Sample records for iv source population

  1. C IV λ1549 as an Eigenvector 1 Parameter for Active Galactic Nuclei

    NASA Astrophysics Data System (ADS)

    Sulentic, Jack W.; Bachev, Rumen; Marziani, Paola; Negrete, C. Alenka; Dultzin, Deborah

    2007-09-01

    We are exploring a spectroscopic unification for all types of broad-line emitting AGNs. The four-dimensional Eigenvector 1 (4DE1) parameter space organizes quasar diversity in a sequence primarily governed by Eddington ratio. This paper considers the role of C IV λ1549 measures as 4DE1 diagnostics. We use HST archival spectra for 130 sources with S/N high enough to permit reliable C IV λ1549 broad-component measures. We find a C IV λ1549BC profile blueshift that is strongly concentrated among (largely radio-quiet [RQ]) sources with FWHM(HβBC)<~4000 km s-1 (which we call Population A). Narrow-line Seyfert 1 (NLSy1; with FWHM Hβ<=2000 km s-1) sources belong to this population but do not emerge as a distinct class. The systematic blueshift, widely interpreted as arising in a disk wind/outflow, is not observed in broader line AGNs (including most radio-loud [RL] sources), which we call Population B. We find new correlations involving FWHM(C IV λ1549BC), C IV λ1549 line shift, and equivalent width only among Population A sources. Sulentic et al. suggested C IV λ1549 measures enhance an apparent dichotomy between sources with FWHM(HβBC) less and greater than 4000 km s-1, suggesting that it has more significance in the context of broad-line region structure than the more commonly discussed RL versus RQ dichotomy. Black hole masses computed from FWHM C IV λ1549BC for about 80 AGNs indicate that the C IV λ1549 width is a poor virial estimator. Comparison of mass estimates derived from HβBC and C IV λ1549 reveals that the latter show different and nonlinear offsets for Population A and B sources. A significant number of sources also show narrow-line C IV λ1549 emission that must be removed before C IV λ1549BC measures can be made and interpreted effectively. We present a recipe for C IV λ1549 narrow-component extraction.

  2. Crimson Viper, Phase IV: Field Experimentation Venue Report and CV14 Combined Report

    DTIC Science & Technology

    2014-09-01

    Notify Officials and Populous of the following: • Notify locations of water source contamination , warning and recommended actions (i.e. boil water) per...of supplies available (e.g. blankets, tarps, food , etc) including medicines Observations and Feedback Objective 1: Assess effectiveness of the...Populous of the following: • Notify locations of water source contamination , warning and recommended actions (i.e. boil water) per local government 69

  3. Anaerobic U(IV) Bio-oxidation and the Resultant Remobilization of Uranium in Contaminated Sediments

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Coates, John D.

    2005-06-01

    A proposed strategy for the remediation of uranium (U) contaminated sites is based on immobilizing U by reducing the oxidized soluble U, U(VI), to form a reduced insoluble end product, U(IV). Due to the use of nitric acid in the processing of nuclear fuels, nitrate is often a co-contaminant found in many of the environments contaminated with uranium. Recent studies indicate that nitrate inhibits U(VI) reduction in sediment slurries. However, the mechanism responsible for the apparent inhibition of U(VI) reduction is unknown, i.e. preferential utilization of nitrate as an electron acceptor, direct biological oxidation of U(IV) coupled to nitrate reduction,more » and/or abiotic oxidation by intermediates of nitrate reduction. Recent studies indicates that direct biological oxidation of U(IV) coupled to nitrate reduction may exist in situ, however, to date no organisms have been identified that can grow by this metabolism. In an effort to evaluate the potential for nitrate-dependent bio-oxidation of U(IV) in anaerobic sedimentary environments, we have initiated the enumeration of nitrate-dependent U(IV) oxidizing bacteria. Sediments, soils, and groundwater from uranium (U) contaminated sites, including subsurface sediments from the NABIR Field Research Center (FRC), as well as uncontaminated sites, including subsurface sediments from the NABIR FRC and Longhorn Army Ammunition Plant, Texas, lake sediments, and agricultural field soil, sites served as the inoculum source. Enumeration of the nitrate-dependent U(IV) oxidizing microbial population in sedimentary environments by most probable number technique have revealed sedimentary microbial populations ranging from 9.3 x 101 - 2.4 x 103 cells (g sediment)-1 in both contaminated and uncontaminated sites. Interestingly uncontaminated subsurface sediments (NABIR FRC Background core FB618 and Longhorn Texas Core BH2-18) both harbored the most numerous nitrate-dependent U(IV) oxidizing population 2.4 x 103 cells (g sediment)-1. The nitrate-dependent U(IV) oxidizing microbial population in groundwaters is less numerous ranging from 0 cells mL-1 (Well FW300, Uncontaminated Background NABIR FRC) to 4.3 x 102 cells mL-1 (Well TPB16, Contaminated Area 2 NABIR FRC). The presence of nitrate-dependent U(IV) oxidizing bacteria supports our hypothesis that bacteria capable of anaerobic U(IV) oxidation are ubiquitous and indigenous to sedimentary and groundwater environments.« less

  4. Characterization of exposure in epidemiological studies on air pollution from biodegradable wastes: Misclassification and comparison of exposure assessment strategies.

    PubMed

    Cantuaria, Manuella Lech; Suh, Helen; Løfstrøm, Per; Blanes-Vidal, Victoria

    2016-11-01

    The assignment of exposure is one of the main challenges faced by environmental epidemiologists. However, misclassification of exposures has not been explored in population epidemiological studies on air pollution from biodegradable wastes. The objective of this study was to investigate the use of different approaches for assessing exposure to air pollution from biodegradable wastes by analyzing (1) the misclassification of exposure that is committed by using these surrogates, (2) the existence of differential misclassification (3) the effects that misclassification may have on health effect estimates and the interpretation of epidemiological results, and (4) the ability of the exposure measures to predict health outcomes using 10-fold cross validation. Four different exposure assessment approaches were studied: ammonia concentrations at the residence (Metric I), distance to the closest source (Metric II), number of sources within certain distances from the residence (Metric IIIa,b) and location in a specific region (Metric IV). Exposure-response models based on Metric I provided the highest predictive ability (72.3%) and goodness-of-fit, followed by IV, III and II. When compared to Metric I, Metric IV yielded the best results for exposure misclassification analysis and interpretation of health effect estimates, followed by Metric IIIb, IIIa and II. The study showed that modelled NH 3 concentrations provide more accurate estimations of true exposure than distances-based surrogates, and that distance-based surrogates (especially those based on distance to the closest point source) are imprecise methods to identify exposed populations, although they may be useful for initial studies. Copyright © 2016 Elsevier GmbH. All rights reserved.

  5. Report for 2011 from the Bordeaux IVS Analysis Center

    NASA Technical Reports Server (NTRS)

    Charlot, Patrick; Bellanger, Antoine; Bourda, Geraldine; Collioud, Arnaud; Baudry, Alain

    2012-01-01

    This report summarizes the activities of the Bordeaux IVS Analysis Center during the year 2011. The work focused on (i) regular analysis of the IVS-R1 and IVS-R4 sessions with the GINS software package; (ii) systematic VLBI imaging of the RDV sessions and calculation of the corresponding source structure index and compactness values; (iii) imaging of the sources observed during the 2009 International Year of Astronomy IVS observing session; and (iv) continuation of our VLBI observational program to identify optically-bright radio sources suitable for the link with the future Gaia frame. Also of importance is the enhancement of the IVS LiveWeb site which now comprises all IVS sessions back to 2003, allowing one to search past observations for session-specific information (e.g. sources or stations).

  6. Selenoamino Acid-Enriched Green Pea as a Value-Added Plant Protein Source for Humans and Livestock.

    PubMed

    Garousi, Farzaneh; Domokos-Szabolcsy, Éva; Jánószky, Mihály; Kovács, Andrea Balláné; Veres, Szilvia; Soós, Áron; Kovács, Béla

    2017-06-01

    Selenium deficiency in various degrees affects around 15% of the world's population, contributing to a variety of health problems. In this study, we examined the accumulation and biotransformation of soil applied Se-supplementation (sodium selenite and sodium selenate forms) at different concentrations, along with growth and yield formation of green pea, in a greenhouse experiment. Biotransformation of inorganic Se was evaluated using HPLC-ICP-MS for Se-species separation in the above ground parts of green pea. Results showed 3 mg kg -1 Se IV increased green pea growth biomarkers and also caused an increase in protein content in leaves by 17%. Selenomethionine represented 65% of the total selenium content in shoots, but was lower in pods and seeds (54 and 38%, respectively). Selenomethionine was the major species in all plant parts and the only organic selenium form in the lower Se IV concentration range. Elevating the dose of Se IV (≥30 mg kg -1 ) triggered detrimental effects on growth and protein content and caused higher accumulation of inorganic Se in forms of Se VI and Se IV . Selenocysteine, another organic form of proteinogenic amino acid, was determined when Se IV (≥10 mg kg -1 ) was applied in higher concentrations. Thus, agronomic biofortification using the appropriate chemical form and concentration of Se will have positive effects on green pea growth and its enriched shoots and seeds provide a value-added protein source for livestock and humans with significant increased selenomethionine.

  7. Target Selection for the SDSS-IV APOGEE-2 Survey

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zasowski, G.; Cohen, R. E.; Carlberg, J. K.

    APOGEE-2 is a high-resolution, near-infrared spectroscopic survey observing ∼3 × 10{sup 5} stars across the entire sky. It is the successor to APOGEE and is part of the Sloan Digital Sky Survey IV (SDSS-IV). APOGEE-2 is expanding on APOGEE’s goals of addressing critical questions of stellar astrophysics, stellar populations, and Galactic chemodynamical evolution using (1) an enhanced set of target types and (2) a second spectrograph at Las Campanas Observatory in Chile. APOGEE-2 is targeting red giant branch and red clump stars, RR Lyrae, low-mass dwarf stars, young stellar objects, and numerous other Milky Way and Local Group sources across the entiremore » sky from both hemispheres. In this paper, we describe the APOGEE-2 observational design, target selection catalogs and algorithms, and the targeting-related documentation included in the SDSS data releases.« less

  8. The Grism Lens-Amplified Survey from Space (GLASS). XI. Detection of C IV in Multiple Images of the z = 6.11 Lyα Emitter behind RXC J2248.7-4431

    NASA Astrophysics Data System (ADS)

    Schmidt, K. B.; Huang, K.-H.; Treu, T.; Hoag, A.; Bradač, M.; Henry, A. L.; Jones, T. A.; Mason, C.; Malkan, M.; Morishita, T.; Pentericci, L.; Trenti, M.; Vulcani, B.; Wang, X.

    2017-04-01

    The C III] and C IV rest-frame UV emission lines are powerful probes of the ionization states of galaxies. They have furthermore been suggested as alternatives for spectroscopic redshift confirmation of objects at the epoch of reionization (z> 6), where the most frequently used redshift indicator, Lyα, is attenuated by the high fraction of neutral hydrogen in the intergalactic medium. However, currently only very few confirmations of carbon UV lines at these high redshifts exist, making it challenging to quantify these claims. Here, we present the detection of C IV λλ1548, 1551 Å in Hubble Space Telescope slitless grism spectroscopy obtained by GLASS of a Lyα emitter at z = 6.11 multiply imaged by the massive foreground galaxy cluster RXC J2248.7-4431. The C IV emission is detected at the 3σ-5σ level in two images of the source, with marginal detection in two other images. We do not detect significant C III]λλ1907, 1909 Å emission implying an equivalent width {{EW}}{{C}{{III}}]}< 20 Å (1σ) and {{C}} {{IV}}/{{C}} {{III}}> 0.7 (2σ). Combined with limits on the rest-frame UV flux from the He II λ1640 Å emission line and the O III]λλ1661, 1666 Å doublet, we put constraints on the metallicity and the ionization state of the galaxy. The estimated line ratios and equivalent widths do not support a scenario where an AGN is responsible for ionizing the carbon atoms. SED fits, including nebular emission lines, imply a source with a mass of log(M/M ⊙) ˜ 9, SFR of around 10 M ⊙ yr-1, and a young stellar population < 50 {Myr} old. The source shows a stronger ionizing radiation field than objects with detected C IV emission at z< 2 and adds to the growing sample of low-mass (log(M/M ⊙) ≲ 9) galaxies at the epoch of reionization with strong radiation fields from star formation.

  9. On valuing patches: Estimating contributions to metapopulation growth with reverse-time capture-recapture modelling

    USGS Publications Warehouse

    Sanderlin, J.S.; Waser, P.M.; Hines, J.E.; Nichols, J.D.

    2012-01-01

    Metapopulation ecology has historically been rich in theory, yet analytical approaches for inferring demographic relationships among local populations have been few. We show how reverse-time multi-state capture-recapture models can be used to estimate the importance of local recruitment and interpopulation dispersal to metapopulation growth. We use 'contribution metrics' to infer demographic connectedness among eight local populations of banner-tailed kangaroo rats, to assess their demographic closure, and to investigate sources of variation in these contributions. Using a 7 year dataset, we show that: (i) local populations are relatively independent demographically, and contributions to local population growth via dispersal within the system decline with distance; (ii) growth contributions via local survival and recruitment are greater for adults than juveniles, while contributions involving dispersal are greater for juveniles; (iii) central populations rely more on local recruitment and survival than peripheral populations; (iv) contributions involving dispersal are not clearly related to overall metapopulation density; and (v) estimated contributions from outside the system are unexpectedly large. Our analytical framework can classify metapopulations on a continuum between demographic independence and panmixia, detect hidden population growth contributions, and make inference about other population linkage forms, including rescue effects and source-sink structures. Finally, we discuss differences between demographic and genetic population linkage patterns for our system. ?? 2011 The Royal Society.

  10. Report for 2012 from the Bordeaux IVS Analysis Center

    NASA Technical Reports Server (NTRS)

    Charlot, Patrick; Bellanger, Antoine; Bouffet, Romuald; Bourda, Geraldine; Collioud, Arnaud; Baudry, Alain

    2013-01-01

    This report summarizes the activities of the Bordeaux IVS Analysis Center during the year 2012. The work focused on (i) regular analysis of the IVS-R1 and IVS-R4 sessions with the GINS software package; (ii) systematic VLBI imaging of the RDV sessions and calculation of the corresponding source structure index and compactness values; (iii) investigation of the correlation between astrometric position instabilities and source structure variations; and (iv) continuation of our VLBI observational program to identify optically-bright radio sources suitable for the link with the future Gaia frame. Also of importance is the 11th European VLBI Network Symposium, which we organized last October in Bordeaux and which drew much attention from the European and International VLBI communities.

  11. Adding source positions to the IVS Combination

    NASA Astrophysics Data System (ADS)

    Bachmann, S.; Thaller, D.

    2016-12-01

    Simultaneous estimation of source positions, Earth orientation parameters (EOPs) and station positions in one common adjustment is crucial for a consistent generation of celestial and terrestrial reference frame (CRF and TRF, respectively). VLBI is the only technique to guarantee this consistency. Previous publications showed that the VLBI intra-technique combination could improve the quality of the EOPs and station coordinates compared to the individual contributions. By now, the combination of EOP and station coordinates is well established within the IVS and in combination with other space geodetic techniques (e.g. inter-technique combined TRF like the ITRF). Most of the contributing IVS Analysis Centers (AC) now provide source positions as a third parameter type (besides EOP and station coordinates), which have not been used for an operational combined solution yet. A strategy for the combination of source positions has been developed and integrated into the routine IVS combination. Investigations are carried out to compare the source positions derived from different IVS ACs with the combined estimates to verify whether the source positions are improved by the combination, as it has been proven for EOP and station coordinates. Furthermore, global solutions of source positions, i.e., so-called catalogues describing a CRF, are generated consistently with the TRF similar to the IVS operational combined quarterly solution. The combined solutions of the source positions time series and the consistently generated TRF and CRF are compared internally to the individual solutions of the ACs as well as to external CRF catalogues and TRFs. Additionally, comparisons of EOPs based on different CRF solutions are presented as an outlook for consistent EOP, CRF and TRF realizations.

  12. Health insurance for the poor: impact on catastrophic and out-of-pocket health expenditures in Mexico

    PubMed Central

    Galárraga, Omar; Salinas-Rodríguez, Aarón; Sesma-Vázquez, Sergio

    2009-01-01

    The goal of Seguro Popular (SP) in Mexico was to improve the financial protection of the uninsured population against excessive health expenditures. This paper estimates the impact of SP on catastrophic health expenditures (CHE), as well as out-of-pocket (OOP) health expenditures, from two different sources. First, we use the SP Impact Evaluation Survey (2005–2006), and compare the instrumental variables (IV) results with the experimental benchmark. Then, we use the same IV methods with the National Health and Nutrition Survey (ENSANUT 2006). We estimate naïve models, assuming exogeneity, and contrast them with IV models that take advantage of the specific SP implementation mechanisms for identification. The IV models estimated included two-stage least squares (2SLS), bivariate probit, and two-stage residual inclusion (2SRI) models. Instrumental variables estimates resulted in comparable estimates against the “gold standard.” Instrumental variables estimates indicate a reduction of 54% in catastrophic expenditures at the national level. SP beneficiaries also had lower expenditures on outpatient and medicine expenditures. The selection-corrected protective effect is found not only in the limited experimental dataset, but also at the national level. PMID:19756796

  13. Health insurance for the poor: impact on catastrophic and out-of-pocket health expenditures in Mexico.

    PubMed

    Galárraga, Omar; Sosa-Rubí, Sandra G; Salinas-Rodríguez, Aarón; Sesma-Vázquez, Sergio

    2010-10-01

    The goal of Seguro Popular (SP) in Mexico was to improve the financial protection of the uninsured population against excessive health expenditures. This paper estimates the impact of SP on catastrophic health expenditures (CHE), as well as out-of-pocket (OOP) health expenditures, from two different sources. First, we use the SP Impact Evaluation Survey (2005-2006), and compare the instrumental variables (IV) results with the experimental benchmark. Then, we use the same IV methods with the National Health and Nutrition Survey (ENSANUT 2006). We estimate naïve models, assuming exogeneity, and contrast them with IV models that take advantage of the specific SP implementation mechanisms for identification. The IV models estimated included two-stage least squares (2SLS), bivariate probit, and two-stage residual inclusion (2SRI) models. Instrumental variables estimates resulted in comparable estimates against the "gold standard." Instrumental variables estimates indicate a reduction of 54% in catastrophic expenditures at the national level. SP beneficiaries also had lower expenditures on outpatient and medicine expenditures. The selection-corrected protective effect is found not only in the limited experimental dataset, but also at the national level.

  14. Potential for a Near Term Very Low Energy Antiproton Source at Brookhaven National Laboratory.

    DTIC Science & Technology

    1989-04-01

    9 Table III-1: Cost Summary . . . . * . . .. . * 10 IV. Lattice and Stretcher Properties . . . . . . .............. 11 Fig. IV-1 Cell... lattice functions . . . . . . . . . . 12 Fig. IV-2 Insertion region lattice . . . . . . . . . 12 Fig. IV-3 Superperiod lattice functions . . . . . . 12...8217 * . . . 13 Table IV-Ib Parameters after lattice matching . . . . 13 Table IV-lc Components specification. . . 13 Table IV-2 Random multipoles. .. . . .. 15

  15. 3C 57 as an atypical radio-loud quasar: implications for the radio-loud/radio-quiet dichotomy

    NASA Astrophysics Data System (ADS)

    Sulentic, J. W.; Martínez-Carballo, M. A.; Marziani, P.; del Olmo, A.; Stirpe, G. M.; Zamfir, S.; Plauchu-Frayn, I.

    2015-06-01

    Lobe-dominated radio-loud (LD RL) quasars occupy a restricted domain in the 4D Eigenvector 1 (4DE1) parameter space which implies restricted geometry/physics/kinematics for this subclass compared to the radio-quiet (RQ) majority of quasars. We discuss how this restricted domain for the LD RL parent population supports the notion for a RQ-RL dichotomy among type 1 sources. 3C 57 is an atypical RL quasar that shows both uncertain radio morphology and falls in a region of 4DE1 space where RL quasars are rare. We present new radio flux and optical spectroscopic measures designed to verify its atypical optical/UV spectroscopic behaviour and clarify its radio structure. The former data confirms that 3C 57 falls off the 4DE1 quasar `main sequence' with both extreme optical Fe II emission (R_{Fe II} ˜ 1) and a large C IV λ1549 profile blueshift (˜-1500 km s-1). These parameter values are typical of extreme Population A sources which are almost always RQ. New radio measures show no evidence for flux change over a 50+ year time-scale consistent with compact steep-spectrum (or young LD) over core-dominated morphology. In the 4DE1 context where LD RL are usually low L/LEdd quasars, we suggest that 3C 57 is an evolved RL quasar (i.e. large blackhole mass) undergoing a major accretion event leading to a rejuvenation reflected by strong Fe II emission, perhaps indicating significant heavy metal enrichment, high bolometric luminosity for a low-redshift source and resultant unusually high Eddington ratio giving rise to the atypical C IV λ1549.

  16. The prognosis and incidence of social phobia in an elderly population. A 5-year follow-up.

    PubMed

    Karlsson, B; Sigström, R; Waern, M; Ostling, S; Gustafson, D; Skoog, I

    2010-07-01

    To examine the prognosis and incidence of social fears and phobia in an elderly population sample followed for 5 years. A general population sample (N = 612) of non-demented men (baseline age 70) and women (baseline age 70 and 78-86) was investigated in 2000-2001 and in 2005-2006 with semi-structured psychiatric examinations including the Comprehensive Psychopathological Rating Scale, and the Mini International Neuropsychiatric Interview. Social phobia was diagnosed according to the DSM-IV criteria. Among nine individuals with DSM-IV social phobia in 2000, 5 (55.6%) had no social fears in 2005, and 1 (11.1%) still met the criteria for DSM-IV social phobia. Among individuals without DSM-IV social phobia in 2000 (N = 603), 12 (2.0%) had DSM-IV social phobia in 2005. These findings challenge the notion that social phobia is a chronic disorder with rare occurrence in old age.

  17. CMS-G from Beta vulgaris ssp. maritima is maintained in natural populations despite containing an atypical cytochrome c oxidase.

    PubMed

    Meyer, Etienne H; Lehmann, Caroline; Boivin, Stéphane; Brings, Lea; De Cauwer, Isabelle; Bock, Ralph; Kühn, Kristina; Touzet, Pascal

    2018-02-23

    While mitochondrial mutants of the respiratory machinery are rare and often lethal, cytoplasmic male sterility (CMS), a mitochondrially inherited trait that results in pollen abortion, is frequently encountered in wild populations. It generates a breeding system called gynodioecy. In Beta vulgaris ssp. maritima , a gynodioecious species, we found CMS-G to be widespread across the distribution range of the species. Despite the sequencing of the mitochondrial genome of CMS-G, the mitochondrial sterilizing factor causing CMS-G is still unknown. By characterizing biochemically CMS-G, we found that the expression of several mitochondrial proteins is altered in CMS-G plants. In particular, Cox1, a core subunit of the cytochrome c oxidase (complex IV), is larger but can still assemble into complex IV. However, the CMS-G-specific complex IV was only detected as a stabilized dimer. We did not observe any alteration of the affinity of complex IV for cytochrome c ; however, in CMS-G, complex IV capacity is reduced. Our results show that CMS-G is maintained in many natural populations despite being associated with an atypical complex IV. We suggest that the modified complex IV could incur the associated cost predicted by theoretical models to maintain gynodioecy in wild populations. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  18. The Sloan Digital Sky Survey Reverberation Mapping Project: The C IV Blueshift, Its Variability, and Its Dependence Upon Quasar Properties

    NASA Astrophysics Data System (ADS)

    Sun, Mouyuan; Xue, Yongquan; Richards, Gordon T.; Trump, Jonathan R.; Shen, Yue; Brandt, W. N.; Schneider, D. P.

    2018-02-01

    We use the multi-epoch spectra of 362 quasars from the Sloan Digital Sky Survey Reverberation Mapping project to investigate the dependence of the blueshift of C IV relative to Mg II on quasar properties. We confirm that high-blueshift sources tend to have low C IV equivalent widths (EWs), and that the low-EW sources span a range of blueshift. Other high-ionization lines, such as He II, also show similar blueshift properties. The ratio of the line width (measured as both the full width at half maximum and the velocity dispersion) of C IV to that of Mg II increases with blueshift. Quasar variability enhances the connection between the C IV blueshift and quasar properties (e.g., EW). The variability of the Mg II line center (i.e., the wavelength that bisects the cumulative line flux) increases with blueshift. In contrast, the C IV line center shows weaker variability at the extreme blueshifts. Quasars with the high-blueshift C IV lines tend to have less variable continuum emission, when controlling for EW, luminosity, and redshift. Our results support the scenario that high-blueshift sources tend to have large Eddington ratios.

  19. EF-1α DNA Sequences Indicate Multiple Origins of Introduced Populations of Essigella californica (Hemiptera: Aphididae).

    PubMed

    Théry, Thomas; Brockerhoff, Eckehard G; Carnegie, Angus J; Chen, Rui; Elms, Stephen R; Hullé, Maurice; Glatz, Richard; Ortego, Jaime; Qiao, Ge-Xia; Turpeau, Évelyne; Favret, Colin

    2017-06-01

    Aphids in the pine-feeding Nearctic genus Essigella (Sternorrhyncha, Aphididae, Lachninae) have been introduced in Europe, North Africa, Oceania, and South America. Mitochondrial, nuclear, and endosymbiont DNA sequences of 12 introduced populations from three continents confirm they all belong to Essigella californica (Essig, 1909). Intron sequence variation of the nuclear gene EF-1α has revealed the existence of four distinct groups. Group I gathers one population from China, where the species is newly reported, and several from Europe (France and Italy); Group II is represented by one population from Argentina; Group III includes two populations from Southern Australia with one from New Zealand; and Group IV corresponds to five populations from Eastern and South-Eastern Australia. These results indicate that introduced populations of E. californica have at least four source populations. They also show that intron variation of EF-1α can be a method to discriminate populations of asexually reproducing aphids. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Taking a Population Census, Episode IV. Resource Material Development: Population Dynamics in Eighth Grade American History.

    ERIC Educational Resources Information Center

    Massialas, Byron G.; And Others

    This is the fourth unit in a series that introduces population concepts into the eighth grade American history curriculum. (See SO 013 782 for an overview of the guide.) In Episode IV, the history topic is union under the Constitution. Objectives are to (1) help the student to examine the need for collecting information on the population during…

  1. The unusual N IV] -emitter galaxy GDS J033218.92-275302.7: star formation or AGN-driven winds from a massive galaxy at z = 5.56

    NASA Astrophysics Data System (ADS)

    Vanzella, E.; Grazian, A.; Hayes, M.; Pentericci, L.; Schaerer, D.; Dickinson, M.; Cristiani, S.; Giavalisco, M.; Verhamme, A.; Nonino, M.; Rosati, P.

    2010-04-01

    Aims: We investigate the nature of the source GDS J033218.92-275302.7 at redshift ~5.56. Methods: The spectral energy distribution of the source is well-sampled by 16 bands photometry from UV-optical (HST and VLT), near infrared, near infrared (VLT) to mid-infrared (Spitzer). The detection of a signal in the mid-infrared Spitzer/IRAC bands 5.8, 8.0 μm - where the nebular emission contribution is less effective - suggests that there is a Balmer break, the signature of an underlying stellar population formed at earlier epochs. The high-quality VLT/FORS2 spectrum shows a clear Lyα emission line, together with semi-forbidden N iv] 1483.3-1486.5 also in emission. These lines imply a young stellar population. In particular, the N iv] 1483.3-1486.5 feature (if the source is not hosting an AGN) is a signature of massive and hot stars with an associated nebular emission. Conversely, it may be a signature of an AGN. The observed SED and the Lyα emission line profile were modeled carefully to investigate the internal properties of the source. Results: From the SED-fitting with a single and a double stellar population and from the Lyα modeling, it turns out that the source seems to have an evolved component with a stellar mass of ~5 × 1010 M⊙ and age ~0.4 Gyr, and a young component with an age of ~0.01 Gyr and star formation rate in the range of 30-200 M⊙ yr-1. The limits on the effective radius derived from the ACS/z850 and VLT/Ks bands indicate that this galaxy is denser than the local ones with similar mass. A relatively high nebular gas column density is favored from the Lyα line modeling (NHI ⪆ 1021 cm-2). A vigorous outflow (~ 450 km s-1) has been measured from the optical spectrum, consistent with the Lyα modeling. From ACS observations it turns out that the region emitting Lyα photons is spatially compact and has a similar effective radius (~0.1 kpc physical) estimated at the ~1400 Å rest-frame wavelength, whose emission is dominated by the stellar continuum and/or AGN. The gas is blown out from the central region, but, given the mass of the galaxy, it is uncertain whether it will pollute the IGM to large distances. We argue that a burst of star formation in a dense gas environment is active (possibly containing hot and massive stars and/or a low luminosity AGN), superimposed on an already formed fraction of stellar mass. Based on observations made at the European Southern Observatory, Paranal, Chile (ESO program 170.A-0788 The Great Observatories Origins Deep Survey: ESO Public Observations of the SIRTF Legacy/HST Treasury/Chandra Deep Field South).

  2. Change in genotype of methicillin-resistant Staphylococcus aureus (MRSA) affects the antibiogram of hospital-acquired MRSA.

    PubMed

    Harada, Dai; Nakaminami, Hidemasa; Miyajima, Eri; Sugiyama, Taku; Sasai, Nao; Kitamura, Yoshinobu; Tamura, Taku; Kawakubo, Takashi; Noguchi, Norihisa

    2018-07-01

    Recently, the dissemination of community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) into hospitals has frequently been reported worldwide. Hospital-acquired MRSA (HA-MRSA) strains exhibit high-level resistance to multiple antimicrobial agents, whereas CA-MRSA strains are usually susceptible to non-β-lactams. Thus, it is predicted that the antibiogram of the HA-MRSA population would change along with the change in genotype of MRSA. Here, we investigated the changes in the MRSA population along with the MRSA antibiogram in a hospital between 2010 and 2016. Staphylococcal cassette chromosome (SCC) mec typing showed that the predominant HA-MRSA strains in the hospital dramatically changed from SCCmec type II, which is the major type of HA-MRSA, to SCCmec type IV, which is the major type of CA-MRSA. Multilocus sequence typing revealed that the predominant SCCmec type IV strain was a clonal complex (CC) 8 clone, which is mainly found among CA-MRSA. Furthermore, the CC1-SCCmec type IV (CC1-IV) clone significantly increased. Both the CC8-IV and CC1-IV clones exhibited high antimicrobial susceptibility. The antibiogram change of the HA-MRSA population was consistent with the antimicrobial susceptibilities and increased prevalence of the CC8-IV and CC1-IV clones. Our data reveal that the change in the genotypes of MRSA strains could impact the antibiogram of HA-MRSA population. Copyright © 2018 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  3. DSM-IV antisocial personality disorder and conduct disorder: evidence for taxonic structures among individuals with and without substance use disorders in the general population.

    PubMed

    Kerridge, Bradley T; Saha, Tulshi D; Hasin, Deborah S

    2014-05-01

    The categorical-dimensional status of DSM-IV (Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition) conduct disorder (CD) and antisocial personality disorder (ASPD) is a source of controversy. This study examined whether the underlying structure of DSM-IV CD and ASPD was dimensional or categorical (taxonic) among individuals with and without substance use disorders. Using a national large representative survey of U.S. adults (n = 43,093), taxometric analyses of DSM-IV CD and ASPD diagnostic criteria were conducted on the total sample and among those with and without substance use disorders. Results of three taxometric procedures were consistent in showing that the structures underlying DSM-IV CD and ASPD were clearly taxonic in the total sample and among individuals with and without substance use disorders. Comparison curve fit indices exceeded 0.57 for each model. Taxonic findings of the present study were in contrast to the dimensional results of prior taxometric research among incarcerated samples with substantial comorbidity of antisocial syndromes and substance use disorders. Results supported the categorical representation and diagnostic thresholds of ASPD and CD as defined in DSM-IV and DSM-5. That the structure of ASPD and CD may be taxonic suggests that further research on these disorders use group comparative designs in which samples with and without these disorders are compared in terms of sociodemographic and clinical correlates, comorbidity, and treatment utilization. The taxonic structure of ASPD and CD may contribute to future research on causal processes through which these antisocial syndromes develop.

  4. First Detection of the Hatchett-McCray Effect in the High-Mass X-ray Binary

    NASA Technical Reports Server (NTRS)

    Sonneborn, G.; Iping, R. C.; Kaper, L.; Hammerschiag-Hensberge, G.; Hutchings, J. B.

    2004-01-01

    The orbital modulation of stellar wind UV resonance line profiles as a result of ionization of the wind by the X-ray source has been observed in the high-mass X-ray binary 4U1700-37/HD 153919 for the first time. Far-UV observations (905-1180 Angstrom, resolution 0.05 Angstroms) were made at the four quadrature points of the binary orbit with the Far Ultraviolet Spectroscopic Explorer (FUSE) in 2003 April and August. The O6.5 laf primary eclipses the X-ray source (neutron star or black hole) with a 3.41-day period. Orbital modulation of the UV resonance lines, resulting from X-ray photoionization of the dense stellar wind, the so-called Hatchett-McCray (HM) effect, was predicted for 4U1700-37/HD153919 (Hatchett 8 McCray 1977, ApJ, 211, 522) but was not seen in N V 1240, Si IV 1400, or C IV 1550 in IUE and HST spectra. The FUSE spectra show that the P V 1118-1128 and S IV 1063-1073 P-Cygni lines appear to vary as expected for the HM effect, weakest at phase 0.5 (X-ray source conjunction) and strongest at phase 0.0 (X-ray source eclipse). The phase modulation of the O VI 1032-1037 lines, however, is opposite to P V and S IV, implying that O VI may be a byproduct of the wind's ionization by the X-ray source. Such variations were not observed in N V, Si IV, and C IV because of their high optical depth. Due to their lower cosmic abundance, the P V and S IV wind lines are unsaturated, making them excellent tracers of the ionization conditions in the O star's wind.

  5. The Evolution of Quasar C IV and Si IV Broad Absorption Lines over Multi-year Timescales

    NASA Astrophysics Data System (ADS)

    Gibson, Robert R.; Brandt, W. N.; Gallagher, S. C.; Hewett, Paul C.; Schneider, Donald P.

    2010-04-01

    We investigate the variability of C IV λ1549 broad absorption line (BAL) troughs over rest-frame timescales of up to ≈7 yr in 14 quasars at redshifts z >~ 2.1. For nine sources at sufficiently high redshift, we also compare the C IV and Si IV λ1400 absorption variation. We compare shorter and longer term variability using spectra from up to four different epochs per source and find complex patterns of variation in the sample overall. The scatter in the change of absorption equivalent width (EW), ΔEW, increases with the time between observations. BALs do not, in general, strengthen or weaken monotonically, and variation observed over shorter (lsimmonths) timescales is not predictive of multi-year variation. We find no evidence for asymmetry in the distribution of ΔEW that would indicate that BALs form and decay on different timescales, and we constrain the typical BAL lifetime to be gsim30 yr. The BAL absorption for one source, LBQS 0022+0150, has weakened and may now be classified as a mini-BAL. Another source, 1235+1453, shows evidence of variable, blue continuum emission that is relatively unabsorbed by the BAL outflow. C IV and Si IV BAL shape changes are related in at least some sources. Given their high velocities, BAL outflows apparently traverse large spatial regions and may interact with parsec-scale structures such as an obscuring torus. Assuming BAL outflows are launched from a rotating accretion disk, notable azimuthal symmetry is required in the outflow to explain the relatively small changes observed in velocity structure over times up to 7 yr.

  6. Evaluation of hydrogenated resin acids as molecular markers for tire-wear debris in urban environments.

    PubMed

    Kumata, Hidetoshi; Mori, Mika; Takahashi, Sho; Takamiya, Shohei; Tsuzuki, Mikio; Uchida, Tatsuya; Fujiwara, Kitao

    2011-12-01

    To propose new molecular markers for tire-wear emissions, four dihydroresin acids, that is, 8-isopimaren-18-oic acid (I), 8-pimaren-18-oic acid (II), 13β(H)-abieten-18-oic acid (III), and 13α(H)-abiet-8-en-18-oic acid (IV), were identified and investigated for source specificities, distributions, and environmental stabilities. The absence of I-IV in natural sources and the linear correlations between dihydroresin acids with different skeletons in tires and in environmental samples demonstrated that I-IV are specific markers for synthetic rubbers. The ratio of III + IV to the sum of III + IV plus abietic acid showed the resin acids distribution between different environmental compartments receiving contributions from traffic and natural sources. The physicochemical properties and results of photolysis experiments suggested that I-IV can set lower limits for tire-wear contributions to environmental loads of particulate matter (PM) and polycyclic aromatic hydrocarbons with molecular weight ≥202. By comparing III + IV concentrations or (III+IV)/pyrene or (III+IV)/benzo[a]pyrene ratios in tires and those in environmental matrices, the contributions of tire-wear emissions to PM, pyrene, and benzo[a]pyrene were estimated to be 0.68 ± 0.54%, 6.9 ± 4.8%, and 0.37 ± 0.18% in roadside PM and 0.83 ± 0.21%, 0.88 ± 0.52%, and 0.08 ± 0.06% in rooftop PM.

  7. Augmenting the core battery with supplementary subtests: Wechsler adult intelligence scale--IV measurement invariance across the United States and Canada.

    PubMed

    Bowden, Stephen C; Saklofske, Donald H; Weiss, Lawrence G

    2011-06-01

    Examination of measurement invariance provides a powerful method to evaluate the hypothesis that the same set of psychological constructs underlies a set of test scores in different populations. If measurement invariance is observed, then the same psychological meaning can be ascribed to scores in both populations. In this study, the measurement model including core and supplementary subtests of the Wechsler Adult Intelligence Scale-Fourth edition (WAIS-IV) were compared across the U.S. and Canadian standardization samples. Populations were compared on the 15 subtest version of the test in people aged 70 and younger and on the 12 subtest version in people aged 70 or older. Results indicated that a slightly modified version of the four-factor model reported in the WAIS-IV technical manual provided the best fit in both populations and in both age groups. The null hypothesis of measurement invariance across populations was not rejected, and the results provide direct evidence for the generalizability of convergent and discriminant validity studies with the WAIS-IV across populations. Small to medium differences in latent means favoring Canadians highlight the value of local norms.

  8. LPA and PLG sequence variation and kringle IV-2 copy number in two populations.

    PubMed

    Crawford, Dana C; Peng, Ze; Cheng, Jan-Fang; Boffelli, Dario; Ahearn, Magdalena; Nguyen, Dan; Shaffer, Tristan; Yi, Qian; Livingston, Robert J; Rieder, Mark J; Nickerson, Deborah A

    2008-01-01

    Lp(a) levels have long been recognized as a potential risk factor for coronary heart disease that is almost completely under genetic control. Much of the genetics impacting Lp(a) levels has been attributed to the highly polymorphic LPA kringle IV-2 copy number variant, and most of the variance in Lp(a) levels in populations of European-descent is inversely correlated with kringle IV copy number. However, less of the variance is explained in African-descent populations for the same structural variation. African-descent populations have, on average, higher levels of Lp(a), suggesting other genetic factors contribute to Lp(a) level variability across populations. To identify potential cis-acting factors, we re-sequenced the gene LPA for single nucleotide polymorphism (SNP) discovery in 23 European-Americans and 24 African-Americans. We also re- sequenced the neighboring gene plasminogen (PLG) and genotyped the kringle IV copy number variant in the same reference samples. These data are the most comprehensive description of sequence variation in LPA and its relationship with the kringle IV copy number variant. With these data, we demonstrate that only a fraction of LPA sequence diversity has been previously documented. Also, we identify several high frequency SNPs present in the African-American sample but absent in the European-American sample. Finally, we show that SNPs within PLG are not in linkage disequilibrium with SNPs in LPA, and we show that kringle IV copy number variation is not in linkage disequilibrium with either LPA or PLG SNPs. Together, these data suggest that LPA SNPs could independently contribute to Lp(a) levels in the general population. Copyright (c) 2008 S. Karger AG, Basel.

  9. The use of alcohol use disorders identification test (AUDIT) in detecting alcohol use disorder and risk drinking in the general population: validation of AUDIT using schedules for clinical assessment in neuropsychiatry.

    PubMed

    Lundin, Andreas; Hallgren, Mats; Balliu, Natalja; Forsell, Yvonne

    2015-01-01

    The alcohol use disorders identification test (AUDIT) and AUDIT-Consumption (AUDIT-C) are commonly used in population surveys but there are few validations studies in the general population. Validity should be estimated in samples close to the targeted population and setting. This study aims to validate AUDIT and AUDIT-C in a general population sample (PART) in Stockholm, Sweden. We used a general population subsample age 20 to 64 that answered a postal questionnaire including AUDIT who later participated in a psychiatric interview (n = 1,093). Interviews using Schedules for Clinical Assessment in Neuropsychiatry was used as criterion standard. Diagnoses were set according to the fourth version of the Diagnostic and Statistical Manual of Mental Disorders (DSM-IV). Agreement between the diagnostic test and criterion standard was measured with area under the receiver operator characteristics curve (AUC). A total of 1,086 (450 men and 636 women) of the interview participants completed AUDIT. There were 96 individuals with DSM-IV-alcohol dependence, 36 DSM-IV-Alcohol Abuse, and 153 Risk drinkers. AUCs were for DSM-IV-alcohol use disorder 0.90 (AUDIT-C 0.85); DSM-IV-dependence 0.94 (AUDIT-C 0.89); risk drinking 0.80 (AUDIT-C 0.80); and any criterion 0.87 (AUDIT-C 0.84). In this general population sample, AUDIT and AUDIT-C performed outstanding or excellent in identifying dependency, risk drinking, alcohol use disorder, any disorder, or risk drinking. Copyright © 2015 by the Research Society on Alcoholism.

  10. Lyα emitters in the GOODS-S field. A powerful pure nebular SED with N IV] emission at z = 5.563

    NASA Astrophysics Data System (ADS)

    Raiter, A.; Fosbury, R. A. E.; Teimoorinia, H.

    2010-02-01

    Context. The Great Observatories Origins Deep Survey (GOODS) has provided us with one of the deepest multi-wavelength views of the distant universe. The combination of multi-band photometry and optical spectroscopy has resulted in the identification of sources whose redshifts extend to values in excess of six. Amongst these distant sources are Lyα emitters whose nature must be deduced by clearly identifying the different components that contribute to the measured SED. Aims: From a sample of Lyα emitters in the GOODS-S field with uncontaminated photometry and optical (red) spectroscopy, we select a spatially compact object at a redshift of 5.563 (Lyα) that shows a second emission line, identified as N IV] 1486 Å. The SED is modelled in a way that accounts for both the N IV] line emission and the photometry in a self-consistent way. Methods: The photoionization code CLOUDY is used to calculate a range of nebular models as a function of stellar ionizing source temperature, ionization parameter, density and nebular metallicity. We compare the theoretical and observed magnitudes and search for the model parameters that also reproduce the observed N IV] luminosity and equivalent width. Results: A nebular model with a hot blackbody ionizing source of around 100 kK and a nebular metallicity of ~5% of solar is able to fit the observed SED and, in particular, explain the large apparent Balmer break which is inferred from the pure stellar population model fitting conventionally applied to multi-band photometric observations. In our model, an apparent spectral break is produced by strong [O III] 4959, 5007 Å emission falling in one of the IR bands (IRAC1 in this case). A lower limit on the total baryonic mass of a model of this type is 3.2 ×10^8~M⊙. Conclusions: It is argued that objects with Lyα emission at high redshift that show an apparent Balmer break may have their SED dominated by nebular emission and so could possibly be identified with very young starbursting galaxies rather than massive evolved stellar populations. Detailed studies of these emission nebulæ with large telescopes will provide a unique insight into very early chemical evolution. Based on observations made at the European Southern Observatory, Paranal, Chile (ESO programme 170.A-0788) The Great Observatories Origins Deep Survey: ESO Public Observations of the SIRTF Legacy/HST Treasury/Chandra Deep Field South.); on observations obtained with the NASA/ESA Hubble Space Telescope obtained at the Space Telescope Science Institute, which is operated by the Association of Universities for Research in Astronomy (AURA), Inc.; and on observations made with the Spitzer Space Telescope, which is operated by the Jet Propulsion Laboratory, California Institute of Technology under a contract with NASA.

  11. Patterns of Treatment Switching in Multiple Sclerosis Therapies in US Patients Active on Social Media: Application of Social Media Content Analysis to Health Outcomes Research.

    PubMed

    Risson, Valéry; Saini, Deepanshu; Bonzani, Ian; Huisman, Alice; Olson, Melvin

    2016-03-17

    Social media analysis has rarely been applied to the study of specific questions in outcomes research. The aim was to test the applicability of social media analysis to outcomes research using automated listening combined with filtering and analysis of data by specialists. After validation, the process was applied to the study of patterns of treatment switching in multiple sclerosis (MS). A comprehensive listening and analysis process was developed that blended automated listening with filtering and analysis of data by life sciences-qualified analysts and physicians. The population was patients with MS from the United States. Data sources were Facebook, Twitter, blogs, and online forums. Sources were searched for mention of specific oral, injectable, and intravenous (IV) infusion treatments. The representativeness of the social media population was validated by comparison with community survey data and with data from three large US administrative claims databases: MarketScan, PharMetrics Plus, and Department of Defense. A total of 10,260 data points were sampled for manual review: 3025 from Twitter, 3771 from Facebook, 2773 from Internet forums, and 691 from blogs. The demographics of the social media population were similar to those reported from community surveys and claims databases. Mean age was 39 (SD 11) years and 14.56% (326/2239) of the population was older than 50 years. Women, patients aged 30 to 49 years, and those diagnosed for more than 10 years were represented by more data points than other patients were. Women also accounted for a large majority (82.6%, 819/991) of reported switches. Two-fifths of switching patients had lived with their disease for more than 10 years since diagnosis. Most reported switches (55.05%, 927/1684) were from injectable to oral drugs with switches from IV therapies to orals the second largest switch (15.38%, 259/1684). Switches to oral drugs accounted for more than 80% (927/1114) of the switches away from injectable therapies. Four reasons accounted for more than 90% of all switches: severe side effects, lack of efficacy, physicians' advice, and greater ease of use. Side effects were the main reason for switches to oral or to injectable therapies and search for greater efficacy was the most important factor in switches to IV therapies. Cost of medication was the reason for switching in less than 0.5% of patients. Social intelligence can be applied to outcomes research with power to analyze MS patients' personal experiences of treatments and to chart the most common reasons for switching between therapies.

  12. DSM-IV Antisocial Personality Disorder and Conduct Disorder: Evidence for Taxonic Structures Among Individuals With and Without Substance Use Disorders in the General Population

    PubMed Central

    Kerridge, Bradley T; Saha, Tulshi D; Hasin, Deborah S

    2014-01-01

    Objective: The categorical-dimensional status of DSM-IV (Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition) conduct disorder (CD) and antisocial personality disorder (ASPD) is a source of controversy. This study examined whether the underlying structure of DSM-IV CD and ASPD was dimensional or categorical (taxonic) among individuals with and without substance use disorders. Method: Using a national large representative survey of U.S. adults (n = 43,093), taxometric analyses of DSM-IV CD and ASPD diagnostic criteria were conducted on the total sample and among those with and without substance use disorders. Results: Results of three taxometric procedures were consistent in showing that the structures underlying DSM-IV CD and ASPD were clearly taxonic in the total sample and among individuals with and without substance use disorders. Comparison curve fit indices exceeded 0.57 for each model. Conclusions: Taxonic findings of the present study were in contrast to the dimensional results of prior taxometric research among incarcerated samples with substantial comorbidity of antisocial syndromes and substance use disorders. Results supported the categorical representation and diagnostic thresholds of ASPD and CD as defined in DSM-IV and DSM-5. That the structure of ASPD and CD may be taxonic suggests that further research on these disorders use group comparative designs in which samples with and without these disorders are compared in terms of sociodemographic and clinical correlates, comorbidity, and treatment utilization. The taxonic structure of ASPD and CD may contribute to future research on causal processes through which these antisocial syndromes develop. PMID:24766762

  13. Multi-Hazard Interactions in Guatemala

    NASA Astrophysics Data System (ADS)

    Gill, Joel; Malamud, Bruce D.

    2017-04-01

    In this paper, we combine physical and social science approaches to develop a multi-scale regional framework for natural hazard interactions in Guatemala. The identification and characterisation of natural hazard interactions is an important input for comprehensive multi-hazard approaches to disaster risk reduction at a regional level. We use five transdisciplinary evidence sources to organise and populate our framework: (i) internationally-accessible literature; (ii) civil protection bulletins; (iii) field observations; (iv) stakeholder interviews (hazard and civil protection professionals); and (v) stakeholder workshop results. These five evidence sources are synthesised to determine an appropriate natural hazard classification scheme for Guatemala (6 hazard groups, 19 hazard types, and 37 hazard sub-types). For a national spatial extent (Guatemala), we construct and populate a "21×21" hazard interaction matrix, identifying 49 possible interactions between 21 hazard types. For a sub-national spatial extent (Southern Highlands, Guatemala), we construct and populate a "33×33" hazard interaction matrix, identifying 112 possible interactions between 33 hazard sub-types. Evidence sources are also used to constrain anthropogenic processes that could trigger natural hazards in Guatemala, and characterise possible networks of natural hazard interactions (cascades). The outcomes of this approach are among the most comprehensive interaction frameworks for national and sub-national spatial scales in the published literature. These can be used to support disaster risk reduction and civil protection professionals in better understanding natural hazards and potential disasters at a regional scale.

  14. AN ERUPTIVE HOT-CHANNEL STRUCTURE OBSERVED AT METRIC WAVELENGTH AS A MOVING TYPE-IV SOLAR RADIO BURST

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vasanth, V.; Chen, Yao; Feng, Shiwei

    2016-10-10

    Hot-channel (HC) structure, observed in the high-temperature passbands of the Atmospheric Imaging Assembly/ Solar Dynamic Observatory , is regarded as one candidate of coronal flux rope that is an essential element of solar eruptions. Here, we present the first radio imaging study of an HC structure in the metric wavelength. The associated radio emission manifests as a moving type-IV (t-IVm) burst. We show that the radio sources co-move outward with the HC, indicating that the t-IV emitting energetic electrons are efficiently trapped within the structure. The t-IV sources at different frequencies present no considerable spatial dispersion during the early stagemore » of the event, while the sources spread gradually along the eruptive HC structure at later stage with significant spatial dispersion. The t-IV bursts are characterized by a relatively high brightness temperature (∼10{sup 7}–10{sup 9} K), a moderate polarization, and a spectral shape that evolves considerably with time. This study demonstrates the possibility of imaging the eruptive HC structure at the metric wavelength and provides strong constraints on the t-IV emission mechanism, which, if understood, can be used to diagnose the essential parameters of the eruptive structure.« less

  15. The prevalence of ADHD in a population-based sample

    PubMed Central

    Rowland, Andrew S.; Skipper, Betty J.; Umbach, David M.; Rabiner, David L.; Campbell, Richard A.; Naftel, A. Jack; Sandler, Dale P.

    2014-01-01

    Objective Few studies of ADHD prevalence have used population-based samples, multiple informants, and DSM-IV criteria. In addition, children who are asymptomatic while receiving ADHD mediction often have been misclassified. Therefore, we conducted a population-based study to estimate the prevalence of ADHD in elementary school children using DSM-IV critera. Methods We screened 7587 children for ADHD. Teachers of 81% of the children completed a DSM-IV checklist. We then interviewed parents using a structured interview (DISC). Of these, 72% participated. Parent and teacher ratings were combined to determine ADHD status. We also estimated the proportion of cases attributable to other conditions. Results Overall, 15.5% of our sample (95% confidence interval (C.I.) 14.6%-16.4%) met DSM-IV-TR criteria for ADHD. Over 40% of cases reported no previous diagnosis. With additional information, other conditions explained about 9% of cases. Conclusions The prevalence of ADHD in this population-based sample was higher than the 3-7% commonly reported. To compare study results, the methods used to implement the DSM criteria need to be standardized. PMID:24336124

  16. Lipids during Bufo arenarum oogenesis.

    PubMed

    Bruzzone, Ariana; Buschiazzo, Jorgelina; Alonso, Telma S

    2003-05-01

    The content and composition of phospholipids and triacylglycerols (TAGs) in Bufo arenarum oocytes in stages III and IV of their oogenesis were studied. The total amount of phospholipids in stage IV oocytes is 0.5-fold higher than in stage III oocytes. In both cases, the main phospholipids are phosphatidylcholine (PC) and phosphatidylethanolamine (PE). A striking observation concerns the high level of diphosphatidylglycerol (DPG) in stage III oocytes, which could be indicative of a relatively larger mitochondrial population with respect to other oogenetic stages. A net increase in sphingomyelin content was found during oogenesis. This fact could be related to the role of this phospholipid in the signal transductional pathways. In PC, palmitic (16:0), linoleic (18:2) and oleic (18:1) are the major fatty acids for both types of oocytes, while in PE the main acyl groups are 18:1, 16:0, arachidonic acid (20:4n6) and 18:2. PE is more unsaturated than PC and both phospholipids are more unsaturated in stage III oocytes than in stage IV oocytes. The amount of triacylglycerols is 0.3-fold higher in stage IV oocytes than in stage III oocytes. In both stages, the main fatty acids are 18:2, 18:1 and 16:0. During oogenesis, a significant increase in 18:1 and 18:3n3, and a decrease in 18:2 of TAG were found. The unsaturation index of TAGs from stage IV oocytes is higher than that from stage III oocytes. The TAG increase during oogenesis is consistent with the putative use of these lipids as a source of energy in embryo development.

  17. Disentangling the complex evolutionary history of the Western Palearctic blue tits (Cyanistes spp.) - phylogenomic analyses suggest radiation by multiple colonization events and subsequent isolation.

    PubMed

    Stervander, Martin; Illera, Juan Carlos; Kvist, Laura; Barbosa, Pedro; Keehnen, Naomi P; Pruisscher, Peter; Bensch, Staffan; Hansson, Bengt

    2015-05-01

    Isolated islands and their often unique biota continue to play key roles for understanding the importance of drift, genetic variation and adaptation in the process of population differentiation and speciation. One island system that has inspired and intrigued evolutionary biologists is the blue tit complex (Cyanistes spp.) in Europe and Africa, in particular the complex evolutionary history of the multiple genetically distinct taxa of the Canary Islands. Understanding Afrocanarian colonization events is of particular importance because of recent unconventional suggestions that these island populations acted as source of the widespread population in mainland Africa. We investigated the relationship between mainland and island blue tits using a combination of Sanger sequencing at a population level (20 loci; 12 500 nucleotides) and next-generation sequencing of single population representatives (>3 200 000 nucleotides), analysed in coalescence and phylogenetic frameworks. We found (i) that Afrocanarian blue tits are monophyletic and represent four major clades, (ii) that the blue tit complex has a continental origin and that the Canary Islands were colonized three times, (iii) that all island populations have low genetic variation, indicating low long-term effective population sizes and (iv) that populations on La Palma and in Libya represent relicts of an ancestral North African population. Further, demographic reconstructions revealed (v) that the Canary Islands, conforming to traditional views, hold sink populations, which have not served as source for back colonization of the African mainland. Our study demonstrates the importance of complete taxon sampling and an extensive multimarker study design to obtain robust phylogeographical inferences. © 2015 John Wiley & Sons Ltd.

  18. Evidence that 50% of BALQSO Outflows Are Situated at Least 100 pc from the Central Source

    NASA Astrophysics Data System (ADS)

    Arav, Nahum; Liu, Guilin; Xu, Xinfeng; Stidham, James; Benn, Chris; Chamberlain, Carter

    2018-04-01

    The most robust way for determining the distance of quasar absorption outflows is the use of troughs from ionic excited states. The column density ratio between the excited and resonance states yields the outflow number density. Combined with a knowledge of the outflow’s ionization parameter, a distance from the central source (R) can be determined. Here we report results from two surveys targeting outflows that show troughs from S IV. One survey includes 1091 SDSS and BOSS quasar spectra, and the other includes higher-quality spectra of 13 quasars observed with the Very Large Telescope. Our S IV samples include 38 broad absorption line (BAL) outflows and four mini-BAL outflows. The S IV is formed in the same physical region of the outflow as the canonical outflow-identifying species C IV. Our results show that S IV absorption is only detected in 25% of C IV BAL outflows. The smaller detection fraction is due to the higher total column density (N H) needed to detect S IV absorption. Since R empirically anticorrelates with N H, the results of these surveys can be extrapolated to C IV quasar outflows with lower N H as well. We find that at least 50% of quasar outflows are at distances larger than 100 pc from the central source, and at least 12% are at distances larger than 1000 pc. These results have profound implications for the study of the origin and acceleration mechanism of quasar outflows and their effects on the host galaxy.

  19. A Solar Stationary Type IV Radio Burst and Its Radiation Mechanism

    NASA Astrophysics Data System (ADS)

    Liu, Hongyu; Chen, Yao; Cho, Kyungsuk; Feng, Shiwei; Vasanth, Veluchamy; Koval, Artem; Du, Guohui; Wu, Zhao; Li, Chuanyang

    2018-04-01

    A stationary Type IV (IVs) radio burst was observed on September 24, 2011. Observations from the Nançay RadioHeliograph (NRH) show that the brightness temperature (TB) of this burst is extremely high, over 10^{11} K at 150 MHz and over 108 K in general. The degree of circular polarization (q) is between -60% ˜ -100%, which means that it is highly left-handed circularly polarized. The flux-frequency spectrum follows a power-law distribution, and the spectral index is considered to be roughly -3 ˜ -4 throughout the IVs. Radio sources of this event are located in the wake of the coronal mass ejection and are spatially dispersed. They line up to present a formation in which lower-frequency sources are higher. Based on these observations, it is suggested that the IVs was generated through electron cyclotron maser emission.

  20. IN-SYNC. IV. The Young Stellar Population in the Orion A Molecular Cloud

    NASA Astrophysics Data System (ADS)

    Da Rio, Nicola; Tan, Jonathan C.; Covey, Kevin R.; Cottaar, Michiel; Foster, Jonathan B.; Cullen, Nicholas C.; Tobin, John J.; Kim, Jinyoung S.; Meyer, Michael R.; Nidever, David L.; Stassun, Keivan G.; Chojnowski, S. Drew; Flaherty, Kevin M.; Majewski, Steve; Skrutskie, Michael F.; Zasowski, Gail; Pan, Kaike

    2016-02-01

    We present the results of the Sloan Digital Sky Survey APOGEE INfrared Spectroscopy of Young Nebulous Clusters program (IN-SYNC) survey of the Orion A molecular cloud. This survey obtained high-resolution near-infrared spectroscopy of about 2700 young pre-main-sequence stars on a ˜ 6^\\circ field of view. We have measured accurate stellar parameters ({T}{{eff}}, {log}g, v{sin}I) and extinctions and placed the sources in the Hertzsprung-Russel diagram (HRD). We have also extracted radial velocities for the kinematic characterization of the population. We compare our measurements with literature results to assess the performance and accuracy of the survey. Source extinction shows evidence for dust grains that are larger than those in the diffuse interstellar medium: we estimate an average RV = 5.5 in the region. Importantly, we find a clear correlation between HRD inferred ages and spectroscopic surface-gravity-inferred ages and between extinction and disk presence; this strongly suggests a real spread of ages larger than a few Myr. Focusing on the young population around NGC 1980/ι Ori, which has previously been suggested to be a separate, foreground, older cluster, we confirm its older (˜5 Myr) age and low AV, but considering that its radial velocity distribution is indistinguishable from Orion A’s population, we suggest that NGC 1980 is part of Orion A’s star formation activity. Based on their stellar parameters and kinematic properties, we identify 383 new candidate members of Orion A, most of which are diskless sources in areas of the region poorly studied by previous works.

  1. Nuclear and Chloroplast Microsatellites Show Multiple Introductions in the Worldwide Invasion History of Common Ragweed, Ambrosia artemisiifolia

    PubMed Central

    Gaudeul, Myriam; Giraud, Tatiana; Kiss, Levente; Shykoff, Jacqui A.

    2011-01-01

    Background Ambrosia artemisiifolia is a North American native that has become one of the most problematic invasive plants in Europe and Asia. We studied its worldwide population genetic structure, using both nuclear and chloroplast microsatellite markers and an unprecedented large population sampling. Our goals were (i) to identify the sources of the invasive populations; (ii) to assess whether all invasive populations were founded by multiple introductions, as previously found in France; (iii) to examine how the introductions have affected the amount and structure of genetic variation in Europe; (iv) to document how the colonization of Europe proceeded; (v) to check whether populations exhibit significant heterozygote deficiencies, as previously observed. Principal Findings We found evidence for multiple introductions of A. artemisiifolia, within regions but also within populations in most parts of its invasive range, leading to high levels of diversity. In Europe, introductions probably stem from two different regions of the native area: populations established in Central Europe appear to have originated from eastern North America, and Eastern European populations from more western North America. This may result from differential commercial exchanges between these geographic regions. Our results indicate that the expansion in Europe mostly occurred through long-distance dispersal, explaining the absence of isolation by distance and the weak influence of geography on the genetic structure in this area in contrast to the native range. Last, we detected significant heterozygote deficiencies in most populations. This may be explained by partial selfing, biparental inbreeding and/or a Wahlund effect and further investigation is warranted. Conclusions This insight into the sources and pathways of common ragweed expansion may help to better understand its invasion success and provides baseline data for future studies on the evolutionary processes involved during range expansion in novel environments. PMID:21423697

  2. Using the urtA Gene to Profile Nitrogen Stress Adaptation and Spatio-Temporal Abundance of Synechococcus Clades in the California Current System

    NASA Astrophysics Data System (ADS)

    Chatterjee, T.; Shilova, I. N.; Zehr, J. P.

    2015-12-01

    Among the planet's most abundant photosynthetic groups, the picocyanobacteria Synechococcus contributes nearly a quarter of our global oxygen supply. Urea, from both natural and anthropogenic sources, is an important alternative to the preferred yet limited sources of reduced nitrogen for cyanobacteria in the marine environment. While urea uptake activity has been observed during nitrogen (N) limitation, this stress adaptation is not well-studied in natural habitats. We propose the urtAgene, which encodes the substrate-binding subunit of the urea-uptake ABC transporter, as a molecular marker to profile cell abundance and stress response in relation to N fluctuation. Strains prevalent in temperate waters of the California Current System - Synechococcus CC9311 (clade I), CC9605 (clade II) and CC9902/BL107 (clade IV) - were targeted by clade-specific qPCR assays to measure urtA gene copy abundance in samples from different geographical stations and a time-series. Spatial and seasonal patterns in clade abundance resembled those previously reported by studies using other Synechococcus marker genes, thus validating urtA as a strong marker. Synechococcus clades I and IV were most abundant in coastal and transitional stations, while the more oligotrophic clade II was detected near open waters. Synechococcus abundances were highest before and after the annual upwelling season, as supported by a non clade-specific rbcL-qPCR assay. A lack of correlation between abundance and nitrate availability indicated utilization of alternative nitrogen sources like urea, which was further evidenced by the detection of clade IV urtA transcripts at the station closest to shore. Urea concentrations tend to be highest in coastal environments due to fertilizer runoff, which can stimulate phytoplankton blooms including harmful algal blooms. This study adds to insight on how such environmental factors are related to N-cycling and patterns of urea-assimilating microbial populations like Synechococcus subgroups in the California Current waters of the Pacific Ocean.

  3. Population pharmacokinetics of unbound hydrocortisone in critically ill neonates and infants with vasopressor-resistant hypotension.

    PubMed

    Vezina, Heather E; Ng, Chee M; Vazquez, Delia M; Barks, John D; Bhatt-Mehta, Varsha

    2014-07-01

    To determine the population pharmacokinetics of unbound hydrocortisone in critically ill neonates and infants receiving IV hydrocortisone for treatment of vasopressor-resistant hypotension and to identify patient-specific sources of pharmacokinetic variability. Prospective observational cohort study. Level 3 neonatal ICU. Sixty-two critically ill neonates and infants receiving IV hydrocortisone as part of standard of care for the treatment of vasopressor-resistant hypotension: median gestational age 28 weeks (range, 23-41), median weight 1.2 kg (range, 0.5-4.4), and 29 females. None. Unbound baseline cortisol and postdose hydrocortisone concentrations measured from blood samples being drawn for routine laboratory tests. A one-compartment model best described the data. Allometric weight and postmenstrual age were significant covariates on unbound hydrocortisone clearance and volume of distribution. Final population estimates for clearance, volume of distribution, and baseline cortisol concentration were 20.2 L/hr, 244 L, and 1.37 ng/mL, respectively. Using the median weight and postmenstrual age of our subjects (i.e., 1.2 kg and 28 wk) in the final model, the typical unbound hydrocortisone clearance and volume of distribution were 1.0 L/hr and 4.2 L, respectively. The typical half-life for unbound hydrocortisone was 2.9 hours. A sharp and continuous increase in unbound hydrocortisone clearance was observed at 35 weeks postmenstrual age. We report the first pharmacokinetic data for unbound hydrocortisone, the pharmacologically active moiety, in critically ill neonates and infants with vasopressor-resistant hypotension. Unbound hydrocortisone clearance increased with body weight and was faster in children with an older postmenstrual age. Unbound hydrocortisone clearance increased sharply at 35 weeks postmenstrual age and continued to mature thereafter. This study lays the groundwork for evaluating unbound hydrocortisone exposure-response relationships and drawing definitive conclusions about the dosing of IV hydrocortisone in critically ill neonates and infants with vasopressor-resistant hypotension.

  4. The 10/66 Dementia Research Group's fully operationalised DSM-IV dementia computerized diagnostic algorithm, compared with the 10/66 dementia algorithm and a clinician diagnosis: a population validation study

    PubMed Central

    Prince, Martin J; de Rodriguez, Juan Llibre; Noriega, L; Lopez, A; Acosta, Daisy; Albanese, Emiliano; Arizaga, Raul; Copeland, John RM; Dewey, Michael; Ferri, Cleusa P; Guerra, Mariella; Huang, Yueqin; Jacob, KS; Krishnamoorthy, ES; McKeigue, Paul; Sousa, Renata; Stewart, Robert J; Salas, Aquiles; Sosa, Ana Luisa; Uwakwa, Richard

    2008-01-01

    Background The criterion for dementia implicit in DSM-IV is widely used in research but not fully operationalised. The 10/66 Dementia Research Group sought to do this using assessments from their one phase dementia diagnostic research interview, and to validate the resulting algorithm in a population-based study in Cuba. Methods The criterion was operationalised as a computerised algorithm, applying clinical principles, based upon the 10/66 cognitive tests, clinical interview and informant reports; the Community Screening Instrument for Dementia, the CERAD 10 word list learning and animal naming tests, the Geriatric Mental State, and the History and Aetiology Schedule – Dementia Diagnosis and Subtype. This was validated in Cuba against a local clinician DSM-IV diagnosis and the 10/66 dementia diagnosis (originally calibrated probabilistically against clinician DSM-IV diagnoses in the 10/66 pilot study). Results The DSM-IV sub-criteria were plausibly distributed among clinically diagnosed dementia cases and controls. The clinician diagnoses agreed better with 10/66 dementia diagnosis than with the more conservative computerized DSM-IV algorithm. The DSM-IV algorithm was particularly likely to miss less severe dementia cases. Those with a 10/66 dementia diagnosis who did not meet the DSM-IV criterion were less cognitively and functionally impaired compared with the DSMIV confirmed cases, but still grossly impaired compared with those free of dementia. Conclusion The DSM-IV criterion, strictly applied, defines a narrow category of unambiguous dementia characterized by marked impairment. It may be specific but incompletely sensitive to clinically relevant cases. The 10/66 dementia diagnosis defines a broader category that may be more sensitive, identifying genuine cases beyond those defined by our DSM-IV algorithm, with relevance to the estimation of the population burden of this disorder. PMID:18577205

  5. Segregation and recombination of a multipartite mitochondrial DNA in populations of the potato cyst nematode Globodera pallida.

    PubMed

    Armstrong, Miles R; Husmeier, Dirk; Phillips, Mark S; Blok, Vivian C

    2007-06-01

    The discovery that the potato cyst nematode Globodera pallida has a multipartite mitochondrial DNA (mtDNA) composed, at least in part, of six small circular mtDNAs (scmtDNAs) raised a number of questions concerning the population-level processes that might act on such a complex genome. Here we report our observations on the distribution of some scmtDNAs among a sample of European and South American G. pallida populations. The occurrence of sequence variants of scmtDNA IV in population P4A from South America, and that particular sequence variants are common to the individuals within a single cyst, is described. Evidence for recombination of sequence variants of scmtDNA IV in P4A is also reported. The mosaic structure of P4A scmtDNA IV sequences was revealed using several detection methods and recombination breakpoints were independently detected by maximum likelihood and Bayesian MCMC methods.

  6. RACIAL DISPARITIES IN TPA TREATMENT RATE FOR STROKE: A POPULATION-BASED STUDY

    PubMed Central

    Hsia, Amie W.; Edwards, Dorothy F.; Morgenstern, Lewis B.; Wing, Jeffrey J.; Brown, Nina C.; Coles, Regina; Loftin, Sarah; Wein, Andrea; Koslosky, Sara S.; Fatima, Sabiha; Fokar, Ali; Gibbons, M. Chris; Jayam-Trouth, Annapurni; Kidwell, Chelsea S.

    2011-01-01

    Background Some prior studies have shown that racial disparities exist in intravenous tissue plasminogen activator (IV tPA) utilization for acute ischemic stroke. We sought to determine whether race was associated with tPA treatment for stroke in a predominantly black urban population. Methods Systematic chart abstraction was performed on consecutive hospitalized ischemic stroke patients from all seven acute care hospitals in the District of Columbia from Feb 1, 2008 to Jan 31, 2009. Results Of 1044 ischemic stroke patients, 74%% were black, 19% non-Hispanic white, 5% received IV tPA. Blacks were one third less likely than whites to receive IV tPA (3% vs. 10%, p<0.001). However, blacks were also less likely than whites to present within 3 hours of symptom onset (13% vs. 21%, p=0.004) and also less likely to be tPA-eligible (5% vs. 13%, p<0.001). Of those who presented within 3 hours, blacks were almost half as likely to be treated with IV tPA than whites (27% vs. 46%, p=0.023). The treatment rate for tPA-eligible patients was similar for blacks and whites (70% vs. 76%, p=0.62). Conclusions In this predominantly black urban population hospitalized for acute ischemic stroke, blacks were significantly less likely to be treated with IV tPA due to contraindications to treatment, delayed presentation, and stroke severity. Effective interventions designed to increase treatment in this population need to focus on culturally relevant education programs designed to address barriers specific to this population. PMID:21719765

  7. Independent Validation and Verification of automated information systems in the Department of Energy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hunteman, W.J.; Caldwell, R.

    1994-07-01

    The Department of Energy (DOE) has established an Independent Validation and Verification (IV&V) program for all classified automated information systems (AIS) operating in compartmented or multi-level modes. The IV&V program was established in DOE Order 5639.6A and described in the manual associated with the Order. This paper describes the DOE IV&V program, the IV&V process and activities, the expected benefits from an IV&V, and the criteria and methodologies used during an IV&V. The first IV&V under this program was conducted on the Integrated Computing Network (ICN) at Los Alamos National Laboratory and several lessons learned are presented. The DOE IV&Vmore » program is based on the following definitions. An IV&V is defined as the use of expertise from outside an AIS organization to conduct validation and verification studies on a classified AIS. Validation is defined as the process of applying the specialized security test and evaluation procedures, tools, and equipment needed to establish acceptance for joint usage of an AIS by one or more departments or agencies and their contractors. Verification is the process of comparing two levels of an AIS specification for proper correspondence (e.g., security policy model with top-level specifications, top-level specifications with source code, or source code with object code).« less

  8. Laser and Light Treatments for Hair Reduction in Fitzpatrick Skin Types IV-VI: A Comprehensive Review of the Literature.

