51, IS222 and ISPa41). Thirteen other strains were shown to be regulatory mutants in which down-regulation of oprD was coupled with overexpressed efflux pumps CzcCBA (n = 1), MexXY (n = 9) and MexEF-OprN (n = 3). The lack of OprD was due to disruption of the oprD promoter by ISPsy2 in one strain and alteration of the porin signal sequence in another. Imipenem resistance in ICU P. aeruginosa strains may result from multiple mechanisms involving metallo-β-lactamase gene acquisition and genetic events (mutations and ISs) inactivating oprD, turning down its expression while increasing efflux activities or preventing insertion of porin OprD in the outer membrane. This diversity of mechanisms allows P. aeruginosa, more than any other nosocomial pathogen, to rapidly adapt to carbapenems in ICUs.

High-throughput analysis of T-DNA location and structure using sequence capture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.

Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less

High-throughput analysis of T-DNA location and structure using sequence capture

DOE PAGES

Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.; ...

2015-10-07

Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less

Transcriptional Enhancers Induce Insertional Gene Deregulation Independently From the Vector Type and Design

PubMed Central

Maruggi, Giulietta; Porcellini, Simona; Facchini, Giulia; Perna, Serena K; Cattoglio, Claudia; Sartori, Daniela; Ambrosi, Alessandro; Schambach, Axel; Baum, Christopher; Bonini, Chiara; Bovolenta, Chiara; Mavilio, Fulvio; Recchia, Alessandra

2009-01-01

The integration characteristics of retroviral (RV) vectors increase the probability of interfering with the regulation of cellular genes, and account for a tangible risk of insertional mutagenesis in treated patients. To assess the potential genotoxic risk of conventional or self-inactivating (SIN) γ-RV and lentiviral (LV) vectors independently from the biological consequences of the insertion event, we developed a quantitative assay based on real-time reverse transcriptase—PCR on low-density arrays to evaluate alterations of gene expression in individual primary T-cell clones. We show that the Moloney leukemia virus long terminal repeat (LTR) enhancer has the strongest activity in both a γ-RV and a LV vector context, while an internal cellular promoter induces deregulation of gene expression less frequently, at a shorter range and to a lower extent in both vector types. Downregulation of gene expression was observed only in the context of LV vectors. This study indicates that insertional gene activation is determined by the characteristics of the transcriptional regulatory elements carried by the vector, and is largely independent from the vector type or design. PMID:19293778

DEVICE FOR CONTROLLING INSERTION OF ROD

DOEpatents

Beaty, B.J.

1958-10-14

A device for rapidly inserting a safety rod into a nuclear reactor upon a given signal or in the event of a power failure in order to prevent the possibility of extensive damage caused by a power excursion is described. A piston is slidably mounted within a vertical cylinder with provision for an electromagnetic latch at the top of the cylinder. This assembly, with a safety rod attached to the piston, is mounted over an access port to the core region of the reactor. The piston is normally latched at the top of the cylinder with the safety rod clear of the core area, however, when the latch is released, the piston and rod drop by their own weight to insert the rod. Vents along the side of the cylinder permit the escape of the air entrapped under the piston over the greater part of the distance, however, at the end of the fall the entrapped air is compressed thereby bringing the safety rod gently to rest, thus providing for a rapid automatic insertion of the rod with a minimum of structural shock.

Artist concept illustrating key events on day by day basis during Apollo 9

NASA Technical Reports Server (NTRS)

1969-01-01

Artist concept illustrating key events on day by day basis during Apollo 9 mission. First photograph illustrates activities on the first day of the mission, including flight crew preparation, orbital insertion, 103 north mile orbit, separations, docking and docked Service Propulsion System Burn (19792); Second day events include landmark tracking, pitch maneuver, yaw-roll maneuver, and high apogee orbits (19793); Third day events include crew transfer and Lunar Module system evaluation (19794); Fourth day events include use of camera, day-night extravehicular activity, use of golden slippers, and television over Texas and Louisiana (19795); Fifth day events include vehicles undocked, Lunar Module burns for rendezvous, maximum separation, ascent propulsion system burn, formation flying and docking, and Lunar Module jettison ascent burn (19796); Sixth thru ninth day events include service propulsion system burns and landmark sightings, photograph special tests (19797); Tenth day events i

Beet western yellows virus infects the carnivorous plant Nepenthes mirabilis.

PubMed

Miguel, Sissi; Biteau, Flore; Mignard, Benoit; Marais, Armelle; Candresse, Thierry; Theil, Sébastien; Bourgaud, Frédéric; Hehn, Alain

2016-08-01

Although poleroviruses are known to infect a broad range of higher plants, carnivorous plants have not yet been reported as hosts. Here, we describe the first polerovirus naturally infecting the pitcher plant Nepenthes mirabilis. The virus was identified through bioinformatic analysis of NGS transcriptome data. The complete viral genome sequence was assembled from overlapping PCR fragments and shown to share 91.1 % nucleotide sequence identity with the US isolate of beet western yellows virus (BWYV). Further analysis of other N. mirabilis plants revealed the presence of additional BWYV isolates differing by several insertion/deletion mutations in ORF5.

indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

PubMed

Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

2017-01-01

Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

Development and Event-specific Detection of Transgenic Glyphosate-resistant Rice Expressing the G2-EPSPS Gene

PubMed Central

Dong, Yufeng; Jin, Xi; Tang, Qiaoling; Zhang, Xin; Yang, Jiangtao; Liu, Xiaojing; Cai, Junfeng; Zhang, Xiaobing; Wang, Xujing; Wang, Zhixing

2017-01-01

Glyphosate is a widely used herbicide, due to its broad spectrum, low cost, low toxicity, high efficiency, and non-selective characteristics. Rice farmers rarely use glyphosate as a herbicide, because the crop is sensitive to this chemical. The development of transgenic glyphosate-tolerant rice could greatly improve the economics of rice production. Here, we transformed the Pseudomonas fluorescens G2 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS) gene G2-EPSPS, which conferred tolerance to glyphosate herbicide into a widely used japonica rice cultivar, Zhonghua 11 (ZH11), to develop two highly glyphosate-tolerant transgenic rice lines, G2-6 and G2-7, with one exogenous gene integration. Seed germination tests and glyphosate-tolerance assays of plants grown in a greenhouse showed that the two transgenic lines could greatly improve glyphosate-tolerance compared with the wild-type; The glyphosate-tolerance field test indicated that both transgenic lines could grow at concentrations of 20,000 ppm glyphosate, which is more than 20-times the recommended concentration in the field. Isolation of the flanking sequence of transgenic rice G2-6 indicated that the 5′-terminal of T-DNA was inserted into chromosome 8 of the rice genome. An event-specific PCR test system was established and the limit of detection of the primers reached five copies. Overall, the G2-EPSPS gene significantly improved glyphosate-tolerance in transgenic rice; furthermore, it is a useful candidate gene for the future development of commercial transgenic rice. PMID:28611804

Accumulation of transposable elements in Hox gene clusters during adaptive radiation of Anolis lizards.

PubMed

Feiner, Nathalie

2016-10-12

Transposable elements (TEs) are DNA sequences that can insert elsewhere in the genome and modify genome structure and gene regulation. The role of TEs in evolution is contentious. One hypothesis posits that TE activity generates genomic incompatibilities that can cause reproductive isolation between incipient species. This predicts that TEs will accumulate during speciation events. Here, I tested the prediction that extant lineages with a relatively high rate of speciation have a high number of TEs in their genomes. I sequenced and analysed the TE content of a marker genomic region (Hox clusters) in Anolis lizards, a classic case of an adaptive radiation. Unlike other vertebrates, including closely related lizards, Anolis lizards have high numbers of TEs in their Hox clusters, genomic regions that regulate development of the morphological adaptations that characterize habitat specialists in these lizards. Following a burst of TE activity in the lineage leading to extant Anolis, TEs have continued to accumulate during or after speciation events, resulting in a positive relationship between TE density and lineage speciation rate. These results are consistent with the prediction that TE activity contributes to adaptive radiation by promoting speciation. Although there was no evidence that TE density per se is associated with ecological morphology, the activity of TEs in Hox clusters could have been a rich source for phenotypic variation that may have facilitated the rapid parallel morphological adaptation to microhabitats seen in extant Anolis lizards. © 2016 The Author(s).

Accumulation of transposable elements in Hox gene clusters during adaptive radiation of Anolis lizards

PubMed Central

2016-01-01

Transposable elements (TEs) are DNA sequences that can insert elsewhere in the genome and modify genome structure and gene regulation. The role of TEs in evolution is contentious. One hypothesis posits that TE activity generates genomic incompatibilities that can cause reproductive isolation between incipient species. This predicts that TEs will accumulate during speciation events. Here, I tested the prediction that extant lineages with a relatively high rate of speciation have a high number of TEs in their genomes. I sequenced and analysed the TE content of a marker genomic region (Hox clusters) in Anolis lizards, a classic case of an adaptive radiation. Unlike other vertebrates, including closely related lizards, Anolis lizards have high numbers of TEs in their Hox clusters, genomic regions that regulate development of the morphological adaptations that characterize habitat specialists in these lizards. Following a burst of TE activity in the lineage leading to extant Anolis, TEs have continued to accumulate during or after speciation events, resulting in a positive relationship between TE density and lineage speciation rate. These results are consistent with the prediction that TE activity contributes to adaptive radiation by promoting speciation. Although there was no evidence that TE density per se is associated with ecological morphology, the activity of TEs in Hox clusters could have been a rich source for phenotypic variation that may have facilitated the rapid parallel morphological adaptation to microhabitats seen in extant Anolis lizards. PMID:27733546

NHC-catalyzed cleavage of vicinal diketones and triketones followed by insertion of enones and ynones.

PubMed

Takaki, Ken; Hino, Makoto; Ohno, Akira; Komeyama, Kimihiro; Yoshida, Hiroto; Fukuoka, Hiroshi

2017-01-01

Thiazolium carbene-catalyzed reactions of 1,2-diketones and 1,2,3-triketones with enones and ynones have been investigated. The diketones gave α,β-double acylation products via unique Breslow intermediates isolable as acid salts, whereas the triketones formed stable adducts with the NHC instead of the coupling products.

GENETIC ANALYSIS OF THE AGGA LOCUS INVOLVED IN AGGLUTINATION ND ADHERENCE OF PSEUDOMONAS PUTIDA, A BENEFICIAL FLUORESCENT PSEUDOMONAD

EPA Science Inventory

An isolate of Pseudomonas putida, which rapidly adheres to plant roots is agglutinated by a glycoprotein from root surfaces. gglutination is presented and adherence to the root surface is diminished by Tn5 insertion in mutant 5123. wo cosmid clones from wild type P putida and 2.7...

NHC-catalyzed cleavage of vicinal diketones and triketones followed by insertion of enones and ynones

PubMed Central

Hino, Makoto; Ohno, Akira; Komeyama, Kimihiro; Yoshida, Hiroto; Fukuoka, Hiroshi

2017-01-01

Thiazolium carbene-catalyzed reactions of 1,2-diketones and 1,2,3-triketones with enones and ynones have been investigated. The diketones gave α,β-double acylation products via unique Breslow intermediates isolable as acid salts, whereas the triketones formed stable adducts with the NHC instead of the coupling products. PMID:28904625

The prevalence of the duodenal ulcer promoting gene (dupA) in Helicobacter pylori isolates varies by ethnic group and is not universally associated with disease development: a case-control study

PubMed Central

Schmidt, Heather-Marie A; Andres, Sönke; Kaakoush, Nadeem O; Engstrand, Lars; Eriksson, Lena; Goh, Khean-Lee; Fock, Kwong Ming; Hilmi, Ida; Dhamodaran, Subbiah; Forman, David; Mitchell, Hazel

2009-01-01

Background The putative H. pylori pathogenicity-associated factor dupA has been associated with IL-8 induction in vitro, and duodenal ulcer (DU) and gastric cancer (GC) development in certain populations, but this association is inconsistent between studies. We aimed to investigate dupA prevalence in clinical isolates from Sweden, Australia and from ethnic Chinese, Indians and Malays resident in Malaysia and Singapore and to examine the association with DU and GC. In addition we investigated the sequence diversity between isolates from these diverse groups and compared the level of IL-8 secretion in isolates possessing and lacking dupA. Methods PCR primers were designed to amplify over the C/T insertion denoting a continuous dupA. PCR products from 29 clinical isolates were sequenced and compared with sequences from three additional strains obtained from GenBank. Clinical isolates from 21 Malaysian patients (8 dupA-positive, 14 dupA-negative) were assessed for their ability to induce IL-8 in AGS cells in vitro. Statistical analysis was performed using Fisher's exact test. Results The prevalence of dupA in isolates from Swedish functional dyspepsia (FD) control patients (65%, 13/20) was higher and in isolates from Indian FD patients (7.1%, 3/42) was lower as compared with isolates from Chinese (28.9%, 13/49, P = 0.005, P = 0.025), Malay (35.7%, 5/14, P = 0.16, P = 0.018) and Australian (37.8%, 17/45, P = 0.060, P < 0.001) FD patients. dupA was associated with DU and GC development in Chinese with 62.5% (10/16) and 54.6% (12/22) of isolates possessing dupA respectively as compared with FD controls (28.9%) (P = 0.015, P = 0.032). No significant difference in prevalence of dupA between FD controls, DU (63.6%, 7/11) and GC (61.9%, 13/21) cases (P = 1.000) was observed in the Swedish population. Sequence analysis revealed a pairwise variation of 1.9% and all isolates possessed the C/T insertion. The average IL-8 induction was 1330 pg/mL for dupA-positive isolates and 1378 pg/mL for dupA-negative isolates. Conclusion Although dupA is highly conserved when present, we identified no consistent association between dupA and DU or GC development across the ethnic groups investigated, with the dupA prevalence in control groups varying significantly. Our results would suggest that in the clinical isolates investigated dupA is not associated with IL-8 induction in vitro. PMID:19338650

The prevalence of the duodenal ulcer promoting gene (dupA) in Helicobacter pylori isolates varies by ethnic group and is not universally associated with disease development: a case-control study.

PubMed

Schmidt, Heather-Marie A; Andres, Sönke; Kaakoush, Nadeem O; Engstrand, Lars; Eriksson, Lena; Goh, Khean-Lee; Fock, Kwong Ming; Hilmi, Ida; Dhamodaran, Subbiah; Forman, David; Mitchell, Hazel

2009-03-11

The putative H. pylori pathogenicity-associated factor dupA has been associated with IL-8 induction in vitro, and duodenal ulcer (DU) and gastric cancer (GC) development in certain populations, but this association is inconsistent between studies. We aimed to investigate dupA prevalence in clinical isolates from Sweden, Australia and from ethnic Chinese, Indians and Malays resident in Malaysia and Singapore and to examine the association with DU and GC. In addition we investigated the sequence diversity between isolates from these diverse groups and compared the level of IL-8 secretion in isolates possessing and lacking dupA. PCR primers were designed to amplify over the C/T insertion denoting a continuous dupA. PCR products from 29 clinical isolates were sequenced and compared with sequences from three additional strains obtained from GenBank. Clinical isolates from 21 Malaysian patients (8 dupA-positive, 14 dupA-negative) were assessed for their ability to induce IL-8 in AGS cells in vitro. Statistical analysis was performed using Fisher's exact test. The prevalence of dupA in isolates from Swedish functional dyspepsia (FD) control patients (65%, 13/20) was higher and in isolates from Indian FD patients (7.1%, 3/42) was lower as compared with isolates from Chinese (28.9%, 13/49, P = 0.005, P = 0.025), Malay (35.7%, 5/14, P = 0.16, P = 0.018) and Australian (37.8%, 17/45, P = 0.060, P < 0.001) FD patients. dupA was associated with DU and GC development in Chinese with 62.5% (10/16) and 54.6% (12/22) of isolates possessing dupA respectively as compared with FD controls (28.9%) (P = 0.015, P = 0.032). No significant difference in prevalence of dupA between FD controls, DU (63.6%, 7/11) and GC (61.9%, 13/21) cases (P = 1.000) was observed in the Swedish population. Sequence analysis revealed a pairwise variation of 1.9% and all isolates possessed the C/T insertion. The average IL-8 induction was 1330 pg/mL for dupA-positive isolates and 1378 pg/mL for dupA-negative isolates. Although dupA is highly conserved when present, we identified no consistent association between dupA and DU or GC development across the ethnic groups investigated, with the dupA prevalence in control groups varying significantly. Our results would suggest that in the clinical isolates investigated dupA is not associated with IL-8 induction in vitro.

Individual headless compression screws fixed with three-dimensional image processing technology improves fusion rates of isolated talonavicular arthrodesis.

PubMed

Xie, Mei-Ming; Xia, Kang; Zhang, Hong-Xin; Cao, Hong-Hui; Yang, Zhi-Jin; Cui, Hai-Feng; Gao, Shang; Tang, Kang-Lai

2017-01-23

Screw fixation is a typical technique for isolated talonavicular arthrodesis (TNA), however, no consensus has been reached on how to select most suitable inserted position and direction. The study aimed to present a new fixation technique and to evaluate the clinical outcome of individual headless compression screws (HCSs) applied with three-dimensional (3D) image processing technology to isolated TNA. From 2007 to 2014, 69 patients underwent isolated TNA by using double Acutrak HCSs. The preoperative three-dimensional (3D) insertion model of double HCSs was applied by Mimics, Catia, and SolidWorks reconstruction software. One HCS oriented antegradely from the edge of dorsal navicular tail where intersected interspace between the first and the second cuneiform into the talus body along the talus axis, and the other one paralleled the first screw oriented from the dorsal-medial navicular where intersected at the medial plane of the first cuneiform. The anteroposterior and lateral X-ray examinations certified that the double HCSs were placed along the longitudinal axis of the talus. Postoperative assessment included the American Orthopaedic Foot & Ankle Society hindfoot (AOFAS), the visual analogue scale (VAS) score, satisfaction score, imaging assessments, and complications. At the mean 44-months follow-up, all patients exhibited good articular congruity and solid bone fusion at an average of 11.26 ± 0.85 weeks (range, 10 ~ 13 weeks) without screw loosening, shifting, or breakage. The overall fusion rates were 100%. The average AOFAS score increased from 46.62 ± 4.6 (range, 37 ~ 56) preoperatively to 74.77 ± 5.4 (range, 64-88) at the final follow-up (95% CI: -30.86 ~ -27.34; p < 0.001). The mean VAS score decreased from 7.01 ± 1.2 (range, 4 ~ 9) to 1.93 ± 1.3 (range, 0 ~ 4) (95% CI: 4.69 ~ 5.48; p < 0.001). One cases (1.45%) and three cases (4.35%) experienced wound infection and adjacent arthritis respectively. The postoperative satisfaction score including pain relief, activities of daily living, and return to recreational activities were good to excellent in 62 (89.9%) cases. Individual 3D reconstruction of HCSs insertion model can be designed with three-dimensional image processing technology in TNA. The technology is safe, effective, and reliable to isolated TNA method with high bone fusion rates, low incidences of complications.

Characterization of the exogenous insert and development of event-specific PCR detection methods for genetically modified Huanong No. 1 papaya.

PubMed

Guo, Jinchao; Yang, Litao; Liu, Xin; Guan, Xiaoyan; Jiang, Lingxi; Zhang, Dabing

2009-08-26

Genetically modified (GM) papaya (Carica papaya L.), Huanong No. 1, was approved for commercialization in Guangdong province, China in 2006, and the development of the Huanong No. 1 papaya detection method is necessary for implementing genetically modified organism (GMO) labeling regulations. In this study, we reported the characterization of the exogenous integration of GM Huanong No. 1 papaya by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. The results suggested that one intact copy of the initial construction was integrated in the papaya genome and which probably resulted in one deletion (38 bp in size) of the host genomic DNA. Also, one unintended insertion of a 92 bp truncated NptII fragment was observed at the 5' end of the exogenous insert. Furthermore, we revealed its 5' and 3' flanking sequences between the insert DNA and the papaya genomic DNA, and developed the event-specific qualitative and quantitative PCR assays for GM Huanong No. 1 papaya based on the 5' integration flanking sequence. The relative limit of detection (LOD) of the qualitative PCR assay was about 0.01% in 100 ng of total papaya genomic DNA, corresponding to about 25 copies of papaya haploid genome. In the quantitative PCR, the limits of detection and quantification (LOD and LOQ) were as low as 12.5 and 25 copies of papaya haploid genome, respectively. In practical sample quantification, the quantified biases between the test and true values of three samples ranged from 0.44% to 4.41%. Collectively, we proposed that all of these results are useful for the identification and quantification of Huanong No. 1 papaya and its derivates.

Investigating Delamination Migration in Composite Tape Laminates

NASA Technical Reports Server (NTRS)

Ratcliffe, James G.; DeCarvalho, Nelson V.

2014-01-01

A modification to a recently developed test specimen designed to investigate migration of a delamination between neighboring ply interfaces in tape laminates is presented. The specimen is a cross-ply laminated beam consisting of 40 plies with a polytetrafluoroethylene insert spanning part way along its length. The insert is located between a lower 0-degree ply (specimen length direction) and a stack of four 90-degree plies (specimen width direction). The modification involved a stacking sequence that promotes stable delamination growth prior to migration, and included a relocation of the insert from the specimen midplane to the interface between plies 14 and 15. Specimens were clamped at both ends onto a rigid baseplate and loaded on their upper surface via a piano hinge assembly, resulting in a predominantly flexural loading condition. Tests were conducted with the load-application point positioned at various locations along a specimen's span. This position affected the sequence of damage events during a test.

Well purge and sample apparatus and method

DOEpatents

Schalla, Ronald; Smith, Ronald M.; Hall, Stephen H.; Smart, John E.; Gustafson, Gregg S.

1995-01-01

The present invention specifically permits purging and/or sampling of a well but only removing, at most, about 25% of the fluid volume compared to conventional methods and, at a minimum, removing none of the fluid volume from the well. The invention is an isolation assembly with a packer, pump and exhaust, that is inserted into the well. The isolation assembly is designed so that only a volume of fluid between the outside diameter of the isolation assembly and the inside diameter of the well over a fluid column height from the bottom of the well to the top of the active portion (lower annulus) is removed. The packer is positioned above the active portion thereby sealing the well and preventing any mixing or contamination of inlet fluid with fluid above the packer. Ports in the wall of the isolation assembly permit purging and sampling of the lower annulus along the height of the active portion.

Well purge and sample apparatus and method

DOEpatents

Schalla, R.; Smith, R.M.; Hall, S.H.; Smart, J.E.; Gustafson, G.S.

1995-10-24

The present invention specifically permits purging and/or sampling of a well but only removing, at most, about 25% of the fluid volume compared to conventional methods and, at a minimum, removing none of the fluid volume from the well. The invention is an isolation assembly with a packer, pump and exhaust, that is inserted into the well. The isolation assembly is designed so that only a volume of fluid between the outside diameter of the isolation assembly and the inside diameter of the well over a fluid column height from the bottom of the well to the top of the active portion (lower annulus) is removed. The packer is positioned above the active portion thereby sealing the well and preventing any mixing or contamination of inlet fluid with fluid above the packer. Ports in the wall of the isolation assembly permit purging and sampling of the lower annulus along the height of the active portion. 8 figs.

[Effects of long-term isolation and anticipation of significant event on sleep: results of the project "Mars-520"].

PubMed

Zavalko, I M; Rasskazova, E I; Gordeev, S A; Palatov, S Iu; Kovrov, G V

2013-01-01

The purpose of the research was to study effect of long-term isolation on night sleep. The data were collected during international ground simulation of an interplanetary manned flight--"Mars-500". The polysomnographic recordings of six healthy men were performed before, four times during and after 520-days confinement. During the isolation sleep efficiency and delta-latency decreased, while sleep latency increased. Post-hoc analysis demonstrate significant differences between background and the last (1.5 months before the end of the experiment) measure during isolation. Frequency of nights with low sleep efficiency rose on the eve of the important for the crew events (simulation of Mars landing and the end of the confinement). Two weeks after the landing simulation, amount of the nights with a low sleep efficiency significantly decreased. Therefore, anticipation of significant event under condition of long-term isolation might result in sleep worsening in previously healthy men, predominantly difficulties getting to sleep.

Well fluid isolation and sample apparatus and method

DOEpatents

Schalla, Ronald; Smith, Ronald M.; Hall, Stephen H.; Smart, John E.

1995-01-01

The present invention specifically permits purging and/or sampling of a well but only removing, at most, about 25% of the fluid volume compared to conventional methods and, at a minimum, removing none of the fluid volume from the well. The invention is an isolation assembly that is inserted into the well. The isolation assembly is designed so that only a volume of fluid between the outside diameter of the isolation assembly and the inside diameter of the well over a fluid column height from the bottom of the well to the top of the active portion (lower annulus) is removed. A seal may be positioned above the active portion thereby sealing the well and preventing any mixing or contamination of inlet fluid with fluid above the packer. Purged well fluid is stored in a riser above the packer. Ports in the wall of the isolation assembly permit purging and sampling of the lower annulus along the height of the active portion.

Typing and comparative genome analysis of Brucella melitensis isolated from Lebanon.

PubMed

Abou Zaki, Natalia; Salloum, Tamara; Osman, Marwan; Rafei, Rayane; Hamze, Monzer; Tokajian, Sima

2017-10-16

Brucella melitensis is the main causative agent of the zoonotic disease brucellosis. This study aimed at typing and characterizing genetic variation in 33 Brucella isolates recovered from patients in Lebanon. Bruce-ladder multiplex PCR and PCR-RFLP of omp31, omp2a and omp2b were performed. Sixteen representative isolates were chosen for draft-genome sequencing and analyzed to determine variations in virulence, resistance, genomic islands, prophages and insertion sequences. Comparative whole-genome single nucleotide polymorphism analysis was also performed. The isolates were confirmed to be B. melitensis. Genome analysis revealed multiple virulence determinants and efflux pumps. Genome comparisons and single nucleotide polymorphisms divided the isolates based on geographical distribution but revealed high levels of similarity between the strains. Sequence divergence in B. melitensis was mainly due to lateral gene transfer of mobile elements. This is the first report of an in-depth genomic characterization of B. melitensis in Lebanon. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Vascular air embolism

PubMed Central

Gordy, Stephanie; Rowell, Susan

2013-01-01

Vascular air embolism is a rare but potentially fatal event. It may occur in a variety of procedures and surgeries but is most often associated as an iatrogenic complication of central line catheter insertion. This article reviews the incidence, pathophysiology, diagnosis, treatment, and prevention of this phenomenon. PMID:23724390

The role of the deep medial collateral ligament in controlling rotational stability of the knee.

PubMed

Cavaignac, Etienne; Carpentier, Karel; Pailhé, Regis; Luyckx, Thomas; Bellemans, Johan

2015-10-01

The tibial insertion of the deep medial collateral ligament (dMCL) is frequently sacrificed when the proximal tibial cut is performed during total knee arthroplasty. The role of the dMCL in controlling the knee's rotational stability is still controversial. The aim of this study was to quantify the rotational laxity induced by an isolated lesion of the dMCL as it occurs during tibial preparation for knee arthroplasty. An isolated resection of the deep MCL was performed in 10 fresh-frozen cadaver knees. Rotational laxity was measured during application of a standard 5.0 N.m rotational torque. Maximal tibial rotation was measured at different knee flexion angles using an image-guided navigation system (Medivision Surgetics system, Praxim, Grenoble, France) before and after dMCL resection. In all cases, internal and external tibial rotation increased after dMCL resection. Total rotational laxity increased significantly for all knee flexion angles, with an average difference of +7.8° (SD 5.7) with the knee in extension, +8.9° (SD 1.9) in 30° flexion, +7° (SD 2.9) in 60° flexion and +5.3° (SD 2.8) in 90° flexion. Sacrificing the tibial insertion of the deep MCL increases rotational laxity of the knee by 5°-9°, depending on the knee flexion angle. Based on our findings, new surgical techniques and implants that preserve the dMCL insertion such as tibial inlay components should be developed. Further clinical evaluations are necessary.

Nosocomial outbreak caused by Salmonella enterica serotype Livingstone producing CTX-M-27 extended-spectrum beta-lactamase in a neonatal unit in Sousse, Tunisia.

PubMed

Bouallègue-Godet, Olfa; Ben Salem, Youssef; Fabre, Laëtitia; Demartin, Marie; Grimont, Patrick A D; Mzoughi, Ridha; Weill, François-Xavier

2005-03-01

In this study, we report an outbreak of Salmonella enterica serotype Livingstone resistant to extended-spectrum cephalosporins that occurred in a neonatal ward of the maternity department of Farhat Hached Hospital, Sousse, Tunisia, in 2002. A total of 16 isolates were recovered from 16 babies hospitalized in the ward during the period 1 to 16 July. All these babies developed diarrhea, and three of them developed septicemia. All the isolates demonstrated resistance to ceftriaxone and ceftazidime due to the production of an extended-spectrum beta-lactamase (ESBL). The isolates were also resistant to aminoglycosides (kanamycin, tobramycin, netilmicin, gentamicin, and amikacin) and sulfamethoxazole-trimethoprim. DNA profiles were determined by pulsed-field gel electrophoresis using the XbaI and SpeI endonucleases and by ribotyping with PstI digestion. They yielded the same patterns, showing that the outbreak was caused by a single clone. The ESBL was identified as CTX-M-27 by sequencing of PCR products and by isoelectric focusing. The ESBL resistance was transferred by a 40-kb conjugative plasmid. The mobile insertion sequence ISEcp1 was found to be located upstream of bla(CTX-M-27) in the same position as that known for a bla(CTX-M-14) sequence. A new gene named dfrA21, encoding resistance to trimethoprim and carried by a 90-kb plasmid, was characterized. The dfrA21 gene was inserted as a single resistance cassette in a class I integron. The babies were treated with colistin, and all except two recovered. The outbreak came to an end when appropriate actions were taken: patient isolation, hand washing, and disinfection of the ward.

Activation of heteroallenes by coordinatively unsaturated nickel(ii) alkyl complexes supported by the hydrotris(3-phenyl-5-methyl)pyrazolyl borate (Tp(Ph,Me)) ligand.

PubMed

Abubekerov, Mark; Eymann, Léonard Y M; Gianetti, Thomas L; Arnold, John

2016-10-07

Activation of sulfur containing heteroallenes by nickel(ii) alkyl complexes supported by the bulky hydrotris(3-phenyl-5-methylpyrazolyl)borate (Tp(Ph,Me)) ligand is described. Exposure of Tp(Ph,Me)NiCH2Ph (1a) and Tp(Ph,Me)NiCH2Si(CH3)3 (1b) to CS2 resulted in formation of the insertion products Tp(Ph,Me)Ni(η(2)-CS2)CH2Ph (2a) and Tp(Ph,Me)Ni(η(2)-CS2)CH2Si(CH3)3 (2b) in moderate yields. Reaction of 1a and MeNCS produced two species in a 1 : 1 ratio, identified as Tp(Ph,Me)Ni(η(2)-MeNC)CH2Ph (3) and Tp(Ph,Me)Ni(η(2)-MeNCS)SCH2Ph (4). Isolation of the unexpected insertion product (3) prompted an investigation into the activity of 1a-b in the presence of isocyanides (i.e.(t)BuNC), which resulted in isolation of Tp(Ph,Me)Ni(η(2-t)BuNC)CH2Ph (5a) and Tp(Ph,Me)Ni(η(2-t)BuNC)CH2Si(CH3)3 (5b). Similarly, reaction of 1a with OCS led to the isolation of a rare example of a Ni(i) carbonyl species Tp(Ph,Me)NiCO (6). Alternatively, complex 6 was also formed by exposure of 1a-b to an atmosphere of CO. Isolation of the intermediate species (Tp(Ph,Me)Ni(η(2)-CO)CH2TMS (7b) and Tp(Ph,Me)Ni(CO)(C(O)R, (8a-b) with R = Ph, TMS)) shed light on the formation of such species.

Kocuria kristinae: a true pathogen in pediatric patients.

PubMed

Chen, Hsin-Mao; Chi, Hsin; Chiu, Nan-Chang; Huang, Fu-Yuan

2015-02-01

Kocuria kristinae is a Gram-positive microorganism, which has rarely been reported as a pathogen that causes infection in humans. Recently, a few studies had concluded that this pathogen can indeed cause infection in immunocompromised hosts. However, the number of reports on K. kristinae infection in pediatric patients is still relatively limited. Clinical data on pediatric patients who had K. kristinae cells isolated from their blood specimens during the period from January 2008 to May 2012 in a tertiary-care hospital in northern Taiwan were gathered and analyzed. Among 12 patients with K. kristinae cells isolated from their blood specimens, laboratory test results confirmed seven to have K. kristinae bloodstream infection. Six of them were premature babies, and one had acute leukemia. The infections were all healthcare associated. All the six premature babies had clinical presentation of sepsis and were inserted with percutaneous central venous catheters. One patient had two sets of blood culture positive for K. kristinae infection, and two premature patients had two sets of K. kristinae isolated, one from blood culture and the other from catheter tip culture, both of which were done at the same time. The leukemic child was inserted with a Broviac catheter and had K. kristinae isolated from both blood specimen and Broviac catheter. In the remaining five patients, K. kristinae infection was considered to be contaminant because they had only one set of positive blood culture and had other recognized infections. K. kristinae can cause infections in premature babies and immunocompromised pediatric patients using long-term intravenous catheters. Therefore, K. kristinae should be considered as a true pathogen and proper treatment should be provided to all susceptible pediatric patients. Copyright © 2013. Published by Elsevier B.V.

Phylogenomics of Brazilian epidemic isolates of Mycobacterium abscessus subsp. bolletii reveals relationships of global outbreak strains

PubMed Central

Davidson, Rebecca M.; Hasan, Nabeeh A.; de Moura, Vinicius Calado Nogueira; Duarte, Rafael Silva; Jackson, Mary; Strong, Michael

2013-01-01

Rapidly growing, non-tuberculous mycobacteria (NTM) in the Mycobacterium abscessus (MAB) species are emerging pathogens that cause various diseases including skin and respiratory infections. The species has undergone recent taxonomic nomenclature refinement, and is currently recognized as two subspecies, M. abscessus subsp. abscessus (MAB-A) and M. abscessus subsp. bolletii (MAB-B). The recently reported outbreaks of MAB-B in surgical patients in Brazil from 2004 to 2009 and in cystic fibrosis patients in the United Kingdom (UK) in 2006 to 2012 underscore the need to investigate the genetic diversity of clinical MAB strains. To this end, we sequenced the genomes of two Brazilian MAB-B epidemic isolates (CRM-0019 and CRM-0020) derived from an outbreak of skin infections in Rio de Janeiro, two unrelated MAB strains from patients with pulmonary infections in the United States (US) (NJH8 and NJH11) and one type MAB-B strain (CCUG 48898) and compared them to 25 publically available genomes of globally diverse MAB strains. Genome-wide analyses of 27,598 core genome single nucleotide polymorphisms (SNPs) revealed that the two Brazilian derived CRM strains are nearly indistinguishable from one another and are more closely related to UK outbreak isolates infecting CF patients than to strains from the US, Malaysia or France. Comparative genomic analyses of six closely related outbreak strains revealed geographic-specific large-scale insertion/deletion variation that corresponds to bacteriophage insertions and recombination hotspots. Our study integrates new genome sequence data with existing genomic information to explore the global diversity of infectious M. abscessus isolates and to compare clinically relevant outbreak strains from different continents. PMID:24055961

Permanent pacemaker insertion following isolated aortic valve replacement before and after the introduction of TAVI.

PubMed

Kogan, Alexander; Sternik, Leonid; Beinart, Roy; Shalabi, Amjad; Glikson, Michael; Spiegelstein, Danny; Levin, Shany; Raanani, Ehud

2015-04-01

Permanent pacemaker (PPM) implantation is required in 3-12% of all patients undergoing surgical aortic valve replacement (AVR). Our aim was to evaluate the contemporary incidence and impact of the introduction of transcatheter aortic valve implantation (TAVI) for PPM insertion after isolated AVR. Since 2004, during a 10-year period, a total of 858 patients underwent isolated AVR at our institution. Forty-one patients with PPM before operation were excluded from the study and 817 patients were included in the statistical analysis. Of these, 20 patients (2.45%) developed significant conduction disorders, leading to PPM implantation within 120 days postoperatively. Patients were further divided into two groups. Before (Group I: June 2004 to September 2008) and after (Group II: October 2008 to May 2014) the introduction of the TAVI program. There were 343 patients in Group I and 475 patients in Group II. The incidence of PPM implantation decreased from 3.79% (13 patients) in Group I to 1.47% (seven patients) in Group II (P < 0.001). Risk factors for permanent pacing identified by univariate analysis were: Group I (before introducing TAVI program), pulmonary hypertension, preoperative anemia, age older than 75 years, and previous myocardial infarction. Multivariate analysis identified Group I (before introducing TAVI program; P < 0.005; odds ratio [OR] 15.2, 95% confidence interval [CI] 6.3-19.9) and pulmonary hypertension (P < 0.005; OR 12.5, 95% CI 3.2-18.3) to be significant. Irreversible atrio-ventricular block or symptomatic bradycardia requiring PPM implantation is a relatively rare complication. The incidence of PPM implantation after isolated surgical AVR decreased in a contemporary setting after the introduction of the TAVI program. ©2015 Wiley Periodicals, Inc.

Preparation and screening of an arrayed human genomic library generated with the P1 cloning system.

PubMed Central

Shepherd, N S; Pfrogner, B D; Coulby, J N; Ackerman, S L; Vaidyanathan, G; Sauer, R H; Balkenhol, T C; Sternberg, N

1994-01-01

We describe here the construction and initial characterization of a 3-fold coverage genomic library of the human haploid genome that was prepared using the bacteriophage P1 cloning system. The cloned DNA inserts were produced by size fractionation of a Sau3AI partial digest of high molecular weight genomic DNA isolated from primary cells of human foreskin fibroblasts. The inserts were cloned into the pAd10sacBII vector and packaged in vitro into P1 phage. These were used to generate recombinant bacterial clones, each of which was picked robotically from an agar plate into a well of a 96-well microtiter dish, grown overnight, and stored at -70 degrees C. The resulting library, designated DMPC-HFF#1 series A, consists of approximately 130,000-140,000 recombinant clones that were stored in 1500 microtiter dishes. To screen the library, clones were combined in a pooling strategy and specific loci were identified by PCR analysis. On average, the library contains two or three different clones for each locus screened. To date we have identified a total of 17 clones containing the hypoxanthine-guanine phosphoribosyltransferase, human serum albumin-human alpha-fetoprotein, p53, cyclooxygenase I, human apurinic endonuclease, beta-polymerase, and DNA ligase I genes. The cloned inserts average 80 kb in size and range from 70 to 95 kb, with one 49-kb insert and one 62-kb insert. Images PMID:8146166

High performance millimeter-wave microstrip circulators and isolators

NASA Technical Reports Server (NTRS)

Shih, Ming; Pan, J. J.

1990-01-01

Millimeter wave systems, phased array antennas, and high performance components all require wideband circulators (and isolators) to perform diplexing and switching, to improve isolation and Voltage Standing Wave Ratio (VSWR), and to construct IMPATT diode reflection amplifiers. Presently, most of the millimeter-wave circulators and isolators are available in the configurations of waveguide or stripline, both of which suffer from the shortcomings of bulky size/weight, narrow bandwidth, and poor compatibility with monolithic millimeter-wave integrated circuits (MMIC). MMW microstrip circulators/isolators can eliminate or improve these shortcomings. Stub-tuned microstrip circulator configuration were developed utilizing the electromagnetic fields perturbation technique, the adhesion problems of microstrip metallization on new ferrite substrate were overcome, the fabrication, assembly, packaging techniques were improved, and then successfully designed, fabricated a Ka band circulator which has isolation and return loss of greater than 16dB, insertion loss less than 0.7dB. To assess the steady and reliable performance of the circulator, a temperature cycling test was done over the range of -20 to +50 C for 3 continuous cycles and found no significant impact or variation of circulator performance.

A High Isolation Series-Shunt RF MEMS Switch

PubMed Central

Yu, Yuan-Wei; Zhu, Jian; Jia, Shi-Xing; Shi, Yi

2009-01-01

This paper presents a wide band compact high isolation microelectromechanical systems (MEMS) switch implemented on a coplanar waveguide (CPW) with three ohmic switch cells, which is based on the series-shunt switch design. The ohmic switch shows a low intrinsic loss of 0.1 dB and an isolation of 24.8 dB at 6 GHz. The measured average pull-in voltage is 28 V and switching time is 47 μs. In order to shorten design period of the high isolation switch, a structure-based small-signal model for the 3-port ohmic MEMS switch is developed and parameters are extracted from the measured results. Then a high isolation switch has been developed where each 3-port ohmic MEMS switch is closely located. The agreement of the measured and modeled radio frequency (RF) performance demonstrates the validity of the electrical equivalent model. Measurements of the series-shunt switch indicate an outstanding isolation of more than 40 dB and a low insertion loss of 0.35 dB from DC to 12 GHz with total chip size of 1 mm × 1.2 mm. PMID:22408535

Nasogastric hydration versus intravenous hydration for infants with bronchiolitis: a randomised trial.

PubMed

Oakley, Ed; Borland, Meredith; Neutze, Jocelyn; Acworth, Jason; Krieser, David; Dalziel, Stuart; Davidson, Andrew; Donath, Susan; Jachno, Kim; South, Mike; Theophilos, Theane; Babl, Franz E

2013-04-01

Bronchiolitis is the most common lower respiratory tract infection in infants and the leading cause of hospital admission. Hydration is a mainstay of treatment, but insufficient evidence exists to guide clinical practice. We aimed to assess whether intravenous hydration or nasogastric hydration is better for treatment of infants. In this multicentre, open, randomised trial, we enrolled infants aged 2-12 months admitted to hospitals in Australia and New Zealand with a clinical diagnosis of bronchiolitis during three bronchiolitis seasons (April 1-Oct 31, in 2009, 2010, and 2011). We randomly allocated infants to nasogastric hydration or intravenous hydration by use of a computer-generated sequence and opaque sealed envelopes, with three randomly assigned block sizes and stratified by hospital site and age group (2-<6 months vs 6-12 months). The primary outcome was length of hospital stay, assessed in all randomly assigned infants. Secondary outcomes included rates of intensive-care unit admission, adverse events, and success of insertion. This trial is registered with the Australian and New Zealand clinical trials registry, ACTRN12605000033640. Mean length of stay for 381 infants assigned nasogastric hydration was 86·6 h (SD 58·9) compared with 82·2 h (58·8) for 378 infants assigned intravenous hydration (absolute difference 4·5 h [95% CI -3·9 to 12·9]; p=0·30). Rates of admission to intensive-care units, need for ventilatory support, and adverse events did not differ between groups. At randomisation, seven infants assigned nasogastric hydration were switched to intravenous hydration and 56 infants assigned intravenous hydration were switched to nasogastric hydration because the study-assigned method was unable to be inserted. For those infants who had data available for successful insertion, 275 (85%) of 323 infants in the nasogastric hydration group and 165 (56%) of 294 infants in the intravenous hydration group required only one attempt for successful insertion. Intravenous hydration and nasogastric hydration are appropriate means to hydrate infants with bronchiolitis. Nasogastric insertion might require fewer attempts and have a higher success rate of insertion than intravenous hydration. Australian National Health and Medical Research Council, Samuel Nissen Charitable Foundation (Perpetual), Murdoch Children's Research Institute, Victorian Government. Copyright © 2013 Elsevier Ltd. All rights reserved.

Effect of microwave radiation on the beating rate of isolated frog hearts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yee, K.C.; Chou, C.K.; Guy, A.W.

1984-01-01

One hundred and two isolated frog hearts were divided into ten groups and placed individually in a waveguide filled with Ringer's solution and exposed to 2,450-MHz CW radiation at 2 and 8.55 W/kg. Heart rate was recorded using one of the following methods: 3-M KCl glass electrode, ultrasound probe, tension transducer, Ringer's solution glass electrode, and a metal wire inserted in the Ringer's solution electrode. An accelerated decrease of heart rate was observed only in those groups recorded using the 3-M KCl electrode and the metal wire Ringer's solution electrode. No effect was found in the other groups. These resultsmore » indicate that bradycardia in isolated hearts could be caused by electrode artifacts resulting from the intensification of electromagnetic fields.« less

Accurate measurement of transgene copy number in crop plants using droplet digital PCR

USDA-ARS?s Scientific Manuscript database

Technical abstract: Genetic transformation is a powerful means for the improvement of crop plants, but requires labor and resource intensive methods. An efficient method for identifying single copy transgene insertion events from a population of independent transgenic lines is desirable. Currently ...

Accurate measure of transgene copy number in crop plants using droplet digital PCR

USDA-ARS?s Scientific Manuscript database

Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy numb...

Unique transposon landscapes are pervasive across Drosophila melanogaster genomes

PubMed Central

Rahman, Reazur; Chirn, Gung-wei; Kanodia, Abhay; Sytnikova, Yuliya A.; Brembs, Björn; Bergman, Casey M.; Lau, Nelson C.

2015-01-01

To understand how transposon landscapes (TLs) vary across animal genomes, we describe a new method called the Transposon Insertion and Depletion AnaLyzer (TIDAL) and a database of >300 TLs in Drosophila melanogaster (TIDAL-Fly). Our analysis reveals pervasive TL diversity across cell lines and fly strains, even for identically named sub-strains from different laboratories such as the ISO1 strain used for the reference genome sequence. On average, >500 novel insertions exist in every lab strain, inbred strains of the Drosophila Genetic Reference Panel (DGRP), and fly isolates in the Drosophila Genome Nexus (DGN). A minority (<25%) of transposon families comprise the majority (>70%) of TL diversity across fly strains. A sharp contrast between insertion and depletion patterns indicates that many transposons are unique to the ISO1 reference genome sequence. Although TL diversity from fly strains reaches asymptotic limits with increasing sequencing depth, rampant TL diversity causes unsaturated detection of TLs in pools of flies. Finally, we show novel transposon insertions negatively correlate with Piwi-interacting RNA (piRNA) levels for most transposon families, except for the highly-abundant roo retrotransposon. Our study provides a useful resource for Drosophila geneticists to understand how transposons create extensive genomic diversity in fly cell lines and strains. PMID:26578579

[NEOCAT, surveillance network of catheter-related bloodstream infections in neonates: 2010 data].

PubMed

L'Hériteau, F; Lacavé, L; Leboucher, B; Decousser, J-W; De Chillaz, C; Astagneau, P; Aujard, Y

2012-09-01

The NEOCAT surveillance network was implemented in 2006 in order to address catheter-associated bloodstream infections (BSIs) in neonates. The results for 2010 surveillance are presented herein. Neonatal intensive care units (NICUs) participated in the study on a voluntary basis. Umbilical catheters (UCs) and central venous catheters (CVCs) were analyzed separately. In 2010, 26NICUs participated. Overall, 2953 neonates were included (median weight, 1550 g; median gestational age, 32 weeks). These neonates had 2551UCs (median insertion duration, 4 days) and 2147CVCs (median insertion duration, 12 days). Thirty-three BSIs associated with UCs were reported, yielding a 2.9/1000UC-day incidence density, 95% confidence interval (95%CI) (1.9-3.8). UC-associated BSIs appeared after a median period of 5 days after UC insertion. The main microorganism isolated from blood cultures was coagulase negative staphylococci (CNS, n=27), S. aureus (n=3), and Enterobacteriaceae (n=5). Three hundred and six CVC-associated BSIs were recorded, yielding a 11.2/1000 CVC-day incidence density (95%CI, 10.0-12.5). These BSIs occurred after a median period of 12 days after CVC insertion. The main microorganisms were CNS (83%), S. aureus (6%), and Enterobacteriaceae (5%). The NEOCAT network provides a useful benchmark for participating wards. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

Structural basis for highly effective HIV-1 neutralization by CD4-mimetic miniproteins revealed by 1.5 Å co-crystal structure of gp120 and M48U1

PubMed Central

Acharya, Priyamvada; Luongo, Timothy; Louder, Mark K.; McKee, Krisha; Yang, Yongping; Kwon, Young Do; Mascola, John R.; Kessler, Pascal; Martin, Loïc; Kwong, Peter D.

2014-01-01

The interface between HIV-1 gp120 envelope glycoprotein and CD4 receptor contains an unusual interfacial cavity, the “Phe43 cavity”, which miniprotein mimetics of CD4 with non-natural extensions can potentially utilize to enhance their neutralization of HIV-1. Here we report co-crystal structures of HIV-1 gp120 with miniproteins M48U1 and M48U7, which insert cyclohexylmethoxy and 5-hydroxypentylmethoxy extensions, respectively, into the Phe43 cavity. Both inserts displayed flexibility and hydrophobic interactions, but the M48U1 insert showed better shape complementarity with the Phe43 cavity than the M48U7 insert. Subtle alteration in gp120 conformation played a substantial role in optimizing fit. With M48U1, these translated into a YU2-gp120 affinity of 0.015 nM and neutralization of all 180-circulating HIV-1 strains tested, except clade-A/E isolates with non-canonical Phe43 cavities. Ligand chemistry, shape complementary, surface burial, and gp120 conformation act in concert to modulate binding of ligands to the gp120-Phe43 cavity and, when optimized, can effect near pan-neutralization of HIV-1. PMID:23707685

Density functional theory studies of TiO2 for photocatalysis and Li storage applications

NASA Astrophysics Data System (ADS)

Kim, Yong-Hoon; Lee, Ji Il; Lee, Dong Ki; Lee, Gyu Heon; Kang, Jeung Ku

We present two theory-experiment collaboration studies of anatase TiO2 for energy applications. First, we discuss a hydrogen-nitrogen co-doped TiO2 (HN-TiO2) as a photocatalyst, and show that the interstitially introduced HN contributes to the increase of solar-to-fuel conversion efficiency. We find that the variation of valence band maximum (VBM) of NH-TiO2 extends the photoactive spectrum to the visible light, and argue that created mid-gap states produce efficient electron and hole conduction channels. Next, we consider experimentally fabricated hierarchical TiO2 nanocrystals integrated with binder-free porous graphene (PG) network foam for a Li storage application. It was found that the TiO2-PG facilitated rapid ionic transfer during the Li-ion insertion/extraction process. We clarify the mechanisms by showing that Li ion migration into the TiO2-PG interface stabilize the binder-free oxide-graphene interface. Atomistic mechanism of Li ion insertion and migration is discussed by comparing cases between an isolated Li ion, when the crowding effect is included, and when the surface Li ions are present. We found that the supply of additional surface Li ions significantly reduce the Li insertion barrier, driving a spontaneous domino-like concerted Li insertion at the oxide surface region.

Development of novel metabolite-responsive transcription factors via transposon-mediated protein fusion.

PubMed

Younger, Andrew K D; Su, Peter Y; Shepard, Andrea J; Udani, Shreya V; Cybulski, Thaddeus R; Tyo, Keith E J; Leonard, Joshua N

2018-02-01

Naturally evolved metabolite-responsive biosensors enable applications in metabolic engineering, ranging from screening large genetic libraries to dynamically regulating biosynthetic pathways. However, there are many metabolites for which a natural biosensor does not exist. To address this need, we developed a general method for converting metabolite-binding proteins into metabolite-responsive transcription factors-Biosensor Engineering by Random Domain Insertion (BERDI). This approach takes advantage of an in vitro transposon insertion reaction to generate all possible insertions of a DNA-binding domain into a metabolite-binding protein, followed by fluorescence activated cell sorting to isolate functional biosensors. To develop and evaluate the BERDI method, we generated a library of candidate biosensors in which a zinc finger DNA-binding domain was inserted into maltose binding protein, which served as a model well-studied metabolite-binding protein. Library diversity was characterized by several methods, a selection scheme was deployed, and ultimately several distinct and functional maltose-responsive transcriptional biosensors were identified. We hypothesize that the BERDI method comprises a generalizable strategy that may ultimately be applied to convert a wide range of metabolite-binding proteins into novel biosensors for applications in metabolic engineering and synthetic biology. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Molecular Cloning and Characterization of Viruses Isolated from Chimpanzees with Pathogenic Human Immunodeficiency Virus Type 1 Infections

PubMed Central

Mwaengo, Dufton M.; Novembre, Francis J.

1998-01-01

We have previously described the development of AIDS in a chimpanzee (C499) infected with human immunodeficiency virus type 1 (HIV-1) and the subsequent pathogenic HIV-1 infection in another chimpanzee (C455) transfused with blood from C499 (F. J. Novembre et al., J. Virol. 71:4086–4091, 1997). In the present study, two virus isolates were derived from these animals: HIV-1JC from peripheral blood mononuclear cells (PBMC) of C499, and HIV-1NC from plasma of C455. These virus isolates were used to generate two infectious molecular clones, termed HIV-1JC16 and HIV-1NC7 (JC16 and NC7, respectively). Comparative analyses of the sequences of the two clones showed that they were highly interrelated but distinct. Based on heteroduplex mobility assays, JC16 and NC7 appear to represent dominant viruses in the uncloned stock population. Compared with amino acid sequences of the parental viruses HIV-1SF2, HIV-1LAV-1b, and HIV-1NDK, JC16 and NC7 showed a number of differences, including insertions, deletions, and point mutations spread throughout the genome. However, insertion/deletion footprints in several genes of both JC16 and NC7 suggested that recombination between SF2 and LAV-1b could have occurred, possibly contributing to the generation of a pathogenic virus. Comparative in vitro analyses of the molecular clones and the uncloned stocks of HIV-1JC and HIV-1NC revealed that these viruses had strikingly similar replicative abilities in mitogen-stimulated PBMC and in macrophages. Compared to the SF2 and LAV-1b isolates of HIV-1, HIV-1JC and HIV-1NC isolates were more similar to LAV-1b with respect to the ability to replicate in mitogen-stimulated PBMC and macrophages. These viruses should prove to be useful in mapping determinants of pathogenesis. PMID:9765443

Multihospital Occurrence of Pan-Resistant Klebsiella pneumoniae Sequence Type 147 with an ISEcp1-Directed blaOXA-181 Insertion in the mgrB Gene in the United Arab Emirates

PubMed Central

Sonnevend, Ágnes; Ghazawi, Akela; Hashmey, Rayhan; Haidermota, Aliasgher; Girgis, Safinaz; Alfaresi, Mubarak; Omar, Mohammed; Paterson, David L.; Zowawi, Hosam M.

2017-01-01

ABSTRACT The emergence of pan-resistant Klebsiella pneumoniae strains is an increasing concern. In the present study, we describe a cluster of 9 pan-resistant K. pneumoniae sequence type 147 (ST147) isolates encountered in 4 patients over nearly 1 year in 3 hospitals of the United Arab Emirates (UAE). The isolates exhibited highly similar genotypes. All produced chromosomally encoded OXA-181, and the majority also produced the NDM-5 carbapenemase. As with the previously described single isolate from the UAE, MS6671, the mgrB was disrupted by a functional, ISEcp1-driven blaOXA-181 insertion causing resistance to carbapenems. The mutation was successfully complemented with an intact mgrB gene, indicating that it was responsible for colistin resistance. blaNDM-5 was located within a resistance island of an approximately 100-kb IncFII plasmid carrying ermB, mph(A), blaTEM-1B, rmtB, blaNDM-5, sul1, aadA2, and dfrA12 resistance genes. Sequencing this plasmid (pABC143-NDM) revealed that its backbone was nearly identical to that of plasmid pMS6671E from which several resistance genes, including blaNDM-5, had been deleted. More extensive similarities of the backbone and the resistance island were found between pABC143C-NDM and the blaNDM-5-carrying IncFII plasmids of two K. pneumoniae ST147 isolates from South Korea, one of which was colistin resistant, and both also produced OXA-181. Notably, one of these strains was isolated from a patient transferred from the UAE. Our data show that this pan-resistant clone has an alarming capacity to maintain itself over an extended period of time and is even likely to be transmitted internationally. PMID:28438945

Multihospital Occurrence of Pan-Resistant Klebsiella pneumoniae Sequence Type 147 with an ISEcp1-Directed blaOXA-181 Insertion in the mgrB Gene in the United Arab Emirates.

PubMed

Sonnevend, Ágnes; Ghazawi, Akela; Hashmey, Rayhan; Haidermota, Aliasgher; Girgis, Safinaz; Alfaresi, Mubarak; Omar, Mohammed; Paterson, David L; Zowawi, Hosam M; Pál, Tibor

2017-07-01

The emergence of pan-resistant Klebsiella pneumoniae strains is an increasing concern. In the present study, we describe a cluster of 9 pan-resistant K. pneumoniae sequence type 147 (ST147) isolates encountered in 4 patients over nearly 1 year in 3 hospitals of the United Arab Emirates (UAE). The isolates exhibited highly similar genotypes. All produced chromosomally encoded OXA-181, and the majority also produced the NDM-5 carbapenemase. As with the previously described single isolate from the UAE, MS6671, the mgrB was disrupted by a functional, IS Ecp1 -driven bla OXA-181 insertion causing resistance to carbapenems. The mutation was successfully complemented with an intact mgrB gene, indicating that it was responsible for colistin resistance. bla NDM-5 was located within a resistance island of an approximately 100-kb IncFII plasmid carrying ermB , mph (A), bla TEM-1B , rmtB , bla NDM-5 , sul1 , aadA2 , and dfrA12 resistance genes. Sequencing this plasmid (pABC143-NDM) revealed that its backbone was nearly identical to that of plasmid pMS6671E from which several resistance genes, including bla NDM-5 , had been deleted. More extensive similarities of the backbone and the resistance island were found between pABC143C-NDM and the bla NDM-5 -carrying IncFII plasmids of two K. pneumoniae ST147 isolates from South Korea, one of which was colistin resistant, and both also produced OXA-181. Notably, one of these strains was isolated from a patient transferred from the UAE. Our data show that this pan-resistant clone has an alarming capacity to maintain itself over an extended period of time and is even likely to be transmitted internationally. Copyright © 2017 American Society for Microbiology.