    PubMed

    Fayne, Rachel A; Perper, Marina; Eber, Ariel E; Aldahan, Adam S; Nouri, Keyvan

    2018-04-01

    Unwanted facial and body hair presents as a common finding in many patients, such as females with hirsutism. With advances in laser and light technology, a clinically significant reduction in hair can be achieved in patients with light skin. However, in patients with darker skin, Fitzpatrick skin types (FST) IV-VI, the higher melanin content of the skin interferes with the proposed mechanism of laser-induced selective photothermolysis, which is to target the melanin in the hair follicle to cause permanent destruction of hair bulge stem cells. Many prospective and retrospective studies have been conducted with laser and light hair-removal devices, but most exclude patients with darkly pigmented skin, considering them a high-risk group for unwanted side effects, including pigmentation changes, blisters, and crust formation. We reviewed the published literature to obtain studies that focused on hair reduction for darker skin types. The existing literature for this patient population identifies longer wavelengths as a key element of the treatment protocol and indicates neodymium-doped yttrium aluminum garnet (Nd:YAG), diode, alexandrite, and ruby lasers as well as certain intense pulsed light sources for safe hair reduction with minimal side effects in patients with FST IV-VI, so long as energy settings and wavelengths are appropriate. Based on the findings in this review, safe and effective hair reduction for patients with FST IV-VI is achievable under proper treatment protocols and energy settings.

  9. Utilization of on-site resources for Regenerative Life Support Systems at a lunar outpost

    NASA Technical Reports Server (NTRS)

    Ming, D. W.; Golden, D. C.; Henninger, D. L.

    1992-01-01

    Regenerative life support systems (RLSS) will be required to regenerate air, water, and wastes, and to produce food for human consumption during long-duration stays on the moon. It may be possible to supplement some of the materials needed for RLSS from resources on the moon. Natural materials at the lunar surface may be used for a variety of lunar RLSS needs, including (i) soils or solid-support substrates for plant growth, (ii) sources for extraction of essential, plant-growth nutrients, (iii) substrates for microbial populations in the degradation of wastes, (iv) sources of O2 and H, which may be used to manufacture water, (v) feed stock materials for the synthesis of useful minerals (e.g., molecular sieves), and (vi) shielding materials surrounding the outpost structure to protect humans, plants, and microorganisms from harmful radiation.

  10. VizieR Online Data Catalog: MGIV (Fourth MIT-Green Bank) 5GHz Survey (Griffith+ 1991)

    NASA Astrophysics Data System (ADS)

    Griffith, M.; Langston, G.; Heflin, M.; Conner, S.; Burke, B.

    1998-10-01

    The MIT-Green Bank IV (MG IV) 5 GHz survey covers 0.504 sr of sky in the right ascension range 15.5 to 2.5 hours, between +37.00 and +50.98 degrees declination (B1950). The final MG IV catalog contains 3427 sources detected with a signal-to-noise ratio greater than 5. The catalog was produced from two separate north and south surveys with the National Radio Astronomy Observatory (NRAO) 91m transit telescope. The north survey was produced from data collected while scanning the telescope north from +39.0 to +50.98 degrees declination and the south survey from data collected from scans from +48.98 to +37.00 degrees declination. The completeness and reliability of the final source list is checked by examination of north and south source lists in a twice observed comparison region, lying between +39.15 and +48.83 degrees declination and excluding the area between +/-10 degrees Galactic latitude. The comparison region covers 0.270 sr of sky and contains 1094 sources. In this region, the MG IV catalog contains 423 sources brighter than 90 mJy and is shown to be 99.1 +/- 1.2% complete at this flux density level. Spectral indices are computed for sources identified in the NRAO 1400 MHz Survey (published by Condon and Broderick in 1985). A comparison of the spectral index distributions between +/- 10 and outside of +/- 10 degrees Galactic latitude is presented. (1 data file).

  11. Prolonged survival of dendritic cell-vaccinated melanoma patients correlates with tumor-specific delayed type IV hypersensitivity response and reduction of tumor growth factor beta-expressing T cells.

    PubMed

    López, Mercedes N; Pereda, Cristian; Segal, Gabriela; Muñoz, Leonel; Aguilera, Raquel; González, Fermín E; Escobar, Alejandro; Ginesta, Alexandra; Reyes, Diego; González, Rodrigo; Mendoza-Naranjo, Ariadna; Larrondo, Milton; Compán, Alvaro; Ferrada, Carlos; Salazar-Onfray, Flavio

    2009-02-20

    The aim of this work was to assess immunologic response, disease progression, and post-treatment survival of melanoma patients vaccinated with autologous dendritic cells (DCs) pulsed with a novel allogeneic cell lysate (TRIMEL) derived from three melanoma cell lines. Forty-three stage IV and seven stage III patients were vaccinated four times with TRIMEL/DC vaccine. Specific delayed type IV hypersensitivity (DTH) reaction, ex vivo cytokine production, and regulatory T-cell populations were determined. Overall survival and disease progression rates were analyzed using Kaplan-Meier curves and compared with historical records. The overall survival for stage IV patients was 15 months. More than 60% of patients showed DTH-positive reaction against the TRIMEL. Stage IV/DTH-positive patients displayed a median survival of 33 months compared with 11 months observed for DTH-negative patients (P = .0014). All stage III treated patients were DTH positive and remained alive and tumor free for a median follow-up period of 48 months (range, 33 to 64 months). DTH-positive patients showed a marked reduction in the proportion of CD4+ transforming growth factor (TGF) beta+ regulatory T cells compared to DTH-negative patients (1.54% v 5.78%; P < .0001). Our findings strongly suggest that TRIMEL-pulsed DCs provide a standardized and widely applicable source of melanoma antigens, very effective in evoking antimelanoma immune response. To our knowledge, this is the first report describing a correlation between vaccine-induced reduction of CD4+TGFbeta+ regulatory T cells and in vivo antimelanoma immune response associated to improved patient survival and disease stability.

  12. Quasars with P v broad absorption in BOSS data release 9

    NASA Astrophysics Data System (ADS)

    Capellupo, D. M.; Hamann, F.; Herbst, H.; Brandt, W. N.; Ge, J.; Pâris, I.; Petitjean, P.; Schneider, D. P.; Streblyanska, A.; York, D.

    2017-07-01

    Broad absorption lines (BALs) found in a significant fraction of quasar spectra identify high-velocity outflows that might be present in all quasars and could be a major factor in feedback to galaxy evolution. Understanding the nature of these flows requires further constraints on their physical properties, including their column densities, for which well-studied BALs, such as C IV λλ1548,1551, typically provide only a lower limit because of saturation effects. Low-abundance lines, such as P v λλ1118,1128, indicate large column densities, implying that outflows more powerful than measurements of C IV alone would indicate. We search through a sample of 2694 BAL quasars from the Sloan Digital Sky Survey III/Baryon Oscillation Spectroscopic Survey data release 9 quasar catalogue for such absorption, and we identify 81 'definite' and 86 'probable' detections of P v broad absorption, yielding a firm lower limit of 3.0-6.2 per cent for the incidence of such absorption among BAL quasars. The P v-detected quasars tend to have stronger C IV and Si IV absorption, as well as a higher incidence of LoBAL absorption, than the overall BAL quasar population. Many of the P v-detected quasars have C IV troughs that do not reach zero intensity (at velocities where P v is detected), confirming that the outflow gas only partially covers the UV continuum source. P v appears significantly in a composite spectrum of non-P v-detected BAL quasars, indicating that P v absorption (and large column densities) is much more common than indicated by our search results. Our sample of P v detections significantly increases the number of known P v detections, providing opportunities for follow-up studies to better understand BAL outflow energetics.

  13. Prevalence of and Risk Factors for Asymptomatic Inflammatory (NIH-IV) Prostatitis in Chinese Men

    PubMed Central

    Wu, Chunlei; Zhang, Zhifu; Lu, Zheng; Liao, Ming; Zhang, Youjie; Xie, Yuanliang; Guo, Xuefeng; Yu, Xiaoxiang; Yang, Xiaobo; Gao, Yong; Tan, Aihua; Mo, Zengnan

    2013-01-01

    Background While many investigators have studied symptomatic prostatitis, little research has been done with regard to asymptomatic (NIH-IV) prostatitis. Purpose To describe the prevalence of and risk factors for NIH-IV prostatitis among a large male population. Methods The study population was comprised of 1,868 men at the second phase recruitment of a population-based cohort in China. Asymptomatic and symptomatic men were defined by the National Institutes of Health Chronic Prostatitis (CP) Symptom Index. Meanwhile, EPS specimens and their leukocyte count were collected. Lifestyle and demographic characteristics were obtained through a questionnaire. Results Prevalence of NIH-IV prostatitis was 21.1% among 1,868 asymptomatic men aged 19–78 years and increased with age. After adjusteing for potential confounding variables (age, smoking habits, alcohol drinking habits, education, physical activity, hypertension, dyslipidemia, obesity and diabetes), age remained a significant factor for NIH-IV prostatitis (OR = 1.35; 95% CI = 1.06–1.71; P = 0.01) and the risk of NIH-IV prostatitis was significantly higher in smokers≧15 pack/years than non-smokers (OR = 1.33; 95% CI = 1.01–1.75; P = 0.03). In addition, compared with non-drinkers, the OR of NIH-IV prostatitis in drinkers ≧1 drinks/week was 1.35 (95% CI = 1.03, 1.77, p = 0.02) after adjusting for the other variables above. In addition, having less than a college education may be a risk factor for NIH-IV prostatitis, although a statistically significant difference did not exist in our data (OR = 1.22; 95% CI = 0.97–1.52; P = 0.08). Conclusions Our findings suggest that NIH-IV prostatitis is prevalent in China. Age, smoking, drinking and lower education levels were associated with an increased risk of NIH-IV prostatitis. The prevalence of NIH-IV prostatitis should be taken into account when estimating the total prevalence of CP in future studies. PMID:23967188

  14. Autism and Intellectual Disability: A Study of Prevalence on a Sample of the Italian Population

    ERIC Educational Resources Information Center

    La Malfa, G.; Lassi, S.; Bertelli, M.; Salvini, R.; Placidi, G. F.

    2004-01-01

    In 1994, the American Association on Mental Retardation with the DSM-IV has come to a final definition of pervasive developmental disorders (PDD), in agreement with the ICD-10. Prevalence of PDD in the general population is 0.10.15% according to the DSM-IV. PDD are more frequent in people with severe intellectual disability (ID). There is a strict…

  15. Concordances and discrepancies between ICD-10 and DSM-IV criteria for anxiety disorders in childhood and adolescence

    PubMed Central

    2012-01-01

    Background Mental disorders are classified by two major nosological systems, the ICD-10 and the DSM-IV-TR, consisting of different diagnostic criteria. The present study investigated the diagnostic concordance between the two systems for anxiety disorders in childhood and adolescence, in particular for separation anxiety disorder (SAD), specific phobia, social phobia, and generalized anxiety disorder (GAD). Methods A structured clinical interview, the Kinder-DIPS, was administered to 210 children and 258 parents. The percentage of agreement, kappa, and Yule’s Y coefficients were calculated for all diagnoses. Specific criteria causing discrepancies between the two classification systems were identified. Results DSM-IV-TR consistently classified more children than ICD-10 with an anxiety disorder, with a higher concordance between DSM-IV-TR and the ICD-10 child section (F9) than with the adult section (F4) of the ICD-10. This result was found for all four investigated anxiety disorders. The results revealed low to high levels of concordance and poor to good agreement between the classification systems, depending on the anxiety disorder. Conclusions The two classification systems identify different children with an anxiety disorder. However, it remains an open question, whether the research results can be generalized to clinical practice since DSM-IV-TR is mainly used in research while ICD-10 is widely established in clinical practice in Europe. Therefore, the population investigated by the DSM (research population) is not identical with the population examined using the ICD (clinical population). PMID:23267678

  16. CHEK2 1100delC, IVS2+1G>A and I157T mutations are not present in colorectal cancer cases from Turkish population.

    PubMed

    Bayram, Süleyman; Topaktaş, Mehmet; Akkız, Hikmet; Bekar, Aynur; Akgöllü, Ersin

    2012-10-01

    The cell cycle checkpoint kinase 2 (CHEK2) protein participates in the DNA damage response in many cell types. Germline mutations in CHEK2 (1100delC, IVS2+1G>A and I157T) have been impaired serine/threonine kinase activity and associated with a range of cancer types. This hospital-based case-control study aimed to investigate whether CHEK2 1100delC, IVS2+1G>A and I157T mutations play an important role in the development of colorectal cancer (CRC) in Turkish population. A total of 210 CRC cases and 446 cancer-free controls were genotyped for CHEK2 mutations by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and allele specific-polymerase chain reaction (AS-PCR) methods. We did not find the CHEK2 1100delC, IVS2+1G>A and I157T mutations in any of the Turkish subjects. Our result demonstrate for the first time that CHEK2 1100delC, IVS2+1G>A and I157T mutations have not been agenetic susceptibility factor for CRC in the Turkish population. Overall, our data suggest that genotyping of CHEK2 mutations in clinical settings in the Turkish population should not be recommended. However, independent studies are need to validate our findings in a larger series, as well as in patients of different ethnic origins. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Genetic concepts and uncertainties in restoring fish populations and species

    USGS Publications Warehouse

    Reisenbichler, R.R.; Utter, F.M.; Krueger, C.C.

    2003-01-01

    Genetic considerations can be crucially important to the success of reintroductions of lotic species. Current paradigms for conservation and population genetics provide guidance for reducing uncertainties in genetic issues and for increasing the likelihood of achieving restoration. Effective restoration is facilitated through specific goals and objectives developed from the definition that a restored or healthy population is (i) genetically adapted to the local environment, (ii) self-sustaining at abundances consistent with the carrying capacity of the river system, (iii) genetically compatible with neighboring populations so that substantial outbreeding depression does not result from straying and interbreeding between populations, and (iv) sufficiently diverse genetically to accommodate environmental variability over many decades. Genetic principles reveal the importance of describing and adhering to the ancestral lineages for the species to be restored and enabling genetic processes to maintain diversity and fitness in the populations under restoration. Newly established populations should be protected from unnecessary human sources of mortality, gene flow from maladapted (e.g., hatchery) or exotic populations, and inadvertent selection by fisheries or other human activities. Such protection facilitates initial, rapid adaptation of the population to its environment and should enhance the chances for persistence. Various uncertainties about specific restoration actions must be addressed on a case-by-case basis. Such uncertainties include whether to allow natural colonization or to introduce fish, which populations are suitable as sources for reintroduction, appropriate levels of gene flow from other populations, appropriate levels of artificial production, appropriate minimum numbers of individuals released or maintained in the population, and the best developmental stages for releasing fish into the restored stream. Rigorous evaluation or experimental management is necessary to reduce uncertainty in our knowledge so that future conservation and restoration activities can be more effective.

  18. DSM-IV and DSM-5 Prevalence of Social Anxiety Disorder in a Population Sample of Older People.

    PubMed

    Karlsson, Björn; Sigström, Robert; Östling, Svante; Waern, Margda; Börjesson-Hanson, Anne; Skoog, Ingmar

    2016-12-01

    To examine the prevalence of social anxiety disorders (SAD) with (DSM-IV) and without (DSM-5) the person's own assessment that the fear was unreasonable, in a population sample of older adults. Further, to determine whether clinical and sociodemographic correlates of SAD differ depending on the criteria applied. Cross-sectional. General population in Gothenburg, Sweden. A random population-based sample of 75- and 85-year olds (N = 1200) without dementia. Psychiatric research nurses carried out a semi-structured psychiatric examination including the Comprehensive Psychopathological Rating Scale. DSM-IV SAD was diagnosed with the Mini International Neuropsychiatric Interview. SAD was diagnosed according to DSM-IV and DSM-5 criteria. The 6-month duration criterion in DSM-5 was not applied because of lack of information. Other assessments included the Global Assessment of Functioning (GAF), the Brief Scale for Anxiety (BSA), and the Montgomery Åsberg Depression Rating Scale (MADRS). The 1-month prevalence of SAD was 2.5% (N = 30) when the unreasonable fear criterion was defined in accordance with DSM-IV and 5.1% (N = 61) when the DSM-5 criterion was applied. Clinical correlates (GAF, MADRS, and BSA) were worse in SAD cases identified by either procedure compared with all others, and ratings for those reporting unreasonable fear suggested greater (albeit nonsignificant) overall psychopathology. Shifting the judgment of how reasonable the fear was, from the individual to the clinician, doubled the prevalence of SAD. This indicates that the DSM-5 version might increase prevalence rates of SAD in the general population. Further studies strictly applying all DSM-5 criteria are needed in order to confirm these findings. Copyright © 2016 American Association for Geriatric Psychiatry. Published by Elsevier Inc. All rights reserved.

  19. First direct comparison of high and low ionization line kinematics in active galactic nuclei

    NASA Technical Reports Server (NTRS)

    Sulentic, J. W.; Marziani, P.; Dultzin-Hacyan, D.; Calvani, M.; Moles, M.

    1995-01-01

    We present first results of a comparison of emission line shift properties for the high (HILs) and low (LILs) ionization lines in 43 low-reshift quasars. We identify a core sample of C IV lambda 1549 and hydrogen beta profiles with a wide distribution of red- and blueshifts (less than or equal to +/- 1000 km/sec). We also identify two tails in this distribution: one with large hydrogen beta redshifts (greater than or equal to 2000 km/sec) and another with large C IV blueshifts (greater than or equal to 1500 km/sec). The tails are mutually exclusive. All objects with extreme hydrogen beta redshift are radio loud, and all objects with extreme C IV blueshift are radio quiet. The core samples of smaller shifts can be most simply divided into: (1) hydrogen beta - a redshifted radio-loud population (related to the tail) and a radio-quiet population with mean shift near zero, and (2) C IV - a blueshifted radio-quiet population (related to the tail) and a radio-loud population with mean shift near zero. The results suggest fundamentally different kinematics for the HILs and LILs. They also suggest very different kinematics for radio-loud and radio-quiet active galactic nuclei. They also favor a predominance of radial motion in a large fraction of the sample.

  20. Amplified Fragment Length Polymorphism Fingerprinting of Pseudomonas Strains from a Poultry Processing Plant

    PubMed Central

    Geornaras, Ifigenia; Kunene, Nokuthula F.; von Holy, Alexander; Hastings, John W.

    1999-01-01

    Molecular typing has been used previously to identify and trace dissemination of pathogenic and spoilage bacteria associated with food processing. Amplified fragment length polymorphism (AFLP) is a novel DNA fingerprinting technique which is considered highly reproducible and has high discriminatory power. This technique was used to fingerprint 88 Pseudomonas fluorescens and Pseudomonas putida strains that were previously isolated from plate counts of carcasses at six processing stages and various equipment surfaces and environmental sources of a poultry abattoir. Clustering of the AFLP patterns revealed a high level of diversity among the strains. Six clusters (clusters I through VI) were delineated at an arbitrary Dice coefficient level of 0.65; clusters III (31 strains) and IV (28 strains) were the largest clusters. More than one-half (52.3%) of the strains obtained from carcass samples, which may have represented the resident carcass population, grouped together in cluster III. By contrast, 43.2% of the strains from most of the equipment surfaces and environmental sources grouped together in cluster IV. In most cases, the clusters in which carcass strains from processing stages grouped corresponded to the clusters in which strains from the associated equipment surfaces and/or environmental sources were found. This provided evidence that there was cross-contamination between carcasses and the abattoir environment at the DNA level. The AFLP data also showed that strains were being disseminated from the beginning to the end of the poultry processing operation, since many strains associated with carcasses at the packaging stage were members of the same clusters as strains obtained from carcasses after the defeathering stage. PMID:10473382

  1. Amplified fragment length polymorphism fingerprinting of Pseudomonas strains from a poultry processing plant.

    PubMed

    Geornaras, I; Kunene, N F; von Holy, A; Hastings, J W

    1999-09-01

    Molecular typing has been used previously to identify and trace dissemination of pathogenic and spoilage bacteria associated with food processing. Amplified fragment length polymorphism (AFLP) is a novel DNA fingerprinting technique which is considered highly reproducible and has high discriminatory power. This technique was used to fingerprint 88 Pseudomonas fluorescens and Pseudomonas putida strains that were previously isolated from plate counts of carcasses at six processing stages and various equipment surfaces and environmental sources of a poultry abattoir. Clustering of the AFLP patterns revealed a high level of diversity among the strains. Six clusters (clusters I through VI) were delineated at an arbitrary Dice coefficient level of 0.65; clusters III (31 strains) and IV (28 strains) were the largest clusters. More than one-half (52.3%) of the strains obtained from carcass samples, which may have represented the resident carcass population, grouped together in cluster III. By contrast, 43.2% of the strains from most of the equipment surfaces and environmental sources grouped together in cluster IV. In most cases, the clusters in which carcass strains from processing stages grouped corresponded to the clusters in which strains from the associated equipment surfaces and/or environmental sources were found. This provided evidence that there was cross-contamination between carcasses and the abattoir environment at the DNA level. The AFLP data also showed that strains were being disseminated from the beginning to the end of the poultry processing operation, since many strains associated with carcasses at the packaging stage were members of the same clusters as strains obtained from carcasses after the defeathering stage.

  2. A DEEPER LOOK AT LEO IV: STAR FORMATION HISTORY AND EXTENDED STRUCTURE

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sand, David J.; Seth, Anil; Olszewski, Edward W.

    We present MMT/Megacam imaging of the Leo IV dwarf galaxy in order to investigate its structure and star formation history, and to search for signs of association with the recently discovered Leo V satellite. Based on parameterized fits, we find that Leo IV is round, with {epsilon} < 0.23 (at the 68% confidence limit) and a half-light radius of r{sub h} {approx_equal} 130 pc. Additionally, we perform a thorough search for extended structures in the plane of the sky and along the line of sight. We derive our surface brightness detection limit by implanting fake structures into our catalog withmore » stellar populations identical to that of Leo IV. We show that we are sensitive to stream-like structures with surface brightness {mu}{sub r} {approx}< 29.6 mag arcsec{sup -2}, and at this limit we find no stellar bridge between Leo IV (out to a radius of {approx}0.5 kpc) and the recently discovered, nearby satellite Leo V. Using the color-magnitude fitting package StarFISH, we determine that Leo IV is consistent with a single age ({approx}14 Gyr), single metallicity ([Fe/H] {approx} -2.3) stellar population, although we cannot rule out a significant spread in these values. We derive a luminosity of M{sub V} = -5.5 {+-} 0.3. Studying both the spatial distribution and frequency of Leo IV's 'blue plume' stars reveals evidence for a young ({approx}2 Gyr) stellar population which makes up {approx}2% of its stellar mass. This sprinkling of star formation, only detectable in this deep study, highlights the need for further imaging of the new Milky Way satellites along with theoretical work on the expected, detailed properties of these possible 'reionization fossils'.« less

  3. A Deeper Look at Leo IV: Star Formation History and Extended Structure

    NASA Astrophysics Data System (ADS)

    Sand, David J.; Seth, Anil; Olszewski, Edward W.; Willman, Beth; Zaritsky, Dennis; Kallivayalil, Nitya

    2010-07-01

    We present MMT/Megacam imaging of the Leo IV dwarf galaxy in order to investigate its structure and star formation history, and to search for signs of association with the recently discovered Leo V satellite. Based on parameterized fits, we find that Leo IV is round, with epsilon < 0.23 (at the 68% confidence limit) and a half-light radius of rh ~= 130 pc. Additionally, we perform a thorough search for extended structures in the plane of the sky and along the line of sight. We derive our surface brightness detection limit by implanting fake structures into our catalog with stellar populations identical to that of Leo IV. We show that we are sensitive to stream-like structures with surface brightness μ r <~ 29.6 mag arcsec-2, and at this limit we find no stellar bridge between Leo IV (out to a radius of ~0.5 kpc) and the recently discovered, nearby satellite Leo V. Using the color-magnitude fitting package StarFISH, we determine that Leo IV is consistent with a single age (~14 Gyr), single metallicity ([Fe/H] ~ -2.3) stellar population, although we cannot rule out a significant spread in these values. We derive a luminosity of MV = -5.5 ± 0.3. Studying both the spatial distribution and frequency of Leo IV's "blue plume" stars reveals evidence for a young (~2 Gyr) stellar population which makes up ~2% of its stellar mass. This sprinkling of star formation, only detectable in this deep study, highlights the need for further imaging of the new Milky Way satellites along with theoretical work on the expected, detailed properties of these possible "reionization fossils." Observations reported here were obtained at the MMT observatory, a joint facility of the Smithsonian Institution and the University of Arizona.

  4. A New Radio Loudness Diagnostic for Active Galaxies: A Radio-to-Mid-Infrared Parameter

    NASA Technical Reports Server (NTRS)

    Melendez, Marcio B.; Kraemer, S. B.; Schmitt, H. R.

    2010-01-01

    We have studied the relationship between the nuclear (high-resolution) radio emission, at 8.4GHz (3.6cm) and 1.4GHz (20cm), the [O IV) (gamma)25.89 micron, [Ne III] (gamma)l5.56 micron and [Ne II] (gamma)l2.81 micron emission lines and the black hole mass accretion rate for a sample of Seyfert galaxies. In order to characterize the radio contribution for the Seyfert nuclei we used the 8.4 GHz/[O IV] ratio, assuming that [0 IV] scales with the luminosity of the active galactic nuclei (AGN). From this we find that Seyfert 1 s (i.e. Seyfert 1.0s, 1.2s and 1.5s) and Seyfert 2s (i.e. Seyfert 1.8s, 1.9s and 2.0s) have similar radio contributions, relative to the AGN. On the other hand, sources in which the [Ne u] emission is dominated either by the AGN or star formation have statistically different radio contributions, with star formation dominated sources more 'radio loud', by a factor of approx.2.8 on average, than AGN dominated sources. We show that star formation dominated sources with relatively larger radio contribution have smaller mass accretion rates. Overall, we suggest that 8.4 GHz/[O IV], or alternatively, 1.4 GHz/[O IV] ratios, can be used to characterize the radio contribution, relative to the AGN, without the limitation of previous methods that rely on optical observables. Key words: Galaxy: stellar content - galaxies: Seyfert - infrared: galaxies

  5. Mutation analysis of the PAH gene in phenylketonuria patients from Rio de Janeiro, Southeast Brazil.

    PubMed

    Vieira Neto, Eduardo; Laranjeira, Francisco; Quelhas, Dulce; Ribeiro, Isaura; Seabra, Alexandre; Mineiro, Nicole; D M Carvalho, Lilian; Lacerda, Lúcia; G Ribeiro, Márcia

    2018-05-10

    Phenylketonuria (PKU) is an autosomal recessive disease resulting from mutations in the PAH gene. Most of the patients are compound heterozygotes, and genotype is a major factor in determining the phenotypic variability of PKU. More than 1,000 variants have been described in the PAH gene. Rio de Janeiro's population has a predominance of Iberian, followed by African and Amerindian ancestries. It is expected that most PKU variants in this Brazilian state have originated in the Iberian Peninsula. However, rare European, African or pathogenic variants that are characteristic of the admixed population of the state might also be found. A total of 102 patients were included in this study. Genomic DNA was isolated from dried blood spots. Sanger sequencing was used for PAH gene variant identification. Deletions and duplications were also screened using MLPA analysis. Haplotypes were also determined. Nine (8.8%) homozygous and 93 (91.2%) compound heterozygous patients were found. The spectrum included 37 causative mutations. Missense, nonsense, and splicing pathogenic variants corresponded to 63.7%, 2.9%, and 22.6% of the mutant alleles, respectively. Large (1.5%), and small deletions, inframe (5.4%) and with frameshift (3.9%), comprised the remainder. The most frequent pathogenic variants were: p.V388M (12.7%), p.R261Q (11.8%), IVS10-11G>A (10.3%), IVS2+5G>C (6.4%), p.S349P (6.4%), p.R252W (5.4%), p.I65T (4.4%), p.T323del (4.4%), and p.P281L (3.4%). One novel variant was detected: c.934G>T (p.G312C) [rs763115697]. The three most frequent pathogenic variants in our study (34.8% of the alleles) were also the most common in other Brazilian states, Portugal, and Spain (p.V388M, p.R261Q, IVS10-11G>A), corroborating that the Iberian Peninsula is the major source of PAH mutations in Rio de Janeiro. Pathogenic variants that have other geographical origins, such IVS2+5G>C, p.G352Vfs*48, and IVS12+1G>A were also detected. Genetic drift and founder effect may have also played a role in the mutation spectrum we observed. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  6. Economic impact of Tegaderm chlorhexidine gluconate (CHG) dressing in critically ill patients.

    PubMed

    Thokala, Praveen; Arrowsmith, Martin; Poku, Edith; Martyn-St James, Marissa; Anderson, Jeff; Foster, Steve; Elliott, Tom; Whitehouse, Tony

    2016-09-01

    To estimate the economic impact of a Tegaderm TM chlorhexidine gluconate (CHG) gel dressing compared with a standard intravenous (i.v.) dressing (defined as non-antimicrobial transparent film dressing), used for insertion site care of short-term central venous and arterial catheters (intravascular catheters) in adult critical care patients using a cost-consequence model populated with data from published sources. A decision analytical cost-consequence model was developed which assigned each patient with an indwelling intravascular catheter and a standard dressing, a baseline risk of associated dermatitis, local infection at the catheter insertion site and catheter-related bloodstream infections (CRBSI), estimated from published secondary sources. The risks of these events for patients with a Tegaderm CHG were estimated by applying the effectiveness parameters from the clinical review to the baseline risks. Costs were accrued through costs of intervention (i.e. Tegaderm CHG or standard intravenous dressing) and hospital treatment costs depended on whether the patients had local dermatitis, local infection or CRBSI. Total costs were estimated as mean values of 10,000 probabilistic sensitivity analysis (PSA) runs. Tegaderm CHG resulted in an average cost-saving of £77 per patient in an intensive care unit. Tegaderm CHG also has a 98.5% probability of being cost-saving compared to standard i.v. dressings. The analyses suggest that Tegaderm CHG is a cost-saving strategy to reduce CRBSI and the results were robust to sensitivity analyses.

  7. New Insights on β-Thalassemia in the Palestinian Population of Gaza: High Frequency and Milder Phenotype Among Homozygous IVS-I-1 (HBB: c.92+1G>A) Patients with High Levels of Hb F.

    PubMed

    Ghoti, Hussam; Fibach, Eitan; Rachmilewitz, Eliezer A; Jeadi, Hisham; Filon, Dvora

    2017-03-01

    β-Thalassemia (β-thal) is a very common disease in the Palestinian population of the Gaza Strip. We studied their mutation frequency and clinical features. Thirteen different mutations were identified. The most common mutation was IVS-I-1 (G>A) (HBB: c.92+1G>A), which was prevalent in 31.5% of the thalassemia alleles studied. The IVS-I-110 (G>A) (HBB: c.93-21G>A) mutation was found in 25.0% of the alleles. Homozygotes for the IVS-I-1 mutation had higher mean hemoglobin (Hb) levels, required less blood transfusions, and lower transferrin saturation than the homozygotes for the IVS-I-110 mutation. This milder phenotype was, most likely, the result of the persistent production of Hb F; it was 9-fold higher in absolute terms (g/dL) and 7.7-fold higher in relative terms (percentage of total Hb). About half of our IVS-I-1 patients carried the XmnI polymorphism, which is known to be associated with elevated Hb F levels.

  8. Spectral synthesis in the ultraviolet. II - Stellar populations and star formation in blue compact galaxies

    NASA Technical Reports Server (NTRS)

    Fanelli, Michael N.; O'Connell, Robert W.; Thuan, Trinh X.

    1988-01-01

    An initial attempt to apply optimizing spectral synthesis techniques to the far-UV spectra of blue compact galaxies (BCGs) is presented. The far-UV absorption-line spectra of the galaxies are clearly composite, with the signatures of the main-sequence types between O3 and mid-A. Most of the low-ionization absorption lines have a stellar origin. The Si IV and C IV features in several objects have P Cygni profiles. In Haro I the strength of Si IV indicates a significant blue supergiant population. The metal-poor blue compact dwarf Mrk 209 displays weak absorption lines, evidence that the stellar component has the same low metallicity as observed in the ionized gas. Good fits to the data are obtained the technique of optimizing population synthesis. The solutions yield stellar luminosity functions which display large discontinuities, indicative of discrete star formation episodes or bursts. The amount of UV extinction is low.

  9. The First Detection of [O IV] from an Ultraluminous X-ray Source with Spitzer: Evidence of High Unbeamed Luminosity in Holmberg II ULX

    NASA Technical Reports Server (NTRS)

    Berghea, C. T.; Dudik, R. P.; Weaver, K. A.; Kallman, T. R.

    2008-01-01

    We present the first Spitzer Infrared Spectrograph (IRS) observations of the [O IV] 25.89 micron emission line detected from the ultraluminous X-ray source (ULX) in Holmberg II. This line is a well established signature of high excitation, usually associated with AGN. Its detection suggests that the ULX has a strong impact on the surrounding gas. A Spitzer high resolution spectral map shows that the [O IV] is coincident with the X-ray position of the Holmberg II ULX. We find that the luminosity and the morphology of the line emission is consistent with photoionization by the soft X-ray and far ultraviolet (FUV) radiation from the accretion disk of the binary system and inconsistent with narrow beaming. We show that the emission nebula is radiation bounded both in the line of sight direction and to the west, and probably matter bounded to the east. Evidence for a massive black hole (BH) in this ULX is mounting. Detailed photoionization models favor an intermediate mass black hole of at least 85 Solar Mass as the ionization source for the [OIV] emission. We find that the spectral type of the companion star strongly affects the expected strength of the [O IV] emission. This finding could explain the origin of [O IV] in some starburst galaxies containing black hole binaries.

  10. The incidence of phlebitis with intravenous amiodarone at guideline dose recommendations.

    PubMed

    Slim, Ahmad M; Roth, Jason E; Duffy, Benjamin; Boyd, Sheri Y N; Rubal, Bernard J

    2007-12-01

    Postoperative atrial fibrillation following cardiothoracic surgery is common and frequently managed with intravenous (IV) amiodarone. Phlebitis is the most common complication with peripheral infusion of this agent. Current practice guidelines for peripheral IV administration of <2 mg/mL amiodarone were established to reduce the risk of phlebitis. The present study examines the incidence of phlebitis in a postoperative patient population given current dose recommendations. A total of 273 patient charts were reviewed. The incidence of phlebitis in patients given IV amiodarone (n = 36) was 13.9% (95% confidence interval, 2.6-25.2%; p = 0.001). Logistic regression analysis with backward elimination of other therapeutic risk factors suggests that the odds ratio for phlebitis using current dose regimens without IV filters is 19-fold greater than baseline risk in this population. Phlebitis remains a significant complication associated with peripheral infusion of amiodarone within recommended dosing limits.

  11. Population pharmacokinetics of intravenous acetaminophen in Japanese patients undergoing elective surgery.

    PubMed

    Imaizumi, Tsuyoshi; Obara, Shinju; Mogami, Midori; Iseki, Yuzo; Hasegawa, Makiko; Murakawa, Masahiro

    2017-06-01

    Intravenous (i.v.) acetaminophen is administered during surgery for postoperative analgesia. However, little information is available on the pharmacokinetics of i.v. acetaminophen in Japanese patients undergoing surgery under general anesthesia. The study was approved by the Institutional Review Board and registered at UMIN-CTR (UMIN000013418). Patients scheduled to undergo elective surgery under general anesthesia were enrolled after obtaining written informed consent. During surgery, 1 g of i.v. acetaminophen was administered over 15, 60, or 120 min. Acetaminophen concentrations (15 or 16 samples per case) were measured at time points from 0-480 min after the start of administration (liquid chromatography-mass spectrometry/tandem mass spectrometry; limit of quantitation 0.1 μg/mL). The predictive performance of three published pharmacokinetic models was evaluated. Population pharmacokinetics were also analyzed using a nonlinear mixed-effect model based on the NONMEM program. Data from 12 patients who underwent endoscopic or lower limb procedures were analyzed (male/female = 7/5, median age 55 years, weight 63 kg). Anesthesia was maintained with remifentanil and propofol or sevoflurane. The pharmacokinetic model of i.v. acetaminophen reported by Würthwein et al. worked well. Using 185 datapoints, the pharmacokinetics of i.v. acetaminophen were described by a two-compartment model with weight as a covariate but not age, sex, or creatinine clearance. The median prediction error and median absolute prediction error of the final model were -1 and 10%, respectively. A population pharmacokinetic model of i.v. acetaminophen in Japanese patients was constructed, with performance within acceptable ranges.

  12. Impact of climate change on cold hardiness of Douglas-fir (Pseudotsuga menziesii): environmental and genetic considerations.

    PubMed

    Bansal, Sheel; St Clair, J Bradley; Harrington, Constance A; Gould, Peter J

    2015-10-01

    The success of conifers over much of the world's terrestrial surface is largely attributable to their tolerance to cold stress (i.e., cold hardiness). Due to an increase in climate variability, climate change may reduce conifer cold hardiness, which in turn could impact ecosystem functioning and productivity in conifer-dominated forests. The expression of cold hardiness is a product of environmental cues (E), genetic differentiation (G), and their interaction (G × E), although few studies have considered all components together. To better understand and manage for the impacts of climate change on conifer cold hardiness, we conducted a common garden experiment replicated in three test environments (cool, moderate, and warm) using 35 populations of coast Douglas-fir (Pseudotsuga menziesii var. menziesii) to test the hypotheses: (i) cool-temperature cues in fall are necessary to trigger cold hardening, (ii) there is large genetic variation among populations in cold hardiness that can be predicted from seed-source climate variables, (iii) observed differences among populations in cold hardiness in situ are dependent on effective environmental cues, and (iv) movement of seed sources from warmer to cooler climates will increase risk to cold injury. During fall 2012, we visually assessed cold damage of bud, needle, and stem tissues following artificial freeze tests. Cool-temperature cues (e.g., degree hours below 2 °C) at the test sites were associated with cold hardening, which were minimal at the moderate test site owing to mild fall temperatures. Populations differed 3-fold in cold hardiness, with winter minimum temperatures and fall frost dates as strong seed-source climate predictors of cold hardiness, and with summer temperatures and aridity as secondary predictors. Seed-source movement resulted in only modest increases in cold damage. Our findings indicate that increased fall temperatures delay cold hardening, warmer/drier summers confer a degree of cold hardiness, and seed-source movement from warmer to cooler climates may be a viable option for adapting coniferous forest to future climate. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

  13. A randomized trial of the efficacy and safety of sequential intravenous/oral moxifloxacin monotherapy versus intravenous piperacillin/tazobactam followed by oral amoxicillin/clavulanate for complicated skin and skin structure infections.

    PubMed

    Gyssens, Inge C; Dryden, Matthew; Kujath, Peter; Nathwani, Dilip; Schaper, Nicolaas; Hampel, Barbara; Reimnitz, Peter; Alder, Jeff; Arvis, Pierre

    2011-11-01

    The primary aim of the RELIEF study was to evaluate the efficacy and safety of two sequential intravenous (iv)/oral regimens: moxifloxacin iv/oral versus piperacillin/tazobactam (TZP) iv followed by oral amoxicillin/clavulanate (AMC). The study had a prospective, randomized, double-dummy, double-blind, multicentre design. Patients ≥18 years were prospectively stratified according to complicated skin and skin structure infection (cSSSI) subtype/diagnosis (major abscess, diabetic foot infection, wound infection or infected ischaemic ulcer), surgical intervention and severity of illness. Diagnoses and disease severity were based on predetermined criteria, documented by repeated photographs, and confirmed by an independent data review committee. Patients were randomized to receive either 400 mg of moxifloxacin iv once daily followed by 400 mg of moxifloxacin orally once daily or 4.0/0.5 g of TZP iv thrice daily followed by 875/125 mg of AMC orally twice daily for 7-21 days. The primary efficacy variable was clinical response at test of cure (TOC) for the per-protocol (PP) population. Clinical efficacy was assessed by the data review committee based on repeated photographs and case descriptions. Clinical trials registry number: NCT 00402727. A total of 813 patients were randomized. Clinical success rates at TOC were similar for moxifloxacin and TZP-AMC in the PP [320/361 (88.6%) versus 275/307 (89.6%), respectively; P = 0.758] and intent-to-treat (ITT) [350/426 (82.2%) versus 305/377 (80.9%), respectively; P = 0.632] populations. Thus, moxifloxacin was non-inferior to TZP-AMC. Bacteriological success rates were high in both treatment arms [moxifloxacin: 432/497 (86.9%) versus TZP-AMC: 370/429 (86.2%), microbiologically valid (MBV) population]. Moxifloxacin was non-inferior to TZP-AMC at TOC in both the MBV and the ITT populations. Both treatments were well tolerated. Once-daily iv/oral moxifloxacin monotherapy was clinically and bacteriologically non-inferior to iv TZP thrice daily followed by oral AMC twice daily in patients with cSSSIs.

  14. A randomized trial of the efficacy and safety of sequential intravenous/oral moxifloxacin monotherapy versus intravenous piperacillin/tazobactam followed by oral amoxicillin/clavulanate for complicated skin and skin structure infections

    PubMed Central

    Gyssens, Inge C.; Dryden, Matthew; Kujath, Peter; Nathwani, Dilip; Schaper, Nicolaas; Hampel, Barbara; Reimnitz, Peter; Alder, Jeff; Arvis, Pierre

    2011-01-01

    Objectives The primary aim of the RELIEF study was to evaluate the efficacy and safety of two sequential intravenous (iv)/oral regimens: moxifloxacin iv/oral versus piperacillin/tazobactam (TZP) iv followed by oral amoxicillin/clavulanate (AMC). Patients and methods The study had a prospective, randomized, double-dummy, double-blind, multicentre design. Patients ≥18 years were prospectively stratified according to complicated skin and skin structure infection (cSSSI) subtype/diagnosis (major abscess, diabetic foot infection, wound infection or infected ischaemic ulcer), surgical intervention and severity of illness. Diagnoses and disease severity were based on predetermined criteria, documented by repeated photographs, and confirmed by an independent data review committee. Patients were randomized to receive either 400 mg of moxifloxacin iv once daily followed by 400 mg of moxifloxacin orally once daily or 4.0/0.5 g of TZP iv thrice daily followed by 875/125 mg of AMC orally twice daily for 7–21 days. The primary efficacy variable was clinical response at test of cure (TOC) for the per-protocol (PP) population. Clinical efficacy was assessed by the data review committee based on repeated photographs and case descriptions. Clinical trials registry number: NCT 00402727. Results A total of 813 patients were randomized. Clinical success rates at TOC were similar for moxifloxacin and TZP–AMC in the PP [320/361 (88.6%) versus 275/307 (89.6%), respectively; P = 0.758] and intent-to-treat (ITT) [350/426 (82.2%) versus 305/377 (80.9%), respectively; P = 0.632] populations. Thus, moxifloxacin was non-inferior to TZP–AMC. Bacteriological success rates were high in both treatment arms [moxifloxacin: 432/497 (86.9%) versus TZP–AMC: 370/429 (86.2%), microbiologically valid (MBV) population]. Moxifloxacin was non-inferior to TZP–AMC at TOC in both the MBV and the ITT populations. Both treatments were well tolerated. Conclusions Once-daily iv/oral moxifloxacin monotherapy was clinically and bacteriologically non-inferior to iv TZP thrice daily followed by oral AMC twice daily in patients with cSSSIs. PMID:21896561

  15. Influenza Vaccination Uptake and Associated Factors among Elderly Population in Hong Kong: The Application of the Health Belief Model

    ERIC Educational Resources Information Center

    Mo, P. K. H.; Lau, J. T. F.

    2015-01-01

    The impact of influenza on elderly can be severe and fatal. Influenza vaccination (IV) has been shown to be effective in reducing influenza-related complications, but the IV uptake among elderly in Hong Kong remains low. This study investigated the prevalence and factors associated with IV among Chinese elderly in Hong Kong using the Health Belief…

  16. The effect of stellar evolution uncertainties on the rest-frame ultraviolet stellar lines of C IV and He II in high-redshift Lyman-break galaxies

    NASA Astrophysics Data System (ADS)

    Eldridge, John J.; Stanway, Elizabeth R.

    2012-01-01

    Young, massive stars dominate the rest-frame ultraviolet (UV) spectra of star-forming galaxies. At high redshifts (z > 2), these rest-frame UV features are shifted into the observed-frame optical and a combination of gravitational lensing, deep spectroscopy and spectral stacking analysis allows the stellar population characteristics of these sources to be investigated. We use our stellar population synthesis code Binary Population and Spectral Synthesis (BPASS) to fit two strong rest-frame UV spectral features in published Lyman-break galaxy spectra, taking into account the effects of binary evolution on the stellar spectrum. In particular, we consider the effects of quasi-homogeneous evolution (arising from the rotational mixing of rapidly rotating stars), metallicity and the relative abundance of carbon and oxygen on the observed strengths of He IIλ1640 Å and C IVλ1548, 1551 Å spectral lines. We find that Lyman-break galaxy spectra at z ˜ 2-3 are best fitted with moderately sub-solar metallicities, and with a depleted carbon-to-oxygen ratio. We also find that the spectra of the lowest metallicity sources are best fitted with model spectra in which the He II emission line is boosted by the inclusion of the effect of massive stars being spun-up during binary mass transfer so these rapidly rotating stars experience quasi-homogeneous evolution.

  17. Epidemiology, clinical characteristics, and associations for symptom-based Rome IV functional dyspepsia in adults in the USA, Canada, and the UK: a cross-sectional population-based study.

    PubMed

    Aziz, Imran; Palsson, Olafur S; Törnblom, Hans; Sperber, Ami D; Whitehead, William E; Simrén, Magnus

    2018-04-01

    The population prevalence, clinical characteristics, and associations for Rome IV functional dyspepsia are not known. Following the publication of the Rome IV criteria for functional gastrointestinal disorders, we aimed to assess the prevalence, characteristics, and associations for symptom-based Rome IV functional dyspepsia in adults across the USA, Canada, and the UK. We sent an internet-based cross-sectional health survey to adults in the general population of three English-speaking countries: the USA, Canada, and the UK. We used quota-based sampling to generate demographically balanced and population-representative samples. Individuals were invited to complete an online questionnaire on general health, without mention that the purpose of this survey was to examine gastrointestinal symptoms. We excluded participants who failed two attention-test questions or were excessively inconsistent on the three gastrointestinal questions that were presented twice in the survey for this particular purpose. The survey enquired about demographics, health-care visits, medications, somatisation, quality of life, and symptom-based criteria for Rome IV functional dyspepsia as well as for irritable bowel syndrome (IBS) and functional heartburn. We made subsequent comparisons between participants with Rome IV functional dyspepsia and controls without dyspepsia. The primary objective was to identify participants who fulfilled symptom-based criteria for Rome IV functional dyspepsia and categorise them into postprandial distress syndrome, epigastric pain syndrome, or overlapping subtypes. 6300 general population adults completed the health survey; 2100 each from the USA, Canada, and the UK. 369 responses were deemed inconsistent, leaving data for 5931 adults. Rome IV functional dyspepsia was significantly more prevalent in the USA (232 [12%] of 1949) than in Canada (167 [8%] of 1988) and the UK (152 [8%] of 1994; p<0·0001). The subtype distribution was 61% postprandial distress syndrome, 18% epigastric pain syndrome, and 21% overlapping variant with both syndromes; this pattern was similar across the countries. Participants with functional dyspepsia had significantly greater health impairment and health-care usage than those without dyspepsia. Participants with the overlapping variant showed greater somatisation and poorer quality-of-life scores than did individuals with either postprandial distress syndrome or epigastric pain syndrome alone. In multivariate analysis, independent factors associated with all functional dyspepsia subtypes included worsening quality of life and the presence of symptoms compatible with functional heartburn and IBS, with functional heartburn and IBS having the strongest association with overlapping postprandial distress syndrome and epigastric pain syndrome. Notably, somatisation showed a positive association with postprandial distress syndrome and the overlapping variant, and use of antidepressants showed a negative association with postprandial distress syndrome. Approximately 10% of the adult population fulfils symptom-based criteria for Rome IV functional dyspepsia and incurs considerable associated health impairment. The functional dyspepsia subtypes show differing associations, suggesting differences in pathophysiological processes or influences. The Rome Foundation, the US National Institute of Diabetes and Digestive and Kidney Diseases, the Swedish Medical Research Council, AFA Insurance, Ferring Pharmaceuticals, and the Faculty of Medicine, University of Gothenburg, Gothenburg, Sweden. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. A population-based study on phobic fears and DSM-IV specific phobia in 70-year olds.

    PubMed

    Sigström, Robert; Östling, Svante; Karlsson, Björn; Waern, Margda; Gustafson, Deborah; Skoog, Ingmar

    2011-01-01

    This population-based study reports on the prevalence and characteristics of specific phobia (SP) and phobic fears in an elderly population. A representative population sample of Swedish 70-year-olds without dementia (N = 558) was examined using semi-structured interviews. Phobic fears included fear of animals, natural environment, specific situations, blood-injection-injury and 'other'. Mental disorders, including SP, were diagnosed according to DSM-IV. Phobic fears (71.0% vs. 37.9%) and SP (13.8% vs. 4.5%) were more common in women than in men. Among those with phobic fears, more than 80% reported onset before age 21. Of those with SP, 35.7% had another DSM-IV diagnosis compared to 8.5% of those reporting no fear. Fear of specific situations and 'other' fears were related to SP and other anxiety disorders. SP was related to lower global functioning. We conclude that specific phobia in the elderly should receive attention from health professionals as it is common and associated with a decrease in global functioning. Copyright © 2010 Elsevier Ltd. All rights reserved.

  19. Impact of dietary fat source and concentration and daily fatty acid intake on the composition of carcass fat and iodine value sampled in three regions of the pork carcass.

    PubMed

    Kellner, T A; Prusa, K J; Patience, J F

    2014-12-01

    The increased inclusion of unsaturated fats in pig diets has raised issues related to pork carcass fat quality. The objective of this experiment was to more precisely measure how differing levels of daily fatty acid intake alters the fatty acid composition in 3 different fat depots. A total of 42 gilts and 21 barrows (PIC 337×C22/29) with an average initial weight of 77.80±0.38 kg were allotted randomly based on sex and BW to 7 treatments: 3 and 6% of each of tallow (TAL; iodine value [IV]=41.9), choice white grease (CWG; IV=66.5), or corn oil (CO; IV=123.1) and a control (CNTR) corn-soybean meal-based diet with no added fat. Pigs were individually housed to allow accurate measurement of individual feed intake, in particular, daily dietary fatty acid and energy intake. Fat samples were collected from the jowl, belly, and loin at slaughter. Diet and carcass fat samples were analyzed for IV. Belly weights were recorded at slaughter along with a subjective belly firmness score (1=firmest to 3=least firm). Carcass lipid IV was increased (P<0.001) by increasing the degree of unsaturation of the dietary fat source (66.8, 70.3, and 76.3 for TAL, CWG, and CO, respectively). Carcass lipid IV for TAL and CWG was not affected (P>0.05) by inclusion levels; however, carcass lipid IV was greater (P<0.001) in pigs fed 6 than 3% CO (80.0 vs. 72.6), and carcasses of gilts had greater IV (P<0.001) than carcasses of barrows (71.5 vs. 69.1). Increasing the level of TAL and CO but not CWG from 3 to 6% decreased the apparent total tract digestibility of GE, resulting in a source×level interaction (P<0.05). Dietary fat source had no effect (P≥0.66) on apparent total tract digestibility of either DM or GE, but feeding 6% dietary fat increased G:F (P=0.006) over pigs fed 3% fat (0.358 vs. 0.337). Of all the fatty acids measured, only linoleic acid intake presented a reasonable coefficient of determination (R2=0.61). Overall, IV product (IVP) was approximately equal to linoleic acid intake as a predictor of carcass IV (R2=0.93 vs. R2=0.94). When inclusion of dietary fat and PUFA intake increased, IVP placed more emphasis on the dietary fat inclusion level rather than the dietary fat composition. Linoleic acid intake corrected the overemphasis placed on dietary fat inclusion by IVP. To conclude, linoleic acid intake showed a strong relationship with carcass IV and can be used as a predictor.

  20. Einstein Observatory survey of X-ray emission from solar-type stars - The late F and G dwarf stars

    NASA Technical Reports Server (NTRS)

    Maggio, A.; Sciortino, S.; Vaiana, G. S.; Majer, P.; Bookbinder, J.

    1987-01-01

    Results of a volume-limited X-ray survey of stars of luminosity classes IV and V in the spectral range F7-G9 observed with the Einstein Observatory are presented. Using survival analysis techniques, the stellar X-ray luminosity function in the 0.15-4.0 keV energy band for both single and multiple sources. It is shown that the difference in X-ray luminosity between these two classes of sources is consistent with the superposition of individual components in multiple-component systems, whose X-ray properties are similar to those of the single-component sources. The X-ray emission of the stars in our sample is well correlated with their chromospheric CA II H-K line emission and with their projected equatorial rotational velocity. Comparison of the X-ray luminosity function constructed for the sample of the dG stars of the local population with the corresponding functions derived elsewhere for the Hyades, the Pleiades, and the Orion Ic open cluster confirms that the level of X-ray emission decreases with stellar age.

  1. The proportion cured of patients diagnosed with Stage III-IV cutaneous malignant melanoma in Sweden 1990-2007: A population-based study.

    PubMed

    Eriksson, Hanna; Lyth, Johan; Andersson, Therese M-L

    2016-06-15

    The survival in cutaneous malignant melanoma (CMM) is highly dependent on the stage of the disease. Stage III-IV CMM patients are at high risk of relapse with a heterogeneous outcome, but not all experience excess mortality due to their disease. This group is referred to as the cure proportion representing the proportion of patients who experience the same mortality rate as the general population. The aim of this study was to estimate the cure proportion of patients diagnosed with Stage III-IV CMM in Sweden. From the population-based Swedish Melanoma Register, we included 856 patients diagnosed with primary Stage III-IV CMM, 1990-2007, followed-up through 2013. We used flexible parametric cure models to estimate cure proportions and median survival times (MSTs) of uncured by sex, age, tumor site, ulceration status (in Stage III patients) and disease stage. The standardized (over sex, age and site) cure proportion was lower in Stage IV CMMs (0.15, 95% CI 0.09-0.22) than non-ulcerated Stage III CMMs (0.48, 95% CI 0.41-0.55) with a statistically significant difference of 0.33 (95% CI = 0.24-0.41). Ulcerated Stage III CMMs had a cure proportion of 0.27 (95% CI 0.21-0.32) with a statistically significant difference compared to non-ulcerated Stage III CMMs (difference 0.21; 95% CI = 0.13-0.30). The standardized MST of uncured was approximately 9-10 months longer for non-ulcerated versus ulcerated Stage III CMMs. We could demonstrate a significantly better outcome in patients diagnosed with non-ulcerated Stage III CMMs compared to ulcerated Stage III CMMs and Stage IV disease after adjusting for age, sex and tumor site. © 2016 UICC.

  2. Ultraviolet spectra of extreme nearby star-forming regions - approaching a local reference sample for JWST

    NASA Astrophysics Data System (ADS)

    Senchyna, Peter; Stark, Daniel P.; Vidal-García, Alba; Chevallard, Jacopo; Charlot, Stéphane; Mainali, Ramesh; Jones, Tucker; Wofford, Aida; Feltre, Anna; Gutkin, Julia

    2017-12-01

    Nearby dwarf galaxies provide a unique laboratory in which to test stellar population models below Z⊙/2. Such tests are particularly important for interpreting the surprising high-ionization ultraviolet (UV) line emission detected at z > 6 in recent years. We present HST/COS UV spectra of 10 nearby metal-poor star-forming galaxies selected to show He II emission in SDSS optical spectra. The targets span nearly a dex in gas-phase oxygen abundance (7.8 < 12 + log O/H < 8.5) and present uniformly large specific star formation rates (sSFR ∼102 Gyr-1). The UV spectra confirm that metal-poor stellar populations can power extreme nebular emission in high-ionization UV lines, reaching C III] equivalent widths comparable to those seen in systems at z ∼ 6-7. Our data reveal a marked transition in UV spectral properties with decreasing metallicity, with systems below 12 + log O/H ≲ 8.0 (Z/Z⊙ ≲ 1/5) presenting minimal stellar wind features and prominent nebular emission in He II and C IV. This is consistent with nearly an order of magnitude increase in ionizing photon production beyond the He+-ionizing edge relative to H-ionizing flux as metallicity decreases below a fifth solar, well in excess of standard stellar population synthesis predictions. Our results suggest that often-neglected sources of energetic radiation such as stripped binary products and very massive O-stars produce a sharper change in the ionizing spectrum with decreasing metallicity than expected. Consequently, nebular emission in C IV and He II powered by these stars may provide useful metallicity constraints in the reionization era.

  3. Cross-cultural reliability and validity of ADHD assessed by the ADHD Rating Scale in a pan-European study.

    PubMed

    Döpfner, Manfred; Steinhausen, Hans-Christoph; Coghill, David; Dalsgaard, Søren; Poole, Lynne; Ralston, Stephen J; Rothenberger, Aribert

    2006-12-01

    To provide psychometric information on the Attention-Deficit/Hyperactivity Disorder (ADHD) Rating Scale-IV (ADHD-RS-IV) in a large population of children with ADHD. Patients aged 6-18 years (n=1,478 in baseline analysis) were rated by 244 physicians on the ADHD-RS-IV based on a semi-structured interview with the patient's parent. Physicians additionally rated functional impairment (CGAS) and health status (CGI-S), and parents rated their child's behavioural and emotional problems (SDQ) and quality of life (CHIP-CE). Inattention and hyperactivity-impulsivity as dimensions of ADHD were replicated. 3-factor solutions reflecting the ICD-10 definition, with hyperactivity, impulsivity and inattention as separate dimensions were extracted in some national sub-samples and in separate analyses for boys and younger children.Good internal consistencies, strong country effects and small effects of age were found. Based on ADHD-RS-IV, 88.5% of patients met the criteria for any ADHD diagnosis. Correlations between ADHD-RS-IV and measures of functional impairment were low but statistically significant. The correlations with SDQ and CHIP-CE scales confirm the convergent and divergent validity of ADHD-RS-IV. Impressive evidence for the cross-cultural factorial validity, internal consistency as well as convergent and divergent validity of ADHD-RS-IV was found. ADHD can be assessed reliably and validly in routine care across Europe. The ICD-10 3-factor model seems to be less robust than the DSM-IV 2-factor model, but may be a good description for special populations (boys, younger children).

  4. Ultrastructural sinusoidal changes in extrahepatic cholestasis. Light and electron microscopic immunohistochemical localization of collagen type III and type IV.

    PubMed

    Gulubova, M V

    1996-07-01

    Extrahepatic cholestasis causes excessive extracellular matrix formation perisinusoidally. Ito cells, transitional and endothelial cells are considered to be a source of extracellular matrix proteins in experimental cholestasis. The localization of collagens type III and type IV in human liver in extrahepatic cholestasis was investigated immunohistochemically in the present study. Immersion fixation was used after modification to be applied to surgical biopsies with commercially available kits. Sinusoidal changes were observed that indicated excessive collagen and matrix formation. Light microscopically, increased immunostaining with the two collagen antibodies was found perisinusoidally and portally. Ultrastructurally, collagen type III positive fibres were found beneath basement membranes of vessels, in collagen bundles and as a fibrillar network in the space of Disse. Collagen type IV immunostaining was located in portal tracts and near hepatocyte microvilli. Intracellular staining with collagen type IV was detected in the rough endoplasmic reticulum of some transitional cells. Immunostaining was located around transitional cells, Ito cells or endothelial cells mainly. Our study indicates that Ito cells, transitional and endothelial cells are the main source of collagens type III and IV in the space of Disse in extrahepatic cholestasis in humans.

  5. Comparison of adverse events of laser and light-assisted hair removal systems in skin types IV-VI.

    PubMed

    Breadon, Jonith Y; Barnes, Chad A

    2007-01-01

    Photoepilation, utilizing lasers and noncoherent light sources, is designed to irradiate as much of the follicular unit as possible, with melanin as the target chromophore. Wavelength absorption should generate energy sufficient to heat and destroy the hair follicle, while preserving the surrounding tissue. When performing photoepilation on African-American skin (Fitzpatrick skin types IV-VI) a greater risk of potential epidermal adverse events, such as dyspigmentation, blistering, crusting, edema, and subsequent scarring, is possible. To reduce epidermal melanin absorption of energy longer wavelengths are considered safer for use on Fitzpatrick skin types IV to VI. This article reviews and compares the reported incidences of adverse events in African-American skin, utilizing lasers and noncoherent light sources for assisted hair removal.

  6. Sex Differences in DSM-IV Posttraumatic Stress Disorder Symptoms Expression Using Item Response Theory: a Population-based Study

    PubMed Central

    Rivollier, Fabrice; Peyre, Hugo; Hoertel, Nicolas; Blanco, Carlos; Limosin, Frédéric; Delorme, Richard

    2015-01-01

    Background Whether there are systematic sex differences in posttraumatic stress disorder (PTSD) symptom expression remains debated. Using methods based on item response theory (IRT), we aimed at examining differences in the likelihood of reporting DSM-IV symptoms of PTSD between women and men, while stratifying for major trauma type and equating for PTSD severity. Method We compared data from women and men in a large nationally representative adult sample, the National Epidemiologic Survey on Alcohol and Related Conditions. Analyses were conducted in the full population sample of individuals who met the DSM-IV criterion A (n = 23,860) and in subsamples according to trauma types. Results The clinical presentation of the 17 DSM-IV PTSD symptoms in the general population did not substantially differ in women and men in the full population and by trauma type after equating for levels of PTSD severity. The only exception was the symptom “foreshortened future”, which was more likely endorsed by men at equivalent levels of PTSD severity. Limitations The retrospective nature of the assessment of PTSD symptoms could have led to recall bias. Our sample size was too small to draw conclusions among individuals who experienced war-related traumas. Conclusions Our findings suggest that the clinical presentation of PTSD does not differ substantially between women and men. We also provide additional psychometric support to the exclusion of the symptom “foreshortened future” from the diagnostic criteria for PTSD in the DSM-5. PMID:26342916

  7. Sex differences in DSM-IV posttraumatic stress disorder symptoms expression using item response theory: A population-based study.

    PubMed

    Rivollier, Fabrice; Peyre, Hugo; Hoertel, Nicolas; Blanco, Carlos; Limosin, Frédéric; Delorme, Richard

    2015-11-15

    Whether there are systematic sex differences in posttraumatic stress disorder (PTSD) symptom expression remains debated. Using methods based on item response theory (IRT), we aimed at examining differences in the likelihood of reporting DSM-IV symptoms of PTSD between women and men, while stratifying for major trauma type and equating for PTSD severity. We compared data from women and men in a large nationally representative adult sample, the National Epidemiologic Survey on Alcohol and Related Conditions. Analyses were conducted in the full population sample of individuals who met the DSM-IV criterion A (n=23,860) and in subsamples according to trauma types. The clinical presentation of the 17 DSM-IV PTSD symptoms in the general population did not substantially differ in women and men in the full population and by trauma type after equating for levels of PTSD severity. The only exception was the symptom "foreshortened future", which was more likely endorsed by men at equivalent levels of PTSD severity. The retrospective nature of the assessment of PTSD symptoms could have led to recall bias. Our sample size was too small to draw conclusions among individuals who experienced war-related traumas. Our findings suggest that the clinical presentation of PTSD does not differ substantially between women and men. We also provide additional psychometric support to the exclusion of the symptom "foreshortened future" from the diagnostic criteria for PTSD in the DSM-5. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Personality disorders and psychosocial problems in a group of participants to therapeutic processes for people with severe social disabilities.

    PubMed

    Salavera, Carlos; Tricás, José M; Lucha, Orosia

    2011-12-11

    Homeless people have high dropout rates when they participate in therapeutic processes. The causes of this failure are not always known. This study investigates whether dropping-out is mediated by personality disorders or whether psychosocial problems are more important. Eighty-nine homeless people in a socio-laboral integration process were assessed. An initial interview was used, and the MCMI II questionnaire was applied to investigate the presence of psychosocial disorders (DSM-IV-TR axis IV). This was designed as an ex post-facto prospective study. Personality disorders were very frequent among the homeless people examined. Moreover, the high index of psychosocial problems (axis IV) in this population supported the proposal that axis IV disorders are influential in failure to complete therapy. The outcomes of the study show that the homeless people examined presented with more psychopathological symptoms, in both axis II and axis IV, than the general population. This supports the need to take into account the comorbidity between these two types of disorder among homeless people, in treatment and in the development of specific intervention programs. In conclusion, the need for more psychosocial treatments addressing the individual problems of homeless people is supported.

  9. Novel NTRK1 mutations cause hereditary sensory and autonomic neuropathy type IV: demonstration of a founder mutation in the Turkish population.

    PubMed

    Tüysüz, Beyhan; Bayrakli, Fatih; DiLuna, Michael L; Bilguvar, Kaya; Bayri, Yasar; Yalcinkaya, Cengiz; Bursali, Aysegul; Ozdamar, Elif; Korkmaz, Baris; Mason, Christopher E; Ozturk, Ali K; Lifton, Richard P; State, Matthew W; Gunel, Murat

    2008-05-01

    Hereditary sensory and autonomic neuropathy type IV (HSAN IV), or congenital insensitivity to pain with anhidrosis, is an autosomal recessive disorder characterized by insensitivity to noxious stimuli, anhidrosis from deinnervated sweat glands, and delayed mental and motor development. Mutations in the neurotrophic tyrosine kinase receptor type 1 (NTRK1), a receptor in the neurotrophin signaling pathway phosphorylated in response to nerve growth factor, are associated with this disorder. We identified six families from Northern Central Turkey with HSAN IV. We screened the NTRK1 gene for mutations in these families. Microsatellite and single nucleotide polymorphism (SNP) markers on the Affymetrix 250K chip platform were used to determine the haplotypes for three families harboring the same mutation. Screening for mutations in the NTRK1 gene demonstrated one novel frameshift mutation, two novel nonsense mutations, and three unrelated kindreds with the same splice-site mutation. Genotyping of the three families with the identical splice-site mutation revealed that they share the same haplotype. This report broadens the spectrum of mutations in NTRK1 that cause HSAN IV and demonstrates a founder mutation in the Turkish population.

  10. The contextual effects of social capital on health: a cross-national instrumental variable analysis.

    PubMed

    Kim, Daniel; Baum, Christopher F; Ganz, Michael L; Subramanian, S V; Kawachi, Ichiro

    2011-12-01

    Past research on the associations between area-level/contextual social capital and health has produced conflicting evidence. However, interpreting this rapidly growing literature is difficult because estimates using conventional regression are prone to major sources of bias including residual confounding and reverse causation. Instrumental variable (IV) analysis can reduce such bias. Using data on up to 167,344 adults in 64 nations in the European and World Values Surveys and applying IV and ordinary least squares (OLS) regression, we estimated the contextual effects of country-level social trust on individual self-rated health. We further explored whether these associations varied by gender and individual levels of trust. Using OLS regression, we found higher average country-level trust to be associated with better self-rated health in both women and men. Instrumental variable analysis yielded qualitatively similar results, although the estimates were more than double in size in both sexes when country population density and corruption were used as instruments. The estimated health effects of raising the percentage of a country's population that trusts others by 10 percentage points were at least as large as the estimated health effects of an individual developing trust in others. These findings were robust to alternative model specifications and instruments. Conventional regression and to a lesser extent IV analysis suggested that these associations are more salient in women and in women reporting social trust. In a large cross-national study, our findings, including those using instrumental variables, support the presence of beneficial effects of higher country-level trust on self-rated health. Previous findings for contextual social capital using traditional regression may have underestimated the true associations. Given the close linkages between self-rated health and all-cause mortality, the public health gains from raising social capital within and across countries may be large. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. The contextual effects of social capital on health: a cross-national instrumental variable analysis

    PubMed Central

    Kim, Daniel; Baum, Christopher F; Ganz, Michael; Subramanian, S V; Kawachi, Ichiro

    2011-01-01

    Past observational studies of the associations of area-level/contextual social capital with health have revealed conflicting findings. However, interpreting this rapidly growing literature is difficult because estimates using conventional regression are prone to major sources of bias including residual confounding and reverse causation. Instrumental variable (IV) analysis can reduce such bias. Using data on up to 167 344 adults in 64 nations in the European and World Values Surveys and applying IV and ordinary least squares (OLS) regression, we estimated the contextual effects of country-level social trust on individual self-rated health. We further explored whether these associations varied by gender and individual levels of trust. Using OLS regression, we found higher average country-level trust to be associated with better self-rated health in both women and men. Instrumental variable analysis yielded qualitatively similar results, although the estimates were more than double in size in women and men using country population density and corruption as instruments. The estimated health effects of raising the percentage of a country's population that trusts others by 10 percentage points were at least as large as the estimated health effects of an individual developing trust in others. These findings were robust to alternative model specifications and instruments. Conventional regression and to a lesser extent IV analysis suggested that these associations are more salient in women and in women reporting social trust. In a large cross-national study, our findings, including those using instrumental variables, support the presence of beneficial effects of higher country-level trust on self-rated health. Past findings for contextual social capital using traditional regression may have underestimated the true associations. Given the close linkages between self-rated health and all-cause mortality, the public health gains from raising social capital within countries may be large. PMID:22078106

  12. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  13. The 1-month prevalence of generalized anxiety disorder according to DSM-IV, DSM-V, and ICD-10 among nondemented 75-year-olds in Gothenburg, Sweden.

    PubMed

    Nilsson, Johan; Östling, Svante; Waern, Margda; Karlsson, Björn; Sigström, Robert; Guo, Xinxin; Skoog, Ingmar

    2012-11-01

    To examine the 1-month prevalence of generalized anxiety disorder (GAD) according to Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV), Diagnostic and Statistical Manual of Mental, Fifth Edition (DSM-V), and International Classification of Diseases, Tenth Revision (ICD-10), and the overlap between these criteria, in a population sample of 75-year-olds. We also aimed to examine comorbidity between GAD and other psychiatric diagnoses, such as depression. During 2005-2006, a comprehensive semistructured psychiatric interview was conducted by trained nurses in a representative population sample of 75-year-olds without dementia in Gothenburg, Sweden (N = 777; 299 men and 478 women). All psychiatric diagnoses were made according to DSM-IV. GAD was also diagnosed according to ICD-10 and DSM-V. The 1-month prevalence of GAD was 4.1% (N = 32) according to DSM-IV, 4.5% (N = 35) according to DSM-V, and 3.7% (N = 29) according to ICD-10. Only 46.9% of those with DSM-IV GAD fulfilled ICD-10 criteria, and only 51.7% and 44.8% of those with ICD-10 GAD fulfilled DSM-IV/V criteria. Instead, 84.4% and 74.3% of those with DSM-IV/V GAD and 89.7% of those with ICD-10 GAD had depression. Also other psychiatric diagnoses were common in those with ICD-10 and DSM-IV GAD. Only a small minority with GAD, irrespective of criteria, had no other comorbid psychiatric disorder. ICD-10 GAD was related to an increased mortality rate. While GAD was common in 75-year-olds, DSM-IV/V and ICD-10 captured different individuals. Current definitions of GAD may comprise two different expressions of the disease. There was greater congruence between GAD in either classification system and depression than between DSM-IV/V GAD and ICD-10 GAD, emphasizing the close link between these entities. 2012 American Association for Geriatric Psychiatry

  14. Advanced Photon Source Upgrade Project - Materials

    ScienceCinema

    Gibbson, Murray

    2018-03-02

    An upgrade to Advanced Photon Source announced by DOE - http://go.usa.gov/ivZ -- will help scientists break through bottlenecks in materials design in order to develop materials with desirable functions.