Coating flexible probes with an ultra fast degrading polymer to aid in tissue insertion

PubMed Central

Wang, Shuwu; Singh, Sagar; Damodaran, Vinod B.; Kaplan, Hilton M.; Kohn, Joachim; Shreiber, David I.; Zahn, Jeffrey D.

2016-01-01

We report a fabrication process for coating neural probes with an ultrafast degrading polymer to create consistent and reproducible devices for neural tissue insertion. The rigid polymer coating acts as a probe insertion aid, but resorbs within hours post-implantation. Despite the feasibility for short term neural recordings from currently available neural prosthetic devices, most of these devices suffer from long term gliosis, which isolates the probes from adjacent neurons, increasing the recording impedance and stimulation threshold. The size and stiffness of implanted probes have been identified as critical factors that lead to this long term gliosis. Smaller, more flexible probes that match the mechanical properties of brain tissue could allow better long term integration by limiting the mechanical disruption of the surrounding tissue during and after probe insertion, while being flexible enough to deform with the tissue during brain movement. However, these small flexible probes inherently lack the mechanical strength to penetrate the brain on their own. In this work, we have developed a micromolding method for coating a non-functional miniaturized SU-8 probe with an ultrafast degrading tyrosine-derived polycarbonate (E5005(2K)). Coated, non-functionalized probes of varying dimensions were reproducibly fabricated with high yields. The polymer erosion/degradation profiles of the probes were characterized in vitro. The probes were also mechanically characterized in ex vivo brain tissue models by measuring buckling and insertion forces during probe insertion. The results demonstrate the ability to produce polymer coated probes of consistent quality for future in vivo use, for example to study the effects of different design parameters that may affect tissue response during long term chronic intra-cortical microelectrode neural recordings. PMID:25681971

Coating flexible probes with an ultra fast degrading polymer to aid in tissue insertion.

PubMed

Lo, Meng-chen; Wang, Shuwu; Singh, Sagar; Damodaran, Vinod B; Kaplan, Hilton M; Kohn, Joachim; Shreiber, David I; Zahn, Jeffrey D

2015-04-01

We report a fabrication process for coating neural probes with an ultrafast degrading polymer to create consistent and reproducible devices for neural tissue insertion. The rigid polymer coating acts as a probe insertion aid, but resorbs within hours post-implantation. Despite the feasibility for short term neural recordings from currently available neural prosthetic devices, most of these devices suffer from long term gliosis, which isolates the probes from adjacent neurons, increasing the recording impedance and stimulation threshold. The size and stiffness of implanted probes have been identified as critical factors that lead to this long term gliosis. Smaller, more flexible probes that match the mechanical properties of brain tissue could allow better long term integration by limiting the mechanical disruption of the surrounding tissue during and after probe insertion, while being flexible enough to deform with the tissue during brain movement. However, these small flexible probes inherently lack the mechanical strength to penetrate the brain on their own. In this work, we have developed a micromolding method for coating a non-functional miniaturized SU-8 probe with an ultrafast degrading tyrosine-derived polycarbonate (E5005(2K)). Coated, non-functionalized probes of varying dimensions were reproducibly fabricated with high yields. The polymer erosion/degradation profiles of the probes were characterized in vitro. The probes were also mechanically characterized in ex vivo brain tissue models by measuring buckling and insertion forces during probe insertion. The results demonstrate the ability to produce polymer coated probes of consistent quality for future in vivo use, for example to study the effects of different design parameters that may affect tissue response during long term chronic intra-cortical microelectrode neural recordings.

Factors Associated with Complications in Older Adults with Isolated Blunt Chest Trauma

PubMed Central

Lotfipour, Shahram; Kaku, Shawn K.; Vaca, Federico E.; Patel, Chirag; Anderson, Craig L.; Ahmed, Suleman S.; Menchine, Michael D.

2009-01-01

Objective: To determine the prevalence of adverse events in elderly trauma patients with isolated blunt thoracic trauma, and to identify variables associated with these adverse events. Methods: We performed a chart review of 160 trauma patients age 65 and older with significant blunt thoracic trauma, drawn from an American College of Surgeons Level I Trauma Center registry. Patients with serious injury to other body areas were excluded to prevent confounding the cause of adverse events. Adverse events were defined as acute respiratory distress syndrome or pneumonia, unanticipated intubation, transfer to the intensive care unit for hypoxemia, or death. Data collected included history, physical examination, radiographic findings, length of hospital stay, and clinical outcomes. Results: Ninety-nine patients had isolated chest injury, while 61 others had other organ systems injured and were excluded. Sixteen patients developed adverse events [16.2% 95% confidence interval (CI) 9.5–24.9%], including two deaths. Adverse events were experienced by 19.2%, 6.1%, and 28.6% of those patients 65–74, 75–84, and ≥85 years old, respectively. The mean length of stay was 14.6 days in patients with an adverse event and 5.8 days in patients without. Post hoc analysis revealed that all 16 patients with an adverse event had one or more of the following: age ≥85, initial systolic blood pressure <90 mmHg, hemothorax, pneumothorax, three or more unilateral rib fractures, or pulmonary contusion (sensitivity 100%, CI 79.4–100%; specificity 38.6%, CI 28.1–49.9%). Conclusion: Adverse events from isolated thoracic trauma in elderly patients complicate 16% of our sample. These criteria were 100% sensitive and 38.5% specific for these adverse events. This study is a first step to identifying variables that might aid in identifying patients at high risk for serious adverse events. PMID:19561823

Jig Aligns Shadow Mask On CCD

NASA Technical Reports Server (NTRS)

Matus, Carlos V.

1989-01-01

Alignment viewed through microscope. Alignment jig positions shadow mask on charge-coupled device (CCD) so metal film deposited on it precisely. Allows CCD package to be inserted and removed without disturbing alignment of mask. Holds CCD packages securely and isolates it electrostatically while providing electrical contact to each of its pins. When alignment jig assembled with CCD, used to move mask under micrometer control.

Isolation and characterization of juvenile hormone esterase from gypsy moth (Lymantria dispar)

Treesearch

Algimantas P. Valaitis; Joan Jolliff

1991-01-01

Insect metamorphosis is under precise hormonal control. During the last larval stadium, the degradation of juvenile hormone by juvenile hormone esterase (JHE) is essential for the initiation of pupation. Therefore, we have targeted this system for disruption with a strategy to produce a recombinant gypsy moth virus which expresses JHE. In order to clone and insert the...

Abscisic acid has a key role in modulating diverse plant-pathogen interactions

Treesearch

Jun Fan; Lionel Hill; Casey Crooks; Peter Doerner; Chris Lamb

2009-01-01

We isolated an activation-tagged Arabidopsis (Arabidopsis thaliana) line, constitutive disease susceptibility2-1D (cds2-1D), that showed enhanced bacterial growth when challenged with various Pseudomonas syringae strains. Systemic acquired resistance and systemic PATHOGENESIS-RELATED GENE1 induction were also compromised in cds2-1D. The T-DNA insertion adjacent to NINE...

Application of Photosynthesis to Artificial Sight

DTIC Science & Technology

2001-10-25

to people who suffer from age-related macular degeneration (AMD) or retinitis pigmentosa (RP), diseases that are the leading causes of blindness...related macular degeneration and retinitis pigmentosa . While this work is still in its infancy, it is clear that isolated Photosystem I reaction...insertion of purified Photosystem I (PSI) reaction centers or other photoactive agents into retinal cells where they will restore photoreceptor function

VdCYC8, encoding CYC8 glucose repression mediator protein, is required for microsclerotia formation and full virulence in Verticillium dahliae

USDA-ARS?s Scientific Manuscript database

Verticillium dahliae is the primary causal agent for Verticillium wilt disease on a diverse array of economically important crops, including cotton. In previous research, we screened a T-DNA insertional mutant library of the highly virulent isolate Vd080 derived from cotton. In this study, the targ...

Transferable green fluorescence-tagged pEI2 in Edwardsiella ictaluri

USDA-ARS?s Scientific Manuscript database

The pEI2 plasmid of Edwardsiella ictaluri isolate, I49, was tagged using a Tn10-GFP-kan cassette to create the green fluorescence-expressing derivative I49-gfp. The Tn10-GFP-kan insertion site was mapped by plasmid sequencing to 663 bp upstream of orf2 and appeared to be at a neutral site in the pla...

Mistaken identity of an open reading frame proposed for PCR-based identification of Mycoplasma bovis and the effect of polymorphisms and insertions on assay performance

USDA-ARS?s Scientific Manuscript database

Mycoplasma bovis is an important cause of disease in cattle and bison. Because the bacterium requires specialized growth conditions many diagnostic laboratories routinely use PCR to replace or complement conventional isolation and identification methods. A frequently used target of such assays is th...

Cloning and Expression of cDNA for Rat Heme Oxygenase

NASA Astrophysics Data System (ADS)

Shibahara, Shigeki; Muller, Rita; Taguchi, Hayao; Yoshida, Tadashi

1985-12-01

Two cDNA clones for rat heme oxygenase have been isolated from a rat spleen cDNA library in λ gt11 by immunological screening using a specific polyclonal antibody. One of these clones has an insert of 1530 nucleotides that contains the entire protein-coding region. To confirm that the isolated cDNA encodes heme oxygenase, we transfected monkey kidney cells (COS-7) with the cDNA carried in a simian virus 40 vector. The heme oxygenase was highly expressed in endoplasmic reticulum of transfected cells. The nucleotide sequence of the cloned cDNA was determined and the primary structure of heme oxygenase was deduced. Heme oxygenase is composed of 289 amino acids and has one hydrophobic segment at its carboxyl terminus, which is probably important for the insertion of heme oxygenase into endoplasmic reticulum. The cloned cDNA was used to analyze the induction of heme oxygenase in rat liver by treatment with CoCl2 or with hemin. RNA blot analysis showed that both CoCl2 and hemin increased the amount of hybridizable mRNA, suggesting that these substances may act at the transcriptional level to increase the amount of heme oxygenase.

Flexible microwave PIN diodes and switches employing transferrable single-crystal Si nanomembranes on plastic substrates

NASA Astrophysics Data System (ADS)

Qin, Guoxuan; Yuan, Hao-Chih; Celler, George K.; Zhou, Weidong; Ma, Zhenqiang

2009-12-01

This paper reports the realization of flexible RF/microwave PIN diodes and switches using transferrable single-crystal Si nanomembranes (SiNM) that are monolithically integrated on low-cost, flexible plastic substrates. High frequency response is obtained through the realization of low parasitic resistance achieved with heavy ion implantation before nanomembrane release and transfer. The flexible lateral SiNM PIN diodes exhibit typical rectifying characteristics with insertion loss and isolation better than 0.9 dB and 19.6 dB, respectively, from DC to 5 GHz, as well as power handling up to 22.5 dBm without gain compression. A single-pole single-throw (SPST) flexible RF switch employing shunt-series PIN diode configuration has achieved insertion loss and isolation better than 0.6 dB and 22.9 dB, respectively, from DC to 5 GHz. Furthermore, the SPST microwave switch shows performance improvement and robustness under mechanical deformation conditions. The study demonstrates the considerable potential of using properly processed transferrable SiNM for microwave passive components. Future investigations on transferrable SiNMs will lead to eventual realization of monolithic microwave integrated systems on low-cost flexible substrates.

Nursing care as a predictor of phlebitis related to insertion of a peripheral venous cannula in emergency departments: findings from a prospective study.

PubMed

Palese, A; Ambrosi, E; Fabris, F; Guarnier, A; Barelli, P; Zambiasi, P; Allegrini, E; Bazoli, L; Casson, P; Marin, M; Padovan, M; Picogna, M; Taddia, P; Salmaso, D; Chiari, P; Marognolli, O; Canzan, F; Saiani, L

2016-03-01

To date, few studies have investigated the occurrence of phlebitis related to insertion of a peripheral venous cannula (PVC) in an emergency department (ED). To describe the natural history of ED-inserted PVC site use; the occurrence and severity of PVC-related phlebitis; and associations with patient, PVC and nursing care factors. A prospective study was undertaken of 1262 patients treated as urgent cases in EDs who remained in a medical unit for at least 24h. The first PVC inserted was observed daily until its removal; phlebitis was measured using the Visual Infusion Phlebitis Scale. Data on patient, PVC, nursing care and organizational variables were collected, and a time-to-event analysis was performed. The prevalence of PVC-related phlebitis was 31%. The cumulative incidence (78/391) was almost 20% three days after insertion, and reached >50% (231/391) five days after insertion. Being in a specialized hospital [hazard ratio (HR) 0.583, 95% confidence interval (CI) 0.366-0.928] and receiving more nursing care (HR 0.988, 95% CI 0.983-0.993) were protective against PVC-related phlebitis at all time points. Missed nursing care increased the incidence of PVC-related phlebitis by approximately 4% (HR 1.038, 95% CI 1.001-1.077). Missed nursing care and expertise of the nurses caring for the patient after PVC insertion affected the incidence of phlebitis; receiving more nursing care and being in a specialized hospital were associated with lower risk of PVC-related phlebitis. These are modifiable risk factors of phlebitis, suggesting areas for intervention at both hospital and unit level. Copyright © 2015 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

Isolated transient vertigo: posterior circulation ischemia or benign origin?

PubMed

Blasberg, Tobias F; Wolf, Lea; Henke, Christian; Lorenz, Matthias W

2017-06-14

Isolated transient vertigo can be the only symptom of posterior circulation ischemia. Thus, it is important to differentiate isolated vertigo of a cerebrovascular origin from that of more benign origins, as patients with cerebral ischemia have a much higher risk for future stroke than do those with 'peripheral' vertigo. The current study aims to identify risk factors for cerebrovascular origin of isolated transient vertigo, and for future cerebrovascular events. From the files of 339 outpatients with isolated transient vertigo we extracted history, clinical and technical findings, diagnosis, and follow-up information on subsequent stroke or transient ischemic attack (TIA). Risk factors were analyzed using multivariate regression models (logistic or Cox) and reconfirmed in univariate analyses. On first presentation, 48 (14.2%) patients received the diagnosis 'probable or definite cerebrovascular vertigo'. During follow-up, 41 patients suffered stroke or TIA (event rate 7.9 per 100 person years, 95% confidence interval (CI) 5.5-10.4), 26 in the posterior circulation (event rate 4.8 per 100 person years, 95% CI 3.0-6.7). The diagnosis was not associated with follow-up cerebrovascular events. In multivariate models testing multiple potential determinants, only the presentation mode was consistently associated with the diagnosis and stroke risk: patients who presented because of vertigo (rather than reporting vertigo when they presented for other reasons) had a significantly higher risk for future stroke or TIA (p = 0.028, event rate 13.4 vs. 5.4 per 100 person years) and for future posterior circulation stroke or TIA (p = 0.044, event rate 7.8 vs. 3.5 per 100 person years). We here report for the first time follow-up stroke rates in patients with transient isolated vertigo. In such patients, the identification of those with cerebrovascular origin remains difficult, and presentation mode was found to be the only consistent risk factor. Confirmation in an independent prospective sample is needed.

Versatile Cosmid Vectors for the Isolation, Expression, and Rescue of Gene Sequences: Studies with the Human α -globin Gene Cluster

NASA Astrophysics Data System (ADS)

Lau, Yun-Fai; Kan, Yuet Wai

1983-09-01

We have developed a series of cosmids that can be used as vectors for genomic recombinant DNA library preparations, as expression vectors in mammalian cells for both transient and stable transformations, and as shuttle vectors between bacteria and mammalian cells. These cosmids were constructed by inserting one of the SV2-derived selectable gene markers-SV2-gpt, SV2-DHFR, and SV2-neo-in cosmid pJB8. High efficiency of genomic cloning was obtained with these cosmids and the size of the inserts was 30-42 kilobases. We isolated recombinant cosmids containing the human α -globin gene cluster from these genomic libraries. The simian virus 40 DNA in these selectable gene markers provides the origin of replication and enhancer sequences necessary for replication in permissive cells such as COS 7 cells and thereby allows transient expression of α -globin genes in these cells. These cosmids and their recombinants could also be stably transformed into mammalian cells by using the respective selection systems. Both of the adult α -globin genes were more actively expressed than the embryonic zeta -globin genes in these transformed cell lines. Because of the presence of the cohesive ends of the Charon 4A phage in the cosmids, the transforming DNA sequences could readily be rescued from these stably transformed cells into bacteria by in vitro packaging of total cellular DNA. Thus, these cosmid vectors are potentially useful for direct isolation of structural genes.

Effects of doping concentration ratio on electrical characterization in pseudomorphic HEMT-based MMIC switches for ICT system

NASA Astrophysics Data System (ADS)

Mun, Jae-Kyoung; Oh, Jung-Hun; Sung, Ho-Kun; Wang, Cong

2015-12-01

The effects of the doping concentration ratios between upper and lower silicon planar-doping layers on the DC and RF characteristics of the double planar doped pseudomorphic high electron mobility transistors (pHEMTs) are investigated. From the device simulation, an increase of maximum extrinsic transconductance and a decrease of total on- and off-state capacitances are observed, as well as an increase of the upper to lower planar-doping concentration ratios (UTLPDR), which give rise to an enhancement of the switching speed and isolation characteristics. On the basis of simulation results, two types of pHEMTs are fabricated with two different UTLPDRs of 4:1 and 1:2. After applying these two types' pHEMTs, single-pole-double-throw (SPDT) transmitter/receiver monolithic microwave integrated circuit (MMIC) switches are also designed and fabricated. The SPDT MMIC switch with a 4:1 UTLPDR shows an insertion loss of 0.58 dB, isolation of 40.2 dB, and switching speed of 100 ns, respectively, which correspondingly indicate a 0.23 dB lower insertion loss, 2.90 dB higher isolation and 2.5 times faster switching speed than those of 1:2 UTLPDR at frequency range of 2-6 GHz. From the simulation results and comparative studies, we propose that the UTLPDR must be greater than 4:1 for the best switching performance. With the abovementioned excellent performances, the proposed switch would be quite promising in the application of information and communications technology system.

Mutagenesis of diploid mammalian genes by gene entrapment

PubMed Central

Lin, Qing; Donahue, Sarah L.; Moore-Jarrett, Tracy; Cao, Shang; Osipovich, Anna B.; Ruley, H. Earl

2006-01-01

The present study describes a genome-wide method for biallelic mutagenesis in mammalian cells. Novel poly(A) gene trap vectors, which contain features for direct cloning vector–cell fusion transcripts and for post-entrapment genome engineering, were used to generate a library of 979 mutant ES cells. The entrapment mutations generally disrupted gene expression and were readily transmitted through the germline, establishing the library as a resource for constructing mutant mice. Cells homozygous for most entrapment loci could be isolated by selecting for enhanced expression of an inserted neomycin-resistance gene that resulted from losses of heterozygosity (LOH). The frequencies of LOH measured at 37 sites in the genome ranged from 1.3 × 10−5 to 1.2 × 10−4 per cell and increased with increasing distance from the centromere, implicating mitotic recombination in the process. The ease and efficiency of obtaining homozygous mutations will (i) facilitate genetic studies of gene function in cultured cells, (ii) permit genome-wide studies of recombination events that result in LOH and mediate a type of chromosomal instability important in carcinogenesis, and (iii) provide new strategies for phenotype-driven mutagenesis screens in mammalian cells. PMID:17062627

The genomic structure of the human Charcot-Leyden crystal protein gene is analogous to those of the galectin genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dyer, K.D.; Handen, J.S.; Rosenberg, H.F.

The Charcot-Leyden crystal (CLC) protein, or eosinophil lysophospholipase, is a characteristic protein of human eosinophils and basophils; recent work has demonstrated that the CLC protein is both structurally and functionally related to the galectin family of {beta}-galactoside binding proteins. The galectins as a group share a number of features in common, including a linear ligand binding site encoded on a single exon. In this work, we demonstrate that the intron-exon structure of the gene encoding CLC is analogous to those encoding the galectins. The coding sequence of the CLC gene is divided into four exons, with the entire {beta}-galactoside bindingmore » site encoded by exon III. We have isolated CLC {beta}-galactoside binding sites from both orangutan (Pongo pygmaeus) and murine (Mus musculus) genomic DNAs, both encoded on single exons, and noted conservation of the amino acids shown to interact directly with the {beta}-galactoside ligand. The most likely interpretation of these results suggests the occurrence of one or more exon duplication and insertion events, resulting in the distribution of this lectin domain to CLC as well as to the multiple galectin genes. 35 refs., 3 figs.« less

Method and device for detecting impact events on a security barrier which includes a hollow rebar allowing insertion and removal of an optical fiber

DOEpatents

Pies, Ross E.

2016-03-29

A method and device for the detection of impact events on a security barrier. A hollow rebar is farmed within a security barrier, whereby the hollow rebar is completely surrounded by the security barrier. An optical fiber passes through the interior of the hollow rebar. An optical transmitter and an optical receiver are both optically connected to the optical fiber and connected to optical electronics. The optical electronics are configured to provide notification upon the detection of an impact event at the security barrier based on the detection of disturbances within the optical fiber.

Safety, Quality, and Acceptability of Contraceptive Subdermal Implant Provision by Community Health Extension Workers Versus Nurses and Midwives in Nigeria: Protocol for a Quasi-Experimental, Noninferiority Study

PubMed Central

Penfold, Suzanne; Alabi, Olalere; Ali, Moazzam; Hopkins, Kristen; Ngo, Thoai Dinh; Odogwu, Kingsley; Douthwaite, Megan; Ezire, Onoriode; Udoh, Uko; Effiom, Effiom; Munroe, Erik S

2018-01-01

Background As part of its Family Planning 2020 commitment, the Nigerian government is aiming for a contraceptive prevalence rate of 36% by 2018, and in 2014, approved a policy to allow community health extension workers (CHEWs), in addition to doctors, nurses, and midwives, to provide contraceptive subdermal implants. There is a lack of rigorous evidence on the safety of long-acting reversible contraceptive provision, such as implants, among lower cadres of health providers. Objective This study aimed to compare implant provision by CHEWs versus nurses and midwives up to 14 days post insertion. Methods The quasi-experimental, noninferiority study will take place in public sector facilities in Kaduna and Ondo States. In each state, we will select 60 facilities, and from these, we will select a total of 30 nurses and midwives and 30 CHEWs to participate. Selected providers will be trained to provide implant services. Once trained, providers will recruit a minimum of 8125 women aged between 18 and 49 years who request and are eligible for an implant, following comprehensive family planning counseling. During implant insertion, providers will record data about the process and any adverse events, and 14 days post insertion, providers will ask 4410 clients about adverse events arising from the implant. Supervisors will observe 792 implant insertions to assess service provision quality and ask clients about their satisfaction with the procedure. We will conclude noninferiority if the CI for the difference in the proportion of adverse events between CHEWs and nurses and midwives on the day of insertion or 14 days post insertion lies to the right of −2%. Results In September and October 2015, we trained 60 CHEWs and a total of 60 nurses and midwives from 12 local government areas (LGAs) in Kaduna and 23 LGAs in Ondo. Recruitment took place between November 2015 and December 2016. Data analysis is being finalized, and results are expected in March 2018. Conclusions The strength of this study is having a standard care (nurse and midwife provision) group with which CHEW provision can be compared. The intervention builds on existing training and supervision procedures, which increases the sustainability and scalability of CHEW implant provision. Important limitations include the lack of randomization due to nurses and midwives in Nigeria working in separate types of health care facilities compared with CHEWs, and that providers self-assess their own practices. It is unfeasible to observe all procedures independently, and observation may change practice. Although providers will be trained to conduct implant removals, the study time will be too short to reach the sample size required to make noninferiority comparisons for removals. Trial Registration ClinicalTrials.gov NCT03088722; https://clinicaltrials.gov/ct2/show/NCT03088722 (Archived by WebCite at http://www.webcitation.org/6xIHImWvu) PMID:29500162

Diversity of Shiga Toxin-Producing Escherichia coli (STEC) O26:H11 Strains Examined via stx Subtypes and Insertion Sites of Stx and EspK Bacteriophages

PubMed Central

Bonanno, Ludivine; Loukiadis, Estelle; Mariani-Kurkdjian, Patricia; Oswald, Eric; Garnier, Lucille; Michel, Valérie

2015-01-01

Shiga toxin-producing Escherichia coli (STEC) is a food-borne pathogen that may be responsible for severe human infections. Only a limited number of serotypes, including O26:H11, are involved in the majority of serious cases and outbreaks. The main virulence factors, Shiga toxins (Stx), are encoded by bacteriophages. Seventy-four STEC O26:H11 strains of various origins (including human, dairy, and cattle) were characterized for their stx subtypes and Stx phage chromosomal insertion sites. The majority of food and cattle strains possessed the stx1a subtype, while human strains carried mainly stx1a or stx2a. The wrbA and yehV genes were the main Stx phage insertion sites in STEC O26:H11, followed distantly by yecE and sbcB. Interestingly, the occurrence of Stx phages inserted in the yecE gene was low in dairy strains. In most of the 29 stx-negative E. coli O26:H11 strains also studied here, these bacterial insertion sites were vacant. Multilocus sequence typing of 20 stx-positive or stx-negative E. coli O26:H11 strains showed that they were distributed into two phylogenetic groups defined by sequence type 21 (ST21) and ST29. Finally, an EspK-carrying phage was found inserted in the ssrA gene in the majority of the STEC O26:H11 strains but in only a minority of the stx-negative E. coli O26:H11 strains. The differences in the stx subtypes and Stx phage insertion sites observed in STEC O26:H11 according to their origin might reflect that strains circulating in cattle and foods are clonally distinct from those isolated from human patients. PMID:25819955

Transposable elements generate population-specific insertional patterns and allelic variation in genes of wild emmer wheat (Triticum turgidum ssp. dicoccoides).

PubMed

Domb, Katherine; Keidar, Danielle; Yaakov, Beery; Khasdan, Vadim; Kashkush, Khalil

2017-10-27

Natural populations of the tetraploid wild emmer wheat (genome AABB) were previously shown to demonstrate eco-geographically structured genetic and epigenetic diversity. Transposable elements (TEs) might make up a significant part of the genetic and epigenetic variation between individuals and populations because they comprise over 80% of the wild emmer wheat genome. In this study, we performed detailed analyses to assess the dynamics of transposable elements in 50 accessions of wild emmer wheat collected from 5 geographically isolated sites. The analyses included: the copy number variation of TEs among accessions in the five populations, population-unique insertional patterns, and the impact of population-unique/specific TE insertions on structure and expression of genes. We assessed the copy numbers of 12 TE families using real-time quantitative PCR, and found significant copy number variation (CNV) in the 50 wild emmer wheat accessions, in a population-specific manner. In some cases, the CNV difference reached up to 6-fold. However, the CNV was TE-specific, namely some TE families showed higher copy numbers in one or more populations, and other TE families showed lower copy numbers in the same population(s). Furthermore, we assessed the insertional patterns of 6 TE families using transposon display (TD), and observed significant population-specific insertional patterns. The polymorphism levels of TE-insertional patterns reached 92% among all wild emmer wheat accessions, in some cases. In addition, we observed population-specific/unique TE insertions, some of which were located within or close to protein-coding genes, creating allelic variations in a population-specific manner. We also showed that those genes are differentially expressed in wild emmer wheat. For the first time, this study shows that TEs proliferate in wild emmer wheat in a population-specific manner, creating new alleles of genes, which contribute to the divergent evolution of homeologous genes from the A and B subgenomes.

Isolation of Mycobacterium avium subspecies paratuberculosis from non-ruminant wildlife living in the sheds and on the pastures of Greek sheep and goats.

PubMed

Florou, M; Leontides, L; Kostoulas, P; Billinis, C; Sofia, M; Kyriazakis, I; Lykotrafitis, F

2008-05-01

This study aimed to: (1) investigate whether non-ruminant wildlife interfacing with dairy sheep and goats of four Greek flocks endemically infected with Mycobacterium avium subspecies paratuberculosis (MAP) harboured MAP and (2) genetically compare the strains isolated from the wildlife to those isolated from the small ruminants of these flocks. We cultured and screened, by polymerase chain reaction (PCR), pooled-tissue samples from 327 wild animals of 11 species for the MAP-specific IS900 insertion sequence. We also cultured faecal samples from 100 sheep or goats from each of the four flocks. MAP was detected in samples from 11 sheep, 12 goats, two mice, two rats, a hare and a fox. Only one rat had histopathological findings. Genetic typing categorized 21 isolates as cattle-type strains and two, from a house mouse and a goat respectively, as sheep-type strains; this is the first report of a rodent harbouring a sheep-type strain. The MAP types that were most frequently isolated amongst the sheep and goats of each flock were also the ones isolated from sympatric rodents; those isolated from the fox and hare also belonged to the predominant ruminant strains.

Molecular Analysis of Mycobacterium avium Isolates by Using Pulsed-Field Gel Electrophoresis and PCR

PubMed Central

Pestel-Caron, Martine; Graff, Gabriel; Berthelot, Gilles; Pons, Jean-Louis; Lemeland, Jean-François

1999-01-01

Genetic relationships among 46 isolates of Mycobacterium avium recovered from 37 patients in a 2,500-bed hospital from 1993 to 1998 were assessed by pulsed-field gel electrophoresis (PFGE) and PCR amplification of genomic sequences located between the repetitive elements IS1245 and IS1311. Each technique enabled the identification of 27 to 32 different patterns among the 46 isolates, confirming that the genetic heterogeneity of M. avium strains is high in a given community. Furthermore, this retrospective analysis of sporadic isolates allowed us (i) to suggest the existence of two remanent strains in our region, (ii) to raise the question of the possibility of nosocomial acquisition of M. avium strains, and (iii) to document laboratory contamination. The methods applied in the present study were found to be useful for the typing of M. avium isolates. In general, both methods yielded similar results for both related and unrelated isolates. However, the isolates in five of the six PCR clusters were distributed among two to three PFGE patterns, suggesting that this PCR-based method may have limitations for the analysis of strains with low insertion sequence copy numbers or for resolution of extended epidemiologic relationships. PMID:10405383

Contribution of Avian Salmonella enterica Isolates to Human Salmonellosis Cases in Constantine (Algeria)

PubMed Central

Elgroud, Rachid; Granier, Sophie A.; Marault, Muriel; Kerouanton, Annaëlle; Lezzar, Abdesslem; Bouzitouna-Bentchouala, Chafia; Brisabois, Anne; Millemann, Yves

2015-01-01

An epidemiological investigation was carried out on one hundred Salmonella isolates from broiler farms, slaughterhouses, and human patients in the Constantine region of Algeria, in order to explore the contribution of avian strains to human salmonellosis cases in this region over the same period of time. The isolates were characterized by phenotypic as well as genotypic methods. A large variety of antimicrobial resistance profiles was found among human isolates, while only seven profiles were found among avian isolates. Enterobacterial Repetitive Intergenic Consensus-PCR (ERIC-PCR), Insertion Sequence 200-PCR (IS200-PCR), and Pulsed Field Gel Electrophoresis (PFGE) resulted in the allocation of the isolates to 16, 20, and 34 different profiles, respectively. The 3 genotyping methods led to complementary results by underlining the clonality of some serovars with the diffusion and persistence of a single clone in the Constantine area as well as stressing the polymorphism present in isolates belonging to other serovars, indicating the diversity of potential reservoirs of nontyphoidal Salmonella. Altogether, our results seem to indicate that nontyphoidal avian Salmonella may play an important role in human salmonellosis in the Constantine region. PMID:26543858

Helicobacter pylori oipA, vacA and dupA genetic diversity in individual hosts.

PubMed

Matteo, Mario José; Armitano, Rita Inés; Granados, Gabriela; Wonaga, Andrés Dario; Sánches, Christian; Olmos, Martín; Catalano, Mariana

2010-01-01

Helicobacter pylori putative virulence factors can undergo a continuously evolving mechanism as an approach to bacterial adaptation to the host changing environment during chronic infection. oipA, vacA and dupA genetic diversity among isolates from multiple biopsies (niches) from the antrum and corpus of 40 patients was investigated. A set of 229 isolates was examined. Direct DNA sequence analysis of amplified fragments was used to study oipA 'on/off' expression status as well as the presence of C or T insertion in jhp0917 that originates a continuous (jhp0917-jhp0918) dupA gene. vacA alleles were identified by multiplex PCR. Different inter-niches oipA CT repeat patterns were observed in nine patients; in six of these, 'on' and 'off' mixed patterns were found. In three of these nine patients, different vacA alleles were also observed in a single host. Inter-niche dupA differences involved the absence and presence of jhp0917 and/or jhp0918 or mutations in dupA, including those that may originate a non-functional gene, and they were also present in two patients with mixed oipA CT patterns and in another seven patients. Evidence of mixed infection was observed in two patients only. In conclusion, oipA and dupA genes showed similar inter-niche variability, occurring in approximately 1/4 patients. Conversely, vacA allele microevolution seemed to be a less common event, occurring in approximately 1/10 patients, probably due to the mechanism that this gene evolves 'in vivo'.

Electrotransformation and clonal isolation of Rickettsia species

PubMed Central

Riley, Sean P; Macaluso, Kevin R; Martinez, Juan J

2015-01-01

Genetic manipulation of obligate intracellular bacteria of the genus Rickettsia is currently undergoing a rapid period of change. The development of viable genetic tools, including replicative plasmids, transposons, homologous recombination, fluorescent protein-encoding genes, and antibiotic selectable markers has provided the impetus for future research development. This unit is designed to coalesce the basic methods pertaining to creation of genetically modified Rickettsia. The unit describes a series of methods, from inserting exogenous DNA into Rickettsia to the final isolation of genetically modified bacterial clones. Researchers working towards genetic manipulation of Rickettsia or similar obligate intracellular bacteria will find these protocols to be a valuable reference. PMID:26528784

Design and simulation of RF MEMS SPST shunt and SPDT shunt-shunt switches for X-band and Ku-band applications

NASA Astrophysics Data System (ADS)

Lenka, Manas K.; Sharma, Amit; Sharma, Jaibir; DasGupta, Amitava

2012-10-01

This paper describes the design and simulation of RF MEMS SPST shunt and SPDT shunt-shunt switches with modified coplanar waveguide (CPW) configuration for X-band and Ku-band applications exhibiting high isolation and low insertion loss. By modifying the basic CPW structure for a six-strip membrane having length 720 μm, the resonant frequency can be reduced from 33.5 GHz to 13.5 GHz with isolation as high as -30 dB(-63 dB at resonant frequency) in Ku-band. Similar results are also found in case SPST and SPDT switches with other membrane types.

NUCLEAR REACTOR CONTROL SYSTEM

DOEpatents

Epler, E.P.; Hanauer, S.H.; Oakes, L.C.

1959-11-01

A control system is described for a nuclear reactor using enriched uranium fuel of the type of the swimming pool and other heterogeneous nuclear reactors. Circuits are included for automatically removing and inserting the control rods during the course of normal operation. Appropriate safety circuits close down the nuclear reactor in the event of emergency.

48 CFR 552.270-10 - Failure in Performance.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Failure in Performance... Failure in Performance. As prescribed in 570.603, insert the following clause: Failure in Performance (SEP... required under this lease are interdependent. In the event of any failure by the Lessor to provide any...

48 CFR 552.270-10 - Failure in Performance.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 48 Federal Acquisition Regulations System 4 2012-10-01 2012-10-01 false Failure in Performance... Failure in Performance. As prescribed in 570.703, insert the following clause: Failure in Performance (SEP... required under this lease are interdependent. In the event of any failure by the Lessor to provide any...

48 CFR 552.270-10 - Failure in Performance.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 4 2014-10-01 2014-10-01 false Failure in Performance... Failure in Performance. As prescribed in 570.703, insert the following clause: Failure in Performance (SEP... required under this lease are interdependent. In the event of any failure by the Lessor to provide any...

48 CFR 552.270-10 - Failure in Performance.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 4 2011-10-01 2011-10-01 false Failure in Performance... Failure in Performance. As prescribed in 570.703, insert the following clause: Failure in Performance (SEP... required under this lease are interdependent. In the event of any failure by the Lessor to provide any...

48 CFR 552.270-10 - Failure in Performance.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 4 2013-10-01 2013-10-01 false Failure in Performance... Failure in Performance. As prescribed in 570.703, insert the following clause: Failure in Performance (SEP... required under this lease are interdependent. In the event of any failure by the Lessor to provide any...

Molecular characterization of Plum pox virus Rec isolates from Russia suggests a new insight into evolution of the strain.

PubMed

Chirkov, Sergei; Ivanov, Peter; Sheveleva, Anna; Kudryavtseva, Anna; Mitrofanova, Irina

2018-04-01

Field isolates of Plum pox virus (PPV), belonging to the strain Rec, have been found for the first time in Russia. Full-size genomes of the isolates K28 and Kisl-1pl from myrobalan and plum, respectively, were sequenced on the 454 platform. Analysis of all known PPV-Rec complete genomes using the Recombination Detection Program (RDP4) revealed yet another recombination event in the 5'-terminal region. This event was detected by seven algorithms, implemented in the RDP4, with statistically significant P values and supported by a phylogenetic analysis with the bootstrap value of 87%. A putative PPV-M-derived segment, encompassing the C-terminus of the P1 gene and approximately two-thirds of the HcPro gene, is bordered by breakpoints at positions 760-940 and 1838-1964, depending on the recombinant isolate. The predicted 5'-distal breakpoint for the isolate Valjevka is located at position 2804. The Dideron (strain D) and SK68 (strain M) isolates were inferred as major and minor parents, respectively. Finding of another recombination event suggests more complex evolutionary history of PPV-Rec than previously assumed. Perhaps the first recombination event led to the formation of a PPV-D variant harboring the PPV-M-derived fragment within the 5'-proximal part of the genome. Subsequent recombination of its descendant with PPV-M in the 3'-proximal genomic region resulted in the emergence of the evolutionary successful strain Rec.

Extreme weather events and environmental contamination are associated with case-clusters of melioidosis in the Northern Territory of Australia.

PubMed

Cheng, Allen C; Jacups, Susan P; Gal, Daniel; Mayo, Mark; Currie, Bart J

2006-04-01

Melioidosis, the infection due to the environmental organism Burkholderia pseudomallei, is endemic to northern Australia and South East Asia. It is associated with exposure to mud and pooled surface water, but environmental determinants of this disease are poorly understood. We defined case-clusters in northern Australia, determined their contribution to the observed rate of melioidosis, and explored clinical features and associated environmental factors. Using geographical information systems data, we examined clustering of melioidosis cases in time and geographical space in the Top End of the Northern Territory of Australia between 1990 and 2002 using a scan statistic. DNA macrorestriction analysis, resolved by pulsed field gel electrophoresis, was performed on isolates from patients. We defined five case-clusters involving 27 patients that occurred within 7-28 days and/or a radius of 100-300 km. Clustered cases were associated with extreme weather events or environmental contamination; no difference in the clinical pattern of disease was noted from other patients not involved in clusters. Isolates from patients linked to environmental contamination were caused by isolates with similar DNA macrorestriction patterns, but isolates from patients linked to severe weather events had more diverse DNA macrorestriction patterns. Case-clusters of melioidosis where isolates exhibit diverse DNA macrorestriction patterns in our region are linked to extreme weather events and outbreaks where isolates are predominantly of the same DNA macrorestriction pattern are linked with contamination of an environmental source.

Longitudinal Relationship Between Loneliness and Social Isolation in Older Adults: Results From the Cardiovascular Health Study.

PubMed

Petersen, Johanna; Kaye, Jeffrey; Jacobs, Peter G; Quinones, Ana; Dodge, Hiroko; Arnold, Alice; Thielke, Stephen

2016-08-01

To understand the longitudinal relationship between loneliness and isolation. Participants included 5,870 adults 65 years and older (M = 72.89 ± 5.59 years) from the first 5 years of the Cardiovascular Health Study. Loneliness was assessed using a dichotomized loneliness question. Social isolation was assessed using six items from the Lubben Social Network Scale. Yearly life events were included to assess abrupt social network changes. Mixed effects logistic regression was employed to analyze the relationship between isolation and loneliness. Higher levels of social isolation were associated with higher odds of loneliness, as was an increase (from median) in level of social isolation. Life events such as a friend dying were also associated with increased odds of loneliness. These results suggest that average level of isolation and increases in the level of isolation are closely tied to loneliness, which has implications for future assessment or monitoring of loneliness in older adult populations. © The Author(s) 2015.

Knock-in/Knock-out (KIKO) vectors for rapid integration of large DNA sequences, including whole metabolic pathways, onto the Escherichia coli chromosome at well-characterised loci.

PubMed

Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E

2013-06-24

Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable expression without the need for continuous antibiotic selection. Three non-essential loci have been characterised as insertion loci; combinatorial insertion at all three loci can be performed in one strain. The largest insertion at a single site described here was 5.4 kb; we have used this method in other studies to insert a total of 7.3 kb at one locus and 11.3 kb across two loci. These vectors are particularly useful for integration of multigene cassettes for metabolic engineering applications.

Transposon Insertion Finder (TIF): a novel program for detection of de novo transpositions of transposable elements.

PubMed

Nakagome, Mariko; Solovieva, Elena; Takahashi, Akira; Yasue, Hiroshi; Hirochika, Hirohiko; Miyao, Akio

2014-03-14

Transposition event detection of transposable element (TE) in the genome using short reads from the next-generation sequence (NGS) was difficult, because the nucleotide sequence of TE itself is repetitive, making it difficult to identify locations of its insertions by alignment programs for NGS. We have developed a program with a new algorithm to detect the transpositions from NGS data. In the process of tool development, we used next-generation sequence (NGS) data of derivative lines (ttm2 and ttm5) of japonica rice cv. Nipponbare, regenerated through cell culture. The new program, called a transposon insertion finder (TIF), was applied to detect the de novo transpositions of Tos17 in the regenerated lines. TIF searched 300 million reads of a line within 20 min, identifying 4 and 12 de novo transposition in ttm2 and ttm5 lines, respectively. All of the transpositions were confirmed by PCR/electrophoresis and sequencing. Using the program, we also detected new transposon insertions of P-element from NGS data of Drosophila melanogaster. TIF operates to find the transposition of any elements provided that target site duplications (TSDs) are generated by their transpositions.

Rates and patterns of great ape retrotransposition.

PubMed

Hormozdiari, Fereydoun; Konkel, Miriam K; Prado-Martinez, Javier; Chiatante, Giorgia; Herraez, Irene Hernando; Walker, Jerilyn A; Nelson, Benjamin; Alkan, Can; Sudmant, Peter H; Huddleston, John; Catacchio, Claudia R; Ko, Arthur; Malig, Maika; Baker, Carl; Marques-Bonet, Tomas; Ventura, Mario; Batzer, Mark A; Eichler, Evan E

2013-08-13

We analyzed 83 fully sequenced great ape genomes for mobile element insertions, predicting a total of 49,452 fixed and polymorphic Alu and long interspersed element 1 (L1) insertions not present in the human reference assembly and assigning each retrotransposition event to a different time point during great ape evolution. We used these homoplasy-free markers to construct a mobile element insertions-based phylogeny of humans and great apes and demonstrate their differential power to discern ape subspecies and populations. Within this context, we find a good correlation between L1 diversity and single-nucleotide polymorphism heterozygosity (r(2) = 0.65) in contrast to Alu repeats, which show little correlation (r(2) = 0.07). We estimate that the "rate" of Alu retrotransposition has differed by a factor of 15-fold in these lineages. Humans, chimpanzees, and bonobos show the highest rates of Alu accumulation--the latter two since divergence 1.5 Mya. The L1 insertion rate, in contrast, has remained relatively constant, with rates differing by less than a factor of three. We conclude that Alu retrotransposition has been the most variable form of genetic variation during recent human-great ape evolution, with increases and decreases occurring over very short periods of evolutionary time.

Sound isolation performance of interior acoustical sash

NASA Astrophysics Data System (ADS)

Tocci, Gregory

2002-05-01

In existing, as well as new buildings, an interior light of glass mounted on the inside of a prime window is used to improve the sound transmission loss otherwise obtained by the prime window alone. Interior acoustical sash is most often 1/4 in. (6 mm) monolithic or laminated glass, and is typically spaced 3 in. to 6 in. from the glass of the prime window. This paper presents TL data measured at Riverbank Acoustical Laboratories by Solutia (formerly Monsanto) for lightweight prime windows of various types, with and without interior acoustical sash glazed with 1/4 in. laminated glass. The TL data are used to estimate the A-weighted insertion loss of interior acoustical sash when applied to prime windows glazed with lightweight glass for four transportation noise source types-highway traffic, aircraft, electric rail, and diesel rail. The analysis also has been extended to determine the insertion loss expressed as a change in OITC. The data also exhibit the reductions in insertion loss that can result from short-circuiting the interior acoustical sash with the prime window. [Work supported by Solutia, Inc.

[cDNA library construction from panicle meristem of finger millet].

PubMed

Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

2014-01-01

The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

Seedling lethality in Nicotiana plumbaginifolia conferred by Ds transposable element insertion into a plant-specific gene.

PubMed

Majira, Amel; Domin, Monique; Grandjean, Olivier; Gofron, Krystyna; Houba-Hérin, Nicole

2002-10-01

A seedling lethal mutant of Nicotiana plumbaginifolia (sdl-1) was isolated by transposon tagging using a maize Dissociation (Ds) element. The insertion mutation was produced by direct co-transformation of protoplasts with two plasmids: one containing Ds and a second with an Ac transposase gene. sdl-1 seedlings exhibit several phenotypes: swollen organs, short hypocotyls in light and dark conditions, and enlarged and multinucleated cells, that altogether suggest cell growth defects. Mutant cells are able to proliferate under in vitro culture conditions. Genomic DNA sequences bordering the transposon were used to recover cDNA from the normal allele. Complementation of the mutant phenotype with the cDNA confirmed that the transposon had caused the mutation. The Ds element was inserted into the first exon of the open reading frame and the homozygous mutant lacked detectable transcript. Phenocopies of the mutant were obtained by an antisense approach. SDL-1 encodes a novel protein found in several plant genomes but apparently missingfrom animal and fungal genomes; the protein is highly conserved and has a potential plastid targeting motif.

Paramedic King Laryngeal Tube airway insertion versus endotracheal intubation in simulated pediatric respiratory arrest.

PubMed

Mitchell, Michael S; Lee White, Marjorie; King, William D; Wang, Henry E

2012-01-01

Pediatric endotracheal intubation (ETI) is difficult and can have serious adverse events when performed by paramedics in the prehospital setting. Paramedics may use the King Laryngeal Tube airway (KLT) in difficult adult airways, but only limited data describe their application in pediatric patients. To compare paramedic airway insertion speed and complications between KLT and ETI in a simulated model of pediatric respiratory arrest. This prospective, randomized trial included paramedics and senior paramedic students with limited prior KLT experience. We provided brief training on pediatric KLT insertion. Using a random allocation protocol, participants performed both ETI and KLT on a pediatric mannequin (6-month old size) in simulated respiratory arrest. The primary outcomes were 1) elapsed time to successful airway placement (seconds), and 2) proper airway positioning. We compared airway insertion performance between KLT and ETI using the Wilcoxon signed-ranks test. Subjects also indicated their preferred airway device. The 25 subjects included 19 paramedics and 6 senior paramedic students. Two subjects had prior adult KLT experience. Airway insertion time was not statistically different between the KLT (median 27 secs) and ETI (median 31 secs) (p = 0.08). Esophageal intubation occurred in 2 of 25 (8%) ETI. Airway leak occurred in 3 of 25 (12%) KLT, but ventilation remained satisfactory. Eighty-four percent of the subjects preferred the KLT over ETI. Paramedics and paramedic students demonstrated similar airway insertion performance between KLT and ETI in simulated, pediatric respiratory arrest. Most subjects preferred KLT. KLT may provide a viable alternative to ETI in prehospital pediatric airway management.

Seven Years of Recording from Monkey Cortex with a Chronically Implanted Multiple Microelectrode

PubMed Central

Krüger, Jürgen; Caruana, Fausto; Volta, Riccardo Dalla; Rizzolatti, Giacomo

2010-01-01

A brush of 64 microwires was chronically implanted in the ventral premotor cortex of a macaque monkey. Contrary to common approaches, the wires were inserted from the white matter side. This approach, by avoiding mechanical pressure on the dura and pia mater during penetration, disturbed only minimally the cortical recording site. With this approach isolated potentials and multiunit activity were recorded for more than 7 years in about one-third of electrodes. The indirect insertion method also provided an excellent stability within each recording session, and in some cases even allowed recording from the same neurons for several years. Histological examination of the implanted brain region shows only a very marginal damage to the recording area. Advantages and problems related to long-term recording are discussed. PMID:20577628

Nonreciprocal Gain in Non-Hermitian Time-Floquet Systems

NASA Astrophysics Data System (ADS)

Koutserimpas, Theodoros T.; Fleury, Romain

2018-02-01

We explore the unconventional wave scattering properties of non-Hermitian systems in which amplification or damping are induced by time-periodic modulation. These non-Hermitian time-Floquet systems are capable of nonreciprocal operations in the frequency domain, which can be exploited to induce novel physical phenomena such as unidirectional wave amplification and perfect nonreciprocal response with zero or even negative insertion losses. This unique behavior is obtained by imparting a specific low-frequency time-periodic modulation to the complex coupling between lossless resonators, promoting only upward frequency conversion, and leading to nonreciprocal parametric gain. We provide a full-wave demonstration of our findings in a one-way microwave amplifier, and establish the potential of non-Hermitian time-Floquet devices for insertion-loss free microwave isolation and unidirectional parametric amplification.

Insulation assembly for electric machine

DOEpatents

Rhoads, Frederick W.; Titmuss, David F.; Parish, Harold; Campbell, John D.

2013-10-15

An insulation assembly is provided that includes a generally annularly-shaped main body and at least two spaced-apart fingers extending radially inwards from the main body. The spaced-apart fingers define a gap between the fingers. A slot liner may be inserted within the gap. The main body may include a plurality of circumferentially distributed segments. Each one of the plurality of segments may be operatively connected to another of the plurality of segments to form the continuous main body. The slot liner may be formed as a single extruded piece defining a plurality of cavities. A plurality of conductors (extendable from the stator assembly) may be axially inserted within a respective one of the plurality of cavities. The insulation assembly electrically isolates the conductors in the electric motor from the stator stack and from other conductors.

Directed alteration of Saccharomyces cerevisiae mitochondrial DNA by biolistic transformation and homologous recombination.

PubMed

Bonnefoy, Nathalie; Fox, Thomas D

2007-01-01

Saccharomyces cerevisiae is currently the only species in which genetic transformation of mitochondria can be used to generate a wide variety of defined alterations in mitochondrial deoxyribonucleic acid (mtDNA). DNA sequences can be delivered into yeast mitochondria by microprojectile bombardment (biolistic transformation) and subsequently incorporated into mtDNA by the highly active homologous recombination machinery present in the organelle. Although transformation frequencies are relatively low, the availability of strong mitochondrial selectable markers for the yeast system, both natural and synthetic, makes the isolation of transformants routine. The strategies and procedures reviewed here allow the researcher to insert defined mutations into endogenous mitochondrial genes and to insert new genes into mtDNA. These methods provide powerful in vivo tools for the study of mitochondrial biology.

Does age matter? Sexual event-level analysis of age-disparate sexual partners among gay, bisexual and other men who have sex with men (GBM) in Vancouver, Canada.

PubMed

Closson, K; Lachowsky, N J; Cui, Z; Shurgold, S; Sereda, P; Rich, A; Moore, D M; Roth, E A; Hogg, R S

2017-08-01

To determine factors associated with age-disparate sexual partners among Vancouver gay, bisexual and other men who have sex with men (GBM). Sexually active GBM aged ≥16 years were recruited from February 2012 to February 2014. Participants self-completed a questionnaire on demographics, attitudes and sexual behaviour and substance use at last sexual event with five most recent partners. Two generalised linear mixed models identified factors associated with: (1) 'same-age' (referent), 'younger' or 'much-younger' and (2) 'same-age' (referent), 'older' or 'much-older' partners. Statistical interactions between age and HIV status were tested. Participants (n=719) were predominantly gay (85.1%), White (75.0%), HIV-negative/unknown status (72.9%) with median age of 33 years (Q1,Q3: 26,47). A minority of sexual events were reported with much-older/much-younger partners (13.7%). In the multivariable models, GBM reporting older partners were more likely to be Asian or Latino, have greater Escape Motivation scores, report their partner used erectile dysfunction drugs (EDDs) and have received something for sex; compared with condom-protected insertive anal sex, participants with older partners were more likely to report condomless insertive anal sex with a serodiscordant or unknown status partner or no insertive anal sex. GBM reporting older partners were less likely to be bisexual-identified, have given something for sex and report event-level alcohol and EDD use. GBM reporting younger partners were more likely to have annual incomes >$30 000 and have met their partner online. As per significant statistical interactions, age-disparate relations were more common for younger HIV-positive and older HIV-negative GBM. Differences among age-disparate partners highlight important targets for health promotion and future research. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

MEMS, Ka-Band Single-Pole Double-Throw (SPDT) Switch for Switched Line Phase Shifters

NASA Technical Reports Server (NTRS)

Scardelletti, Maximilian C.; Ponchak, George E.; Varaljay, Nicholas C.

2002-01-01

Ka-band MEMS doubly anchored cantilever beam capacitive shunt devices are used to demonstrate a MEMS SPDT switch fabricated on high resistivity silicon (HRS) utilizing finite ground coplanar waveguide (FGC) transmission lines. The SPDT switch has an insertion loss (IL), return loss (RL), and isolation of 0.3dB, 40dB, and 30 dB, respectively at Ka-band.

Polymorphic amplified typing sequences (PATS) and pulsed-field gel electrophoresis (PFGE) yield comparable results in the strain typing of a diverse set of bovine Escherichia coli O157 isolates

USDA-ARS?s Scientific Manuscript database

The PCR-based Escherichia coli O157 (O157) strain typing system, Polymorphic Amplified Typing Sequences (PATS), targets insertions-deletions (Indels) and single nucleotide polymorphisms (SNPs) at the XbaI and AvrII(BlnI) restriction enzyme sites, respectively, besides amplifying four known virulenc...

Pyranose 2-oxidase from Phanerochaete chrysosporium : expression in E. coli and biochemical characterization

Treesearch

Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer

2009-01-01

The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...

Imperfect duplicate insertions type of mutations in plasmepsin V modulates binding properties of PEXEL motifs of export proteins in Indian Plasmodium vivax.

PubMed

Rawat, Manmeet; Vijay, Sonam; Gupta, Yash; Tiwari, Pramod Kumar; Sharma, Arun

2013-01-01

Plasmepsin V (PM-V) have functionally conserved orthologues across the Plasmodium genus who's binding and antigenic processing at the PEXEL motifs for export about 200-300 essential proteins is important for the virulence and viability of the causative Plasmodium species. This study was undertaken to determine P. vivax plasmepsin V Ind (PvPM-V-Ind) PEXEL motif export pathway for pathogenicity-related proteins/antigens export thereby altering plasmodium exportome during erythrocytic stages. We identify and characterize Plasmodium vivax plasmepsin-V-Ind (mutant) gene by cloning, sequence analysis, in silico bioinformatic protocols and structural modeling predictions based on docking studies on binding capacity with PEXEL motifs processing in terms of binding and accessibility of export proteins. Cloning and sequence analysis for genetic diversity demonstrates PvPM-V-Ind (mutant) gene is highly conserved among all isolates from different geographical regions of India. Imperfect duplicate insertion types of mutations (SVSE from 246-249 AA and SLSE from 266-269 AA) were identified among all Indian isolates in comparison to P.vivax Sal-1 (PvPM-V-Sal 1) isolate. In silico bioinformatics interaction studies of PEXEL peptide and active enzyme reveal that PvPM-V-Ind (mutant) is only active in endoplasmic reticulum lumen and membrane embedding is essential for activation of plasmepsin V. Structural modeling predictions based on docking studies with PEXEL motif show significant variation in substrate protein binding of these imperfect mutations with data mined PEXEL sequences. The predicted variation in the docking score and interacting amino acids of PvPM-V-Ind (mutant) proteins with PEXEL and lopinavir suggests a modulation in the activity of PvPM-V in terms of binding and accessibility at these sites. Our functional modeled validation of PvPM-V-Ind (mutant) imperfect duplicate insertions with data mined PEXEL sequences leading to altered binding and substrate accessibility of the enzyme makes it a plausible target to investigate export mechanisms for in silico virtual screening and novel pharmacophore designing.