  15. A 1.4 deg2 blind survey for C II], C III] and C IV at z ˜ 0.7-1.5 - I. Nature, morphologies and equivalent widths

    NASA Astrophysics Data System (ADS)

    Stroe, Andra; Sobral, David; Matthee, Jorryt; Calhau, João; Oteo, Ivan

    2017-11-01

    While traditionally associated with active galactic nuclei (AGN), the properties of the C II] (λ = 2326 Å), C III] (λ, λ = 1907, 1909 Å) and C IV (λ, λ = 1549, 1551 Å) emission lines are still uncertain as large, unbiased samples of sources are scarce. We present the first blind, statistical study of C II], C III] and C IV emitters at z ˜ 0.68, 1.05, 1.53, respectively, uniformly selected down to a flux limit of ˜4 × 10-17 erg s-1 cm-1 through a narrow-band survey covering an area of ˜1.4 deg2 over COSMOS and UDS. We detect 16 C II], 35 C III] and 17 C IV emitters, whose nature we investigate using optical colours as well as Hubble Space Telescope (HST), X-ray, radio and far-infrared data. We find that z ˜ 0.7 C II] emitters are consistent with a mixture of blue (UV slope β = -2.0 ± 0.4) star-forming (SF) galaxies with discy HST structure and AGN with Seyfert-like morphologies. Bright C II] emitters have individual X-ray detections as well as high average black hole accretion rates (BHARs) of ˜0.1 M⊙ yr-1. C III] emitters at z ˜ 1.05 trace a general population of SF galaxies, with β = -0.8 ± 1.1, a variety of optical morphologies, including isolated and interacting galaxies and low BHAR (<0.02 M⊙ yr-1). Our C IV emitters at z ˜ 1.5 are consistent with young, blue quasars (β ˜ -1.9) with point-like optical morphologies, bright X-ray counterparts and large BHAR (0.8 M⊙ yr-1). We also find some surprising C II], C III] and C IV emitters with rest-frame equivalent widths (EWs) that could be as large as 50-100 Å. AGN or spatial offsets between the UV continuum stellar disc and the line-emitting regions may explain the large EW. These bright C II], C III] and C IV emitters are ideal candidates for spectroscopic follow-up to fully unveil their nature.

  16. Tephra Blanket Record of a Violent Strombolian Eruption, Sunset Crater, Arizona

    NASA Astrophysics Data System (ADS)

    Wagner, K. D.; Ort, M. H.

    2015-12-01

    New fieldwork provides a detailed description of the widespread tephra of the ~1085 CE Sunset Crater eruption in the San Francisco Volcanic Field, Arizona, and refines interpretation of the eruptive sequence. The basal fine-lapilli tephra-fall-units I-IV are considered in detail. Units I and II are massive, with Unit I composed of angular to spiny clasts and II composed of more equant, oxidized clasts. Units III and IV have inversely graded bases and massive tops and are composed of angular to spiny iridescent and mixed iridescent and oxidized angular clasts, respectively. Xenoliths are rare in all units (<0.1%): sedimentary xenoliths are consistent with the known shallow country rock (Moenkopi and Kaibab Fms); magmatic xenoliths are pumiceous rhyolite mingled with basalt. Unit II is less sideromelane rich (20%) than Units I, III, and IV (60-80%). Above these units are at least two more coarse tephra-fall units. Variably preserved ash and fine-lapilli laminae cap the tephra blanket. This deposit is highly susceptible to reworking, and likely experienced both syn- and post-eruptive aeolian redistribution. It appears as either well sorted, alternating planar-parallel beds of ash and fine lapilli with rare wavy beds, or as cross- or planar-bedded ash. The tephra blanket as a whole is stratigraphically underlain by a fissure-fed lava flow and lapilli-fall units are intercalated with two larger flows. Mean grain size is coarsest in Unit I but coarsens in Units II-IV. Units I, III, and IV are moderately to poorly sorted with no skew. Unit II is better sorted and more coarse-skewed. Units I and III are slightly more platykurtic than II and IV. Without considering possible spatial effects introduced by dispersion patterns, bootstrap ANOVA confidence intervals suggest at least Unit II sorting and skewness are from distinct populations. Isopachs indicate Units I and II were associated with a 10-km-long fissure source. After or during Unit II's deposition, activity localized to Sunset Crater. Units III and IV were emplaced with waxing to sustained activity, and followed by at least two more sustained episodes. Two lava flows began effusing from the cone during this period and remained active after explosive activity ceased. Primary tephra deposition ended with a period of small discrete explosions.

  17. Three-dimensional epithelial tissues generated from human embryonic stem cells.

    PubMed

    Hewitt, Kyle J; Shamis, Yulia; Carlson, Mark W; Aberdam, Edith; Aberdam, Daniel; Garlick, Jonathan A

    2009-11-01

    The use of pluripotent human embryonic stem (hES) cells for tissue engineering may provide advantages over traditional sources of progenitor cells because of their ability to give rise to multiple cell types and their unlimited expansion potential. We derived cell populations with properties of ectodermal and mesenchymal cells in two-dimensional culture and incorporated these divergent cell populations into three-dimensional (3D) epithelial tissues. When grown in specific media and substrate conditions, two-dimensional cultures were enriched in cells (EDK1) with mesenchymal morphology and surface markers. Cells with a distinct epithelial morphology (HDE1) that expressed cytokeratin 12 and beta-catenin at cell junctions became the predominant cell type when EDK1 were grown on surfaces enriched in keratinocyte-derived extracellular matrix proteins. When these cells were incorporated into the stromal and epithelial tissue compartments of 3D tissues, they generated multilayer epithelia similar to those generated with foreskin-derived epithelium and fibroblasts. Three-dimensional tissues demonstrated stromal cells with morphologic features of mature fibroblasts, type IV collagen deposition in the basement membrane, and a stratified epithelium that expressed cytokeratin 12. By deriving two distinct cell lineages from a common hES cell source to fabricate complex tissues, it is possible to explore environmental cues that will direct hES-derived cells toward optimal tissue form and function.

  18. Mortality Prediction Using Acute Physiology and Chronic Health Evaluation II and Acute Physiology and Chronic Health Evaluation IV Scoring Systems: Is There a Difference?

    PubMed Central

    Venkataraman, Ramesh; Gopichandran, Vijayaprasad; Ranganathan, Lakshmi; Rajagopal, Senthilkumar; Abraham, Babu K; Ramakrishnan, Nagarajan

    2018-01-01

    Background: Mortality prediction in the Intensive Care Unit (ICU) setting is complex, and there are several scoring systems utilized for this process. The Acute Physiology and Chronic Health Evaluation (APACHE) II has been the most widely used scoring system; although, the more recent APACHE IV is considered an updated and advanced prediction model. However, these two systems may not give similar mortality predictions. Objectives: The aim of this study is to compare the mortality prediction ability of APACHE II and APACHE IV scoring systems among patients admitted to a tertiary care ICU. Methods: In this prospective longitudinal observational study, APACHE II and APACHE IV scores of ICU patients were computed using an online calculator. The outcome of the ICU admissions for all the patients was collected as discharged or deceased. The data were analyzed to compare the discrimination and calibration of the mortality prediction ability of the two scores. Results: Out of the 1670 patients' data analyzed, the area under the receiver operating characteristic of APACHE II score was 0.906 (95% confidence interval [CI] – 0.890–0.992), and APACHE IV score was 0.881 (95% CI – 0.862–0.890). The mean predicted mortality rate of the study population as given by the APACHE II scoring system was 44.8 ± 26.7 and as given by APACHE IV scoring system was 29.1 ± 28.5. The observed mortality rate was 22.4%. Conclusions: The APACHE II and IV scoring systems have comparable discrimination ability, but the calibration of APACHE IV seems to be better than that of APACHE II. There is a need to recalibrate the scales with weights derived from the Indian population. PMID:29910542

  19. Mortality Prediction Using Acute Physiology and Chronic Health Evaluation II and Acute Physiology and Chronic Health Evaluation IV Scoring Systems: Is There a Difference?

    PubMed

    Venkataraman, Ramesh; Gopichandran, Vijayaprasad; Ranganathan, Lakshmi; Rajagopal, Senthilkumar; Abraham, Babu K; Ramakrishnan, Nagarajan

    2018-05-01

    Mortality prediction in the Intensive Care Unit (ICU) setting is complex, and there are several scoring systems utilized for this process. The Acute Physiology and Chronic Health Evaluation (APACHE) II has been the most widely used scoring system; although, the more recent APACHE IV is considered an updated and advanced prediction model. However, these two systems may not give similar mortality predictions. The aim of this study is to compare the mortality prediction ability of APACHE II and APACHE IV scoring systems among patients admitted to a tertiary care ICU. In this prospective longitudinal observational study, APACHE II and APACHE IV scores of ICU patients were computed using an online calculator. The outcome of the ICU admissions for all the patients was collected as discharged or deceased. The data were analyzed to compare the discrimination and calibration of the mortality prediction ability of the two scores. Out of the 1670 patients' data analyzed, the area under the receiver operating characteristic of APACHE II score was 0.906 (95% confidence interval [CI] - 0.890-0.992), and APACHE IV score was 0.881 (95% CI - 0.862-0.890). The mean predicted mortality rate of the study population as given by the APACHE II scoring system was 44.8 ± 26.7 and as given by APACHE IV scoring system was 29.1 ± 28.5. The observed mortality rate was 22.4%. The APACHE II and IV scoring systems have comparable discrimination ability, but the calibration of APACHE IV seems to be better than that of APACHE II. There is a need to recalibrate the scales with weights derived from the Indian population.

  20. Agriculture on Mars: Soils for Plant Growth

    NASA Technical Reports Server (NTRS)

    Ming, D. W.

    2016-01-01

    Robotic rovers and landers have enabled the mineralogical, chemical, and physical characterization of loose, unconsolidated materials on the surface of Mars. Planetary scientists refer to the regolith material as "soil." NASA is currently planning to send humans to Mars in the mid 2030s. Early missions may rely on the use of onsite resources to enable exploration and self-sufficient outposts on Mars. The martian "soil" and surface environment contain all essential plant growth elements. The study of martian surface materials and how they might react as agricultural soils opens a new frontier for researchers in the soil science community. Other potential applications for surface "soils" include (i) sources for extraction of essential plant-growth nutrients, (ii) sources of O2, H2, CO2, and H2O, (iii) substrates for microbial populations in the degradation of wastes, and (iv) shielding materials surrounding outpost structures to protect humans, plants, and microorganisms from radiation. There are many challenges that will have to be addressed by soil scientists prior to human exploration over the next two decades.

  1. A Survey of Inhalant Use Disorders among Delinquent Youth: Prevalence, Clinical Features, and Latent Structure of DSM-IV Diagnostic Criteria

    PubMed Central

    Howard, Matthew O; Perron, Brian E

    2009-01-01

    Background Inhalant use is among the most pernicious and poorly understood forms of adolescent substance use. Many youth in the juvenile justice system have used inhalants, but little is known about inhalant use disorders (IUDs) in antisocial youth populations. The purpose of this study was to examine the prevalence, clinical features, and latent structure of DSM-IV IUDs in a state population of antisocial youth. Methods Cross-sectional survey conducted in 2003. Of 740 youth residing in Missouri State Division of Youth Services' (MDYS) residential treatment facilities at the time the study was conducted, 723 (97.7%) completed interviews. Eighty-seven percent were male, with a mean age of 15.5 (SD = 1.2). Nearly 4 in 10 youth (38.5%; n = 279) reported lifetime inhalant use. Youth ranged from very mildly to severely antisocial. Results Of 279 inhalant users, 52 (18.6%) met DSM-IV inhalant abuse criteria and 79 (28.3%) met inhalant dependence criteria. Five of 10 IUD criteria were met by > 10% of the total sample. Latent class analyses demonstrated a substantial concordance between DSM-IV-defined IUDs and an empirically-derived classification based on responses to DSM-IV IUD diagnostic criteria. Conclusion IUDs and constituent criteria were prevalent among youth in the juvenile justice system. Two groups of problem inhalant users were identified, symptomatic users-DSM-IV inhalant abuse and highly symptomatic users-DSM-IV inhalant dependence, which differed primarily in severity of inhalant-related problems. Inhalant screening, prevention and treatment efforts in juvenile justice settings are rarely delivered, but critically needed. PMID:19267939

  2. Discrepancy Score Reliabilities in the WAIS-IV Standardization Sample

    ERIC Educational Resources Information Center

    Glass, Laura A.; Ryan, Joseph J.; Charter, Richard A.

    2010-01-01

    In the present investigation, the authors provide internal consistency reliabilities for Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) subtest and Index discrepancy scores using the standardization sample as the data source. Reliabilities ranged from 0.55 to 0.88 for subtest discrepancy scores and 0.80 to 0.91 for Index discrepancy…

  3. Real-time Data Streams from ``e-RemoteCtrl'' to Central VLBI Network Status Monitoring Services Like IVS Live

    NASA Astrophysics Data System (ADS)

    Neidhardt, Alexander; Collioud, Arnaud

    2014-12-01

    A central VLBI network status monitoring can be realized by using online status information about current VLBI sessions, real-time, and status data directly from each radio telescope. Such monitoring helps to organize sessions or to get immediate feedback from the active telescopes. Therefore the remote control software for VLBI radio telescopes ``e-RemoteCtrl'' (http://www.econtrol-software.de), which enables remote access as extension to the NASA Field System, realizes real-time data streams to dedicated data centers. The software has direct access to the status information about the current observation (e.g., schedule, scan, source) and the telescope (e.g., current state, temperature, pressure) in real-time. This information are directly sent to ``IVS Live''. ``IVS Live'' (http://ivslive.obs.u-bordeaux1.fr/) is a Web tool that can be used to follow the observing sessions, organized by the International VLBI Service for Geodesy and Astrometry (IVS), navigate through past or upcoming sessions, or search and display specific information about sessions, sources (like VLBI images), and stations, by using an Internet browser.

  4. The First Detection of [O IV] from an Ultraluminous X-ray Source with Spitzer. II. Evidence for High Luminosity in Holmberg II ULX

    NASA Technical Reports Server (NTRS)

    Berghea, C. T.; Dudik, R. P.; Weaver, K. A.; Kallman, T. R.

    2009-01-01

    This is the second of two papers examining Spitzer Infrared Spectrograph (IRS) observations of the ultraluminous X-ray source (ULX) in Holmberg II. Here we perform detailed photoionization modeling of they infrared lines. Our analysis suggests that the luminosity and morphology of the [O IV] 25.89 micron emission line is consistent with photoionization by the soft X-ray and far ultraviolet (FUV) radiation from the accretion disk of the binary system and inconsistent with narrow beaming. We show that the emission nebula is matter-bounded both in the line of sight direction and to the east, and probably radiation-bounded to the west. A bolometric luminosity in excess of 1040 erg per second would be needed to produce the measured [O IV] flux. We use modeling and previously published studies to conclude that shacks likely contribute very little, if at all, to the high excitation line fluxes observed in the Holmberg II ULX. Additionally, we find that the spectral type of the companion star has a surprisingly strong effect on they predicted strength of the [O IV] emission. This finding could explain the origin of [O IV] hi some starburst systems containing black hole binaries.

  5. The First Detection of [O IV] from an Ultraluminous X-ray Source with Spitzer. 2; Evidence for High Luminosity in Holmberg II ULX

    NASA Technical Reports Server (NTRS)

    Berghea, C. T.; Dudik, R. P.; Weaver, K. A.; Kallman, T. R.

    2009-01-01

    This is the second of two papers examining Spitzer Infrared Spectrograph (IRS) observations of the ultraluminous X-ray source (ULX) in Holmberg II. Here we perform detailed photoionization modeling of the infrared lines. Our analysis suggests that the luminosity and morphology of the [O IV] 25.89 micron emission line is consistent with photoionization by the soft X-ray and far ultraviolet (FUV) radiation from the accretion disk of the binary system and inconsistent with narrow beaming. We show that the emission nebula is matter-bounded both in the line of sight direction and to the east, and probably radiation-bounded to the west. A bolometric luminosity in excess of 10(exp 40) erg/s would be needed to produce the measured [O IV] flux. We use modeling and previously published studies to conclude that shocks likely contribute very little, if at all, to the high-excitation line fluxes observed in the Holmberg II ULX. Additionally, we find that the spectral type of the companion star has a surprisingly strong effect on the predicted strength of the [O IV] emission. This finding could explain the origin of [O IV] in some starburst systems containing black hole binaries.

  6. WISC-IV Profiles Are Associated with Differences in Symptomatology and Outcome in Children with ADHD

    ERIC Educational Resources Information Center

    Thaler, Nicholas S.; Bello, Danielle T.; Etcoff, Lewis M.

    2013-01-01

    Objective: The current study investigated the Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV) cluster profiles of children with ADHD to examine the association between IQ profiles and diagnostic frequency, symptomatology, and outcome in this population. Method: Hierarchical cluster analysis was conducted on 189 children with a…

  7. Personality disorders and psychosocial problems in a group of participants to therapeutic processes for people with severe social disabilities

    PubMed Central

    2011-01-01

    Background Homeless people have high dropout rates when they participate in therapeutic processes. The causes of this failure are not always known. This study investigates whether dropping-out is mediated by personality disorders or whether psychosocial problems are more important. Method Eighty-nine homeless people in a socio-laboral integration process were assessed. An initial interview was used, and the MCMI II questionnaire was applied to investigate the presence of psychosocial disorders (DSM-IV-TR axis IV). This was designed as an ex post-facto prospective study. Results Personality disorders were very frequent among the homeless people examined. Moreover, the high index of psychosocial problems (axis IV) in this population supported the proposal that axis IV disorders are influential in failure to complete therapy. Conclusion The outcomes of the study show that the homeless people examined presented with more psychopathological symptoms, in both axis II and axis IV, than the general population. This supports the need to take into account the comorbidity between these two types of disorder among homeless people, in treatment and in the development of specific intervention programs. In conclusion, the need for more psychosocial treatments addressing the individual problems of homeless people is supported. PMID:22151623

  8. Bellagio IV Population Conference. Working Papers.

    ERIC Educational Resources Information Center

    Rockefeller Foundation, New York, NY.

    The document contains papers presented at a meeting to consider global population growth. The purpose of the conference was to promote the exchange of ideas relating to population growth between educators, government officials, and development agency personnel from developing and developed nations. Ten papers are presented. Topics discussed…

  9. The effect of asymmetrical electrode form after negative bias illuminated stress in amorphous IGZO thin film transistors

    NASA Astrophysics Data System (ADS)

    Su, Wan-Ching; Chang, Ting-Chang; Liao, Po-Yung; Chen, Yu-Jia; Chen, Bo-Wei; Hsieh, Tien-Yu; Yang, Chung-I.; Huang, Yen-Yu; Chang, Hsi-Ming; Chiang, Shin-Chuan; Chang, Kuan-Chang; Tsai, Tsung-Ming

    2017-03-01

    This paper investigates the degradation behavior of InGaZnO thin film transistors (TFTs) under negative bias illumination stress (NBIS). TFT devices with two different source and drain layouts were exanimated: one having a parallel format electrode and the other with UI format electrode. UI means that source/drain electrodes shapes is defined as a forked-shaped structure. The I-V curve of the parallel electrode exhibited a symmetric degradation under forward and reverse sweeping in the saturation region after 1000 s NBIS. In contrast, the I-V curve of the UI electrode structure under similar conditions was asymmetric. The UI electrode structure also shows a stretch-out phenomenon in its C-V measurement. Finally, this work utilizes the ISE-Technology Computer Aided Design (ISE-TCAD) system simulations, which simulate the electron field and IV curves, to analyze the mechanisms dominating the parallel and UI device degradation behaviors.

  10. How and Why to Do VLBI on GPS

    NASA Technical Reports Server (NTRS)

    Dickey, J. M.

    2010-01-01

    In order to establish the position of the center of mass of the Earth in the International Celestial Reference Frame, observations of the Global Positioning Satellite (GPS) constellation using the IVS network are important. With a good frame-tie between the coordinates of the IVS telescopes and nearby GPS receivers, plus a common local oscillator reference signal, it should be possible to observe and record simultaneously signals from the astrometric calibration sources and the GPS satellites. The standard IVS solution would give the atmospheric delay and clock offsets to use in analysis of the GPS data. Correlation of the GPS signals would then give accurate orbital parameters of the satellites in the ICRF reference frame, i.e., relative to the positions of the astrometric sources. This is particularly needed to determine motion of the center of mass of the earth along the rotation axis.

  11. A Case Report of Post-Operative Jöd-Basedow Phenomennon Following Oral and IV Iodine Contrast Administration

    PubMed Central

    Hull, Erroll; Lujan, Eugenio

    2014-01-01

    This is a case of thyrotoxicosis, due to the Jöd-Basedow phenomenon following administration of oral and IV iodinated contrast in a patient with history of gastrointestinal stromal tumor (GIST) and small bowel obstruction. The patient developed atrial fibrillation and had an extended stay in the intensive care unit. Given the aging population with possible subclinical hyperthyroidism, multinodular goiter, and the rise in contrast administration for routine diagnostic studies, this case serves to raise awareness of the risks of “routine” tests administered to our aging patient population. PMID:24716009

  12. CHILES Con Pol: Probing galaxy evolution, the dark Universe, and cosmic magnetism with a deep 1000 hour Jansky VLA survey

    NASA Astrophysics Data System (ADS)

    Hales, Christopher A.; Chiles Con Pol Collaboration

    2014-04-01

    We recently started a 1000 hour campaign to observe 0.2 square degrees of the COSMOS field in full polarization continuum at 1.4 GHz with the Jansky VLA, as part of a joint program with the spectral line COSMOS HI Large Extragalactic Survey (CHILES). When complete, we expect our CHILES Continuum Polarization (CHILES Con Pol) survey to reach an unprecedented SKA-era sensitivity of 0.7 uJy per 4 arcsecond FWHM beam. Here we present the key goals of CHILES Con Pol, which are to (i) produce a source catalog of legacy value to the astronomical community, (ii) measure differential source counts in total intensity, linear polarization, and circular polarization in order to constrain the redshift and luminosity distributions of source populations, (iii) perform a novel weak lensing study using radio polarization as an indicator of intrinsic alignment to better study dark energy and dark matter, and (iv) probe the unknown origin of cosmic magnetism by measuring the strength and structure of intergalactic magnetic fields in the filaments of large scale structure. The CHILES Con Pol source catalog will be a useful resource for upcoming wide-field surveys by acting as a training set for machine learning algorithms, which can then be used to identify and classify radio sources in regions lacking deep multiwavelength coverage.

  13. Introduction to basic solar cell measurements

    NASA Technical Reports Server (NTRS)

    Brandhorst, H. W., Jr.

    1976-01-01

    The basic approaches to solar cell performance and diagnostic measurements are described. The light sources, equipment for I-V curve measurement, and the test conditions and procedures for performance measurement are detailed. Solar cell diagnostic tools discussed include analysis of I-V curves, series resistance and reverse saturation current determination, spectral response/quantum yield measurement, and diffusion length/lifetime determination.

  14. Using isotopic patterns of ectomycorrhizal and saprotrophic fungi to elucidate fungal sources of carbon and nitrogen in a Norway spruce stand

    NASA Astrophysics Data System (ADS)

    Chen, Janet; Rinne-Garmston, Katja; Penttilä, Reijo; Hobbie, Erik; Mäkipää, Raisa

    2016-04-01

    To predict effects of global change on fungal community structure and the consequential effects on carbon (C) and nitrogen (N) cycling, we first need to understand different fungal sources of C and N. We determined sources of C and N by measuring δ15N and δ13C of an extensive collection of ectomycorrhizal and saprotrophic sporocarps and their potential substrates from Norway spruce (Picea abies) stands in southern Finland. The substrates included organic soil, roots in organic soil, mineral soil, roots in mineral soil, moss, needles, needles in litter, branches, twigs in litter, wood and decay wood from stages I-V. Notably, δ15N and δ13C analysis of wood in decay stages I-V was a novel measurement, as were our associations between wood decay fungi and the decay stage of trees. Decay stage of wood significantly correlated with the δ15N and δ13C of associated saprotrophic wood decay fungi species. Fungi were lower in δ15N by 0.3-0.7‰ when associated with decay wood in stages II and III compared to I and IV and higher in δ13C by 0.9-1.2‰ when associated with decay stage I compared to decay stages II-IV. The ectomycorrhizal fungi, Piloderma fallax, was significantly correlated with 15N enrichment of decay wood upon its introduction in decay stages III and IV that continued to the later decay stage V, with δ15N of decay stage V 1.5‰ higher than decay stage IV. These results indicate that wood decay fungi rely on C and N from various wood decay stages and influence C and N pools of wood as well. Litter decay fungi were lower in δ13C than wood decay fungi by 1.9‰ and higher in δ15N by 3‰ and isotopically tracked their C and N sources. Calocera viscosa, Gymnopus acervatus, and Leotia lubrica were highly 15N-enriched compared to other saprotrophic fungi and they had δ15N values similar to fungi with hydrophobic ectomycorrhizae indicating function more similar to ectomycorrhizal fungi or N sources similar to this functional group. Similar to other studies, ectomycorrhizal fungi were 15N-enriched relative to saprotrophic fungi and fungi with hydrophobic ectomycorrhizae were 15N-enriched compared to fungi with hydrophilic ectomycorrhizae by 3.6‰. δ15N and δ13C values indicate that ectomycorrhizal fungi derive C from plant sugars similar to woody substrate, and acquire N from older sources within the litter layer and deeper in organic and mineral soils, with hydrophobic ectomycorrhizae using older sources of N than hydrophilic ectomycorrhizae. Interestingly, Entoloma cetratum with hydrophilic ectomycorrhizae and Hydnum repandum with hydrophobic ectomycorrhizae both had abnormally high δ15N values that suggest an irregular 15N-enriched source of N, likely from a higher 15N-enriched trophic level.

  15. Epidemiological and clinical relevance of insomnia diagnosis algorithms according to the DSM-IV and the International Classification of Sleep Disorders (ICSD).

    PubMed

    Ohayon, Maurice M; Reynolds, Charles F

    2009-10-01

    Although the epidemiology of insomnia in the general population has received considerable attention in the past 20 years, few studies have investigated the prevalence of insomnia using operational definitions such as those set forth in the ICSD and DSM-IV, specifying what proportion of respondents satisfied the criteria to reach a diagnosis of insomnia disorder. This is a cross-sectional study involving 25,579 individuals aged 15 years and over representative of the general population of France, the United Kingdom, Germany, Italy, Portugal, Spain and Finland. The participants were interviewed on sleep habits and disorders managed by the Sleep-EVAL expert system using DSM-IV and ICSD classifications. At the complaint level, too short sleep (20.2%), light sleep (16.6%), and global sleep dissatisfaction (8.2%) were reported by 37% of the subjects. At the symptom level (difficulty initiating or maintaining sleep and non-restorative sleep at least 3 nights per week), 34.5% of the sample reported at least one of them. At the criterion level, (symptoms+daytime consequences), 9.8% of the total sample reported having them. At the diagnostic level, 6.6% satisfied the DSM-IV requirement for positive and differential diagnosis. However, many respondents failed to meet diagnostic criteria for duration, frequency and severity in the two classifications, suggesting that multidimensional measures are needed. A significant proportion of the population with sleep complaints do not fit into DSM-IV and ICSD classifications. Further efforts are needed to identify diagnostic criteria and dimensional measures that will lead to insomnia diagnoses and thus provide a more reliable, valid and clinically relevant classification.

  16. Efficacy of anidulafungin in 539 patients with invasive candidiasis: a patient-level pooled analysis of six clinical trials

    PubMed Central

    Kullberg, Bart Jan; Vasquez, José; Mootsikapun, Piroon; Nucci, Marcio; Paiva, José-Artur; Garbino, Jorge; Yan, Jean Li; Aram, Jalal; Capparella, Maria Rita; Conte, Umberto; Schlamm, Haran; Swanson, Robert; Herbrecht, Raoul

    2017-01-01

    Abstract Objectives: To evaluate the efficacy of anidulafungin for the treatment of candidaemia and invasive candidiasis in a large dataset, including patients with deep-seated tissue candidiasis, neutropenia and infection due to non-albicans Candida species. Methods: Data were pooled from six prospective, multicentre, multinational studies: four open-label, non-comparative studies of anidulafungin and two double-blind, double-dummy, randomized studies of anidulafungin versus caspofungin (clinical trial registrations: NCT00496197, NCT00548262, NCT00537329, NCT00689338, NCT00806351 and NCT00805740; ClinicalTrials.gov). In all studies, patients with culture-confirmed invasive candidiasis received a single intravenous (iv) loading dose of anidulafungin 200 mg on day 1, followed by 100 mg once-daily. Switch to oral fluconazole or voriconazole was permitted after 5–10 days of iv treatment in all studies except one. Antifungal treatment (iv plus oral therapy if applicable) was maintained for ≥14 days after the last positive Candida culture. The primary endpoint was successful global response at end of iv therapy (EOivT) in the modified ITT (mITT) population. Results: In total, 539 patients were included (mITT population). The most common baseline Candida species were Candida albicans (47.9%), Candida glabrata (21.0%), Candida tropicalis (13.7%), Candida parapsilosis (13.2%) and Candida krusei (3.5%). Median duration of anidulafungin iv treatment was 10.0 days. The global response success rate at EOivT was 76.4% (95% CI 72.9%–80.0%). All-cause mortality was 13.0% on day 14 and 19.1% on day 28. Adverse events (AEs) were consistent with the known AE profile for anidulafungin. Conclusions: These data demonstrate that anidulafungin is effective for treatment of candidaemia and invasive candidiasis in a broad patient population. PMID:28459966

  17. [Analysis of H63D mutation in hemochromatosis (HFE) gene in populations of central Eurasia].

    PubMed

    Khusainova, R I; Khusnutdinova, N N; Litvinov, S S; Khusnutdinova, E K

    2013-02-01

    An analysis of the frequency of H63D (c. 187C>G) mutations in the HFEgene in 19 populations from Central Eurasia demonstrated that the distribution of the mutation in the region of interest was not uniform and that there were the areas of H63D accumulation. The investigation of three polymorphic variants, c.340+4T>C (rs2071303, IVS2(+4)T>C), c.893-44T>C (rs1800708, IVS4(-44)T>C), and c.1007-47G>A (rs1572982, IVS5(-47)A>G), in the HFE gene in individuals homozygous for H63D mutations in the HFE gene revealed the linkage of H63D with three haplotypes, *CTA, *TG, and *TTA. These findings indicated the partial spread of the mutation in Central Eurasia from Western Europe, as well as the possible repeated appearance of the mutation on the territory on interest.

  18. CCD photometry of Andromeda IV - Dwarf irregular galaxy or M31 open cluster?

    NASA Technical Reports Server (NTRS)

    Jones, Joseph H.

    1993-01-01

    CCD photometry of Andromeda IV was obtained during discretionary time in August of 1989 at the Canada-France-Hawaii Telescope on Mauna Kea and the data were reduced at CFHT during the summer of 1991. And IV has been catalogued both as a dwarf galaxy and as an open star cluster in M31. The color-magnitude diagrams presented indicate that this object has a young population of stars with a narrow age range, consistent with the characteristics of an open star cluster or stellar association. A radial velocity measurement taken from the literature and analyzed with respect to the rotation curve of M31 indicates this object resides in the disk of the Andromeda Galaxy, strengthening the conclusion that it is indeed a very large open star cluster or a densely populated stellar association rather than a dwarf irregular galaxy.

  19. Larvicidal potential of some plants from West Africa against Culex quinquefasciatus (Say) and Anopheles gambiae Giles (Diptera: Culicidae).

    PubMed

    Azokou, Alain; Koné, Mamidou W; Koudou, Benjamin G; Tra Bi, Honora F

    2013-01-01

    Mosquitoes increased resistance to insecticides, and environmental concerns about the use of insecticides, pose a major challenge in the search for new molecules to deplete and incapacitate mosquito populations. Plants are the valuable source as practices consisting in exploiting plant materials as repellents, and are still in wide use throughout developing countries. The aim of the present study was to screen plants from Cτte d'Ivoire for larvicidal activity against mosquitoes. Resistant and sensitive larvae (III and IV instar) of Anopheles gambiae and Culex quinquefasciatus were exposed to crude ethanol extracts (90%) of 45 plants and viability observed after 30 min, 6, 12 and 24 h postincubation. After partition of active extracts, each fraction (hexane and chloroform washed with NaCl 1%, tannins and aqueous) was tested using the same protocol at various concentrations (1000- 31.2 ppm). Of 49 extracts tested, 7 exhibited high potential (LC50 = 80 to 370 ppm) against resistant and sensitive III and IV instar larvae of An. gambiae and Cx. quinquefasciatus. These extracts were from Cissus populnea, Cochlospermum planchonii, Heliotropium indicum, Phyllanthus amarus, Vitex grandifolia and Alchornea cordifolia. However, three most active plant species (LC50 = 80- 180 ppm) were Cs. populnea, Cm. planchonii and P. amarus Their hexane and chloroform fractions showed high larvicidal activity. This study demonstrated that plants from Cτte d'Ivoire have a real potential for malaria, yellow fever, filarial and dengue vector control. Those could be used as sources or provide lead compounds for the development of safe plant-based biocides.

  20. Genes associated to lactose metabolism illustrate the high diversity of Carnobacterium maltaromaticum.

    PubMed

    Iskandar, Christelle F; Cailliez-Grimal, Catherine; Rahman, Abdur; Rondags, Emmanuel; Remenant, Benoît; Zagorec, Monique; Leisner, Jorgen J; Borges, Frédéric; Revol-Junelles, Anne-Marie

    2016-09-01

    The dairy population of Carnobacterium maltaromaticum is characterized by a high diversity suggesting a high diversity of the genetic traits linked to the dairy process. As lactose is the main carbon source in milk, the genetics of lactose metabolism was investigated in this LAB. Comparative genomic analysis revealed that the species C. maltaromaticum exhibits genes related to the Leloir and the tagatose-6-phosphate (Tagatose-6P) pathways. More precisely, strains can bear genes related to one or both pathways and several strains apparently do not contain homologs related to these pathways. Analysis at the population scale revealed that the Tagatose-6P and the Leloir encoding genes are disseminated in multiple phylogenetic lineages of C. maltaromaticum: genes of the Tagatose-6P pathway are present in the lineages I, II and III, and genes of the Leloir pathway are present in the lineages I, III and IV. These data suggest that these genes evolved thanks to horizontal transfer, genetic duplication and translocation. We hypothesize that the lac and gal genes evolved in C. maltaromaticum according to a complex scenario that mirrors the high population diversity. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Extremely red quasars in BOSS

    NASA Astrophysics Data System (ADS)

    Hamann, Fred; Zakamska, Nadia L.; Ross, Nicholas; Paris, Isabelle; Alexandroff, Rachael M.; Villforth, Carolin; Richards, Gordon T.; Herbst, Hanna; Brandt, W. Niel; Cook, Ben; Denney, Kelly D.; Greene, Jenny E.; Schneider, Donald P.; Strauss, Michael A.

    2017-01-01

    Red quasars are candidate young objects in an early transition stage of massive galaxy evolution. Our team recently discovered a population of extremely red quasars (ERQs) in the Baryon Oscillation Spectroscopic Survey (BOSS) that has a suite of peculiar emission-line properties including large rest equivalent widths (REWs), unusual `wingless' line profiles, large N V/Lyα, N V/C IV, Si IV/C IV and other flux ratios, and very broad and blueshifted [O III] λ5007. Here we present a new catalogue of C IV and N V emission-line data for 216 188 BOSS quasars to characterize the ERQ line properties further. We show that they depend sharply on UV-to-mid-IR colour, secondarily on REW(C IV), and not at all on luminosity or the Baldwin Effect. We identify a `core' sample of 97 ERQs with nearly uniform peculiar properties selected via I-W3 ≥ 4.6 (AB) and REW(C IV) ≥ 100 Å at redshifts 2.0-3.4. A broader search finds 235 more red quasars with similar unusual characteristics. The core ERQs have median luminosity ˜ 47.1, sky density 0.010 deg-2, surprisingly flat/blue UV spectra given their red UV-to-mid-IR colours, and common outflow signatures including BALs or BAL-like features and large C IV emission-line blueshifts. Their SEDs and line properties are inconsistent with normal quasars behind a dust reddening screen. We argue that the core ERQs are a unique obscured quasar population with extreme physical conditions related to powerful outflows across the line-forming regions. Patchy obscuration by small dusty clouds could produce the observed UV extinctions without substantial UV reddening.

  2. A Population-Based Survival Assessment of Categorizing Level III and IV Rural Hospitals as Trauma Centers

    ERIC Educational Resources Information Center

    Arthur, Melanie; Newgard, Craig D.; Mullins, Richard J.; Diggs, Brian S.; Stone, Judith V.; Adams, Annette L.; Hedges, Jerris R.

    2009-01-01

    Context: Patients injured in rural areas are hypothesized to have improved outcomes if statewide trauma systems categorize rural hospitals as Level III and IV trauma centers, though evidence to support this belief is sparse. Purpose: To determine if there is improved survival among injured patients hospitalized in states that categorize rural…

  3. 76 FR 38050 - Defense Federal Acquisition Regulation Supplement; Management of Manufacturing Risk in Major...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-29

    ...-readiness processes of potential contractors and subcontractors as a part of the source selection process... Supplement (DFARS) subpart 215.3, Source Selection. It amends DFARS 215.304(c) by adding paragraph (iv) to... and subcontractors shall be considered as a part of the source selection process for major defense...

  4. 10 CFR 32.74 - Manufacture and distribution of sources or devices containing byproduct material for medical use.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... accidents; (iv) For devices containing byproduct material, the radiation profile of a prototype device; (v... source or device pertinent to an evaluation of its radiation safety, including: (i) The byproduct...) Instructions for handling and storing the source or device from the radiation safety standpoint; these...

  5. 10 CFR 32.74 - Manufacture and distribution of sources or devices containing byproduct material for medical use.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... accidents; (iv) For devices containing byproduct material, the radiation profile of a prototype device; (v... source or device pertinent to an evaluation of its radiation safety, including: (i) The byproduct...) Instructions for handling and storing the source or device from the radiation safety standpoint; these...

  6. Probing the Metal Enrichment of the Intergalactic Medium at z = 5-6 Using the Hubble Space Telescope

    NASA Astrophysics Data System (ADS)

    Cai, Zheng; Fan, Xiaohui; Dave, Romeel; Finlator, Kristian; Oppenheimer, Ben

    2017-11-01

    We test the galactic outflow model by probing associated galaxies of four strong intergalactic C IV absorbers at z = 5-6 using the Hubble Space Telescope (HST) Advanced Camera for Surveys (ACS) ramp narrowband filters. The four strong C IV absorbers reside at z = 5.74, 5.52, 4.95, and 4.87, with column densities ranging from N C IV = 1013.8 to 1014.8 cm-2. At z = 5.74, we detect an I-dropout Lyα emitter (LAE) candidate with a projected impact parameter of 42 physical kpc from the C IV absorber. This LAE candidate has a Lyα-based star formation rate (SFRLyα ) of 2 M ⊙ yr-1 and a UV-based SFR of 4 M ⊙ yr-1. Although we cannot completely rule out that this I-dropout emitter may be an [O II] interloper, its measured properties are consistent with the C IV powered galaxy at z = 5.74. For C IV absorbers at z = 4.95 and z = 4.87, although we detect two LAE candidates with impact parameters of 160 and 200 kpc, such distances are larger than that predicted from the simulations. Therefore, we treat them as nondetections. For the system at z = 5.52, we do not detect LAE candidates, placing a 3σ upper limit of SFRLyα ≈ 1.5 M ⊙ yr-1. In summary, in these four cases, we only detect one plausible C IV source at z = 5.74. Combining the modest SFR of the one detection and the three nondetections, our HST observations strongly support that smaller galaxies (SFRLyα ≲ 2 M ⊙ yr-1) are main sources of intergalactic C IV absorbers, and such small galaxies play a major role in the metal enrichment of the intergalactic medium at z ≳ 5.

  7. Purification, identification and molecular mechanism of two dipeptidyl peptidase IV (DPP-IV) inhibitory peptides from Antarctic krill (Euphausia superba) protein hydrolysate.

    PubMed

    Ji, Wei; Zhang, Chaohua; Ji, Hongwu

    2017-10-01

    Dipeptidyl peptidase IV (DPP-IV) played an important role in blood glucose regulation. Inhibition of DPP-IV may improve glycemic control in diabetics by preventing the rapid breakdown of incretin hormones and prolonging their physiological action. In this study, Antarctic krill (Euphausia superba) protein was hydrolyzed using animal proteolytic enzymes. The hydrolysate was purified sequentially by ultrafiltration, gel filtration chromatography and reversed phase high-performance liquid chromatography (RP-HPLC). DPP-IV inhibitory activity of the fractions achieved from Antarctic krill protein was determined by DPP-IV screening reagent kit. Two purified peptides were identified by Xevo G2-XS QTof mass spectrometer (QTOF-MS). One peptide purified was Ala-Pro (AP) with IC 50 values of 0.0530mg/mL, the other Ile-Pro-Ala (IPA) with IC 50 values of 0.0370mg/mL. They both exhibited strong DPP-IV inhibitory activity. The molecular docking analysis revealed that DPP-IV inhibition by AP and IPA was mainly due to formation of a strong interaction surface force with the 91-96 and 101-105 amino acids of the DPP-IV. Our results suggested that the protein hydrolysate from Antarctic krill can be considered as a promising natural source of DPP-IV inhibitory peptides in the management of diabetes. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. [Mucolipidoses type IV in a patient with mapuche ancestry].

    PubMed

    Hernández Ch, Marta; Méndez C, José Ignacio; Concha G, María José; Huete L, Isidro; González B, Sergio; Durán S, Gloria P

    2008-07-01

    We report a 7 year-old girl with mapuche ancestors, diagnosed as a cerebral palsy since infancy and on active rehabilitation. She acquired motor and cognitive skills at 3 years of age. At 5 years of age, a slow neurological deterioration started, associated to visual impairment. Optic atrophy was added to the typical neurological exam of ataxic cerebral palsy and the diagnosis was re-considered. Neuroimaging showed a slow and progressive atrophy of intracerebral structures and ultramicroscopy revealed intracytoplasmatic inclusions in conjunctiva and skin, compatible with mucolipidoses type IV (ML-IV). ML-IV must be included in the differential diagnosis of cerebral palsy associated with loss of acquired skills and progressive visual impairment. Electron microscopy of skin or conjunctiva is a useful diagnostic test. Suspicion of ML-IV must not be restricted to Ashkenazi Jewish population.

  9. Physical Characterization of the Near-Earth Object Population

    NASA Technical Reports Server (NTRS)

    Binzel, Richard P.

    2004-01-01

    Many pieces of the puzzle must be brought together in order to have a clear picture of the near-Earth object (NEO) population. Four of the pieces that can be described include: i) the taxonomic distribution of the population as measured by observational sampling, ii) the determination of albedos that can be associated with the taxonomic distribution, iii) discovery statistics for the NE0 population, and iv) the debiasing of the discovery statistics using the taxonomic and albedo information. Support from this grant enables us to address three of these four pieces. Binzel et al. (2004, submitted) presents the first piece, detailing the observations and observed characteristics of the NE0 and Mars-crossing (MC) population. For the second piece, a complementary program of albedo measurements is pursued at the Keck Observatory (Binzel, P. I.) with first results published in Delbo et al. (2003). For the third piece, the most extensive NE0 discovery statistics are provided by the LINEAR survey. Binzel has supervised the MIT Ph. D. thesis work of Stuart (2003) to bring the fourth piece, submitted for publication by Stuart and Binzel (2004). Our results provide new constraints for the NE0 population and progress for the Spaceguard Survey, illuminate asteroid and comet source regions for the NEOs, and provide new evidence for space weathering processes linking asteroids and meteorites. Further, we are identifying top priority near-Earth spacecraft mission candidates based on their spectral properties and inferred compositions.

  10. A combined approach for the evaluation of a volatile organic compound emissions inventory.

    PubMed

    Choi, Yu-Jin; Calabrese, Richard V; Ehrman, Sheryl H; Dickerson, Russell R; Stehr, Jeffrey W

    2006-02-01

    Emissions inventories significantly affect photochemical air quality model performance and the development of effective control strategies. However, there have been very few studies to evaluate their accuracy. Here, to evaluate a volatile organic compound (VOC) emissions inventory, we implemented a combined approach: comparing the ratios of carbon bond (CB)-IV VOC groups to nitrogen oxides (NOx) or carbon monoxide (CO) using an emission preprocessing model, comparing the ratios of VOC source contributions from a source apportionment technique to NOx or CO, and comparing ratios of CB-IV VOC groups to NOx or CO and the absolute concentrations of CB-IV VOC groups using an air quality model, with the corresponding ratios and concentrations observed at three sites (Maryland, Washington, DC, and New Jersey). The comparisons of the ethene/NOx ratio, the xylene group (XYL)/NOx ratio, and ethene and XYL concentrations between estimates and measurements showed some differences, depending on the comparison approach, at the Maryland and Washington, DC sites. On the other hand, consistent results at the New Jersey site were observed, implying a possible overestimation of vehicle exhaust. However, in the case of the toluene group (TOL), which is emitted mainly from surface coating and printing sources in the solvent utilization category, the ratios of TOL/ NOx or CO, as well as the absolute concentrations revealed an overestimate of these solvent sources by a factor of 1.5 to 3 at all three sites. In addition, the overestimate of these solvent sources agreed with the comparisons of surface coating and printing source contributions relative to NOx from a source apportionment technique to the corresponding value of estimates at the Maryland site. Other studies have also suggested an overestimate of solvent sources, implying a possibility of inaccurate emission factors in estimating VOC emissions from surface coating and printing sources. We tested the impact of these overestimates with a chemical transport model and found little change in ozone but substantial changes in calculated secondary organic aerosol concentrations.

  11. Pulse I-V characterization of a nano-crystalline oxide device with sub-gap density of states

    NASA Astrophysics Data System (ADS)

    Kim, Taeho; Hur, Ji-Hyun; Jeon, Sanghun

    2016-05-01

    Understanding the charge trapping nature of nano-crystalline oxide semiconductor thin film transistors (TFTs) is one of the most important requirements for their successful application. In our investigation, we employed a fast-pulsed I-V technique for understanding the charge trapping phenomenon and for characterizing the intrinsic device performance of an amorphous/nano-crystalline indium-hafnium-zinc-oxide semiconductor TFT with varying density of states in the bulk. Because of the negligible transient charging effect with a very short pulse, the source-to-drain current obtained with the fast-pulsed I-V measurement was higher than that measured by the direct-current characterization method. This is because the fast-pulsed I-V technique provides a charge-trap free environment, suggesting that it is a representative device characterization methodology of TFTs. In addition, a pulsed source-to-drain current versus time plot was used to quantify the dynamic trapping behavior. We found that the charge trapping phenomenon in amorphous/nano-crystalline indium-hafnium-zinc-oxide TFTs is attributable to the charging/discharging of sub-gap density of states in the bulk and is dictated by multiple trap-to-trap processes.

  12. Pulse I-V characterization of a nano-crystalline oxide device with sub-gap density of states.

    PubMed

    Kim, Taeho; Hur, Ji-Hyun; Jeon, Sanghun

    2016-05-27

    Understanding the charge trapping nature of nano-crystalline oxide semiconductor thin film transistors (TFTs) is one of the most important requirements for their successful application. In our investigation, we employed a fast-pulsed I-V technique for understanding the charge trapping phenomenon and for characterizing the intrinsic device performance of an amorphous/nano-crystalline indium-hafnium-zinc-oxide semiconductor TFT with varying density of states in the bulk. Because of the negligible transient charging effect with a very short pulse, the source-to-drain current obtained with the fast-pulsed I-V measurement was higher than that measured by the direct-current characterization method. This is because the fast-pulsed I-V technique provides a charge-trap free environment, suggesting that it is a representative device characterization methodology of TFTs. In addition, a pulsed source-to-drain current versus time plot was used to quantify the dynamic trapping behavior. We found that the charge trapping phenomenon in amorphous/nano-crystalline indium-hafnium-zinc-oxide TFTs is attributable to the charging/discharging of sub-gap density of states in the bulk and is dictated by multiple trap-to-trap processes.

  13. A Mini-BAL Outflow at 900 pc from the Central Source: VLT/X-shooter Observations

    NASA Astrophysics Data System (ADS)

    Xu, Xinfeng; Arav, Nahum; Miller, Timothy; Benn, Chris

    2018-05-01

    We determine the physical conditions and location of the outflow material seen in the mini-BAL quasar SDSS J1111+1437 (z = 2.138). These results are based on the analysis of a high S/N, medium-resolution VLT/X-shooter spectrum. The main outflow component spans the velocity range ‑1500 to ‑3000 km s‑1 and has detected absorption troughs from both high-ionization species: C IV, N V, O VI, Si IV, P V, and S IV; and low-ionization species: H I, C II, Mg II, Al II, Al III, Si II, and Si III. Measurements of these troughs allow us to derive an accurate photoionization solution for this absorption component: a hydrogen column density, {log}({N}{{H}})={21.47}-0.27+0.21 cm‑2 and ionization parameter, {log}({U}{{H}})=-{1.23}-0.25+0.20. Troughs produced from the ground and excited states of S IV combined with the derived {U}{{H}} value allow us to determine an electron number density of {log}({n}{{e}})={3.62}-0.11+0.09 cm‑3 and to obtain the distance of the ionized gas from the central source: R={880}-260+210 pc.

  14. Methodology of a population-based stroke and TIA incidence and outcomes study: the Auckland Regional Community Stroke Study (ARCOS IV) 2011-2012.

    PubMed

    Krishnamurthi, Rita; Jones, Amy; Barber, P Alan; Barker-Collo, Suzanne; McPherson, Kathryn; Bennett, Derrick; Rush, Elaine; Suh, Flora; Starkey, Nicola; Theadom, Alice; Parag, Varsha; Rathnasabapathy, Yogini; Feigin, Valery L

    2014-01-01

    Stroke is a leading cause of death and disability worldwide. Stroke burden is immense as it leads to premature deaths, leaves survivors with ongoing disabilities, and has a major financial impact on the individual, their families, and the community. Reliable, high-quality evidence is needed on stroke risk factors, incidence, and outcomes to provide information on how best to reduce this burden. Population-based studies are regarded as the 'gold-standard' of measuring disease burden but are not common due to the logistical and financial challenges they present. The Auckland Regional Community Stroke Studies are among a few in the world that have been carried out at a population level and at regular intervals. The aim of the fourth Auckland Regional Community Stroke Studies IV is to examine the current measures of stroke incidence, prevalence, and outcomes as well the trends over four decades. This article describes the methodology of the Auckland Regional Community Stroke Studies IV with stroke and transient ischemic attacks cases registered over a 12-month period from March 1, 2011 to February 29, 2012. The methodology described may be used as a guide in order to design similar population-based stroke incidence and outcome studies in other countries and populations, thus facilitating the collection of most consistent and accurate stroke epidemiological data. © 2013 The Authors. International Journal of Stroke © 2013 World Stroke Organization.

  15. Beam dynamics and expected performance of Sweden's new storage-ring light source: MAX IV

    NASA Astrophysics Data System (ADS)

    Leemann, S. C.; Andersson, Å.; Eriksson, M.; Lindgren, L.-J.; Wallén, E.; Bengtsson, J.; Streun, A.

    2009-12-01

    MAX IV will be Sweden’s next-generation high-performance synchrotron radiation source. The project has recently been granted funding and construction is scheduled to begin in 2010. User operation for a broad and international user community should commence in 2015. The facility is comprised of two storage rings optimized for different wavelength ranges, a linac-based short-pulse facility and a free-electron laser for the production of coherent radiation. The main radiation source of MAX IV will be a 528 m ultralow emittance storage ring operated at 3 GeV for the generation of high-brightness hard x rays. This storage ring was designed to meet the requirements of state-of-the-art insertion devices which will be installed in nineteen 5 m long dispersion-free straight sections. The storage ring is based on a novel multibend achromat design delivering an unprecedented horizontal bare lattice emittance of 0.33 nm rad and a vertical emittance below the 8 pm rad diffraction limit for 1 Å radiation. In this paper we present the beam dynamics considerations behind this storage-ring design and detail its expected unique performance.

  16. Mid-IR Properties of an Unbiased AGN Sample of the Local Universe. 1; Emission-Line Diagnostics

    NASA Technical Reports Server (NTRS)

    Weaver, K. A.; Melendez, M.; Muhotzky, R. F.; Kraemer, S.; Engle, K.; Malumuth. E.; Tueller, J.; Markwardt, C.; Berghea, C. T.; Dudik, R. P.; hide

    2010-01-01

    \\Ve compare mid-IR emission-lines properties, from high-resolution Spitzer IRS spectra of a statistically-complete hard X-ray (14-195 keV) selected sample of nearby (z < 0.05) AGN detected by the Burst Alert Telescope (BAT) aboard Swift. The luminosity distribution for the mid-infrared emission-lines, [O IV] 25.89 microns, [Ne II] 12.81 microns, [Ne III] 15.56 microns and [Ne V] 14.32 microns, and hard X-ray continuum show no differences between Seyfert 1 and Seyfert 2 populations, although six newly discovered BAT AGNs are shown to be under-luminous in [O IV], most likely the result of dust extinction in the host galaxy. The overall tightness of the mid-infrared correlations and BAT luminosities suggests that the emission lines primarily arise in gas ionized by the AGN. We also compared the mid-IR emission-lines in the BAT AGNs with those from published studies of star-forming galaxies and LINERs. We found that the BAT AGN fall into a distinctive region when comparing the [Ne III]/[Ne II] and the [O IV]/[Ne III] quantities. From this we found that sources that have been previously classified in the mid-infrared/optical as AGN have smaller emission line ratios than those found for the BAT AGNs, suggesting that, in our X-ray selected sample, the AGN represents the main contribution to the observed line emission. Overall, we present a different set of emission line diagnostics to distinguish between AGN and star forming galaxies that can be used as a tool to find new AGN.

  17. Bacterial population dynamics during uranium reduction andre-oxidation: Application of a novel high density oligonucleotidemicroarray approach

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brodie, Eoin L.; DeSantis, Todd Z.; Joyner, Dominique C.

    2006-01-30

    Reduction of soluble uranium U(VI) to less-soluble uraniumU(IV) is a promising approach to minimize migration from contaminatedaquifers. It is generally assumed that, under constant reducingconditions, U(IV) is stable and immobile; however, in a previous study,we documented reoxidation of U(IV) under continuous reducing conditions(Wan et al., Environ. Sci. Technol. 2005, 39:6162 6169). To determine ifchanges in microbial community composition were a factor in U(IV)reoxidation, we employed a high-density phylogenetic DNA microarray (16Smicroarray) containing 500,000 probes to monitor changes in bacterialpopulations during this remediation process. Comparison of the 16Smicroarray with clone libraries demonstrated successful detection andclassification of most clone groups. Analysis ofmore » the most dynamic groupsof 16S rRNA gene amplicons detected by the 16S microarray identified fiveclusters of bacterial subfamilies responding in a similar manner. Thisapproach demonstrated that amplicons of known metal-reducing bacteriasuch as Geothrix fermentans (confirmed by quantitative PCR) and thosewithin the Geobacteraceae were abundant during U(VI) reduction and didnot decline during the U(IV) reoxidation phase. Significantly, it appearsthat the observed reoxidation of uranium under reducing conditionsoccurred despite elevated microbial activity and the consistent presenceof metal-reducing bacteria. High-density phylogenetic microarraysconstitute a powerful tool, enabling the detection and monitoring of asubstantial portion of the microbial population in a routine, accurate,and reproducible manner.« less

  18. Risky Business II: Finding Big Bucks. Panel IV.

    ERIC Educational Resources Information Center

    Appalachia, 1986

    1986-01-01

    Five panelists discuss alternatives to venture capital sources for Appalachian business expansion, new institutions created or supported by state and local governments to provide capital, and how businesses can best position themselves to take advantage of all capital sources. (NEC)

  19. On-Farm Evaluation of Hermetic Technology Against Maize Storage Pests in Kenya.

    PubMed

    Likhayo, Paddy; Bruce, Anani Y; Mutambuki, Kimondo; Tefera, Tadele; Mueke, Jones

    2016-08-01

    On-farm trial with a total of 32 farmers in eight villages of Naivasha and Nakuru areas of Kenya was conducted between December 2013 and September 2014 to evaluate hermetic grain storage technologies under farmers' management conditions. The storage technologies evaluated were metal silo and SuperGrain IV-R bag alongside the standard woven polypropylene bag with or without Actellic super dust. Moisture content, insect population, grain discoloration, and weight loss were analyzed 90, 180, and 270 d after storage. Grain moisture content remained stable over the storage period. Both metal silo and SuperGrain IV-R bag suppressed insect population, prevented grain loss and cross-infestation of insects from the surrounding environment. On the contrary, polypropylene bags allowed rapid build up of insect population and re-infestation from the surrounding environment. Grain weight losses were 1.5% in the metal silo and 1.8% in the SuperGrain IV-R bags compared to 32% in the polypropylene bags without Actellic Super dust, 270 d after storage. The present study, therefore, demonstrates that storing grains either in metal silo or SuperGrain IV-R bags would benefit farmers in reducing grain losses and improving quality. The study was of great interest to the farmers, grain storage scientists, and food security experts. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Contribution of alpha3(IV)alpha4(IV)alpha5(IV) Collagen IV to the Mechanical Properties of the Glomerular Basement Membrane

    NASA Astrophysics Data System (ADS)

    Gyoneva, Lazarina

    The glomerular basement membrane (GBM) is a vital part of the blood-urine filtration barrier in the kidneys. In healthy GBMs, the main tension-resisting component is alpha3(IV)alpha4(IV)alpha5(IV) type IV collagen, but in some diseases it is replaced by other collagen IV isoforms. As a result, the GBM becomes leaky and disorganized, ultimately resulting in kidney failure. Our goal is to understanding the biomechanical aspects of the alpha3(IV)alpha4(IV)alpha5(IV) chains and how their absence could be responsible for (1) the initial injury to the GBM and (2) progression to kidney failure. A combination of experiments and computational models were designed for that purpose. A model basement membrane was used to compare experimentally the distensibility of tissues with the alpha3(IV)alpha4(IV)alpha5(IV) chains present and missing. The experiments showed basement membranes containing alpha3(IV)alpha4(IV)alpha5(IV) chains were less distensible. It has been postulated that the higher level of lateral cross-linking (supercoiling) in the alpha3(IV)alpha4(IV)alpha5(IV) networks contributes additional strength/stability to basement membranes. In a computational model of supercoiled networks, we found that supercoiling greatly increased the stiffness of collagen IV networks but only minimally decreased the permeability, which is well suited for the needs of the GBM. It is also known that the alpha3(IV)alpha4(IV)alpha5(IV) networks are more protected from enzymatic degradation, and we explored their significance in GBM remodeling. Our simulations showed that the more protected network was needed to prevent the system from entering a dangerous feedback cycle due to autoregulation mechanisms in the kidneys. Overall, the work adds to the evidence of biomechanical differences between the alpha3(IV)alpha4(IV)alpha5(IV) networks and other collagen IV networks, points to supercoiling as the main source of biomechanical differences, discusses the suitability of alpha3(IV)alpha4(IV)alpha5(IV) networks to meet the mechanics and permeability needs of the GBM, and explores the role of biomechanics and enzymatic digestion in GBM remodeling.

  1. An Investigation into the Effect of the Mode of Presentation on Contract Evaluation When Cost/Schedule Control System Criteria Is Used.

    DTIC Science & Technology

    1986-09-01

    inversely related to years of experience. 1 18 IV. Methodology The methods used to test the research hypotheses were experimentation and survey. Two test...17 IV. Methodology .. .. .. .. .. .. .. ... .. ... .. .... 19 Task. .. .. .. .. .. .. ... .. ... .. ... .... 19 Population...Attribute Ratings vs Mode of Presentation (Paired T-test). . 53 XXVI. Preferences ............................... 53 vii Abstract This rsearch -focused

  2. An Examination of a Proposed DSM-IV Pathological Gambling Hierarchy in a Treatment Seeking Population: Similarities with Substance Dependence and Evidence for Three Classification Systems.

    PubMed

    Christensen, Darren R; Jackson, Alun C; Dowling, Nicki A; Volberg, Rachel A; Thomas, Shane A

    2015-09-01

    Toce-Gerstein et al. (Addiction 98:1661-1672, 2003) investigated the distribution of Diagnostic and Statistical Manual for Mental Disorders, 4th edition (DSM-IV) pathological gambling criteria endorsement in a U.S. community sample for those people endorsing a least one of the DSM-IV criteria (n = 399). They proposed a hierarchy of gambling disorders where endorsement of 1-2 criteria were deemed 'At-Risk', 3-4 'Problem gamblers', 5-7 'Low Pathological', and 8-10 'High Pathological' gamblers. This article examines these claims in a larger Australian treatment seeking population. Data from 4,349 clients attending specialist problem gambling services were assessed for meeting the ten DSM-IV pathological gambling criteria. Results found higher overall criteria endorsement frequencies, three components, a direct relationship between criteria endorsement and gambling severity, clustering of criteria similar to the Toce-Gerstein et al. taxonomy, high accuracy scores for numerical and criteria specific taxonomies, and also high accuracy scores for dichotomous pathological gambling diagnoses. These results suggest significant complexities in the frequencies of criteria reports and relationships between criteria.

  3. Sediment sources and their contribution along northern coast of the South China Sea: Evidence from clay minerals of surface sediments

    NASA Astrophysics Data System (ADS)

    Liu, Jianguo; Yan, Wen; Chen, Zhong; Lu, Jun

    2012-09-01

    Clay minerals of surface sediment samples from nine bays/harbors along northern coast of the South China Sea (SCS) are used for sediment sources and contribution estimation in the study areas. Results reveal that sediments in the study bays/harbors seem to be a mixture of sediments from the Pearl, Hanjiang River and local islands/rivers, but their clay mineral assemblage is distinct from that of Luzon and Taiwan sediments, indicating that sediments are derived mainly from the neighboring sources through riverine input and partly from localized sediments. Due to input of local sediments in the northern SCS, sediments from both east of the Leizhou Peninsula (Area IV) and next to the Pearl River estuary (PRE, Area II) have high smectite percent. Affected by riverine input of the Pearl and Hanjiang Rivers, sediments in west of the PRE (Area III) and east of the PRE (Area I) have high illite (average 47%) and kaolinite (54%) percents, respectively. Sediment contributions of various major sources to the study areas are estimated as the following: (1) the Hanjiang River provide 95% and 84% sediments in Areas I and II, respectively, (2) the Pearl River supply 79% and 29% sediments in Areas III and IV, respectively and (3) local sediments contribute the rest and reach the maximum (˜71%) in Area IV.

  4. Should there be separate parent and teacher-based categories of ODD? Evidence from a general population.

    PubMed

    Munkvold, Linda; Lundervold, Astri; Lie, Stein Atle; Manger, Terje

    2009-10-01

    To examine the occurrence of oppositional defiant disorder (ODD) symptoms in a general population of boys and girls, as reported by parents and teachers, and to investigate differences in prevalence estimates, depending on how parents' and teachers' ratings were combined. Data were collected from 7007 children (aged 7-9) who participated in The Bergen Child Study (BCS), an ongoing population-based study of children's development and mental health. ODD symptoms were measured by the SNAP-IV (Swanson, Nolan, & Pelham-IV) Oppositional Defiant Disorder sub-scale (SNAP-IV ODD) that was distributed to parents and teachers. Co-occurring symptoms of mental health problems were measured by the Strengths and Difficulties Questionnaire (SDQ). Prevalence-estimates of ODD varied considerably depending on how ratings from parents and teachers were combined. Specific ODD symptoms occurred at very different rates depending on the rater and on the gender of the child being rated. Parents and teachers co-identified very few children with ODD. ODD identified by only one informant was associated with high levels of comorbid mental health problems and impairment according to both informants. The results support an informant-specific conceptualization of childhood ODD.

  5. Uranium(IV) adsorption by natural organic matter in anoxic sediments

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bone, Sharon E.; Dynes, James J.; Cliff, John

    2017-01-09

    Uranium is an important fuel source and a global environmental contaminant. It accumulates in the tetravalent state, U(IV), in anoxic sediments, including ore deposits, marine basins, and contaminated aquifers. However, very little is known about the speciation of U(IV) in low temperature geochemical environments, inhibiting the development of a conceptual model of U behavior. Until recently, U(IV) was assumed to exist predominantly as the sparingly soluble mineral uraninite (UO 2) in anoxic sediments; yet studies now show that UO 2 is not often dominant in these environments. However, a model of U(IV) speciation under environmentally relevant conditions has not yetmore » been developed. Here we show that complexes of U(IV) adsorb on organic carbon and organic carbon-coated clays in an organic-rich natural substrate under field-relevant conditions. Whereas previous research assumed that the U(IV) product depended on the reduction pathway, our results demonstrate that UO 2 formation can be inhibited simply by decreasing the U:solid ratio. Thus, it is the number and type of surface ligands that controls U(IV) speciation subsequent to U(VI) reduction. Projections of U transport and bioavailability, and thus its threat to human and ecosystem health, must consider retention of U(IV) ions within the local sediment environment.« less

  6. Environmental burden of diarrhoeal diseases due to unsafe water supply and poor sanitation coverage in Nepal.

    PubMed

    Aryal, K K; Joshi, H D; Dhimal, M; Singh, S P; Dhakal, P; Dhimal, B; Bhusal, C L

    2012-05-01

    Unsafe water and poor sanitation are major contributing factors of diarrhoea. Most of the water supply systems in urban and rural area of Nepal do not have basic water treatment facilities. This has resulted in frequent reports of fecal contamination in drinking water and outbreaks of waterborne diseases. The purpose of this study was to find out the burden of diarrhoeal diseases at different scenario of water supply system and sanitation status in Nepalese context. A cross-sectional study was conducted in four different districts of Nepal analyzing six different scenarios based on availability of water supply and sanitation status. Village Development Committees (VDCs) and community selection was made purposively and 360 households, 60 from each scenario were selected conveniently to achieve the required number. Within the selected household, the head of the household or any member above 18 years of age was interviewed using a structured questionnaire. Observation was done for toilet and water sources besides questionnaire method. Incidence of diarrhoea per 1000 population was found to be the highest in scenario-IV (Spring without toilet) with 204.89 followed by scenario-VI (Tube well without toilet) with 145.30, while it was less in scenario-I (Tap water with toilet) with 46.05. Accordingly, the burden of disease (YLD) was also found to be the highest in scenario-IV and the lowest in scenario-I. Most of the households didn't treat water before drinking. Hand washing practice was found to be more than 90% regardless of toilet availability. The greater risk of acquiring diarrhoeal disease and higher burden of disease in situation of unprotected water source and absence of toilet shows that these are still important contributing factors for diarrhoeal disease in Nepal. Use of sanitary toilets and protected water source are the important measures for diarrhoeal disease prevention in Nepal.

  7. 10 CFR 70.39 - Specific licenses for the manufacture or initial transfer of calibration or reference sources.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... and design; (iii) Details of the method of incorporation and binding of the plutonium in the source; (iv) Procedures for and results of prototype testing of sources, which are designed to contain more... experimental studies and tests, required by the Commission to facilitate a determination of the safety of the...

  8. 40 CFR 63.1318 - PET and polystyrene affected sources-testing and compliance demonstration provisions.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 11 2011-07-01 2011-07-01 false PET and polystyrene affected sources...: Group IV Polymers and Resins § 63.1318 PET and polystyrene affected sources—testing and compliance... not apply and owners or operators are not required to comply with § 63.113. (b) PET affected sources...

  9. 40 CFR 63.1318 - PET and polystyrene affected sources-testing and compliance demonstration provisions.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 12 2012-07-01 2011-07-01 true PET and polystyrene affected sources...: Group IV Polymers and Resins § 63.1318 PET and polystyrene affected sources—testing and compliance... not apply and owners or operators are not required to comply with § 63.113. (b) PET affected sources...

  10. 40 CFR 63.1318 - PET and polystyrene affected sources-testing and compliance demonstration provisions.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 11 2010-07-01 2010-07-01 true PET and polystyrene affected sources...: Group IV Polymers and Resins § 63.1318 PET and polystyrene affected sources—testing and compliance... not apply and owners or operators are not required to comply with § 63.113. (b) PET affected sources...

  11. Resolving the paradigm crisis in intravenous iron and erythropoietin management.

    PubMed

    Besarab, A

    2006-05-01

    Despite the proven benefits of intravenous (i.v.) iron therapy in anemia management, it remains underutilized in the hemodialysis population. Although overall i.v. iron usage continues to increase slowly, monthly usage statistics compiled by the US Renal Data System suggest that clinicians are not implementing continued dosing regimens following repletion of iron stores. Continued therapy with i.v. iron represents a key opportunity to improve patient outcomes and increase the efficiency of anemia treatment. Regular administration of low doses of i.v. iron prevents the recurrence of iron deficiency, enhances response to recombinant human erythropoietin therapy, minimizes fluctuation of hemoglobin levels, hematocrit levels, and iron stores, and may reduce overall costs of care. This article reviews the importance of i.v. iron dosing on a regular basis in the hemodialysis patient with iron-deficiency anemia and explores reasons why some clinicians may still be reluctant to employ these protocols in the hemodialysis setting.

  12. Identifying potential sources of Sudan I contamination in Capsicum fruits over its growth period.

    PubMed

    Wu, Naiying; Gao, Wei; Zhou, Li; Lian, Yunhe; Li, Fengfei; Han, Wenjie

    2015-04-15

    Sudan dyes in spices are often assumed to arise from cross-contamination or malicious addition. Here, experiments were carried out to identify the potential source of Sudan I-IV in Capsicum fruits through investigation of their contents in native Capsicum tissues, soils and associated agronomic materials. Sudan II-IV was not detected in any of the tested samples. Sudan I was found in almost all samples except for the mulching film. Sudan I concentrations decreased from stems to leaves and then to fruits or roots. Sudan I levels in soils were significantly elevated by vegetation treatment. These results exclude the possibility of soil as the main source for Sudan I contamination in Capsicum fruits. Further study found out pesticide and fertilizer constitutes the major source of Sudan I contamination. This work represents a preliminary step for a detailed Sudan I assessment to support Capsicum management and protection in the studied region. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Evaluation of a research diagnostic algorithm for DSM-5 neurocognitive disorders in a population-based cohort of older adults.

    PubMed

    Eramudugolla, Ranmalee; Mortby, Moyra E; Sachdev, Perminder; Meslin, Chantal; Kumar, Rajeev; Anstey, Kaarin J

    2017-03-04

    There is little information on the application and impact of revised criteria for diagnosing dementia and mild cognitive impairment (MCI), now termed major and mild neurocognitive disorders (NCDs) in the DSM-5. We evaluate a psychometric algorithm for diagnosing DSM-5 NCDs in a community-dwelling sample, and characterize the neuropsychological and functional profile of expert-diagnosed DSM-5 NCDs relative to DSM-IV dementia and International Working Group criteria for MCI. A population-based sample of 1644 adults aged 72-78 years was assessed. Algorithmic diagnostic criteria used detailed neuropsychological data, medical history, longitudinal cognitive performance, and informant interview. Those meeting all criteria for at least one diagnosis had data reviewed by a neurologist (expert diagnosis) who achieved consensus with a psychiatrist for complex cases. The algorithm accurately classified DSM-5 major NCD (area under the curve (AUC) = 0.95, 95% confidence interval (CI) 0.92-0.97), DSM-IV dementia (AUC = 0.91, 95% CI 0.85-0.97), DSM-5 mild NCD (AUC = 0.75, 95% CI 0.70-0.80), and MCI (AUC = 0.76, 95% CI 0.72-0.81) when compared to expert diagnosis. Expert diagnosis of dementia using DSM-5 criteria overlapped with 90% of DSM-IV dementia cases, but resulted in a 127% increase in diagnosis relative to DSM-IV. Additional cases had less severe memory, language impairment, and instrumental activities of daily living (IADL) impairments compared to cases meeting DSM-IV criteria for dementia. DSM-5 mild NCD overlapped with 83% of MCI cases and resulted in a 19% increase in diagnosis. These additional cases had a subtly different neurocognitive profile to MCI cases, including poorer social cognition. DSM-5 NCD criteria can be operationalized in a psychometric algorithm in a population setting. Expert diagnosis using DSM-5 NCD criteria captured most cases with DSM-IV dementia and MCI in our sample, but included many additional cases suggesting that DSM-5 criteria are broader in their categorization.