Imperfect Duplicate Insertions Type of Mutations in Plasmepsin V Modulates Binding Properties of PEXEL Motifs of Export Proteins in Indian Plasmodium vivax

PubMed Central

Rawat, Manmeet; Vijay, Sonam; Gupta, Yash; Tiwari, Pramod Kumar; Sharma, Arun

2013-01-01

Introduction Plasmepsin V (PM-V) have functionally conserved orthologues across the Plasmodium genus who's binding and antigenic processing at the PEXEL motifs for export about 200–300 essential proteins is important for the virulence and viability of the causative Plasmodium species. This study was undertaken to determine P. vivax plasmepsin V Ind (PvPM-V-Ind) PEXEL motif export pathway for pathogenicity-related proteins/antigens export thereby altering plasmodium exportome during erythrocytic stages. Method We identify and characterize Plasmodium vivax plasmepsin-V-Ind (mutant) gene by cloning, sequence analysis, in silico bioinformatic protocols and structural modeling predictions based on docking studies on binding capacity with PEXEL motifs processing in terms of binding and accessibility of export proteins. Results Cloning and sequence analysis for genetic diversity demonstrates PvPM-V-Ind (mutant) gene is highly conserved among all isolates from different geographical regions of India. Imperfect duplicate insertion types of mutations (SVSE from 246–249 AA and SLSE from 266–269 AA) were identified among all Indian isolates in comparison to P.vivax Sal-1 (PvPM-V-Sal 1) isolate. In silico bioinformatics interaction studies of PEXEL peptide and active enzyme reveal that PvPM-V-Ind (mutant) is only active in endoplasmic reticulum lumen and membrane embedding is essential for activation of plasmepsin V. Structural modeling predictions based on docking studies with PEXEL motif show significant variation in substrate protein binding of these imperfect mutations with data mined PEXEL sequences. The predicted variation in the docking score and interacting amino acids of PvPM-V-Ind (mutant) proteins with PEXEL and lopinavir suggests a modulation in the activity of PvPM-V in terms of binding and accessibility at these sites. Conclusion/Significance Our functional modeled validation of PvPM-V-Ind (mutant) imperfect duplicate insertions with data mined PEXEL sequences leading to altered binding and substrate accessibility of the enzyme makes it a plausible target to investigate export mechanisms for in silico virtual screening and novel pharmacophore designing. PMID:23555891

Isolation of bacteria-containing phagosomes by magnetic selection

PubMed Central

Lönnbro, Per; Nordenfelt, Pontus; Tapper, Hans

2008-01-01

Background There is a growing awareness of the importance of intracellular events in determining the outcome of infectious disease. To improve the understanding of such events, like phagosome maturation, we set out to develop a versatile technique for phagosome isolation that is rapid and widely applicable to different pathogens. Results We developed two different protocols to isolate phagosomes containing dead or live bacteria modified with small magnetic particles, in conjunction with a synchronized phagocytosis protocol and nitrogen cavitation. For dead bacteria, we performed analysis of the phagosome samples by microscopy and immunoblot, and demonstrated the appearance of maturation markers on isolated phagosomes. Conclusion We have presented detailed protocols for phagosome isolation, which can be adapted for use with different cell types and prey. The versatility and simplicity of the approach allow better control of phagosome isolation, the parameters of which are critical in studies of host-bacteria interaction and phagosome maturation. PMID:18588680

Development of a novel multi-layer MRE isolator for suppression of building vibrations under seismic events

NASA Astrophysics Data System (ADS)

Yang, Jian; Sun, Shuaishuai; Tian, Tongfei; Li, Weihua; Du, Haiping; Alici, Gursel; Nakano, Masami

2016-03-01

Protecting civil engineering structures from uncontrollable events such as earthquakes while maintaining their structural integrity and serviceability is very important; this paper describes the performance of a stiffness softening magnetorheological elastomer (MRE) isolator in a scaled three storey building. In order to construct a closed-loop system, a scaled three storey building was designed and built according to the scaling laws, and then four MRE isolator prototypes were fabricated and utilised to isolate the building from the motion induced by a scaled El Centro earthquake. Fuzzy logic was used to output the current signals to the isolators, based on the real-time responses of the building floors, and then a simulation was used to evaluate the feasibility of this closed loop control system before carrying out an experimental test. The simulation and experimental results showed that the stiffness softening MRE isolator controlled by fuzzy logic could suppress structural vibration well.

Le concept suédois pour stockage définitif des déchets nucléaires

NASA Astrophysics Data System (ADS)

Hedman, Tommy; Nyström, Anders; Thegerström, Claes

2002-10-01

The purpose of a disposal is to isolate the radioactive waste from man and the environment. If the isolation is broken, the leakage and transport of radioactive substances must be retarded. The package is one of several barriers, used to achieve these two main functions. For short-lived, low and intermediate level waste four standard containers of steel and concrete are used. Spent fuel will be placed in a canister consisting of a pressure-bearing insert of cast nodular iron and an outer corrosion barrier of copper before it is deposited in a deep geological repository. In particular, the development of a high integrity copper canister for the isolation of spent nuclear fuel is described in this paper. To cite this article: T. Hedman et al., C. R. Physique 3 (2002) 903-913.

Acceleration of a Static Observer Near the Event Horizon of a Static Isolated Black Hole.

ERIC Educational Resources Information Center

Doughty, Noel A.

1981-01-01

Compares the magnitude of the proper acceleration of a static observer in a static, isolated, spherically symmetric space-time region with the Newtonian result including the situation in the interior of a perfect-fluid star. This provides a simple physical interpretation of surface gravity and illustrates the global nature of the event horizon.…

Lineage-specific expansions of retroviral insertions within the genomes of African great apes but not humans and orangutans.

PubMed

Yohn, Chris T; Jiang, Zhaoshi; McGrath, Sean D; Hayden, Karen E; Khaitovich, Philipp; Johnson, Matthew E; Eichler, Marla Y; McPherson, John D; Zhao, Shaying; Pääbo, Svante; Eichler, Evan E

2005-04-01

Retroviral infections of the germline have the potential to episodically alter gene function and genome structure during the course of evolution. Horizontal transmissions between species have been proposed, but little evidence exists for such events in the human/great ape lineage of evolution. Based on analysis of finished BAC chimpanzee genome sequence, we characterize a retroviral element (Pan troglodytes endogenous retrovirus 1 [PTERV1]) that has become integrated in the germline of African great ape and Old World monkey species but is absent from humans and Asian ape genomes. We unambiguously map 287 retroviral integration sites and determine that approximately 95.8% of the insertions occur at non-orthologous regions between closely related species. Phylogenetic analysis of the endogenous retrovirus reveals that the gorilla and chimpanzee elements share a monophyletic origin with a subset of the Old World monkey retroviral elements, but that the average sequence divergence exceeds neutral expectation for a strictly nuclear inherited DNA molecule. Within the chimpanzee, there is a significant integration bias against genes, with only 14 of these insertions mapping within intronic regions. Six out of ten of these genes, for which there are expression data, show significant differences in transcript expression between human and chimpanzee. Our data are consistent with a retroviral infection that bombarded the genomes of chimpanzees and gorillas independently and concurrently, 3-4 million years ago. We speculate on the potential impact of such recent events on the evolution of humans and great apes.

CRISPR-based screening of genomic island excision events in bacteria.

PubMed

Selle, Kurt; Klaenhammer, Todd R; Barrangou, Rodolphe

2015-06-30

Genomic analysis of Streptococcus thermophilus revealed that mobile genetic elements (MGEs) likely contributed to gene acquisition and loss during evolutionary adaptation to milk. Clustered regularly interspaced short palindromic repeats-CRISPR-associated genes (CRISPR-Cas), the adaptive immune system in bacteria, limits genetic diversity by targeting MGEs including bacteriophages, transposons, and plasmids. CRISPR-Cas systems are widespread in streptococci, suggesting that the interplay between CRISPR-Cas systems and MGEs is one of the driving forces governing genome homeostasis in this genus. To investigate the genetic outcomes resulting from CRISPR-Cas targeting of integrated MGEs, in silico prediction revealed four genomic islands without essential genes in lengths from 8 to 102 kbp, totaling 7% of the genome. In this study, the endogenous CRISPR3 type II system was programmed to target the four islands independently through plasmid-based expression of engineered CRISPR arrays. Targeting lacZ within the largest 102-kbp genomic island was lethal to wild-type cells and resulted in a reduction of up to 2.5-log in the surviving population. Genotyping of Lac(-) survivors revealed variable deletion events between the flanking insertion-sequence elements, all resulting in elimination of the Lac-encoding island. Chimeric insertion sequence footprints were observed at the deletion junctions after targeting all of the four genomic islands, suggesting a common mechanism of deletion via recombination between flanking insertion sequences. These results established that self-targeting CRISPR-Cas systems may direct significant evolution of bacterial genomes on a population level, influencing genome homeostasis and remodeling.

Direct current electrical stimulation of acupuncture needles for peripheral nerve regeneration: an exploratory case series.

PubMed

Inoue, Motohiro; Katsumi, Yasukazu; Itoi, Megumi; Hojo, Tatsuya; Nakajima, Miwa; Ohashi, Suzuyo; Oi, Yuki; Kitakoji, Hiroshi

2011-06-01

To examine the therapeutic effect of a novel therapeutic method based on electroacupuncture with intermittent direct current (DCEA) and associated adverse events in patients with peripheral nerve damage and a poor clinical prognosis. In seven older patients with peripheral nerve damage (neurapraxia 2, axonotmesis 4, neuromesis 1), an acupuncture needle connected to an anode electrode was inserted proximal to the site of the injury along the route of the nerve, while the cathode electrode was inserted into the innervated muscle, and DCEA was performed (100 Hz for 20 min, weekly). Muscular paralysis was evaluated weekly with manual muscle testing, the active range of motion of joints related to the muscular paralysis and, when necessary, needle electromyography. Adverse events were also recorded during the course of the treatment. Complete functional recovery was observed in the two cases with neurapraxia and two with axonotmesis, while one axonotmesis case achieved improvement and the other showed reinnervation potential without functional recovery. No improvement was observed in the neurotmesis case. Pigmentation of the skin where the anode needle was inserted occurred in three cases. Although there was no definite causal link, one case showed excessive formation and resorption of bone in the area close to the cathode needle site. Accelerated nerve regeneration caused by DCEA may contribute to recovery. The skin pigmentation and callus formation suggest that the shape of the anode electrode, current intensity and other factors should be examined to establish a safer treatment method.

Variation in the Breeding System of Prunella vulgaris L.

PubMed

Qu, Luping; Widrlechner, Mark P

2011-05-01

Prunella vulgaris (Lamiaceae), commonly known as selfheal, is a perennial herb with a long history of use in traditional medicine. Recent studies have found that P. vulgaris possesses anti-inflammatory, antiviral, and antibacterial properties, and it is likely that this will lead to increased commercial demand for this species. To date, research publications on P. vulgaris cultivation and genetics are scarce. Using accessions originally collected from different geographical regions, we investigated the breeding system of this species by observing variation in floral morphology, time of pollen release, and selfed-seed set in bagged flowers and isolated plants. Two types of floral morphology, one with exerted styles, extending past open corollas when viewed from above, and the other with shorter, inserted styles, were found among 30 accessions. Two accessions originally collected from Asia uniformly displayed exerted styles, and 27 accessions had inserted styles. One accession from Oregon displayed variation in this trait among individual plants. Microscopic observation of seven accessions, including ones with both exerted and inserted styles, revealed that they all release pollen to some degree before the flowers open. Using bagged flowers, we found that selfed-seed set varied widely among eight accessions, ranging from 6% to 94%. However, bagging may underestimate seed set for some accessions. The two accessions with the lowest rates when using bagged flowers increased in seed set by 350% and 158%, respectively, when we evaluated single, unbagged plants in isolation cages. The accession with 6% selfed-seed set when bagged also had exerted styles. These findings suggest that mating systems in P. vulgaris may be in the process of evolutionary change and that understanding breeding-system variation should be useful in developing efficient seed-regeneration protocols and breeding and selection strategies for this species.

Variation in the Breeding System of Prunella vulgaris L

PubMed Central

Qu, Luping; Widrlechner, Mark P.

2011-01-01

Prunella vulgaris (Lamiaceae), commonly known as selfheal, is a perennial herb with a long history of use in traditional medicine. Recent studies have found that P. vulgaris possesses anti-inflammatory, antiviral, and antibacterial properties, and it is likely that this will lead to increased commercial demand for this species. To date, research publications on P. vulgaris cultivation and genetics are scarce. Using accessions originally collected from different geographical regions, we investigated the breeding system of this species by observing variation in floral morphology, time of pollen release, and selfed-seed set in bagged flowers and isolated plants. Two types of floral morphology, one with exerted styles, extending past open corollas when viewed from above, and the other with shorter, inserted styles, were found among 30 accessions. Two accessions originally collected from Asia uniformly displayed exerted styles, and 27 accessions had inserted styles. One accession from Oregon displayed variation in this trait among individual plants. Microscopic observation of seven accessions, including ones with both exerted and inserted styles, revealed that they all release pollen to some degree before the flowers open. Using bagged flowers, we found that selfed-seed set varied widely among eight accessions, ranging from 6% to 94%. However, bagging may underestimate seed set for some accessions. The two accessions with the lowest rates when using bagged flowers increased in seed set by 350% and 158%, respectively, when we evaluated single, unbagged plants in isolation cages. The accession with 6% selfed-seed set when bagged also had exerted styles. These findings suggest that mating systems in P. vulgaris may be in the process of evolutionary change and that understanding breeding-system variation should be useful in developing efficient seed-regeneration protocols and breeding and selection strategies for this species. PMID:21776085

Isolation and characterization of a Ds-tagged rice (Oryza sativa L.) GA-responsive dwarf mutant defective in an early step of the gibberellin biosynthesis pathway.

PubMed

Margis-Pinheiro, Marcia; Zhou, Xue-Rong; Zhu, Qian-Hao; Dennis, Elizabeth S; Upadhyaya, Narayana M

2005-03-01

We have isolated a severe dwarf transposon (Ds) insertion mutant in rice (Oryza sativa L.), which could be differentiated early in the seedling stage by reduced shoot growth and dark green leaves, and later by severe dwarfism and failure to initiate flowering. These mutants, however, showed normal seed germination and root growth. One of the sequences flanking Ds, rescued from the mutant, was of a chromosome 4-located putative ent-kaurene synthase (KS) gene, encoding the enzyme catalyzing the second step of the gibberellin (GA) biosynthesis pathway. Dwarf mutants were always homozygous for this Ds insertion and no normal plants homozygous for this mutation were recovered in the segregating progeny, indicating that the Ds insertion mutation is recessive. As mutations in three recently reported rice GA-responsive dwarf mutant alleles and the dwarf mutation identified in this study mapped to the same locus, we designate the corresponding gene OsKS1. The osks1 mutant seedlings were responsive to exogenous gibberellin (GA3). OsKS1 transcripts of about 2.3 kb were detected in leaves and stem of wild-type plants, but not in germinating seeds or roots, suggesting that OsKS1 is not involved in germination or root growth. There are at least five OsKS1-like genes in the rice genome, four of which are also represented in rice expressed sequence tag (EST) databases. All OsKS1-like genes are transcribed with different expression patterns. ESTs corresponding to all six OsKS genes are represented in other cereal databases including barley, wheat and maize, suggesting that they are biologically active.

Noncytopathogenic Pestivirus Strains Generated by Nonhomologous RNA Recombination: Alterations in the NS4A/NS4B Coding Region

PubMed Central

Gallei, Andreas; Orlich, Michaela; Thiel, Heinz-Juergen; Becher, Paul

2005-01-01

Several studies have demonstrated that cytopathogenic (cp) pestivirus strains evolve from noncytopathogenic (noncp) viruses by nonhomologous RNA recombination. In addition, two recent reports showed the rapid emergence of noncp Bovine viral diarrhea virus (BVDV) after a few cell culture passages of cp BVDV strains by homologous recombination between identical duplicated viral sequences. To allow the identification of recombination sites from noncp BVDV strains that evolve from cp viruses, we constructed the cp BVDV strains CP442 and CP552. Both harbor duplicated viral sequences of different origin flanking the cellular insertion Nedd8*; the latter is a prerequisite for their cytopathogenicity. In contrast to the previous studies, isolation of noncp strains was possible only after extensive cell culture passages of CP442 and CP552. Sequence analysis of 15 isolated noncp BVDVs confirmed that all recombinant strains lack at least most of Nedd8*. Interestingly, only one strain resulted from homologous recombination while the other 14 strains were generated by nonhomologous recombination. Accordingly, our data suggest that the extent of sequence identity between participating sequences influences both frequency and mode (homologous versus nonhomologous) of RNA recombination in pestiviruses. Further analyses of the noncp recombinant strains revealed that a duplication of 14 codons in the BVDV nonstructural protein 4B (NS4B) gene does not interfere with efficient viral replication. Moreover, an insertion of viral sequences between the NS4A and NS4B genes was well tolerated. These findings thus led to the identification of two genomic loci which appear to be suited for the insertion of heterologous sequences into the genomes of pestiviruses and related viruses. PMID:16254361

[Central venous catheter-related infections in critically ill patients].

PubMed

Diener, J R; Coutinho, M S; Zoccoli, C M

1996-01-01

To determine incidence rate, etiology and risk factors for central venous catheter (CVC)-related infections in critically-ill patients, a prospective cohort study was conducted in the general Intensive Care Unit (ICU) of a 212 bed Hospital in Florianópolis, Brazil. Patients admitted to ICU between May 1993 and February 1994, exposed to short-term CVC, were included in the study. Quantitative skin culture at CVC insertion site, semi-quantitative CVC tip culture, quantitative hub culture, and peripheral blood-culture were done. Results were submitted to univariate and multivariate analysis. Fifty-seven catheterization periods were analysed in 51 patients. The incidence rate was 21.1% (33.1 per 1,000 catheter-days) for local infection, and 8.7% (14.1 per 1,000 catheter-days) for catheter-associated bacteremia. The skin at the insertion site was colonized in 32.7% and the hub in 29.1% of the patients respectively. Potential sources of infection were the skin in 41.2% of the cases, the hub in 29.4%, remote site in 5.9% and unknown in 23.5%. The hub was implicated in 60% of the catheter-associated bacteremias. Coagulase-negative staphylococci were the main isolates. Another intravascular device and purulence at the insertion site were independently associated with local infection. Insertion at internal jugular site and hub colonization were independently associated with bacteremia. Catheter-associated bacteremia is a major complication of central venous catheterization in critically-ill patients. Internal jugular insertion and CVC hub colonization are important risk factors for significant catheter-related infections.

Combinatorial events of insertion sequences and ICE in Gram-negative bacteria.

PubMed

Toleman, Mark A; Walsh, Timothy R

2011-09-01

The emergence of antibiotic and antimicrobial resistance in Gram-negative bacteria is incremental and linked to genetic elements that function in a so-called 'one-ended transposition' manner, including ISEcp1, ISCR elements and Tn3-like transposons. The power of these elements lies in their inability to consistently recognize one of their own terminal sequences, while recognizing more genetically distant surrogate sequences. This has the effect of mobilizing the DNA sequence found adjacent to their initial location. In general, resistance in Gram-negatives is closely linked to a few one-off events. These include the capture of the class 1 integron by a Tn5090-like transposon; the formation of the 3' conserved segment (3'-CS); and the fusion of the ISCR1 element to the 3'-CS. The structures formed by these rare events have been massively amplified and disseminated in Gram-negative bacteria, but hitherto, are rarely found in Gram-positives. Such events dominate current resistance gene acquisition and are instrumental in the construction of large resistance gene islands on chromosomes and plasmids. Similar combinatorial events appear to have occurred between conjugative plasmids and phages constructing hybrid elements called integrative and conjugative elements or conjugative transposons. These elements are beginning to be closely linked to some of the more powerful resistance mechanisms such as the extended spectrum β-lactamases, metallo- and AmpC type β-lactamases. Antibiotic resistance in Gram-negative bacteria is dominated by unusual combinatorial mistakes of Insertion sequences and gene fusions which have been selected and amplified by antibiotic pressure enabling the formation of extended resistance islands. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Divergence in genital morphology may contribute to mechanical reproductive isolation in a millipede

PubMed Central

Wojcieszek, Janine M; Simmons, Leigh W

2013-01-01

Genitalia appear to evolve rapidly and divergently in taxa with internal fertilization. The current consensus is that intense directional sexual selection drives the rapid evolution of genitalia. Recent research on the millipede Antichiropus variabilis suggests that the male genitalia are currently experiencing stabilizing selection – a pattern of selection expected for lock-and-key structures that enforce mate recognition and reproductive isolation. Here, we investigate how divergence in genital morphology affects reproductive compatibility among isolated populations of A. variabilis. Females from a focal population were mated first to a male from their own population and, second, to a male from one of two populations with divergent genital morphology. We observed variation in mating behavior that might indicate the emergence of precopulatory reproductive barriers: males from one divergent population took significantly longer to recognize females and exhibited mechanical difficulty in genital insertion. Moreover, we observed very low paternity success for extra-population males who were successful in copulating. Our data suggest that divergence in genital shape may be contributing to reproductive isolation, and incipient speciation among isolated populations of A. variabilis. PMID:23467632

Host shifts and molecular evolution of H7 avian influenza virus hemagglutinin

PubMed Central

2011-01-01

Evolutionary consequences of host shifts represent a challenge to identify the mechanisms involved in the emergence of influenza A (IA) viruses. In this study we focused on the evolutionary history of H7 IA virus in wild and domestic birds, with a particular emphasis on host shifts consequences on the molecular evolution of the hemagglutinin (HA) gene. Based on a dataset of 414 HA nucleotide sequences, we performed an extensive phylogeographic analysis in order to identify the overall genetic structure of H7 IA viruses. We then identified host shift events and investigated viral population dynamics in wild and domestic birds, independently. Finally, we estimated changes in nucleotide substitution rates and tested for positive selection in the HA gene. A strong association between the geographic origin and the genetic structure was observed, with four main clades including viruses isolated in North America, South America, Australia and Eurasia-Africa. We identified ten potential events of virus introduction from wild to domestic birds, but little evidence for spillover of viruses from poultry to wild waterbirds. Several sites involved in host specificity (addition of a glycosylation site in the receptor binding domain) and virulence (insertion of amino acids in the cleavage site) were found to be positively selected in HA nucleotide sequences, in genetically unrelated lineages, suggesting parallel evolution for the HA gene of IA viruses in domestic birds. These results highlight that evolutionary consequences of bird host shifts would need to be further studied to understand the ecological and molecular mechanisms involved in the emergence of domestic bird-adapted viruses. PMID:21711553

Dynamic of mutational events in variable number tandem repeats of Escherichia coli O157:H7.

PubMed

Bustamante, A V; Sanso, A M; Segura, D O; Parma, A E; Lucchesi, P M A

2013-01-01

VNTRs regions have been successfully used for bacterial subtyping; however, the hypervariability in VNTR loci is problematic when trying to predict the relationships among isolates. Since few studies have examined the mutation rate of these markers, our aim was to estimate mutation rates of VNTRs specific for verotoxigenic E. coli O157:H7. The knowledge of VNTR mutational rates and the factors affecting them would make MLVA more effective for epidemiological or microbial forensic investigations. For this purpose, we analyzed nine loci performing parallel, serial passage experiments (PSPEs) on 9 O157:H7 strains. The combined 9 PSPE population rates for the 8 mutating loci ranged from 4.4 × 10(-05) to 1.8 × 10(-03) mutations/generation, and the combined 8-loci mutation rate was of 2.5 × 10(-03) mutations/generation. Mutations involved complete repeat units, with only one point mutation detected. A similar proportion between single and multiple repeat changes was detected. Of the 56 repeat mutations, 59% were insertions and 41% were deletions, and 72% of the mutation events corresponded to O157-10 locus. For alleles with up to 13 UR, a constant and low mutation rate was observed; meanwhile longer alleles were associated with higher and variable mutation rates. Our results are useful to interpret data from microevolution and population epidemiology studies and particularly point out that the inclusion or not of O157-10 locus or, alternatively, a differential weighting data according to the mutation rates of loci must be evaluated in relation with the objectives of the proposed study.

Integrated mechanism for the generation of the 5′ junctions of LINE inserts

PubMed Central

Yamaguchi, Katsumi; Kajikawa, Masaki; Okada, Norihiro

2014-01-01

To elucidate the molecular mechanism of the integration of long interspersed elements (LINEs), we characterized the 5′ ends of more than 200 LINE de novo retrotransposition events into chicken DT40 or human HeLa cells. Human L1 inserts produced 15-bp target-site duplications (TSDs) and zebrafish ZfL2-1 inserts produced 5-bp TSDs in DT40 cells, suggesting that TSD length depends on the LINE species. Further analysis of 5′ junctions revealed that the 5′-end-joining pathways of LINEs can be divided into two fundamental types—annealing or direct. We also found that the generation of 5′ inversions depends on host and LINE species. These results led us to propose a new model for 5′-end joining, the type of which is determined by the extent of exposure of 3′ overhangs generated after the second-strand cleavage and by the involvement of host factors. PMID:25378331

Integrated mechanism for the generation of the 5' junctions of LINE inserts.

PubMed

Yamaguchi, Katsumi; Kajikawa, Masaki; Okada, Norihiro

2014-12-01

To elucidate the molecular mechanism of the integration of long interspersed elements (LINEs), we characterized the 5' ends of more than 200 LINE de novo retrotransposition events into chicken DT40 or human HeLa cells. Human L1 inserts produced 15-bp target-site duplications (TSDs) and zebrafish ZfL2-1 inserts produced 5-bp TSDs in DT40 cells, suggesting that TSD length depends on the LINE species. Further analysis of 5' junctions revealed that the 5'-end-joining pathways of LINEs can be divided into two fundamental types-annealing or direct. We also found that the generation of 5' inversions depends on host and LINE species. These results led us to propose a new model for 5'-end joining, the type of which is determined by the extent of exposure of 3' overhangs generated after the second-strand cleavage and by the involvement of host factors. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Endogenous Retrovirus EAV-HP Linked to Blue Egg Phenotype in Mapuche Fowl

PubMed Central

Alcalde, José A.; Wang, Chen; Han, Jian-Lin; Gongora, Jaime; Gourichon, David; Tixier-Boichard, Michèle; Hanotte, Olivier

2013-01-01

Oocyan or blue/green eggshell colour is an autosomal dominant trait found in native chickens (Mapuche fowl) of Chile and in some of their descendants in European and North American modern breeds. We report here the identification of an endogenous avian retroviral (EAV-HP) insertion in oocyan Mapuche fowl and European breeds. Sequencing data reveals 100% retroviral identity between the Mapuche and European insertions. Quantitative real-time PCR analysis of European oocyan chicken indicates over-expression of the SLCO1B3 gene (P<0.05) in the shell gland and oviduct. Predicted transcription factor binding sites in the long terminal repeats (LTR) indicate AhR/Ar, a modulator of oestrogen, as a possible promoter/enhancer leading to reproductive tissue-specific over-expression of the SLCO1B3 gene. Analysis of all jungle fowl species Gallus sp. supports the retroviral insertion to be a post-domestication event, while identical LTR sequences within domestic chickens are in agreement with a recent de novo mutation. PMID:23990950

Endogenous retrovirus EAV-HP linked to blue egg phenotype in Mapuche fowl.

PubMed

Wragg, David; Mwacharo, Joram M; Alcalde, José A; Wang, Chen; Han, Jian-Lin; Gongora, Jaime; Gourichon, David; Tixier-Boichard, Michèle; Hanotte, Olivier

2013-01-01

Oocyan or blue/green eggshell colour is an autosomal dominant trait found in native chickens (Mapuche fowl) of Chile and in some of their descendants in European and North American modern breeds. We report here the identification of an endogenous avian retroviral (EAV-HP) insertion in oocyan Mapuche fowl and European breeds. Sequencing data reveals 100% retroviral identity between the Mapuche and European insertions. Quantitative real-time PCR analysis of European oocyan chicken indicates over-expression of the SLCO1B3 gene (P<0.05) in the shell gland and oviduct. Predicted transcription factor binding sites in the long terminal repeats (LTR) indicate AhR/Ar, a modulator of oestrogen, as a possible promoter/enhancer leading to reproductive tissue-specific over-expression of the SLCO1B3 gene. Analysis of all jungle fowl species Gallus sp. supports the retroviral insertion to be a post-domestication event, while identical LTR sequences within domestic chickens are in agreement with a recent de novo mutation.

Spitzer Parallax Observations of Long Duration Gaia Microlensing Events

NASA Astrophysics Data System (ADS)

Carey, Sean; Calchi-Novati, Sebastiano; Wyrzykowski, Lukasz; Kruszynska, Katarzyna; Gromadzki, Mariusz; Rybicki, Krzysztof

2018-05-01

We proposed to observe of order ten long duration (>100 day) microlensing events identified in Gaia survey data with the Spitzer Space Telescope. The long duration events are likely due to massive lenses, hence they could be isolated black holes. These observations could make defintive mass measurements for the first time of isolated stellar remanant black holes in our Galaxy. The Spitzer data provide a key component to making an umabiguous mass measurement by providing the microlensing parallax (as has been done for >500 event by Spitzer so far). The Gaia data is used for the detection of the events and measurement of the astrometric motion caused by the microlensing event. From the astrometric microlensing signature, the Einstein radius of the lens can be measured and combined with the microlensing parallax yields the lens mass and distance.

Genetic analysis of West Nile virus isolates from an outbreak in Idaho, United States, 2006-2007.

PubMed

Grinev, Andriyan; Chancey, Caren; Añez, Germán; Ball, Christopher; Winkelman, Valerie; Williamson, Phillip; Foster, Gregory A; Stramer, Susan L; Rios, Maria

2013-09-23

West Nile virus (WNV) appeared in the U.S. in 1999 and has since become endemic, with yearly summer epidemics causing tens of thousands of cases of serious disease over the past 14 years. Analysis of WNV strains isolated during the 2006-2007 epidemic seasons demonstrates that a new genetic variant had emerged coincidentally with an intense outbreak in Idaho during 2006. The isolates belonging to the new variant carry a 13 nt deletion, termed ID-Δ13, located at the variable region of the 3'UTR, and are genetically related. The analysis of deletions and insertions in the 3'UTR of two major lineages of WNV revealed the presence of conserved repeats and two indel motifs in the variable region of the 3'UTR. One human and two bird isolates from the Idaho 2006-2007 outbreaks were sequenced using Illumina technology and within-host variability was analyzed. Continued monitoring of new genetic variants is important for public health as WNV continues to evolve.

Isolation of novel variants of infectious bursal disease virus from different outbreaks in Northeast India.

PubMed

Morla, Sudhir; Deka, Pankaj; Kumar, Sachin

2016-04-01

Infectious bursal disease virus (IBDV) is a highly infectious disease of young chicken that predominantly affects the immune system. In the present study, we are reporting first comprehensive study of IBDV outbreaks from the Northeastern part of India. Northeast India shares a porous border with four different countries; and as a rule any outbreak in the neighboring countries substantially affects the poultry population in the adjoining states. Nucleotide sequence analysis of the VP2 gene of the IBDV isolates from the Northeastern part of India suggested the extreme virulent nature of the virus. The virulent marker amino acids (A222, I242, Q253, I256 and S299) in the hypervariable region of the Northeastern isolates were found identical with the reported very virulent strains of IBDV. A unique insertion of I/L294V was recorded in all the isolates of the Northeastern India. The study will be useful in understanding the circulating pathotypes of IBDV in India. Copyright © 2016 Elsevier Ltd. All rights reserved.

Improving TV Program Comprehensibility: Developmental Effects of Visual and Verbal Production Features.

ERIC Educational Resources Information Center

Calvert, Sandra L.; And Others

Preplays (critical material presented before a televised program) were inserted before three sections of a televised story to determine if they would improve children's attention and comprehension by providing overall plot structure for selecting and integrating important story events. The preplays varied on two orthogonal dimensions: presence or…

An Event-Level Comparison of Risk-Related Sexual Practices Between Black and Other-Race Men Who Have Sex with Men: Condoms, Semen, Lubricant, and Rectal Douching

PubMed Central

Rosenberger, Joshua G.; Schick, Vanessa R.; Novak, David S.; Reece, Michael

2013-01-01

Abstract Black men who have sex with men (MSM) living in the U.S. are disproportionately affected by HIV/AIDS. An online survey of sexual behavior was completed by Black, White, Hispanic/Latino, Asian/Pacific Islander, and other-race MSM (n=11,766) ages 18–87 years. Complete condom use, semen exposure, pre-coital rectal douching (enema use), and lubricant use at last male-partnered sexual event were compared by race, controlling for relevant sociodemographic variables and stratifying by sexual position (receptive, insertive, or both). Across sexual positions, 55–62% of Black MSM reported condom use, 5–8% reported semen exposure, 18–53% reported douching, and 33–43% reported lubricant use. Reported behavioral profiles were not significantly different from other races, except that Black MSM reported greater condom use than White MSM in the insertive position. Although findings argue against disproportionate rates of risk behavior accounting for racial disparities in HIV prevalence, they nonetheless highlight a need for continued behavioral intervention. PMID:23373663

Mars Pathfinder and Mars Global Surveyor Outreach Compilation

NASA Astrophysics Data System (ADS)

1999-09-01

This videotape is a compilation of the best NASA JPL (Jet Propulsion Laboratory) videos of the Mars Pathfinder and Mars Global Surveyor missions. The mission is described using animation and narration as well as some actual footage of the entire sequence of mission events. Included within these animations are the spacecraft orbit insertion; descent to the Mars surface; deployment of the airbags and instruments; and exploration by Sojourner, the Mars rover. JPL activities at spacecraft control during significant mission events are also included at the end. The spacecraft cameras pan the surrounding Mars terrain and film Sojourner traversing the surface and inspecting rocks. A single, brief, processed image of the Cydonia region (Mars face) at an oblique angle from the Mars Global Surveyor is presented. A description of the Mars Pathfinder mission, instruments, landing and deployment process, Mars approach, spacecraft orbit insertion, rover operation are all described using computer animation. Actual color footage of Sojourner as well as a 360 deg pan of the Mars terrain surrounding the spacecraft is provided. Lower quality black and white photography depicting Sojourner traversing the Mars surface and inspecting Martian rocks also is included.

Mars Pathfinder and Mars Global Surveyor Outreach Compilation

NASA Technical Reports Server (NTRS)

1999-01-01

This videotape is a compilation of the best NASA JPL (Jet Propulsion Laboratory) videos of the Mars Pathfinder and Mars Global Surveyor missions. The mission is described using animation and narration as well as some actual footage of the entire sequence of mission events. Included within these animations are the spacecraft orbit insertion; descent to the Mars surface; deployment of the airbags and instruments; and exploration by Sojourner, the Mars rover. JPL activities at spacecraft control during significant mission events are also included at the end. The spacecraft cameras pan the surrounding Mars terrain and film Sojourner traversing the surface and inspecting rocks. A single, brief, processed image of the Cydonia region (Mars face) at an oblique angle from the Mars Global Surveyor is presented. A description of the Mars Pathfinder mission, instruments, landing and deployment process, Mars approach, spacecraft orbit insertion, rover operation are all described using computer animation. Actual color footage of Sojourner as well as a 360 deg pan of the Mars terrain surrounding the spacecraft is provided. Lower quality black and white photography depicting Sojourner traversing the Mars surface and inspecting Martian rocks also is included.

Characterization of a naturally occurring recombinant isolate of Grapevine fanleaf virus.

PubMed

Vigne, E; Demangeat, G; Komar, V; Fuchs, M

2005-11-01

The naturally occurring Grapevine fanleaf virus (GFLV) recombinant isolate A17b was recovered from its grapevine host by sap inoculation and serial passages onto Gomphrena globosa, a pseudo local lesion herbaceous host, and Chenopodium quinoa, a systemic herbaceous host, to characterize some of its biological properties. Sequence analysis of the CP gene, in which a recombinational event was previously detected, demonstrated the genetic stability of recombinant isolate A17b over a 5-year period in its natural host as well as in C. quinoa. Also, recombinant isolate A17b was graft transmissible, as shown by an in vitro heterologous approach, and transmitted by the nematode Xiphinema index as readily as nonrecombinant GFLV isolates. Furthermore, despite a lower pathogenicity on Chenopodium amaranticolor, recombinant isolate A17b had a similar host range and induced similar symptoms in type and severity to nonrecombinant GFLV isolates. Interestingly, the use of infectious chimeric RNA2 transcripts in combination to RNA1 transcripts of GFLV strain F13 suggested no implication of the recombination event in the CP gene of isolate A17b in the reduced pathogenicity on C. amaranticolor. Altogether, recombinant isolate A17b had similar biological properties to GFLV nonrecombinant isolates.

Hepatitis C virus genotypes in Singapore and Indonesia.

PubMed

Ng, W C; Guan, R; Tan, M F; Seet, B L; Lim, C A; Ngiam, C M; Sjaifoellah Noer, H M; Lesmana, L

1995-01-01

5' untranslated and partial core (C) region sequence of hepatitis C virus (HCV) in 21 Singaporean and 15 Indonesian isolates were amplified by reverse-transcription polymerase chain reaction and sequenced with the use of conserved primer sequences deduced from HCV genomes identified in other geographical regions. The HCV genotypes are predominantly that of Simmonds type 1 and less of type 2 and 3 with the latter genotype currently not detected in Indonesia. The 5' untranslated sequences are related to HCV-1. DK-7 (Denmark), US-11 (United States of America), HCV-J4, SA-10 (South Africa), T-3 (Taiwan), HCV-J6, HCV-J8, Eb-1 and Eb-8. When compared with the prototype HCV-1, insertions are found within the 5' untranslated region of Singaporean isolates and not in the Indonesians. There are Singaporean and Indonesian isolates that have sequences within the 5' untranslated region that differ slightly from each other. Microheterogeneity is observed in the core region of two Singaporeans and one Indonesian isolate. Finally, not all HCV isolates can be amplified with the conserved core sequence primers when compared with the ease with which these isolates can be amplified with 5' untranslated region conserved primers.

Occurrence and characterization of hitherto unknown Streptomyces species in semi-arid soils.

PubMed

Kumar, Surendra; Priya, E; Singh Solanki, Dilip; Sharma, Ruchika; Gehlot, Praveen; Pathak, Rakesh; Singh, S K

2016-09-01

Streptomyces the predominant genus of Actinobacteria and plays an important role in the recycling of soil organic matter and production of important secondary metabolites. The occurrence and diversity assessment of Streptomyces species revealed alkaline and poor nutrient status of soils of semi-arid region of Jodhpur, Rajasthan. The morphological and biochemical characterization of 21 Streptomyces isolates facilitated Genus level identification but were insufficient to designate species. Species designation based on 16S rRNA gene delineated 21 isolates into 14 Streptomyces species. Upon BLAST search, the test isolates exhibited 98 to 100% identities with that of the best aligned sequences of the NCBI database. The GC content of 16S rRNA gene sequences of all the Streptomyces isolates tested ranged from 59.03% to 60.94%. The multiple sequence alignment of all the 21 Streptomyces isolates generated a phylogram with high bootstrap values indicating reliable grouping of isolates based on nucleotide sequence variations by way of insertion, deletion and substitutions and 16S rRNA length polymorphism. Some of the Streptomyces species molecularly identified under present study are reported for the first time from semi-arid region of Jodhpur.

How to use Gagne's model of instructional design in teaching psychomotor skills

PubMed Central

Rostami, Kamran; Ishaq, Sauid

2011-01-01

Gagne's model of instructional design is based on the information processing model of the mental events that occur when adults are presented with various stimuli and focuses on the learning outcomes and how to arrange specific instructional events to achieve those outcomes. Applying Gagne's nine-step model is an excellent way to ensure an effective and systematic learning program as it gives structure to the lesson plans and a holistic view to the teaching. In this paper, we have chosen a routine practical procedure that junior doctors need to learn: insertion of a peritoneal (ascitic) drain and we use Gagne's “events of instruction” to design a lesson plan for this subject. PMID:24834168

How to use Gagne's model of instructional design in teaching psychomotor skills.

PubMed

Khadjooi, Kayvan; Rostami, Kamran; Ishaq, Sauid

2011-01-01

Gagne's model of instructional design is based on the information processing model of the mental events that occur when adults are presented with various stimuli and focuses on the learning outcomes and how to arrange specific instructional events to achieve those outcomes. Applying Gagne's nine-step model is an excellent way to ensure an effective and systematic learning program as it gives structure to the lesson plans and a holistic view to the teaching. In this paper, we have chosen a routine practical procedure that junior doctors need to learn: insertion of a peritoneal (ascitic) drain and we use Gagne's "events of instruction" to design a lesson plan for this subject.

Analysis of the K1 capsule biosynthesis genes of Escherichia coli: definition of three functional regions for capsule production.

PubMed

Boulnois, G J; Roberts, I S; Hodge, R; Hardy, K R; Jann, K B; Timmis, K N

1987-06-01

Transposon and deletion analysis of the cloned K1 capsule biosynthesis genes of Escherichia coli revealed that approximately 17 kb of DNA, split into three functional regions, is required for capsule production. One block (region 1) is required for translocation of polysaccharide to the cell surface and mutations in this region result in the intracellular appearance of polymer indistinguishable on immunoelectrophoresis to that found on the surface of K1 encapsulated bacteria. This material was released from the cell by osmotic shock indicating that the polysaccharide was probably present in the periplasmic space. Insertions in a second block (region 2) completely abolished polymer production and this second region is believed to encode the enzymes for the biosynthesis and polymerisation of the K1 antigen. Addition of exogenous N-acetylneuraminic acid to one insertion mutant in this region restored its ability to express surface polymer as judged by K1 phage sensitivity. This insertion probably defines genes involved in biosynthesis of N-acetylneuraminic acid. Insertions in a third block (region 3) result in the intracellular appearance of polysaccharide with a very low electrophoretic mobility. The presence of the cloned K1 capsule biosynthesis genes on a multicopy plasmid in an E. coli K-12 strain did not increase the yields of capsular polysaccharide produced compared to the K1+ isolate from which the genes were cloned.

pTC Plasmids from Sulfolobus Species in the Geothermal Area of Tengchong, China: Genomic Conservation and Naturally-Occurring Variations as a Result of Transposition by Mobile Genetic Elements

PubMed Central

Xiang, Xiaoyu; Huang, Xiaoxing; Wang, Haina; Huang, Li

2015-01-01

Plasmids occur frequently in Archaea. A novel plasmid (denoted pTC1) containing typical conjugation functions has been isolated from Sulfolobus tengchongensis RT8-4, a strain obtained from a hot spring in Tengchong, China, and characterized. The plasmid is a circular double-stranded DNA molecule of 20,417 bp. Among a total of 26 predicted pTC1 ORFs, 23 have homologues in other known Sulfolobus conjugative plasmids (CPs). pTC1 resembles other Sulfolobus CPs in genome architecture, and is most highly conserved in the genomic region encoding conjugation functions. However, attempts to demonstrate experimentally the capacity of the plasmid for conjugational transfer were unsuccessful. A survey revealed that pTC1 and its closely related plasmid variants were widespread in the geothermal area of Tengchong. Variations of the plasmids at the target sites for transposition by an insertion sequence (IS) and a miniature inverted-repeat transposable element (MITE) were readily detected. The IS was efficiently inserted into the pTC1 genome, and the inserted sequence was inactivated and degraded more frequently in an imprecise manner than in a precise manner. These results suggest that the host organism has evolved a strategy to maintain a balance between the insertion and elimination of mobile genetic elements to permit genomic plasticity while inhibiting their fast spreading. PMID:25686154

pTC Plasmids from Sulfolobus Species in the Geothermal Area of Tengchong, China: Genomic Conservation and Naturally-Occurring Variations as a Result of Transposition by Mobile Genetic Elements.

PubMed

Xiang, Xiaoyu; Huang, Xiaoxing; Wang, Haina; Huang, Li

2015-02-12

Plasmids occur frequently in Archaea. A novel plasmid (denoted pTC1) containing typical conjugation functions has been isolated from Sulfolobus tengchongensis RT8-4, a strain obtained from a hot spring in Tengchong, China, and characterized. The plasmid is a circular double-stranded DNA molecule of 20,417 bp. Among a total of 26 predicted pTC1 ORFs, 23 have homologues in other known Sulfolobus conjugative plasmids (CPs). pTC1 resembles other Sulfolobus CPs in genome architecture, and is most highly conserved in the genomic region encoding conjugation functions. However, attempts to demonstrate experimentally the capacity of the plasmid for conjugational transfer were unsuccessful. A survey revealed that pTC1 and its closely related plasmid variants were widespread in the geothermal area of Tengchong. Variations of the plasmids at the target sites for transposition by an insertion sequence (IS) and a miniature inverted-repeat transposable element (MITE) were readily detected. The IS was efficiently inserted into the pTC1 genome, and the inserted sequence was inactivated and degraded more frequently in an imprecise manner than in a precise manner. These results suggest that the host organism has evolved a strategy to maintain a balance between the insertion and elimination of mobile genetic elements to permit genomic plasticity while inhibiting their fast spreading.

Coping with Unexpected Events: Depression and Trauma

MedlinePlus

... indifference Inability to concentrate Recurring memories or bad dreams about the event Social withdrawal, isolation, strained personal ... Continually re-experiencing the event (“flashbacks”) through images, dreams, and/or a sense of re-living the ...

Chromosomal Amplification of the blaOXA-58 Carbapenemase Gene in a Proteus mirabilis Clinical Isolate.

PubMed

Girlich, Delphine; Bonnin, Rémy A; Bogaerts, Pierre; De Laveleye, Morgane; Huang, Daniel T; Dortet, Laurent; Glaser, Philippe; Glupczynski, Youri; Naas, Thierry

2017-02-01

Horizontal gene transfer may occur between distantly related bacteria, thus leading to genetic plasticity and in some cases to acquisition of novel resistance traits. Proteus mirabilis is an enterobacterial species responsible for human infections that may express various acquired β-lactam resistance genes, including different classes of carbapenemase genes. Here we report a Proteus mirabilis clinical isolate (strain 1091) displaying resistance to penicillin, including temocillin, together with reduced susceptibility to carbapenems and susceptibility to expanded-spectrum cephalosporins. Using biochemical tests, significant carbapenem hydrolysis was detected in P. mirabilis 1091. Since PCR failed to detect acquired carbapenemase genes commonly found in Enterobacteriaceae, we used a whole-genome sequencing approach that revealed the presence of bla OXA-58 class D carbapenemase gene, so far identified only in Acinetobacter species. This gene was located on a 3.1-kb element coharboring a bla AmpC -like gene. Remarkably, these two genes were bracketed by putative XerC-XerD binding sites and inserted at a XerC-XerD site located between the terminase-like small- and large-subunit genes of a bacteriophage. Increased expression of the two bla genes resulted from a 6-time tandem amplification of the element as revealed by Southern blotting. This is the first isolation of a clinical P. mirabilis strain producing OXA-58, a class D carbapenemase, and the first description of a XerC-XerD-dependent insertion of antibiotic resistance genes within a bacteriophage. This study revealed a new role for the XerC-XerD recombinase in bacteriophage biology. Copyright © 2017 American Society for Microbiology.

Chromosomal Amplification of the blaOXA-58 Carbapenemase Gene in a Proteus mirabilis Clinical Isolate

PubMed Central

Girlich, Delphine; Bogaerts, Pierre; De Laveleye, Morgane; Huang, Daniel T.; Glupczynski, Youri

2016-01-01

ABSTRACT Horizontal gene transfer may occur between distantly related bacteria, thus leading to genetic plasticity and in some cases to acquisition of novel resistance traits. Proteus mirabilis is an enterobacterial species responsible for human infections that may express various acquired β-lactam resistance genes, including different classes of carbapenemase genes. Here we report a Proteus mirabilis clinical isolate (strain 1091) displaying resistance to penicillin, including temocillin, together with reduced susceptibility to carbapenems and susceptibility to expanded-spectrum cephalosporins. Using biochemical tests, significant carbapenem hydrolysis was detected in P. mirabilis 1091. Since PCR failed to detect acquired carbapenemase genes commonly found in Enterobacteriaceae, we used a whole-genome sequencing approach that revealed the presence of blaOXA-58 class D carbapenemase gene, so far identified only in Acinetobacter species. This gene was located on a 3.1-kb element coharboring a blaAmpC-like gene. Remarkably, these two genes were bracketed by putative XerC-XerD binding sites and inserted at a XerC-XerD site located between the terminase-like small- and large-subunit genes of a bacteriophage. Increased expression of the two bla genes resulted from a 6-time tandem amplification of the element as revealed by Southern blotting. This is the first isolation of a clinical P. mirabilis strain producing OXA-58, a class D carbapenemase, and the first description of a XerC-XerD-dependent insertion of antibiotic resistance genes within a bacteriophage. This study revealed a new role for the XerC-XerD recombinase in bacteriophage biology. PMID:27855079

Alu polymorphisms in the Waorani tribe from the Ecuadorian Amazon reflect the effects of isolation and genetic drift.

PubMed

Gómez-Pérez, Luis; Alfonso-Sánchez, Miguel A; Sánchez, Dora; García-Obregón, Susana; Espinosa, Ibone; Martínez-Jarreta, Begoña; De Pancorbo, Marian M; Peña, José A

2011-01-01

The Amazon basin is inhabited by some of the most isolated human groups worldwide. Among them, the Waorani tribe is one of the most interesting Native American populations from the anthropological perspective. This study reports a genetic characterization of the Waorani based on autosomal genetic loci. We analyzed 12 polymorphic Alu insertions in 36 Waorani individuals from different communal longhouses settled in the Yasuní National Park. The most notable finding was the strikingly reduced genetic diversity detected in the Waorani, corroborated by the existence of four monomorphic loci (ACE, APO, FXIIIB, and HS4.65), and of other four Alu markers that were very close to the fixation for the presence (PV92 and D1) or the absence (A25 and HS4.32) of the insertion. Furthermore, results of the centroid analysis supported the notion of the Waorani being one of the Amerindian groups less impacted by gene flow processes. The prolonged isolation of the Waorani community, in conjunction with a historically low effective population size and high inbreeding levels, have resulted in the drastic reduction of their genetic diversity, because of the effects of severe genetic drift. Recurrent population bottlenecks most likely determined by certain deep-rooted sociocultural practices of the Waorani (characterized by violence, internal quarrels, and revenge killings until recent times) are likely responsible for this pattern of diversity. The findings of this study illustrate how sociocultural factors can shape the gene pool of human populations. Copyright © 2011 Wiley-Liss, Inc.

Prevention of meticillin-resistant Staphylococcus aureus bloodstream infections in European hospitals: moving beyond policies.

PubMed

Borg, M A; Hulscher, M; Scicluna, E A; Richards, J; Azanowsky, J-M; Xuereb, D; Huis, A; Moro, M L; Maltezou, H C; Frank, U

2014-08-01

There is evidence that meticillin-resistant Staphylococcus aureus (MRSA) bacteraemia can be reduced with improved infection control and antibiotic stewardship. To survey infection control and antibiotic stewardship practices within European hospitals and to identify initiatives that correlate with reduced MRSA prevalence. Online questionnaires were sent to European hospitals about their surveillance, hand hygiene, intravenous device management, admission screening, isolation, antibiotic prescribing, hospital demographics and MRSA blood culture isolates during 2010. In all, 269 replies were received from hospitals in 29 European countries. Lower MRSA prevalence showed significant association with presence of incidence surveillance, performance of root cause analysis, mandatory training requirements for hand hygiene, accountability measures for persistent non-compliance, and multi-stakeholder teamwork in antibiotic prescribing. Presence of policies on intravenous catheter insertion and management showed no variation between different MRSA prevalence groups. However, low-prevalence hospitals reported more competency assessment programmes in insertion and maintenance of peripheral and central venous catheters. Hospitals from the UK and Ireland reported the highest uptake of infection control and antibiotic stewardship practices that were significantly associated with low MRSA prevalence, whereas Southern European hospitals exhibited the lowest. In multiple regression analysis, isolation of high-risk patients, performance of root cause analysis, obligatory training for nurses in hand hygiene, and undertaking joint ward rounds including microbiologists and infectious disease physicians remained significantly associated with lower MRSA prevalence. Proactive infection control and antibiotic stewardship initiatives that instilled accountability, ownership, teamwork, and validated competence among healthcare workers were associated with improved MRSA outcomes. Copyright © 2014 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

Genome analysis of a clinical isolate of Shewanella sp. uncovered an active hybrid integrative and conjugative element carrying an integron platform inserted in a novel genomic locus.

PubMed

Parmeciano Di Noto, Gisela; Jara, Eugenio; Iriarte, Andrés; Centrón, Daniela; Quiroga, Cecilia

2016-08-01

Shewanella spp. are currently considered to be emerging pathogens that can code for a blaOXA carbapenemase in their chromosome. Complete genome analysis of the clinical isolate Shewanella sp. Sh95 revealed that this strain is a novel species, which shares a lineage with marine isolates. Characterization of its resistome showed that it codes for genes drfA15, qacH and blaOXA-48. We propose that Shewanella sp. Sh95 acts as reservoir of blaOXA-48. Moreover, analysis of mobilome showed that it contains a novel integrative and conjugative element (ICE), named ICESh95. Comparative analysis between the close relatives ICESpuPO1 from Shewanella sp. W3-18-1 and ICE SXTMO10 from Vibrio cholerae showed that ICESh95 encompassed two new regions, a type III restriction modification system and a multidrug resistance integron. The integron platform contained a novel arrangement formed by gene cassettes drfA15 and qacH, and a class C-attC group II intron. Furthermore, insertion of ICESh95 occurred at a unique target site, which correlated with the presence of a different xis/int module. Mobility of ICESh95 was assessed and demonstrated its ability to self-transfer with high efficiency to different species of bacteria. Our results show that ICESh95 is a self-transmissible, mobile element, which can contribute to the dissemination of antimicrobial resistance; this is clearly a threat when natural bacteria from water ecosystems, such as Shewanella, act as vectors in its propagation.

Peripheral Venous Catheter-Related Adverse Events: Evaluation from a Multicentre Epidemiological Study in France (the CATHEVAL Project)

PubMed Central

Miliani, Katiuska; Taravella, Raphaël; Thillard, Denis; Chauvin, Valérie; Martin, Emmanuelle; Edouard, Stéphanie; Astagneau, Pascal

2017-01-01

Introduction Peripheral venous catheters (PVC) are medical devices most frequently used during hospital care. Although the frequency of specific PVC-related adverse events (PVCAEs) has been reported, the global risk related to the insertion of this device is poorly estimated. The aim of this study is to determine the incidence of PVCAEs during the indwell time, after catheter removal, and to identify practice-mirroring risk factors. Methods A prospective observational study was conducted as a part of a research project, called CATHEVAL, in one surgery ward and four medicine wards from three public general tertiary care hospitals in Northern France that were invited to participate between June-2013 and June-2014. Each participating ward included during a two-month study period all patients older than 15 years carrying a PVC. All inserted PVCs were monitored from insertion of PVC to up to 48 hours after removal. Monitored data included several practice-mirroring items, as well as the occurrence of at least one PVCAE. A multivariate Cox proportional hazard model, based on a marginal risk approach, was used to identify factors associated with the occurrence of at least one PVCAE. Results Data were analysed for 815 PVCs (1964 PVC-days) in 573 patients. The incidence of PVCAE was 52.3/100 PVCs (21.9/100 PVC-days). PVCAEs were mainly clinical: phlebitis (20.1/100 PVCs), haematoma (17.7/100 PVCs) and liquid/blood escape (13.1/100 PVCs). Infections accounted for only 0.4/100 PVCs. The most frequent mechanical PVCAEs, was obstruction/occlusion of PVC (12.4/100 PVCs). The incidence of post-removal PVCAEs was 21.7/100 PVCs. Unstable PVC and unclean dressing were the two main risk factors. Conclusion Limitation of breaches in healthcare quality including post-removal monitoring should be reinforced to prevent PVC-related adverse events in hospital settings. PMID:28045921

Biomimetic materials for protein storage and transport

DOEpatents

Firestone, Millicent A [Elmhurst, IL; Laible, Philip D [Villa Park, IL

2012-05-01

The invention provides a method for the insertion of protein in storage vehicles and the recovery of the proteins from the vehicles, the method comprising supplying isolated protein; mixing the isolated protein with a fluid so as to form a mixture, the fluid comprising saturated phospholipids, lipopolymers, and a surfactant; cycling the mixture between a first temperature and a second temperature; maintaining the mixture as a solid for an indefinite period of time; diluting the mixture in detergent buffer so as to disrupt the composition of the mixture, and diluting to disrupt the fluid in its low viscosity state for removal of the guest molecules by, for example, dialysis, filtering or chromatography dialyzing/filtering the emulsified solid.

Aminoglycoside acetyltransferase 3-IV (aacC4) and hygromycin B 4-I phosphotransferase (hphB) in bacteria isolated from human and animal sources.