  14. GVHD after HLA-matched sibling BMT or PBSCT: Comparison of North American Caucasian and Japanese Populations

    PubMed Central

    Kanda, Junya; Brazauskas, Ruta; Hu, Zhen-Huan; Kuwatsuka, Yachiyo; Nagafuji, Koji; Kanamori, Heiwa; Kanda, Yoshinobu; Miyamura, Koichi; Murata, Makoto; Fukuda, Takahiro; Sakamaki, Hisashi; Kimura, Fumihiko; Seo, Sachiko; Aljurf, Mahmoud; Yoshimi, Ayami; Milone, Giuseppe; Wood, William A; Ustun, Celalettin; Hashimi, Shahrukh; Pasquini, Marcelo; Bonfim, Carmem; Dalal, Jignesh; Hahn, Theresa; Atsuta, Yoshiko; Saber, Wael

    2016-01-01

    The risk of acute graft-versus-host disease (GVHD) after HLA-matched sibling bone marrow (BM) transplantation is lower in Japanese than in Caucasian patients. However, race may have differential effect on GVHD dependent on the graft source. North American Caucasian and Japanese patients receiving their first allogeneic BM or peripheral blood stem cell (PBSC) transplantations from an HLA-matched sibling for leukemia were eligible. BM was used in 13% and 53% of Caucasian and Japanese patients, respectively. In multivariate analysis, the interaction term between race and graft source was not significant in any of the models, indicating that graft source does not affect the impact of race on outcomes. The risk of grades III–IV acute GVHD was significantly lower in Japanese than in Caucasian patients (hazard ratio (HR) 0.74, 95% confidence interval (CI) 0.57–0.96), which resulted in lower risk of non-relapse mortality in Japanese patients (HR 0.69, 95% CI 0.54–0.89). The risk of relapse was also lower in this group. Lower risk of non-relapse mortality and relapse resulted in lower overall mortality rates among Japanese patients. In conclusion, irrespective of graft source, the risk of severe acute GVHD is lower in Japanese patients, which results in lower risk of non-relapse mortality. PMID:26762681

  15. Dipeptidyl(amino)peptidase IV and aminopeptidase M metabolize circulating substance P in vivo.

    PubMed

    Ahmad, S; Wang, L; Ward, P E

    1992-03-01

    Recent studies have demonstrated that Fischer-344 rats from Japanese Charles River Inc. specifically lack dipeptidyl(amino)peptidase IV (DAP IV-negative; EC 3.4.14.5), whereas Fischer-344 rats from sources within the United States (DAP IV-positive) possess normal DAP IV activity. In the present study, plasma from DAP IV-positive rats metabolized substance P (SP) (5.37 +/- 0.25 nmol/min/ml) via the actions of angiotensin-converting enzyme (EC 3.4.15.1) (1.86 +/- 0.50 nmol/min/ml) and DAP IV (2.56 +/- 0.42 nmol/min/ml). DAP IV sequentially converted SP to SP[3-11] and SP[5-11]. The SP[5-11] metabolite was then rapidly hydrolyzed by plasma aminopeptidase M (AmM; EC 3.4.11.2) (36.2 +/- 4.2 nmol/min/ml). In contrast, SP metabolism by plasma from DAP IV-negative rats was less than half that of control animals (2.14 +/- 0.06 nmol/min/ml), due to a complete lack of DAP IV hydrolysis. The absence of DAP IV was not associated with any differences in angiotensin-converting enzyme-mediated hydrolysis of SP (1.45 +/- 0.11 nmol/min/ml) or AmM-mediated hydrolysis of SP[5-11] (37.1 +/- 0.9 nmol/min/ml). Consistent with this deficiency in SP metabolism, SP was more potent in vivo in stimulating salivary secretion in DAP IV-negative rats compared to DAP IV-positive animals. Potentiation was specific in that SP[5-11], an SP fragment resistant to DAP IV, was equipotent in DAP IV-negative and positive animals. SP[5-11]-induced salivary secretion was potentiated in both strains when AmM-mediated hydrolysis was inhibited by amastatin (20 nmol/min, i.v.). These data provide direct evidence for a significant role for DAP IV and AmM in the in vivo processing of SP and active SP metabolites.

  16. The First Detection of [O IV] from an Ultraluminous X-ray Source with Spitzer. I. Observational Results for Holmberg II ULX

    NASA Technical Reports Server (NTRS)

    Berghea, C. T.; Dudik, R. P.; Weaver, K. A.; Kallman, T. R.

    2009-01-01

    We presen the first Spitzer Infrared Spectrograph (IRS) observations of the [O IV] 25.89 um emission line detected from the ultraluminous X-ray source (ULX) in Holmberg II. This line is a well established signature of high excitation usually associated with AGN. Its detection suggests that the ULX has a strong impact on the surrounding gas. A Spitzer high resolution spectral map shows that the [O IV] is coincident with the X-ray position of the ULX. The ratios of the [O IV] to lower ionization lines are similar to those observed in AGN, suggesting that a strong UV and X-ray source is responsible for the, photoionization. The best XMM-Newton data is used to model the X-ray band which is then extrapolated into the UV. We perform infrared and ultraviolet photometry, and use its previously published optical and radio data to construct the full SED for the ULX and its companion. The preferred model to describe the SED includes an accretion disk which dominates the soft X-rays but contributes little at UV and optical wavelengths. The optical counterpart is consistent with a B supergiant as previously suggested in other studies. The bolometric luminosity of the ULX suggests the presence of an intermediate-mass black hole with mass >85 M for sub-Eddington accretion or, alternatively, a stellar-mass black hole that is accreting at super-Eddington rates. In a follow-up second paper we perform detailed photoionization modeling of the infrared lines in order to constrain the bolometric luminosity of the ULX.

  17. The DAPP-SF as a screener for personality disorder in a forensic setting.

    PubMed

    Spaans, Marleen; Rinne, Thomas; de Beurs, Edwin; Spinhoven, Philip

    2015-01-01

    Studies on the Dimensional Assessment of Personality Pathology-Short Form (DAPP-SF) have shown its ability to identify treatment-seeking patients with personality disorders. This study focuses on its screening potential for personality disorder in 89 criminal suspects (77 men, 12 women; M age = 37.0 years) undergoing residential pretrial psychological assessments in a high-security setting. It was expected that Structured Interview for DSM-IV Personality (SIDP-IV) criteria met for personality disorder(s) would be associated with higher DAPP-SF scores. A floor effect was found in DAPP-SF scores: The forensic population reported less personality pathology than the general population. Only moderate associations between DAPP-SF and SIDP-IV outcome were found. Receiver operating characteristic analysis showed that some DAPP-SF subscales did not exceed chance level in their ability to screen for personality disorders. It is concluded that the DAPP-SF has limited usefulness as a screener for personality disorders in a forensic pretrial setting. Alternative forensic screening instruments are presented.

  18. Aminoglycoside acetyltransferase 3-IV (aacC4) and hygromycin B 4-I phosphotransferase (hphB) in bacteria isolated from human and animal sources.

    PubMed

    Salauze, D; Otal, I; Gomez-Lus, R; Davies, J

    1990-10-01

    Members of the family Enterobacteriaceae harboring an enzyme of the aminoglycoside acetyltransferase 3 class (AAC-3-IV) (apramycin and gentamicin resistance) and hygromycin B phosphotransferase 4 (HPH-4-I) (hygromycin B resistance) have been isolated from human clinical sources in Europe. A cluster of genes containing IS140, aacC4, and hphB was found in these strains. We demonstrate by Southern hybridization that this cluster is identical to the operon found in animals that also contains insertion sequences belonging to the ISO family. This provides another example of presumptive transfer of antibiotic resistance genes between bacteria of animal and human origin.

  19. Manifestation of counteracting photovoltaic effect on IV characteristics in multi-junction solar cells

    NASA Astrophysics Data System (ADS)

    Mintairov, M. A.; Evstropov, V. V.; Mintairov, S. A.; Shvarts, M. Z.; Kozhukhovskaia, S. A.; Kalyuzhnyy, N. A.

    2017-11-01

    The existence within monolithic double- and triple-junction solar cells of a photoelectric source, which counteracts the basic photovoltaic p-n junctions, is proved. The paper presents a detailed analysis of the shape of the light IV-characteristics, as well as the dependence Voc-Jsc (open circuit voltage - short-circuit current). It is established that the counteracting source is tunnel p+-n+ junction. The photoelectric characteristics of samples with different tunnel diode peak current values were investigated, including the case of a zero value. When the tunnel p+-n+ junction is photoactive, the Voc-Jsc dependence has a dropping part, including a sharp jump. This undesirable effect decreases with increasing peak current.

  20. 48 CFR 25.702-1 - Definitions.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... apparatus of business or commerce. Marginalized populations of Sudan means— (1) Adversely affected groups in... specific authorization from the Office of Foreign Assets Control in the Department of the Treasury, or are...) Consist of providing goods or services to marginalized populations of Sudan; (iv) Consist of providing...

  1. 48 CFR 25.702-1 - Definitions.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... apparatus of business or commerce. Marginalized populations of Sudan means— (1) Adversely affected groups in... specific authorization from the Office of Foreign Assets Control in the Department of the Treasury, or are...) Consist of providing goods or services to marginalized populations of Sudan; (iv) Consist of providing...

  2. 48 CFR 25.702-1 - Definitions.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... apparatus of business or commerce. Marginalized populations of Sudan means— (1) Adversely affected groups in... specific authorization from the Office of Foreign Assets Control in the Department of the Treasury, or are...) Consist of providing goods or services to marginalized populations of Sudan; (iv) Consist of providing...

  3. 48 CFR 25.702-1 - Definitions.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... apparatus of business or commerce. Marginalized populations of Sudan means— (1) Adversely affected groups in... specific authorization from the Office of Foreign Assets Control in the Department of the Treasury, or are...) Consist of providing goods or services to marginalized populations of Sudan; (iv) Consist of providing...

  4. Arcsecond positions for milliarcsecond VLBI nuclei of extragalactic radio sources. IV - Seventeen sources

    NASA Technical Reports Server (NTRS)

    Morabito, D. D.; Preston, R. A.; Linfield, R. P.; Slade, M. A.; Jauncey, D. L.

    1986-01-01

    VLBI measurements of time delay and delay rate at 2.29 and 8.42 GHz on baselines of 10,000 km have been used to determine the positions of the milliarcsecond nuclei in 17 extragalactic radio sources with estimated accuracies of 0.1 to 0.3 arcsec. The observed sources are part of an all-sky VLBI catalog of milliarcsecond radio sources. In addition, slightly improved positions are presented for 101 sources originally reported by Morabito et al. (1983). Arcsecond positions have now been determined for 836 sources.

  5. Overview of Solar Radio Bursts and their Sources

    NASA Astrophysics Data System (ADS)

    Golla, Thejappa; MacDowall, Robert J.

    2018-06-01

    Properties of radio bursts emitted by the Sun at frequencies below tens of MHz are reviewed. In this frequency range, the most prominent radio emissions are those of solar type II, complex type III and solar type IV radio bursts, excited probably by the energetic electron populations accelerated in completely different environments: (1) type II bursts are due to non-relativistic electrons accelerated by the CME driven interplanetary shocks, (2) complex type III bursts are due to near-relativistic electrons accelerated either by the solar flare reconnection process or by the SEP shocks, and (3) type IV bursts are due to relativistic electrons, trapped in the post-eruption arcades behind CMEs; these relativistic electrons probably are accelerated by the continued reconnection processes occurring beneath the CME. These radio bursts, which can serve as the natural plasma probes traversing the heliosphere by providing information about various crucial space plasma parameters, are also an ideal instrument for investigating acceleration mechanisms responsible for the high energy particles. The rich collection of valuable high quality radio and high time resolution in situ wave data from the WAVES experiments of the STEREO A, STEREO B and WIND spacecraft has provided an unique opportunity to study these different radio phenomena and understand the complex physics behind their excitation. We have developed Monte Carlo simulation techniques to estimate the propagation effects on the observed characteristics of these low frequency radio bursts. We will present some of the new results and describe how one can use these radio burst observations for space weather studies. We will also describe some of the non-linear plasma processes detected in the source regions of both solar type III and type II radio bursts. The analysis and simulation techniques used in these studies will be of immense use for future space based radio observations.

  6. Quantitative petrographic analysis of Desmoinesian sandstones from Oklahoma

    USGS Publications Warehouse

    Dyman, Thaddeus S.

    1989-01-01

    Desmoinesian sandstones from the northern Oklahoma platform and the Anadarko, Arkoma, and Ardmore basins record a complex interaction between mid-Pennsylvanian source-area tectonism and cyclic sedimentation patterns associated with numerous transgressions and regressions. Framework-grain summaries for 50 thin sections from sandstones of the Krebs, Cabaniss, and Marmaton Groups and their surface and subsurface equivalents were subjected to multivariate statistical analyses to establish regional compositional trends for provenance analysis. R-mode cluster and correspondence analyses were used to determine the contributing effect (total variance) of key framework grains. Fragments of monocrystalline and polycrystalline quartz; potassium and plagioclase feldspar; chert; and metamorphic, limestone, and mudstone-sandstone rock fragments contribute most to the variation in the grain population. Q-mode cluster and correspondence analyses were used to identify four petrofacies and establish the range of compositional variation in Desmoinesian sandstones. Petrofacies I is rich in monocrystalline quartz (78-98%); mica and rock fragments are rare. Petrofacies II is also rich in monocrystalline quartz (60-84%) and averages 12% total rock fragments. Petrofacies III and IV are compositionally heterogeneous and contain variable percentages of monocrystalline and polycrystalline quartz, potassium feldspar, mica, chert, and metamorphic and sedimentary rock fragments. Quantitative analyses indicate that Desmoinesian sandstones were derived from sedimentary, igneous, and metamorphic source areas. Sandstones of petrofacies I and II occur mostly in the lower Desmoinesian and are widely distributed, although they are most abundant in eastern and central Oklahoma; sandstones of petrofacies III and IV are widely distributed and occur primarily in the middle and upper Desmoinesian. The range of compositional variation and the distribution of petrofacies are related to paleotectonics and basin development, sediment recycling, and varying depositional environments.

  7. Comparison of sequential intravenous/oral ciprofloxacin plus metronidazole with intravenous ceftriaxone plus metronidazole for treatment of complicated intra-abdominal infections.

    PubMed

    Wacha, Hannes; Warren, Brian; Bassaris, Harry; Nikolaidis, Paul

    2006-08-01

    Intra-abdominal infections are a substantial clinical problem and an important cause of morbidity and death in the hospital. Optimal treatment requires both source control and antibiotic therapy. Sequential intravenous (IV) to oral therapy may improve patient convenience and reduce total health care costs. In this randomized, double-blind trial, the efficacy of sequential IV-to-oral ciprofloxacin plus metronidazole was compared with ceftriaxone plus metronidazole in adult patients with complicated intra-abdominal infections. The trial enrolled 531 patients, who began with IV therapy. Patients who improved clinically were switched to oral therapy on day three or later. The clinical and bacteriological responses four to six weeks after the end of therapy and the safety of the two regimens were assessed. To maintain blinding, the patients received placebo IV in the ciprofloxacin group or placebo orally in the ceftriaxone group. A total of 475 patients (235 ciprofloxacin plus metronidazole, 240 ceftriaxone plus metronidazole) were valid for evaluation of efficacy. All patients were included in the safety analysis. Of the patients valid for efficacy, 78% of the ciprofloxacin plus metronidazole group and 81% of the ceftriaxone plus metronidazole group were eligible for a switch to oral therapy. The clinical success rates were 98.9% and 96.9%, respectively, which were statistically equivalent. The clinical success rates for all patients, including those on continuous IV therapy, were 90.6% and 87.9%. Source control was achieved in more than 90% of the patients. The bacteriological eradication rates were similar in the two groups. Bacterial complications (e.g., surgical site infections, abscesses) were encountered more often in the ceftriaxone plus metronidazole group. Sequential ciprofloxacin plus metronidazole IV-to-oral therapy was statistically equivalent to ceftriaxone plus metronidazole. The switch to oral therapy with ciprofloxacin plus metronidazole was as effective and safe as continued IV therapy in patients able to tolerate enteral feeding.

  8. The AAHKS Clinical Research Award: Intraosseous Regional Prophylaxis Provides Higher Tissue Concentrations in High BMI Patients in Total Knee Arthroplasty: A Randomized Trial.

    PubMed

    Chin, Seung Joon; Moore, Grant A; Zhang, Mei; Clarke, Henry D; Spangehl, Mark J; Young, Simon W

    2018-07-01

    Obesity is an established risk factor for periprosthetic joint infections after total knee arthroplasty (TKA). In obese patients, a larger dose of prophylactic vancomycin based on actual body weight is required to reach therapeutic concentrations. It is unclear how tissue concentrations are affected when intraosseous regional administration (IORA) is used in this population. This study compared tissue concentrations of low-dose vancomycin via IORA vs actual body weight-adjusted systemic intravenous (IV) dose in primary TKA. Twenty-two patients with a body mass index (BMI) >35 undergoing TKA were randomized into 2 groups. The IV group received 15 mg/kg (maximum of 2 g) of systemic IV vancomycin and the IORA group received 500 mg vancomycin into the tibia. Subcutaneous fat and bone samples were taken at regular intervals. Tissue antibiotic concentrations were measured using liquid chromatography coupled with tandem mass spectrometry. A blood sample was taken 1 to 2 hours after tourniquet deflation to measure systemic concentration. The mean BMI was 41.1 in the IORA group and 40.1 in the IV systemic group. The overall mean tissue concentration in subcutaneous fat was 39.3 μg/g in the IORA group and 4.4 μg/g in the IV systemic group (P < .01). Mean tissue concentrations in bones were 34.4 μg/g in the IORA group and 6.1 μg/g in the IV systemic group (P < .01). Low-dose IORA was effective in the high-BMI population group, providing tissue concentrations of vancomycin 5-9 times higher than systemic administration. IORA optimizes timing of vancomycin administration and provides high tissue antibiotic concentrations during TKA in this high-risk patient group. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. Clinical value of DSM IV and DSM 5 criteria for diagnosing the most prevalent somatoform disorders in patients with medically unexplained physical symptoms (MUPS).

    PubMed

    van Dessel, Nikki Claassen-; van der Wouden, Johannes C; Dekker, Joost; van der Horst, Henriette E

    2016-03-01

    This study aimed (1) to describe frequencies of DSM IV somatisation disorder, undifferentiated somatoform disorder and pain disorder versus DSM 5 somatic symptom disorder (SSD) in a multi-setting population of patients with medically unexplained physical symptoms (MUPS), (2) to investigate differences in sociodemographic and (psycho)pathological characteristics between these diagnostic groups and (3) to explore the clinical relevance of the distinction between mild and moderate DSM 5 SSD. We used baseline data of a cohort of 325 MUPS patients. Measurements included questionnaires about symptom severity, physical functioning, anxiety, depression, health anxiety and illness perceptions. These questionnaires were used as proxy measures for operationalization of DSM IV and DSM 5 diagnostic criteria. 92.9% of participants fulfilled criteria of a DSM IV somatoform disorder, while 45.5% fulfilled criteria of DSM 5 SSD. Participants fulfilling criteria of DSM 5 SSD suffered from more severe symptoms than those only fulfilling criteria of a DSM IV somatoform disorder(mean PHQ-15 score of 13.98 (SD 5.17) versus 11.23 (SD 4.71), P-value<0.001). Furthermore their level of physical functioning was significantly lower. Compared to patients with mild SSD, patients with moderate SSD suffered from significantly lower physical functioning and higher levels of depression. Within a population of MUPS patients DSM 5 SSD criteria are more restrictive than DSM IV criteria for somatoform disorders. They are associated with higher symptom severity and lower physical functioning. However, further specification of the positive psychological criteria of DSM 5 SSD may improve utility in research and practice. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Pregabalin Use Among Users of Illicit Drugs: A Cross-Sectional Survey in Southern Germany.

    PubMed

    Snellgrove, Brendan J; Steinert, Tilman; Jaeger, Susanne

    2017-10-01

    The antiepileptic drug pregabalin is one of the best-selling pharmaceutical products worldwide. There are increasing concerns about its potential for misuse and dependence especially among patients with former or current substance use disorders (SUDs). Our objective was to clarify the extent and pattern of pregabalin use as well as motives and predictors in this population. We conducted a cross-sectional study with patients on a detoxification ward for illicit drugs at the Center for Psychiatry, Südwürttemberg, Ravensburg in southern Germany from August 2012 until July 2013. We used an extensive questionnaire, part of the Structured Clinical Interview for DSM-IV (Diagnostic and Statistical Manual of Mental Disorders, 4th edition) Axis I Disorders (SCID-I) and urine samples. Of the 253 participating patients, 56% had used pregabalin at least once. Of these, 92% had acquired it at least in part from illegal sources. The main motives for the use of pregabalin were the attenuation of opioid withdrawal symptoms, the augmentation of other psychotropic substances, and the psychotropic effects of pregabalin itself. Predictors for pregabalin use were opioid and sedative use as well as younger age. The criteria of dependency according to DSM-IV was met by 11% of pregabalin users and 13% of urine samples were positive for pregabalin. Use of pregabalin is common among users of illicit drugs in large parts of southern Germany, with motives for use, acquisition, and mode of use suggesting misuse. The mode of use, especially intake of high doses and concomitant use of other drugs, poses a serious risk to this population, including the development of dependency.

  11. 40 CFR 63.1319 - PET and polystyrene affected sources-recordkeeping provisions.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... (CONTINUED) AIR PROGRAMS (CONTINUED) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS FOR SOURCE CATEGORIES (CONTINUED) National Emission Standards for Hazardous Air Pollutant Emissions: Group IV Polymers...)(i) by demonstrating that mass emissions per mass product are less than or equal to the level...

  12. Investigating the reasons of variability in Si IV and C IV broad absorption line troughs of quasars

    NASA Astrophysics Data System (ADS)

    Stathopoulos, Dimitrios; Lyratzi, Evangelia; Danezis, Emmanuel; Antoniou, Antonios; Tzimeas, Dimitrios

    2017-09-01

    In this paper we analyze the C IV and Si IV broad absorption troughs of two BALQSOs (J101056.69+355833.3, J114548.38+393746.6) to the individual components they consist of. By analyzing a BAL trough to its components we have the advantage to study the variations of the individual absorbing systems in the line of sight and not just the variations of the whole absorption trough or the variations of selected portions of BAL troughs exhibiting changes. We find that the velocity shifts and FWHMs (Full Width at Half Maximum) of the individual components do not vary between an interval of six years. All variable components show changes in the optical depths at line centers which are manifested as variations in the EW (Equivalent Width) of the components. In both BALQSOs, over corresponding velocities, Si IV has higher incidence of variability than C IV. From our analysis, evidence is in favour of different covering fractions between C IV and Si IV. Finally, although most of our results favour the crossing cloud scenario as the cause of variability, there is also strong piece of evidence indicating changing ionization as the source of variability. Thus, a mixed situation where both physical mechanisms contribute to BAL variability is the most possible scenario.

  13. Tribal child welfare. Interim final rule.

    PubMed

    2012-01-06

    The Administration for Children and Families (ACF) is issuing this interim final rule to implement statutory provisions related to the Tribal title IV-E program. Effective October 1, 2009, section 479B(b) of the Social Security Act (the Act) authorizes direct Federal funding of Indian Tribes, Tribal organizations, and Tribal consortia that choose to operate a foster care, adoption assistance and, at Tribal option, a kinship guardianship assistance program under title IV-E of the Act. The Fostering Connections to Success and Increasing Adoptions Act of 2008 requires that ACF issue interim final regulations which address procedures to ensure that a transfer of responsibility for the placement and care of a child under a State title IV-E plan to a Tribal title IV-E plan occurs in a manner that does not affect the child's eligibility for title IV-E benefits or medical assistance under title XIX of the Act (Medicaid) and such services or payments; in-kind expenditures from third-party sources for the Tribal share of administration and training expenditures under title IV-E; and other provisions to carry out the Tribal-related amendments to title IV-E. This interim final rule includes these provisions and technical amendments necessary to implement a Tribal title IV-E program.

  14. Uranium(IV) adsorption by natural organic matter in anoxic sediments

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bone, Sharon E.; Dynes, James J.; Cliff, John

    Uranium is an important carbon-free fuel source and environmental contaminant that accumulates in the tetravalent state, U(IV), in anoxic sediments, such as ore deposits, marine basins, and contaminated aquifers. However, little is known about the speciation of U(IV) in low-temperature geochemical environments, inhibiting the development of a conceptual model of U behavior. Until recently, U(IV) was assumed to exist predominantly as the sparingly soluble mineral uraninite (UO 2+x) in anoxic sediments; however, studies now show that this is not often the case. Yet a model of U(IV) speciation in the absence of mineral formation under field-relevant conditions has not yetmore » been developed. Uranium(IV) speciation controls its reactivity, particularly its susceptibility to oxidative mobilization, impacting its distribution and toxicity. Here we show adsorption to organic carbon and organic carbon-coated clays dominate U(IV) speciation in an organic-rich natural substrate under field-relevant conditions. Whereas previous research assumed that U(IV) speciation is dictated by the mode of reduction (i.e., whether reduction is mediated by microbes or by inorganic reductants), our results demonstrate that mineral formation can be diminished in favor of adsorption, regardless of reduction pathway. Projections of U transport and bioavailability, and thus its threat to human and ecosystem health, must consider U(IV) adsorption to organic matter within the sediment environment.« less

  15. Uranium(IV) adsorption by natural organic matter in anoxic sediments

    DOE PAGES

    Bone, Sharon E.; Dynes, James J.; Cliff, John; ...

    2017-01-09

    Uranium is an important carbon-free fuel source and environmental contaminant that accumulates in the tetravalent state, U(IV), in anoxic sediments, such as ore deposits, marine basins, and contaminated aquifers. However, little is known about the speciation of U(IV) in low-temperature geochemical environments, inhibiting the development of a conceptual model of U behavior. Until recently, U(IV) was assumed to exist predominantly as the sparingly soluble mineral uraninite (UO 2+x) in anoxic sediments; however, studies now show that this is not often the case. Yet a model of U(IV) speciation in the absence of mineral formation under field-relevant conditions has not yetmore » been developed. Uranium(IV) speciation controls its reactivity, particularly its susceptibility to oxidative mobilization, impacting its distribution and toxicity. Here we show adsorption to organic carbon and organic carbon-coated clays dominate U(IV) speciation in an organic-rich natural substrate under field-relevant conditions. Whereas previous research assumed that U(IV) speciation is dictated by the mode of reduction (i.e., whether reduction is mediated by microbes or by inorganic reductants), our results demonstrate that mineral formation can be diminished in favor of adsorption, regardless of reduction pathway. Projections of U transport and bioavailability, and thus its threat to human and ecosystem health, must consider U(IV) adsorption to organic matter within the sediment environment.« less

  16. Assessment Inventories, Surveys, and Templates for Evaluating Educational Technology Regional and Local Assistance Programs. Phase IV of the Comprehensive Study of Educational Technology Programs Authorized from 1984-1992.

    ERIC Educational Resources Information Center

    Far West Lab. for Educational Research and Development, San Francisco, CA.

    This report on Phase IV, of a four-phase study, provided for the development of evaluation templates and instruments to be used by the California Department of Education to facilitate systematic assessment of state funded educational technology programs and projects. These assessment documents comprised the major data collection sources for the…

  17. Summary of miscellaneous hazard environments for hypothetical Space Shuttle and Titan IV launch abort accidents

    NASA Technical Reports Server (NTRS)

    Eck, M.; Mukunda, M.

    1989-01-01

    The various analyses described here were aimed at obtaining a more comprehensive understanding and definition of the environments in the vicinity of the Radioisotope Thermal Generator (RTG) during certain Space Transportation System (STS) and Titan IV launch abort accidents. Addressed here are a number of issues covering explosion environments and General Purpose Heat Source Radioisotope Thermoelectric Generator (GPHS-RTG) responses to those environments.

  18. Source positions from VLBI combined solution

    NASA Astrophysics Data System (ADS)

    Bachmann, S.; Thaller, D.; Engelhardt, G.

    2014-12-01

    The IVS Combination Center at BKG is primarily responsible for combined Earth Orientation Parameter (EOP) products and the generation of a terrestrial reference frame based on VLBI observations (VTRF). The procedure is based on the combination of normal equations provided by six IVS Analysis Centers (AC). Since more and more ACs also provide source positions in the normal equations - beside EOPs and station coordinates - an estimation of these parameters is possible and should be investigated. In the past, the International Celestial Reference Frame (ICRF) was not generated as a combined solution from several individual solutions, but was based on a single solution provided by one AC. The presentation will give an overview on the combination strategy and the possibilities for combined source position determination. This includes comparisons with existing catalogs, quality estimation and possibilities of rigorous combination of EOP, TRF and CRF in one combination process.

  19. Alcohol Use Disorders in Argentinian Girls and Women 12 Months Before Delivery: Comparison of DSM-IV, DSM-5, and ICD-10 Diagnostic Criteria.

    PubMed

    López, Mariana B; Conde, Karina; Cremonte, Mariana

    The evidence of important problems related to prenatal alcohol exposure has faced researchers with the problem of understanding and screening alcohol use in this population. Although any alcohol use should be considered risky during pregnancy, identifying alcohol-drinking problems (ADPs) could be especially important because women with ADPs could not benefit from a simple advice of abstinence and because their offsprings are subjected to a higher risk of problems related with prenatal alcohol exposure. In this context, we aim to study the prevalence and characteristics of ADPs in pregnant women, evaluating the performance of different diagnostic systems in this population. The aims of the study were to describe the prevalence of ADPs obtained with the criteria of the Diagnostic and Statistical Manual of Mental Disorders in its fourth (DSM-IV) and fifth edition (DSM-5), and the International Classification of Diseases (ICD)-10, in Argentinean females aged 13 to 44 years, 12 months before delivery; to evaluate the level of agreement between these classification systems; and to analyze the performance of each diagnosis criterion in this population. Data were collected through personal interviews of a probability sample of puerperal women (N = 641) in the city of Santa Fe (Argentina), between October 2010 and February 2011. Diagnoses compatible with DSM-IV, DSM-5, and ICD-10 were obtained through the Composite International Diagnostic Interview. Agreement among diagnostic systems was measured through Cohen kappa. Diagnosis criteria performance were analyzed considering their prevalence and discriminating ability (D value). Total ADP prevalence was 6.4% for DSM-IV (4.2% abuse and 2.2% dependence), 8.1% for DSM-5 (6.4% mild, 0.8% moderate, and 0.9% severe alcohol use disorder), and 14.1% for the ICD-10 (11.9% harmful use and 2.2% dependence). DSM-5 modifications improved agreement between DSM and ICD. The least prevalent and worst discriminating ability diagnostic criterion was "legal problems." The most prevalent and 1 of the best discriminating ability diagnostic criterion was '"health issues." DSM-IV and ICD-10 dependence prevalence was similar to that of previous studies in pregnant women, whereas abuse prevalence was surprisingly higher. Our results indicate a better performance of the DSM-5 alcohol use disorder category relative to the DSM-IV dual categorization. Nevertheless, the poor diagnostic performance of some DSM-5 criteria in this population could evidence their intercultural variability.

  20. Translations on USSR Science and Technology, Physical Sciences and Technology, No. 25

    DTIC Science & Technology

    1977-12-07

    PORTRAN-II; FORTRAN -IV; and ALGOL-60 dialect. BASIC language may be used when solving problems in the interactive mode (the stages of...transmissions and broadcasts. Materials from foreign-language sources are translated; those from English-language sources are transcribed or reprinted, with... source . Times within items are as given by source . The contents of this publication in no way represent the poli- cies, views or attitudes of the U.S

  1. Comparison of Lip Print Patterns in Two Indian Subpopulations and Its Correlation in ABO Blood Groups.

    PubMed

    Sr, Ashwinirani; Suragimath, Girish; Sande, Abhijeet R; Kulkarni, Prasad; Nimbal, Anand; Shankar, T; Gowd, T Snigdha; Shetty, Prajwal K

    2014-10-01

    The study of lip-print pattern (cheiloscopy) is a scientific method for personal identification and plays a major role in forensic and criminal investigations. To compare the lip print patterns in Kerala and Maharashtra population and correlate between ABO blood groups. Two hundred subjects, 100 from Maharashtra and 100 from Kerala were considered for the study. Lip prints were recorded, analyzed according to Tsuchihashi classification. The lip print patterns were compared in the two populations, correlated in ABO blood groups. The data obtained was statistically analyzed with SPSS software using chi-square test. In our study, predominant lip print pattern observed in Kerala population was type IV (53%) and Maharashtra population was type II (42%). The difference between the two population was statistically significant (p<0.001). Subjects with A+ and O- blood groups had type II lip print predominance. Subjects with B+, AB+ and O+ blood groups had type IV predominance. The lip print patterns do not show any correlation in ABO blood groups. Lip prints are unique to each individual and are different even in two persons. Lip print patterns were different in the two sub populations studied, and they showed no correlation in ABO blood groups.

  2. Area 4 has layer IV in adult primates

    PubMed Central

    García-Cabezas, Miguel Ángel; Barbas, Helen

    2014-01-01

    There are opposing views about the status of layer IV in primary motor cortex (area 4). Cajal described a layer IV in area 4 of adult humans. In contrast, Brodmann found layer IV in development but not in adult primates and called area 4 ‘agranular’. We addressed this issue in rhesus monkeys using the neural marker SMI-32, which labels neurons in lower layer III and upper V, but not in layer IV. SMI-32 delineated a central unlabeled cortical stripe in area 4 that corresponds to layer IV, which was populated with small interneurons also found in layer IV in ‘granular’ areas (such as area 46). We distinguished layer IV interneurons from projection neurons in the layers above and below using cellular criteria. The commonly used term ‘agranular’ for area 4 is also used for the phylogenetically ancient limbic cortices, confusing areas that differ markedly in laminar structure. This issue pertains to the systematic variation in the architecture across cortices, traced from limbic cortices through areas with increasingly more elaborate laminar structure. The principle of systematic variation can be used to predict laminar patterns of connections across cortical systems. This principle places area 4 and agranular anterior cingulate cortices at opposite poles of the graded laminar differentiation of motor cortices. The status of layer IV in area 4 thus pertains to core organizational features of the cortex, its connections and evolution. PMID:24735460

  3. Practice patterns for the use of iodinated i.v. contrast media for pediatric CT studies: a survey of the Society for Pediatric Radiology.

    PubMed

    Callahan, Michael J; Servaes, Sabah; Lee, Edward Y; Towbin, Alexander J; Westra, Sjirk J; Frush, Donald P

    2014-04-01

    There are limited data available on the use of i.v. contrast media for CT studies in the pediatric population. The purpose of this study is to determine the practice patterns of i.v. contrast media usage for pediatric CT by members of the Society for Pediatric Radiology (SPR). SPR members were surveyed regarding the use of i.v. contrast media for pediatric CT studies. Questions pertained to information required before administering i.v. contrast media, types of central catheters for injecting i.v. contrast media, injection rates based on angiocatheter size and study type, and management of i.v. contrast media extravasation. The response rate of 6% (88/1545) represented practice patterns of 26% (401/1545) of the SPR membership. Most respondents thought the following clinical information was mandatory before i.v. contrast media administration: allergy to i.v. contrast media (97%), renal insufficiency (97%), current metformin use (72%), significant allergies (61%), diabetes (54%), and asthma (52%). Most administered i.v. contrast media through nonimplanted central venous catheters (78%), implanted venous ports (78%), and peripherally inserted central catheters (72%). The most common maximum i.v. contrast media injection rates were 5.0 mL/s or greater for a 16-gauge angiocatheter, 4.0 mL/s for an 18-gauge angiocatheter, 3.0 mL/s for a 20-gauge angiocatheter, and 2.0 mL/s for a 22-gauge angiocatheter. For soft-tissue extravasation of i.v. contrast media, 95% elevate the affected extremity, 76% use ice, and 45% use heat. The results of this survey illustrate the collective opinion of a subset of SPR members relating to the use of i.v. contrast media in pediatric CT, providing guidelines for clinical histories needed before i.v. contrast media, maximum i.v. contrast injection rates for standard angiocatheters, contrast media injection rates for specific CT studies, and management of i.v. contrast media soft-tissue extravasation.

  4. Implementing the UCSD PASCAL system on the MODCOMP computer. [deep space network

    NASA Technical Reports Server (NTRS)

    Wolfe, T.

    1980-01-01

    The implementation of an interactive software development system (UCSD PASCAL) on the MODCOMP computer is discussed. The development of an interpreter for the MODCOMP II and the MODCOMP IV computers, written in MODCOMP II assembly language, is described. The complete Pascal programming system was run successfully on a MODCOMP II and MODCOMP IV under both the MAX II/III and MAX IV operating systems. The source code for an 8080 microcomputer version of the interpreter was used as the design for the MODCOMP interpreter. A mapping of the functions within the 8080 interpreter into MODCOMP II assembly language was the method used to code the interpreter.

  5. Which One Is Better? Jigsaw II versus Jigsaw IV on the Subject of the Building Blocks of Matter and Atom

    ERIC Educational Resources Information Center

    Turkmen, Hakan; Buyukaltay, Didem

    2015-01-01

    In this study, the effect of using Jigsaw II and Jigsaw IV techniques on the subject of "Atoms-The Basic Unit of Matter" in science course of 6th grade on academic achievement was examined. Pre-test post-test control group research was used in the study. Study population is all secondary schools in Turgutlu district of Manisa province…

  6. Genetic heterogeneity of Beta thalassemia in Lebanon reflects historic and recent population migration.

    PubMed

    Makhoul, N J; Wells, R S; Kaspar, H; Shbaklo, H; Taher, A; Chakar, N; Zalloua, P A

    2005-01-01

    Beta thalassemia is an autosomal recessive disorder characterized by reduced (beta(+)) or absent (beta(0)) beta-globin chain synthesis. In Lebanon it is the most predominant genetic defect. In this study we investigated the religious and geographic distribution of the beta-thalassemia mutations identified in Lebanon, and traced their precise origins. A total of 520 beta-globin chromosomes from patients of different religious and regional backgrounds was studied. Beta thalassemia mutations were identified using Amplification Refractory Mutation System (ARMS) PCR or direct gene sequencing. Six (IVS-I-110, IVS-I-1, IVS-I-6, IVS-II-1, cd 5 and the C > T substitution at cd 29) out of 20 beta-globin defects identified accounted for more than 86% of the total beta-thalassemia chromosomes. Sunni Muslims had the highest beta-thalassemia carrier rate and presented the greatest heterogeneity, with 16 different mutations. Shiite Muslims followed closely with 13 mutations, whereas Maronites represented 11.9% of all beta-thalassemic subjects and carried 7 different mutations. RFLP haplotype analysis showed that the observed genetic diversity originated from both new mutational events and gene flow from population migration. This study provides information about the types and distribution of beta-thalassemia mutations within each religious group and geographic region, which is essential for the implementation of screening and prevention programs.

  7. Self-report assessment of the DSM-IV personality disorders. Measurement of trait and distress characteristics: the ADP-IV.

    PubMed

    Schotte, C K; de Doncker, D; Vankerckhoven, C; Vertommen, H; Cosyns, P

    1998-09-01

    Self-report instruments assessing the DSM personality disorders are characterized by overdiagnosis due to their emphasis on the measurement of personality traits rather than the impairment and distress associated with the criteria. The ADP-IV, a Dutch questionnaire, introduces an alternative assessment method: each test item assesses 'Trait' as well as 'Distress/impairment' characteristics of a DSM-IV criterion. This item format allows dimensional as well as categorical diagnostic evaluations. The present study explores the validity of the ADP-IV in a sample of 659 subjects of the Flemish population. The dimensional personality disorder subscales, measuring Trait characteristics, are internally consistent and display a good concurrent validity with the Wisconsin Personality Disorders Inventory. Factor analysis at the item-level resulted in 11 orthogonal factors, describing personality dimensions such as psychopathy, social anxiety and avoidance, negative affect and self-image. Factor analysis at the subscale-level identified two basic dimensions, reflecting hostile (DSM-IV Cluster B) and anxious (DSM-IV Cluster C) interpersonal attitudes. Categorical ADP-IV diagnoses are obtained using scoring algorithms, which emphasize the Trait or the Distress concepts in the diagnostic evaluation. Prevalences of ADP-IV diagnoses of any personality disorder according to these algorithms vary between 2.28 and 20.64%. Although further research in clinical samples is required, the present results support the validity of the ADP-IV and the potential of the measurement of trait and distress characteristics as a method for assessing personality pathology.

  8. 40 CFR 63.1321 - Batch process vents provisions.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Standards for Hazardous Air Pollutant Emissions: Group IV Polymers and Resins § 63.1321 Batch process vents..., owners and operators of new and existing affected sources with batch process vents shall comply with the... applicable reporting requirements in § 63.1327. (b) New SAN batch affected sources. Owners and operators of...

  9. LOGWAR 15: Analysis Report

    DTIC Science & Technology

    2016-04-01

    Sanitation, and Hygiene WFP World Food Programme WHO World Health Organization Unclassified Unclassified xii This page intentionally left blank...Insurgency Natural Disaster Contamination Visibility Disposition Distribution Sourcing Prioritization Security Financial U.S. Military Services Combatant...supply; restrictions on sourcing; contamination concerns (IV solutions) Small in size; multiple variants with limited interchangeability; requires

  10. 40 CFR 63.1320 - PET and polystyrene affected sources-reporting provisions.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... (CONTINUED) AIR PROGRAMS (CONTINUED) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS FOR SOURCE CATEGORIES (CONTINUED) National Emission Standards for Hazardous Air Pollutant Emissions: Group IV Polymers... with § 63.1316 by demonstrating that mass emissions per mass product are less than or equal to the...

  11. Modeling Grade IV Gas Emboli using a Limited Failure Population Model with Random Effects

    NASA Technical Reports Server (NTRS)

    Thompson, Laura A.; Conkin, Johnny; Chhikara, Raj S.; Powell, Michael R.

    2002-01-01

    Venous gas emboli (VGE) (gas bubbles in venous blood) are associated with an increased risk of decompression sickness (DCS) in hypobaric environments. A high grade of VGE can be a precursor to serious DCS. In this paper, we model time to Grade IV VGE considering a subset of individuals assumed to be immune from experiencing VGE. Our data contain monitoring test results from subjects undergoing up to 13 denitrogenation test procedures prior to exposure to a hypobaric environment. The onset time of Grade IV VGE is recorded as contained within certain time intervals. We fit a parametric (lognormal) mixture survival model to the interval-and right-censored data to account for the possibility of a subset of "cured" individuals who are immune to the event. Our model contains random subject effects to account for correlations between repeated measurements on a single individual. Model assessments and cross-validation indicate that this limited failure population mixture model is an improvement over a model that does not account for the potential of a fraction of cured individuals. We also evaluated some alternative mixture models. Predictions from the best fitted mixture model indicate that the actual process is reasonably approximated by a limited failure population model.

  12. Effects of dietary lipid sources on performance and apparent total tract digestibility of lipids and energy when fed to nursery pigs.

    PubMed

    Mendoza, S M; van Heugten, E

    2014-02-01

    Acidulated fats and oils are by-products of the fat-refining industry. They contain high levels of FFA and are 10% to 20% less expensive than refined fats and oils. Two studies were designed to measure the effects of dietary lipid sources low or high in FFA on growth performance and apparent total tract digestibility (ATTD) of lipids and GE in nursery pigs. In Exp. 1, 189 pigs at 14 d postweaning (BW of 9.32 ± 0.11 kg) were used for 21 d with 9 replicate pens per treatment and 3 pigs per pen. Dietary treatments consisted of a control diet without added lipids and 6 diets with 6% inclusion of lipids. Four lipid sources were combined to create the dietary treatments with 2 levels of FFA (0.40% or 54.0%) and 3 degrees of fat saturation (iodine value [IV] = 77, 100, or 123) in a 2 × 3 factorial arrangement. Lipid sources were soybean oil (0.3% FFA and IV = 129.4), soybean-cottonseed acid oil blend (70.5% FFA and IV = 112.9), choice white grease (0.6% FFA and IV = 74.8), and choice white acid grease (56.0% FFA and IV = 79.0). Addition of lipid sources decreased ADFI (810 vs. 872 g/d; P = 0.018) and improved G:F (716 vs. 646 g/kg; P < 0.001). Diets high in FFA tended (P = 0.08) to improve final BW (21.35 vs. 21.01 kg) and ADG (576 vs. 560 g/d). Lipid-supplemented diets had greater ATTD of lipids than control diets (67.4% vs. 29.7%; P < 0.001). Apparent total tract digestibility of lipids was greater in diets with low FFA (69.9% vs. 64.9%; P < 0.001) and decreased linearly with increasing IV (73.2%, 69.1%, and 67.2%). For GE, ATTD was greater in diets with low FFA (83.1% vs. 80.9%; P = 0.001). In Exp. 2, 252 pigs at 7 d postweaning (BW of 7.0 ± 0.2 kg) were used for 28 d with 9 replicate pens per treatment and 4 pigs per pen. Diets included a control diet without added lipids and 6 treatments with 2.5%, 5.0%, or 7.5% of lipids from either poultry fat (1.9% FFA) or acidulated poultry fat (37.8% FFA) in a 2 × 3 factorial arrangement. Addition of lipids increased (P < 0.001) final BW (19.9 vs. 18.4 kg) and ADG (460 vs. 405 g/d) regardless of source. Fat increased (P < 0.001) ADFI when added at 2.5% and then decreased ADFI with each further increment (663, 740, 681, and 653 g for 0%, 2.5%, 5.0%, and 7.5% fat, respectively). Inclusion of lipids linearly (P < 0.001) improved G:F (615, 615, 688, and 692 g/kg for 0%, 2.5%, 5.0%, and 7.5% fat, respectively) and ATTD of lipids (17.8%, 50.2%, 71.0%, and 77.3% for 0, 2.5, 5.0, and 7.5% fat, respectively) and GE (76.1%, 76.4%, 83.3%, and 84.4% for 0%, 2.5%, 5.0%, and 7.5% fat, respectively). Acidulated lipids resulted in similar performance compared with refined lipids and could be economical alternatives to more expensive lipid sources.

  13. Solar-driven membrane distillation demonstration in Leupp, Arizona.

    PubMed

    Ravisankar, Vishnu Arvind; Seaman, Robert; Mirchandani, Sera; Arnold, Robert G; Ela, Wendell P

    2016-03-01

    The Navajo Nation is the largest and one of the driest Native American reservations in the US. The population in the Navajo Nation is sporadically distributed over a very large area making it extremely ineffective to connect homes to a centralized water supply system. Owing to this population distribution and the multi decadal drought prevailing in the region, over 40% of the 300,000 people living on Navajo Tribal Lands lack access to running potable water. For many people the only alternative is hauling water from filling stations, resulting in economic hardship and limited supply. A solution to this problem is a de-centralized off-grid water source. The University of Arizona and US Bureau of Reclamation's Solar Membrane Distillation (SMD), stand-alone, pilot desalination system on the Navajo Reservation will provide an off-grid source of potable water; the pilot will serve as a proximal water source, ease the financial hardships caused by the drought, and provide a model for low-cost water treatment systems in arid tribal lands. Bench-scale experiments and an earlier field prototype plant showed viable operation of a solar heated, membrane distillation (MD) system, but further optimization is required. The objectives of the Navajo pilot study are to i) demonstrate integration of solar collectors and membrane distillation, ii) optimize operational parameters, iii) demonstrate and monitor technology performance during extended duration operation, and iv) facilitate independent system operation by the Navajo Water Resources Department, including hand-over of a comprehensive operations manual for implementation of subsequent SMD systems. The Navajo SMD system is designed as a perennial installation that includes remote communication of research data and full automation for remote, unmanned operation.

  14. Strong spatial segregation between wildcats and domestic cats may explain low hybridization rates on the Iberian Peninsula.

    PubMed

    Gil-Sánchez, J M; Jaramillo, J; Barea-Azcón, J M

    2015-12-01

    The European wildcat (Felis silvestris silvestris) is an endangered felid impacted by genetic introgression with the domestic cat (Felis silvestris catus). The problem of hybridization has had different effects in different areas. In non-Mediterranean regions pure forms of wildcats became almost extinct, while in Mediterranean regions genetic introgression is a rare phenomenon. The study of the potential factors that prevent the gene flow in areas of lower hybridization may be key to wildcat conservation. We studied the population size and spatial segregation of wildcats and domestic cats in a typical Mediterranean area of ancient sympatry, where no evidence of hybridization had been detected by genetic studies. Camera trapping of wild-living cats and walking surveys of stray cats in villages were used for capture-recapture estimations of abundance and spatial segregation. Results showed (i) a low density of wildcats and no apparent presence of putative hybrids; (ii) a very low abundance of feral cats in spite of the widespread and large population sources of domestic cats inhabiting villages; (iii) strong spatial segregation between wildcats and domestic/feral cats; and (iv) no relationship between the size of the potential population sources and the abundance of feral cats. Hence, domestic cats were limited in their ability to become integrated into the local habitat of wildcats. Ecological barriers (habitat preferences, food limitations, intra-specific and intra-guild competition, predation) may explain the severe divergences of hybridization impact observed at a biogeographic level. This has a direct effect on key conservation strategies for wildcats (i.e., control of domestic cats). Copyright © 2015 Elsevier GmbH. All rights reserved.

  15. 24 CFR 983.57 - Site selection standards.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... families and in relation to the racial mix of the locality's population. (iv) Units may be considered... constructed or rehabilitated in the past 10 years, relative to the racial mix of the eligible population. (C... discrimination on the basis of race, color, religion, sex, national origin, age, familial status, or disability...

  16. 24 CFR 983.57 - Site selection standards.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... families and in relation to the racial mix of the locality's population. (iv) Units may be considered... constructed or rehabilitated in the past 10 years, relative to the racial mix of the eligible population. (C... discrimination on the basis of race, color, religion, sex, national origin, age, familial status, or disability...

  17. 24 CFR 983.57 - Site selection standards.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... families and in relation to the racial mix of the locality's population. (iv) Units may be considered... constructed or rehabilitated in the past 10 years, relative to the racial mix of the eligible population. (C... discrimination on the basis of race, color, religion, sex, national origin, age, familial status, or disability...

  18. Epidemiology, Clinical Characteristics, and Associations for Rome IV Functional Nausea and Vomiting Disorders in Adults.

    PubMed

    Aziz, Imran; Palsson, Olafur S; Whitehead, William E; Sperber, Ami D; Simrén, Magnus; Törnblom, Hans

    2018-05-29

    Functional nausea and vomiting disorders (FNVDs) are classified as chronic nausea and vomiting syndrome (CNVS) or cyclic vomiting syndrome (CVS) - CVS includes cannabinoid hyperemesis syndrome. We investigated the population prevalence of FNVDs, their characteristics, and associated factors. In the year 2015, an Internet cross-sectional health survey was completed by 5931 adults in the general populations of 3 English-speaking countries; 2100 participants were in the United States, Canada, or the United Kingdom. Quota-based sampling was used to generate demographically balanced and population-representative samples. The survey collected data on demographics, healthcare visits, medications, somatic symptom severity, quality of life, and symptom-based diagnostic criteria for Rome IV FNVDs as well as for irritable bowel syndrome and functional dyspepsia. Subsequent comparisons were made between Rome IV FNVD subjects and individuals without FNVDs (controls). Overall, 2.2% of the population (n=131) fulfilled symptom-based diagnostic criteria for Rome IV FNVDs - the United States (3%) had a greater prevalence than Canada (1.9%) or the United Kingdom (1.8%) (P=.02). The prevalence of CNVS was similar among the countries, ranging from 0.8% to 1.2%. However, the prevalence of CVS was higher in the United States (2%) than in Canada (0.7%) or the United Kingdom (1%) (P=.03). The proportion of subjects with CVS taking cannabis did not differ significantly among countries (P=.31), although the 7 cases of cannabinoid hyperemesis syndrome were in the United States. A significantly higher proportion of subjects with CVS reported a compulsive need for hot water bathing to alleviate emetic symptoms than subjects with CNVS (44% vs. 19%, P=.03); this behaviour was independent of cannabis but augmented by its use. Subjects with FNVDs had significantly greater health impairment and health care utilization than controls. On multivariate analysis, independent factors associated with FNVDs were younger age, increasing somatic symptom severity, lower quality of life, presence of irritable bowel syndrome, and functional dyspepsia. However, on subgroup analysis, somatic symptom severity was associated with CVS but not CNVS, whereas poor quality of life was associated with CNVS but not CVS. Based on a cross-sectional health survey of adults in the general populations of 3 English-speaking countries, approximately 2% of subjects meet symptom-based criteria for Rome IV FNVDs and have considerable health impairments. Hot water bathing to alleviate emetic symptoms is reported for all FNVDs, and is perpetuated by cannabis use. Copyright © 2018 AGA Institute. Published by Elsevier Inc. All rights reserved.

  19. Wolbachia diversity and cytoplasmic incompatibility patterns in Culex pipiens populations in Turkey.

    PubMed

    Altinli, Mine; Gunay, Filiz; Alten, Bulent; Weill, Mylene; Sicard, Mathieu

    2018-03-20

    Wolbachia are maternally transmitted bacteria that can manipulate their hosts' reproduction causing cytoplasmic incompatibility (CI). CI is a sperm-egg incompatibility resulting in embryonic death. Due to this sterilising effect on mosquitoes, Wolbachia are considered for vector control strategies. Important vectors for arboviruses, filarial nematodes and avian malaria, mosquitoes of Culex pipiens complex are suitable for Wolbachia-based vector control. They are infected with Wolbachia wPip strains belonging to five genetically distinct groups (wPip-I to V) within the Wolbachia B supergroup. CI properties of wPip strongly correlate with this genetic diversity: mosquitoes infected with wPip strains from a different wPip group are more likely to be incompatible with each other. Turkey is a critical spot for vector-borne diseases due to its unique geographical position as a natural bridge between Asia, Europe and Africa. However, general wPip diversity, distribution and CI patterns in natural Cx. pipiens (s.l.) populations in the region are unknown. In this study, we first identified wPip diversity in Turkish Cx. pipiens (s.l.) populations, by assigning them to one of the five groups within wPip (wPip-Ito V). We further investigated CI properties between different wPip strains from this region. We showed a wPip fixation in Cx. pipiens (s.l.) populations in Turkey by analysing 753 samples from 59 sampling sites. Three wPip groups were detected in the region: wPip-I, wPip-II and wPip-IV. The most dominant group was wPip-II. While wPip-IV was restricted to only two locations, wPip-I and wPip-II had wider distributions. Individuals infected with wPip-II were found co-existing with individuals infected with wPip-I or wPip-IV in some sampling sites. Two mosquito isofemale lines harbouring either a wPip-I or a wPip-II strain were established from a population in northwestern Turkey. Reciprocal crosses between these lines showed that they were fully compatible with each other but bidirectionally incompatible with wPip-IV Istanbul infected line. Our findings reveal a high diversity of wPip and CI properties in Cx. pipiens (s.l.) populations in Turkey. Knowledge on naturally occurring CI patterns caused by wPip diversity in Turkey might be useful for Cx. pipiens (s.l.) control in the region.

  20. Exploratory factor analysis of borderline personality disorder criteria in monolingual Hispanic outpatients with substance use disorders†

    PubMed Central

    Becker, Daniel F.; Añez, Luis Miguel; Paris, Manuel; Grilo, Carlos M.

    2009-01-01

    This study examined the factor structure of the DSM-IV criteria for borderline personality disorder (BPD) in Hispanic patients. Subjects were 130 monolingual Hispanic adults who had been admitted to a specialty outpatient clinic that provides psychiatric and substance abuse services to Spanish-speaking individuals. All were reliably assessed with the Spanish-Language Version of the Diagnostic Interview for DSM-IV Personality Disorders. After evaluating internal consistency of the BPD criterion set, an exploratory factor analysis was performed using principal axis factoring. Results suggested a unidimensional structure, and were consistent with similar studies of the DSM-IV criteria for BPD in non-Hispanic samples. These findings have implications for understanding borderline psychopathology in this population, and for the overall validity of the DSM-IV BPD construct. PMID:20472296

  1. Transition metal-catalyzed oxidation of atmospheric sulfur: Global implications for the sulfur budget

    NASA Astrophysics Data System (ADS)

    Alexander, Becky; Park, Rokjin J.; Jacob, Daniel J.; Gong, Sunling

    2009-01-01

    We use observations of the oxygen-17 excess (Δ17O) of sulfate in the Arctic to quantify the sulfate source from aqueous SO2 (S(IV)) oxidation by O2 catalyzed by transition metals. Due to the lack of photochemically produced OH and H2O2 in high latitudes during winter, combined with high anthropogenic SO2 emissions in the Northern Hemisphere, oxidation by O3 is predicted to dominate sulfate formation during winter in this region. However, Δ17O measurements of sulfate aerosol collected in Alert, Canada, are not consistent with O3 as the dominant oxidant and indicate that a S(IV) oxidant with near-zero Δ17O values (O2) is important during winter. We use a global chemical transport model to interpret quantitatively the Alert observations and assess the global importance of sulfate production by Fe(III)- and Mn(II)-catalyzed oxidation of S(IV) by O2. We scale anthropogenic and natural atmospheric metal concentrations to primary anthropogenic sulfate and dust concentrations, respectively. The solubility and oxidation state of these metals is determined by cloud liquid water content, source, and sunlight. By including metal-catalyzed S(IV) oxidation, the model is consistent with the Δ17O magnitudes in the Alert data during winter. Globally, we find that this mechanism contributes 9-17% to sulfate production. The inclusion of metal-catalyzed oxidation does not resolve model discrepancies with surface SO2 and sulfate observations in Europe. Oxygen isotope measurements of sulfate aerosols collected near anthropogenic and dust sources of metals would help to verify the importance of this sulfur oxidation pathway.

  2. Application of F⁺RNA Coliphages as Source Tracking Enteric Viruses on Parsley and Leek Using RT-PCR.

    PubMed

    Shahrampour, Dina; Yavarmanesh, Masoud; Najafi, Mohammad Bagher Habibi; Mohebbi, Mohebbat

    2015-12-01

    The objective of this study was to identify sources of fecal contamination in leek and parsley, by using four different F(+)RNA coliphage genogroups (IV, I indicate animal fecal contamination and II, III indicate human fecal contamination). Three different concentrations (10(2), 10(4), 10(6) pfu/ml) of MS2 coliphage were inoculated on the surface of parsley and leek samples for detection of phage recovery efficiency among two methods of elution concentration (PEG-precipitation and Ultracentrifugation) by performing double agar layer (DAL) assay in three replications. Highest recovery of MS2 was observed in PEG method and in 10(6) inoculation concentration. Accordingly, the PEG method was used for washing and isolation of potentially contaminated phages of 30 collected samples (15 samples from the market and 15 samples from the farm). The final solutions of PEG method were tested for the enumeration of plaques by DAL assay. Total RNA was then extracted from recovered phages, and RT-PCR was performed by using four primer sets I, II, III, and IV. Incidence of F(+)RNA coliphages was observed in 12/15 (80 %) and 10/15 (66/6 %) of samples were obtained from farm and market, respectively, using both DAL and RT-PCR test methods. Different genotypes (I, II, and IV) of F(+)RNA coliphages were found in farm samples, while only genotype I was detected in market samples by using the primer sets. Due to the higher frequency of genotype I and IV, the absence of genotype III, and also the low frequency of genotype II, it is concluded that the contamination of vegetable (parsley and leek) in Neyshabour, Iran is most likely originated from animal sources.

  3. IVS Observation of ICRF2-Gaia Transfer Sources

    NASA Astrophysics Data System (ADS)

    Le Bail, K.; Gipson, J. M.; Gordon, D.; MacMillan, D. S.; Behrend, D.; Thomas, C. C.; Bolotin, S.; Himwich, W. E.; Baver, K. D.; Corey, B. E.; Titus, M.; Bourda, G.; Charlot, P.; Collioud, A.

    2016-03-01

    The second realization of the International Celestial Reference Frame (ICRF2), which is the current fundamental celestial reference frame adopted by the International Astronomical Union, is based on Very Long Baseline Interferometry (VLBI) data at radio frequencies in X band and S band. The European Space Agency’s Gaia mission, launched on 2013 December 19, started routine scientific operations in 2014 July. By scanning the whole sky, it is expected to observe ∼500,000 Quasi Stellar Objects in the optical domain an average of 70 times each during the five years of the mission. This means that, in the future, two extragalactic celestial reference frames, at two different frequency domains, will coexist. It will thus be important to align them very accurately. In 2012, the Laboratoire d’Astrophysique de Bordeaux (LAB) selected 195 sources from ICRF2 that will be observed by Gaia and should be suitable for aligning the radio and optical frames: they are called ICRF2-Gaia transfer sources. The LAB submitted a proposal to the International VLBI Service (IVS) to regularly observe these ICRF2-Gaia transfer sources at the same rate as Gaia observes them in the optical realm, e.g., roughly once a month. We describe our successful effort to implement such a program and report on the results. Most observations of the ICRF2-Gaia transfer sources now occur automatically as part of the IVS source monitoring program, while a subset of 37 sources requires special attention. Beginning in 2013, we scheduled 25 VLBI sessions devoted in whole or in part to measuring these 37 sources. Of the 195 sources, all but one have been successfully observed in the 12 months prior to 2015 September 01. Of the sources, 87 met their observing target of 12 successful sessions per year. The position uncertainties of all of the ICRF2-Gaia transfer sources have improved since the start of this observing program. For a subset of 24 sources whose positions were very poorly known, the uncertainty has decreased, on average, by a factor of four. This observing program is successful because the two main goals were reached for most of the 195 ICRF2-Gaia transfer sources: observing at the requested target of 12 successful sessions per year and improving the position uncertainties to better than 200 μas for both R.A. and decl. However, scheduling some of the transfer sources remains a challenge because of network geometry and the weakness of the sources, and this will be one focus of future sessions used in this ongoing program.

  4. The nature of electron acceptor (MnIV/NO3) triggers differential expression of genes associated with stress and ammonium limitation responses in Shewanella algae C6G3.

    PubMed

    Aigle, Axel; Bonin, Patricia; -Nunez, Nicolas Fernandez; Loriod, Béatrice; Guasco, Sophie; Bergon, Aurélie; Armougom, Fabrice; Iobbi-Nivol, Chantal; Imbert, Jean; Michotey, Valérie

    2018-03-16

    Shewanella algae C6G3 can reduce dissimilatively nitrate into ammonium and manganese-oxide (MnIV) into MnII. It has the unusual ability to produce anaerobically nitrite from ammonium in the presence of MnIV. To gain insight into their metabolic capabilities, global mRNA expression patterns were investigated by RNA-seq and qRT-PCR in cells growing with lactate and ammonium as carbon and nitrogen sources and with either MnIV or nitrate as electron acceptors. Gene exhibiting higher expression levels in the presence of MnIV belonged to functional categories of carbohydrate, coenzyme, lipid metabolisms and inorganic ion transport. Comparative transcriptomic pattern between MnIV and NO3 revealed that the strain presented an ammonium limitation status with MnIV, despite the presence of non-limiting concentration of ammonium under both culture conditions. In addition, in presence of MnIV, ntrB/nrtC regulators, ammonium channel, nitrogen regulatory protein P-II, glutamine synthetase and asparagine synthetase glutamine dependent genes were over-represented. Under nitrate condition, the expression of genes involved in the synthesis of several amino acids was increased. Finally, expression level of genes associated with the general stress response was also amplified and among them, katE, a putative catalase/peroxidase present on several Shewanella genomes, was highly expressed with a relative median value higher in MnIV condition.

  5. Intravenous Carbamazepine for Adults With Seizures.

    PubMed

    Vickery, P Brittany; Tillery, Erika E; DeFalco, Alicia Potter

    2018-03-01

    To review the pharmacology, pharmacokinetics, efficacy, safety, dosage and administration, potential drug-drug interactions, and place in therapy of the intravenous (IV) formulation of carbamazepine (Carnexiv) for the treatment of seizures in adult patients. A comprehensive PubMed and EBSCOhost search (1945 to August 2017) was performed utilizing the keywords carbamazepine, Carnexiv, carbamazepine intravenous, IV carbamazepine, seizures, epilepsy, and seizure disorder. Additional data were obtained from literature review citations, manufacturer's product labeling, and Lundbeck website as well as Clinicaltrials.gov and governmental sources. All English-language trials evaluating IV carbamazepine were analyzed for this review. IV carbamazepine is FDA approved as temporary replacement therapy for treatment of adult seizures. Based on a phase I trial and pooled data from 2 open-label bioavailability studies comparing oral with IV dosing, there was no noted indication of loss of seizure control in patients switched to short-term replacement antiepileptic drug therapy with IV carbamazepine. The recommended dose of IV carbamazepine is 70% of the patient's oral dose, given every 6 hours via 30-minute infusions. The adverse effect profile of IV carbamazepine is similar to that of the oral formulation, with the exception of added infusion-site reactions. IV carbamazepine is a reasonable option for adults with generalized tonic-clonic or focal seizures, previously stabilized on oral carbamazepine, who are unable to tolerate oral medications for up to 7 days. Unknown acquisition cost and lack of availability in the United States limit its use currently.

  6. Monitoring the tobacco use epidemic IV. The vector: Tobacco industry data sources and recommendations for research and evaluation.

    PubMed

    Cruz, Tess Boley

    2009-01-01

    This Vector paper (IV of V on monitoring the tobacco use epidemic) presents the data sources and methods that can be used to monitor tobacco marketing and makes recommendations for creating a national surveillance system. In 2002, the Vector Work Group of the National Tobacco Monitoring, Research and Evaluation Workshop identified priority indicators of tobacco marketing: tobacco brand pricing strategies, retail environment advertising and promotional allowances, gray market or smuggling activities, lobbying, direct mail marketing, tobacco brand placements in films, Internet promotions, and sponsorship at bars and events. This paper reviews and identifies data sources and gaps for these priority indicators and for 12 other indicators of interest. There are 38 commercial data sites and Internet sources, as well as individual research efforts that address the priority indicators. These sources are not integrated, often costly, and limited in standardization. Tobacco marketing could be more effectively monitored with the development of a national research network. Surveillance of the tobacco industry's methods to push tobacco and pull consumers can help the public health community identify new markets and campaigns, justify and tailor effective tobacco control strategies, and evaluate existing counter-marketing efforts.

  7. Evaluation of the cost-effectiveness of electrical stimulation therapy for pressure ulcers in spinal cord injury.

    PubMed

    Mittmann, Nicole; Chan, Brian C; Craven, B Cathy; Isogai, Pierre K; Houghton, Pamela

    2011-06-01

    To evaluate the incremental cost-effectiveness of electrical stimulation (ES) plus standard wound care (SWC) as compared with SWC only in a spinal cord injury (SCI) population with grade III/IV pressure ulcers (PUs) from the public payer perspective. A decision analytic model was constructed for a 1-year time horizon to determine the incremental cost-effectiveness of ES plus SWC to SWC in a cohort of participants with SCI and grade III/IV PUs. Model inputs for clinical probabilities were based on published literature. Model inputs, namely clinical probabilities and direct health system and medical resources were based on a randomized controlled trial of ES plus SWC versus SWC. Costs (Can $) included outpatient (clinic, home care, health professional) and inpatient management (surgery, complications). One way and probabilistic sensitivity (1000 Monte Carlo iterations) analyses were conducted. The perspective of this analysis is from a Canadian public health system payer. Model target population was an SCI cohort with grade III/IV PUs. Not applicable. Incremental cost per PU healed. ES plus SWC were associated with better outcomes and lower costs. There was a 16.4% increase in the PUs healed and a cost savings of $224 at 1 year. ES plus SWC were thus considered a dominant economic comparator. Probabilistic sensitivity analysis resulted in economic dominance for ES plus SWC in 62%, with another 35% having incremental cost-effectiveness ratios of $50,000 or less per PU healed. The largest driver of the economic model was the percentage of PU healed with ES plus SWC. The addition of ES to SWC improved healing in grade III/IV PU and reduced costs in an SCI population. Copyright © 2011 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  8. Evaluation of an early step-down strategy from intravenous anidulafungin to oral azole therapy for the treatment of candidemia and other forms of invasive candidiasis: results from an open-label trial.

    PubMed

    Vazquez, Jose; Reboli, Annette C; Pappas, Peter G; Patterson, Thomas F; Reinhardt, John; Chin-Hong, Peter; Tobin, Ellis; Kett, Daniel H; Biswas, Pinaki; Swanson, Robert

    2014-02-21

    Hospitalized patients are at increased risk for candidemia and invasive candidiasis (C/IC). Improved therapeutic regimens with enhanced clinical and pharmacoeconomic outcomes utilizing existing antifungal agents are still needed. An open-label, non-comparative study evaluated an intravenous (i.v.) to oral step-down strategy. Patients with C/IC were treated with i.v. anidulafungin and after 5 days of i.v. therapy had the option to step-down to oral azole therapy (fluconazole or voriconazole) if they met prespecified criteria. The primary endpoint was the global response rate (clinical + microbiological) at end of treatment (EOT) in the modified intent-to-treat (MITT) population (at least one dose of anidulafungin plus positive Candida within 96 hours of study entry). Secondary endpoints included efficacy at other time points and in predefined patient subpopulations. Patients who stepped down early (≤ 7 days' anidulafungin) were identified as the "early switch" subpopulation. In total, 282 patients were enrolled, of whom 250 were included in the MITT population. The MITT global response rate at EOT was 83.7% (95% confidence interval, 78.7-88.8). Global response rates at all time points were generally similar in the early switch subpopulation compared with the MITT population. Global response rates were also similar across multiple Candida species, including C. albicans, C. glabrata, and C. parapsilosis. The most common treatment-related adverse events were nausea and vomiting (four patients each). A short course of i.v. anidulafungin, followed by early step-down to oral azole therapy, is an effective and well-tolerated approach for the treatment of C/IC. ClinicalTrials.gov: NCT00496197.

  9. Evaluation of an early step-down strategy from intravenous anidulafungin to oral azole therapy for the treatment of candidemia and other forms of invasive candidiasis: results from an open-label trial

    PubMed Central

    2014-01-01

    Background Hospitalized patients are at increased risk for candidemia and invasive candidiasis (C/IC). Improved therapeutic regimens with enhanced clinical and pharmacoeconomic outcomes utilizing existing antifungal agents are still needed. Methods An open-label, non-comparative study evaluated an intravenous (IV) to oral step-down strategy. Patients with C/IC were treated with IV anidulafungin and after 5 days of IV therapy had the option to step-down to oral azole therapy (fluconazole or voriconazole) if they met prespecified criteria. The primary endpoint was the global response rate (clinical + microbiological) at end of treatment (EOT) in the modified intent-to-treat (MITT) population (at least one dose of anidulafungin plus positive Candida within 96 hours of study entry). Secondary endpoints included efficacy at other time points and in predefined patient subpopulations. Patients who stepped down early (≤ 7 days’ anidulafungin) were identified as the "early switch" subpopulation. Results In total, 282 patients were enrolled, of whom 250 were included in the MITT population. The MITT global response rate at EOT was 83.7% (95% confidence interval, 78.7–88.8). Global response rates at all time points were generally similar in the early switch subpopulation compared with the MITT population. Global response rates were also similar across multiple Candida species, including C. albicans, C. glabrata, and C. parapsilosis. The most common treatment-related adverse events were nausea and vomiting (four patients each). Conclusions A short course of IV anidulafungin, followed by early step-down to oral azole therapy, is an effective and well-tolerated approach for the treatment of C/IC. Trial registration ClinicalTrials.gov: NCT00496197 PMID:24559321

  10. 45 CFR 1356.68 - Tribal title IV-E agency requirements for in-kind administrative and training contributions from...

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON CHILDREN, YOUTH AND FAMILIES, FOSTER CARE MAINTENANCE... third-party sources. (a) Option to claim in-kind expenditures from third-party sources for non-Federal...

  11. 45 CFR 1356.68 - Tribal title IV-E agency requirements for in-kind administrative and training contributions from...

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON CHILDREN, YOUTH AND FAMILIES, FOSTER CARE MAINTENANCE... third-party sources. (a) Option to claim in-kind expenditures from third-party sources for non-Federal...

  12. 45 CFR 1356.68 - Tribal title IV-E agency requirements for in-kind administrative and training contributions from...

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON CHILDREN, YOUTH AND FAMILIES, FOSTER CARE MAINTENANCE... third-party sources. (a) Option to claim in-kind expenditures from third-party sources for non-Federal...

  13. 40 CFR 63.11148 - What are the standards and compliance requirements for existing sources using batch copper...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... acid plant prior to discharge to the atmosphere. (iv) For each secondary capture system that is used to... practicable, maintain and operate any affected source, including associated air pollution control equipment, in a manner consistent with good air pollution control practice for minimizing emissions...

  14. 40 CFR 63.11148 - What are the standards and compliance requirements for existing sources using batch copper...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... acid plant prior to discharge to the atmosphere. (iv) For each secondary capture system that is used to... practicable, maintain and operate any affected source, including associated air pollution control equipment, in a manner consistent with good air pollution control practice for minimizing emissions...

  15. 40 CFR 63.11148 - What are the standards and compliance requirements for existing sources using batch copper...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... acid plant prior to discharge to the atmosphere. (iv) For each secondary capture system that is used to... practicable, maintain and operate any affected source, including associated air pollution control equipment, in a manner consistent with good air pollution control practice for minimizing emissions...

  16. 40 CFR 63.11148 - What are the standards and compliance requirements for existing sources using batch copper...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... acid plant prior to discharge to the atmosphere. (iv) For each secondary capture system that is used to... practicable, maintain and operate any affected source, including associated air pollution control equipment, in a manner consistent with good air pollution control practice for minimizing emissions...

  17. 40 CFR 63.11148 - What are the standards and compliance requirements for existing sources using batch copper...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... acid plant prior to discharge to the atmosphere. (iv) For each secondary capture system that is used to... practicable, maintain and operate any affected source, including associated air pollution control equipment, in a manner consistent with good air pollution control practice for minimizing emissions...

  18. 40 CFR 63.1515 - Notifications.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... has been reconstructed such that it is an affected source, that has an initial startup after the... source that has an initial startup after the effective date of this subpart and for which an application... startup; and (iv) Actual date of startup. (4) As required by § 63.9(b)(5), after the effective date of...

  19. LOGWAR 15: Analysis Report

    DTIC Science & Technology

    2016-04-01

    Vertical Replenishment VTC Video Teleconference WASH Water, Sanitation, and Hygiene WFP World Food Programme WHO World Health Organization...issues Pa rt ic ip an ts Contexts Combat Disease Refugees Insurgency Natural Disaster Contamination Visibility Disposition Distribution Sourcing...requirements; limited shelf life; used by many actors; often in short supply; restrictions on sourcing; contamination concerns (IV solutions) Small in

  20. 40 CFR 257.27 - Selection of remedy.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... withdrawal rate of users; (iii) Ground-water quantity and quality; (iv) The potential damage to wildlife... Ground-Water Monitoring and Corrective Action § 257.27 Selection of remedy. (a) Based on the results of... ground-water protection standard as specified pursuant to §§ 257.25 (h) or (i); (3) Control the source(s...

  1. 40 CFR 257.27 - Selection of remedy.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... withdrawal rate of users; (iii) Ground-water quantity and quality; (iv) The potential damage to wildlife... Ground-Water Monitoring and Corrective Action § 257.27 Selection of remedy. (a) Based on the results of... ground-water protection standard as specified pursuant to §§ 257.25 (h) or (i); (3) Control the source(s...

  2. 40 CFR 257.27 - Selection of remedy.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... withdrawal rate of users; (iii) Ground-water quantity and quality; (iv) The potential damage to wildlife... Ground-Water Monitoring and Corrective Action § 257.27 Selection of remedy. (a) Based on the results of... ground-water protection standard as specified pursuant to §§ 257.25 (h) or (i); (3) Control the source(s...

  3. 40 CFR 63.1319 - PET and polystyrene affected sources-recordkeeping provisions.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... (CONTINUED) AIR PROGRAMS (CONTINUED) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS FOR SOURCE CATEGORIES National Emission Standards for Hazardous Air Pollutant Emissions: Group IV Polymers and Resins... mass emissions per mass product are less than or equal to the level specified in § 63.1316(b)(1)(i) (i...

  4. 40 CFR 63.1319 - PET and polystyrene affected sources-recordkeeping provisions.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... (CONTINUED) AIR PROGRAMS (CONTINUED) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS FOR SOURCE CATEGORIES National Emission Standards for Hazardous Air Pollutant Emissions: Group IV Polymers and Resins... mass emissions per mass product are less than or equal to the level specified in § 63.1316(b)(1)(i) (i...

  5. Administration of intravenous morphine for acute pain in the emergency department inflicts an economic burden in Europe

    PubMed Central

    Casamayor, Montserrat; Hennebert, Marc; Brazzi, Luca; Prosen, Gregor

    2018-01-01

    Background Acute pain is among the leading causes of referral to the emergency department (ED) in industrialized countries. Its management mainly depends on intensity. Moderate-to-severe pain is treated with intravenous (IV) administered opioids, of which morphine is the most commonly used in the ED. We have estimated the burden of IV administration of morphine in the five key European countries (EU5) using a micro-costing approach. Scope A structured literature review was conducted to identify clinical guidelines for acute pain management in EU5 and clinical studies conducted in the ED setting. The data identified in this literature review constituted the source for all model input parameters, which were clustered as analgesic (morphine), material used for IV morphine administration, nurse workforce time and management of morphine-related adverse events and IV-related complications. Findings The cost per patient of IV morphine administration in the ED ranges between €18.31 in Spain and €28.38 in Germany. If costs associated with the management of morphine-related adverse events and IV-related complications are also considered, the total costs amount to €121.13–€132.43. The main driver of those total costs is the management of IV-related complications (phlebitis, extravasation and IV prescription errors; 73% of all costs) followed by workforce time (14%). Conclusions IV morphine provides effective pain relief in the ED, but the costs associated with the IV administration inflict an economic burden on the respective national health services in EU5. An equally rapid-onset and efficacious analgesic that does not require IV administration could reduce this burden. PMID:29675049

  6. An integrated safety analysis of intravenous ibuprofen (Caldolor®) in adults

    PubMed Central

    Southworth, Stephen R; Woodward, Emily J; Peng, Alex; Rock, Amy D

    2015-01-01

    Intravenous (IV) nonsteroidal anti-inflammatory drugs such as IV ibuprofen are increasingly used as a component of multimodal pain management in the inpatient and outpatient settings. The safety of IV ibuprofen as assessed in ten sponsored clinical studies is presented in this analysis. Overall, 1,752 adult patients have been included in safety and efficacy trials over 11 years; 1,220 of these patients have received IV ibuprofen and 532 received either placebo or comparator medication. The incidence of adverse events (AEs), serious AEs, and changes in vital signs and clinically significant laboratory parameters have been summarized and compared to patients receiving placebo or active comparator drug. Overall, IV ibuprofen has been well tolerated by hospitalized and outpatient patients when administered both prior to surgery and postoperatively as well as for nonsurgical pain or fever. The overall incidence of AEs is lower in patients receiving IV ibuprofen as compared to those receiving placebo in this integrated analysis. Specific analysis of hematological and renal effects showed no increased risk for patients receiving IV ibuprofen. A subset analysis of elderly patients suggests that no dose adjustment is needed in this higher risk population. This integrated safety analysis demonstrates that IV ibuprofen can be safely administered prior to surgery and continued in the postoperative period as a component of multimodal pain management. PMID:26604816

  7. The S(IV)-type Asteroids as Ordinary Chondrite Parent Body Candidates: Implications for the Completeness of the Meteorite Sample of Asteroids

    NASA Astrophysics Data System (ADS)

    Gaffey, M. J.

    1995-09-01

    The discrepancy between the abundance of ordinary chondrites (OCs) among the meteorites and the rarity of unambiguously similar assemblages in the asteroid belt has been a major point of discussion within and between the asteroid and meteorite communities. Various resolutions to this apparent paradox have been proposed [e.g., 1-5], including: 1) interpretations of S-type asteroid spectra are incorrect due to space weathering effects; 2) ordinary chondrites derive from a few rare but favorably situated parent bodies; 3) OCs come from a residual population of small unheated mainbelt asteroids; 4) shock effects darken OC parent body surfaces disguising them as C-type asteroids, and 5) OCs come from inner solar system planetesimals ejected to the Oort cloud which have been recently perturbed into Earth-crossing orbits. Although none of these possibilities has yet been rigorously excluded, recent investigations suggest that the resolution of the apparent paradox lies in some combination of the first three options. For option 3, the discovery of a small mainbelt asteroid with an OC-like spectrum indicates OC-assemblages among the smaller mainbelt asteroids [6], although their abundance is still low in the current sample [7]. For option 2, the mineralogical survey indicated that while most S-asteroids could be rigorously excluded on mineralogical criteria, the S(IV) subtype of this class has silicate compositions within the OC range [8]. The S(IV)-objects are concentrated near the 3:1 secular resonance at 2.5 AU providing an efficient escape into Earth-crossing orbits. Unfortunately for a simple resolution of the OC parent body question, S(IV) spectra still exhibit weaker silicate features and redder spectral slopes than OC assemblages. Although significant uncertainties remain, optical alteration of asteroid surfaces interpreted from the Galileo images of Ida and Gaspra may reconcile the mismatch between OC and S(IV) spectra [option 1]. Although only a subset of the S(IV) objects are viable OC-parent bodies [3 Juno, 6 Hebe, and 7 Iris are the leading candidates], their proximity to the 3:1 chaotic zone would allow them to contribute a significant portion of the ordinary chondrites. In particular, dynamical models suggest that Hebe should be a major contributor to the terrestrial meteorite flux [9]. Each leading contender is currently undergoing detailed spectral evaluation as a potential OC source. From both asteroid observational constraints and from chemical and isotopic studies of meteorites, the ordinary chondrites appear to represent an extensive and relatively complete (by meteoritic standards) sample of a few asteroid source bodies. In a similar fashion, the Howardite-Eucrite-Diogenite suite sample a single primary parent body (Vesta) and are over-represented in meteorite collections due to a fortuitous (and temporary on a solar system timescale) emplacement of Vesta ejecta fragments close to the 3:1 resonance. This suggests that the particular value of the ordinary chondrites lies in the good sample provided for each source body rather than as representatives of an abundant asteroid type. Acknowledgments: Various portions of this research were supported by NASA Planetary Geology and Geophysics grant NAGW-642 and NSF Planetary Astronomy grant AST-9012180. References: [1] Wetherill G. W. and Chapman C. R. (1988) in Meteorites and the Early Solar System, pp. 35-67, Univ. of Arizona. [2] Bell J. F. et al. (1989) in Asteroids II, pp. 921-945, Univ. of Arizona. [3] Gaffey M. J. et al. (1989) in Asteroids II, pp. 98-127, Univ. of Arizona. [4] Britt D. T. and Pieters C. M. (1991) LPS XXII, 141-142. [5] Gaffey M. J. (1984) Icarus, 60, 83-114. [6] Binzel R. P. et al. (1993) Science, 262, 1541-1543. [7] Shui X. et al. (1995) Icarus, 115, 1-35. [8] Gaffey M. J. et al. (1993) Icarus, 106, 573-602. [9] Farinella P. et al. (1993) Icarus, 101, 174-187.

  8. Sport participation and subjective well-being: instrumental variable results from German survey data.

    PubMed

    Ruseski, Jane E; Humphreys, Brad R; Hallman, Kirstin; Wicker, Pamela; Breuer, Christoph

    2014-02-01

    A major policy goal of many ministries of sport and health is increased participation in sport to promote health. A growing literature is emerging about the benefits of sport participation on happiness. A challenge in establishing a link between sport participation and happiness is controlling for endogeneity of sport participation in the happiness equation. This study seeks to establish causal evidence of a relationship between sport participation and self reported happiness using instrumental variables (IV). IV estimates based on data from a 2009 population survey living in Rheinberg, Germany indicate that individuals who participate in sport have higher life happiness. The results suggest a U-shaped relationship between age and self-reported happiness. Higher income is associated with greater self-reported happiness, males are less happy than females, and single individuals are less happy than nonsingles. Since the results are IV, this finding is interpreted as a causal relationship between sport participation and subjective well-being (SWB). This broader impact of sport participation on general happiness lends support to the policy priority of many governments to increase sport participation at all levels of the general population.

  9. Opioid use in knee arthroplasty after receiving intravenous acetaminophen.

    PubMed

    Kelly, Jennifer S; Opsha, Yekaterina; Costello, Jennifer; Schiller, Daryl; Hola, Eric T

    2014-12-01

    Intravenous (IV) acetaminophen may be an effective component of multimodal postoperative pain management. The primary objective of this study was to evaluate the impact of IV acetaminophen on total opioid use in postoperative patients. The secondary objective was to evaluate the effect of IV acetaminophen on hospital length of stay. This retrospective, case-control study evaluated the impact of IV acetaminophen on total opioid use in surgical patients. Patients were included if they received at least one perioperative dose of IV acetaminophen and underwent a surgical knee procedure. Controls were matched and randomly selected based on procedure type, age, and severity of illness. Postoperative opioids were converted into oral morphine equivalents, and overall use was compared between groups. One hundred patients were enrolled, with 25 patients receiving IV acetaminophen and 75 matched controls. A total of 135 mg versus 112.5 mg oral morphine equivalents were used in the IV acetaminophen group and control group, respectively (p=0.987). There were 45 mg/day oral morphine equivalents used in the IV acetaminophen group versus 37.5 mg in the control group (p=0.845). The median hospital length of stay in both groups was 3 days (p=0.799). IV acetaminophen did not significantly decrease postoperative opioid use in patients who underwent surgical knee procedures. In addition, there was a nonsignificant trend toward increased opioid use in the IV acetaminophen group. There was no significant difference in hospital length of stay between the IV acetaminophen group and the control group. These findings require further study in larger patient populations and in other orthopedic procedures that typically require longer hospital stays. © 2014 Pharmacotherapy Publications, Inc.

  10. Mechanisms of Selective Induction of Gastric Mucosal Eicosanoids in Response to Potentially Noxious Stimuli

    DTIC Science & Technology

    1991-04-30

    the proposed source of leukotrienes. Lidocaine (2.2 mg/kg iv bolus followed by 66 /ig/kg/min iv Infusion) was used to inhibit sensory afferents... Lidocaine significantly inhibited LTC4 generation following acid or bile, but had no effect on PGE2 synthesis after bile. Thus, the release of LTĈ...viil Effect of Inhibition of Sensory Afferent Nerves by Lidocaine on Gastric Emptying and Mucosal Eicosanoid Generation After Exposure of the

  11. A method of classification for multisource data in remote sensing based on interval-valued probabilities

    NASA Technical Reports Server (NTRS)

    Kim, Hakil; Swain, Philip H.

    1990-01-01

    An axiomatic approach to intervalued (IV) probabilities is presented, where the IV probability is defined by a pair of set-theoretic functions which satisfy some pre-specified axioms. On the basis of this approach representation of statistical evidence and combination of multiple bodies of evidence are emphasized. Although IV probabilities provide an innovative means for the representation and combination of evidential information, they make the decision process rather complicated. It entails more intelligent strategies for making decisions. The development of decision rules over IV probabilities is discussed from the viewpoint of statistical pattern recognition. The proposed method, so called evidential reasoning method, is applied to the ground-cover classification of a multisource data set consisting of Multispectral Scanner (MSS) data, Synthetic Aperture Radar (SAR) data, and digital terrain data such as elevation, slope, and aspect. By treating the data sources separately, the method is able to capture both parametric and nonparametric information and to combine them. Then the method is applied to two separate cases of classifying multiband data obtained by a single sensor. In each case a set of multiple sources is obtained by dividing the dimensionally huge data into smaller and more manageable pieces based on the global statistical correlation information. By a divide-and-combine process, the method is able to utilize more features than the conventional maximum likelihood method.

  12. A Systematic Evaluation of ADHD and Comorbid Psychopathology in a Population-Based Twin Sample

    ERIC Educational Resources Information Center

    Volk, Heather E.; Neuman, Rosalind J.; Todd, Richard D.

    2005-01-01

    Objective: Clinical and population samples demonstrate that attention-deficit/hyperactivity disorder (ADHD) occurs with other disorders. Comorbid disorder clustering within ADHD subtypes is not well studied. Method: Latent class analysis (LCA) examined the co-occurrence of DSM-IV ADHD, oppositional defiant disorder (ODD), conduct disorder (CD),…

  13. 24 CFR 983.57 - Site selection standards.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... must not be located in a racially mixed area if the project will cause a significant increase in the... families and in relation to the racial mix of the locality's population. (iv) Units may be considered... constructed or rehabilitated in the past 10 years, relative to the racial mix of the eligible population. (C...

  14. 12 CFR 715.8 - Requirements for verification of accounts and passbooks.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... selection: (ii) A sample which is representative of the population from which it was selected; (iii) An equal chance of selecting each dollar in the population; (iv) Sufficient accounts in both number and... consistent with GAAS if such methods provide for: (i) Sufficient accounts in both number and scope on which...

  15. Angiotensin I converting enzyme inhibitory activity and antihypertensive effect in spontaneously hypertensive rats of cobia (Rachycentron canadum) head papain hydrolysate.

    PubMed

    Yang, Ping; Jiang, Yuchuan; Hong, Pengzhi; Cao, Wenhong

    2013-06-01

    Cobia head protein hydrolysate (CHPH) with angiotensin I converting enzyme (ACE) inhibitory activity was prepared with papain. The 3 kDa ultrafiltration filtrate CHPH-IV of the hydrolysate exerted a potent ACE inhibitory activity with IC50 being 0.24 mg/mL. The fractions with molecular weight located between 1749 Da and 173 Da represented up 66.96% of CHPH-IV, and those between 494 Da and 173 Da represented up 31.37% of CHPH-IV. It was found that the ACE inhibitory activity of CHPH-IV was intensified from IC50 0.24 mg/mL to 0.17 mg/mL after incubation with gastrointestinal proteases. The CHPH-IV significantly decreased the systolic blood pressure in a dose-dependent manner after oral administration to spontaneously hypertensive rats (SHR) at dose of 150 mg/kg, 600 mg/kg and 1200 mg/kg body weight. These results suggested that CHPH-IV from cobia head protein hydrolysate by papain could serve as a source of peptides with antihypertensive activity in functional food industry.

  16. Circuit analysis method for thin-film solar cell modules

    NASA Technical Reports Server (NTRS)

    Burger, D. R.

    1985-01-01

    The design of a thin-film solar cell module is dependent on the probability of occurrence of pinhole shunt defects. Using known or assumed defect density data, dichotomous population statistics can be used to calculate the number of defects expected in a module. Probability theory is then used to assign the defective cells to individual strings in a selected series-parallel circuit design. Iterative numerical calculation is used to calcuate I-V curves using cell test values or assumed defective cell values as inputs. Good and shunted cell I-V curves are added to determine the module output power and I-V curve. Different levels of shunt resistance can be selected to model different defect levels.

  17. Maladaptively high and low openness: the case for experiential permeability.

    PubMed

    Piedmont, Ralph L; Sherman, Martin F; Sherman, Nancy C

    2012-12-01

    The domain of Openness within the Five-Factor Model (FFM) has received inconsistent support as a source for maladaptive personality functioning, at least when the latter is confined to the disorders of personality included within the American Psychiatric Association's (APA) Diagnostic and Statistical Manual of Mental Disorders (DSM-IV-TR; APA, ). However, an advantage of the FFM relative to the DSM-IV-TR is that the former was developed to provide a reasonably comprehensive description of general personality structure. Rather than suggest that the FFM is inadequate because the DSM-IV-TR lacks much representation of Openness, it might be just as reasonable to suggest that the DSM-IV-TR is inadequate because it lacks an adequate representation of maladaptive variants of both high and low Openness. This article discusses the development and validation of a measure of these maladaptive variants, the Experiential Permeability Inventory. © 2012 The Authors. Journal of Personality © 2012, Wiley Periodicals, Inc.

  18. Near-infrared and optical spectroscopy of FSC 10214+4724

    NASA Technical Reports Server (NTRS)

    Soifer, B. T.; Cohen, J. G.; Armus, L.; Matthews, K.; Neugebauer, G.; Oke, J. B.

    1995-01-01

    New infrared and optical spectroscopic observations, obtained with the W. M. Keck Telescope, are reported for the highly luminous infrared source FSC 10214+4724. The rest frame optical spectrum shows new emission lines of (Ne III), (Ne V), (O I), (O II), (S II), and He(+), while the rest frame ultraviolet spectrum shows new lines of O IV) + Si IV, N III, N IV), Si II, Ne IV, and possibly N II and (Ne III), as well as clearly showing that Ly-alpha is self-absorbed. The emission-line spectrum is most characteristic of a Seyfert 2 nucleus. The preponderance of spectroscopic evidence strengthens the case for a dust-enshrouded Active galactic nuclei (AGN) powering much or most of the observed luminosity. The various spectral lines lead to a wide range in the inferred reddening and ionization parameter for this system, suggesting that we are viewing several environments through differing extinctions.

  19. Comparison of Lip Print Patterns in Two Indian Subpopulations and Its Correlation in ABO Blood Groups

    PubMed Central

    Suragimath, Girish; Sande, Abhijeet R; Kulkarni, Prasad; Nimbal, Anand; Shankar, T.; Gowd, T. Snigdha; Shetty, Prajwal K

    2014-01-01

    Background: The study of lip-print pattern (cheiloscopy) is a scientific method for personal identification and plays a major role in forensic and criminal investigations. Objective: To compare the lip print patterns in Kerala and Maharashtra population and correlate between ABO blood groups. Materials and Methods: Two hundred subjects, 100 from Maharashtra and 100 from Kerala were considered for the study. Lip prints were recorded, analyzed according to Tsuchihashi classification. The lip print patterns were compared in the two populations, correlated in ABO blood groups. The data obtained was statistically analyzed with SPSS software using chi-square test. Results: In our study, predominant lip print pattern observed in Kerala population was type IV (53%) and Maharashtra population was type II (42%). The difference between the two population was statistically significant (p<0.001). Subjects with A+ and O- blood groups had type II lip print predominance. Subjects with B+, AB+ and O+ blood groups had type IV predominance. The lip print patterns do not show any correlation in ABO blood groups. Conclusion: Lip prints are unique to each individual and are different even in two persons. Lip print patterns were different in the two sub populations studied, and they showed no correlation in ABO blood groups. PMID:25478445

  20. Energy and Macronutrient Intakes and Food Sources in Preschool Children: Thai NHES IV.

    PubMed

    Satheannoppakao, Warapone; Kasemsup, Rachada; Nontarak, Jiraluck; Kessomboon, Pattapong; Putwatana, Panwadee; Taneepanichskul, Surasak; Sangthong, Rassamee; Chariyalertsak, Suwat; Aekplakorn, Wichai

    2015-10-01

    Examine intakes of energy and macronutrients, and identify their food sources, in Thai preschool children. Data from the Thai National Health Examination Survey (NHES) IV were used. Mothers/caregivers were interviewed regarding their children's 24-hour-dietary intake. Dietary data were analyzed for energy and macronutrients, and their food sources were investigated. Due to skewed data, Mann-Whitney U test was used to compare energy and macronutrient intake between sexes and age groups. Among 256 preschool children, more than 90% had protein intakes higher than the recommended level. Only 12.7 to 29.0% met the recommended intake for energy. Amounts of carbohydrate and fat consumed varied from below to above the Dietary Reference Intake (DRI) recommendation. Intakes of carbohydrate in boys and fat in girls were statistically different between age groups (p < 0.05). Fifty to 60% of energy came from dairy products, grains and starchy products. The major carbohydrate contributors were grains and starchy products. Dairy products were the main source of protein. Important food sources of fat were dairy products for one- to three-year-old children and fat and oils for four- to five-year-old children. Thai preschool children have inappropriate intakes of energy and macronutrients. Dairy products and grains and/or starchy products were the main sources of energy, carbohydrate, and protein. Dietary fat sources varied by age group.

  1. Epidemiology of melasma in Brazilian patients: a multicenter study.

    PubMed

    Hexsel, Doris; Lacerda, Davi A; Cavalcante, Andrea S; Machado Filho, Carlos A S; Kalil, Célia Luiza P V; Ayres, Eloísa L; Azulay-Abulafia, Luna; Weber, Magda B; Serra, Marcio S; Lopes, Nádya F P; Cestari, Tania F

    2014-04-01

    Melasma is an acquired, irregularly patterned, light to dark-brown hypermelanosis, with symmetric distribution mostly over the face. The aim of this study was to evaluate clinical characteristics and factors related to melasma in Brazilian patients. This was a cross-sectional, multicenter study performed in Brazil. Investigators examined and questioned 953 patients over 18 years of age on clinical characteristics and other factors related to their melasma. Melasma was more prevalent in women (97.5%) and in Fitzpatrick skin phototypes II (12.8%), III (36.3%), and IV (39.7%). Skin phototypes II and III and family history of melasma had early onset of the disorder when compared with skin phototypes IV, V, and VI (P<0.0001). Similar results were also observed when these same groups were compared with the absence of family history (P<0.0001). Extra-facial melasma was more frequent in postmenopausal women compared with those who were not experiencing menopause (14.2% vs. 3.5%, P<0.0001). Data suggested that the age of melasma onset are related to skin phototypes and family history. Additionally, extra-facial melasma was more common in menopausal women. This is the first study on the epidemiology of melasma in Brazil involving a large sample of the population. These data can be a source of new relevant research on the cause and development of melasma. © 2013 The International Society of Dermatology.

  2. Attitudes of Major Soviet Nationalities. Volume IV. Central Asia. Kazakhstan, Kirgizistan, Turkmenistan, Uzbekistan, Tadzhikistan.

    DTIC Science & Technology

    1973-06-01

    attitudes. IV. Demography Although Uzbekistan is somewhat smaller in area than neighboring Turkmenistan, it has nearly six times the population--close...Uzbekistan - Demography - 2 Table A.2. National Composition of Uzbek SSR 19 26a 19 39b 1959 c 1 970c T number % number % number % number % Total . Uzbek...Mullyadzbanov, Narodo naseleniye Ilzbekskoi SSR (Tashkent, 1967): 177. c Pravda Vostoka (April 28), 1971: 2. 4 Uzbekistan - Demography - 3 the extraordinary

  3. Metapopulation structure of the specialized herbivore Macrosiphoniella tanacetaria (Homoptera, Aphididae).

    PubMed

    Massonnet, Blandine; Simon, Jean-Christophe; Weisser, Wolfgang W

    2002-12-01

    We investigated population dynamics, genetic diversity and spatial structure in the aphid species Macrosiphoniella tanacetaria, a specialist herbivore feeding on tansy, Tanacetum vulgare. Tansy plants (genets) consist of many shoots (ramets), and genets are grouped in sites. Thus, aphids feeding on tansy can cluster at the level of ramets, genets and sites. We studied aphid population dynamics in 1997 and 2001 and found that within sites: (i). at any time, aphids used only a fraction of the available ramets and genets; (ii). at the level of ramets, most aphid colonies survived only one week; (iii). at the level of genets, mean survival time was less than 4 weeks; and (iv). colonization and extinction events occurred throughout the season. We sampled aphids in seven sites in the Alsace region, France (4-45 km apart) and two sites in Germany in 1999 to study genetic structure within and between populations. Genetic analyses using nine microsatellite loci showed that: (i). genotypic variability was high, (ii). none of the populations was in Hardy-Weinberg equilibrium, (iii). heterozygote deficits and linkage disequilibria were frequent, and (iv). all populations were genetically differentiated, even at a small geographical scale. Renewed sampling of the Alsace sites in 2001 showed that three populations had become extinct and significant genetic changes had occurred in the remaining four populations. The frequencies of extinction and colonization events at several spatial scales suggest a hierarchical metapopulation structure for M. tanacetaria. Frequent population turnover and drift are likely causes for the genetic differentiation of M. tanacetaria populations.

  4. The cross-cultural generalizability of Axis-II constructs: an evaluation of two personality disorder assessment instruments in the People's Republic of China.

    PubMed

    Yang, J; McCrae, R R; Costa, P T; Yao, S; Dai, X; Cai, T; Gao, B

    2000-01-01

    We examined the reliability, cross-instrument validity, and factor structure of Chinese adaptations of the Personality Diagnostic Questionnaire (PDQ-4+; N = 1,926) and Personality Disorders Interview (PDI-IV; N = 525) in psychiatric patients. Comparisons with data from Western countries suggest that the psychometric properties of these two instruments are comparable across cultures. Low to modest agreement between the PDQ-4+ and PDI-IV was observed for both dimensional and categorical personality disorder evaluations. When the PDI-IV was used as the diagnostic standard, the PDQ-4+ showed higher sensitivity than specificity, and higher negative predictive power than positive predictive power. Factor analyses of both instruments replicated the four-factor structure O'Connor and Dyce (1998) found in Western samples. Results suggested that conceptions and measures of DSM-IV personality disorders are cross-culturally generalizable to Chinese psychiatric populations.

  5. Probing the Metal Enrichment of the Intergalactic Medium at z = 5–6 Using the Hubble Space Telescope

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cai, Zheng; Fan, Xiaohui; Dave, Romeel

    We test the galactic outflow model by probing associated galaxies of four strong intergalactic C iv absorbers at z = 5–6 using the Hubble Space Telescope ( HST ) Advanced Camera for Surveys (ACS) ramp narrowband filters. The four strong C iv absorbers reside at z = 5.74, 5.52, 4.95, and 4.87, with column densities ranging from N {sub Civ} = 10{sup 13.8} to 10{sup 14.8} cm{sup −2}. At z = 5.74, we detect an i-dropout Ly α emitter (LAE) candidate with a projected impact parameter of 42 physical kpc from the C iv absorber. This LAE candidate has amore » Ly α -based star formation rate (SFR{sub Lyα} ) of 2 M {sub ⊙} yr{sup −1} and a UV-based SFR of 4 M {sub ⊙} yr{sup −1}. Although we cannot completely rule out that this i-dropout emitter may be an [O ii] interloper, its measured properties are consistent with the C iv powered galaxy at z = 5.74. For C iv absorbers at z = 4.95 and z = 4.87, although we detect two LAE candidates with impact parameters of 160 and 200 kpc, such distances are larger than that predicted from the simulations. Therefore, we treat them as nondetections. For the system at z = 5.52, we do not detect LAE candidates, placing a 3 σ upper limit of SFR{sub Lyα} ≈ 1.5 M {sub ⊙} yr{sup −1}. In summary, in these four cases, we only detect one plausible C iv source at z = 5.74. Combining the modest SFR of the one detection and the three nondetections, our HST observations strongly support that smaller galaxies (SFR{sub Lyα} ≲ 2 M {sub ⊙} yr{sup −1}) are main sources of intergalactic C iv absorbers, and such small galaxies play a major role in the metal enrichment of the intergalactic medium at z ≳ 5.« less

  6. 46 CFR 298.27 - Advances.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... other sources, (iii) The measures that you are taking and have taken to alleviate the situation, (iv) Financial projections, (v) Proposed term of the repayment, (vi) Current and projected market conditions...

  7. 40 CFR 146.10 - Plugging and abandoning Class I, II, III, IV, and V wells.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... cement in a manner which will not allow the movement of fluids either into or between underground sources... sources of drinking water. (2) Placement of the cement plugs shall be accomplished by one of the following... alternative method approved by the Director, which will reliably provide a comparable level of protection to...

  8. 78 FR 39654 - Approval, and Promulgation of Air Quality Implementation Plans; Michigan; Redesignation of the...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-02

    ... requirement of the Act. Michigan's maintenance plan submission includes a budget for the mobile source... (Section 107(d)(3)(E)(iv)) 5. Motor Vehicle Emissions Budget (MVEBs) for the Mobile Source Contribution to.... 4. Describe any assumptions and provide any technical information and/or data that you used. 5. If...

  9. VizieR Online Data Catalog: Radio fluxes of 195 ICRF2-Gaia transfer sources (Le Bail+, 2016)

    NASA Astrophysics Data System (ADS)

    Le Bail, K.; Gipson, J. M.; Gordon, D.; MacMillan, D. S.; Behrend, D.; Thomas, C. C.; Bolotin, S.; Himwich, W. E.; Baver, K. D.; Corey, B. E.; Titus, M.; Bourda, G.; Charlot, P.; Collioud, A.

    2016-07-01

    The second realization of the International Celestial Reference Frame (ICRF2) is based on Very Long Baseline Interferometry (VLBI) data at radio frequencies in X band and S band. The European Space Agency's Gaia mission, launched on 2013 December 19, started routine scientific operations in 2014 July. By scanning the whole sky, it is expected to observe ~500000 Quasi Stellar Objects in the optical domain. This means that, in the future, two extragalactic celestial reference frames, at two different frequency domains, will coexist. It will thus be important to align them very accurately. In 2012, the Laboratoire d'Astrophysique de Bordeaux (LAB) selected 195 sources from ICRF2 that will be observed by Gaia and should be suitable for aligning the radio and optical frames: they are called ICRF2-Gaia transfer sources. The LAB submitted a proposal to the International VLBI Service (IVS) to regularly observe these ICRF2-Gaia transfer sources at the same rate as Gaia observes them in the optical realm, e.g., roughly once a month. Of the 195 sources, all but one have been successfully observed in the 12 months prior to 2015 September 01. Table1 lists the 195 ICRF2-Gaia transfer sources. Beginning in 2003 June, the Goddard VLBI group developed a program to purposefully monitor when sources were observed and to increase the observations of "under-observed" sources. In 2013 March, we added all 195 ICRF2-Gaia transfer sources to the IVS source monitoring program with an observation target of 12 successful sessions per year. (1 data file).

  10. Multiple Intravenous Infusions Phase 2b: Laboratory Study

    PubMed Central

    Pinkney, Sonia; Fan, Mark; Chan, Katherine; Koczmara, Christine; Colvin, Christopher; Sasangohar, Farzan; Masino, Caterina; Easty, Anthony; Trbovich, Patricia

    2014-01-01

    Background Administering multiple intravenous (IV) infusions to a single patient via infusion pump occurs routinely in health care, but there has been little empirical research examining the risks associated with this practice or ways to mitigate those risks. Objectives To identify the risks associated with multiple IV infusions and assess the impact of interventions on nurses’ ability to safely administer them. Data Sources and Review Methods Forty nurses completed infusion-related tasks in a simulated adult intensive care unit, with and without interventions (i.e., repeated-measures design). Results Errors were observed in completing common tasks associated with the administration of multiple IV infusions, including the following (all values from baseline, which was current practice): setting up and programming multiple primary continuous IV infusions (e.g., 11.7% programming errors) identifying IV infusions (e.g., 7.7% line-tracing errors) managing dead volume (e.g., 96.0% flush rate errors following IV syringe dose administration) setting up a secondary intermittent IV infusion (e.g., 11.3% secondary clamp errors) administering an IV pump bolus (e.g., 11.5% programming errors) Of 10 interventions tested, 6 (1 practice, 3 technology, and 2 educational) significantly decreased or even eliminated errors compared to baseline. Limitations The simulation of an adult intensive care unit at 1 hospital limited the ability to generalize results. The study results were representative of nurses who received training in the interventions but had little experience using them. The longitudinal effects of the interventions were not studied. Conclusions Administering and managing multiple IV infusions is a complex and risk-prone activity. However, when a patient requires multiple IV infusions, targeted interventions can reduce identified risks. A combination of standardized practice, technology improvements, and targeted education is required. PMID:26316919

  11. Decameter Type IV Burst Associated with a Behind-the-limb CME Observed on 7 November 2013

    NASA Astrophysics Data System (ADS)

    Melnik, V. N.; Brazhenko, A. I.; Konovalenko, A. A.; Dorovskyy, V. V.; Rucker, H. O.; Panchenko, M.; Frantsuzenko, A. V.; Shevchuk, M. V.

    2018-03-01

    We report on the results of observations of a type IV burst made by the Ukrainian Radio interferometer of the Academy of Sciences (URAN-2) in the frequency range 22 - 33 MHz. The burst is associated with a coronal mass ejection (CME) initiated by a behind-the-limb active region (N05E151) and was also observed by the Nançay Decameter Array (NDA) radio telescope in the frequency band 30 - 60 MHz. The purpose of the article is the determination of the source of this type IV burst. After analysis of the observational data obtained with the URAN-2, the NDA, the Solar-Terrestrial Relations Observatory (STEREO) A and B spacecraft, and the Solar and Heliospheric Observatory (SOHO) spacecraft, we come to the conclusion that the source of the burst is the core of a behind-the-limb CME. We conclude that the radio emission can escape the center of the CME core at a frequency of 60 MHz and originates from the periphery of the core at a frequency of 30 MHz that is due to occultation by the solar corona at the corresponding frequencies. We find plasma densities in these regions assuming the plasma mechanism of radio emission. We show that the frequency drift of the start of the type IV burst is governed by an expansion of the CME core. The type III bursts that were observed against this type IV burst are shown to be generated by fast electrons propagating through the CME core plasma. A type II burst was registered at frequencies of 44 - 64 MHz and 3 - 16 MHz and was radiated by a shock with velocities of about 1000 km s^{-1} and 800 km s^{-1}, respectively.

  12. Experimental extrinsic allergic alveolitis and pulmonary angiitis induced by intratracheal or intravenous challenge with Corynebacterium parvum in sensitized rats.

    PubMed Central

    Yi, E. S.; Lee, H.; Suh, Y. K.; Tang, W.; Qi, M.; Yin, S.; Remick, D. G.; Ulich, T. R.

    1996-01-01

    Extrinsic allergic alveolitis and pulmonary sarcoidosis are granulomatous diseases of the lung for which clinical presentation and anatomic site of granuloma formation differ. Extrinsic allergic alveolitis is caused by inhaled antigens, whereas the nature and source of the inciting antigen in sarcoidosis is unknown. To test the hypothesis that the route via which antigen is introduced to the lung contributes to the clinicopathological presentation of pulmonary granulomatous disease, rats immunized with intravenous (i.v.) Corynebacterium parvum were challenged after 2 weeks with either intratracheal (i.t.) or i.v. C. parvum. The granulomatous inflammation elicited by i.t. challenge predominantly involved alveolar spaces and histologically simulated extrinsic allergic alveolitis. In contrast, the inflammation induced by i.v. challenge was characterized by granulomatous angiitis and interstitial inflammation simulating sarcoidosis. Elevations of leukocyte counts and TNF levels in bronchoalveolar fluid, which reflect inflammation in the intra-alveolar compartment, were much more pronounced after i.t. than after i.v. challenge. Tumor necrosis factor, interleukin-6, CC chemokine, CXC chemokine, and adhesion molecule mRNA and protein expression occurred in each model. In conclusion, i.t. or i.v. challenge with C. parvum in sensitized rats caused pulmonary granulomatous inflammation that was histologically similar to human extrinsic allergic alveolitis and sarcoidosis, respectively. Although the soluble and cellular mediators of granulomatous inflammation were qualitatively similar in both disease models, the differing anatomic source of the same antigenic challenge was responsible for differing clinicopathological presentations. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 11 Figure 13 Figure 12 Figure 14 PMID:8863677

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Borland, M.; Hettel, R.; Leemann, S. C.

    With the recent success in commissioning of MAX IV, the multi-bend achromat (MBA) lattice has begun to deliver on its promise to usher in a new generation of higher-brightness synchrotron light sources. In this paper, we begin by reviewing the challenges, recent success, and lessons learned of the MAX-IV project. Drawing on these lessons, we then describe the physics challenges in even more ambitious rings and how these can be met. In addition, we touch on engineering issues and choices that are tightly linked with the physics design.

  14. 40 CFR 442.26 - Pretreatment standards for new sources (PSNS).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... treatment at the POTW; (iv) All spent cleaning solutions, including interior caustic washes, interior...-treatment of segregated wastewaters (including heels, prerinse/pre-steam wastes, spent cleaning solutions...

  15. 40 CFR 442.26 - Pretreatment standards for new sources (PSNS).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... treatment at the POTW; (iv) All spent cleaning solutions, including interior caustic washes, interior...-treatment of segregated wastewaters (including heels, prerinse/pre-steam wastes, spent cleaning solutions...

  16. Synthesis and reactivity of a mononuclear non-haem cobalt(IV)-oxo complex

    NASA Astrophysics Data System (ADS)

    Wang, Bin; Lee, Yong-Min; Tcho, Woon-Young; Tussupbayev, Samat; Kim, Seoung-Tae; Kim, Yujeong; Seo, Mi Sook; Cho, Kyung-Bin; Dede, Yavuz; Keegan, Brenna C.; Ogura, Takashi; Kim, Sun Hee; Ohta, Takehiro; Baik, Mu-Hyun; Ray, Kallol; Shearer, Jason; Nam, Wonwoo

    2017-03-01

    Terminal cobalt(IV)-oxo (CoIV-O) species have been implicated as key intermediates in various cobalt-mediated oxidation reactions. Herein we report the photocatalytic generation of a mononuclear non-haem [(13-TMC)CoIV(O)]2+ (2) by irradiating [CoII(13-TMC)(CF3SO3)]+ (1) in the presence of [RuII(bpy)3]2+, Na2S2O8, and water as an oxygen source. The intermediate 2 was also obtained by reacting 1 with an artificial oxidant (that is, iodosylbenzene) and characterized by various spectroscopic techniques. In particular, the resonance Raman spectrum of 2 reveals a diatomic Co-O vibration band at 770 cm-1, which provides the conclusive evidence for the presence of a terminal Co-O bond. In reactivity studies, 2 was shown to be a competent oxidant in an intermetal oxygen atom transfer, C-H bond activation and olefin epoxidation reactions. The present results lend strong credence to the intermediacy of CoIV-O species in cobalt-catalysed oxidation of organic substrates as well as in the catalytic oxidation of water that evolves molecular oxygen.

  17. Building Analytic Capacity and Statistical Literacy Among Title IV-E MSW Students

    PubMed Central

    LERY, BRIDGETTE; PUTNAM-HORNSTEIN, EMILY; WIEGMANN, WENDY; KING, BRYN

    2016-01-01

    Building and sustaining effective child welfare practice requires an infrastructure of social work professionals trained to use data to identify target populations, connect interventions to outcomes, adapt practice to varying contexts and dynamic populations, and assess their own effectiveness. Increasingly, public agencies are implementing models of self-assessment in which administrative data are used to guide and continuously evaluate the implementation of programs and policies. The research curriculum described in the article was developed to provide Title IV-E and other students interested in public child welfare systems with hands-on opportunities to become experienced and “statistically literate” users of aggregated public child welfare data from California’s administrative child welfare system, attending to the often missing link between data/research and practice improvement. PMID:27429600

  18. Effect of Fumigation on Rotylenchulus reniformis Population Density Through Subsurface Drip Irrigation Located Every Other Furrow.

    PubMed

    Wheeler, T A; Porter, D O; Archer, D; Mullinix, B G

    2008-09-01

    Plots naturally infested with Rotylenchulus reniformis were sampled in the spring of 2006 and 2007 at depths of 15 and 30 cm in the bed, furrow over the drip tape, and "dry" furrow, and at approximately 40 to 45 cm depth in the bed and dry furrow. Then, 1,3-dichloropropene (Telone EC) was injected into the subsurface drip irrigation at 46 kg a.i./ha, and 3 to 4 weeks later the plots were resampled and assayed for nematodes. The transformed values for nematode population density (IvLRr) before fumigation were higher at 30 and 40 cm depths than at a 15 cm depth. IvLRr before fumigation was higher in the soil over the drip lines than in the bed or dry furrow and was higher in the bed than the dry furrow. IvLRr was higher in the plots to be fumigated than the plots that were not to be fumigated for all depths and locations except at a 15 cm depth over the drip lines, where the values were similar. However, after fumigation, IvLRr was lower over the drip lines at a 30 cm depth in plots that were fumigated compared to samples in a similar location and depth that were not fumigated. There were no other location/depth combinations where the fumigation reduced IvLRr below that in the nonfumigated plots. Yield in 2006, which was a very hot and dry year, was predicted adequately (R(2) = 0.67) by a linear model based on the preplant population density of R. reniformis, with a very steep slope (-2.8 kg lint/ha per R. reniformis/100 cm(3) soil). However, no relationship between nematode density and yield was seen in 2007, which had cooler weather for most of the season. Yield was not significantly improved by fumigation through the drip irrigation system in either year compared to plots treated only with aldicarb (0.84 kg a.i./ha), indicating that the level of control with fumigation did not kill enough R. reniformis to be successful.

  19. Biological regeneration of manganese (IV) and iron (III) for anaerobic metal oxide-mediated removal of pharmaceuticals from water.

    PubMed

    Liu, Wenbo; Langenhoff, Alette A M; Sutton, Nora B; Rijnaarts, Huub H M

    2018-05-18

    Applying manganese(IV)- or iron(III)-(hydr)oxides to remove pharmaceuticals from water could be attractive, due to the capacity of these metal oxides to remove pharmaceuticals and be regenerated. As pharmaceutical removal under anaerobic conditions is foreseen, Mn(IV) or Fe(III) regeneration under anaerobic conditions, or with minimum oxygen dosage, is preferred. In this study, batch experiments are performed to investigate (1) Mn(IV) and Fe(III) regeneration from Mn(II) and Fe(II); (2) the pharmaceutical removal during biological Mn(IV) and Fe(III) regeneration; and (3) anaerobic abiotic pharmaceutical removal with different Mn(IV) or Fe(III) species. Results show that biological re-oxidation of reduced Mn(II) to Mn(IV) occurs under oxygen-limiting conditions. Biological re-oxidation of Fe(II) to Fe(III) is obtained with nitrate under anaerobic conditions. Both bio-regenerated Mn(IV)-oxides and Fe(III)-hydroxides are amorphous. The pharmaceutical removal is insignificant by Mn(II)- or Fe(II)-oxidizing bacteria during regeneration. Finally, pharmaceutical removal is investigated with various Mn(IV) and Fe(III) sources. Anaerobic abiotic removal using Mn(IV) produced from drinking water treatment plants results in 23% metoprolol and 44% propranolol removal, similar to chemically synthesized Mn(IV). In contrast, Fe(III) from drinking water treatment plants outperformed chemically or biologically synthesized Fe(III); Fe (III) from drinking water treatment can remove 31-43% of propranolol via anaerobic abiotic process. In addition, one of the Fe(III)-based sorbents tested, FerroSorp ® RW, can also remove propranolol (20-25%). Biological regeneration of Mn(IV) and Fe(III) from the reduced species Mn(II) and Fe(II) could be more effective in terms of cost and treatment efficiency. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Identification of Novel Human Dipeptidyl Peptidase-IV Inhibitors of Natural Origin (Part II): In Silico Prediction in Antidiabetic Extracts

    PubMed Central

    Guasch, Laura; Sala, Esther; Ojeda, María José; Valls, Cristina; Bladé, Cinta; Mulero, Miquel; Blay, Mayte; Ardévol, Anna; Garcia-Vallvé, Santiago; Pujadas, Gerard

    2012-01-01

    Background Natural extracts play an important role in traditional medicines for the treatment of diabetes mellitus and are also an essential resource for new drug discovery. Dipeptidyl peptidase IV (DPP-IV) inhibitors are potential candidates for the treatment of type 2 diabetes mellitus, and the effectiveness of certain antidiabetic extracts of natural origin could be, at least partially, explained by the inhibition of DPP-IV. Methodology/Principal Findings Using an initial set of 29,779 natural products that are annotated with their natural source and an experimentally validated virtual screening procedure previously developed in our lab (Guasch et al.; 2012) [1], we have predicted 12 potential DPP-IV inhibitors from 12 different plant extracts that are known to have antidiabetic activity. Seven of these molecules are identical or similar to molecules with described antidiabetic activity (although their role as DPP-IV inhibitors has not been suggested as an explanation for their bioactivity). Therefore, it is plausible that these 12 molecules could be responsible, at least in part, for the antidiabetic activity of these extracts through their inhibitory effect on DPP-IV. In addition, we also identified as potential DPP-IV inhibitors 6 molecules from 6 different plants with no described antidiabetic activity but that share the same genus as plants with known antidiabetic properties. Moreover, none of the 18 molecules that we predicted as DPP-IV inhibitors exhibits chemical similarity with a group of 2,342 known DPP-IV inhibitors. Conclusions/Significance Our study identified 18 potential DPP-IV inhibitors in 18 different plant extracts (12 of these plants have known antidiabetic properties, whereas, for the remaining 6, antidiabetic activity has been reported for other plant species from the same genus). Moreover, none of the 18 molecules exhibits chemical similarity with a large group of known DPP-IV inhibitors. PMID:23028712

  1. Mutation spectrum of β-globin gene in thalassemia patients at Hasan Sadikin Hospital - West Java Indonesia.

    PubMed

    Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S

    2017-12-30

    Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.

  2. Validation of a Spanish-language version of the ADHD Rating Scale IV in a Spanish sample.

    PubMed

    Vallejo-Valdivielso, M; Soutullo, C A; de Castro-Manglano, P; Marín-Méndez, J J; Díez-Suárez, A

    2017-07-14

    The purpose of this study is to validate a Spanish-language version of the 18-item ADHD Rating Scale-IV (ADHD-RS-IV.es) in a Spanish sample. From a total sample of 652 children and adolescents aged 6 to 17 years (mean age was 11.14±3.27), we included 518 who met the DSM-IV-TR criteria for ADHD and 134 healthy controls. To evaluate the factorial structure, validity, and reliability of the scale, we performed a confirmatory factor analysis (CFA) using structural equation modelling on a polychoric correlation matrix and maximum likelihood estimation. The scale's discriminant validity and predictive value were estimated using ROC (receiver operating characteristics) curve analysis. Both the full scale and the subscales of the Spanish-language version of the ADHD-RS-IV showed good internal consistency. Cronbach's alpha was 0.94 for the full scale and ≥ 0.90 for the subscales, and ordinal alpha was 0.95 and ≥ 0.90, respectively. CFA showed that a two-factor model (inattention and hyperactivity/impulsivity) provided the best fit for the data. ADHD-RS-IV.es offered good discriminant ability to distinguish between patients with ADHD and controls (AUC=0.97). The two-factor structure of the Spanish-language version of the ADHD-RS-IV (ADHD-RS-IV.es) is consistent with those of the DSM-IV-TR and DSM-5 as well as with the model proposed by the author of the original scale. Furthermore, it has good discriminant ability. ADHD-RS-IV.es is therefore a valid and reliable tool for determining presence and severity of ADHD symptoms in the Spanish population. Copyright © 2017 Sociedad Española de Neurología. Publicado por Elsevier España, S.L.U. All rights reserved.

  3. Geographic structure evidenced in the toxic dinoflagellate Alexandrium pacificum Litaker (A. catenella - group IV (Whedon & Kofoid) Balech) along Japanese and Chinese coastal waters.

    PubMed

    Genovesi, Benjamin; Berrebi, Patrick; Nagai, Satoshi; Reynaud, Nathalie; Wang, Jinhui; Masseret, Estelle

    2015-09-15

    The intra-specific diversity and genetic structure within the Alexandrium pacificum Litaker (A. catenella - Group IV) populations along the Temperate Asian coasts, were studied among individuals isolated from Japan to China. The UPGMA dendrogram and FCA revealed the existence of 3 clusters. Assignment analysis suggested the occurrence of gene flows between the Japanese Pacific coast (cluster-1) and the Chinese Zhejiang coast (cluster-2). Human transportations are suspected to explain the lack of genetic difference between several pairs of distant Japanese samples, hardly explained by a natural dispersal mechanism. The genetic isolation of the population established in the Sea of Japan (cluster-3) suggested the existence of a strong ecological and geographical barrier. Along the Pacific coasts, the South-North current allows limited exchanges between Chinese and Japanese populations. The relationships between Temperate Asian and Mediterranean individuals suggested different scenario of large-scale dispersal mechanisms. Copyright © 2015. Published by Elsevier Ltd.

  4. Children's Problems Predict Adults' "DSM-IV" Disorders across 24 Years

    ERIC Educational Resources Information Center

    Reef, Joni; van Meurs, Inge; Verhulst, Frank C.; van der Ende, Jan

    2010-01-01

    Objective: The goal of this study was to determine continuities of a broad range of psychopathology from childhood into middle adulthood in a general population sample across a 24-year follow-up. Method: In 1983, parent ratings of children's problems were collected with the Child Behavior Checklist (CBCL) in a general population sample of 2,076…

  5. Collaborative Analysis of DRD4 and DAT Genotypes in Population-Defined ADHD Subtypes

    ERIC Educational Resources Information Center

    Todd, Richard D.; Huang, Hongyan; Smalley, Susan L.; Nelson, Stanley F.; Willcutt, Erik G.; Pennington, Bruce F.; Smith, Shelley D.; Faraone, Stephen V.; Neuman, Rosalind J.

    2005-01-01

    Background: It has been proposed that some of the variability in reporting of associations between attention deficit hyperactivity disorder (ADHD) and candidate genes may result from mixing of genetically heterogeneous forms of ADHD using DSM-IV criteria. The goal of the current study is to test whether population-based ADHD subtypes defined by…

  6. Associated Medical Disorders and Disabilities in Children with Autistic Disorder: A Population-Based Study

    ERIC Educational Resources Information Center

    Kielinen, Marko; Rantala, Heikki; Timonen, Eija; Linna, Sirkka-Liisa; Moilanen, Irma

    2004-01-01

    A population-based survey was conducted among 152,732 Finnish children and adolescents aged under 16 years and living in northern Finland. Diagnoses and associated medical conditions were derived from the hospital and institutional records of this area. One hundred and eighty-seven children with DSM-IV autistic disorder were identified. Associated…

  7. Performance of the RAPS4/RAPS4-QF for DSM-5 compared to DSM-IV alcohol use disorders in the general population: Data from the 2000-2010 National Alcohol Surveys.

    PubMed

    Cherpitel, Cheryl J; Ye, Yu

    2015-06-01

    A number of relatively short screening instruments have been developed for identifying alcohol use disorders (AUD), but performance has been evaluated against the standard Diagnostic and Statistical Manual of Mental and Behavior Disorders (DSM) criteria, and it is not known how screening instruments may perform based on the newly formulated DSM-5 criteria, which is a radical departure from previous versions of the DSM. Analyzed here is the performance of the RAPS4/RAPS4-QF against DSM-5 criteria for AUD compared to DSM-IV dependence and abuse criteria. Sensitivity and specificity are analyzed in a merged sample of 21,386 respondents from three National Alcohol Surveys of the U.S. general population (2000, 2005, 2010). Sensitivity of the RAPS4 was lower for DSM-5 AUD (62.5%) than for DSM-IV dependence (88%), while the RAPS4-QF was higher for DSM-5 AUD (90.3%) than for DSM-IV abuse (81.3%), or abuse/dependence (85.8%), while maintaining good specificity (84%). Sensitivity of the RAPS4-QF was higher for males (92%) compared to females (86.6%) and highest for whites (93.8%) followed by Hispanics (84.2%) and blacks (82.4%). Screening instruments may not perform similarly for DSM-5 as for DSM-IV AUD, and data here suggest the RAPS4-QF may be a good instrument choice for identifying those meeting criteria for DSM-5 AUD. These data also suggest the need for additional research and a similar evaluation of other commonly used screening instruments for DSM-5 AUD. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  8. Static Air Support Surfaces to Prevent Pressure Injuries: A Multicenter Cohort Study in Belgian Nursing Homes.

    PubMed

    Serraes, Brecht; Beeckman, Dimitri

    2016-01-01

    The aim of this study was to investigate the incidence and risk factors for developing pressure injuries (PIs) in patients placed on a static air support surfaces: mattress overlay, heel wedge, and seat cushion. Multicenter cohort study. The sample comprised 176 residents; their mean age was 87 (SD = 6.76) years; their mean Braden Scale score was 14 (SD = 2.54). The study was performed on a convenience sample of 6 nursing homes in Belgium. Data were collected on 23 care units. The primary outcome measure, cumulative PI incidence (category [stage] II-IV) over a 30-day observation period, was calculated. Pressure injury occurrence was defined according to the 2014 European and US National Pressure Injury Advisory panels, Pan Pacific Pressure Injury Alliance classification system. The PI incidence for category (stage) II-IV was 5.1%. Six residents (3.4%) developed a category II PI, and 3 (1.7%) developed a category III PI; no category IV ulcers occurred. No significant risk factors for category II-IV PIs were identified using multivariate logistic regression. Time of sitting in a chair was found to be a risk factor for development of nonblanchable erythema (category I PI) (odds ratio = 21.608; 95% confidence interval [CI], 20.510-22.812; P = .013). The median time to develop a category II-IV PI was 16 days (interquartile range = 2-26). The interrater reliability between the observations of the researcher and nurses on-site was almost perfect (0.86; 95% CI, 0.81-0.91). We found a low incidence of PIs when using a static air overlay mattress for patients at risk in a nursing home population. Static air support surfaces, alongside patient-tailored patient repositioning protocols, should be considered to prevent PIs in this patient population.

  9. Underutilization of IV nitrates in the treatment of acute heart failure.

    PubMed

    Mohan, Mohapradeep; Hawkey, Sean; Baig, Fatima; Choy, Anna Maria; Lang, Chim C

    2015-08-01

    Acute heart failure (AHF) is a growing public health concern with high inhospital mortality and costs. Clinical practice guidelines, underpinned by positive randomized controlled trials, recommend the early use of intravenous (IV) nitrates in the treatment of AHF. However, the "real-world" usage of IV nitrates has not been clearly defined. The objective of this study was to examine the use of IV nitrates in the treatment of AHF as recommended by clinical practice guidelines. A case-record analysis was conducted of all admissions with AHF at a large teaching hospital. Of the 81 AHF patients (mean age 77 ± 11, mean SBP 130 ± 27 mmHg) enrolled for this analysis, only 5 (6%) received IV nitrates at the time of AHF admission. Forty (49%, mean age 77 ± 11, mean SBP 131 ± 27 mmHg) of these 81 patients met the guideline criteria for suitability for IV nitrates and only 5 (12%) of these received them during this admission. Patients who received IV nitrates were more likely to have higher blood pressure and all had myocardial ischemia as a precipitant. Seventy-five (93%) of the total population received loop diuretics on admission. Overall, this study shows that loop diuretics remain the first-line therapy in AHF with little use of IV nitrates, despite recommendations from clinical practice guidelines. © 2015 John Wiley & Sons Ltd.

  10. Brief Report: Investigating the Implications of Applying the New DSM-5 Criteria for Diagnosing Autism Spectrum Disorder in a Preschool Population in Singapore

    ERIC Educational Resources Information Center

    Wong, Chui Mae; Koh, Hwan Cui

    2016-01-01

    Diagnostic reports for 206 children who underwent an assessment for autism spectrum disorder (ASD) using the DSM-IV-TR criteria, were re-evaluated using the DSM-5 criteria. Mean age of the children at time of diagnosis was 3 years 10 months. Of the 202 children diagnosed with ASD on the DSM-IV-TR, 184 (91.1%) also met the DSM-5 criteria for ASD.…

  11. Gene flow in environmental Legionella pneumophila leads to genetic and pathogenic heterogeneity within a Legionnaires' disease outbreak.

    PubMed

    McAdam, Paul R; Vander Broek, Charles W; Lindsay, Diane S J; Ward, Melissa J; Hanson, Mary F; Gillies, Michael; Watson, Mick; Stevens, Joanne M; Edwards, Giles F; Fitzgerald, J Ross

    2014-01-01

    Legionnaires' disease is a severe form of pneumonia caused by the environmental bacterium Legionella pneumophila. Outbreaks commonly affect people with known risk factors, but the genetic and pathogenic complexity of L. pneumophila within an outbreak is not well understood. Here, we investigate the etiology of the major Legionnaires' disease outbreak that occurred in Edinburgh, UK, in 2012, by examining the evolutionary history, genome content, and virulence of L. pneumophila clinical isolates. Our high resolution genomic approach reveals that the outbreak was caused by multiple genetic subtypes of L. pneumophila, the majority of which had diversified from a single progenitor through mutation, recombination, and horizontal gene transfer within an environmental reservoir prior to release. In addition, we discover that some patients were infected with multiple L. pneumophila subtypes, a finding which can affect the certainty of source attribution. Importantly, variation in the complement of type IV secretion systems encoded by different genetic subtypes correlates with virulence in a Galleria mellonella model of infection, revealing variation in pathogenic potential among the outbreak source population of L. pneumophila. Taken together, our study indicates previously cryptic levels of pathogen heterogeneity within a Legionnaires' disease outbreak, a discovery that impacts on source attribution for future outbreak investigations. Furthermore, our data suggest that in addition to host immune status, pathogen diversity may be an important influence on the clinical outcome of individual outbreak infections.

  12. A Deep Search for Faint Galaxies Associated with Very Low Redshift C IV Absorbers. III. The Mass- and Environment-dependent Circumgalactic Medium

    NASA Astrophysics Data System (ADS)

    Burchett, Joseph N.; Tripp, Todd M.; Bordoloi, Rongmon; Werk, Jessica K.; Prochaska, J. Xavier; Tumlinson, Jason; Willmer, C. N. A.; O'Meara, John; Katz, Neal

    2016-12-01

    Using Hubble Space Telescope Cosmic Origins Spectrograph observations of 89 QSO sightlines through the Sloan Digital Sky Survey footprint, we study the relationships between C IV absorption systems and the properties of nearby galaxies, as well as the large-scale environment. To maintain sensitivity to very faint galaxies, we restrict our sample to 0.0015\\lt z\\lt 0.015, which defines a complete galaxy survey to L≳ 0.01 L\\ast or stellar mass {M}* ≳ {10}8 {M}⊙ . We report two principal findings. First, for galaxies with impact parameter ρ \\lt 1 {r}{vir}, C IV detection strongly depends on the luminosity/stellar mass of the nearby galaxy. C IV is preferentially associated with galaxies with {M}* \\gt {10}9.5 {M}⊙ ; lower-mass galaxies rarely exhibit significant C IV absorption (covering fraction {f}C={9}-6+12 % for 11 galaxies with {M}* \\lt {10}9.5 {M}⊙ ). Second, C IV detection within the {M}* \\gt {10}9.5 {M}⊙ population depends on environment. Using a fixed-aperture environmental density metric for galaxies with ρ < 160 kpc at z\\lt 0.055, we find that {57}-13+12 % (8/14) of galaxies in low-density regions (regions with fewer than seven L\\gt 0.15 L\\ast galaxies within 1.5 Mpc) have affiliated C IV absorption; however, none (0/7) of the galaxies in denser regions show C IV. Similarly, the C IV detection rate is lower for galaxies residing in groups with dark matter halo masses of {M}{halo}\\gt {10}12.5 {M}⊙ . In contrast to C IV, H I is pervasive in the circumgalactic medium without regard to mass or environment. These results indicate that C IV absorbers with {log} N({{C}} {{IV}})≳ 13.5 {{cm}}-2 trace the halos of {M}* \\gt {10}9.5 {M}⊙ galaxies but also reflect larger-scale environmental conditions.

  13. Inter-rater agreement of comorbid DSM-IV personality disorders in substance abusers.

    PubMed

    Hesse, Morten; Thylstrup, Birgitte

    2008-05-17

    Little is known about the inter-rater agreement of personality disorders in clinical settings. Clinicians rated 75 patients with substance use disorders on the DSM-IV criteria of personality disorders in random order, and on rating scales representing the severity of each. Convergent validity agreement was moderate (range for r = 0.55, 0.67) for cluster B disorders rated with DSM-IV criteria, and discriminant validity was moderate for eight of the ten personality disorders. Convergent validity of the rating scales was only moderate for antisocial and narcissistic personality disorder. Dimensional ratings may be used in research studies and clinical practice with some caution, and may be collected as one of several sources of information to describe the personality of a patient.

  14. Oral versus intravenous premedication for small bowel biopsy in children: effect on procedure and fluoroscopy times.

    PubMed

    Stenhammar, L; Wärngård, O; Lewander, P; Nordvall, M

    1993-01-01

    Oral alimemazine and cisapride, or diazepam and cisapride, or iv midazolam and metoclopramide were given as premedication for small bowel biopsy to three groups of children from a total population of 185 individuals. The biopsy procedures were performed under intermittent fluoroscopy and times for both were recorded. The median biopsy procedure time was significantly shorter in children given iv midazolam and metoclopramide (6 min) compared to those given oral premedication (10 min) (p < 0.001). The median fluoroscopy time was very short in all groups, ranging between 3 and 6 s. It is concluded that iv premedication is superior to oral premedication for small bowel biopsy in children because more effective sedation is obtained.

  15. 45 CFR 303.3 - Location of noncustodial parents in IV-D cases.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ..., unemployment insurance, income taxation, driver's licenses, vehicle registration, and criminal records and... location, whichever occurs sooner. Quarterly attempts may be limited to automated sources, but must include...

  16. 45 CFR 303.3 - Location of noncustodial parents in IV-D cases.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ..., unemployment insurance, income taxation, driver's licenses, vehicle registration, and criminal records and... location, whichever occurs sooner. Quarterly attempts may be limited to automated sources, but must include...

  17. 45 CFR 303.3 - Location of noncustodial parents in IV-D cases.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ..., unemployment insurance, income taxation, driver's licenses, vehicle registration, and criminal records and... location, whichever occurs sooner. Quarterly attempts may be limited to automated sources, but must include...

  18. 45 CFR 303.3 - Location of noncustodial parents in IV-D cases.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ..., unemployment insurance, income taxation, driver's licenses, vehicle registration, and criminal records and... location, whichever occurs sooner. Quarterly attempts may be limited to automated sources, but must include...

  19. The electron-cyclotron maser instability as a source of plasma radiation. [Solar radio bursts

    NASA Technical Reports Server (NTRS)

    Winglee, R. M.; Dulk, G. A.

    1986-01-01

    The generation of continuum bursts from the sun at dm and m wavelengths (in particular, type IV bursts) via the electron-cyclotron-maser instability is examined. The maser instability can be driven by an electron distribution with either a loss-cone anisotropy or a peak at large pitch angles. For omega(p)/Omega(e) much greater than 1, the maser emission is produced by electrons interacting through a harmonic (cyclotron) resonance and is electrostatic, being in the upper hybrid mode at frequencies approximately equal to omega(p). Coalescence processes are required to convert the electrostatic waves into transverse radiation which can escape from the source region. Whether the resultant spectrum is nearly a smooth continuum or has a zebra-stripe pattern (both of which occur in type IV bursts) depends on the form of the electron distribution, inhomogeneities in the density and magnetic field, and whether the maser reaches saturation. For at least the case of some type IV dm bursts with fine structure, comparison with observations seems to indicate that the electrons producing the emission are more likely to have a loss-cone distribution, and that the maser instability is not at saturation.

  20. Sloan Digital Sky Survey IV: Mapping the Milky Way, nearby galaxies, and the distant universe

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blanton, Michael R.; Bershady, Matthew A.; Abolfathi, Bela

    Here, we describe the Sloan Digital Sky Survey IV (SDSS-IV), a project encompassing three major spectroscopic programs. The Apache Point Observatory Galactic Evolution Experiment 2 (APOGEE-2) is observing hundreds of thousands of Milky Way stars at high resolution and high signal-to-noise ratios in the near-infrared. The Mapping Nearby Galaxies at Apache Point Observatory (MaNGA) survey is obtaining spatially resolved spectroscopy for thousands of nearby galaxies (medianmore » $$z\\sim 0.03$$). The extended Baryon Oscillation Spectroscopic Survey (eBOSS) is mapping the galaxy, quasar, and neutral gas distributions between $$z\\sim 0.6$$ and 3.5 to constrain cosmology using baryon acoustic oscillations, redshift space distortions, and the shape of the power spectrum. Within eBOSS, we are conducting two major subprograms: the SPectroscopic IDentification of eROSITA Sources (SPIDERS), investigating X-ray AGNs and galaxies in X-ray clusters, and the Time Domain Spectroscopic Survey (TDSS), obtaining spectra of variable sources. All programs use the 2.5 m Sloan Foundation Telescope at the Apache Point Observatory; observations there began in Summer 2014. APOGEE-2 also operates a second near-infrared spectrograph at the 2.5 m du Pont Telescope at Las Campanas Observatory, with observations beginning in early 2017. Observations at both facilities are scheduled to continue through 2020. In keeping with previous SDSS policy, SDSS-IV provides regularly scheduled public data releases; the first one, Data Release 13, was made available in 2016 July.« less

  1. Sloan Digital Sky Survey IV: Mapping the Milky Way, nearby galaxies, and the distant universe

    DOE PAGES

    Blanton, Michael R.; Bershady, Matthew A.; Abolfathi, Bela; ...