PubMed

Salauze, D; Otal, I; Gomez-Lus, R; Davies, J

1990-10-01

Members of the family Enterobacteriaceae harboring an enzyme of the aminoglycoside acetyltransferase 3 class (AAC-3-IV) (apramycin and gentamicin resistance) and hygromycin B phosphotransferase 4 (HPH-4-I) (hygromycin B resistance) have been isolated from human clinical sources in Europe. A cluster of genes containing IS140, aacC4, and hphB was found in these strains. We demonstrate by Southern hybridization that this cluster is identical to the operon found in animals that also contains insertion sequences belonging to the ISO family. This provides another example of presumptive transfer of antibiotic resistance genes between bacteria of animal and human origin.

On-Chip Optical Nonreciprocity Using an Active Microcavity

PubMed Central

Jiang, Xiaoshun; Yang, Chao; Wu, Hongya; Hua, Shiyue; Chang, Long; Ding, Yang; Hua, Qian; Xiao, Min

2016-01-01

Optically nonreciprocal devices provide critical functionalities such as light isolation and circulation in integrated photonic circuits for optical communications and information processing, but have been difficult to achieve. By exploring gain-saturation nonlinearity, we demonstrate on-chip optical nonreciprocity with excellent isolation performance within telecommunication wavelengths using only one toroid microcavity. Compatible with current complementary metal-oxide-semiconductor process, our compact and simple scheme works for a very wide range of input power levels from ~10 microwatts down to ~10 nanowatts, and exhibits remarkable properties of one-way light transport with sufficiently low insertion loss. These superior features make our device become a promising critical building block indispensable for future integrated nanophotonic networks. PMID:27958356

Isolation of Mycobacterium avium subspecies paratuberculosis from non-ruminant wildlife living in the sheds and on the pastures of Greek sheep and goats

PubMed Central

FLOROU, M.; LEONTIDES, L.; KOSTOULAS, P.; BILLINIS, C.; SOFIA, M.; KYRIAZAKIS, I.; LYKOTRAFITIS, F.

2008-01-01

SUMMARY This study aimed to: (1) investigate whether non-ruminant wildlife interfacing with dairy sheep and goats of four Greek flocks endemically infected with Mycobacterium avium subspecies paratuberculosis (MAP) harboured MAP and (2) genetically compare the strains isolated from the wildlife to those isolated from the small ruminants of these flocks. We cultured and screened, by polymerase chain reaction (PCR), pooled-tissue samples from 327 wild animals of 11 species for the MAP-specific IS900 insertion sequence. We also cultured faecal samples from 100 sheep or goats from each of the four flocks. MAP was detected in samples from 11 sheep, 12 goats, two mice, two rats, a hare and a fox. Only one rat had histopathological findings. Genetic typing categorized 21 isolates as cattle-type strains and two, from a house mouse and a goat respectively, as sheep-type strains; this is the first report of a rodent harbouring a sheep-type strain. The MAP types that were most frequently isolated amongst the sheep and goats of each flock were also the ones isolated from sympatric rodents; those isolated from the fox and hare also belonged to the predominant ruminant strains. PMID:17578601

Genomic Characteristics of Bifidobacterium thermacidophilum Pig Isolates and Wild Boar Isolates Reveal the Unique Presence of a Putative Mobile Genetic Element with tetW for Pig Farm Isolates

PubMed Central

Tsuchida, Sayaka; Maruyama, Fumito; Ogura, Yoshitoshi; Toyoda, Atsushi; Hayashi, Tetsuya; Okuma, Moriya; Ushida, Kazunari

2017-01-01

Genomic analysis was performed on seven strains of Bifidobacterium thermacidophilum, a Sus-associated Bifidobacterium. Three strains from the feces of domestic pigs (Sus scrofa domesticus) and four strains from the rectal feces of free-range Japanese wild boars (S. s. scrofa) were compared. The phylogenetic position of these isolates suggested by genomic analyses were not concordant with that suggested by 16S rRNA sequence. There was biased distribution of genes for virulence, phage, metabolism of aromatic compounds, iron acquisition, cell division, and DNA metabolism. In particular four wild boar isolates harbored fiber-degrading enzymes, such as endoglucanase, while two of the pig isolates obtained from those grown under an intensive feeding practice with routine use of antimicrobials, particularly tetracycline harbored a tetracycline resistance gene, which was further proved functional by disk diffusion test. The tetW gene is associated with a serine recombinase of an apparently non-bifidobacterial origin. The insertion site of the tetW cassette was precisely defined by analyzing the corresponding genomic regions in the other tetracycline-susceptible isolates. The cassette may have been transferred from some other bacteria in the pig gut. PMID:28861055

Isolation of mitochondria from Saccharomyces cerevisiae using magnetic bead affinity purification

PubMed Central

Liao, Pin-Chao; Boldogh, Istvan R.; Siegmund, Stephanie E.

2018-01-01

Isolated mitochondria are widely used to study the function of the organelle. Typically, mitochondria are prepared using differential centrifugation alone or in conjunction with density gradient ultracentrifugation. However, mitochondria isolated using differential centrifugation contain membrane or organelle contaminants, and further purification of crude mitochondria by density gradient ultracentrifugation requires large amounts of starting material, and is time-consuming. Mitochondria have also been isolated by irreversible binding to antibody-coated magnetic beads. We developed a method to prepare mitochondria from budding yeast that overcomes many of the limitations of other methods. Mitochondria are tagged by insertion of 6 histidines (6xHis) into the TOM70 (Translocase of outer membrane 70) gene at its chromosomal locus, isolated using Ni-NTA (nickel (II) nitrilotriacetic acid) paramagnetic beads and released from the magnetic beads by washing with imidazole. Mitochondria prepared using this method contain fewer contaminants, and are similar in ultrastructure as well as protein import and cytochrome c oxidase complex activity compared to mitochondria isolated by differential centrifugation. Moreover, this isolation method is amenable to small samples, faster than purification by differential and density gradient centrifugation, and more cost-effective than purification using antibody-coated magnetic beads. Importantly, this method can be applied to any cell type where the genetic modification can be introduced by CRISPR or other methods. PMID:29698455

Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates.

PubMed

Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

2015-07-01

Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains.

Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates

PubMed Central

Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

2015-01-01

Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains. PMID:26130851

Mars Observer Lecture: Mars Orbit Insertion

NASA Technical Reports Server (NTRS)

Dodd, Suzanne R. (Personal Name)

1993-01-01

The Mars Observer mission spacecraft was primarily designed for exploring Mars and the Martian environment. The Mars Observer was launched on September 25, 1992. The spacecraft was lost in the vicinity of Mars on August 21, 1993 when the spacecraft began its maneuvering sequence for Martian orbital insertion. This videotape shows a lecture by Suzanne R. Dodd, the Mission Planning Team Chief for the Mars Observer Project. Ms Dodd begins with a brief overview of the mission and the timeline from the launch to orbital insertion. Ms Dodd then reviews slides showing the trajectory of the spacecraft on its trip to Mars. Slides of the spacecraft being constructed are also shown. She then discusses the Mars orbit insertion and the events that will occur to move the spacecraft from the capture orbit into a mapping orbit. During the trip to Mars, scientists at JPL had devised a new strategy, called Power In that would allow for an earlier insertion into the mapping orbit. The talk summarizes this strategy, showing on a slide the planned transition orbits. There are shots of the Martian moon, Phobos, taken from the Viking spacecraft, as Ms Dodd explains that the trajectory will allow the orbiter to make new observations of that moon. She also explains the required steps to prepare for mapping after the spacecraft has achieved the mapping orbit around Mars. The lecture ends with a picture of Mars from the Observer on its approach to the planet.

Whole genome analyses of marine fish pathogenic isolate, Mycobacterium sp. 012931.

PubMed

Kurokawa, Satoru; Kabayama, Jun; Hwang, Seong Don; Nho, Seong Won; Hikima, Jun-ichi; Jung, Tae Sung; Kondo, Hidehiro; Hirono, Ikuo; Takeyama, Haruko; Mori, Tetsushi; Aoki, Takashi

2014-10-01

Mycobacterium is a genus within the order Actinomycetales that comprises of a large number of well-characterized species, several of which includes pathogens known to cause serious disease in human and animal. Here, we report the whole genome sequence of Mycobacterium sp. strain 012931 isolated from the marine fish, yellowtail (Seriola quinqueradiata). Mycobacterium sp. 012931 is a fish pathogen causing serious damage to aquaculture farms in Japan. DNA dot plot analysis showed that Mycobacterium sp. 012931 was more closely related to Mycobacterium marinum when compared across several Mycobacterium species. However, little conservation of the gene order was observed between Mycobacterium sp. 012931 and M. marinum genome. The annotated 5,464 genes of Mycobacterium sp. 012931 was classified into 26 subsystems. The insertion/deletion gene analysis shows Mycobacterium sp. 012931 had 643 unique genes that were not found in the M. marinum strains. In the virulence, disease, and defense subsystem, both insertion and deletion genes of Mycobacterium sp. 012931 were associated with the PPE gene cluster of Mycobacteria. Of seven plcB genes in Mycobacterium sp. 012931, plcB_2 and plcB_3 showed low identities with those of M. marinum strains. Therefore, Mycobacterium sp. 012931 has differences on genetic and virulence from M. marinum and may induce different interaction mechanisms between host and pathogen.

Phyllobacterium loti sp. nov. isolated from nodules of Lotus corniculatus

PubMed Central

Sánchez, Maximo; Ramírez-Bahena, Martha-Helena; Peix, Alvaro; Lorite, María J.; Sanjuán, Juan; Monza, Jorge

2014-01-01

Strain S658T was isolated from a Lotus corniculatus nodule in a soil sample obtained in Uruguay. Phylogenetic analysis of the 16S rRNA gene and atpD gene showed that this strain clustered within the genus Phyllobacterium. The closest related species was, in both cases, Phyllobacterium trifolii PETP02T with 99.8 % sequence similarity in the 16S rRNA gene and 96.1 % in the atpD gene. The 16S rRNA gene contains an insert at the beginning of the sequence that has no similarities with other inserts present in the same gene in described rhizobial species. Ubiquinone Q-10 was the only quinone detected. Strain S658T differed from its closest relatives through its growth in diverse culture conditions and in the assimilation of several carbon sources. It was not able to reproduce nodules in Lotus corniculatus. The results of DNA–DNA hybridization, phenotypic tests and fatty acid analyses confirmed that this strain should be classified as a representative of a novel species of the genus Phyllobacterium, for which the name Phyllobacterium loti sp. nov. is proposed. The type strain is S658T( = LMG 27289T = CECT 8230T). PMID:24271211

Isolation, characterization, and complementation of a motility mutant of Spiroplasma citri.

PubMed Central

Jacob, C; Nouzières, F; Duret, S; Bové, J M; Renaudin, J

1997-01-01

The helical mollicute Spiroplasma citri, when growing on low-agar medium, forms fuzzy colonies with occasional surrounding satellite colonies due to the ability of the spiroplasmal cells to move through the agar matrix. In liquid medium, these helical organisms flex, twist, and rotate rapidly. By using Tn4001 insertion mutagenesis, a motility mutant was isolated on the basis of its nondiffuse, sharp-edged colonies. Dark-field microscopy observations revealed that the organism flexed at a low frequency and had lost the ability to rotate about the helix axis. In this mutant, the transposon was shown to be inserted into an open reading frame encoding a putative polypeptide of 409 amino acids for which no significant homology with known proteins was found. The corresponding gene, named scm1, was recovered from the wild-type strain and introduced into the motility mutant by using the S. citri oriC plasmid pBOT1 as the vector. The appearance of fuzzy colonies and the observation that spiroplasma cells displayed rotatory and flexional movements showed the motile phenotype to be restored in the spiroplasmal transformants. The functional complementation of the motility mutant proves the scm1 gene product to be involved in the motility mechanism of S. citri. PMID:9244268

Self-inflicted foreign bodies in lower genitourinary tract in males: Our experience and review of literature

PubMed Central

Mahadevappa, Nagabhushana; Kochhar, Gaurav; Vilvapathy, Karthikeyan Senguttuvan; Dharwadkar, Sachin; Kumar, Sumit

2016-01-01

Objectives: To study retrospectively the frequency, demographic, phenomenological, and psychiatric profile in patients presented with self-insertion of foreign bodies in the lower genitourinary tract in our institute. Materials and Methods: From January 2009 to 2015, the records of patients admitted with self-insertion of foreign bodies into the lower urinary tract were analyzed retrospectively regarding demographic and phenomenological profile, the mode of presentation, diagnosis, management, complications, and possible contributing factors leading to the event. Results: Out of 17,978 inpatients, ten patients (0.055%) presented with foreign body insertion in the lower genitourinary tract in last 6 years. Mean age was 28.1 ± 13.9 (7–50) years. Objects used for insertion were varied from seeds, twigs to the electric wire. The contributing factors were lack of partner, misconception about masturbation, and underlying psychiatric illness. The presenting symptoms were pain and swelling of the penis, difficulty in voiding, and skin ulceration. The diagnosis was possible by simple observation in four patients, X-ray kidney, ureter, and bladder, and sonography of the pelvis in six patients. Five patients had endoscopic retrieval of foreign body, 2 had an open, suprapubic cystotomy, urethrotomy was needed in one patient, and forceps removal in two patients. There were no postoperative complications. Psychiatric profile was evaluated in nine patients. Conclusions: Foreign body insertion to lower urinary tract was rare. A main cause for insertion of foreign bodies was autoerotism, misconceptions regarding masturbation, and underlying psychiatric illness. In addition to suitable method of surgical removal, counseling and psychiatric evaluation are necessary to prevent recurrences or for early detection of psychiatric problems. PMID:27453657

Evolutionary force of AT-rich repeats to trap genomic and episomal DNAs into the rice genome: lessons from endogenous pararetrovirus.

PubMed

Liu, Ruifang; Koyanagi, Kanako O; Chen, Sunlu; Kishima, Yuji

2012-12-01

In plant genomes, the incorporation of DNA segments is not a common method of artificial gene transfer. Nevertheless, various segments of pararetroviruses have been found in plant genomes in recent decades. The rice genome contains a number of segments of endogenous rice tungro bacilliform virus-like sequences (ERTBVs), many of which are present between AT dinucleotide repeats (ATrs). Comparison of genomic sequences between two closely related rice subspecies, japonica and indica, allowed us to verify the preferential insertion of ERTBVs into ATrs. In addition to ERTBVs, the comparative analyses showed that ATrs occasionally incorporate repeat sequences including transposable elements, and a wide range of other sequences. Besides the known genomic sequences, the insertion sequences also represented DNAs of unclear origins together with ERTBVs, suggesting that ATrs have integrated episomal DNAs that would have been suspended in the nucleus. Such insertion DNAs might be trapped by ATrs in the genome in a host-dependent manner. Conversely, other simple mono- and dinucleotide sequence repeats (SSR) were less frequently involved in insertion events relative to ATrs. Therefore, ATrs could be regarded as hot spots of double-strand breaks that induce non-homologous end joining. The insertions within ATrs occasionally generated new gene-related sequences or involved structural modifications of existing genes. Likewise, in a comparison between Arabidopsis thaliana and Arabidopsis lyrata, the insertions preferred ATrs to other SSRs. Therefore ATrs in plant genomes could be considered as genomic dumping sites that have trapped various DNA molecules and may have exerted a powerful evolutionary force. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

Novel mutants of Erwinia carotovora subsp. carotovora defective in the production of plant cell wall degrading enzymes generated by Mu transpososome-mediated insertion mutagenesis.

PubMed

Laasik, Eve; Ojarand, Merli; Pajunen, Maria; Savilahti, Harri; Mäe, Andres

2005-02-01

As in Erwinia carotovora subsp. carotovora the regulation details of the main virulence factors, encoding extracellular enzymes that degrade the plant cell wall, is only rudimentally understood, we performed a genetic screen to identify novel candidate genes involved in the process. Initially, we used Mu transpososome-mediated mutagenesis approach to generate a comprehensive transposon insertion mutant library of ca. 10000 clones and screened the clones for the loss of extracellular enzyme production. Extracellular enzymes production was abolished by mutations in the chromosomal helEcc, trkAEcc yheLEcc, glsEcc, igaAEcc and cysQEcc genes. The findings reported here demonstrate that we have isolated six new representatives that belong to the pool of genes modulating the production of virulence factors in E. carotovora.

Holding Area LINQ Trial (HALT).

PubMed

Lee, John J; Weitz, Daniel; Anand, Rishi

Recent studies have shown that insertable cardiac monitors (ICMs) can be implanted out of the traditional hospital setting and efforts are being made to explore the feasibility of implanting these devices in a specific standardized location other than the operating room or a cardiac catherization/electrophysiology lab. This was a prospective, non-randomized, single center post-market clinical trial designed to occur in the holding area of a hospital operating room or cardiac catheterization/electrophysiology laboratory. The Medtronic Reveal LINQ ICM was implanted and patients were followed for 90 days post implant. This study was designed to observe any procedure related adverse events stemming from the holding area implantation. Twenty patients were implanted at our hospital in a holding room not traditionally associated with the electrophysiology/cardiac/operatory labs. One patient was lost to the 90-day follow up. In one case, ICM implantation led to diagnosis requiring removal of ICM before the 90 day follow up and insertion of a biventricular implantable cardioverter defibrillator (ICD). In the remaining 18 patients, there were no serious complications such as minor skin infections, systemic infections or procedure-related adverse events requiring device explant. When following a standardized protocol with attention to sterile technique, it is feasible to implant ICMs in a holding area with no procedure related adverse events (AE). Copyright © 2017 Indian Heart Rhythm Society. Production and hosting by Elsevier B.V. All rights reserved.

Biofortified indica rice attains iron and zinc nutrition dietary targets in the field

PubMed Central

Trijatmiko, Kurniawan R.; Dueñas, Conrado; Tsakirpaloglou, Nikolaos; Torrizo, Lina; Arines, Felichi Mae; Adeva, Cheryl; Balindong, Jeanette; Oliva, Norman; Sapasap, Maria V.; Borrero, Jaime; Rey, Jessica; Francisco, Perigio; Nelson, Andy; Nakanishi, Hiromi; Lombi, Enzo; Tako, Elad; Glahn, Raymond P.; Stangoulis, James; Chadha-Mohanty, Prabhjit; Johnson, Alexander A. T.; Tohme, Joe; Barry, Gerard; Slamet-Loedin, Inez H.

2016-01-01

More than two billion people are micronutrient deficient. Polished grains of popular rice varieties have concentration of approximately 2 μg g−1 iron (Fe) and 16 μg g−1 zinc (Zn). The HarvestPlus breeding programs for biofortified rice target 13 μg g−1 Fe and 28 μg g−1 Zn to reach approximately 30% of the estimated average requirement (EAR). Reports on engineering Fe content in rice have shown an increase up to 18 μg g−1 in glasshouse settings; in contrast, under field conditions, 4 μg g−1 was the highest reported concentration. Here, we report on selected transgenic events, field evaluated in two countries, showing 15 μg g−1 Fe and 45.7 μg g−1 Zn in polished grain. Rigorous selection was applied to 1,689 IR64 transgenic events for insert cleanliness and, trait and agronomic performances. Event NASFer-274 containing rice nicotianamine synthase (OsNAS2) and soybean ferritin (SferH-1) genes showed a single locus insertion without a yield penalty or altered grain quality. Endosperm Fe and Zn enrichment was visualized by X-ray fluorescence imaging. The Caco-2 cell assay indicated that Fe is bioavailable. No harmful heavy metals were detected in the grain. The trait remained stable in different genotype backgrounds. PMID:26806528

Transformation of Chloroplast Ribosomal RNA Genes in Chlamydomonas: Molecular and Genetic Characterization of Integration Events

PubMed Central

Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.

1990-01-01

Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764

K13-propeller mutations confer artemisinin resistance in Plasmodium falciparum clinical isolates

PubMed Central

Straimer, Judith; Gnädig, Nina F.; Witkowski, Benoit; Amaratunga, Chanaki; Duru, Valentine; Ramadani, Arba Pramundita; Dacheux, Mélanie; Khim, Nimol; Zhang, Lei; Lam, Stephen; Gregory, Philip D.; Urnov, Fyodor D.; Mercereau-Puijalon, Odile; Benoit-Vical, Françoise; Fairhurst, Rick M.; Ménard, Didier; Fidock, David A.

2015-01-01

The emergence of artemisinin resistance in Southeast Asia imperils efforts to reduce the global malaria burden. We genetically modified the Plasmodium falciparum K13 locus using zinc-finger nucleases and measured ring-stage survival rates after drug exposure in vitro; these rates correlate with parasite clearance half-lives in artemisinin-treated patients. With isolates from Cambodia, where resistance first emerged, survival rates decreased from 13 to 49% to 0.3 to 2.4% after the removal of K13 mutations. Conversely, survival rates in wild-type parasites increased from ≤0.6% to 2 to 29% after the insertion of K13 mutations. These mutations conferred elevated resistance to recent Cambodian isolates compared with that of reference lines, suggesting a contemporary contribution of additional genetic factors. Our data provide a conclusive rationale for worldwide K13-propeller sequencing to identify and eliminate artemisinin-resistant parasites. PMID:25502314

Non-reciprocal optical mirrors based on spatio-temporal acousto-optic modulation

NASA Astrophysics Data System (ADS)

Fleury, R.; Sounas, D. L.; Alù, A.

2018-03-01

Here, we investigate a scheme to realize free-space isolators and highly non-reciprocal mirrors with weak modulation imparted by an acoustic wave. We propose a strategy to dramatically break time-reversal symmetry by exploiting resonant interactions between a travelling acoustic wave and highly resonant Fabry-Pérot modes, inducing total reflection of an optical beam at a given angle, and no reflection at the negative angle. Different from conventional acousto-optic isolators, which are based on non-resonant frequency conversion and filtering, our proposal operates at the frequency of the optical signal by tailoring the resonant properties of the structure as well as the acoustic wave frequency and intensity, enabling 50 dB isolation with modest modulation requirements. Operation in the reflection mode allows for close-to-zero insertion loss, enabling disruptive opportunities in our ability to control and manipulate photons.

Magneto-optical non-reciprocal devices in silicon photonics

PubMed Central

Shoji, Yuya; Mizumoto, Tetsuya

2014-01-01

Silicon waveguide optical non-reciprocal devices based on the magneto-optical effect are reviewed. The non-reciprocal phase shift caused by the first-order magneto-optical effect is effective in realizing optical non-reciprocal devices in silicon waveguide platforms. In a silicon-on-insulator waveguide, the low refractive index of the buried oxide layer enhances the magneto-optical phase shift, which reduces the device footprints. A surface activated direct bonding technique was developed to integrate a magneto-optical garnet crystal on the silicon waveguides. A silicon waveguide optical isolator based on the magneto-optical phase shift was demonstrated with an optical isolation of 30 dB and insertion loss of 13 dB at a wavelength of 1548 nm. Furthermore, a four port optical circulator was demonstrated with maximum isolations of 15.3 and 9.3 dB in cross and bar ports, respectively, at a wavelength of 1531 nm. PMID:27877640

Using SINEs to probe ancient explosive speciation: "hidden" radiation of African cichlids?

PubMed

Terai, Yohey; Takahashi, Kazuhiko; Nishida, Mutsumi; Sato, Tetsu; Okada, Norihiro

2003-06-01

Cichlid fishes of the east African Great Lakes represent a paradigm of adaptive radiation. We conducted a phylogenetic analysis of cichlids including pan-African and west African species by using insertion patterns of short interspersed elements (SINEs) at orthologous loci. The monophyly of the east African cichlids was consistently supported by seven independent insertions of SINE sequences that are uniquely shared by these species. In addition, data from four other loci indicated that the genera Tilapia (pan-African) and Steatocranus (west African) are the closest relatives to east African cichlids. However, relationships among Tilapia, Steatocranus, and the east African clade were ambiguous because of incongruencies among topologies suggested by insertion patterns of SINEs at six other loci. One plausible explanation for this phenomenon is incomplete lineage sorting of alleles containing or missing a SINE insertion at these loci during ancestral speciation. Such incomplete sorting may have taken place earlier than 14 MYA, followed by random and stochastic fixation of the alleles in subsequent lineages. These observations prompted us to consider the possibility that cichlid speciation occurred at an accelerated rate during this period when the African Great Lakes did not exist. The SINE method could be useful for detecting ancient exclusive speciation events that tend to remain hidden during conventional sequence analyses because of accumulated point mutations.

Rates and patterns of great ape retrotransposition

PubMed Central

Hormozdiari, Fereydoun; Konkel, Miriam K.; Prado-Martinez, Javier; Chiatante, Giorgia; Herraez, Irene Hernando; Walker, Jerilyn A.; Nelson, Benjamin; Alkan, Can; Sudmant, Peter H.; Huddleston, John; Catacchio, Claudia R.; Ko, Arthur; Malig, Maika; Baker, Carl; Genome Project, Great Ape; Marques-Bonet, Tomas; Ventura, Mario; Batzer, Mark A.; Eichler, Evan E.

2013-01-01

We analyzed 83 fully sequenced great ape genomes for mobile element insertions, predicting a total of 49,452 fixed and polymorphic Alu and long interspersed element 1 (L1) insertions not present in the human reference assembly and assigning each retrotransposition event to a different time point during great ape evolution. We used these homoplasy-free markers to construct a mobile element insertions-based phylogeny of humans and great apes and demonstrate their differential power to discern ape subspecies and populations. Within this context, we find a good correlation between L1 diversity and single-nucleotide polymorphism heterozygosity (r2 = 0.65) in contrast to Alu repeats, which show little correlation (r2 = 0.07). We estimate that the “rate” of Alu retrotransposition has differed by a factor of 15-fold in these lineages. Humans, chimpanzees, and bonobos show the highest rates of Alu accumulation—the latter two since divergence 1.5 Mya. The L1 insertion rate, in contrast, has remained relatively constant, with rates differing by less than a factor of three. We conclude that Alu retrotransposition has been the most variable form of genetic variation during recent human–great ape evolution, with increases and decreases occurring over very short periods of evolutionary time. PMID:23884656

[Peripherally inserted central catheter antibiotic therapy for cystic fibrosis patients].

PubMed

Betegnie, A-L; Cracowski, C; Bedouch, P; Segond, C; Robein-Dobremez, M-J; Pin, I; Allenet, B

2014-11-01

Peripherally inserted central catheters (PICC) are more and more used for intravenous antibiotic infusions in cystic fibrosis (CF) patients in the Grenoble area (France). The aim of this study was to assess the use of this technique in this indication. 1. Retrospective evaluation of 102 consecutive PICC insertions over 3years and the incidence of adverse events during the therapy. 2. Prospective evaluation of 12 patient's satisfaction and their nurses over a 3-month period. 3. Comparative analysis of single domiciliary treatment costs using PICC versus peripheral catheter (PC). 102 PICC insertions were attempted in 31 patients. Seven failures and 7 complications occurred during the treatment requiring removal of the PICC, i.e. an overall success rate of 86.2% (88/102). Pain during PICC introduction was 4.2/10 (visual analogical scale). Mean satisfaction levels during therapy were 9.3/10 for patients and 8.7/10 for nurses. Compared with PC, all the patients said that PICC was "more comfortable". Differential costs of treatment with PC and with PICC at home were estimated at 57.15€ and 590.16€ respectively. PICC is an alternative to CP for intravenous antibiotherapy in CF patients, providing better safety and comfort. PICC use should be promoted in this indication. Copyright © 2013 SPLF. Published by Elsevier Masson SAS. All rights reserved.

Somatically Acquired LINE-1 Insertions in Normal Esophagus Undergo Clonal Expansion in Esophageal Squamous Cell Carcinoma.

PubMed

Doucet-O'Hare, Tara T; Sharma, Reema; Rodić, Nemanja; Anders, Robert A; Burns, Kathleen H; Kazazian, Haig H

2016-09-01

Squamous cell carcinoma of the esophagus (SCC) is the most common form of esophageal cancer in the world and is typically diagnosed at an advanced stage when successful treatment is challenging. Understanding the mutational profile of this cancer may identify new treatment strategies. Because somatic retrotransposition has been shown in tumors of the gastrointestinal system, we focused on LINE-1 (L1) mobilization as a source of genetic instability in this cancer. We hypothesized that retrotransposition is ongoing in SCC patients. The expression of L1 encoded proteins is necessary for retrotransposition to occur; therefore, we evaluated the expression of L1 open reading frame 1 protein (ORF1p). Using immunohistochemistry, we detected ORF1p expression in all four SCC cases evaluated. Using L1-seq, we identified and validated 74 somatic insertions in eight tumors of the nine evaluated. Of these, 12 insertions appeared to be somatic, not genetically inherited, and sub-clonal (i.e., present in less than one copy per genome equivalent) in the adjacent normal esophagus (NE), while clonal in the tumor. Our results indicate that L1 retrotransposition is active in SCC of the esophagus and that insertion events are present in histologically NE that expands clonally in the subsequent tumor. © 2016 WILEY PERIODICALS, INC.