    2017-06-29

    Here, we describe the Sloan Digital Sky Survey IV (SDSS-IV), a project encompassing three major spectroscopic programs. The Apache Point Observatory Galactic Evolution Experiment 2 (APOGEE-2) is observing hundreds of thousands of Milky Way stars at high resolution and high signal-to-noise ratios in the near-infrared. The Mapping Nearby Galaxies at Apache Point Observatory (MaNGA) survey is obtaining spatially resolved spectroscopy for thousands of nearby galaxies (medianmore » $$z\\sim 0.03$$). The extended Baryon Oscillation Spectroscopic Survey (eBOSS) is mapping the galaxy, quasar, and neutral gas distributions between $$z\\sim 0.6$$ and 3.5 to constrain cosmology using baryon acoustic oscillations, redshift space distortions, and the shape of the power spectrum. Within eBOSS, we are conducting two major subprograms: the SPectroscopic IDentification of eROSITA Sources (SPIDERS), investigating X-ray AGNs and galaxies in X-ray clusters, and the Time Domain Spectroscopic Survey (TDSS), obtaining spectra of variable sources. All programs use the 2.5 m Sloan Foundation Telescope at the Apache Point Observatory; observations there began in Summer 2014. APOGEE-2 also operates a second near-infrared spectrograph at the 2.5 m du Pont Telescope at Las Campanas Observatory, with observations beginning in early 2017. Observations at both facilities are scheduled to continue through 2020. In keeping with previous SDSS policy, SDSS-IV provides regularly scheduled public data releases; the first one, Data Release 13, was made available in 2016 July.« less

  2. Sloan Digital Sky Survey IV: Mapping the Milky Way, Nearby Galaxies, and the Distant Universe

    NASA Astrophysics Data System (ADS)

    Blanton, Michael R.; Bershady, Matthew A.; Abolfathi, Bela; Albareti, Franco D.; Allende Prieto, Carlos; Almeida, Andres; Alonso-García, Javier; Anders, Friedrich; Anderson, Scott F.; Andrews, Brett; Aquino-Ortíz, Erik; Aragón-Salamanca, Alfonso; Argudo-Fernández, Maria; Armengaud, Eric; Aubourg, Eric; Avila-Reese, Vladimir; Badenes, Carles; Bailey, Stephen; Barger, Kathleen A.; Barrera-Ballesteros, Jorge; Bartosz, Curtis; Bates, Dominic; Baumgarten, Falk; Bautista, Julian; Beaton, Rachael; Beers, Timothy C.; Belfiore, Francesco; Bender, Chad F.; Berlind, Andreas A.; Bernardi, Mariangela; Beutler, Florian; Bird, Jonathan C.; Bizyaev, Dmitry; Blanc, Guillermo A.; Blomqvist, Michael; Bolton, Adam S.; Boquien, Médéric; Borissova, Jura; van den Bosch, Remco; Bovy, Jo; Brandt, William N.; Brinkmann, Jonathan; Brownstein, Joel R.; Bundy, Kevin; Burgasser, Adam J.; Burtin, Etienne; Busca, Nicolás G.; Cappellari, Michele; Delgado Carigi, Maria Leticia; Carlberg, Joleen K.; Carnero Rosell, Aurelio; Carrera, Ricardo; Chanover, Nancy J.; Cherinka, Brian; Cheung, Edmond; Gómez Maqueo Chew, Yilen; Chiappini, Cristina; Doohyun Choi, Peter; Chojnowski, Drew; Chuang, Chia-Hsun; Chung, Haeun; Cirolini, Rafael Fernando; Clerc, Nicolas; Cohen, Roger E.; Comparat, Johan; da Costa, Luiz; Cousinou, Marie-Claude; Covey, Kevin; Crane, Jeffrey D.; Croft, Rupert A. C.; Cruz-Gonzalez, Irene; Garrido Cuadra, Daniel; Cunha, Katia; Damke, Guillermo J.; Darling, Jeremy; Davies, Roger; Dawson, Kyle; de la Macorra, Axel; Dell'Agli, Flavia; De Lee, Nathan; Delubac, Timothée; Di Mille, Francesco; Diamond-Stanic, Aleks; Cano-Díaz, Mariana; Donor, John; Downes, Juan José; Drory, Niv; du Mas des Bourboux, Hélion; Duckworth, Christopher J.; Dwelly, Tom; Dyer, Jamie; Ebelke, Garrett; Eigenbrot, Arthur D.; Eisenstein, Daniel J.; Emsellem, Eric; Eracleous, Mike; Escoffier, Stephanie; Evans, Michael L.; Fan, Xiaohui; Fernández-Alvar, Emma; Fernandez-Trincado, J. G.; Feuillet, Diane K.; Finoguenov, Alexis; Fleming, Scott W.; Font-Ribera, Andreu; Fredrickson, Alexander; Freischlad, Gordon; Frinchaboy, Peter M.; Fuentes, Carla E.; Galbany, Lluís; Garcia-Dias, R.; García-Hernández, D. A.; Gaulme, Patrick; Geisler, Doug; Gelfand, Joseph D.; Gil-Marín, Héctor; Gillespie, Bruce A.; Goddard, Daniel; Gonzalez-Perez, Violeta; Grabowski, Kathleen; Green, Paul J.; Grier, Catherine J.; Gunn, James E.; Guo, Hong; Guy, Julien; Hagen, Alex; Hahn, ChangHoon; Hall, Matthew; Harding, Paul; Hasselquist, Sten; Hawley, Suzanne L.; Hearty, Fred; Gonzalez Hernández, Jonay I.; Ho, Shirley; Hogg, David W.; Holley-Bockelmann, Kelly; Holtzman, Jon A.; Holzer, Parker H.; Huehnerhoff, Joseph; Hutchinson, Timothy A.; Hwang, Ho Seong; Ibarra-Medel, Héctor J.; da Silva Ilha, Gabriele; Ivans, Inese I.; Ivory, KeShawn; Jackson, Kelly; Jensen, Trey W.; Johnson, Jennifer A.; Jones, Amy; Jönsson, Henrik; Jullo, Eric; Kamble, Vikrant; Kinemuchi, Karen; Kirkby, David; Kitaura, Francisco-Shu; Klaene, Mark; Knapp, Gillian R.; Kneib, Jean-Paul; Kollmeier, Juna A.; Lacerna, Ivan; Lane, Richard R.; Lang, Dustin; Law, David R.; Lazarz, Daniel; Lee, Youngbae; Le Goff, Jean-Marc; Liang, Fu-Heng; Li, Cheng; Li, Hongyu; Lian, Jianhui; Lima, Marcos; Lin, Lihwai; Lin, Yen-Ting; Bertran de Lis, Sara; Liu, Chao; de Icaza Lizaola, Miguel Angel C.; Long, Dan; Lucatello, Sara; Lundgren, Britt; MacDonald, Nicholas K.; Deconto Machado, Alice; MacLeod, Chelsea L.; Mahadevan, Suvrath; Geimba Maia, Marcio Antonio; Maiolino, Roberto; Majewski, Steven R.; Malanushenko, Elena; Malanushenko, Viktor; Manchado, Arturo; Mao, Shude; Maraston, Claudia; Marques-Chaves, Rui; Masseron, Thomas; Masters, Karen L.; McBride, Cameron K.; McDermid, Richard M.; McGrath, Brianne; McGreer, Ian D.; Medina Peña, Nicolás; Melendez, Matthew; Merloni, Andrea; Merrifield, Michael R.; Meszaros, Szabolcs; Meza, Andres; Minchev, Ivan; Minniti, Dante; Miyaji, Takamitsu; More, Surhud; Mulchaey, John; Müller-Sánchez, Francisco; Muna, Demitri; Munoz, Ricardo R.; Myers, Adam D.; Nair, Preethi; Nandra, Kirpal; Correa do Nascimento, Janaina; Negrete, Alenka; Ness, Melissa; Newman, Jeffrey A.; Nichol, Robert C.; Nidever, David L.; Nitschelm, Christian; Ntelis, Pierros; O'Connell, Julia E.; Oelkers, Ryan J.; Oravetz, Audrey; Oravetz, Daniel; Pace, Zach; Padilla, Nelson; Palanque-Delabrouille, Nathalie; Alonso Palicio, Pedro; Pan, Kaike; Parejko, John K.; Parikh, Taniya; Pâris, Isabelle; Park, Changbom; Patten, Alim Y.; Peirani, Sebastien; Pellejero-Ibanez, Marcos; Penny, Samantha; Percival, Will J.; Perez-Fournon, Ismael; Petitjean, Patrick; Pieri, Matthew M.; Pinsonneault, Marc; Pisani, Alice; Poleski, Radosław; Prada, Francisco; Prakash, Abhishek; Queiroz, Anna Bárbara de Andrade; Raddick, M. Jordan; Raichoor, Anand; Barboza Rembold, Sandro; Richstein, Hannah; Riffel, Rogemar A.; Riffel, Rogério; Rix, Hans-Walter; Robin, Annie C.; Rockosi, Constance M.; Rodríguez-Torres, Sergio; Roman-Lopes, A.; Román-Zúñiga, Carlos; Rosado, Margarita; Ross, Ashley J.; Rossi, Graziano; Ruan, John; Ruggeri, Rossana; Rykoff, Eli S.; Salazar-Albornoz, Salvador; Salvato, Mara; Sánchez, Ariel G.; Aguado, D. S.; Sánchez-Gallego, José R.; Santana, Felipe A.; Santiago, Basílio Xavier; Sayres, Conor; Schiavon, Ricardo P.; da Silva Schimoia, Jaderson; Schlafly, Edward F.; Schlegel, David J.; Schneider, Donald P.; Schultheis, Mathias; Schuster, William J.; Schwope, Axel; Seo, Hee-Jong; Shao, Zhengyi; Shen, Shiyin; Shetrone, Matthew; Shull, Michael; Simon, Joshua D.; Skinner, Danielle; Skrutskie, M. F.; Slosar, Anže; Smith, Verne V.; Sobeck, Jennifer S.; Sobreira, Flavia; Somers, Garrett; Souto, Diogo; Stark, David V.; Stassun, Keivan; Stauffer, Fritz; Steinmetz, Matthias; Storchi-Bergmann, Thaisa; Streblyanska, Alina; Stringfellow, Guy S.; Suárez, Genaro; Sun, Jing; Suzuki, Nao; Szigeti, Laszlo; Taghizadeh-Popp, Manuchehr; Tang, Baitian; Tao, Charling; Tayar, Jamie; Tembe, Mita; Teske, Johanna; Thakar, Aniruddha R.; Thomas, Daniel; Thompson, Benjamin A.; Tinker, Jeremy L.; Tissera, Patricia; Tojeiro, Rita; Hernandez Toledo, Hector; de la Torre, Sylvain; Tremonti, Christy; Troup, Nicholas W.; Valenzuela, Octavio; Martinez Valpuesta, Inma; Vargas-González, Jaime; Vargas-Magaña, Mariana; Vazquez, Jose Alberto; Villanova, Sandro; Vivek, M.; Vogt, Nicole; Wake, David; Walterbos, Rene; Wang, Yuting; Weaver, Benjamin Alan; Weijmans, Anne-Marie; Weinberg, David H.; Westfall, Kyle B.; Whelan, David G.; Wild, Vivienne; Wilson, John; Wood-Vasey, W. M.; Wylezalek, Dominika; Xiao, Ting; Yan, Renbin; Yang, Meng; Ybarra, Jason E.; Yèche, Christophe; Zakamska, Nadia; Zamora, Olga; Zarrouk, Pauline; Zasowski, Gail; Zhang, Kai; Zhao, Gong-Bo; Zheng, Zheng; Zheng, Zheng; Zhou, Xu; Zhou, Zhi-Min; Zhu, Guangtun B.; Zoccali, Manuela; Zou, Hu

    2017-07-01

    We describe the Sloan Digital Sky Survey IV (SDSS-IV), a project encompassing three major spectroscopic programs. The Apache Point Observatory Galactic Evolution Experiment 2 (APOGEE-2) is observing hundreds of thousands of Milky Way stars at high resolution and high signal-to-noise ratios in the near-infrared. The Mapping Nearby Galaxies at Apache Point Observatory (MaNGA) survey is obtaining spatially resolved spectroscopy for thousands of nearby galaxies (median z˜ 0.03). The extended Baryon Oscillation Spectroscopic Survey (eBOSS) is mapping the galaxy, quasar, and neutral gas distributions between z˜ 0.6 and 3.5 to constrain cosmology using baryon acoustic oscillations, redshift space distortions, and the shape of the power spectrum. Within eBOSS, we are conducting two major subprograms: the SPectroscopic IDentification of eROSITA Sources (SPIDERS), investigating X-ray AGNs and galaxies in X-ray clusters, and the Time Domain Spectroscopic Survey (TDSS), obtaining spectra of variable sources. All programs use the 2.5 m Sloan Foundation Telescope at the Apache Point Observatory; observations there began in Summer 2014. APOGEE-2 also operates a second near-infrared spectrograph at the 2.5 m du Pont Telescope at Las Campanas Observatory, with observations beginning in early 2017. Observations at both facilities are scheduled to continue through 2020. In keeping with previous SDSS policy, SDSS-IV provides regularly scheduled public data releases; the first one, Data Release 13, was made available in 2016 July.

  3. 78 FR 31713 - Office of the Chief of Protocol; Gifts to Federal Employees from Foreign Government Sources...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-24

    ... Vol. 78 Friday, No. 101 May 24, 2013 Part IV Department of State Office of the Chief of Protocol; Gifts to Federal Employees From Foreign Government Sources Reported to Employing Agencies in Calendar Year 2010; Notice #0;#0;Federal Register / Vol. 78 , No. 101 / Friday, May 24, 2013 / Notices#0;#0; [[Page 31714

  4. 40 CFR 63.1318 - PET and polystyrene affected sources-testing and compliance demonstration provisions.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 12 2013-07-01 2013-07-01 false PET and polystyrene affected sources... Pollutant Emissions: Group IV Polymers and Resins § 63.1318 PET and polystyrene affected sources—testing and... effectiveness) do not apply and owners or operators are not required to comply with § 63.113. (b) PET affected...

  5. 40 CFR Table 2 to Subpart Jjj of... - Group 1 Storage Vessels at Existing Affected Sources

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 12 2013-07-01 2013-07-01 false Group 1 Storage Vessels at Existing... SOURCE CATEGORIES (CONTINUED) National Emission Standards for Hazardous Air Pollutant Emissions: Group IV Polymers and Resins Pt. 63, Subpt. JJJ, Table 2 Table 2 to Subpart JJJ of Part 63—Group 1 Storage Vessels...

  6. 40 CFR Table 2 to Subpart Jjj of... - Group 1 Storage Vessels at Existing Affected Sources

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 12 2014-07-01 2014-07-01 false Group 1 Storage Vessels at Existing... SOURCE CATEGORIES (CONTINUED) National Emission Standards for Hazardous Air Pollutant Emissions: Group IV Polymers and Resins Pt. 63, Subpt. JJJ, Table 2 Table 2 to Subpart JJJ of Part 63—Group 1 Storage Vessels...

  7. 40 CFR Table 2 to Subpart Jjj of... - Group 1 Storage Vessels at Existing Affected Sources

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 11 2010-07-01 2010-07-01 true Group 1 Storage Vessels at Existing... SOURCE CATEGORIES National Emission Standards for Hazardous Air Pollutant Emissions: Group IV Polymers and Resins Pt. 63, Subpt. JJJ, Table 2 Table 2 to Subpart JJJ of Part 63—Group 1 Storage Vessels at...

  8. 40 CFR Table 4 to Subpart Jjj of... - Group 1 Storage Vessels at New Affected Sources

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 12 2013-07-01 2013-07-01 false Group 1 Storage Vessels at New... SOURCE CATEGORIES (CONTINUED) National Emission Standards for Hazardous Air Pollutant Emissions: Group IV Polymers and Resins Pt. 63, Subpt. JJJ, Table 4 Table 4 to Subpart JJJ of Part 63—Group 1 Storage Vessels...

  9. 40 CFR Table 4 to Subpart Jjj of... - Group 1 Storage Vessels at New Affected Sources

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 11 2011-07-01 2011-07-01 false Group 1 Storage Vessels at New... SOURCE CATEGORIES National Emission Standards for Hazardous Air Pollutant Emissions: Group IV Polymers and Resins Pt. 63, Subpt. JJJ, Table 4 Table 4 to Subpart JJJ of Part 63—Group 1 Storage Vessels at...

  10. 40 CFR Table 2 to Subpart Jjj of... - Group 1 Storage Vessels at Existing Affected Sources

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 12 2012-07-01 2011-07-01 true Group 1 Storage Vessels at Existing... SOURCE CATEGORIES National Emission Standards for Hazardous Air Pollutant Emissions: Group IV Polymers and Resins Pt. 63, Subpt. JJJ, Table 2 Table 2 to Subpart JJJ of Part 63—Group 1 Storage Vessels at...

  11. 40 CFR Table 4 to Subpart Jjj of... - Group 1 Storage Vessels at New Affected Sources

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 12 2014-07-01 2014-07-01 false Group 1 Storage Vessels at New... SOURCE CATEGORIES (CONTINUED) National Emission Standards for Hazardous Air Pollutant Emissions: Group IV Polymers and Resins Pt. 63, Subpt. JJJ, Table 4 Table 4 to Subpart JJJ of Part 63—Group 1 Storage Vessels...

  12. 40 CFR Table 2 to Subpart Jjj of... - Group 1 Storage Vessels at Existing Affected Sources

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 11 2011-07-01 2011-07-01 false Group 1 Storage Vessels at Existing... SOURCE CATEGORIES National Emission Standards for Hazardous Air Pollutant Emissions: Group IV Polymers and Resins Pt. 63, Subpt. JJJ, Table 2 Table 2 to Subpart JJJ of Part 63—Group 1 Storage Vessels at...

  13. 40 CFR 70.1 - Program overview.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ..., shall apply to the permitting of affected sources under the acid rain program, except as provided herein or modified in regulations promulgated under title IV of the Act (acid rain program). (e) Issuance of...

  14. 40 CFR 70.1 - Program overview.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ..., shall apply to the permitting of affected sources under the acid rain program, except as provided herein or modified in regulations promulgated under title IV of the Act (acid rain program). (e) Issuance of...

  15. 40 CFR 70.1 - Program overview.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ..., shall apply to the permitting of affected sources under the acid rain program, except as provided herein or modified in regulations promulgated under title IV of the Act (acid rain program). (e) Issuance of...

  16. 40 CFR 70.1 - Program overview.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ..., shall apply to the permitting of affected sources under the acid rain program, except as provided herein or modified in regulations promulgated under title IV of the Act (acid rain program). (e) Issuance of...

  17. 40 CFR 70.1 - Program overview.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ..., shall apply to the permitting of affected sources under the acid rain program, except as provided herein or modified in regulations promulgated under title IV of the Act (acid rain program). (e) Issuance of...

  18. Broad absorption-line time variability in the QSO CSO 203

    NASA Technical Reports Server (NTRS)

    Barlow, Thomas A.; Junkkarinen, Vesa T.; Burbidge, E. M.; Weymann, Ray J.; Morris, Simon L.; Korista, Kirk T.

    1992-01-01

    We present spectroscopy of the BALQSO CSO 203 during four epochs over a 17-month time span. These data show three distinct levels in the broad absorption lines (BALs) of Si IV 1397A and C IV 1549A. We also note possible variations in the N V 1240A and Al III 1857A absorption troughs. A broad-band monitoring effort during this period shows that the continuum level remained constant to within 10 percent. We argue that the triggering mechanism for the absorption-line changes is most likely synchronous with the continuum source photons; however, no correlation with the central source has yet been found. The observed variations are consistent with changes in the ionization level in the broad absorption-line region (BALR). We discuss possible mechanisms for these changes and the implications for the structure of the BALR.

  19. C IV broad absorption line variability in QSO spectra from SDSS surveys

    NASA Astrophysics Data System (ADS)

    De Cicco, Demetra; Brandt, William N.; Grier, Catherine J.; Paolillo, Maurizio

    2017-12-01

    Broad absorption lines (BALs) in the spectra of quasi-stellar objects (QSOs) are thought to arise from outflowing winds along our line of sight; winds, in turn, are thought to originate from the accretion disk, in the very surroundings of the central supermassive black hole (SMBH), and they likely affect the accretion process onto the SMBH, as well as galaxy evolution. BALs can exhibit variability on timescales typically ranging from months to years. We analyze such variability and, in particular, BAL disappearance, with the aim of investigating QSO physics and structure. We search for disappearing C IV BALs in the spectra of 1319 QSOs from different programs from the Sloan Digital Sky Survey (SDSS); the analyzed time span covers 0.28-4.9 yr (rest frame), and the source redshifts are in the range 1.68-4.27. This is to date the largest sample ever used for such a study. We find 67 sources (5.1_{-0.6}^{+0.7}% of the sample) with 73 disappearing BALs in total (3.9_{-0.5}^{+0.5}% of the total number of C IV BALs detected; some sources have more than one BAL that disappears). We compare the sample of disappearing BALs to the whole sample of BALs, and investigate the correlation in the variability of multiple troughs in the same spectrum. We also derive estimates of the average lifetime of a BAL trough and of the BAL phase along our line of sight.

  20. Characterization of glucose-6-phosphate dehydrogenase deficiency and identification of a novel haplotype 487G>A/IVS5-612(G>C) in the Achang population of Southwestern China.

    PubMed

    Yang, YinFeng; Zhu, YueChun; Li, DanYi; Li, ZhiGang; Lü, HuiRu; Wu, Jing; Tang, Jing; Tong, ShuFen

    2007-08-01

    The prevalence of glucose-6-phosphate dehydrogenase (G6PD) deficiency and its gene mutations were studied in the Achang population from Lianghe County in Southwestern China. We found that 7.31% (19 of 260) males and 4.35% (10 of 230) females had G6PD deficiency. The molecular analysis of G6PD gene exons 2-13 was performed by a PCR-DHPLC-Sequencing or PCR-Sequencing. Sixteen independent subjects with G6PD Mahidol (487G>A) and the new polymorphism IVS5-612 (G>C), which combined into a novel haplotype, were identified accounting for 84.2% (16/19). And 100% Achang G6PD Mahidol were linked to the IVS5-612 C. The percentage of G6PD Mahidol in the Achang group is close to that in the Myanmar population (91.3% 73/80), which implies that there are some gene flows between Achang and Myanmar populations. Interestingly, G6PD Canton (1376G>T) and G6PD Kaiping (1388G>A), which were the most common G6PD variants from other ethnic groups in China, were not found in this Achang group, suggesting that there are different G6PD mutation profiles in the Achang group and other ethnic groups in China. Our findings appear to be the first documented report on the G6PD genetics of the AChang people, which will provide important clues to the Achang ethnic group origin and will help prevention and treatment of malaria in this area.

  1. Epidemiology of Infective Endocarditis in Rural Upstate New York, 2011 - 2016.

    PubMed

    Fatima, Saeeda; Dao, Benajmin; Jameel, Ayesha; Sharma, Konika; Strogatz, David; Scribani, Melissa; Rammohan, Harish Raj Seetha

    2017-09-01

    The epidemiology of infective endocarditis (IE) depends on a number of host factors whose prevalence can vary globally. The usual patient population affected by IE is sicker and older, often with many comorbid conditions. The risk is growing in younger populations due to the emerging epidemic of intravenous (IV) drug use. We have performed a temporal trend analysis of various factors of IE in the rural counties covering a major part of central Upstate New York. We performed a retrospective analysis of electronic medical records of patients who were admitted in a tertiary care hospital in rural Upstate New York and diagnosed with IE from January 1, 2011 to December 31, 2016. Forty-five patients were identified with definite IE and nine with possible IE. Total incidence of IE was 3.5 cases per 100,000 person years in the total population and 4.4 if we consider total population ≥ 18 years in the denominator. A significant (P = 0.022) increase in incidence of IE from 2011 to 2016 was seen by univariate analysis. Incidence was higher in males (P = 0.029) and for those aged 65 or older (P = 0.0003). IV drug use among cases is noted to be more prevalent in 2015 and 2016 compared to previous years. In this study of patients in a rural region of New York, an increase in the incidence of IE was seen over the study period with changes in patient characteristics and etiology over this time. We speculate that an increase in IV drug use could be a leading factor in the recent and future increased incidence of IE in the area.

  2. Epidemiology of Infective Endocarditis in Rural Upstate New York, 2011 - 2016

    PubMed Central

    Fatima, Saeeda; Dao, Benajmin; Jameel, Ayesha; Sharma, Konika; Strogatz, David; Scribani, Melissa; Rammohan, Harish Raj Seetha

    2017-01-01

    Background The epidemiology of infective endocarditis (IE) depends on a number of host factors whose prevalence can vary globally. The usual patient population affected by IE is sicker and older, often with many comorbid conditions. The risk is growing in younger populations due to the emerging epidemic of intravenous (IV) drug use. We have performed a temporal trend analysis of various factors of IE in the rural counties covering a major part of central Upstate New York. Methods We performed a retrospective analysis of electronic medical records of patients who were admitted in a tertiary care hospital in rural Upstate New York and diagnosed with IE from January 1, 2011 to December 31, 2016. Forty-five patients were identified with definite IE and nine with possible IE. Results Total incidence of IE was 3.5 cases per 100,000 person years in the total population and 4.4 if we consider total population ≥ 18 years in the denominator. A significant (P = 0.022) increase in incidence of IE from 2011 to 2016 was seen by univariate analysis. Incidence was higher in males (P = 0.029) and for those aged 65 or older (P = 0.0003). IV drug use among cases is noted to be more prevalent in 2015 and 2016 compared to previous years. Conclusion In this study of patients in a rural region of New York, an increase in the incidence of IE was seen over the study period with changes in patient characteristics and etiology over this time. We speculate that an increase in IV drug use could be a leading factor in the recent and future increased incidence of IE in the area. PMID:28811851

  3. Molecular and phylogenetic analyses of the liver amphistome Explanatum explanatum (Creplin, 1847) Fukui, 1929 in ruminants from Bangladesh and Nepal based on nuclear ribosomal ITS2 and mitochondrial nad1 sequences.

    PubMed

    Mohanta, U K; Rana, H B; Devkota, B; Itagaki, T

    2017-07-01

    Explanatum explanatum flukes, liver amphistomes of ruminants, cause significant economic loss in the livestock industry by inducing severe liver damage. A total of 66 flukes from 26 buffaloes and 7 cattle in four different geographic areas of Bangladesh and 20 flukes from 10 buffaloes in the Chitwan district of Nepal were subjected for analysis. The sequences (442 bp) of the second internal transcribed spacer (ITS2) of ribosomal DNA and the variable fragments (657 bp) of mitochondrial nicotinamide dehydrogenase subunit 1 (nad1) of E. explanatum flukes from Bangladesh and Nepal were analysed. The aim of this study was molecular characterization of the flukes and to elucidate their origin and biogeography. In the ITS2 region, two genotypes were detected among the flukes from Bangladesh, while flukes from Nepal were of only one genotype. Phylogenetic analyses inferred from the nad1 gene revealed that at least four divergent populations (groups I-IV) are distributed in Bangladesh, whereas two divergent populations were found to be distributed in Nepal. Fst values (pairwise fixation index) suggest that Bangladeshi and Nepalese populations of group I to IV are significantly different from each other; but within groups III and IV, the populations from Bangladesh and Nepal were genetically close. This divergence in the nad1 gene indicates that each lineage of E. explanatum from diverse geography was co-adapted during the multiple domestication events of ruminants. This study, for the first time, provides molecular characterization of E. explanatum in Bangladesh and Nepal, and may provide useful information for elucidating its origin and dispersal route in Asia.

  4. Deriving the reference value from the circadian motor active patterns in the "non-dementia" population, compared to the "dementia" population: What is the amount of physical activity conducive to the good circadian rhythm.

    PubMed

    Kodama, Ayuto; Kume, Yu; Tsugaruya, Megumi; Ishikawa, Takashi

    2016-01-01

    The circadian rhythm in older adults is commonly known to change with a decrease in physical activity. However, the association between circadian rhythm metrics and physical activity remains unclear. The objective of this study was to examine circadian activity patterns in older people with and without dementia and to determine the amount of physical activity conducive to a good circadian measurement. Circadian parameters were collected from 117 older community-dwelling people (66 subjects without dementia and 52 subjects with dementia); the parameters were measured continuously using actigraphy for 7 days. A receiver operating characteristic (ROC) curve was applied to determine reference values for the circadian rhythm parameters, consisting of interdaily stability (IS), intradaily variability (IV), and relative amplitude (RA), in older subjects. The ROC curve revealed reference values of 0.55 for IS, 1.10 for IV, and 0.82 for RA. In addition, as a result of the ROC curve in the moderate-to-vigorous physical Activity (MVPA) conducive to the reference value of the Non-parametric Circadian Rhythm Analysis per day, the optimal reference values were 51 minutes for IV and 55 minutes for RA. However, the IS had no classification accuracy. Our results demonstrated the reference values derived from the circadian parameters of older Japanese population with or without dementia. Also, we determined the MVPA conducive to a good circadian rest-active pattern. This reference value for physical activity conducive to a good circadian rhythm might be useful for developing a new index for health promotion in the older community-dwelling population.

  5. ADHD latent class clusters: DSM-IV subtypes and comorbidity

    PubMed Central

    Elia, Josephine; Arcos-Burgos, Mauricio; Bolton, Kelly L.; Ambrosini, Paul J.; Berrettini, Wade; Muenke, Maximilian

    2014-01-01

    ADHD (Attention Deficit Hyperactivity Disorder) has a complex, heterogeneous phenotype only partially captured by Diagnostic and Statistical Manual of Mental Disorders (DSM-IV) criteria. In this report, latent class analyses (LCA) are used to identify ADHD phenotypes using K-SADS-IVR (Schedule for Affective Disorders & Schizophrenia for School Age Children-IV-Revised) symptoms and symptom severity data from a clinical sample of 500 ADHD subjects, ages 6–18, participating in an ADHD genetic study. Results show that LCA identified six separate ADHD clusters, some corresponding to specific DSM-IV subtypes while others included several subtypes. DSM-IV comorbid anxiety and mood disorders were generally similar across all clusters, and subjects without comorbidity did not aggregate within any one cluster. Age and gender composition also varied. These results support findings from population-based LCA studies. The six clusters provide additional homogenous groups that can be used to define ADHD phenotypes in genetic association studies. The limited age ranges aggregating in the different clusters may prove to be a particular advantage in genetic studies where candidate gene expression may vary during developmental phases. DSM-IV comorbid mood and anxiety disorders also do not appear to increase cluster heterogeneity; however, longitudinal studies that cover period of risk are needed to support this finding. PMID:19900717

  6. Prophylactic isopropyl alcohol inhalation and intravenous ondansetron versus ondansetron alone in the prevention of postoperative nausea and vomiting in high-risk patients.

    PubMed

    Radford, Kennett D; Fuller, Thomas N; Bushey, Brent; Daniel, Carole; Pellegrini, Joseph E

    2011-08-01

    Patients identified as high risk for postoperative nausea and vomiting (PONV) are often treated prophylactically with intravenous (IV) ondansetron and an additional agent. Limited options exist for a second agent with no adverse effects. The purpose of this investigation was to determine if combining the prophylactic inhalation of isopropyl alcohol (IPA) vapors, an agent with no adverse effects, with IV ondansetron would be more effective than IV ondansetron alone in the prevention of PONV in high-risk patients. A total of 76 patients at high risk for PONV were randomized into control (n = 38) and experimental (n = 38) groups. All patients received IV ondansetron before emergence from general anesthesia. In addition, the experimental group inhaled IPA vapors before induction. Severity of PONV was measured using a 0 to 10 verbal numeric rating scale. Other measured variables included time to onset and incidence of PONV, 24-hour composite nausea score, and satisfaction with nausea control. No significant differences in demographics, surgical or anesthesia time, number of risk factors, severity or incidence of PONV, or satisfaction scores were noted. Prophylactic inhalation of IPA vapors in combination with IV ondansetron was no more efficacious than IV ondansetron alone in the prevention of PONV in a high-risk population.

  7. Symptoms Associated With Attention Deficit/Hyperactivity Disorder and Autism Spectrum Disorders in School-Aged Children Prenatally Exposed to Substances

    PubMed Central

    Sandtorv, Lisbeth Beate; Fevang, Silje Katrine Elgen; Nilsen, Sondre Aasen; Bøe, Tormod; Gjestad, Rolf; Haugland, Siren; Elgen, Irene Bircow

    2018-01-01

    Prenatal exposure to substances may influence a child’s neurodevelopment and impact on subsequent mental health. In a hospital-based population of school-aged children prenatally exposed to opiates and a number of illicit substances (n = 57), we evaluated mental health symptoms associated with attention deficit/hyperactivity disorder (ADHD) and autism spectrum disorders (ASD) using the Swanson, Nolan, and Pelham Questionnaire, revision IV (SNAP-IV) and the Autism Spectrum Screening Questionnaire (ASSQ) and compared the scores to a reference group which comprised children from the population-based Bergen Child Study (n = 171). Prenatally exposed children had significantly higher SNAP-IV scores associated with ADHD symptoms in both areas of inattention and hyperactivity/impulsivity and also reported a higher ASSQ score related to an increased number of symptoms associated with ASD, compared with the reference group. Of tested predictors of mental health outcomes in the exposed group, the intelligence quotient was a strong predictor of most mental health outcomes, and neonatal abstinence syndrome was a predictor of inattention. In conclusion, prenatally exposed children had more mental health symptoms associated with ADHD and ASD, compared with the reference group. PMID:29618930

  8. Once-daily, high-dose levofloxacin versus ticarcillin-clavulanate alone or followed by amoxicillin-clavulanate for complicated skin and skin-structure infections: a randomized, open-label trial.

    PubMed

    Graham, Donald R; Talan, David A; Nichols, Ronald L; Lucasti, Christopher; Corrado, Michael; Morgan, Nancy; Fowler, Cynthia L

    2002-08-15

    This study tested whether levofloxacin, at a new high dose of 750 mg, was effective for the treatment of complicated skin and skin-structure infections (SSSIs). Patients with complicated SSSIs (n=399) were randomly assigned in a ratio of 1:1 to 2 treatment arms: levofloxacin (750 mg given once per day intravenously [iv], orally, or iv/orally) or ticarcillin-clavulanate (TC; 3.1 g given iv every 4-6 hours) followed, at the investigator's discretion, by amoxicillin-clavulanate (AC; 875 mg given orally every 12 hours). In the clinically evaluable population, therapeutic equivalence was demonstrated between the levofloxacin and TC/AC regimens (success rates of 84.1% and 80.3%, respectively). In the microbiologically evaluable population, the overall rate of eradication was 83.7% in the levofloxacin treatment group and 71.4% in the TC/AC treatment group (95% confidence interval, -24.3 to -0.2). Both levofloxacin and TC/AC were well tolerated. These data demonstrate that levofloxacin (750 mg once per day) is safe and at least as effective as TC/AC for complicated SSSIs.

  9. INTERNAL ROOT MORPHOLOGY IN MANDIBULAR FIRST PERMANENT MOLARS IN A KENYAN POPULATION.

    PubMed

    Muriithi, N J; Maina, S W; Okoth, J; Gathece, L W

    2012-05-01

    To determine the internal root morphology and gender variations in mandibular first permanent molars in a Kenyan population. In vitro descriptive cross sectional study. School of Dental Sciences, University of Nairobi The mesial root of mandibular first molars had two canals in 96.3% of the teeth in both males and females and-type IV canal configuration was most prevalent in the mesial root. The distal root of the mandibular first molar had one canal in 57.7% of the teeth in males and females. There were significant gender variations in the number of canals and canal configurations in the distal root. Two canals were more prevalent in females (53.6%) compared to males (30.4%) and a single canal was more frequent in males (69.6%) compared to females (46.4%) (P=0.001). Canal types 1, 11 and IV were the most frequent in the mandibular distal root. The gender variation in the frequency of canal types I, II and IV in the distal root was statistically significant (P=0.001). Most of the mandibular first molars have three canals (56%). Two canals in the distal root are more frequent among females (53.6%) compared to males (30.4%).

  10. Global Far-ultraviolet Properties of the Cygnus Loop

    NASA Astrophysics Data System (ADS)

    Kim, Il-Joong; Seon, Kwang-Il; Lim, Yeo-Myeong; Lee, Dae-Hee; Han, Wonyong; Min, Kyoung-Wook; Edelstein, Jerry

    2014-03-01

    We present the C III λ977, O VI λλ1032, 1038 and N IV] λ1486 emission line maps of the Cygnus Loop, obtained with the newly processed data of the Spectroscopy of Plasma Evolution from Astrophysical Radiation (SPEAR; also known as FIMS) mission. In addition, the Si IV+O IV] line complexes around 1400 Å are resolved into two separate emission lines whose intensity demonstrates a relatively high Si IV region that was predicted in the previous study. The morphological similarity between the O VI and X-ray images, as well as a comparison of the O VI intensity with the value expected from the X-ray results, indicates that large portions of the observed O VI emissions could be produced from X-ray emitting gas. Comparisons of the far-ultraviolet (FUV) images with the optical and H I 21 cm images reveal spatial variations of shock-velocity populations and high FUV extinction in the direction of a previously identified H I cloud. By calculating the FUV line ratios for several subregions of the Cygnus Loop, we investigate the spatial variation of the population of radiative shock velocities as well as the effects of resonance scattering, X-ray emitting gas, and nonradiative shocks. The FUV and X-ray luminosity comparisons between the Cygnus Loop and the Vela supernova remnant suggest that the fraction of shocks in the early evolutionary stages is much larger in the Cygnus Loop.

  11. Patterns of ancestry and genetic diversity in reintroduced populations of the slimy sculpin: Implications for conservation

    USGS Publications Warehouse

    Huff, David D.; Miller, Loren M.; Vondracek, Bruce C.

    2010-01-01

    Reintroductions are a common approach for preserving intraspecific biodiversity in fragmented landscapes. However, they may exacerbate the reduction in genetic diversity initially caused by population fragmentation because the effective population size of reintroduced populations is often smaller and reintroduced populations also tend to be more geographically isolated than native populations. Mixing genetically divergent sources for reintroduction purposes is a practice intended to increase genetic diversity. We documented the outcome of reintroductions from three mixed sources on the ancestral composition and genetic variation of a North American fish, the slimy sculpin (Cottus cognatus). We used microsatellite markers to evaluate allelic richness and heterozygosity in the reintroduced populations relative to computer simulated expectations. Sculpins in reintroduced populations exhibited higher levels of heterozygosity and allelic richness than any single source, but only slightly higher than the single most genetically diverse source population. Simulations intended to mimic an ideal scenario for maximizing genetic variation in the reintroduced populations also predicted increases, but they were only moderately greater than the most variable source population. We found that a single source contributed more than the other two sources at most reintroduction sites. We urge caution when choosing whether to mix source populations in reintroduction programs. Genetic characteristics of candidate source populations should be evaluated prior to reintroduction if feasible. When combined with knowledge of the degree of genetic distinction among sources, simulations may allow the genetic diversity benefits of mixing populations to be weighed against the risks of outbreeding depression in reintroduced and nearby populations.

  12. Patterns of ancestry and genetic diversity in reintroduced populations of the slimy sculpin: Implications for conservation

    USGS Publications Warehouse

    Huff, D.D.; Miller, L.M.; Vondracek, B.

    2010-01-01

    Reintroductions are a common approach for preserving intraspecific biodiversity in fragmented landscapes. However, they may exacerbate the reduction in genetic diversity initially caused by population fragmentation because the effective population size of reintroduced populations is often smaller and reintroduced populations also tend to be more geographically isolated than native populations. Mixing genetically divergent sources for reintroduction purposes is a practice intended to increase genetic diversity. We documented the outcome of reintroductions from three mixed sources on the ancestral composition and genetic variation of a North American fish, the slimy sculpin (Cottus cognatus). We used microsatellite markers to evaluate allelic richness and heterozygosity in the reintroduced populations relative to computer simulated expectations. Sculpins in reintroduced populations exhibited higher levels of heterozygosity and allelic richness than any single source, but only slightly higher than the single most genetically diverse source population. Simulations intended to mimic an ideal scenario for maximizing genetic variation in the reintroduced populations also predicted increases, but they were only moderately greater than the most variable source population. We found that a single source contributed more than the other two sources at most reintroduction sites. We urge caution when choosing whether to mix source populations in reintroduction programs. Genetic characteristics of candidate source populations should be evaluated prior to reintroduction if feasible. When combined with knowledge of the degree of genetic distinction among sources, simulations may allow the genetic diversity benefits of mixing populations to be weighed against the risks of outbreeding depression in reintroduced and nearby populations. ?? 2010 US Government.

  13. Comparisons of modern United States and Canadian malting barley cultivars with those from pre-Prohibition: IV. Malting quality assessments using standard and nonstandard measures

    USDA-ARS?s Scientific Manuscript database

    This study was conducted to identify which traits or combination of traits associated with malting quality and mashing performance could best define the differences between and within a population of pre-Prohibition malting barley varieties and a population of modern elite malting barley cultivars. ...

  14. Lease vs. Purchase Analysis of Alternative Fuel Vehicles in the United States Marine Corps

    DTIC Science & Technology

    2009-12-01

    data (2004 to 2009) for the largest populations of AFVs in the light-duty category and then apply a model that will compare the two alternatives based...the largest populations of AFVs in the light-duty category and then apply a model that will compare the two alternatives based on their relative net...28 IV. THE MODEL

  15. 45 CFR Appendix C to Part 1356 - Calculating Sample Size for NYTD Follow-Up Populations

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 45 Public Welfare 4 2013-10-01 2013-10-01 false Calculating Sample Size for NYTD Follow-Up Populations C Appendix C to Part 1356 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE... REQUIREMENTS APPLICABLE TO TITLE IV-E Pt. 1356, App. C Appendix C to Part 1356—Calculating Sample Size for NYTD...

  16. Factors influencing response to intravenous lacosamide in emergency situations: LACO-IV study.

    PubMed

    Garcés, Mercedes; Villanueva, Vicente; Mauri, José Angel; Suller, Ana; García, Carolina; López González, Franscisco Javier; Rodríguez Osorio, Xiana; Fernández Pajarín, Gustavo; Piera, Anna; Guillamón, Edelmira; Santafé, Consuelo; Castillo, Ascensión; Giner, Pau; Torres, Nerea; Escalza, Inés; Del Villar, Ana; García de Casasola, Maria Carmen; Bonet, Macarena; Noé, Enrique; Olmedilla, Nuria

    2014-07-01

    Status epilepticus (SE) and acute repetitive seizures (ARSs) frequently result in emergency visits. Wide variations in response are seen with standard antiepileptic drugs (AEDs). Oral and intravenous (IV) formulations of lacosamide are approved as adjunctive therapy in the treatment of partial-onset seizures in adults and adolescents. The aim of the retrospective multicenter observational study (LACO-IV) was to analyze data from a large cohort of patients with SE or ARSs of varying severity and etiology, who received IV lacosamide in the emergency setting. Patient clinical data were entered into a database; lacosamide use and efficacy and tolerability variables were analyzed. In SE, IV lacosamide tended to be used mainly in nonconvulsive status epilepticus as second- or third-line treatment. The proportion of patients with no seizures when IV lacosamide was the last drug administered was 76.5% (70.9% SE and 83.7% ARSs). The rate of seizure cessation ≤ 24 h after IV lacosamide administration was 57.1% (49.1% SE and 67.4% ARSs). Of the factors analyzed, a shorter latency from seizure onset to IV lacosamide infusion influenced treatment response significantly. A nonsignificant tendency towards a higher response was seen with lacosamide dose >200mg versus ≤ 200 mg. Analysis of response according to mechanism of action showed no significant differences in response to IV lacosamide in patients receiving prior sodium channel blocker (SCB) or non-SCB AEDs in the overall or SE population; however, in ARSs, a tendency towards a higher response was observed in those receiving non-SCB AEDs. The frequency and nature of adverse events observed were in line with those reported in other studies (somnolence being the most frequent). In the absence of randomized prospective controlled studies of IV lacosamide, our observations suggest that IV lacosamide may be a potential alternative for treatment of SE/ARSs when seizures fail to improve with standard AEDs or when AEDs are contraindicated or not recommended. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Evidence for a Hard Ionizing Spectrum from a z = 6.11 Stellar Population

    NASA Astrophysics Data System (ADS)

    Mainali, Ramesh; Kollmeier, Juna A.; Stark, Daniel P.; Simcoe, Robert A.; Walth, Gregory; Newman, Andrew B.; Miller, Daniel R.

    2017-02-01

    We present the Magellan/FIRE detection of highly ionized C IV λ1550 and O III]λ1666 in a deep infrared spectrum of the z = 6.11 gravitationally lensed low-mass galaxy RXC J2248.7-4431-ID3, which has previously known Lyα. No corresponding emission is detected at the expected location of He II λ1640. The upper limit on He II, paired with detection of O III] and C IV, constrains possible ionization scenarios. Production of C IV and O III] requires ionizing photons of 2.5-3.5 Ryd, but once in that state their multiplet emission is powered by collisional excitation at lower energies (˜0.5 Ryd). As a pure recombination line, He II emission is powered by 4 Ryd ionizing photons. The data therefore require a spectrum with significant power at 3.5 Ryd but a rapid drop toward 4.0 Ryd. This hard spectrum with a steep drop is characteristic of low-metallicity stellar populations, and less consistent with soft AGN excitation, which features more 4 Ryd photons and hence higher He II flux. The conclusions based on ratios of metal line detections to helium non-detection are strengthened if the gas metallicity is low. RXJ2248-ID3 adds to the growing handful of reionization-era galaxies with UV emission line ratios distinct from the general z=2{--}3 population in a way that suggests hard ionizing spectra that do not necessarily originate in AGNs.

  18. Deposition of sedimentary organic matter in black shale facies indicated by the geochemistry and petrography of high-resolution samples, blake nose, western North Atlantic

    USGS Publications Warehouse

    Barker, C.E.; Pawlewicz, M.; Cobabe, E.A.

    2001-01-01

    A transect of three holes drilled across the Blake Nose, western North Atlantic Ocean, retrieved cores of black shale facies related to the Albian Oceanic Anoxic Events (OAE) lb and ld. Sedimentary organic matter (SOM) recovered from Ocean Drilling Program Hole 1049A from the eastern end of the transect showed that before black shale facies deposition organic matter preservation was a Type III-IV SOM. Petrography reveals that this SOM is composed mostly of degraded algal debris, amorphous SOM and a minor component of Type III-IV terrestrial SOM, mostly detroinertinite. When black shale facies deposition commenced, the geochemical character of the SOM changed from a relatively oxygen-rich Type III-IV to relatively hydrogen-rich Type II. Petrography, biomarker and organic carbon isotopic data indicate marine and terrestrial SOM sources that do not appear to change during the transition from light-grey calcareous ooze to the black shale facies. Black shale subfacies layers alternate from laminated to homogeneous. Some of the laminated and the poorly laminated to homogeneous layers are organic carbon and hydrogen rich as well, suggesting that at least two SOM depositional processes are influencing the black shale facies. The laminated beds reflect deposition in a low sedimentation rate (6m Ma-1) environment with SOM derived mostly from gravity settling from the overlying water into sometimes dysoxic bottom water. The source of this high hydrogen content SOM is problematic because before black shale deposition, the marine SOM supplied to the site is geochemically a Type III-IV. A clue to the source of the H-rich SOM may be the interlayering of relatively homogeneous ooze layers that have a widely variable SOM content and quality. These relatively thick, sometimes subtly graded, sediment layers are thought to be deposited from a Type II SOM-enriched sediment suspension generated by turbidities or direct turbidite deposition.

  19. Population genetic analysis of Enterocytozoon bieneusi in humans.

    PubMed

    Li, Wei; Cama, Vitaliano; Feng, Yaoyu; Gilman, Robert H; Bern, Caryn; Zhang, Xichen; Xiao, Lihua

    2012-01-01

    Genotyping based on sequence analysis of the ribosomal internal transcribed spacer has revealed significant genetic diversity in Enterocytozoonbieneusi. Thus far, the population genetics of E. bieneusi and its significance in the epidemiology of microsporidiosis have not been examined. In this study, a multilocus sequence typing of E. bieneusi in AIDS patients in Lima, Peru was conducted, using 72 specimens previously genotyped as A, D, IV, EbpC, WL11, Peru7, Peru8, Peru10 and Peru11 at the internal transcribed spacer locus. Altogether, 39 multilocus genotypes were identified among the 72 specimens. The observation of strong intragenic linkage disequilibria and limited genetic recombination among markers were indicative of an overall clonal population structure of E. bieneusi. Measures of pair-wise intergenic linkage disequilibria and a standardised index of association (IAS) based on allelic profile data further supported this conclusion. Both sequence-based and allelic profile-based phylogenetic analyses showed the presence of two genetically isolated groups in the study population, one (group 1) containing isolates of the anthroponotic internal transcribed spacer genotype A, and the other (group 2) containing isolates of multiple internal transcribed spacer genotypes (mainly genotypes D and IV) with zoonotic potential. The measurement of linkage disequilibria and recombination indicated group 2 had a clonal population structure, whereas group 1 had an epidemic population structure. The formation of the two sub-populations was confirmed by STRUCTURE and Wright's fixation index (FST) analyses. The data highlight the power of MLST in understanding the epidemiology of E. bieneusi. Published by Elsevier Ltd.

  20. Residual Gas in Closed Systems. III: Development and Reduction of Gases Generated by Source Materials

    NASA Technical Reports Server (NTRS)

    Palosz, W.

    2003-01-01

    The amounts and composition of residual gases formed in sealed ampoules loaded with different sources (elements and II-VI and IV-VI compounds) after consecutive annealings were investigated. A given source was subjected to a series of heat treatments, with intermediate measurements and removal of the gas accumulated in the system. The results of these experiments are discussed in terms of the underlying thermochemical and kinetic phenomena and practical limitations of reducing the amount of residual gases in sealed ampoules.

  1. Symbiotic flagellate protists as cryptic drivers of adaptation and invasiveness of the subterranean termite Reticulitermes grassei Clément.

    PubMed

    Duarte, Sónia; Nobre, Tânia; Borges, Paulo A V; Nunes, Lina

    2018-06-01

    Changes in flagellate protist communities of subterranean termite Reticulitermes grassei across different locations were evaluated following four predictions: (i) Rural endemic (Portugal mainland) termite populations will exhibit high diversity of symbionts; (ii) invasive urban populations (Horta city, Faial island, Azores), on the contrary, will exhibit lower diversity of symbionts, showing high similarity of symbiont assemblages through environmental filtering; (iii) recent historical colonization of isolated regions-as the case of islands-will imply a loss of symbiont diversity; and (iv) island isolation will trigger a change in colony breeding structure toward a less aggressive behavior. Symbiont flagellate protist communities were morphologically identified, and species richness and relative abundances, as well as biodiversity indices, were used to compare symbiotic communities in colonies from urban and rural environments and between island invasive and mainland endemic populations. To evaluate prediction on the impact of isolation (iv), aggression tests were performed among termites comprising island invasive and mainland endemic populations. A core group of flagellates and secondary facultative symbionts was identified. Termites from rural environments showed, in the majority of observed colonies, more diverse and abundant protist communities, probably confirming prediction (i). Corroborating prediction (ii), the two least diverse communities belong to termites captured inside urban areas. The Azorean invasive termite colonies had more diverse protist communities than expected and prediction (iii) which was not verified within this study. Termites from mainland populations showed a high level of aggressiveness between neighboring colonies, in contrast to the invasive colonies from Horta city, which were not aggressive to neighbors according to prediction (iv). The symbiotic flagellate community of R. grassei showed the ability to change in a way that might be consistent with adaptation to available conditions, possibly contributing to optimization of the colonization of new habitats and spreading of its distribution area, highlighting R. grassei potential as an invasive species.

  2. Intravenous lacosamide in seizure emergencies: Observations from a hospitalized in-patient adult population.

    PubMed

    d'Orsi, Giuseppe; Pascarella, Maria Grazia; Martino, Tommaso; Carapelle, Elena; Pacillo, Francesca; Di Claudio, Maria Teresa; Mancini, Daniela; Trivisano, Marina; Avolio, Carlo; Specchio, Luigi M

    2016-11-01

    to evaluate the efficacy and safety of intravenous (IV) lacosamide (LCM) in the treatment of seizure clusters (SC) and status epilepticus (SE) in hospitalized adult patients. we prospectively analyzed treatment response, seizure outcome, and adverse effects of IV LCM in 38 patients with seizure emergencies (15 with SC, 23 with SE) during a hospital stay. The loading dose of IV LCM was 200-400mg and the maintenance dose was 200-400mg daily. Response to IV LCM was evaluated within 20min, 4h and 24h of LCM infusion. an acute anti-seizure effect after IV LCM was especially evident when it was first used - (SC) or second line (established SE) treatment. In particular, 87% of SC patients (13/15) and 80% of established SE (8/10) demonstrated response to LCM treatment, while no patients with super-refractory SE (0/8) responded to IV LCM according to our criteria. The loading of IV LCM was well tolerated, with mild adverse effects (2/38 temporary dizziness). In most patients, during and after administration of the loading dose of IV LCM a temporary (30min-1h) sedation was observed. No ECG and laboratory values-changes were documented in any of the patients. LCM is an effective and well-tolerated treatment when used to treat SC in hospitalized adult patients. As add-on therapy, it may be useful to stop seizure activity in patients with focal SE not responding to first/second-line intravenous AEDs. Copyright © 2016 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  3. Sex and age differences in attention-deficit/hyperactivity disorder symptoms and diagnoses: implications for DSM-V and ICD-11.

    PubMed

    Ramtekkar, Ujjwal P; Reiersen, Angela M; Todorov, Alexandre A; Todd, Richard D

    2010-03-01

    To examine gender and age differences in attention-deficit/hyperactivity disorder (ADHD) symptom endorsement in a large community-based sample. Families with four or more full siblings ascertained from Missouri birth records completed telephone interviews regarding lifetime DSM-IV ADHD symptoms and the Strengths and Weaknesses of ADHD-Symptoms and Normal-behavior (SWAN) questionnaire for current ADHD symptoms. Complete data were available for 9,380 subjects aged 7 through 29 years. Lifetime and current DSM-IV-like ADHD diagnoses were assigned by the DSM-IV symptom criteria. Linear regression was used to examine sex and age effects on SWAN ADHD symptom scores. Logistic regression was used to examine sex and age effects on specific ADHD diagnoses. Fractional polynomial graphs were used to examine ADHD symptom count variations across age. Overall prevalence of current DSM-IV-like ADHD was 9.2% with a male:female ratio of 2.28:1. The prevalence of DSM-IV-like ADHD was highest in children. Gender differences in DSM-IV-like ADHD subtype prevalences were highest in adolescents. On average, individuals with lifetime DSM-IV-like ADHD diagnoses had elevated current ADHD symptoms even as adolescents or adults. Lower male:female ratios than reported in some clinic-based studies suggest that females are underdiagnosed in the community. Although they may no longer meet the full symptom criteria, young adults with a history of lifetime DSM-IV-like ADHD maintain higher levels of ADHD symptoms compared with the general population. The use of age-specific diagnostic criteria should be considered for DSM-V and ICD-11.

  4. What Is Mitochondrial DNA?

    MedlinePlus

    ... to create adenosine triphosphate (ATP), the cell’s main energy source. A set of enzyme complexes, designated as complexes I-V, carry out oxidative phosphorylation within mitochondria. In addition to energy production, mitochondria play a role in several other ...

  5. Synthesis of refractory materials

    DOEpatents

    Holt, Joseph B.

    1984-01-01

    Refractory metal nitrides are synthesized during a self-propagating combustion process utilizing a solid source of nitrogren. For this purpose, a metal azide is employed, preferably NaN.sub.3. The azide is combusted with Mg or Ca, and a metal oxide is selected from Groups III-A, IV-A, III-B, IV-B, or a rare earth metal oxide. The mixture of azide, Ca or Mg and metal oxide is heated to the mixture's ignition temperature. At that temperature the mixture is ignited and undergoes self-sustaining combustion until the starter materials are exhausted, producing the metal nitride.

  6. Phase II Study of HER-2/neu Intracellular Domain Peptide-Based Vaccine Administered to Stage IV HER2 Positive Breast Cancer Patients Receiving Trastuzumab

    DTIC Science & Technology

    2007-05-01

    the combined approach as well as the immunogenicity of HER2 ICD peptide vaccination. If there is evidence to suggest that the true rate of Grade IV... approach will be evaluated as the ability of the vaccine to elicit HER2 ICD specific T cell immunity, to elicit epitope spreading, and to stimulate...July 2006. Unfortunately, by the time all needed source documents (i.e., imaging, clinical labs, cardiac function tests) were collected, this

  7. Synthesis of refractory materials

    DOEpatents

    Holt, J.B.

    1983-08-16

    Refractory metal nitrides are synthesized during a self-propagating combustion process utilizing a solid source of nitrogen. For this purpose, a metal azide is employed, preferably NaN/sub 3/. The azide is combusted with Mg or Ca, and a metal oxide is selected from Groups III-A, IV-A, III-B, IV-B, or a rare earth metal oxide. The mixture of azide, Ca or Mg and metal oxide is heated to the mixture's ignition temperature. At that temperature the mixture is ignited and undergoes self-sustaining combustion until the starter materials are exhausted, producing the metal nitride.

  8. Comparison of granisetron alone and granisetron plus dexamethasone in the prophylaxis of cytotoxic-induced emesis.

    PubMed Central

    Carmichael, J.; Bessell, E. M.; Harris, A. L.; Hutcheon, A. W.; Dawes, P. J.; Daniels, S.; Bessel, E. M.

    1994-01-01

    Two hundred and seventy-eight adult chemonaive patients, receiving moderately emetogenic chemotherapy were randomly allocated to receive either intravenous (i.v.) granisetron 3 mg plus i.v. dexamethasone 8 mg or i.v. granisetron 3 mg plus i.v. placebo dexamethasone prior to chemotherapy. Eight-two per cent of all patients recruited were female, and 91% of all patients consumed less than 10 units of alcohol per week, suggesting a study population with an increased risk of nausea and vomiting. In the first 24 h 85% of patients who received granisetron plus dexamethasone were complete responders compared with 75.9% of the patients receiving granisetron alone (P = 0.053). There were statistically significant improvements in complete response over 7 days (P = 0.029) and in the numbers of patients receiving rescue antiemetic (P = 0.0004). Toxicity was minimal with no significant differences between treatment groups. These results confirm the antiemetic activity of granisetron and show that it has an additive effect in combination with dexamethasone. PMID:7981069

  9. Four Models Including Fish, Seafood, Red Meat and Enriched Foods to Achieve Australian Dietary Recommendations for n-3 LCPUFA for All Life-Stages

    PubMed Central

    Fayet-Moore, Flavia; Baghurst, Katrine; Meyer, Barbara J.

    2015-01-01

    Populations are not meeting recommended intakes of omega-3 long chain polyunsaturated fatty acids (n-3 LCPUFA). The aim was (i) to develop a database on n-3 LCPUFA enriched products; (ii) to undertake dietary modelling exercise using four dietary approaches to meet the recommendations and (iii) to determine the cost of the models. Six n-3 LCPUFA enriched foods were identified. Fish was categorised by n-3 LCPUFA content (mg/100 g categories as “excellent” “good” and “moderate”). The four models to meet recommended n-3 LCPUFA intakes were (i) fish only; (ii) moderate fish (with red meat and enriched foods); (iii) fish avoiders (red meat and enriched foods only); and (iv) lacto-ovo vegetarian diet (enriched foods only). Diets were modelled using the NUTTAB2010 database and n-3 LCPUFA were calculated and compared to the Suggested Dietary Targets (SDT). The cost of meeting these recommendations was calculated per 100 mg n-3 LCPUFA. The SDT were achieved for all life-stages with all four models. The weekly food intake in number of serves to meet the n-3 LCPUFA SDT for all life-stages for each dietary model were: (i) 2 “excellent” fish; (ii) 1 “excellent” and 1 “good” fish, and depending on life-stage, 3–4 lean red meat, 0–2 eggs and 3–26 enriched foods; (iii) 4 lean red meat, and 20–59 enriched foods; (iv) 37–66 enriched foods. Recommended intakes of n-3 LCPUFA were easily met by the consumption of fish, which was the cheapest source of n-3 LCPUFA. Other strategies may be required to achieve the recommendations including modifying the current food supply through feeding practices, novel plant sources and more enriched foods. PMID:26492269

  10. Mapping of new quantitative trait loci for sudden death syndrome and soybean cyst nematode resistance in two soybean populations.

    PubMed

    Swaminathan, Sivakumar; Abeysekara, Nilwala S; Knight, Joshua M; Liu, Min; Dong, Jia; Hudson, Matthew E; Bhattacharyya, Madan K; Cianzio, Silvia R

    2018-05-01

    Novel QTL conferring resistance to both the SDS and SCN was detected in two RIL populations. Dual resistant RILs could be used in breeding programs for developing resistant soybean cultivars. Soybean cultivars, susceptible to the fungus Fusarium virguliforme, which causes sudden death syndrome (SDS), and to the soybean cyst nematode (SCN) (Heterodera glycines), suffer yield losses valued over a billion dollars annually. Both pathogens may occur in the same production fields. Planting of cultivars genetically resistant to both pathogens is considered one of the most effective means to control the two pathogens. The objective of the study was to map quantitative trait loci (QTL) underlying SDS and SCN resistances. Two recombinant inbred line (RIL) populations were developed by crossing 'A95-684043', a high-yielding maturity group (MG) II line resistant to SCN, with 'LS94-3207' and 'LS98-0582' of MG IV, resistant to both F. virguliforme and SCN. Two hundred F 7 derived recombinant inbred lines from each population AX19286 (A95-684043 × LS94-3207) and AX19287 (A95-684043 × LS98-0582) were screened for resistance to each pathogen under greenhouse conditions. Five hundred and eighty and 371 SNP markers were used for mapping resistance QTL in each population. In AX19286, one novel SCN resistance QTL was mapped to chromosome 8. In AX19287, one novel SDS resistance QTL was mapped to chromosome 17 and one novel SCN resistance QTL was mapped to chromosome 11. Previously identified additional SDS and SCN resistance QTL were also detected in the study. Lines possessing superior resistance to both pathogens were also identified and could be used as germplasm sources for breeding SDS- and SCN-resistant soybean cultivars.

  11. High-energy neutrino fluxes from AGN populations inferred from X-ray surveys

    NASA Astrophysics Data System (ADS)

    Jacobsen, Idunn B.; Wu, Kinwah; On, Alvina Y. L.; Saxton, Curtis J.

    2015-08-01

    High-energy neutrinos and photons are complementary messengers, probing violent astrophysical processes and structural evolution of the Universe. X-ray and neutrino observations jointly constrain conditions in active galactic nuclei (AGN) jets: their baryonic and leptonic contents, and particle production efficiency. Testing two standard neutrino production models for local source Cen A (Koers & Tinyakov and Becker & Biermann), we calculate the high-energy neutrino spectra of single AGN sources and derive the flux of high-energy neutrinos expected for the current epoch. Assuming that accretion determines both X-rays and particle creation, our parametric scaling relations predict neutrino yield in various AGN classes. We derive redshift-dependent number densities of each class, from Chandra and Swift/BAT X-ray luminosity functions (Silverman et al. and Ajello et al.). We integrate the neutrino spectrum expected from the cumulative history of AGN (correcting for cosmological and source effects, e.g. jet orientation and beaming). Both emission scenarios yield neutrino fluxes well above limits set by IceCube (by ˜4-106 × at 1 PeV, depending on the assumed jet models for neutrino production). This implies that: (i) Cen A might not be a typical neutrino source as commonly assumed; (ii) both neutrino production models overestimate the efficiency; (iii) neutrino luminosity scales with accretion power differently among AGN classes and hence does not follow X-ray luminosity universally; (iv) some AGN are neutrino-quiet (e.g. below a power threshold for neutrino production); (v) neutrino and X-ray emission have different duty cycles (e.g. jets alternate between baryonic and leptonic flows); or (vi) some combination of the above.

  12. Nutritional Supplement Habits of Athletes With an Impairment and Their Sources of Information.

    PubMed

    Graham-Paulson, Terri Susan; Perret, Claudio; Smith, Brett; Crosland, Jeanette; Goosey-Tolfrey, Victoria Louise

    2015-08-01

    The consumption of nutritional supplements (NS) is common among able-bodied (AB) athletes yet little is known about NS use by athletes with an impairment. This study examined the: (i) prevalence of NS use by athletes with an impairment; (ii) reasons for use/ nonuse; (iii) sources of information regarding NS; and (iv) whether age, gender, impairment, performance level and sport category influence NS use. The questionnaire was completed by 399 elite (n = 255) and nonelite (n = 144) athletes (296 M, 103 F) online or at a sporting event/training camp. Data were evaluated using chi-square analyses. Fifty-eight percent (n = 232) of athletes used NS in the previous 6-month period and 41% (n = 102) of these followed the instructions on the label to determine dose. Adherence to these AB recommendations may partly explain why 9% (n = 37) experienced negative effects from NS use. As expected, the most popular NS were: protein, sports drinks, multivitamins and carbohydrate supplements, which were obtained from health food/sport shops, internet and supermarkets (top 3) where evidence-based, impairment-specific advice is limited. The nutritionist/dietitian was the most used and trusted source of information, which is a promising finding. The most prevalent reasons for use were to support exercise recovery, support the immune system and provide energy. Elite athletes were more likely to use NS, which may reflect greater training hours and/or access to nutritionists. Fifty-two percent of athletes (n = 209) requested more information/ education regarding NS. NS use is prevalent in this population. Education on dosage and appropriate sources of information is required.

  13. Nonquadratic Variation of the Blum Blum Shub Pseudorandom Number Generator

    DTIC Science & Technology

    2016-09-01

    maximum 200 words) Cryptography is essential for secure online communications. Many different types of ciphers are implemented in modern-day... cryptography , but they all have one common factor. All ciphers require a source of randomness, which makes them unpre- dictable. One such source of this...Martinsen Second Reader Craig Rasmussen Chair, Department of Applied Mathematics iii THIS PAGE INTENTIONALLY LEFT BLANK iv ABSTRACT Cryptography is

  14. 40 CFR 52.129 - Review of new sources and modifications.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... g/100 stdm3); has a heat input of not more than 1 MBtu/h (250 Mg-cal/h) and burns only distillate oil; or has a heat input of not more than 350,000 Btu/h (88.2 Mg-cal/h) and burns any other fuel. (iv... the source to be provided with: (i) Sampling ports of a size, number, and location as the...

  15. 40 CFR 52.129 - Review of new sources and modifications.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... g/100 stdm3); has a heat input of not more than 1 MBtu/h (250 Mg-cal/h) and burns only distillate oil; or has a heat input of not more than 350,000 Btu/h (88.2 Mg-cal/h) and burns any other fuel. (iv... the source to be provided with: (i) Sampling ports of a size, number, and location as the...

  16. 40 CFR Table 3 to Subpart Jjj of... - Group 1 Storage Vessels at Existing Affected Sources Producing the Listed Thermoplastics

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 11 2011-07-01 2011-07-01 false Group 1 Storage Vessels at Existing... Pollutant Emissions: Group IV Polymers and Resins Pt. 63, Subpt. JJJ, Table 3 Table 3 to Subpart JJJ of Part 63—Group 1 Storage Vessels at Existing Affected Sources Producing the Listed Thermoplastics...

  17. 40 CFR Table 3 to Subpart Jjj of... - Group 1 Storage Vessels at Existing Affected Sources Producing the Listed Thermoplastics

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 12 2012-07-01 2011-07-01 true Group 1 Storage Vessels at Existing... Pollutant Emissions: Group IV Polymers and Resins Pt. 63, Subpt. JJJ, Table 3 Table 3 to Subpart JJJ of Part 63—Group 1 Storage Vessels at Existing Affected Sources Producing the Listed Thermoplastics...

  18. 40 CFR Table 3 to Subpart Jjj of... - Group 1 Storage Vessels at Existing Affected Sources Producing the Listed Thermoplastics

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 12 2014-07-01 2014-07-01 false Group 1 Storage Vessels at Existing... Hazardous Air Pollutant Emissions: Group IV Polymers and Resins Pt. 63, Subpt. JJJ, Table 3 Table 3 to Subpart JJJ of Part 63—Group 1 Storage Vessels at Existing Affected Sources Producing the Listed...

  19. 40 CFR Table 3 to Subpart Jjj of... - Group 1 Storage Vessels at Existing Affected Sources Producing the Listed Thermoplastics

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 11 2010-07-01 2010-07-01 true Group 1 Storage Vessels at Existing... Pollutant Emissions: Group IV Polymers and Resins Pt. 63, Subpt. JJJ, Table 3 Table 3 to Subpart JJJ of Part 63—Group 1 Storage Vessels at Existing Affected Sources Producing the Listed Thermoplastics...

  20. 40 CFR Table 3 to Subpart Jjj of... - Group 1 Storage Vessels at Existing Affected Sources Producing the Listed Thermoplastics

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 12 2013-07-01 2013-07-01 false Group 1 Storage Vessels at Existing... Hazardous Air Pollutant Emissions: Group IV Polymers and Resins Pt. 63, Subpt. JJJ, Table 3 Table 3 to Subpart JJJ of Part 63—Group 1 Storage Vessels at Existing Affected Sources Producing the Listed...

  1. Design and characterization of GaN p-i-n diodes for betavoltaic devices

    NASA Astrophysics Data System (ADS)

    Khan, Muhammad R.; Smith, Joshua R.; Tompkins, Randy P.; Kelley, Stephen; Litz, Marc; Russo, John; Leathersich, Jeff; Shahedipour-Sandvik, Fatemeh (Shadi); Jones, Kenneth A.; Iliadis, Agis

    2017-10-01

    The performance of gallium nitride (GaN) p-i-n diodes were investigated for use as a betavoltaic device. Dark IV measurements showed a turn on-voltage of approximately 3.2 V, specific-on-resistance of 15.1 mΩ cm2 and a reverse leakage current of -0.14 mA/cm2 at -10 V. A clear photo-response was observed when IV curves were measured under a light source at a wavelength of 310 nm (4.0 eV). In addition, GaN p-i-n diodes were tested under an electron-beam in order to simulate common beta radiation sources ranging from that of 3H (5.6 keV average) to 63Ni (17 keV average). From this data, we estimated output powers of 53 nW and 750 nW with overall efficiencies of 0.96% and 4.4% for our device at incident electron energies of 5.6 keV and 17 keV corresponding to 3H and 63Ni beta sources respectively.

  2. Asynchronous brain-computer interface for cognitive assessment in people with cerebral palsy

    NASA Astrophysics Data System (ADS)

    Alcaide-Aguirre, R. E.; Warschausky, S. A.; Brown, D.; Aref, A.; Huggins, J. E.

    2017-12-01

    Objective. Typically, clinical measures of cognition require motor or speech responses. Thus, a significant percentage of people with disabilities are not able to complete standardized assessments. This situation could be resolved by employing a more accessible test administration method, such as a brain-computer interface (BCI). A BCI can circumvent motor and speech requirements by translating brain activity to identify a subject’s response. By eliminating the need for motor or speech input, one could use a BCI to assess an individual who previously did not have access to clinical tests. Approach. We developed an asynchronous, event-related potential BCI-facilitated administration procedure for the peabody picture vocabulary test (PPVT-IV). We then tested our system in typically developing individuals (N  =  11), as well as people with cerebral palsy (N  =  19) to compare results to the standardized PPVT-IV format and administration. Main results. Standard scores on the BCI-facilitated PPVT-IV, and the standard PPVT-IV were highly correlated (r  =  0.95, p  <  0.001), with a mean difference of 2.0  ±  6.4 points, which is within the standard error of the PPVT-IV. Significance. Thus, our BCI-facilitated PPVT-IV provided comparable results to the standard PPVT-IV, suggesting that populations for whom standardized cognitive tests are not accessible could benefit from our BCI-facilitated approach.

  3. Noninvasive and invasive ventilation and enteral nutrition for ALS in Italy.

    PubMed

    Fini, Nicola; Georgoulopoulou, Eleni; Vinceti, Marco; Monelli, Marco; Pinelli, Giovanni; Vacondio, Paolo; Giovannini, Michele; Dallari, Rossano; Marudi, Andrea; Mandrioli, Jessica

    2014-10-01

    We performed a population-based study to assess amyotrophic lateral sclerosis (ALS) survival after noninvasive ventilation (NIV), invasive ventilation (IV), and enteral nutrition (EN). We included patients diagnosed from 2000 to 2009 in Modena, where a prospective registry and a Motor Neuron Diseases Centre have been active since 2000. Of the 193 incident cases, 47.7% received NIV, 24.3% received tracheostomy, and 49.2% received EN. A total of 10.4% of the patients refused NIV, 31.6% refused IV, and 8.7% refused EN. The median survival times after NIV, IV, and EN were 15, 19, and 9 months, respectively. Of the tracheostomized patients, 79.7% were discharged from the hospital; 73.0% were discharged to home. The median survival times for tracheostomized patients who were cared for at home and in nursing homes were 43 and 2 months, respectively. The multivariate analysis demonstrated that the place of discharge was the only independent prognostic factor after IV (P<0.01). Service organizations may promote adherence to NIV, IV, EN, and influence postprocedure survival. These data may be useful in defining health plans regarding advanced ALS care and in patient counseling. © 2014 Wiley Periodicals, Inc.

  4. Expanding the Therapeutic Potential of the Iron Chelator Deferasirox in the Development of Aqueous Stable Ti(IV) Anticancer Complexes.

    PubMed

    Loza-Rosas, Sergio A; Vázquez-Salgado, Alexandra M; Rivero, Kennett I; Negrón, Lenny J; Delgado, Yamixa; Benjamín-Rivera, Josué A; Vázquez-Maldonado, Angel L; Parks, Timothy B; Munet-Colón, Charlene; Tinoco, Arthur D

    2017-07-17

    The recent X-ray structure of titanium(IV)-bound human serum transferrin (STf) exhibiting citrate as a synergistic anion reveals a difference in Ti(IV) coordination versus iron(III), the metal endogenously delivered by the protein to cells. This finding enriches our bioinspired drug design strategy for Ti(IV)-based anticancer therapeutics, which applies a family of Fe(III) chelators termed chemical transferrin mimetic (cTfm) ligands to inhibit Fe bioavailability in cancer cells. Deferasirox, a drug used for iron overload disease, is a cTfm ligand that models STf coordination to Fe(III), favoring Fe(III) binding versus Ti(IV). This metal affinity preference drives deferasirox to facilitate the release of cytotoxic Ti(IV) intracellularly in exchange for Fe(III). An aqueous speciation study performed by potentiometric titration from pH 4 to 8 with micromolar levels of Ti(IV) deferasirox at a 1:2 ratio reveals exclusively Ti(deferasirox) 2 in solution. The predominant complex at pH 7.4, [Ti(deferasirox) 2 ] 2- , exhibits the one of the highest aqueous stabilities observed for a potent cytotoxic Ti(IV) species, demonstrating little dissociation even after 1 month in cell culture media. UV-vis and 1 H NMR studies show that the stability is unaffected by the presence of biomolecular Ti(IV) binders such as citrate, STf, and albumin, which have been shown to induce dissociation or regulate cellular uptake and can alter the activity of other antiproliferative Ti(IV) complexes. Kinetic studies on [Ti(deferasirox) 2 ] 2- transmetalation with Fe(III) show that a labile Fe(III) source is required to induce this process. The initial step of this process occurs on the time scale of minutes, and equilibrium for the complete transmetalation is reached on a time scale of hours to a day. This work reveals a mechanism to deliver Ti(IV) compounds into cells and trigger Ti(IV) release by a labile Fe(III) species. Cellular studies including other cTfm ligands confirm the Fe(III) depletion mechanism of these compounds and show their ability to induce early and late apoptosis.

  5. 45 CFR 309.10 - Who is eligible to apply for and receive Federal funding to operate a Tribal IV-D program?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... Tribal law or code, in the population subject to the jurisdiction of the Tribal court or administrative... defined by Tribal laws or codes, in the population of the Tribes subject to the jurisdiction of the Tribal... and provide justification for operating a program with less than the minimum number of children may be...

  6. 45 CFR 309.10 - Who is eligible to apply for and receive Federal funding to operate a Tribal IV-D program?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... Tribal law or code, in the population subject to the jurisdiction of the Tribal court or administrative... defined by Tribal laws or codes, in the population of the Tribes subject to the jurisdiction of the Tribal... and provide justification for operating a program with less than the minimum number of children may be...

  7. 45 CFR 309.10 - Who is eligible to apply for and receive Federal funding to operate a Tribal IV-D program?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... Tribal law or code, in the population subject to the jurisdiction of the Tribal court or administrative... defined by Tribal laws or codes, in the population of the Tribes subject to the jurisdiction of the Tribal... and provide justification for operating a program with less than the minimum number of children may be...

  8. 45 CFR 309.10 - Who is eligible to apply for and receive Federal funding to operate a Tribal IV-D program?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... Tribal law or code, in the population subject to the jurisdiction of the Tribal court or administrative... defined by Tribal laws or codes, in the population of the Tribes subject to the jurisdiction of the Tribal... and provide justification for operating a program with less than the minimum number of children may be...

  9. 45 CFR 309.10 - Who is eligible to apply for and receive Federal funding to operate a Tribal IV-D program?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... Tribal law or code, in the population subject to the jurisdiction of the Tribal court or administrative... defined by Tribal laws or codes, in the population of the Tribes subject to the jurisdiction of the Tribal... and provide justification for operating a program with less than the minimum number of children may be...

  10. Identifying the bacterial community on the surface of Intralox belting in a meat boning room by culture-dependent and culture-independent 16S rDNA sequence analysis.

    PubMed

    Brightwell, Gale; Boerema, Jackie; Mills, John; Mowat, Eilidh; Pulford, David

    2006-05-25

    We examined the bacterial community present on an Intralox conveyor belt system in an operating lamb boning room by sequencing the 16S ribosomal DNA (rDNA) of bacteria extracted in the presence or absence of cultivation. RFLP patterns for 16S rDNA clone library and cultures were generated using HaeIII and MspI restriction endonucleases. 16S rDNA amplicons produced 8 distinct RFLP pattern groups. RFLP groups I-IV were represented in the clone library and RFLP groups I and V-VIII were represented amongst the cultured isolates. Partial DNA sequences from each RFLP group revealed that all group I, II and VIII representatives were Pseudomonas spp., group III were Sphingomonas spp., group IV clones were most similar to an uncultured alpha proteobacterium, group V was similar to a Serratia spp., group VI with an Alcaligenes spp., and group VII with Microbacterium spp. Sphingomonads were numerically dominant in the culture-independent clone library and along with the group IV alpha proteobacterium were not represented amongst the cultured isolates. Serratia, Alcaligenes and Microbacterium spp. were only represented with cultured isolates. Pseudomonads were detected by both culture-dependent (84% of isolates) and culture-independent (12.5% of clones) methods and their presence at high frequency does pose the risk of product spoilage if transferred onto meat stored under aerobic conditions. The detection of sphingomonads in large numbers by the culture-independent method demands further analysis because sphingomonads may represent a new source of meat spoilage that has not been previously recognised in the meat processing environment. The 16S rDNA collections generated by both methods were important at representing the diversity of the bacterial population associated with an Intralox conveyor belt system.

  11. High Trypanosoma cruzi infection prevalence associated with minimal cardiac pathology among wild carnivores in central Texas.

    PubMed

    Curtis-Robles, Rachel; Lewis, Barbara C; Hamer, Sarah A

    2016-08-01

    Infection with the zoonotic vector-borne protozoal parasite Trypanosoma cruzi causes Chagas disease in humans and dogs throughout the Americas. Despite the recognized importance of various wildlife species for perpetuating Trypanosoma cruzi in nature, relatively little is known about the development of cardiac disease in infected wildlife. Using a cross-sectional study design, we collected cardiac tissue and blood from hunter-donated wildlife carcasses- including raccoon (Procyon lotor), coyote (Canis latrans), gray fox (Urocyon cinereoargenteus), and bobcat (Lynx rufus) - from central Texas, a region with established populations of infected triatomine vectors and increasing diagnoses of Chagas disease in domestic dogs. Based on PCR analysis, we found that 2 bobcats (14.3%), 12 coyotes (14.3%), 8 foxes (13.8%), and 49 raccoons (70.0%) were positive for T. cruzi in at least one sample (right ventricle, apex, and/or blood clot). Although a histologic survey of right ventricles showed that 21.1% of 19 PCR-positive hearts were characterized by mild lymphoplasmocytic infiltration, no other lesions and no amastigotes were observed in any histologic section. DNA sequencing of the TcSC5D gene revealed that raccoons were infected with T. cruzi strain TcIV, and a single racoon harbored a TcI/TcIV mixed infection. Relative to other wildlife species tested here, our data suggest that raccoons may be important reservoirs of TcIV in Texas and a source of infection for indigenous triatomine bugs. The overall high level of infection in this wildlife community likely reflects high levels of vector contact, including ingestion of bugs. Although the relationship between the sylvatic cycle of T. cruzi transmission and human disease risk in the United States has yet to be defined, our data suggest that hunters and wildlife professionals should take precautions to avoid direct contact with potentially infected wildlife tissues.

  12. Ultraviolet emission lines in young low-mass galaxies at z ≃ 2: physical properties and implications for studies at z > 7

    NASA Astrophysics Data System (ADS)

    Stark, Daniel P.; Richard, Johan; Siana, Brian; Charlot, Stéphane; Freeman, William R.; Gutkin, Julia; Wofford, Aida; Robertson, Brant; Amanullah, Rahman; Watson, Darach; Milvang-Jensen, Bo

    2014-12-01

    We present deep spectroscopy of 17 very low mass (M⋆ ≃ 2.0 × 106-1.4 × 109 M⊙) and low luminosity (MUV ≃ -13.7 to -19.9) gravitationally lensed galaxies in the redshift range z ≃ 1.5-3.0. Deep rest-frame ultraviolet spectra reveal large equivalent width emission from numerous emission lines (N IV], O III], C IV, Si III], C III]) which are rarely seen in individual spectra of more massive star-forming galaxies. C III] is detected in 16 of 17 low-mass star-forming systems with rest-frame equivalent widths as large as 13.5 Å. Nebular C IV emission is present in the most extreme C III] emitters, requiring an ionizing source capable of producing a substantial component of photons with energies in excess of 47.9 eV. Photoionization models support a picture whereby the large equivalent widths are driven by the increased electron temperature and enhanced ionizing output arising from metal-poor gas and stars (0.04-0.13 Z⊙), young stellar populations (6-50 Myr), and large ionization parameters (log U = -2.16 to -1.84). The young ages implied by the emission lines and continuum spectral energy distributions (SEDs) indicate that the extreme line emitters in our sample are in the midst of a significant upturn in their star formation activity. The low stellar masses, blue UV colours, and large specific star formation rates of our sample are similar to those of typical z ≳ 6 galaxies. Given the strong attenuation of Lyα in z ≳ 6 galaxies, we suggest that C III] is likely to provide our best probe of early star-forming galaxies with ground-based spectrographs and one off the most efficient means of confirming z ≳ 10 galaxies with the James Webb Space Telescope.

  13. Accommodating environmental variation in population models: metaphysiological biomass loss accounting.

    PubMed

    Owen-Smith, Norman

    2011-07-01

    1. There is a pressing need for population models that can reliably predict responses to changing environmental conditions and diagnose the causes of variation in abundance in space as well as through time. In this 'how to' article, it is outlined how standard population models can be modified to accommodate environmental variation in a heuristically conducive way. This approach is based on metaphysiological modelling concepts linking populations within food web contexts and underlying behaviour governing resource selection. Using population biomass as the currency, population changes can be considered at fine temporal scales taking into account seasonal variation. Density feedbacks are generated through the seasonal depression of resources even in the absence of interference competition. 2. Examples described include (i) metaphysiological modifications of Lotka-Volterra equations for coupled consumer-resource dynamics, accommodating seasonal variation in resource quality as well as availability, resource-dependent mortality and additive predation, (ii) spatial variation in habitat suitability evident from the population abundance attained, taking into account resource heterogeneity and consumer choice using empirical data, (iii) accommodating population structure through the variable sensitivity of life-history stages to resource deficiencies, affecting susceptibility to oscillatory dynamics and (iv) expansion of density-dependent equations to accommodate various biomass losses reducing population growth rate below its potential, including reductions in reproductive outputs. Supporting computational code and parameter values are provided. 3. The essential features of metaphysiological population models include (i) the biomass currency enabling within-year dynamics to be represented appropriately, (ii) distinguishing various processes reducing population growth below its potential, (iii) structural consistency in the representation of interacting populations and (iv) capacity to accommodate environmental variation in space as well as through time. Biomass dynamics provide a common currency linking behavioural, population and food web ecology. 4. Metaphysiological biomass loss accounting provides a conceptual framework more conducive for projecting and interpreting the population consequences of climatic shifts and human transformations of habitats than standard modelling approaches. © 2011 The Author. Journal of Animal Ecology © 2011 British Ecological Society.

  14. A genome-wide association meta-analysis on apolipoprotein A-IV concentrations

    PubMed Central

    Lamina, Claudia; Friedel, Salome; Coassin, Stefan; Rueedi, Rico; Yousri, Noha A.; Seppälä, Ilkka; Gieger, Christian; Schönherr, Sebastian; Forer, Lukas; Erhart, Gertraud; Kollerits, Barbara; Marques-Vidal, Pedro; Ried, Janina; Waeber, Gerard; Bergmann, Sven; Dähnhardt, Doreen; Stöckl, Andrea; Kiechl, Stefan; Raitakari, Olli T.; Kähönen, Mika; Willeit, Johann; Kedenko, Ludmilla; Paulweber, Bernhard; Peters, Annette; Meitinger, Thomas; Strauch, Konstantin; Study Group, KORA; Lehtimäki, Terho; Hunt, Steven C.; Vollenweider, Peter; Kronenberg, Florian

    2016-01-01

    Apolipoprotein A-IV (apoA-IV) is a major component of HDL and chylomicron particles and is involved in reverse cholesterol transport. It is an early marker of impaired renal function. We aimed to identify genetic loci associated with apoA-IV concentrations and to investigate relationships with known susceptibility loci for kidney function and lipids. A genome-wide association meta-analysis on apoA-IV concentrations was conducted in five population-based cohorts (n = 13,813) followed by two additional replication studies (n = 2,267) including approximately 10 M SNPs. Three independent SNPs from two genomic regions were significantly associated with apoA-IV concentrations: rs1729407 near APOA4 (P = 6.77 × 10 − 44), rs5104 in APOA4 (P = 1.79 × 10−24) and rs4241819 in KLKB1 (P = 5.6 × 10−14). Additionally, a look-up of the replicated SNPs in downloadable GWAS meta-analysis results was performed on kidney function (defined by eGFR), HDL-cholesterol and triglycerides. From these three SNPs mentioned above, only rs1729407 showed an association with HDL-cholesterol (P = 7.1 × 10 − 07). Moreover, weighted SNP-scores were built involving known susceptibility loci for the aforementioned traits (53, 70 and 38 SNPs, respectively) and were associated with apoA-IV concentrations. This analysis revealed a significant and an inverse association for kidney function with apoA-IV concentrations (P = 5.5 × 10−05). Furthermore, an increase of triglyceride-increasing alleles was found to decrease apoA-IV concentrations (P = 0.0078). In summary, we identified two independent SNPs located in or next the APOA4 gene and one SNP in KLKB1. The association of KLKB1 with apoA-IV suggests an involvement of apoA-IV in renal metabolism and/or an interaction within HDL particles. Analyses of SNP-scores indicate potential causal effects of kidney function and by lesser extent triglycerides on apoA-IV concentrations. PMID:27412012

  15. THE BROWN DWARF KINEMATICS PROJECT (BDKP). IV. RADIAL VELOCITIES OF 85 LATE-M AND L DWARFS WITH MagE

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Burgasser, Adam J.; Logsdon, Sarah E.; Gagné, Jonathan

    2015-09-15

    Radial velocity measurements are presented for 85 late M- and L-type very low-mass stars and brown dwarfs obtained with the Magellan Echellette spectrograph. Targets primarily have distances within 20 pc of the Sun, with more distant sources selected for their unusual spectral energy distributions. We achieved precisions of 2–3 km s{sup −1}, and combined these with astrometric and spectrophotometric data to calculate UVW velocities. Most are members of the thin disk of the Galaxy, and velocity dispersions indicate a mean age of 5.2 ± 0.2 Gyr for sources within 20 pc. We find signficantly different kinematic ages between late-M dwarfsmore » (4.0 ± 0.2 Gyr) and L dwarfs (6.5 ± 0.4 Gyr) in our sample that are contrary to predictions from prior simulations. This difference appears to be driven by a dispersed population of unusually blue L dwarfs which may be more prevalent in our local volume-limited sample than in deeper magnitude-limited surveys. The L dwarfs exhibit an asymmetric U velocity distribution with a net inward flow, similar to gradients recently detected in local stellar samples. Simulations incorporating brown dwarf evolution and Galactic orbital dynamics are unable to reproduce the velocity asymmetry, suggesting non-axisymmetric perturbations or two distinct L dwarf populations. We also find the L dwarfs to have a kinematic age-activity correlation similar to more massive stars. We identify several sources with low surface gravities, and two new substellar candidate members of nearby young moving groups: the astrometric binary DENIS J08230313–4912012AB, a low-probability member of the β Pictoris Moving Group; and 2MASS J15104786–2818174, a moderate-probability member of the 30–50 Myr Argus Association.« less

  16. DSM-IV "criterion A" schizophrenia symptoms across ethnically different populations: evidence for differing psychotic symptom content or structural organization?

    PubMed

    McLean, Duncan; Thara, Rangaswamy; John, Sujit; Barrett, Robert; Loa, Peter; McGrath, John; Mowry, Bryan

    2014-09-01

    There is significant variation in the expression of schizophrenia across ethnically different populations, and the optimal structural and diagnostic representation of schizophrenia are contested. We contrasted both lifetime frequencies of DSM-IV criterion A (the core symptom criterion of the internationally recognized DSM classification system) symptoms and types/content of delusions and hallucinations in transethnic schizophrenia populations from Australia (n = 776), India (n = 504) and Sarawak, Malaysia (n = 259), to elucidate clinical heterogeneity. Differences in both criterion A symptom composition and symptom content were apparent. Indian individuals with schizophrenia reported negative symptoms more frequently than other sites, whereas individuals from Sarawak reported disorganized symptoms more frequently. Delusions of control and thought broadcast, insertion, or withdrawal were less frequent in Sarawak than Australia. Curiously, a subgroup of 20 Indian individuals with schizophrenia reported no lifetime delusions or hallucinations. These findings potentially challenge the long-held view in psychiatry that schizophrenia is fundamentally similar across cultural groups, with differences in only the content of psychotic symptoms, but equivalence in structural form.

  17. Integrating technology to improve medication administration.

    PubMed

    Prusch, Amanda E; Suess, Tina M; Paoletti, Richard D; Olin, Stephen T; Watts, Starann D

    2011-05-01

    The development, implementation, and evaluation of an i.v. interoperability program to advance medication safety at the bedside are described. I.V. interoperability integrates intelligent infusion devices (IIDs), the bar-code-assisted medication administration system, and the electronic medication administration record system into a bar-code-driven workflow that populates provider-ordered, pharmacist-validated infusion parameters on IIDs. The purpose of this project was to improve medication safety through the integration of these technologies and decrease the potential for error during i.v. medication administration. Four key phases were essential to developing and implementing i.v. interoperability: (a) preparation, (b) i.v. interoperability pilot, (c) preliminary validation, and (d) expansion. The establishment of pharmacy involvement in i.v. interoperability resulted in two additional safety checks: pharmacist infusion rate oversight and nurse independent validation of the autoprogrammed rate. After instituting i.v. interoperability, monthly compliance to the telemetry drug library increased to a mean ± S.D. of 72.1% ± 2.1% from 56.5% ± 1.5%, and the medical-surgical nursing unit's drug library monthly compliance rate increased to 58.6% ± 2.9% from 34.1% ± 2.6% (p < 0.001 for both comparisons). The number of manual pump edits decreased with both telemetry and medical-surgical drug libraries, demonstrating a reduction from 56.9 ± 12.8 to 14.2 ± 3.9 and from 61.2 ± 15.4 to 14.7 ± 3.8, respectively (p < 0.001 for both comparisons). Through the integration and incorporation of pharmacist oversight for rate changes, the telemetry and medical-surgical patient care areas demonstrated a 32% reduction in reported monthly errors involving i.v. administration of heparin. By integrating two stand-alone technologies, i.v. interoperability was implemented to improve medication administration. Medication errors were reduced, nursing workflow was simplified, and pharmacists became involved in checking infusion rates of i.v. medications.

  18. On the Directivity of Low-Frequency Type IV Radio Bursts

    NASA Technical Reports Server (NTRS)

    Gopalswamy, N.; Akiyama, S.; Makela, P.; Yashiro, S.; Cairns, I. H.

    2016-01-01

    An intense type IV radio burst was observed by the STEREO Behind (STB) spacecraft located about 144 deg. behind Earth. The burst was associated with a large solar eruption that occurred on the backside of the Sun (N05E151) close to the disk center in the STB view. The eruption was also observed by the STEREO Ahead (STA) spacecraft (located at 149 deg. ahead of Earth) as an eruption close to the west limb (N05W60) in that view. The type IV burst was complete in STB observations in that the envelope reached the lowest frequency and then receded to higher frequencies. The burst was partial viewed from STA, revealing only the edge coming down to the lowest frequency. The type IV burst was not observed at all near Earth because the source was 61 deg. behind the east limb. The eruption was associated with a low-frequency type II burst observed in all three views, although it was not very intense. Solar energetic particles were also observed at both STEREOs and at SOHO, suggesting that the shock was much extended, consistent with the very high speed of the CME (2048 km/s). These observations suggest that the type IV emission is directed along a narrow cone above the flare site. We confirm this result statistically using the type IV bursts of solar cycle 23.

  19. Potential Impact of DSM-5 Criteria on Autism Spectrum Disorder Prevalence Estimates

    PubMed Central

    Maenner, Matthew J.; Rice, Catherine E.; Arneson, Carrie L.; Cunniff, Christopher; Schieve, Laura A.; Carpenter, Laura A.; Van Naarden Braun, Kim; Kirby, Russell S.; Bakian, Amanda V.; Durkin, Maureen S.

    2014-01-01

    IMPORTANCE The DSM-5 contains revised diagnostic criteria for autism spectrum disorder (ASD) from the DSM-IV-TR. Potential impacts of the new criteria on ASD prevalence are unclear. OBJECTIVE To assess potential effects of the DSM-5 ASD criteria on ASD prevalence estimation by retrospectively applying the new criteria to population-based surveillance data collected for previous ASD prevalence estimation. DESIGN, SETTING, AND PARTICIPANTS Cross-sectional, population-based ASD surveillance based on clinician review of coded behaviors documented in children’s medical and educational evaluations from 14 geographically defined areas in the United States participating in the Autism and Developmental Disabilities Monitoring (ADDM) Network in 2006 and 2008. This study included 8-year-old children living in ADDM Network study areas in 2006 or 2008, including 644 883 children under surveillance, of whom 6577 met surveillance ASD case status based on the DSM-IV-TR. MAIN OUTCOMES AND MEASURES Proportion of children meeting ADDM Network ASD criteria based on the DSM-IV-TR who also met DSM-5 criteria; overall prevalence of ASD using DSM-5 criteria. RESULTS Among the 6577 children classified by the ADDM Network as having ASD based on the DSM-IV-TR, 5339 (81.2%) met DSM-5 ASD criteria. This percentage was similar for boys and girls but higher for those with than without intellectual disability (86.6% and 72.5%, respectively; P < .001). A total of 304 children met DSM-5 ASD criteria but not current ADDM Network ASD case status. Based on these findings, ASD prevalence per 1000 for 2008 would have been 10.0 (95% CI, 9.6–10.3) using DSM-5 criteria compared with the reported prevalence based on DSM-IV-TR criteria of 11.3 (95% CI, 11.0–11.7). CONCLUSIONS AND RELEVANCE Autism spectrum disorder prevalence estimates will likely be lower under DSM-5 than under DSM-IV-TR diagnostic criteria, although this effect could be tempered by future adaptation of diagnostic practices and documentation of behaviors to fit the new criteria. PMID:24452504

  20. Efficacy of Guanfacine Extended Release in the Treatment of Combined and Inattentive Only Subtypes of Attention-Deficit/Hyperactivity Disorder

    PubMed Central

    Kollins, Scott H.; Wigal, Timothy L.

    2012-01-01

    Abstract Background Extended-release guanfacine (GXR) is approved for the treatment of attention-deficit/hyperactivity disorder (ADHD) in children and adolescents aged 6–17 years. This post-hoc analysis further examines the effects of GXR on hyperactivity-impulsivity and inattentiveness. Method Data from two large double-blind placebo-controlled pivotal trials of GXR in the treatment of ADHD were analyzed. Using the pooled population to provide sufficient sample size and associated statistical power, the impact of GXR treatment on core ADHD symptoms was examined by comparing ADHD Rating Scale IV (ADHD-RS-IV) total scores in the overall GXR and placebo groups in subjects with each of the three ADHD subtypes. ADHD-RS-IV Hyperactivity-Impulsivity and Inattentiveness subscale scores in the overall study population by randomized dose group (vs. placebo) were also examined. Results The full analysis set included 631 subjects aged 6–17 years (GXR: n=490; placebo: n=141). Among subjects with the predominantly inattentive subtype of ADHD, differences in least squares (LS) mean reductions from baseline in ADHD-RS-IV total scores were significantly greater in GXR-treated subjects (n=127) than in placebo-treated subjects (n=38) at treatment weeks 3 through 5 and end point (p≤0.020). Among subjects with combined type ADHD, differences in LS mean ADHD-RS-IV total score reductions from baseline were significantly greater in the GXR group (n=354) than in the placebo group (n=100) at treatment weeks 1 through 5 and end point (p≤0.011). The dearth of predominantly hyperactive-impulsive type subjects (n=12) precluded analysis of this subgroup. Each randomized GXR dose group in each trial demonstrated significantly greater reductions from baseline in ADHD-RS-IV Hyperactivity-Impulsivity and Inattentiveness subscale scores than did the respective placebo group at end point (p≤0.05 for all). Conclusions The results support the use of GXR in the treatment of core ADHD symptoms as defined in the American Psychiatric Association Diagnostic and Statistical Manual of Mental Disorders, 4th ed., Text Revision, including hyperactivity, impulsivity, and inattention. PMID:22612526

  1. Evidence for a founder effect for the IVS4 +4 A{r_arrow}T mutation in the Fanconi anemia gene FACC in a Jewish population

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Verlander, P.C.; Kaporis, A.G.; Qian, L.

    1994-09-01

    Fanconi anemia (FA) is a genetically heterogeneous autosomal recessive disorder defined by hypersensitivity of cells to DNA cross-linking agents; a gene for complementation group C(FACC) has been cloned. Two common mutations, IVS4 +4 A{r_arrow}T and 322delG, and several rare mutations have recently been reported in affected individuals. We now report the development of amplification refractory mutation system (ARMS) assays for rapid, non-radioactive detection of these known mutations in FACC. Primer pairs specific for variant sequences were designed, with the 3{prime} terminal base of one primer matching the variant base. PCR products are separated by electrophoresis on 2.5% agarose gels; mutationsmore » are indicated by the presence of a band of a specific size. These ARMS assays can be multiplexed to allow screening for all known mutations in two PCR reactions. We have used these assays for detection of FACC mutations in affected individuals in the International Fanconi Anemia Registry (IFAR), and for carrier detection FACC families. IVS4 +4 A{r_arrow}T is the only FACC mutation found in Jewish FA patients and their families, of both Ashkenazi and Sephardic ancestry. This mutation was not found in any affected individual of non-Jewish origin. In addition, DNA samples from 1596 healthy Jewish individuals primarily of Ashkenazi ancestry were supplied to us by Dor Yeshorim. These samples, ascertained for carrier screening for Tay Sachs, cystic fibrosis, and other genetic diseases with a high frequency in the religious Jewish community served by this organization, were tested for both IVS4 +4 A{r_arrow}T and 322delG mutations; seventeen IVS4 +4 A{r_arrow}T are of Sephardic Jewish ancestry. We hypothesize that IVS4 +4 A{r_arrow}T is a very old mutation, predating the divergence of the Ashkenazi and Sephardic populations. Haplotype analysis with microsatellite markers is in progress.« less

  2. Low Metallicities and Old Ages for Three Ultra-diffuse Galaxies in the Coma Cluster

    NASA Astrophysics Data System (ADS)

    Gu, Meng; Conroy, Charlie; Law, David; van Dokkum, Pieter; Yan, Renbin; Wake, David; Bundy, Kevin; Merritt, Allison; Abraham, Roberto; Zhang, Jielai; Bershady, Matthew; Bizyaev, Dmitry; Brinkmann, Jonathan; Drory, Niv; Grabowski, Kathleen; Masters, Karen; Pan, Kaike; Parejko, John; Weijmans, Anne-Marie; Zhang, Kai

    2018-05-01

    A large population of ultra-diffuse galaxies (UDGs) was recently discovered in the Coma cluster. Here we present optical spectra of three such UDGs, DF 7, DF 44, and DF 17, which have central surface brightnesses of μ g ≈ 24.4–25.1 mag arcsec‑2. The spectra were acquired as part of an ancillary program within the SDSS-IV MaNGA Survey. We stacked 19 fibers in the central regions from larger integral field units (IFUs) per source. With over 13.5 hr of on-source integration, we achieved a mean signal-to-noise ratio in the optical of 9.5 Å‑1, 7.9 Å‑1, and 5.0 Å‑1, respectively, for DF 7, DF 44, and DF 17. Stellar population models applied to these spectra enable measurements of recession velocities, ages, and metallicities. The recession velocities of DF 7, DF 44, and DF 17 are {6599}-25+40 km s‑1, {6402}-39+41 km s‑1, and {8315}-43+43 km s‑1, spectroscopically confirming that all of them reside in the Coma cluster. The stellar populations of these three galaxies are old and metal-poor, with ages of {7.9}-2.5+3.6 Gyr, {8.9}-3.3+4.3 Gyr, and {9.1}-5.5+3.9 Gyr, and iron abundances of [Fe/H] -{1.0}-0.4+0.3, -{1.3}-0.4+0.4, and -{0.8}-0.5+0.5, respectively. Their stellar masses are (3–6) × 108 M ⊙. The UDGs in our sample are as old or older than galaxies at similar stellar mass or velocity dispersion (only DF 44 has an independently measured dispersion). They all follow the well-established stellar mass–stellar metallicity relation, while DF 44 lies below the velocity dispersion-metallicity relation. These results, combined with the fact that UDGs are unusually large for their stellar masses, suggest that stellar mass plays a more important role in setting stellar population properties for these galaxies than either size or surface brightness.

  3. An evaluation of treatment strategies for head and neck cancer in an African American population.

    PubMed

    Ignacio, D N; Griffin, J J; Daniel, M G; Serlemitsos-Day, M T; Lombardo, F A; Alleyne, T A

    2013-07-01

    This study evaluated treatment strategies for head and neck cancers in a predominantly African American population. Data were collected utilizing medical records and the tumour registry at the Howard University Hospital. Kaplan-Meier method was used for survival analysis and Cox proportional hazards regression analysis predicted the hazard of death. Analysis revealed that the main treatment strategy was radiation combined with platinum for all stages except stage I. Cetuximab was employed in only 1% of cases. Kaplan-Meier analysis revealed stage II patients had poorer outcome than stage IV while Cox proportional hazard regression analysis (p = 0.4662) showed that stage I had a significantly lower hazard of death than stage IV (HR = 0.314; p = 0.0272). Contributory factors included tobacco and alcohol but body mass index (BMI) was inversely related to hazard of death. There was no difference in survival using any treatment modality for African Americans.

  4. Multiple Intravenous Infusions Phase 2a: Ontario Survey

    PubMed Central

    Fan, Mark; Koczmara, Christine; Masino, Caterina; Cassano-Piché, Andrea; Trbovich, Patricia; Easty, Anthony

    2014-01-01

    Background Research conducted in earlier phases of this study prospectively identified a number of concerns related to the safe administration of multiple intravenous (IV) infusions in Ontario hospitals. Objective To investigate the potential prevalence of practices or policies that may contribute to the patient safety risks identified in Phase 1b of this study. Data Sources and Review Methods Sixty-four survey responses were analyzed from clinical units where multiple IV infusions may occur (e.g., adult intensive care units). Survey questions were organized according to the topics identified in Phase 1b as potential contributors to patient harm (e.g., labelling practices, patient transfer practices, secondary infusion policies). Results Survey results indicated suboptimal practices and policies in some clinical units, and variability in a number of infusion practices. Key areas of concern included the following: use of primary IV tubing without back check valves when administering secondary infusions administration of secondary infusions with/as high-alert continuous IV medications potential confusion about how IV tubing should be labelled to reflect replacement date and time interruptions to IV therapy due to IV pump and/or tubing changes when patients are transferred between clinical units coadministration of continuous or intermittent infusions on central venous pressure monitoring ports variability in respondents’ awareness of the infusion pump's bolus capabilities Limitations Due to the limited sample size, survey responses may not be representative of infusion practices across Ontario. Answers to some questions indicated that the intent of the questions might have been misunderstood. Due to a design error, 1 question about bolus administration methods was not shown to as many respondents as appropriate. Conclusions The Ontario survey revealed variability in IV infusion practice across the province and potential opportunities to improve safety. PMID:26257837

  5. Malleolar fractures and their ligamentous injury equivalents have similar outcomes in supination-external rotation type IV fractures of the ankle treated by anatomical internal fixation.

    PubMed

    Berkes, M B; Little, M T M; Lazaro, L E; Sculco, P K; Cymerman, R M; Daigl, M; Helfet, D L; Lorich, D G

    2012-11-01

    It has previously been suggested that among unstable ankle fractures, the presence of a malleolar fracture is associated with a worse outcome than a corresponding ligamentous injury. However, previous studies have included heterogeneous groups of injury. The purpose of this study was to determine whether any specific pattern of bony and/or ligamentous injury among a series of supination-external rotation type IV (SER IV) ankle fractures treated with anatomical fixation was associated with a worse outcome. We analysed a prospective cohort of 108 SER IV ankle fractures with a follow-up of one year. Pre-operative radiographs and MRIs were undertaken to characterise precisely the pattern of injury. Operative treatment included fixation of all malleolar fractures. Post-operative CT was used to assess reduction. The primary and secondary outcome measures were the Foot and Ankle Outcome Score (FAOS) and the range of movement of the ankle. There were no clinically relevant differences between the four possible SER IV fracture pattern groups with regard to the FAOS or range of movement. In this population of strictly defined SER IV ankle injuries, the presence of a malleolar fracture was not associated with a significantly worse clinical outcome than its ligamentous injury counterpart. Other factors inherent to the injury and treatment may play a more important role in predicting outcome.

  6. A DECAMETER STATIONARY TYPE IV BURST IN IMAGING OBSERVATIONS ON 2014 SEPTEMBER 6

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koval, Artem; Chen, Yao; Feng, Shiwei

    2016-08-01

    First-of-its-kind radio imaging of a decameter solar stationary type IV radio burst has been presented in this paper. On 2014 September 6 the observations of type IV burst radio emission were carried out with the two-dimensional heliograph based on the Ukrainian T-shaped radio telescope (UTR-2), together with other telescope arrays. Starting at ∼09:55 UT and for ∼3 hr, the radio emission was kept within the observational session of UTR-2. The interesting observation covered the full evolution of this burst, “from birth to death.” During the event lifetime, two C-class solar X-ray flares with peak times 11:29 UT and 12:24 UTmore » took place. The time profile of this burst in radio has a double-humped shape that can be explained by injection of energetic electrons, accelerated by the two flares, into the burst source. According to the heliographic observations, we suggest that the burst source was confined within a high coronal loop, which was part of a relatively slow coronal mass ejection. The latter has been developed for several hours before the onset of the event. Through analysis of about 1.5 × 10{sup 6} heliograms (3700 temporal frames with 4096 images in each frame that correspond to the number of frequency channels), the radio burst source imaging shows a fascinating dynamical evolution. Both space-based ( GOES , SDO , SOHO , STEREO ) data and various ground-based instrumentation (ORFEES, NDA, RSTO, NRH) records have been used for this study.« less

  7. Health-related quality of life across the anxiety disorders

    PubMed Central

    Comer, Jonathan S.; Blanco, Carlos; Hasin, Deborah S.; Liu, Shang-Min; Grant, Bridget F.; Turner, J. Blake; Olfson, Mark

    2009-01-01

    Objective Although clinical studies have documented that specific anxiety disorders are associated with impaired psychosocial functioning, little is known regarding their comparative effects on health-related quality of life within a general population. The current analysis compares health-related quality of life in a U.S. community-dwelling sample of adults with DSM-IV social anxiety disorder (SAD), generalized anxiety disorders (GAD), panic disorder (PD), and specific phobia (SP). Method Face-to-face survey of a U.S. nationally representative sample of over 43,000 adults aged 18 years and older residing in households and group quarters. Prevalence of DSM-IV anxiety disorders and relative associations with health-related quality of life indicators were examined. Results Roughly 9.8% of respondents met diagnostic criteria for at least one 12-month DSM-IV anxiety disorder which, relative to the non-anxiety-disordered general population, were each associated with lower personal income, increased rates of 12-month physical conditions, and greater numbers of Axis I and Axis II DSM-IV psychiatric conditions. After adjusting for socio-demographic and clinical correlates including other anxiety disorders, GAD was associated with significant decrements in the SF-12 Mental Component Summary score. In similar models, GAD and to a lesser extent PD were significantly associated with impairment in social functioning, role emotional, and mental health SF subscales. Conclusion GAD, followed by PD, appears to exact significant and independent tolls on health-related quality of life. Results underscore the importance of prompt and accurate clinical identification and improving access to effective interventions for these disorders. PMID:20816036

  8. Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia.

    PubMed

    Tan, Jin Ai Mary Anne; Chin, Pui See; Wong, Yean Ching; Tan, Kim Lian; Chan, Lee Lee; George, Elizabeth

    2006-10-01

    In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations. DNA from 173 beta-thalassaemia carriers and five beta-thalassaemia major patients from the Malay, Chinese and Indian ethnic groups were first analysed by ARMS and gap-PCR. Ninety-five per cent (174/183) of the 183 beta-globin genes studied were characterised using these two techiques. The remaining nine uncharacterised beta-globin genes (4.9%) were analysed using genomic sequencing of a 904 bp amplified PCR product consisting of the promoter region, exon 1, intervening sequence (IVS) 1, exon 2 and the 5' IVS2 regions of the beta-globin gene. The rare beta-globin mutations detected in the Chinese patients were CD27/28 (+C) and CD43 (GAG-TAG), and -88 (C-T) in an Indian patient. Beta-globin mutations at CD16 (-C), IVS1-1 (G-A), IVS2-1 (G-A), -86 (C-G) and Haemoglobin South Florida (CD1, GTG-ATG) were confirmed in the Malay patients. The seven rare beta-globin mutations and a rare haemoglobin variant confirmed in this study have been described in other populations but have not been previously described in Malaysian beta-thalassemia patients.

  9. Population Pharmacokinetics of Colistin Methanesulfonate in Rats: Achieving Sustained Lung Concentrations of Colistin for Targeting Respiratory Infections

    PubMed Central

    W. S. Yapa, Shalini; Li, Jian; Porter, Christopher J. H.; Nation, Roger L.

    2013-01-01

    Colistin methanesulfonate (CMS), the inactive prodrug of colistin, is administered by inhalation for the management of respiratory infections. However, limited pharmacokinetic data are available for CMS and colistin following pulmonary delivery. This study investigates the pharmacokinetics of CMS and colistin following intravenous (i.v.) and intratracheal (i.t.) administration in rats and determines the targeting advantage after direct delivery into the lungs. In addition to plasma, bronchoalveolar lavage (BAL) fluid was collected to quantify drug concentrations in lung epithelial lining fluid (ELF). The resulting data were analyzed using a population modeling approach in S-ADAPT. A three-compartment model described the disposition of both compounds in plasma following i.v. administration. The estimated mean clearance from the central compartment was 0.122 liters/h for CMS and 0.0657 liters/h for colistin. Conversion of CMS to colistin from all three compartments was required to fit the plasma data. The fraction of the i.v. dose converted to colistin in the systemic circulation was 0.0255. Two BAL fluid compartments were required to reflect drug kinetics in the ELF after i.t. dosing. A slow conversion of CMS (mean conversion time [MCTCMS] = 3.48 h) in the lungs contributed to high and sustained concentrations of colistin in ELF. The fraction of the CMS dose converted to colistin in ELF (fm,ELF = 0.226) was higher than the corresponding fractional conversion in plasma after i.v. administration. In conclusion, pulmonary administration of CMS achieves high and sustained exposures of colistin in lungs for targeting respiratory infections. PMID:23917323

  10. Skin phototyping in a Chinese female population: analysis of four hundred and four cases from four major cities of China.

    PubMed

    Liu, W; Lai, W; Wang, X M; Li, L; Tian, Y; Lu, Y; Wu, Y Y; Li, Y; Zhang, P; Wu, Y; Chen, L

    2006-08-01

    The sun-reactive skin types in 404 Chinese females living in different cities were investigated in this study. A questionnaire was designed according to the original concept of skin types proposed by Fitzpatrick and the investigation was conducted in two ways: self-administered reporting and then a personal interview. Minimal erythema dose (MED) and minimal persistent pigmentation dose (MPPD) were also measured in part of the volunteers with a standard solar simulator. The results show that in the way of personal interview, the predominant skin type of the investigated group is type III (71.4%), and then type II (14.7%) and type IV (14.2%), while in the self-reporting manner, the result is as follows: type III, 74.3%, type II, 25.6% and type IV, 1%. There are no skin type I, V or VI in the studied group. MED and MPPD from the same population show some relevance to the skin types, e.g. with the change of skin type from Type II to IV, the mean value of MED increases gradually and the MPPD decreases slightly. From the study we concluded that the skin types of the investigated Chinese females are principally type III (more than 70%), and then type II and type IV. The different ways of answering the questionnaire did not affect the results remarkably. The measurements of photobiology parameters confirmed that there is a certain correlation between skin types and MED or MPPD determined in this group of volunteers.

  11. SAP- FORTRAN STATIC SOURCE CODE ANALYZER PROGRAM (IBM VERSION)

    NASA Technical Reports Server (NTRS)

    Manteufel, R.

    1994-01-01

    The FORTRAN Static Source Code Analyzer program, SAP, was developed to automatically gather statistics on the occurrences of statements and structures within a FORTRAN program and to provide for the reporting of those statistics. Provisions have been made for weighting each statistic and to provide an overall figure of complexity. Statistics, as well as figures of complexity, are gathered on a module by module basis. Overall summed statistics are also accumulated for the complete input source file. SAP accepts as input syntactically correct FORTRAN source code written in the FORTRAN 77 standard language. In addition, code written using features in the following languages is also accepted: VAX-11 FORTRAN, IBM S/360 FORTRAN IV Level H Extended; and Structured FORTRAN. The SAP program utilizes two external files in its analysis procedure. A keyword file allows flexibility in classifying statements and in marking a statement as either executable or non-executable. A statistical weight file allows the user to assign weights to all output statistics, thus allowing the user flexibility in defining the figure of complexity. The SAP program is written in FORTRAN IV for batch execution and has been implemented on a DEC VAX series computer under VMS and on an IBM 370 series computer under MVS. The SAP program was developed in 1978 and last updated in 1985.

  12. SAP- FORTRAN STATIC SOURCE CODE ANALYZER PROGRAM (DEC VAX VERSION)

    NASA Technical Reports Server (NTRS)

    Merwarth, P. D.

    1994-01-01

    The FORTRAN Static Source Code Analyzer program, SAP, was developed to automatically gather statistics on the occurrences of statements and structures within a FORTRAN program and to provide for the reporting of those statistics. Provisions have been made for weighting each statistic and to provide an overall figure of complexity. Statistics, as well as figures of complexity, are gathered on a module by module basis. Overall summed statistics are also accumulated for the complete input source file. SAP accepts as input syntactically correct FORTRAN source code written in the FORTRAN 77 standard language. In addition, code written using features in the following languages is also accepted: VAX-11 FORTRAN, IBM S/360 FORTRAN IV Level H Extended; and Structured FORTRAN. The SAP program utilizes two external files in its analysis procedure. A keyword file allows flexibility in classifying statements and in marking a statement as either executable or non-executable. A statistical weight file allows the user to assign weights to all output statistics, thus allowing the user flexibility in defining the figure of complexity. The SAP program is written in FORTRAN IV for batch execution and has been implemented on a DEC VAX series computer under VMS and on an IBM 370 series computer under MVS. The SAP program was developed in 1978 and last updated in 1985.

  13. SOME COMMENTS ON TYPE IV BURSTS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, H.; Kakinuma, T.

    1962-01-01

    It has become clear that a large continuum burst is composed of 4 distinctive types, CM/sub 1/, CM/sub 2/, DM, and IV, which originate from different altitudes over the photosphere. The observational characters of each type are given. CM/sub 1/ is the main phase of a centimeter-wave burst originating from about 0.02-0.05 R/sub S/ in height. DM burst is polarized in the ordinary sense, which is the cause of reversal of polarization with frequency. Its center frequency lies between about 1000 and 200 Mc/s, and is often misunderstood as the original Type IV burst. The movement of magnetic field duringmore » a burst is suggested. CM/sub 2/ may be considered as an enhancement of the upper part of the source of S-component caused by this movement of the field. (auth)« less

  14. Repellent and Anti-quorum Sensing Activity of Six Aromatic Plants Occurring in Colombia.

    PubMed

    Cervantes-Ceballos, Leonor; Caballero-Gallardo, Karina; Olivero-Verbel, Jesus

    2015-10-01

    Essential oils (EOs) are widely used as biopesticides and to control bacterial infections. This study describes the ability of six EOs isolated from plants cultivated in Colombia to perform as repellents against Ulomoides dermestoides and as quorum sensing (QS) inhibitors. EOs from Aloysia triphylla, Cymbopogon nardus, Lippia origanoides, Hyptis suaveolens, Swinglea glutinosa and Eucalyptus globulus were repellents classified as Class IV, IV, IV, III, II, and II, respectively, whereas the commercial repellent IR3535 only reached Class II after 2 h exposure. All EOs presented small, but significant inhibitory properties against the QS system in Escherichia coli (pJBA132) at 25 μg/mL after 4 h exposure. These data suggest evaluated EOs from Colombia are sustainable, promising new sources of natural repellents and could be important as anti-quorum sensing molecules.

  15. Modeling the Galaxy-Halo Connection: An open-source approach with Halotools

    NASA Astrophysics Data System (ADS)

    Hearin, Andrew

    2016-03-01

    Although the modern form of galaxy-halo modeling has been in place for over ten years, there exists no common code base for carrying out large-scale structure calculations. Considering, for example, the advances in CMB science made possible by Boltzmann-solvers such as CMBFast, CAMB and CLASS, there are clear precedents for how theorists working in a well-defined subfield can mutually benefit from such a code base. Motivated by these and other examples, I present Halotools: an open-source, object-oriented python package for building and testing models of the galaxy-halo connection. Halotools is community-driven, and already includes contributions from over a dozen scientists spread across numerous universities. Designed with high-speed performance in mind, the package generates mock observations of synthetic galaxy populations with sufficient speed to conduct expansive MCMC likelihood analyses over a diverse and highly customizable set of models. The package includes an automated test suite and extensive web-hosted documentation and tutorials (halotools.readthedocs.org). I conclude the talk by describing how Halotools can be used to analyze existing datasets to obtain robust and novel constraints on galaxy evolution models, and by outlining the Halotools program to prepare the field of cosmology for the arrival of Stage IV dark energy experiments.

  16. Crosswalk between DSM-IV Dependence and DSM-5 Substance Use Disorders for Opioids, Cannabis, Cocaine and Alcohol

    PubMed Central

    Compton, Wilson M.; Dawson, Deborah A.; Goldstein, Risë B.; Grant, Bridget F.

    2013-01-01

    Background Ascertaining agreement between DSM-IV and DSM-5 is important to determine the applicability of treatments for DSM-IV conditions to persons diagnosed according to the proposed DSM-5. Methods Data from a nationally representative sample of US adults were used to compare concordance of past-year DSM-IV Opioid, Cannabis, Cocaine and Alcohol Dependence with past-year DSM-5 disorders at thresholds of 3+, 4+ 5+ and 6+ positive DSM-5 criteria among past-year users of opioids (n=264), cannabis (n=1,622), cocaine (n=271) and alcohol (n=23,013). Substance-specific 2×2 tables yielded overall concordance (kappa), sensitivity, specificity, positive predictive values (PPV) and negative predictive values (NPV). Results For DSM-IV Alcohol, Cocaine and Opioid Dependence, optimal concordance occurred when 4+ DSM-5 criteria were endorsed, corresponding to the threshold for moderate DSM-5 Alcohol, Cocaine and Opioid Use Disorders. Maximal concordance of DSM-IV Cannabis Dependence and DSM-5 Cannabis Use Disorder occurred when 6+ criteria were endorsed, corresponding to the threshold for severe DSM-5 Cannabis Use Disorder. At these optimal thresholds, sensitivity, specificity, PPV and NPV generally exceeded 85% (>75% for cannabis). Conclusions Overall, excellent correspondence of DSM-IV Dependence with DSM-5 Substance Use Disorders was documented in this general population sample of alcohol, cannabis, cocaine and opioid users. Applicability of treatments tested for DSM-IV Dependence is supported by these results for those with a DSM-5 Alcohol, Cocaine or Opioid Use Disorder of at least moderate severity or Severe Cannabis Use Disorder. Further research is needed to provide evidence for applicability of treatments for persons with milder substance use disorders. PMID:23642316

  17. Later Onset Fabry Disease, Cardiac Damage Progress in Silence: Experience With a Highly Prevalent Mutation.

    PubMed

    Hsu, Ting-Rong; Hung, Sheng-Che; Chang, Fu-Pang; Yu, Wen-Chung; Sung, Shih-Hsien; Hsu, Chia-Lin; Dzhagalov, Ivan; Yang, Chia-Feng; Chu, Tzu-Hung; Lee, Han-Jui; Lu, Yung-Hsiu; Chang, Sheng-Kai; Liao, Hsuan-Chieh; Lin, Hsiang-Yu; Liao, Tsan-Chieh; Lee, Pi-Chang; Li, Hsing-Yuan; Yang, An-Hang; Ho, Hui-Chen; Chiang, Chuan-Chi; Lin, Ching-Yuang; Desnick, Robert J; Niu, Dau-Ming

    2016-12-13

    Recently, several studies revealed a much higher prevalence of later onset Fabry disease (FD) than previously expected. It suggested that later onset FD might present as an important hidden health issue in certain ethnic or demographic populations in the world. However, the natural history of its phenotype has not been systemically investigated, especially the cardiac involvement. The study analyzed a large-scale newborn screening program for FD to understand the natural course of later onset FD. To date, 916,383 newborns have been screened for FD in Taiwan, including more than 1,200 individuals with the common, later onset IVS4+919G>A (IVS4) mutation. Echocardiography was performed in 620 adults with the IVS4 mutation to analyze the prevalence of left ventricular hypertrophy (LVH), and gadolinium-enhanced cardiac magnetic resonance imaging was performed in 129 patients with FD, including 100 IVS4 adults. LVH was observed in 67% of men and 32% of women older than 40 years. Imaging evidenced significant late gadolinium enhancement in 38.1% of IVS4 men and 16.7% of IVS4 women with the IVS4 mutation but without LVH. Seventeen patients underwent endomyocardial biopsies, which revealed significant globotriaosylceramide substrate accumulation in their cardiomyocytes. Significant cardiomyocyte substrate accumulation in IVS4 patients led to severe and irreversible cardiac fibrosis before development of LVH or other significant cardiac manifestations. Thus, it might be too late to start enzyme replacement therapy after the occurrence of LVH or other significant cardiac manifestations in patients with later onset FD. This study also indicated the importance of newborn screening for early detection of the insidious, ongoing, irreversible cardiac damage in patients with later onset FD. Copyright © 2016 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  18. Predictions of Actinide Solubilities under Near-Field Conditions Expected in the WIPP

    NASA Astrophysics Data System (ADS)

    Brush, L. H.; Xiong, Y.

    2009-12-01

    The Waste Isolation Pilot Plant (WIPP) is a U.S. Department of Energy (DOE) repository in southeast New Mexico for defense-related transuranic (TRU) waste. The repository, which opened in March 1999, is located at a subsurface depth of 655 m (2150 ft) in the Salado Fm., a Permian bedded-salt formation. The repository will eventually contain the equivalent of 844,000 208 L (55 gal) drums of TRU waste. After filling the rooms and access drifts and installing panel closures, creep closure of the salt will crush the steel waste containers in most cases and encapsulate the waste. The WIPP actinide source term model used for long-term performance assessment (PA) of the repository comprises dissolved and suspended submodels (solubilities and colloids). This presentation will describe the solubilities. From the standpoint of long-term PA, the order of importance of the radioelements in the TRU waste to be emplaced in the WIPP is Pu ~ Am >> U > Th >> Np ~ Cm and fission products. The DOE has included all of these actinides, but not fission products, in the WIPP Actinide Source Term Program (ASTP). Anoxic corrosion of Fe- and Al-base metals and microbial consumption of cellulosic, plastic, and rubber materials will produce gas and create strongly reducing conditions in the WIPP after closure. The use of MgO as an engineered barrier to consume microbially produced CO2 will result in low fCO2 and basic pH. Under these conditions, Th, U, Np, Pu, and Am will speciate essentially entirely as Th(IV), U(IV), Np(IV), Pu(III), and Am(III); or Th(IV), U(VI), Np(V), Pu(IV), and Am(III). The DOE has developed thermodynamic speciation-and-solubility models for +III, +IV, and +V actinides in brines. Experimental data for Nd, Am, and Cm species were used to parameterize the +III Pitzer activity-coefficient model; data for Th species were used for the +IV model; and data for Np(V) species were used for the +V model. These models include the effects of the organic ligands acetate, citrate, EDTA, and oxalate in TRU waste. The oxidation-state analogy was then used to extend the +III model to Pu(III), and the +IV model to Pu(IV), U(IV), and Np(IV). The solubility of U(VI) was estimated. For the recent WIPP Compliance Recertification Application PA Baseline Calculations, we calculated actinide solubilities with fCO2 buffered at 3.14 × 10-6 atm by the brucite-hydromagnesite carbonation reaction, with pH maintained at ~9 by the brucite dissolution-precipitation reaction, and with estimated concentrations of the organic ligands in brines from the Salado and the Castile Fm., which underlies the Salado. The calculated +III, +IV, and +V solubilities are 1.56 × 10-6, 5.64 × 10-8, and 4.07 × 10-7 M, respectively, in Salado brine; and 1.51 × 10-6, 6.98 × 10-8, and 8.75 × 10-7 M in Castile brine. The U(VI) solubility estimated for both brines is 1 × 10-3 M. This research is funded by WIPP programs administered by the U.S. Department of Energy. Sandia is a multiprogram laboratory operated by Sandia Corporation, a Lockheed Martin Company, for the United States Department of Energy’s National Nuclear Security Administration under contract DE-AC04-94AL85000.

  19. Analysis of Slewing and Attitude Determination Requirements for CTEx

    DTIC Science & Technology

    2010-03-01

    for CTEx to incorporate a star tracker with 1 arcsecond accuracy to determine attitude without reliance on outside sources. iv Acknowledgements I owe a... 1 1.1 Spectroscopy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 1.2...12 2.1.2 EO- 1 /Hyperion

  20. Organizing the Fight: Technological Determinants of Command and Control and Combat Operations

    DTIC Science & Technology

    2006-09-01

    time for reviewing instruction, searching existing data sources, gathering and maintaining the data needed, and completing and reviewing the...59 IV. THE MITIGATING EFFECTS OF TIME ...66 1. Desert Storm: Time for Work-arounds

  1. Mexican-Origin Parents' Stress and Satisfaction: The Role of Emotional Support.

    PubMed

    Popp, Tierney K; Delgado, Melissa Y; Wheeler, Lorey A

    2018-01-24

    Guided by a process model of parenting and the integrative model, this study examined sources of emotional support (i.e., partner, maternal, paternal) as related to stress and satisfaction resulting from the parenting role in a sample of Mexican-origin young adult parents who participated in the National Longitudinal Study of Adolescent to Adult Health (Add Health) during Wave IV. Participants were male and female parents (26-35 years of age; 59% female; N = 737) who had children and a partner. Results from structural equation modeling revealed support from mothers as salient; high levels of maternal support were associated with high levels of parenting satisfaction. Tests of indirect effects suggested that parenting satisfaction played an intervening role in the link between maternal support and parenting stress. The pattern of results held across levels of linguistic acculturation but varied by gender. Understanding the mechanisms that predict parenting stress and satisfaction within the Mexican-origin population may help in the identification of culturally sensitive intervention strategies. © 2018 Family Process Institute.

  2. Handbook of ecotoxicology

    USGS Publications Warehouse

    Hoffman, David J.; Rattner, Barnett A.; Burton, G. Allen; Cairns, John

    1995-01-01

    The Handbook of Ecotoxicology offers 34 chapters with contributions from over 50 selected international experts. The book is divided into four major sections: I. Quantifying and Measuring Ecotoxicological Effects, II. Contaminant Sources and Effects, III. Case Histories and Ecosystem Surveys, and IV. Methods for Making Estimates and Predictability in Ecotoxicology. Concepts and methodology are presented for many types of aquatic and terrestrial ecotoxicity test protocols for both controlled and field assessments. Chapters are offered on such diverse topics as sediment and soil ecotoxicity, landscape indicators, biomonitoring, and use of current bioindicators. The roles of deforestation and global warming, pathogens and disease in ecotoxicology, abiotic factors, urban runoff, predictive ecotoxicology, population modeling, and restoration ecology are discussed. This book was designed to serve as a reference book for students entering the fields of ecotoxicology, aquatic toxicology, terrestrial wildlife toxicology, and other environmental sciences. Many portions of this handbook will serve as a convenient reference text for established investigators, resource managers, and those involved in risk assessment and risk management within regulatory agencies and the private sector.

  3. Progress towards the Millennium Development Goals in a community of extreme poverty: local vs. national disparities in Peru.

    PubMed

    Gyorkos, Theresa W; Joseph, Serene A; Casapía, Martin

    2009-06-01

    Standard indicators are being used worldwide to track progress towards achieving the Millennium Development Goals (MDGs). These are usually at country level and do not accurately reflect within-country variability of progress towards the targets. This may lead to lack of attention and under-resourcing of the most vulnerable populations. Therefore, the objective of this study was to compare selected standard MDG indicators at country level and community level in Peru. As MDG indicators we selected: (i) moderate to severe and severe underweight in children under 5 years old; (ii) immunization against measles in 1-year olds; (iii) births attended by skilled health professionals and (iv) youth unemployment. Country-level data for Peru were obtained from United Nations published sources. Community-level data were obtained from a household survey conducted in 2005-2006 in Belén, a community of extreme poverty in the Amazon region. Belén indicators were consistently less favourable than country-level indicators, and indicators even differed between zones of high and low socioeconomic status within Belén itself. Compared to MDG indicators at the national level in Peru, the population of Belén experiences intra-country regional disparities in important health and social outcomes. Improving the coverage and quality of interventions and services in this community is essential. Other vulnerable populations in Peru should also be identified and targeted so that they can benefit from, and ultimately contribute to, progress in achieving the MDGs.

  4. Pore-scale characterization of biogeochemical controls on iron and uranium speciation under flow conditions.

    PubMed

    Pearce, Carolyn I; Wilkins, Michael J; Zhang, Changyong; Heald, Steve M; Fredrickson, Jim K; Zachara, John M

    2012-08-07

    Etched silicon microfluidic pore network models (micromodels) with controlled chemical and redox gradients, mineralogy, and microbiology under continuous flow conditions are used for the incremental development of complex microenvironments that simulate subsurface conditions. We demonstrate the colonization of micromodel pore spaces by an anaerobic Fe(III)-reducing bacterial species (Geobacter sulfurreducens) and the enzymatic reduction of a bioavailable Fe(III) phase within this environment. Using both X-ray microprobe and X-ray absorption spectroscopy, we investigate the combined effects of the precipitated Fe(III) phases and the microbial population on uranium biogeochemistry under flow conditions. Precipitated Fe(III) phases within the micromodel were most effectively reduced in the presence of an electron shuttle (AQDS), and Fe(II) ions adsorbed onto the precipitated mineral surface without inducing any structural change. In the absence of Fe(III), U(VI) was effectively reduced by the microbial population to insoluble U(IV), which was precipitated in discrete regions associated with biomass. In the presence of Fe(III) phases, however, both U(IV) and U(VI) could be detected associated with biomass, suggesting reoxidation of U(IV) by localized Fe(III) phases. These results demonstrate the importance of the spatial localization of biomass and redox active metals, and illustrate the key effects of pore-scale processes on contaminant fate and reactive transport.

  5. Lack of CHEK2 gene mutations in differentiated thyroid carcinoma patients using high resolution melting analysis.

    PubMed

    Fayaz, Shima; Fard-Esfahani, Pezhman; Torbati, Peyman Mohammadi

    2014-01-01

    Recently, mutations in the genes involved in cell cycle control, including CHEK2, are being considered as etiological factors in different kinds of cancers. The CHEK2 protein plays an important role in protecting damaged DNA from entering mitosis. In this study the potential effects of two common mutations IVS2+1G?A and Ile157Thr of CHEK2 gene in differentiated thyroid carcinoma (DTC) were evaluated. A total of 100 patients admitted to the Research Institute for Nuclear Medicine were diagnosed with DTC based on pathology reports of surgery samples. An additional 100 people were selected as a control group with no cancer history. PCR-HRM (high resolution melting) analysis was performed to deal with each of mutations in all case and control samples separately. During the analysis of IVS2+1G?A and Ile157Thr mutations of CHEK2 gene in the case and control groups, all the samples were identified as wild homozygote type. The finding suggests that IVS2+1G?A and Ile157Thr mutations of CHEK2 gene do not constitute a risk factor for DTC in the Iranian population. However, further studies with a larger population are required to confirm the outcome.

  6. Polymorphisms in chemokine and receptor genes and gastric cancer risk and survival in a high risk Polish population.

    PubMed

    Gawron, Andrew J; Fought, Angela J; Lissowska, Jolanta; Ye, Weimin; Zhang, Xiao; Chow, Wong-Ho; Beane Freeman, Laura E; Hou, Lifang

    2011-03-01

    To examine if genetic variations in chemokine receptor and ligand genes are associated with gastric cancer risk and survival. The study included 298 cases and 417 controls from a population-based study of gastric cancer conducted in Warsaw, Poland in 1994-1996. We investigated seven single nucleotide polymorphisms in a chemokine ligand (CXCL12) and chemokine receptor (CCR2, CCR5, CX3CR1) genes and one frameshift deletion (CCR5) in blood leukocyte DNA in relation to gastric cancer risk and survival. Genotyping was conducted at the NCI Core Genotyping Facility. Odds ratios and 95% confidence intervals were computed using univariate and multivariate logistic regression models. Survival analysis was performed using Cox proportional hazards models. Gastric cancer risk was not associated with single chemokine polymorphisms. A CCR5 haplotype that contained the common alleles of IVS1+151 G>T (rs2734648), IVS2+80 C>T (rs1800024) and minor allele of IVS1+246 A>G (rs1799987) was associated with a borderline significantly increased risk (OR = 1.5, 95% CI: 1.0?2.2). For gastric cancer cases, there was a greater risk of death for carriers of the minor alleles of CCR2 Ex2+241 G>A (rs1799864) (HR = 1.5, 95% CI: 1.1-2.1) and CCR5 IVS2+80 C>T (rs1800024) (HR = 1.5, 95% CI: 1.1-2.1). Carriers of the CCR5 minor allele of IVS1+151 G>T (rs2734648) had a decreased risk of death compared to homozygote carriers of the common allele (HR = 0.8, 95% CI: 0.6-1.0). Our findings do not support an association between gastric cancer risk and single chemokine genetic variation. The observed associations between cancer risk and a CCR5 haplotype and between survival and polymorphisms in CCR2 and CCR5 need replication in future studies.

  7. Population demographics and genetic diversity in remnant and translocated populations of sea otters

    USGS Publications Warehouse

    Bodkin, James L.; Ballachey, Brenda E.; Cronin, M.A.; Scribner, K.T.

    1999-01-01

    The effects of small population size on genetic diversity and subsequent population recovery are theoretically predicted, but few empirical data are available to describe those relations. We use data from four remnant and three translocated sea otter (Enhydra lutris) populations to examine relations among magnitude and duration of minimum population size, population growth rates, and genetic variation. Metochondrial (mt)DNA haplotype diversity was correlated with the number of years at minimum population size (r = -0.741, p = 0.038) and minimum population size (r = 0.709, p = 0.054). We found no relation between population growth and haplotype diversity, altough growth was significantly greater in translocated than in remnant populations. Haplotype diversity in populations established from two sources was higher than in a population established from a single source and was higher than in the respective source populations. Haplotype frequencies in translocated populations of founding sizes of 4 and 28 differed from expected, indicating genetic drift and differential reproduction between source populations, whereas haplotype frequencies in a translocated population with a founding size of 150 did not. Relations between population demographics and genetic characteristics suggest that genetic sampling of source and translocated populations can provide valuable inferences about translocations.

  8. Bioactive compounds from culinary herbs inhibit a molecular target for type 2 diabetes management, dipeptidyl peptidase IV.

    PubMed

    Bower, Allyson M; Real Hernandez, Luis M; Berhow, Mark A; de Mejia, Elvira Gonzalez

    2014-07-02

    Greek oregano (Origanum vulgare), marjoram (Origanum majorana), rosemary (Rosmarinus officinalis), and Mexican oregano (Lippia graveolens) are concentrated sources of bioactive compounds. The aims were to characterize and examine extracts from greenhouse-grown or commercially purchased herbs for their ability to inhibit dipeptidyl peptidase IV (DPP-IV) and protein tyrosine phosphatase 1B (PTP1B), enzymes that play a role in insulin secretion and insulin signaling, respectively. Greenhouse herbs contained more polyphenols (302.7-430.1 μg of gallic acid equivalents/mg of dry weight of extract (DWE)) and flavonoids (370.1-661.4 μg of rutin equivalents/mg of DWE) compared to the equivalent commercial herbs. Greenhouse rosemary, Mexican oregano, and marjoram extracts were the best inhibitors of DPP-IV (IC₅₀=16, 29, and 59 μM, respectively). Commercial rosemary, Mexican oregano, and marjoram were the best inhibitors of PTP1B (32.4-40.9% at 500 μM). The phytochemicals eriodictyol, naringenin, hispidulin, cirsimaritin, and carnosol were identified by LC-ESI-MS as being present in greenhouse-grown Mexican oregano and rosemary. Computational modeling indicated that hispidulin, carnosol, and eriodictyol would have the best binding affinities for DPP-IV. Biochemically, the best inhibitors of DPP-IV were cirsimaritin (IC₅₀=0.43±0.07 μM), hispidulin (IC₅₀=0.49±0.06 μM), and naringenin (IC₅₀=2.5±0.29 μM). Overall, herbs contain several flavonoids that inhibit DPP-IV and should be investigated further regarding their potential in diabetes management.

  9. Evaluation of Cervicography Screening for Cervical Cancer in a High Risk Population

    DTIC Science & Technology

    2000-02-16

    Higher sensitivity was associated with younger age , premenopausal status, the presence of metaplasia. the absence of cervicovaginal atrophy, and improved...recommended for postmenopausal women and/or women ages 50 and older. iv EVALUATION OF CERVICOGRAPHY SCREENING FOR CERVICAL CANCER IN A HIGH-RISK POPULATION...Institute. The Guanacaste site was selected because of its consistently high age -adjusted rates of cervical cancer despite existing Papanicolaou

  10. Prevalence of DSM-IV psychiatric disorder in the French elderly population.

    PubMed

    Ritchie, K; Artero, S; Beluche, I; Ancelin, M-L; Mann, A; Dupuy, A-M; Malafosse, A; Boulenger, J-P

    2004-02-01

    France has high rates of psychotropic drug consumption and suicide in the elderly population, but it has not yet been possible to determine whether this is due to exceptionally high morbidity rates. To describe the first longitudinal population study of psychiatric disorder undertaken in France, and to estimate current and lifetime prevalences and age of onset of psychiatric disorder. A study group of 1873 non-institutionalised persons aged 65 years and over was randomly recruited from the Montpellier district electoral rolls. The Mini International Neuropsychiatric Interview was used to assess current and lifetime symptoms. Cases identified by the application of DSM-IV criteria were re-examined by a clinical panel. Forty-six per cent of the study population had experienced a mental disorder in their lifetime, and 3.7% had made a suicide attempt. Lifetime prevalence of major depression was 26.5% and 30% for anxiety disorders. Current prevalence rates were 14.2% for anxiety disorders, 10.7% for phobia, 3% for major depression and 1.7% for psychosis. Results show very high rates of lifetime but not current major depression. Rates of current phobia and suicidal ideation in the very elderly are also high compared with other studies. The rates reported are likely to be underestimates.

  11. A risk of breast cancer in women - carriers of constitutional CHEK2 gene mutations, originating from the North - Central Poland

    PubMed Central

    2014-01-01

    Background Germline mutations of the CHEK2 gene have been reported to be associated with breast cancer. In this study, we analyzed the association of CHEK2 mutations with the risk of development of breast cancer in women of North-Central Poland. Methods 420 women with breast cancer and 435 controls were tested for three protein truncating (IVS2 + 1G > A, 1100delC, del5395) and one missense (I157T) CHEK2 mutation. IVS2 + 1G > A and I157T mutations were identified by RFLP-PCR, 1100delC variant was analyzed using an ASO-PCR and del5395 mutation by multiplex-PCR. The statistical tests: the odds ratio (OR) and Fisher’s exact test were used. Results In 33 out of 420 (7.9%) women consecutively diagnosed with breast cancer, we detected one of four analyzed CHEK2 mutations: I157T, 1100delC, IVS2 + 1G > A or del5395. Together they were not associated with the increased risk of breast cancer (North-Central control group: OR = 1.6, p = 0.124; the general Polish population: OR = 1.4, p = 0.109). This association was only seen for IVS2 + 1G > A mutation (OR = 3.0; p = 0.039). One of the three truncating CHEK2 mutations (IVS2 + 1G > A, 1100delC, del5395) was present in 9 of 420 women diagnosed with breast cancer (2.1%) and in 4 of 121 women (3.3%) with a history of breast cancer in a first- and/or second- degree relatives. Together they were associated with the increased risk of disease in these groups, compared to the general Polish population (OR = 2.1, p = 0.053 and OR = 3.2; p = 0.044, respectively). I157T mutation was detected in 25 of 420 women diagnosed with breast cancer (6.0%) and in 8 of 121 women (6.6%) with a history of breast cancer in first- and/or second- degree relatives. The prevalance of I157T mutation was 4.1% (18/435) in North-Central control group and 4.8% (265/5.496) in the general Polish population. However it was not associated with an increased risk of breast cancer. Conclusion Obtained results suggest that CHEK2 mutations could potentially contribute to the susceptibility to breast cancer. The germline mutations of CHEK2, especially the truncating ones confer low-penetrance breast cancer predisposition that contribute significantly to familial clustering of breast cancer at the population level. PMID:24713400

  12. A risk of breast cancer in women - carriers of constitutional CHEK2 gene mutations, originating from the North - Central Poland.

    PubMed

    Bąk, Aneta; Janiszewska, Hanna; Junkiert-Czarnecka, Anna; Heise, Marta; Pilarska-Deltow, Maria; Laskowski, Ryszard; Pasińska, Magdalena; Haus, Olga

    2014-04-08

    Germline mutations of the CHEK2 gene have been reported to be associated with breast cancer. In this study, we analyzed the association of CHEK2 mutations with the risk of development of breast cancer in women of North-Central Poland. 420 women with breast cancer and 435 controls were tested for three protein truncating (IVS2 + 1G > A, 1100delC, del5395) and one missense (I157T) CHEK2 mutation. IVS2 + 1G > A and I157T mutations were identified by RFLP-PCR, 1100delC variant was analyzed using an ASO-PCR and del5395 mutation by multiplex-PCR. The statistical tests: the odds ratio (OR) and Fisher's exact test were used. In 33 out of 420 (7.9%) women consecutively diagnosed with breast cancer, we detected one of four analyzed CHEK2 mutations: I157T, 1100delC, IVS2 + 1G > A or del5395. Together they were not associated with the increased risk of breast cancer (North-Central control group: OR = 1.6, p = 0.124; the general Polish population: OR = 1.4, p = 0.109). This association was only seen for IVS2 + 1G > A mutation (OR = 3.0; p = 0.039). One of the three truncating CHEK2 mutations (IVS2 + 1G > A, 1100delC, del5395) was present in 9 of 420 women diagnosed with breast cancer (2.1%) and in 4 of 121 women (3.3%) with a history of breast cancer in a first- and/or second- degree relatives. Together they were associated with the increased risk of disease in these groups, compared to the general Polish population (OR = 2.1, p = 0.053 and OR = 3.2; p = 0.044, respectively). I157T mutation was detected in 25 of 420 women diagnosed with breast cancer (6.0%) and in 8 of 121 women (6.6%) with a history of breast cancer in first- and/or second- degree relatives. The prevalance of I157T mutation was 4.1% (18/435) in North-Central control group and 4.8% (265/5.496) in the general Polish population. However it was not associated with an increased risk of breast cancer. Obtained results suggest that CHEK2 mutations could potentially contribute to the susceptibility to breast cancer. The germline mutations of CHEK2, especially the truncating ones confer low-penetrance breast cancer predisposition that contribute significantly to familial clustering of breast cancer at the population level.