Instability of the insertional mutation in CftrTgH(neoim)Hgu cystic fibrosis mouse model

PubMed Central

Charizopoulou, Nikoletta; Jansen, Silke; Dorsch, Martina; Stanke, Frauke; Dorin, Julia R; Hedrich, Hans-Jürgen; Tümmler, Burkhard

2004-01-01

Background A major boost to the cystic fibrosis disease research was given by the generation of various mouse models using gene targeting in embryonal stem cells. Moreover, the introduction of the same mutation on different inbred strains generating congenic strains facilitated the search for modifier genes. From the original CftrTgH(neoim)Hgu CF mouse model we have generated using strict brother × sister mating two inbred CftrTgH(neoim)Hgu mouse lines (CF/1 and CF/3). Thereafter, the insertional mutation was introgressed from CF/3 into three inbred backgrounds (C57BL/6, BALB/c, DBA/2J) generating congenic animals. In every backcross cycle germline transmission of the insertional mutation was monitored by direct probing the insertion via Southern RFLP. In order to bypass this time consuming procedure we devised an alternative PCR based protocol whereby mouse strains are differentiated at the Cftr locus by Cftr intragenic microsatellite genotypes that are tightly linked to the disrupted locus. Results Using this method we were able to identify animals carrying the insertional mutation based upon the differential haplotypic backgrounds of the three inbred strains and the mutant CftrTgH(neoim)Hgu at the Cftr locus. Moreover, this method facilitated the identification of the precise vector excision from the disrupted Cftr locus in two out of 57 typed animals. This reversion to wild type status took place without any loss of sequence revealing the instability of insertional mutations during the production of congenic animals. Conclusions We present intragenic microsatellite markers as a tool for fast and efficient identification of the introgressed locus of interest in the recipient strain during congenic animal breeding. Moreover, the same genotyping method allowed the identification of a vector excision event, posing questions on the stability of insertional mutations in mice. PMID:15102331

Whole genome characterization of a novel porcine reproductive and respiratory syndrome virus 1 isolate: Genetic evidence for recombination between Amervac vaccine and circulating strains in mainland China.

PubMed

Chen, Nanhua; Liu, Qiaorong; Qiao, Mingming; Deng, Xiaoyu; Chen, Xizhao; Sun, Ming

2017-10-01

Genotype 1 porcine reproductive and respiratory syndrome virus (PRRSV 1) have been continuously isolated in China in recent years. Complete genome sequences of these isolates are important to investigate the prevalence and evolution of Chinese PRRSV 1. Herein, we describe the isolation of a novel PRRSV 1 isolate, denominated HLJB1, in the Heilongjiang province of China. Complete genome sequencing of HLJB1 showed that it shares 90.66% and 58.21% nucleotide identities with PRRSV 1 and 2 prototypic strains Lelystad virus and ATCC VR-2332, respectively. HLJB1 has a unique 5-amino-acid insertion in nsp2, which has never been described in other PRRSV 1 isolates. Whole genome-based phylogenetic analysis revealed that all Chinese PRRSV 1 isolates are clustered in pan-European subtype 1 and can be divided into four subgroups. HLJB1 resides in the subgroup of BJEU06-1-like isolates but is also closely related to the Amervac-like isolates. Additionally, recombination analyses suggested that HLJB1 is a recombinant from the Amervac vaccine and the BJEU06-1 isolate. To our best knowledge, our results provide the first genetic evidence for recombination between Amervac vaccine and circulating strains. These findings are also beneficial for studying the origin and evolution of PRRSV 1 in China. Copyright © 2017. Published by Elsevier B.V.

Are you ready for Mars? - Main media events surrounding the arrival of ESA's Mars Express at Mars

NASA Astrophysics Data System (ADS)

2003-11-01

Launched on 2 June 2003 from Baikonur (Kazakhstan) on board a Russian Soyuz launcher operated by Starsem, the European probe -built for ESA by a European team of industrial companies led by Astrium - carries seven scientific instruments that will perform a series of remote-sensing experiments designed to shed new light on the Martian atmosphere, the planet’s structure and its geology. In particular, the British-made Beagle 2 lander, named after the ship on which Charles Darwin explored uncharted areas of the Earth in 1830, will contribute to the search for traces of life on Mars through exobiology experiments and geochemistry research. On Christmas Eve the Mars Express orbiter will be steered on a course taking it into an elliptical orbit, where it will safely circle the planet for a minimum of almost 2 Earth years. The Beagle 2 lander - which will have been released from the mother craft a few days earlier (on 19 December) - instead will stay on a collision course with the planet. It too should also be safe, being designed for atmospheric entry and geared for a final soft landing due to a sophisticated system of parachutes and airbags. On arrival, the Mars Express mission control team will report on the outcome of the spacecraft's delicate orbital insertion manoeuvre. It will take some time for Mars Express to manouvre into position to pick communications from Beagle 2. Hence, initially, other means will be used to check that Beagle 2 has landed: first signals from the Beagle 2 landing are expected to be available throughout Christmas Day, either through pick-up and relay of Beagle 2 radio signals by NASA’s Mars Odyssey, or by direct pick-up by the Jodrell Bank radio telescope in the UK. Mars Express will then pass over Beagle 2 in early January 2004, relaying data and images back to Earth. The first images from the cameras of Beagle 2 and Mars Express are expected to be available between the end of the year and the beginning of January 2004. The key dates relating to the arrival of Mars Express at its destination will be marked by several media events not to be missed. Pencil them into your diaries so as not to miss one of the most exciting events of the year. Tuesday 11 November Mars Express/Beagle 2 Media briefing Royal Society- 6-9 Carlton House Terrace, London 10:00 - 13:00 -Status report on the mission -Technical details on forthcoming Mars Express/Beagle 2 operations -News handling arrangements around Christmas Speakers: Prof. David Southwood, ESA Director of Science; Prof. Colin Pillinger, Beagle 2 Lander Lead Scientist; John Reddy, ESA Mars Express Principal Electrical Systems Engineer. Contact: Peter Barratt, PPARC Tel. + 44 (0) 1793 44 20 25 e-mail: Beagle2@pparc.ac.uk Wednesday 3 December ESA Media briefing ESA/ ESOC, Darmstadt, Germany 10:30 - 12:30 -Scientific outlook and expected results -Status report on the mission -Presentation of upcoming events Speakers: Rudolf Schmidt, ESA Mars Express Project Manager; Augustin Chicarro, ESA Mars Express Project Scientist. In addition, Mars Express scientists and Mission Control Managers will highlight their contribution to the Mars Express mission. In videoconference with ESA/Headquarters, Paris (F); ESA/ESTEC, Noordwijk (NL), ESA/ESRIN, Frascati (I). Contact: Jocelyne Landeau Constantin, ESA/ESOC Tel. + 49 6151 90 26 96 e-mail: Jocelyne.Landeau-Constantin@esa.int Friday 19 December Mars Express Orbiter/ Beagle 2 separation Mission Control Managers announce results of Beagle 2 separation from the mother craft. a.Event at ESA/ESOC, Darmstadt , Germany 08:30 - 14:00 Speakers: Prof. David Southwood, ESA Director of Science; Rudolf Schmidt, ESA Mars Express Project Manager Contact: Jocelyne Landeau Constantin, ESA/ESOC Tel. + 49 6151 90 26 96 e-mail: Jocelyne.Landeau-Constantin@esa.int b.Event in London -location and time t.b.c. Speaker: Prof. Colin Pillinger, Beagle 2 Lander Lead Scientist. Contact: Peter Barratt, PPARC Tel. + 44 (0) 1793 44 20 25 e-mail: Beagle2@pparc.ac.uk Thursday 25 December Christmas on Mars a.Media event at ESA/ ESOC, Darmstadt, Germany 03:00 - 07:00 Mars Express orbit insertion follow-up and Beagle 2 landing- Experience the accomplishment of one of the most exciting phases of the Mars Express mission in real time in the presence of Mission Control Managers and Scientists. 08:30 - 10:00 Christmas media brunch- Announcement of Mars orbit insertion results and Beagle 2 landing, with the participation of Prof. David Sourthwood, ESA Director of Science. Contact: Jocelyne Landeau Constantin, ESA/ESOC Tel. + 49 6151 90 26 96 e-mail: Jocelyne.Landeau-Constantin@esa.int b.Event in central London - location and time t.b.c. Contact: Peter Barratt, PPARC Tel. + 44 (0) 1793 44 20 25 e-mail: Beagle2@pparc.ac.uk Note to Editors: Timeline of expected main mission events 16 December All day Fine targeting of Mars Express to point at landing site - ranging 19 December 06:51 GMT/07:51 CET Decision to release Beagle 2 08:41 GMT/09:41 CET Eject command sent to Mars Express 10:15 GMT/11:15 CET First results of release available 20 December Re-targeting of Mars Express on an orbital insertion course 23 December Update on Mars Express Orbital Insertion Sequence 24 December Night Final decision to steer Mars Express into a Martian orbit 25 December 02:45 GMT/03:45 CET Beagle 2 landing on Mars 03:00 GMT/04:00 CET Mars Express Orbital Insertion 05:15 GMT/06:15 CET Mars Odyssey orbiter flight over Beagle 2 07:00 GMT/08:00 CET First evaluation of Mars Express orbital insertion 22:45 GMT/23:45 CET Possible direct capture of Beagle 2 signals at Jodrell Bank (UK)

Memory for sequences of events impaired in typical aging.

PubMed

Allen, Timothy A; Morris, Andrea M; Stark, Shauna M; Fortin, Norbert J; Stark, Craig E L

2015-03-01

Typical aging is associated with diminished episodic memory performance. To improve our understanding of the fundamental mechanisms underlying this age-related memory deficit, we previously developed an integrated, cross-species approach to link converging evidence from human and animal research. This novel approach focuses on the ability to remember sequences of events, an important feature of episodic memory. Unlike existing paradigms, this task is nonspatial, nonverbal, and can be used to isolate different cognitive processes that may be differentially affected in aging. Here, we used this task to make a comprehensive comparison of sequence memory performance between younger (18-22 yr) and older adults (62-86 yr). Specifically, participants viewed repeated sequences of six colored, fractal images and indicated whether each item was presented "in sequence" or "out of sequence." Several out of sequence probe trials were used to provide a detailed assessment of sequence memory, including: (i) repeating an item from earlier in the sequence ("Repeats"; e.g., AB A: DEF), (ii) skipping ahead in the sequence ("Skips"; e.g., AB D: DEF), and (iii) inserting an item from a different sequence into the same ordinal position ("Ordinal Transfers"; e.g., AB 3: DEF). We found that older adults performed as well as younger controls when tested on well-known and predictable sequences, but were severely impaired when tested using novel sequences. Importantly, overall sequence memory performance in older adults steadily declined with age, a decline not detected with other measures (RAVLT or BPS-O). We further characterized this deficit by showing that performance of older adults was severely impaired on specific probe trials that required detailed knowledge of the sequence (Skips and Ordinal Transfers), and was associated with a shift in their underlying mnemonic representation of the sequences. Collectively, these findings provide unambiguous evidence that the capacity to remember sequences of events is fundamentally affected by typical aging. © 2015 Allen et al.; Published by Cold Spring Harbor Laboratory Press.

Memory for sequences of events impaired in typical aging

PubMed Central

Allen, Timothy A.; Morris, Andrea M.; Stark, Shauna M.; Fortin, Norbert J.

2015-01-01

Typical aging is associated with diminished episodic memory performance. To improve our understanding of the fundamental mechanisms underlying this age-related memory deficit, we previously developed an integrated, cross-species approach to link converging evidence from human and animal research. This novel approach focuses on the ability to remember sequences of events, an important feature of episodic memory. Unlike existing paradigms, this task is nonspatial, nonverbal, and can be used to isolate different cognitive processes that may be differentially affected in aging. Here, we used this task to make a comprehensive comparison of sequence memory performance between younger (18–22 yr) and older adults (62–86 yr). Specifically, participants viewed repeated sequences of six colored, fractal images and indicated whether each item was presented “in sequence” or “out of sequence.” Several out of sequence probe trials were used to provide a detailed assessment of sequence memory, including: (i) repeating an item from earlier in the sequence (“Repeats”; e.g., ABADEF), (ii) skipping ahead in the sequence (“Skips”; e.g., ABDDEF), and (iii) inserting an item from a different sequence into the same ordinal position (“Ordinal Transfers”; e.g., AB3DEF). We found that older adults performed as well as younger controls when tested on well-known and predictable sequences, but were severely impaired when tested using novel sequences. Importantly, overall sequence memory performance in older adults steadily declined with age, a decline not detected with other measures (RAVLT or BPS-O). We further characterized this deficit by showing that performance of older adults was severely impaired on specific probe trials that required detailed knowledge of the sequence (Skips and Ordinal Transfers), and was associated with a shift in their underlying mnemonic representation of the sequences. Collectively, these findings provide unambiguous evidence that the capacity to remember sequences of events is fundamentally affected by typical aging. PMID:25691514

Occurrence of multi-antibiotic resistant Pseudomonas spp. in drinking water produced from karstic hydrosystems.

PubMed

Flores Ribeiro, Angela; Bodilis, Josselin; Alonso, Lise; Buquet, Sylvaine; Feuilloley, Marc; Dupont, Jean-Paul; Pawlak, Barbara

2014-08-15

Aquatic environments could play a role in the spread of antibiotic resistance genes by enabling antibiotic-resistant bacteria transferred through wastewater inputs to connect with autochthonous bacteria. Consequently, drinking water could be a potential pathway to humans and animals for antibiotic resistance genes. The aim of this study was to investigate occurrences of Escherichia coli and Pseudomonas spp. in drinking water produced from a karst, a vulnerable aquifer with frequent increases in water turbidity after rainfall events and run-offs. Water samples were collected throughout the system from the karstic springs to the drinking water tap during three non-turbid periods and two turbid events. E. coli densities in the springs were 10- to 1000-fold higher during the turbid events than during the non-turbid periods, indicating that, with increased turbidity, surface water had entered the karstic system and contaminated the spring water. However, no E. coli were isolated in the drinking water. In contrast, Pseudomonas spp. were isolated from the drinking water only during turbid events, while the densities in the springs were from 10- to 100-fold higher than in the non-turbid periods. All the 580 Pseudomonas spp. isolates obtained from the sampling periods were resistant (to between 1 and 10 antibiotics), with similar resistance patterns. Among all the Pseudomonas isolated throughout the drinking water production system, between 32% and 86% carried the major resistance pattern: ticarcillin, ticarcillin-clavulanic acid, cefsulodin, and/or aztreonam, and/or sulfamethoxazol-trimethoprim, and/or fosfomycin. Finally, 8 Pseudomonas spp. isolates, related to the Pseudomonas putida and Pseudomonas fluorescens species, were isolated from the drinking water. Thus, Pseudomonas could be involved in the dissemination of antibiotic resistance via drinking water during critical periods. Copyright © 2014 Elsevier B.V. All rights reserved.

The relationship between gorgonian coral (Cnidaria: Gorgonacea) diseases and African dust storms

USGS Publications Warehouse

Weir-Brush, J. R.; Garrison, V.H.; Smith, G.W.; Shinn, E.A.

2004-01-01

The number of reports of coral diseases has increased throughout the world in the last 20 years. Aspergillosis, which primarily affects Gorgonia ventalina and G. flabellum, is one of the few diseases to be characterized. This disease is caused by Aspergillus sydowii, a terrestrial fungus with a worldwide distribution. Upon infection, colonies may lose tissue, and ultimately, mortality may occur if the infection is not sequestered. The spores of A. sydowii are <5 ??m, small enough to be easily picked up by winds and dispersed over great distances. Aspergillosis is prevalent in the Caribbean, and it appears that this primarily terrestrial fungus has adapted to a marine environment. It has been proposed that dust storms originating in Africa may be one way in which potential coral pathogens are distributed and deposited into the marine environments of the Caribbean. To test the hypothesis that African dust storms transport and deposit pathogens, we collected air samples from both dust storms and periods of nondust in St. John, U.S. Virgin Islands. Because we focused on fungal pathogens and used A. sydowii as a model, we isolated and cultured fungi on various types of media. Fungi including Aspergillus spp. were isolated from air samples taken from dust events and non-dust events. Twenty-three separate cultures and seven genera were isolated from dust event samples whereas eight cultures from five genera were isolated from non-dust air samples. Three isolates from the Virgin Islands dust event samples morphologically identified as Aspergillus spp. produced signs of aspergillosis in seafans, and the original pathogens were re-isolated from those diseased seafans fulfilling Koch's Postulates. This research supports the hypothesis that African dust storms transport across the Atlantic Ocean and deposit potential coral pathogens in the Caribbean.

Characterization of three active transposable elements recently inserted in three independent DFR-A alleles and one high-copy DNA transposon isolated from the Pink allele of the ANS gene in onion (Allium cepa L.).

PubMed

Kim, Sunggil; Park, Jee Young; Yang, Tae-Jin

2015-06-01

Intact retrotransposon and DNA transposons inserted in a single gene were characterized in onions (Allium cepa) and their transcription and copy numbers were estimated in this study. While analyzing diverse onion germplasm, large insertions in the DFR-A gene encoding dihydroflavonol 4-reductase (DFR) involved in the anthocyanin biosynthesis pathway were found in two accessions. A 5,070-bp long terminal repeat (LTR) retrotransposon inserted in the active DFR-A (R4) allele was identified from one of the large insertions and designated AcCOPIA1. An intact ORF encoded typical domains of copia-like LTR retrotransposons. However, AcCOPIA1 contained atypical 'TG' and 'TA' dinucleotides at the ends of the LTRs. A 4,615-bp DNA transposon was identified in the other large insertion. This DNA transposon, designated AcCACTA1, contained an ORF coding for a transposase showing homology with the CACTA superfamily transposable elements (TEs). Another 5,073-bp DNA transposon was identified from the DFR-A (TRN) allele. This DNA transposon, designated AchAT1, belonged to the hAT superfamily with short 4-bp terminal inverted repeats (TIRs). Finally, a 6,258-bp non-autonomous DNA transposon, designated AcPINK, was identified in the ANS-p allele encoding anthocyanidin synthase, the next downstream enzyme to DFR in the anthocyanin biosynthesis pathway. AcPINK also possessed very short 3-bp TIRs. Active transcription of AcCOPIA1, AcCACTA1, and AchAT1 was observed through RNA-Seq analysis and RT-PCR. The copy numbers of AcPINK estimated by mapping the genomic DNA reads produced by NextSeq 500 were predominantly high compared with the other TEs. A series of evidence indicated that these TEs might have transposed in these onion genes very recently, providing a stepping stone for elucidation of enormously large-sized onion genome structure.

Fission yeast retrotransposon Tf1 integration is targeted to 5' ends of open reading frames.

PubMed

Behrens, R; Hayles, J; Nurse, P

2000-12-01

Target site selection of transposable elements is usually not random but involves some specificity for a DNA sequence or a DNA binding host factor. We have investigated the target site selection of the long terminal repeat-containing retrotransposon Tf1 from the fission yeast Schizosaccharomyces pombe. By monitoring induced transposition events we found that Tf1 integration sites were distributed throughout the genome. Mapping these insertions revealed that Tf1 did not integrate into open reading frames, but occurred preferentially in longer intergenic regions with integration biased towards a region 100-420 bp upstream of the translation start site. Northern blot analysis showed that transcription of genes adjacent to Tf1 insertions was not significantly changed.

Fission yeast retrotransposon Tf1 integration is targeted to 5′ ends of open reading frames

PubMed Central

Behrens, Ralf; Hayles, Jacky; Nurse, Paul

2000-01-01

Target site selection of transposable elements is usually not random but involves some specificity for a DNA sequence or a DNA binding host factor. We have investigated the target site selection of the long terminal repeat-containing retrotransposon Tf1 from the fission yeast Schizosaccharomyces pombe. By monitoring induced transposition events we found that Tf1 integration sites were distributed throughout the genome. Mapping these insertions revealed that Tf1 did not integrate into open reading frames, but occurred preferentially in longer intergenic regions with integration biased towards a region 100–420 bp upstream of the translation start site. Northern blot analysis showed that transcription of genes adjacent to Tf1 insertions was not significantly changed. PMID:11095681

Rhizobia from Lanzarote, the Canary Islands, that nodulate Phaseolus vulgaris have characteristics in common with Sinorhizobium meliloti isolates from mainland Spain.

PubMed

Zurdo-Piñeiro, José Luis; García-Fraile, Paula; Rivas, Raúl; Peix, Alvaro; León-Barrios, Milagros; Willems, Anne; Mateos, Pedro Francisco; Martínez-Molina, Eustoquio; Velázquez, Encarna; van Berkum, Peter

2009-04-01

The stable, low-molecular-weight (LMW) RNA fractions of several rhizobial isolates of Phaseolus vulgaris grown in the soil of Lanzarote, an island of the Canary Islands, were identical to a less-common pattern found within Sinorhizobium meliloti (assigned to group II) obtained from nodules of alfalfa and alfalfa-related legumes grown in northern Spain. The P. vulgaris isolates and the group II LMW RNA S. meliloti isolates also were distinguishable in that both had two conserved inserts of 20 and 46 bp in the 16S-23S internal transcribed spacer region that were not present in other strains of S. meliloti. The isolates from P. vulgaris nodulated bean but not Medicago sativa, while those recovered from Medicago, Melilotus, and Trigonella spp. nodulated both host legumes. The bean isolates also were distinguished from those of Medicago, Melilotus, and Trigonella spp. by nodC sequence analysis. The nodC sequences of the bean isolates were most similar to those reported for S. meliloti bv. mediterranense and Sinorhizobium fredii bv. mediterranense (GenBank accession numbers DQ333891 and AF217267, respectively). None of the evidence placed the bean isolates from Lanzarote in the genus Rhizobium, which perhaps is inconsistent with seed-borne transmission of Rhizobium etli from the Americas to the Canaries as an explanation for the presence of bean-nodulating rhizobia in soils of Lanzarote.

Recombinations in Staphylococcal Cassette Chromosome mec Elements Compromise the Molecular Detection of Methicillin Resistance in Staphylococcus aureus

PubMed Central

Hill-Cawthorne, Grant A.; Hudson, Lyndsey O.; El Ghany, Moataz Fouad Abd; Piepenburg, Olaf; Nair, Mridul; Dodgson, Andrew; Forrest, Matthew S.

2014-01-01

Clinical laboratories are increasingly using molecular tests for methicillin-resistant Staphylococcus aureus (MRSA) screening. However, primers have to be targeted to a variable chromosomal region, the staphylococcal cassette chromosome mec (SCCmec). We initially screened 726 MRSA isolates from a single UK hospital trust by recombinase polymerase amplification (RPA), a novel, isothermal alternative to PCR. Undetected isolates were further characterised using multilocus sequence, spa typing and whole genome sequencing. 96% of our tested phenotypically MRSA isolates contained one of the six orfX-SCCmec junctions our RPA test and commercially available molecular tests target. However 30 isolates could not be detected. Sequencing of 24 of these isolates demonstrated recombinations within the SCCmec element with novel insertions that interfered with the RPA, preventing identification as MRSA. This result suggests that clinical laboratories cannot rely solely upon molecular assays to reliably detect all methicillin-resistance. The presence of significant recombinations in the SCCmec element, where the majority of assays target their primers, suggests that there will continue to be isolates that escape identification. We caution that dependence on amplification-based molecular assays will continue to result in failure to diagnose a small proportion (∼4%) of MRSA isolates, unless the true level of SCCmec natural diversity is determined by whole genome sequencing of a large collection of MRSA isolates. PMID:24972080

Comparative Genome Analyses of Streptococcus suis Isolates from Endocarditis Demonstrate Persistence of Dual Phenotypic Clones

PubMed Central

Tohya, Mari; Watanabe, Takayasu; Maruyama, Fumito; Arai, Sakura; Ota, Atsushi; Athey, Taryn B. T.; Fittipaldi, Nahuel; Nakagawa, Ichiro; Sekizaki, Tsutomu

2016-01-01

Many bacterial species coexist in the same niche as heterogeneous clones with different phenotypes; however, understanding of infectious diseases by polyphenotypic bacteria is still limited. In the present study, encapsulation in isolates of the porcine pathogen Streptococcus suis from persistent endocarditis lesions was examined. Coexistence of both encapsulated and unencapsulated S. suis isolates was found in 26 out of 59 endocarditis samples. The isolates were serotype 2, and belonged to two different sequence types (STs), ST1 and ST28. The genomes of each of the 26 pairs of encapsulated and unencapsulated isolates from the 26 samples were sequenced. The data showed that each pair of isolates had one or more unique nonsynonymous mutations in the cps gene, and the encapsulated and unencapsulated isolates from the same samples were closest to each other. Pairwise comparisons of the sequences of cps genes in 7 pairs of encapsulated and unencapsulated isolates identified insertion/deletions (indels) ranging from one to 104 bp in different cps genes of unencapsulated isolates. Capsule expression was restored in a subset of unencapsulated isolates by complementation in trans with cps expression vectors. Examination of gene content common to isolates indicated that mutation frequency was higher in ST28 pairs than in ST1 pairs. Genes within mobile genetic elements were mutation hot spots among ST28 isolates. Taken all together, our results demonstrate the coexistence of dual phenotype (encapsulated and unencapsulated) bacterial clones and suggest that the dual phenotypes arose independently in each farm by means of spontaneous mutations in cps genes. PMID:27433935

Direct versus indirect ACL femoral attachment fibres and their implications on ACL graft placement.

PubMed

Moulton, Samuel G; Steineman, Brett D; Haut Donahue, Tammy L; Fontboté, Cristián A; Cram, Tyler R; LaPrade, Robert F

2017-01-01

To further elucidate the direct and indirect fibre insertion morphology within the human ACL femoral attachment using scanning electron microscopy and determine where in the footprint each fibre type predominates. The hypothesis was that direct fibre attachment would be found centrally in the insertion site, while indirect fibre attachment would be found posteriorly adjacent to the posterior articular cartilage. Ten cadaveric knees were dissected to preserve and isolate the entirety of the femoral insertion of the ACL. Specimens were then prepared and evaluated with scanning electron microscopy to determine insertional fibre morphology and location. The entirety of the fan-like projection of the ACL attachment site lay posterior to the lateral intercondylar ridge. In all specimens, a four-phase architecture, consistent with previous descriptions of direct fibres, was found in the centre of the femoral attachment site. The posterior margin of the ACL attachment attached directly adjacent to the posterior articular cartilage with some fibres coursing into it. The posterior portion of the ACL insertion had a two-phase insertion, consistent with previous descriptions of indirect fibres. The transition from the ligament fibres to bone had less interdigitations, and the interdigitations were significantly smaller (p < 0.001) compared to the transition in the direct fibre area. The interdigitations of the direct fibres were 387 ± 81 μm (range 282-515 μm) wide, while the interdigitations of indirect fibres measured 228 ± 75 μm (range 89-331 μm). The centre of the ACL femoral attachment consisted of a direct fibre structure, while the posterior portion had an indirect fibre structure. These results support previous animal studies reporting that the centre of the ACL femoral insertion was comprised of the strongest reported fibre type. Clinically, the femoral ACL reconstruction tunnel should be oriented to cover the entirety of the central direct ACL fibres and may need to be customized based on graft type and the fixation device used during surgery.

Preliminary Report on Mission Design and Operations for Critical Events

NASA Technical Reports Server (NTRS)

Hayden, Sandra C.; Tumer, Irem

2005-01-01

Mission-critical events are defined in the Jet Propulsion Laboratory s Flight Project Practices as those sequences of events which must succeed in order to attain mission goals. These are dependent on the particular operational concept and design reference mission, and are especially important when committing to irreversible events. Critical events include main engine cutoff (MECO) after launch; engine cutoff or parachute deployment on entry, descent, and landing (EDL); orbital insertion; separation of payload from vehicle or separation of booster segments; maintenance of pointing accuracy for power and communication; and deployment of solar arrays and communication antennas. The purpose of this paper is to report on the current practices in handling mission-critical events in design and operations at major NASA spaceflight centers. The scope of this report includes NASA Johnson Space Center (JSC), NASA Goddard Space Flight Center (GSFC), and NASA Jet Propulsion Laboratory (JPL), with staff at each center consulted on their current practices, processes, and procedures.

Random insertion and gene disruption via transposon mutagenesis of Ureaplasma parvum using a mini-transposon plasmid

PubMed Central

Aboklaish, Ali F.; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I.; Spiller, O. Brad

2015-01-01

While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. PMID:25444567

Random insertion and gene disruption via transposon mutagenesis of Ureaplasma parvum using a mini-transposon plasmid.

PubMed

Aboklaish, Ali F; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I; Spiller, O Brad

2014-11-01

While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. Copyright © 2014 Elsevier GmbH. All rights reserved.