  13. 48 CFR 25.702-1 - Definitions.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... Financial Services, the Committee on Foreign Relations, and the Permanent Select Committee on Intelligence... equipment, facilities, personnel, products, services, personal property, real property, or any other...) Consist of providing goods or services to marginalized populations of Sudan; (iv) Consist of providing...

  14. Hepatitis C Seroprevalence and Risk Factors in Adult Population of Chaharmahal and Bakhtiari Province of Iran in 2013.

    PubMed

    Moezzi, Masoumeh; Imani, Reza; Karimi, Ali; Pourheidar, Behrouz

    2015-10-01

    Hepatitis C is the second leading viral infectious disease worldwide. In Iran, hepatitis C is the most important and prevalent reason for chronic hepatitis and liver cirrhosis in the multi transfused population. This study was conducted to determine seroprevalence and burden of hepatitis C in Chaharmahal and Bakhtiari province and to plan for controlling it. For this analytical, population-based study, 3000 samples were older than 15 years old and were enrolled from urban and rural areas of Chaharmahal and Bakhtiari province, southwest Iran per cluster sampling. Written informed consent was obtained from the participants and the demographic data, transmission route and risk factors were collected after blood sample taking. Hepatitis C virus antibody (HCV Ab) and western blotting were consecutively run. Data analysis was done by SPSS 19 using descriptive statistics, and chi-square test, Fisher's exact test, and logistic regression Ap value of 0.05 was considered as the level of significance. The prevalence of HCV Ab was obtained 1.4% (95% CI, 0.95-1.7) and that of positive hepatitis C by western blotting 0.9% (95% CI, 0.65-1.3). The prevalence in men (1.2%) was obtained two times higher than women. The highest prevalence was obtained in 35 to 44-year-old population (2%). The prevalence was higher in married individuals and less in higher educated. History of hospital stay, first degree relatives infected with HCV, jaundice, history of blood transfusion, tattoo, outpatient surgery, imprisonment, contact with the infected, intravenous (IV) drug abuse, and smoking had significant association with disease prevalence (p<0.05). The highest odds ratio was obtained for history of IV drug abuse (OR=38.2, 95% CI, 14.06-103.9) followed by imprisonment (OR=8.9, 95% CI, 2.97-26.6). However, by logistic regression only history of IV drug abuse was obtained as significant (p<0.05). Hepatitis C is growing and emerging as the most prevalent chronic, viral hepatic disease, so further consideration of risk factors and routes of transmission is crucial for appropriate planning for, and preventing, treating, and controlling hepatitis C. IV drug abusers as the most important group need special consideration and surveillance in order to cut infection chain and decrease the disease incidence.

  15. Treatment of melasma with low fluence, large spot size, 1064-nm Q-switched neodymium-doped yttrium aluminum garnet (Nd:YAG) laser for the treatment of melasma in Fitzpatrick skin types II-IV.

    PubMed

    Brown, Alia S; Hussain, Mussarat; Goldberg, David J

    2011-12-01

    Melasma is a common condition affecting over six million American women. Treatment of dermal or combined melasma is difficult and does not respond well to conventional topical therapies. Various light sources have been used recently in the treatment of melasma including fractionated ablative and non-ablative lasers as well as intense pulse light. We report the use of low fluence, large spot size Q-switched, Nd:Yag laser for the treatment of melasma in skin types II-IV.

  16. The Effect of Draft DSM-5 Criteria on Posttraumatic Stress Disorder Prevalence

    PubMed Central

    Calhoun, Patrick S.; Hertzberg, Jeffrey S.; Kirby, Angela C.; Dennis, Michelle F.; Hair, Lauren P.; Dedert, Eric A.; Beckham, Jean C.

    2012-01-01

    Background This study was designed to examine the concordance of proposed DSM-5 posttraumatic stress disorder (PTSD) criteria with DSM-IV classification rules and examine the impact of the proposed DSM-5 PTSD criteria on prevalence. Method The sample (N=185) included participants who were recruited for studies focused on trauma and health conducted at an academic medical center and VA medical center in the southeastern United States. The prevalence and concordance between DSM-IV and the proposed DSM-5 classifications were calculated based on results from structured clinical interviews. Prevalence rates and diagnostic efficiency indices including sensitivity, specificity, area under the curve (AUC), and Kappa were calculated for each of the possible ways to define DSM-5 PTSD. Results Ninety-five percent of the sample reported an event that met both DSM-IV PTSD Criterion A1 and A2, but only 89% reported a trauma that met Criterion A on DSM-5. Results examining concordance between DSM-IV and DSM-5 algorithms indicated that several of the algorithms had AUCs above .90. The requirement of two symptoms from both Clusters D and E provided strong concordance to DSM-IV (AUC = .93; Kappa = .86) and a greater balance between sensitivity and specificity than requiring three symptoms in both Clusters D and E. Conclusions Despite several significant changes to the diagnostic criteria for PTSD for DSM-5, several possible classification rules provided good concordance with DSM-IV. The magnitude of the impact of DSM-5 decision rules on prevalence will be largely affected by the DSM-IV PTSD base rate in the population of interest. PMID:23109002

  17. Intravenous Lidocaine as an Adjuvant for Pain Associated with Sickle Cell Disease.

    PubMed

    Nguyen, Natalie L; Kome, Anne M; Lowe, Denise K; Coyne, Patrick; Hawks, Kelly G

    2015-01-01

    The objectives of this study were to evaluate the efficacy and safety of adjuvant intravenous (IV) lidocaine in adults with sickle cell disease (SCD). This was a retrospective review. Adults with SCD receiving at least one IV lidocaine infusion from 2004 to 2014 were included. Patient demographics, lidocaine treatment parameters, pain scores, pain medications, and adverse effects were recorded. Eleven patients were identified, yielding 15 IV lidocaine trials. Clinical improvement in pain scores from pre-lidocaine challenge to 24 hours post-lidocaine challenge, defined by ≥ 20% reduction in pain scores, was achieved in 53.3% (8 of 15) of IV lidocaine challenges. Of the 8 clinically successful trials, the mean reduction in morphine dose equivalents (MDE) from 24 hours pre-lidocaine challenge to 24 hours post-lidocaine challenge was 32.2%. Additionally, clinically successful trials had a mean initial and a maximum dose of 1 mg/kg/h (range: 0.5-2.7 mg/kg/h) and 1.3 mg/kg/h (range: 0.5-1.9 mg/kg/h), respectively. On average, these patients underwent 3 dose titrations (range: 1-8) and received lidocaine infusions for 4.4 days (range: 2-8 days). Two patients experienced disorientation and dizziness. The authors conclude that adjuvant IV lidocaine provided pain relief and a mean reduction in MDE during sickle cell pain crisis. These results provide preliminary insight into the use of IV lidocaine for treating pain in patients with SCD, although prospective studies are needed to determine efficacy, dosing, and tolerability of IV lidocaine in this patient population.

  18. Accountability analysis of title IV phase 2 of the 1990 Clean Air Act Amendments.

    PubMed

    Morgenstern, Richard D; Harrington, Winston; Shih, Jhih-Shyang; Bell, Michelle L

    2012-11-01

    In this study, we sought to assess what portion, if any, of the reductions in ambient concentrations of particulate matter (PM*) < or = 2.5 microm in aerodynamic diameter (PM2.5) that occurred in the United States between the years 1999 and 2006 can be attributed to reductions in emissions of sulfur dioxide (SO2) and nitrogen oxides (NOx) resulting from implementation of Phase 2 of Title IV of the 1990 Clean Air Act Amendments. To this end, a detailed statistical model linking sources and monitors over time and space was used to estimate associations between the observed emissions reductions and improvements in air quality. Overall, it turned out to be quite feasible to use relatively transparent statistical methods to assess these outcomes of the Phase 2 program, which was designed to reduce long-range transport of emissions. Associations between changes in emissions from individual power plants and monitor-specific estimates of changes in concentrations of PM2.5, our indicator pollutant, were highly significant and were mostly of the expected relative magnitudes with respect to distances and directions from sources. Originally estimated on monthly data for a set of 193 monitors between 1999 and 2005, our preferred model performed equally well using data for the same 193 monitors for 2006 as well as for an additional 217 monitors not in the original set in 2006. Although substantial model uncertainty was observed, we were able to estimate that the Title IV Phase 2 emissions reduction program implemented between 1999 and 2005 reduced PM2.5 concentrations in the eastern United States by an average of 1.07 microg/m3 (standard deviation [SD] = 0.11 microg/m3) compared with a counterfactual case defined as there having been no change in emission rates per unit of energy input (1 million British thermal units [BTUs]). On a population-weighted basis, the comparable reduction in PM2.5 was 0.89 microg/m3. Compared with the air quality fate and transport models used by the U.S. Environmental Protection Agency (EPA) to estimate air quality improvements associated with the Clean Air Interstate Rule (CAIR) for 2010 and 2015, when baseline PM2.5 concentrations were expected to be about one-third lower, our statistical model yielded roughly similar results per ton of SO2 reduced, well within the estimated confidence intervals of the models. We have proposed a number of steps to advance air quality outcomes research using statistical methods. Specifically, we have emphasized the value of updating our analysis with post-2005 data to try to corroborate our findings. We have also recommended extending the work on air quality outcomes to include changes in health outcomes that might be associated with the implementation of Title IV Phase 2.

  19. Astragaloside IV prevents damage to human mesangial cells through the inhibition of the NADPH oxidase/ROS/Akt/NF‑κB pathway under high glucose conditions.

    PubMed

    Sun, Li; Li, Weiping; Li, Weizu; Xiong, Li; Li, Guiping; Ma, Rong

    2014-07-01

    Glomerular hypertrophy and hyperfiltration are the two major pathological characteristics of the early stages of diabetic nephropathy (DN), which are respectively related to mesangial cell (MC) proliferation and a decrease in calcium influx conducted by canonical transient receptor potential cation channel 6 (TRPC6). The marked increase in the production of reactive oxygen species (ROS) induced by hyperglycemia is the main sponsor of multiple pathological pathways in DN. Nicotinamide adenine dinucleotide phosphate (NADPH) oxidase is an important source of ROS production in MCs. Astragaloside IV (AS‑IV) is an active ingredient of Radix Astragali which has a potent antioxidative effect. In this study, we aimed to investigate whether high glucose (HG)‑induced NADPH oxidase activation and ROS production contribute to MC proliferation and the downregulation of TRPC6 expression; we also wished to determine the effects of AS‑IV on MCs under HG conditions. Using a human glomerular mesangial cell line, we found that treatment with AS‑IV for 48 h markedly attenuated HG‑induced proliferation and the hypertrophy of MCs in a dose‑dependent manner. The intracellular ROS level was also markedly reduced following treatment with AS‑IV. In addition, the enhanced activity of NADPH oxidase and the expression level of NADPH oxidase 4 (Nox4) protein were decreased. Treatment with AS‑IV also inhibited the phosphorylation level of Akt and IκBα in the MCs. In addition, TRPC6 protein expression and the intracellular free calcium concentration were also markedly reduced following treatment with AS‑IV under HG conditions. These results suggest that AS‑IV inhibits HG‑induced mesangial cell proliferation and glomerular contractile dysfunction through the NADPH oxidase/ROS/Akt/nuclear factor‑κB (NF‑κB) pathway, providing a new perspective for the clinical treatment of DN.

  20. 7 CFR 1721.104 - Eligible purposes.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... measures: (i) Caulking; (ii) Weather-stripping; (iii) Heat pump systems (including water source heat pumps); (iv) Heat pumps, water heaters, and central heating or central air conditioning system replacements or modifications, which reduce energy consumption; (v) Ceiling insulation; (vi) Wall insulation; (vii) Floor...

  1. 7 CFR 1721.104 - Eligible purposes.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... measures: (i) Caulking; (ii) Weather-stripping; (iii) Heat pump systems (including water source heat pumps); (iv) Heat pumps, water heaters, and central heating or central air conditioning system replacements or modifications, which reduce energy consumption; (v) Ceiling insulation; (vi) Wall insulation; (vii) Floor...

  2. 7 CFR 1721.104 - Eligible purposes.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... measures: (i) Caulking; (ii) Weather-stripping; (iii) Heat pump systems (including water source heat pumps); (iv) Heat pumps, water heaters, and central heating or central air conditioning system replacements or modifications, which reduce energy consumption; (v) Ceiling insulation; (vi) Wall insulation; (vii) Floor...

  3. 7 CFR 1721.104 - Eligible purposes.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... measures: (i) Caulking; (ii) Weather-stripping; (iii) Heat pump systems (including water source heat pumps); (iv) Heat pumps, water heaters, and central heating or central air conditioning system replacements or modifications, which reduce energy consumption; (v) Ceiling insulation; (vi) Wall insulation; (vii) Floor...

  4. 7 CFR 1721.104 - Eligible purposes.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... measures: (i) Caulking; (ii) Weather-stripping; (iii) Heat pump systems (including water source heat pumps); (iv) Heat pumps, water heaters, and central heating or central air conditioning system replacements or modifications, which reduce energy consumption; (v) Ceiling insulation; (vi) Wall insulation; (vii) Floor...

  5. 40 CFR Table 8 to Subpart Uuuu of... - Reporting Requirements

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...) and (3); 13. for affected sources invoking the delay of repair provisions in § 63.104(e) for heat exchanger systems, the next compliance report must contain the information in § 63.104(f)(2)(i) through (iv...

  6. 40 CFR Table 8 to Subpart Uuuu of... - Reporting Requirements

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...) and (3); 13. for affected sources invoking the delay of repair provisions in § 63.104(e) for heat exchanger systems, the next compliance report must contain the information in § 63.104(f)(2)(i) through (iv...

  7. 76 FR 81371 - Approval and Disapproval and Promulgation of Implementation Plans; Texas; Infrastructure and...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-12-28

    ... Source Ozone Modeling K. Comments That Address Cumulative Air Quality Impacts IV. Final Action V... (section 110(a)(2)(J)); air quality modeling/data (section 110(a)(2)(K)); permitting fees (section 110(a)(2...

  8. CYBER-205 Devectorizer

    NASA Technical Reports Server (NTRS)

    Lakeotes, Christopher D.

    1990-01-01

    DEVECT (CYBER-205 Devectorizer) is CYBER-205 FORTRAN source-language-preprocessor computer program reducing vector statements to standard FORTRAN. In addition, DEVECT has many other standard and optional features simplifying conversion of vector-processor programs for CYBER 200 to other computers. Written in FORTRAN IV.

  9. A study of lip print pattern in Goan dental students - A digital approach.

    PubMed

    Prabhu, Rachana V; Dinkar, Ajit; Prabhu, Vishnudas

    2012-10-01

    To find the incidence of different types of lip patterns, the dominant pattern, quadrant wise, amongst the Goan population. To assess, the quadrant wise differences in lip patterns among males and females and to report new lip print pattern in Goan population. Lip prints of 100 students studying in Goa Dental College & Hospital were taken using 14 mm wide and 50 mm long Scotch tape without any distortion. These prints were then scanned (256 gray shades at a resolution of 300 dpi.) for the digital analysis. Using various applications of Adobe Photoshop 7 software an attempt was made to trace each and every line. K. Suzuki and Y. Tsuchihashi's classification was followed to define the patterns of the grooves. The current study has found the most predominant pattern in Quadrant I to be Type V (580 lines; 52.39%) followed in order by Type I' (196 lines; 17.70%), Type I (166 lines; 14.99%), Type II (166 lines; 10.47%), Type IV (40 lines; 3.61%), Type III (9 lines; 0.81%). In Quadrant II of this study the most predominant pattern recorded was Type V (589 lines; 50.47%) followed in order by Type I' (209 lines; 17.90%), Type I (204 lines; 17.48%), Type II (130 lines; 11.13%), Type IV (34 lines; 2.91%), Type III (1 line; 0.08%). In Quadrant III of this study the most predominant pattern recorded was again Type V (484 lines; 52.09%) followed in order by Type I' (174 lines; 18.72%), Type I (155 lines; 16.68%), Type II (102 lines; 10.97%), Type IV (9 lines; 0.96%), Type III (5 lines; 0.53%). In Quadrant IV of this study the most predominant pattern recorded was Type V (543 lines; 58.19%) followed in order by Type I (151 lines; 16.18%), Type I' (138 lines; 14.79%), Type II (85 lines; 9.11%), Type III (9 lines; 0.96%), Type IV (7 line; 0.75%). In all four Quadrants the most predominant pattern found in males and females was Type V. The present study recorded the following types of type V patterns for the first time; Trifurcations, Bridge or 'H' pattern, Horizontal Lines, Cartwheel, Pineapple Skin and Multiple Branching Appearance. The digital method of analyzing the Lip Print images using Adobe Photoshop 7 software serves as a convenient method that provides better visualization and ease in identification and recording of the Lip Print pattern. Predominant pattern in all four quadrants was Type V followed by the linear pattern i.e. Type I' in quadrants I, II, and III and Type I in quadrant IV in the studied population. Distribution of pattern is not affected by the sex. Although type V is the most predominant pattern found in Goan population, the sub-classification of this type defines the more defined term and aids in accuracy of the classification. Copyright © 2012. Published by Elsevier Ltd.

  10. Special Analysis for the Disposal of the Materials and Energy Corporation Sealed Sources at the Area 5 Radioactive Waste Management Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shott, Gregory

    This special analysis (SA) evaluates whether the Materials and Energy Corporation (M&EC) Sealed Source waste stream (PERM000000036, Revision 0) is suitable for shallow land burial (SLB) at the Area 5 Radioactive Waste Management Site (RWMS) on the Nevada National Security Site (NNSS). Disposal of the M&EC Sealed Source waste meets all U.S. Department of Energy (DOE) Manual DOE M 435.1-1, “Radioactive Waste Management Manual,” Chapter IV, Section P performance objectives (DOE 1999). The M&EC Sealed Source waste stream is recommended for acceptance without conditions.

  11. Seasonal influenza vaccination coverage and its determinants among nursing homes personnel in western France.

    PubMed

    Elias, Christelle; Fournier, Anna; Vasiliu, Anca; Beix, Nicolas; Demillac, Rémi; Tillaut, Hélène; Guillois, Yvonnick; Eyebe, Serge; Mollo, Bastien; Crépey, Pascal

    2017-07-07

    Influenza-associated deaths is an important risk for the elderly in nursing homes (NHs) worldwide. Vaccination coverage among residents is high but poorly effective due to immunosenescence. Hence, vaccination of personnel is an efficient way to protect residents. Our objective was to quantify the seasonal influenza vaccination (IV) coverage among NH for elderly workers and identify its determinants in France. We conducted a cross-sectional study in March 2016 in a randomized sample of NHs of the Ille-et-Vilaine department of Brittany, in western France. A standardized questionnaire was administered to a randomized sample of NH workers for face-to-face interviews. General data about the establishment was also collected. Among the 33 NHs surveyed, IV coverage for the 2015-2016 season among permanent workers was estimated at 20% (95% Confidence Interval (CI) 15.3%-26.4%) ranging from 0% to 69% depending on the establishments surveyed. Moreover, IV was associated with having previously experienced a "severe" influenza episode in the past (Prevalence Ratio 1.48, 95% CI 1.01-2.17), and varied by professional categories (p < 0.004) with better coverage among administrative staff. Better knowledge about influenza prevention tools was also correlated (p < 0.001) with a higher IV coverage. Individual perceptions of vaccination benefits had a significant influence on the IV coverage (p < 0.001). Although IV coverage did not reach a high rate, our study showed that personnel considered themselves sufficiently informed about IV. IV coverage remains low in the NH worker population in Ille-et-Vilaine and also possibly in France. Strong variations of IV coverage among NHs suggest that management and working environment play an important role. To overcome vaccine "hesitancy", specific communication tools may be required to be adapted to the various NH professionals to improve influenza prevention.

  12. The pediatric Rome IV criteria: what's new?

    PubMed

    Koppen, Ilan J N; Nurko, Samuel; Saps, Miguel; Di Lorenzo, Carlo; Benninga, Marc A

    2017-03-01

    Functional gastrointestinal disorders (FGIDs) are common in children of all ages and comprise of a wide range of conditions related to the gastrointestinal tract that cannot be attributed to structural or biochemical abnormalities. FGIDs are diagnosed according to the symptom-based Rome criteria. Areas covered: In 2016, the revised pediatric Rome IV criteria were published, these revised criteria are discussed in this review article. For the youngest age group (neonates/toddlers), the criteria for infant colic have undergone the most notable revisions. The most prominent changes in Rome IV were made in the criteria for children/adolescents, with the definition of two new FGIDs (functional nausea and functional vomiting) and the restructuring of the criteria for functional abdominal pain disorders, including the definition of FGID subtypes for functional dyspepsia and irritable bowel syndrome. Expert commentary: Overall, the Rome IV have been refined and are expected to improve the process of diagnosing FGIDs in the pediatric population and to better facilitate the healthcare professional in distinguishing different clinical entities. These changes will likely benefit future research and clinical care.

  13. EPR and IR spectral investigations on some leafy vegetables of Indian origin

    NASA Astrophysics Data System (ADS)

    Prasuna, C. P. Lakshmi; Chakradhar, R. P. S.; Rao, J. L.; Gopal, N. O.

    2009-09-01

    EPR spectral investigations have been carried out on four edible leafy vegetables of India, which are used as dietary component in day to day life. In Rumex vesicarius leaf sample, EPR spectral investigations at different temperatures indicate the presence of anti-ferromagnetically coupled Mn(IV)-Mn(IV) complexes. EPR spectra of Trigonella foenum graecum show the presence of Mn ions in multivalent state and Fe 3+ ions in rhombic symmetry. EPR spectra of Basella rubra indicate the presence of Mn(IV)-O-Mn(IV) type complexes. The EPR spectra of Basella rubra have been studied at different temperatures. It is found that the spin population for the resonance signal at g = 2.06 obeys the Boltzmann distribution law. The EPR spectra of Moringa oliefera leaves show the presence of Mn 2+ ions. Radiation induced changes in free radical of this sample have also been studied. The FT-IR spectra of Basella rubra and Moringa oliefera leaves show the evidences for the protein matrix bands and those corresponding to carboxylic C dbnd O bonds.

  14. U.S. Army Medical Materiel Development Activity 1991 Annual Report

    DTIC Science & Technology

    1991-01-31

    coliphage detection technology. The RABTEK will significantly reduce the time required to determine the sanitary quality of potential water sources, and...dependence on medical grade oxygen resupply. o The e st I %Mt is a device which produces sterile Water for Injection from a potable water source, combines...that water with concentrated electrolytes to formulate parenteral solutions, and packages the solutions in sterile plastic IV bags. 1 1 e Laser

  15. Characterization of Vertical Impact Device Acceleration Pulses Using Parametric Assessment: Phase IV Dual Impact Pulses

    DTIC Science & Technology

    2017-01-04

    response, including the time for reviewing instructions, searching existing data sources, searching existing data sources, gathering and maintaining...configurations with a restrained manikin, was evaluated in four different test series . Test Series 1 was conducted to determine the materials and...5 ms TTP. Test Series 2 was conducted to determine the materials and drop heights required for energy attenuation of the seat pan to generate a 4 m

  16. GENES AS INSTRUMENTS FOR STUDYING RISK BEHAVIOR EFFECTS: AN APPLICATION TO MATERNAL SMOKING AND OROFACIAL CLEFTS

    PubMed Central

    Jugessur, Astanand; Murray, Jeffrey C.; Moreno, Lina; Wilcox, Allen; Lie, Rolv T.

    2011-01-01

    This study uses instrumental variable (IV) models with genetic instruments to assess the effects of maternal smoking on the child’s risk of orofacial clefts (OFC), a common birth defect. The study uses genotypic variants in neurotransmitter and detoxification genes relateded to smoking as instruments for cigarette smoking before and during pregnancy. Conditional maximum likelihood and two-stage IV probit models are used to estimate the IV model. The data are from a population-level sample of affected and unaffected children in Norway. The selected genetic instruments generally fit the IV assumptions but may be considered “weak” in predicting cigarette smoking. We find that smoking before and during pregnancy increases OFC risk substantially under the IV model (by about 4–5 times at the sample average smoking rate). This effect is greater than that found with classical analytic models. This may be because the usual models are not able to consider self-selection into smoking based on unobserved confounders, or it may to some degree reflect limitations of the instruments. Inference based on weak-instrument robust confidence bounds is consistent with standard inference. Genetic instruments may provide a valuable approach to estimate the “causal” effects of risk behaviors with genetic-predisposing factors (such as smoking) on health and socioeconomic outcomes. PMID:22102793

  17. Virological Surveillance of Influenza A Subtypes Isolated in 2014 from Clinical Outbreaks in Canadian Swine

    PubMed Central

    Grgić, Helena; Gallant, Jackie; Poljak, Zvonimir

    2017-01-01

    Influenza A viruses (IAVs) are respiratory pathogens associated with an acute respiratory disease that occurs year-round in swine production. It is currently one of the most important pathogens in swine populations, with the potential to infect other host species including humans. Ongoing research indicates that the three major subtypes of IAV—H1N1, H1N2, and H3N2—continue to expand in their genetic and antigenic diversity. In this study, we conducted a comprehensive genomic analysis of 16 IAVs isolated from different clinical outbreaks in Alberta, Manitoba, Ontario, and Saskatchewan in 2014. We also examined the genetic basis for probable antigenic differences among sequenced viruses. On the basis of phylogenetic analysis, all 13 Canadian H3N2 viruses belonged to cluster IV, eight H3N2 viruses were part of the IV-C cluster, and one virus belonged to the IV-B and one to the IV-D cluster. Based on standards used in this study, three H3N2 viruses could not be clearly classified into any currently established group within cluster IV (A to F). Three H1N2 viruses were part of the H1α cluster. PMID:28335552

  18. The National Adult Reading Test: restandardisation against the Wechsler Adult Intelligence Scale-Fourth edition.

    PubMed

    Bright, Peter; Hale, Emily; Gooch, Vikki Jayne; Myhill, Thomas; van der Linde, Ian

    2018-09-01

    Since publication in 1982, the 50-item National Adult Reading Test (NART; Nelson, 1982; NART-R; Nelson & Willison, 1991) has remained a widely adopted method for estimating premorbid intelligence both for clinical and research purposes. However, the NART has not been standardised against the most recent revisions of the Wechsler Adult Intelligence Scale (WAIS-III; Wechsler, 1997, and WAIS-IV; Wechsler, 2008). Our objective, therefore, was to produce reliable standardised estimates of WAIS-IV IQ from the NART. Ninety-two neurologically healthy British adults were assessed and regression equations calculated to produce population estimates of WAIS-IV full-scale IQ (FSIQ) and constituent index scores. Results showed strong NART/WAIS-IV FSIQ correlations with more moderate correlations observed between NART error and constituent index scores. FSIQ estimates were closely similar to the published WAIS and WAIS-R estimates at the high end of the distribution, but at the lower end were approximately equidistant from the highly discrepant WAIS (low) and WAIS-R (high) values. We conclude that the NART is likely to remain an important tool for estimating the impact of neurological damage on general cognitive ability. We advise caution in the use of older published WAIS and/or WAIS-R estimates for estimating premorbid WAIS-IV FSIQ, particularly for those with low NART scores.

  19. Impact of the DSM-5 attention-deficit/hyperactivity disorder age-of-onset criterion in the US adolescent population.

    PubMed

    Vande Voort, Jennifer L; He, Jian-Ping; Jameson, Nicole D; Merikangas, Kathleen R

    2014-07-01

    The present study aims to compare the prevalence and clinical correlates of DSM-IV versus DSM-5-defined attention-deficit/hyperactivity disorder (ADHD) and subtypes in a nationally representative sample of US youth based on the age-of-onset criterion. The sample includes 1,894 participants 12 to 15 years of age from cross-sectional National Health and Nutrition Examination Survey (NHANES) surveys conducted from 2001 to 2004. Data on DSM-IV and DSM-5 criteria for ADHD were derived from administration of the parental ADHD module of the National Institute of Mental Health (NIMH) Diagnostic Interview Schedule for Children, Version IV (DISC-IV). Extension of the age-of-onset criterion from 7 to 12 years led to an increase in the prevalence rate of ADHD from 7.38% (DSM-IV) to 10.84% (DSM-5). Youth with later age of onset did not differ from those with earlier age of onset in terms of severity and patterns of comorbidity. However, the group with later age of onset was more likely to be from lower income and ethnic minority families. The comparability of the clinical significance of the early and later age-of-onset groups supports the DSM-5 extension of the age-of-onset criterion in ADHD. Published by Elsevier Inc.

  20. 75 FR 36237 - National Institute on Disability and Rehabilitation Research (NIDRR)-Disability and...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-24

    ... outcomes for underserved populations; (4) identify research gaps; (5) identify mechanisms of integrating... Part IV Department of Education National Institute on Disability and Rehabilitation Research (NIDRR)-- Disability and Rehabilitation Research Projects and Centers Program-- Rehabilitation Research...

  1. 7 CFR 1980.317 - Equal opportunity and nondiscrimination requirements in use, occupancy, rental, or sale of housing.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... signed by RHS, with an attached Equal Employment Opportunity poster. Posters in Spanish must be provided and displayed where a significant portion of the population is Spanish speaking. (iv) Under Executive...

  2. The water soluble axially disubstituted silicon phthalocyanines: photophysicochemical properties and in vitro studies.

    PubMed

    Göksel, Meltem; Biyiklioglu, Zekeriya; Durmuş, Mahmut

    2017-08-01

    Two novel silicon(IV) phthalocyanines bearing 1,3-bis[3(dimethylamino)phenoxy]propan-2-ol or 1,3-bis[3(diethylamino)phenoxy]propan-2-ol groups at their axial positions were synthesized. These phthalocyanines were converted into their water soluble derivatives by the quaternization reaction with methyl iodide. The quaternized phthalocyanines show excellent solubility aqueous solutions without any aggregation which makes them potential photosensitizers for use in photodynamic therapy (PDT). For this reason, the photophysical and photochemical properties such as fluorescence quantum yields, lifetimes, singlet oxygen generation and photodegradation of both non-ionic (3 and 5) and quaternized cationic silicon(IV) phthalocyanines were investigated. Furthermore, the cytotoxicity of PDT was determined by colorimetric proliferation assay against to hepatocellular carcinoma (HuH-7) cancer cells. In this study, the cells were incubated with a novel water soluble silicon(IV) phthalocyanine derivatives and thereafter the cells were illuminated using broad-band incoherent light source.

  3. Preparing the MAX IV storage rings for timing-based experiments

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stråhlman, C., E-mail: Christian.Strahlman@maxlab.lu.se; Olsson, T., E-mail: Teresia.Olsson@maxlab.lu.se; Leemann, S. C.

    2016-07-27

    Time-resolved experimental techniques are increasingly abundant at storage ring facilities. Recent developments in accelerator technology and beamline instrumentation allow for simultaneous operation of high-intensity and timing-based experiments. The MAX IV facility is a state-of-the-art synchrotron light source in Lund, Sweden, that will come into operation in 2016. As many storage ring facilities are pursuing upgrade programs employing strong-focusing multibend achromats and passive harmonic cavities (HCs) in high-current operation, it is of broad interest to study the accelerator and instrumentation developments required to enable timing-based experiments at such machines. In particular, the use of hybrid filling modes combined with pulse pickingmore » by resonant excitation or pseudo single bunch has shown promising results. These methods can be combined with novel beamline instrumentation, such as choppers and instrument gating. In this paper we discuss how these techniques can be implemented and employed at MAX IV.« less

  4. Structure of the Wechsler Intelligence Scale for Children--Fourth Edition among a national sample of referred students.

    PubMed

    Watkins, Marley W

    2010-12-01

    The structure of the Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV; D. Wechsler, 2003a) was analyzed via confirmatory factor analysis among a national sample of 355 students referred for psychoeducational evaluation by 93 school psychologists from 35 states. The structure of the WISC-IV core battery was best represented by four first-order factors as per D. Wechsler (2003b), plus a general intelligence factor in a direct hierarchical model. The general factor was the predominate source of variation among WISC-IV subtests, accounting for 48% of the total variance and 75% of the common variance. The largest 1st-order factor, Processing Speed, only accounted for 6.1% total and 9.5% common variance. Given these explanatory contributions, recommendations favoring interpretation of the 1st-order factor scores over the general intelligence score appear to be misguided.

  5. Impact of piglet oral vaccination against tuberculosis in endemic free-ranging wild boar populations.

    PubMed

    Díez-Delgado, Iratxe; Sevilla, Iker A; Romero, Beatriz; Tanner, Eleanor; Barasona, Jose A; White, Andrew R; Lurz, Peter W W; Boots, Mike; de la Fuente, José; Dominguez, Lucas; Vicente, Joaquin; Garrido, Joseba M; Juste, Ramón A; Aranaz, Alicia; Gortazar, Christian

    2018-07-01

    The Eurasian wild boar (Sus scrofa) is the main wild reservoir of the Mycobacterium tuberculosis complex in Mediterranean woodlands and a key risk factor for cattle tuberculosis (TB) breakdowns. Wild boar vaccination therefore has the potential to be a valuable tool for TB control. We tested two orally delivered vaccines, heat-inactivated Mycobacterium bovis (IV) and BCG, in four sites (two per vaccine type: one Managed and one Natural or unmanaged) during four years. TB was also monitored in 15 unvaccinated sites (spatial control), as well as in all sites from one year prior to intervention (temporal control). The rationale is that by vaccinating 2-6 month old wild boar piglets we can reduce disease at the population level during the study period. This is achievable due to the fast turnover of wild boar populations. Vaccine baits were deployed using selective piglet feeders and this method proved highly successful with uptake rates of 50 to 74% in Natural sites and 89 to 92% in Managed sites. This is relevant for the potential delivery of vaccines to control other diseases, too. Local wild boar TB prevalence at the beginning of the study was already high ranging from 50 to 100%. TB prevalence increased in unvaccinated sites (6%), while a significant decline occurred in the Managed IV site (34%). Changes recorded in the remaining sites were not significant. The short-term impact of vaccination observed in the field was complemented by mathematical modelling, representative of the field system, which examined the long-term impact and showed that vaccination of piglets reduced prevalence and increased abundance at the population level. We conclude that IV could become part of integrated TB control schemes, although its application must be tailored for each specific site. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. OBSTACLES TO FAMILY PLANNING USE AMONG RURAL WOMEN IN ATIAK HEALTH CENTER IV, AMURU DISTRICT, NORTHERN UGANDA

    PubMed Central

    Ouma, S.; Turyasima, M.; Acca, H.; Nabbale, F.; Obita, K. O.; Rama, M.; Adong, C. C.; Openy, A.; Beatrice, M. O.; Odongo-Aginya, E. I.; Awor, S.

    2016-01-01

    Background Uganda’s rapid population growth (3.2%) since 1948 has placed more demands on health sector and lowered living standard of Ugandans resulting into 49% of people living in acute poverty especially in post conflict Northern Uganda. The population rise was due to low use of contraceptive methods (21% in rural areas and 43% in urban areas) and coupled with high unmet need for family planning (41%). This indicated poor access to reproductive health services. Effective use of family planning could reduce the rapid population growth. Objective To determine obstacles to family planning use among rural women in Northern Uganda. Design A descriptive cross-sectional analytical study. Setting Atiak Health Centre IV, Amuru District, rural Northern Uganda. Subjects Four hundred and twenty four females of reproductive ages were selected from both Inpatient and Outpatient Departments of Atiak Health Centre IV. Results There was high level of awareness 418 (98.6%), positive attitude 333 (78.6%) and fair level of utilisation 230 (54.2%) of family planning. However, significant obstacles to family planning usage included; long distance to Health facility, unavailability of preferred contraceptive methods, absenteeism of family planning providers, high cost of managing side effects, desire for big family size, children dying less than five years old, husbands forbidding women from using family planning and lack of community leaders’ involvement in family planning programme. Conclusions In spites of the high level of awareness, positive attitude, and free family planning services, there were obstacles that hindered family planning usage among these rural women. However, taking services close to people, reducing number of children dying before their fifth birthday, educating men about family planning, making sure family planning providers and methods are available, reducing cost of managing side effects and involving community leaders will improve utilisation of family planning and thus reduce the rapid population growth and poverty. PMID:27099401

  7. OBSTACLES TO FAMILY PLANNING USE AMONG RURAL WOMEN IN ATIAK HEALTH CENTER IV, AMURU DISTRICT, NORTHERN UGANDA.

    PubMed

    Ouma, S; Turyasima, M; Acca, H; Nabbale, F; Obita, K O; Rama, M; Adong, C C; Openy, A; Beatrice, M O; Odongo-Aginya, E I; Awor, S

    Uganda's rapid population growth (3.2%) since 1948 has placed more demands on health sector and lowered living standard of Ugandans resulting into 49% of people living in acute poverty especially in post conflict Northern Uganda. The population rise was due to low use of contraceptive methods (21% in rural areas and 43% in urban areas) and coupled with high unmet need for family planning (41%). This indicated poor access to reproductive health services. Effective use of family planning could reduce the rapid population growth. To determine obstacles to family planning use among rural women in Northern Uganda. A descriptive cross-sectional analytical study. Atiak Health Centre IV, Amuru District, rural Northern Uganda. Four hundred and twenty four females of reproductive ages were selected from both Inpatient and Outpatient Departments of Atiak Health Centre IV. There was high level of awareness 418 (98.6%), positive attitude 333 (78.6%) and fair level of utilisation 230 (54.2%) of family planning. However, significant obstacles to family planning usage included; long distance to Health facility, unavailability of preferred contraceptive methods, absenteeism of family planning providers, high cost of managing side effects, desire for big family size, children dying less than five years old, husbands forbidding women from using family planning and lack of community leaders' involvement in family planning programme. In spites of the high level of awareness, positive attitude, and free family planning services, there were obstacles that hindered family planning usage among these rural women. However, taking services close to people, reducing number of children dying before their fifth birthday, educating men about family planning, making sure family planning providers and methods are available, reducing cost of managing side effects and involving community leaders will improve utilisation of family planning and thus reduce the rapid population growth and poverty.

  8. 40 CFR 442.15 - Pretreatment standards for existing sources (PSES).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... be incompatible with treatment at the POTW; (iv) All spent cleaning solutions, including interior caustic washes, interior presolve washes, interior detergent washes, interior acid washes, and exterior... effective pre-treatment of segregated wastewaters (including heels, prerinse/pre-steam wastes, spent...

  9. 40 CFR 442.16 - Pretreatment standards for new sources (PSNS).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... be incompatible with treatment at the POTW; (iv) All spent cleaning solutions, including interior caustic washes, interior presolve washes, interior detergent washes, interior acid washes, and exterior... effective pre-treatment of segregated wastewaters (including heels, prerinse/pre-steam wastes, spent...

  10. 40 CFR 442.25 - Pretreatment standards for existing sources (PSES).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... be incompatible with treatment at the POTW; (iv) All spent cleaning solutions, including interior caustic washes, interior presolve washes, interior detergent washes, interior acid washes, and exterior... effective pre-treatment of segregated wastewaters (including heels, prerinse/pre-steam wastes, spent...

  11. 40 CFR 442.16 - Pretreatment standards for new sources (PSNS).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... be incompatible with treatment at the POTW; (iv) All spent cleaning solutions, including interior caustic washes, interior presolve washes, interior detergent washes, interior acid washes, and exterior... effective pre-treatment of segregated wastewaters (including heels, prerinse/pre-steam wastes, spent...

  12. 40 CFR 442.15 - Pretreatment standards for existing sources (PSES).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... be incompatible with treatment at the POTW; (iv) All spent cleaning solutions, including interior caustic washes, interior presolve washes, interior detergent washes, interior acid washes, and exterior... effective pre-treatment of segregated wastewaters (including heels, prerinse/pre-steam wastes, spent...

  13. 40 CFR 442.16 - Pretreatment standards for new sources (PSNS).

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... be incompatible with treatment at the POTW; (iv) All spent cleaning solutions, including interior caustic washes, interior presolve washes, interior detergent washes, interior acid washes, and exterior... effective pre-treatment of segregated wastewaters (including heels, prerinse/pre-steam wastes, spent...

  14. 40 CFR 442.26 - Pretreatment standards for new sources (PSNS).

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... be incompatible with treatment at the POTW; (iv) All spent cleaning solutions, including interior caustic washes, interior presolve washes, interior detergent washes, interior acid washes, and exterior... effective pre-treatment of segregated wastewaters (including heels, prerinse/pre-steam wastes, spent...

  15. 40 CFR 442.16 - Pretreatment standards for new sources (PSNS).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... be incompatible with treatment at the POTW; (iv) All spent cleaning solutions, including interior caustic washes, interior presolve washes, interior detergent washes, interior acid washes, and exterior... effective pre-treatment of segregated wastewaters (including heels, prerinse/pre-steam wastes, spent...

  16. 40 CFR 442.16 - Pretreatment standards for new sources (PSNS).

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... be incompatible with treatment at the POTW; (iv) All spent cleaning solutions, including interior caustic washes, interior presolve washes, interior detergent washes, interior acid washes, and exterior... effective pre-treatment of segregated wastewaters (including heels, prerinse/pre-steam wastes, spent...

  17. 40 CFR 442.25 - Pretreatment standards for existing sources (PSES).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... be incompatible with treatment at the POTW; (iv) All spent cleaning solutions, including interior caustic washes, interior presolve washes, interior detergent washes, interior acid washes, and exterior... effective pre-treatment of segregated wastewaters (including heels, prerinse/pre-steam wastes, spent...

  18. 40 CFR 442.26 - Pretreatment standards for new sources (PSNS).

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... be incompatible with treatment at the POTW; (iv) All spent cleaning solutions, including interior caustic washes, interior presolve washes, interior detergent washes, interior acid washes, and exterior... effective pre-treatment of segregated wastewaters (including heels, prerinse/pre-steam wastes, spent...

  19. 40 CFR 442.26 - Pretreatment standards for new sources (PSNS).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... be incompatible with treatment at the POTW; (iv) All spent cleaning solutions, including interior caustic washes, interior presolve washes, interior detergent washes, interior acid washes, and exterior... effective pre-treatment of segregated wastewaters (including heels, prerinse/pre-steam wastes, spent...

  20. Quality of abdominal computed tomography angiography: hand versus mechanical intravenous contrast administration in children.

    PubMed

    Ayyala, Rama S; Zurakowski, David; Lee, Edward Y

    2015-11-01

    Abdominal CT angiography has been increasingly used for evaluation of various conditions related to abdominal vasculature in the pediatric population. However, no direct comparison has evaluated the quality of abdominal CT angiography in children using hand versus mechanical administration of intravenous (IV) contrast agent. To compare hand versus mechanical administration of IV contrast agent in the quality of abdominal CT angiography in the pediatric population. We retrospectively reviewed the electronic medical record to identify pediatric patients (≤18 years) who had abdominal CT angiography between August 2012 and August 2013. The information obtained includes: (1) type of administration of IV contrast agent (hand [group 1] versus mechanical [group 2]), (2) size (gauge) of IV catheter, (3) amount of contrast agent administered and (4) rate of contrast agent administration (ml/s). Two reviewers independently performed qualitative and quantitative evaluation of abdominal CT angiography image quality. Qualitative evaluation of abdominal CT angiography image quality was performed by visual assessment of the degree of contrast enhancement in the region of interest (ROI) based on a 4-point scale. Quantitative evaluation of each CT angiography examination was performed by measuring the Hounsfield unit (HU) using an ROI within the abdominal aorta at two levels (celiac axis and the inferior mesenteric artery) for each child. Analysis of variance (ANOVA) using the F-test was applied to compare contrast enhancement within the abdominal aorta at two levels (celiac axis and inferior mesenteric artery) between hand administration and mechanical administration of IV contrast methods with adjustment for age. We identified 46 pediatric patients (24 male, 22 female; mean age 7.3 ± 5.5 years; range 5 weeks to 18 years) with abdominal CT angiography performed during the study period. Of these patients, 16 (35%; 1.7 ± 2.2 years; range 5 weeks to 5 years) had hand administration of IV contrast agent and 30 (65%; 10.2 ± 4.2 years; range 4-18 years) had mechanical administration of IV contrast agent. All 46 abdominal CT angiography studies were of diagnostic quality based on qualitative evaluation (all ≥3). All abdominal CT angiography studies from both groups showed diagnostic quality of contrast enhancement (>150 HU) at both the celiac axis and the inferior mesenteric artery (IMA) levels. The contrast enhancement of the abdominal aorta was not significantly different between the IV contrast administration methods at either the celiac axis level (360 ± 158 vs. 353 ± 116, P = 0.24) or the IMA level (340 ± 140 vs. 351 ± 90, P = 0.27), adjusting for age. Diagnostic-quality abdominal CT angiography can be achieved using hand administration of IV contrast agent in infants and young children (≤5 years).

  1. The craving withdrawal model for alcoholism: towards the DSM-V. Improving the discriminant validity of alcohol use disorder diagnosis.

    PubMed

    de Bruijn, Carla; van den Brink, Wim; de Graaf, Ron; Vollebergh, Wilma A M

    2005-01-01

    To compare the discriminant validity of the DSM-IV and the ICD-10 classification of alcohol use disorders (AUD) with an alternative classification, the craving withdrawal model (CWM). CWM requires craving and withdrawal for the diagnosis of alcohol dependence and raises the alcohol abuse threshold to two DSM-IV AUD criteria. Data were derived from The Netherlands Mental Health Survey and Incidence Study, a large representative sample of the general Dutch population. In the present study, only non-abstinent subjects were included (n=6041). Three diagnostic systems (DSM-IV, ICD-10, and CWM) were compared using the following discriminant variables: alcohol intake, psychiatric comorbidity, functional status, familial alcohol problems, and treatment sought. The year prevalence of CWM alcohol dependence was lower than the prevalence of ICD-10 and DSM-IV dependence (0.3% vs 1.4% and 1.4%). The year prevalence of abuse was similar for CWM and DSM-IV (4.7 and 4.9%), but lower for ICD-10 harmful use (1.7%). DSM-IV resulted in a poor distinction between normality and abuse and ICD-10 resulted in a poor distinction between harmful use and dependence. In contrast, the CWM distinctions between normality and abuse, and between abuse, and dependence were significant for most of the discriminant variables. This study indicates that CWM improves the discriminant validity of AUD diagnoses. The predictive validity of the CWM for alcohol and other substance use disorders remain to be studied.

  2. Estimating the effect of treatment rate changes when treatment benefits are heterogeneous: antibiotics and otitis media.

    PubMed

    Park, Tae-Ryong; Brooks, John M; Chrischilles, Elizabeth A; Bergus, George

    2008-01-01

    Contrast methods to assess the health effects of a treatment rate change when treatment benefits are heterogeneous across patients. Antibiotic prescribing for children with otitis media (OM) in Iowa Medicaid is the empirical example. Instrumental variable (IV) and linear probability model (LPM) are used to estimate the effect of antibiotic treatments on cure probabilities for children with OM in Iowa Medicaid. Local area physician supply per capita is the instrument in the IV models. Estimates are contrasted in terms of their ability to make inferences for patients whose treatment choices may be affected by a change in population treatment rates. The instrument was positively related to the probability of being prescribed an antibiotic. LPM estimates showed a positive effect of antibiotics on OM patient cure probability while IV estimates showed no relationship between antibiotics and patient cure probability. Linear probability model estimation yields the average effects of the treatment on patients that were treated. IV estimation yields the average effects for patients whose treatment choices were affected by the instrument. As antibiotic treatment effects are heterogeneous across OM patients, our estimates from these approaches are aligned with clinical evidence and theory. The average estimate for treated patients (higher severity) from the LPM model is greater than estimates for patients whose treatment choices are affected by the instrument (lower severity) from the IV models. Based on our IV estimates it appears that lowering antibiotic use in OM patients in Iowa Medicaid did not result in lost cures.

  3. Expression of the rat CD26 antigen (dipeptidyl peptidase IV) on subpopulations of rat lymphocytes.

    PubMed

    Gorrell, M D; Wickson, J; McCaughan, G W

    1991-04-15

    The T cell activation antigen CD26 has been recently identified as the cell surface ectopeptidase dipeptidyl peptidase IV (DPP-IV). DPP-IV is found on many cell types, including lymphocytes, epithelial cells, and certain endothelial cells. The MRC OX61 monoclonal antibody (MAb) which specifically recognises rat DPP-IV was used to examine the expression of CD26/DPP-IV on rat lymphocytes. The molecular nature of the antigen was examined by immunoprecipitation from thymocytes, splenocytes, and hepatocytes. Analysis by one- and two-dimensional gel electrophoresis indicated that the native form of CD26 includes a 220-kDa homodimer. On tissue sections MRC OX61 MAb stained nearly all thymocytes and in the spleen and lymph nodes predominantly stained the T cell areas. However, in immunofluorescence experiments OX61 stained 80 to 87% of lymph node cells and 78 to 85% of spleen cells. Furthermore, two-colour immunofluorescence analysis of the CD4+, CD8+, and Ig+ lymphocyte subsets indicated that only 2 to 5% of each of these subsets lacked OX61 staining. Spleen cells and thymocytes of both CD4+ and CD8+ subsets stained much more intensely with OX61 after these cells were stimulated with phytohemagglutinin. These findings indicate that rat CD26 antigen expression is not confined to the T cell population as has been suggested, but also occurs on B cells, and is increased on T cells following their activation.

  4. High-redshift Galaxies and Black Holes Detectable with the JWST: A Population Synthesis Model from Infrared to X-Rays

    NASA Astrophysics Data System (ADS)

    Volonteri, Marta; Reines, Amy E.; Atek, Hakim; Stark, Daniel P.; Trebitsch, Maxime

    2017-11-01

    The first billion years of the Universe has been a pivotal time: stars, black holes (BHs), and galaxies formed and assembled, sowing the seeds of galaxies as we know them today. Detecting, identifying, and understanding the first galaxies and BHs is one of the current observational and theoretical challenges in galaxy formation. In this paper we present a population synthesis model aimed at galaxies, BHs, and active galactic nuclei (AGNs) at high redshift. The model builds a population based on empirical relations. The spectral energy distribution of galaxies is determined by age and metallicity, and that of AGNs by BH mass and accretion rate. We validate the model against observations, and predict properties of galaxies and AGN in other wavelength and/or luminosity ranges, estimating the contamination of stellar populations (normal stars and high-mass X-ray binaries) for AGN searches from the infrared to X-rays, and vice versa for galaxy searches. For high-redshift galaxies with stellar ages < 1 {Gyr}, we find that disentangling stellar and AGN emission is challenging at restframe UV/optical wavelengths, while high-mass X-ray binaries become more important sources of confusion in X-rays. We propose a color-color selection in the James Webb Space Telescope bands to separate AGN versus star-dominated galaxies in photometric observations. We also estimate the AGN contribution, with respect to massive, hot, and metal-poor stars, at driving high-ionization lines, such as C IV and He II. Finally, we test the influence of the minimum BH mass and occupation fraction of BHs in low-mass galaxies on the restframe UV/near-IR and X-ray AGN luminosity function.

  5. Variation is the universal: making cultural evolution work in developmental psychology.

    PubMed

    Kline, Michelle Ann; Shamsudheen, Rubeena; Broesch, Tanya

    2018-04-05

    Culture is a human universal, yet it is a source of variation in human psychology, behaviour and development. Developmental researchers are now expanding the geographical scope of research to include populations beyond relatively wealthy Western communities. However, culture and context still play a secondary role in the theoretical grounding of developmental psychology research, far too often. In this paper, we highlight four false assumptions that are common in psychology, and that detract from the quality of both standard and cross-cultural research in development. These assumptions are: (i) the universality assumption , that empirical uniformity is evidence for universality, while any variation is evidence for culturally derived variation; (ii) the Western centrality assumption , that Western populations represent a normal and/or healthy standard against which development in all societies can be compared; (iii) the deficit assumption , that population-level differences in developmental timing or outcomes are necessarily due to something lacking among non-Western populations; and (iv) the equivalency assumption , that using identical research methods will necessarily produce equivalent and externally valid data, across disparate cultural contexts. For each assumption, we draw on cultural evolutionary theory to critique and replace the assumption with a theoretically grounded approach to culture in development. We support these suggestions with positive examples drawn from research in development. Finally, we conclude with a call for researchers to take reasonable steps towards more fully incorporating culture and context into studies of development, by expanding their participant pools in strategic ways. This will lead to a more inclusive and therefore more accurate description of human development.This article is part of the theme issue 'Bridging cultural gaps: interdisciplinary studies in human cultural evolution'. © 2018 The Author(s).

  6. Kinetics of abiotic nitrous oxide production via oxidation of hydroxylamine by particulate metals in seawater

    NASA Astrophysics Data System (ADS)

    Cavazos, A. R.; Taillefert, M.; Glass, J. B.

    2016-12-01

    The oceans are a significant of nitrous oxide (N2O) to the atmosphere. Current models of global oceanic N2­O flux focus on microbial N2O cycling and often ignore abiotic reactions, such as the thermodynamically favorable oxidation of the nitrification intermediate hydroxylamine (NH2OH) by Mn(IV) or Fe(III). At circumneutral pH, NH2OH oxidation is more thermodynamically favorable via Mn(IV) than Fe(III) reduction. We characterized the kinetics of NH2OH oxidation in synthetic ocean water at pH 5.1-8.8 using microsensor electrodes to measure real-time N2O production. N2O production rates and yield were greater when NH2OH was oxidized by Mn(IV) than Fe(III). Accordingly, the reduction of Mn(IV) was first order with respect to NH2OH whereas the reduction of Fe(III) was zero order with respect to NH2OH. Interestingly, the order of the reaction with respect to Mn(IV) appears to be negative whereas the reaction is second order with respect to Fe(III). The inverse order with respect to Mn(IV) may be due to the aggregation of particles in seawater, which decreases their surface area and changes their reactivity. Finally, the reaction is first order with respect to protons with Fe(III) as the oxidant but zero order with Mn(IV). The stronger effect of the pH on the reaction with Fe(III) as the oxidant compared to Mn(IV) reflects the stoichiometry of these two reactions, as each mole of N2O produced by Fe(III) reduction consumes eight protons while each mole of N2O produced with Mn(IV) as the oxidant requires only four protons. Our data show that abiotic NH2OH oxidation by Mn(IV) or Fe(III) particles may represent a significant source of N2O in seawater. These findings suggest that abiotic N2O production in marine waters may be significant in areas of the oceans where particulate metals originating from aerosols, dust, or rivers may react with NH2OH released from ammonia-oxidizing microorganisms.

  7. Does source population size affect performance in new environments?

    PubMed Central

    Yates, Matthew C; Fraser, Dylan J

    2014-01-01

    Small populations are predicted to perform poorly relative to large populations when experiencing environmental change. To explore this prediction in nature, data from reciprocal transplant, common garden, and translocation studies were compared meta-analytically. We contrasted changes in performance resulting from transplantation to new environments among individuals originating from different sized source populations from plants and salmonids. We then evaluated the effect of source population size on performance in natural common garden environments and the relationship between population size and habitat quality. In ‘home-away’ contrasts, large populations exhibited reduced performance in new environments. In common gardens, the effect of source population size on performance was inconsistent across life-history stages (LHS) and environments. When transplanted to the same set of new environments, small populations either performed equally well or better than large populations, depending on life stage. Conversely, large populations outperformed small populations within native environments, but only at later life stages. Population size was not associated with habitat quality. Several factors might explain the negative association between source population size and performance in new environments: (i) stronger local adaptation in large populations and antagonistic pleiotropy, (ii) the maintenance of genetic variation in small populations, and (iii) potential environmental differences between large and small populations. PMID:25469166

  8. Brief Report: Investigating the Implications of Applying the New DSM-5 Criteria for Diagnosing Autism Spectrum Disorder in a Preschool Population in Singapore.

    PubMed

    Wong, Chui Mae; Koh, Hwan Cui

    2016-09-01

    Diagnostic reports for 206 children who underwent an assessment for autism spectrum disorder (ASD) using the DSM-IV-TR criteria, were re-evaluated using the DSM-5 criteria. Mean age of the children at time of diagnosis was 3 years 10 months. Of the 202 children diagnosed with ASD on the DSM-IV-TR, 184 (91.1 %) also met the DSM-5 criteria for ASD. The overall concordance rate of ASD diagnosis on the DSM-IV-TR and DSM-5 was higher than that reported in other studies. Of the 18 children who did not meet DSM-5 criteria for ASD, 16 children met all social communication criteria but did not fulfil at least two restricted and repetitive behaviour (RRB) criteria. Six of those children had further RRBs emerging later on follow-up.

  9. The Latin American experience of allografting patients with severe aplastic anaemia: real-world data on the impact of stem cell source and ATG administration in HLA-identical sibling transplants.

    PubMed

    Gómez-Almaguer, D; Vázquez-Mellado, A; Navarro-Cabrera, J R; Abello-Polo, V; Milovic, V; García, J; Basquiera, A L; Saba, S; Balladares, G; Vela-Ojeda, J; Gómez, S; Karduss-Aurueta, A; Bustinza-Álvarez, A; Requejo, A; Feldman, L; Jaime-Pérez, J C; Yantorno, S; Kusminsky, G; Gutiérrez-Aguirre, C H; Arbelbide, J; Martinez-Rolon, J; Jarchum, G; Jaimovich, G; Riera, L; Pedraza-Mesa, E; Villamizar-Gómez, L; Herrera-Rojas, M Á; Gamboa-Alonso, M M; Foncuberta, C; Rodríguez-González, G; García Ruiz-Esparza, M A; Hernández-Maldonado, E; Paz-Infanzón, M; González-López, E; Ruiz-Argüelles, G J

    2017-01-01

    We studied 298 patients with severe aplastic anaemia (SAA) allografted in four Latin American countries. The source of cells was bone marrow (BM) in 94 patients and PBSCs in 204 patients. Engraftment failed in 8.1% of recipients with no difference between BM and PBSCs (P=0.08). Incidence of acute GvHD (aGvHD) for BM and PBSCs was 30% vs 32% (P=0.18), and for grades III-IV was 2.6% vs 11.6% (P=0.01). Chronic GvHD (cGvHD) between BM and PBSCs was 37% vs 59% (P=0.002) and extensive 5% vs 23.6% (P=0.01). OS was 74% vs 76% for BM vs PBSCs (P=0.95). Event-free survival was superior in patients conditioned with anti-thymocyte globulin (ATG)-based regimens compared with other regimens (79% vs 61%, P=0.001) as excessive secondary graft failure was seen with other regimens (10% vs 26%, P=0.005) respectively. In multivariate analysis, aGvHD II-IV (hazard ratio (HR) 2.50, confidence interval (CI) 1.1-5.6, P=0.02) and aGvHD III-IV (HR 8.3 CI 3.4-20.2, P<0.001) proved to be independent negative predictors of survival. In conclusion, BM as a source of cells and ATG-based regimens should be standard because of higher GvHD incidence with PBSCs, although the latter combining with ATG in the conditioning regimen could be an option in selected high-risk patients.

  10. Sickle cell disease in the Kurdish population of northern Iraq.

    PubMed

    Al-Allawi, Nasir A S; Jalal, Sana D; Nerwey, Farida F; Al-Sayan, Galawezh O O; Al-Zebari, Sahima S M; Alshingaly, Awny A; Markous, Raji D; Jubrael, Jaladet M S; Hamamy, Hanan

    2012-01-01

    Epidemiological studies have revealed that sickle cell disease patients are clustered in two geographical areas in Iraq, one among the Arabs in the extreme south, another among the Kurdish population in the extreme north, where they constitute major health problems. However, no studies have focused on the genotypes responsible for sickle cell disease or the β-globin gene haplotypes associated with it. For the latter purpose, a total of 103 unrelated Kurdish sickle cell disease patients were evaluated by restriction fragment length polymorphism (RFLP) for the sickle cell mutation, followed by multiplex polymerase chain reaction (PCR) and reverse hybridization for β- and α-thalassemia (β- and α-thal) mutations, whenever indicated. Results showed that the most common genotype was sickle cell anemia (68.0%) followed by Hb S/β(0)-thal and Hb S/β(+)-thal at frequencies of 24.2 and 7.8%, respectively. Eight β-thal mutations were associated with the latter two genotypes including: IVS-II-1 (G>A), IVS-I-110 (G>A), codon 8 (-AA), codon 44 (-C), codon 22 (-7 bp), IVS-I-1 (G>A), codon 30 (G>C) and IVS-I-6 (T>C). In Hb SS patients, the -α(3.7) deletion was documented in 10.0% and was the only α-thal mutation detected. Furthermore, 5' β-globin gene cluster haplotyping of 128 β(S) chromosomes revealed that the most common haplotype seen in 69.5% was the Benin haplotype, followed by the Arab-Indian haplotype in 12.5%. These latter findings closely resemble reports from neighboring Turkey, Syria, Jordan, Lebanon and Mediterranean countries, suggesting a possible common origin, but are in contrast to findings from the Eastern Arabian Peninsula and Iran.

  11. The mental health impact of AIDS-related mortality in South Africa: a national study

    PubMed Central

    Myer, L; Seedat, S; Stein, D J; Moomal, H; Williams, D R

    2011-01-01

    Background Few data exist on how the HIV/AIDS epidemic may influence population mental health. The associations were examined between knowing someone who died of HIV/AIDS and common mental disorders among South African adults. Methods Between 2002 and 2004, a nationally representative sample of 4351 adults were interviewed about personally knowing someone who died of HIV/AIDS, and the World Health Organization Composite International Diagnostic Interview was used to generate psychiatric diagnoses for depression, anxiety and substance abuse disorders during the preceding 12 months based on the Diagnostic and Statistical Manual, 4th edition (DSM-IV). Results Overall, 42.2% of the sample knew someone who died of HIV/AIDS, and 16.5% met the criteria for at least one DSM-IV diagnosis. Individuals who knew someone who died of HIV/AIDS were significantly more likely to have any DSM-IV defined disorder, including any depressive, anxiety or substance-related disorder (p<0.001 for all associations). In multivariate models adjusted for participant demographic characteristics, life events and socioeconomic status, individual disorders significantly associated with knowing someone who died of HIV/AIDS included generalised anxiety disorder, social phobia and alcohol/drug dependence or abuse. Based on these results, it is estimated that up to 15% of 12-month DSM-IV disorders in the South African adult population may be related to knowing someone who died of HIV/AIDS. Conclusion These novel data suggest that AIDS-related mortality may contribute substantially to the burden of mental disorders in settings of high HIV prevalence. While this finding requires further investigation, these data suggest the need to strengthen mental health services in communities where HIV/AIDS is prevalent. PMID:19074926

  12. Relevance and Diversity of Nitrospira Populations in Biofilters of Brackish RAS

    PubMed Central

    Kruse, Myriam; Keuter, Sabine; Bakker, Evert; Spieck, Eva; Eggers, Till; Lipski, André

    2013-01-01

    Lithoautotrophic nitrite-oxidizing bacterial populations from moving-bed biofilters of brackish recirculation aquaculture systems (RAS; shrimp and barramundi) were tested for their metabolic activity and phylogenetic diversity. Samples from the biofilters were labeled with 13C-bicarbonate and supplemented with nitrite at concentrations of 0.3, 3 and 10 mM, and incubated at 17 and 28°C, respectively. The biofilm material was analyzed by fatty acid methyl ester - stable isotope probing (FAME-SIP). High portions of up to 45% of Nitrospira-related labeled lipid markers were found confirming that Nitrospira is the major autotrophic nitrite oxidizer in these brackish systems with high nitrogen loads. Other nitrite-oxidizing bacteria such as Nitrobacter or Nitrotoga were functionally not relevant in the investigated biofilters. Nitrospira-related 16S rRNA gene sequences were obtained from the samples with 10 mM nitrite and analyzed by a cloning approach. Sequence studies revealed four different phylogenetic clusters within the marine sublineage IV of Nitrospira, though most sequences clustered with the type strain of Nitrospira marina and with a strain isolated from a marine RAS. Three lipids dominated the whole fatty acid profiles of nitrite-oxidizing marine and brackish enrichments of Nitrospira sublineage IV organisms. The membranes included two marker lipids (16∶1 cis7 and 16∶1 cis11) combined with the non-specific acid 16∶0 as major compounds and confirmed these marker lipids as characteristic for sublineage IV species. The predominant labeling of these characteristic fatty acids and the phylogenetic sequence analyses of the marine Nitrospira sublineage IV identified organisms of this sublineage as main autotrophic nitrite-oxidizers in the investigated brackish biofilter systems. PMID:23705006

  13. Lifetime prevalence of mood and anxiety disorders in fragile X premutation carriers.

    PubMed

    Bourgeois, James A; Seritan, Andreea L; Casillas, E Melina; Hessl, David; Schneider, Andrea; Yang, Ying; Kaur, Inderjeet; Cogswell, Jennifer B; Nguyen, Danh V; Hagerman, Randi J

    2011-02-01

    The authors studied the lifetime prevalence of DSM-IV-TR psychiatric disorders in a population of adults with the fragile X premutation. The Structured Clinical Interview for DSM-IV was conducted, from 2007-2008, in 85 individuals with the fragile X premutation, 47 with the fragile X-associated tremor/ataxia syndrome (FXTAS; 33 male, 14 female; mean age = 66 years) and 38 without FXTAS (16 male, 22 female; mean age = 52 years). Lifetime prevalence for mood and anxiety disorders among carriers with and without FXTAS was compared to available age-specific population estimates from the National Comorbidity Survey Replication (NCS-R). Among participants with FXTAS, 30 (65%) met lifetime DSM-IV-TR criteria for a mood disorder; 24 (52%) met lifetime DSM-IV-TR criteria for an anxiety disorder. Among the non-FXTAS participants, there were 15 instances of lifetime mood disorder (42%) and 18 of lifetime anxiety disorder (47%). When compared to age-specific NCS-R data, the lifetime prevalences of any mood disorder (P < .0001), major depressive disorder (P < .0001), any anxiety disorder (P < .0001), panic disorder (P = .006), specific phobia (P = .0003), and posttraumatic stress disorder (P = .004) were significantly higher in participants with FXTAS. The lifetime rates of social phobia in individuals with the premutation without FXTAS were significantly higher than NCS-R data (P = .001). This sample of carriers of the fragile X premutation had a notably high lifetime risk of mood and anxiety disorders. Mood and anxiety disorders may be part of the clinical phenotype of the fragile X premutation conditions, especially in carriers with FXTAS. Clinicians encountering these patients are advised to consider FXTAS as a neuropsychiatric syndrome as well as a neurologic disorder. © Copyright 2011 Physicians Postgraduate Press, Inc.

  14. 40 CFR 302.8 - Continuous releases.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... PLANNING, AND COMMUNITY RIGHT-TO-KNOW PROGRAMS DESIGNATION, REPORTABLE QUANTITIES, AND NOTIFICATION § 302.8... sensitive populations and ecosystems within a one-mile radius of the facility or vessel (e.g., elementary schools, hospitals, retirement communities, or wetlands). (iv) For each hazardous substance release...

  15. A population of large neurons in laminae III and IV of the rat spinal cord that have long dorsal dendrites and lack the neurokinin 1 receptor

    PubMed Central

    Polgár, Erika; Thomson, Suzanne; Maxwell, David J; Al-Khater, Khulood; Todd, Andrew J

    2007-01-01

    The dorsal horn of the rat spinal cord contains a population of large neurons with cell bodies in laminae III or IV, that express the neurokinin 1 receptor (NK1r) and have long dorsal dendrites that branch extensively within the superficial laminae. In this study, we have identified a separate population of neurons that have similar dendritic morphology, but lack the NK1r. These cells also differ from the NK1r-expressing neurons in that they have significantly fewer contacts from substance P-containing axons and are not retrogradely labelled following injection of tracer into the caudal ventrolateral medulla. We also provide evidence that these cells do not belong to the postsynaptic dorsal column pathway or the spinothalamic tract. It is therefore likely that these cells do not have supraspinal projections. They may provide a route through which information transmitted by C fibres that lack neuropeptides is conveyed to deeper laminae. The present findings demonstrate the need for caution when attempting to classify neurons solely on the basis of somatodendritic morphology. PMID:17880393

  16. Alcohol dependence: international policy implications for prison populations.

    PubMed

    Jones, Gail Yvonne; Hoffmann, Norman G

    2006-11-08

    In light of the emphasis on drug abuse, this study explored the relative prevalence of substance use disorders among United Kingdom (UK) prison inmates in the context of findings from a general inmate population in the United States (US). The lead author of the report conducted a structured diagnostic interview with 155 new admissions to one of two prisons in the UK using the CAAPE (Comprehensive Addiction And Psychological Evaluation), a structured diagnostic interview, to ensure consistent assessments. The US sample consisted of 6,881 male inmates in a state prison system evaluated with an automated version of the SUDDS-IV (Substance Use Disorder Diagnostic Schedule-IV) interview. Alcohol dependence emerged as the most prevalent substance use disorder in both UK prisons and in the US sample. Relative frequencies of abuse and dependence for alcohol and other drugs revealed that dependence on a given substance was more prevalent than abuse ad defined by the current diagnostic criteria. Despite the emphasis on drugs in correctional populations, alcohol dependence appears to be the most prominent substance use disorder among the incarcerated in both the US and UK and must be considered in developing treatment programs and policy priorities.

  17. [Monitoring the Secondary Prevention of Coronary Artery Disease in Europe and Russia: Results of the Russian Part of the International Multicenter Study EUROASPIRE IV].

    PubMed

    Pogosova, N V; Oganov, R G; Boytsov, S A; Ausheva, A K; Sokolova, O J; Kursakov, A A; Pozdnyakov, Y M; Salbieva, Ma O; Lelchuk, I N; Gusarova, T A; Gomyranova, Mn V; Skazin, N A; Yeliseeva, N A; Akhmedova, E B; Bedeynikova, K K; Kovrigina, M N

    2015-12-01

    The results of the Russian part of the EUROASPIRE IV study show that we have a large room for improvement of traditional risk factors management in CAD patients hospitalized for acute myocardial infarction, acute coronary syndromes, PCI or CABG (at average in 1.7 years of follow-up after index events). It is also true for other European countries, although certain differences exist between Russian and whole study population. In some respects, the results of secondary prevention in Russian patients were even more successful: e.g. effective blood pressure control was achieved in 73.4% of our patients taking antihypertensive drugs vs 53.5% in whole study population. In contrast, smoking was more prevalent among Russian patients (22.2% vs 15.0% in other countries). Obviously, it was related to lower frequency of smoking cessation support offered to our patients: only 1.1% were referred to a smoking cessation program, 3.2% were prescribed nicotine replacement therapy, none were prescribed varenicline (vs 18.6, 22.9, 6.2%, respectively, in whole study population). The Russian cohort had the highest rate of overweight and obesity compared to other European countries (93.1 vs 82.1% in whole study population). 74.9% our patients received lipid lowering drugs (vs 86.6% in Europe), although the LDL-C goal was achieved only in 15.9% of our patients taking lipid lowering drugs (vs 21.1% in whole study population).

  18. SDSS-IV MaNGA: stellar population gradients as a function of galaxy environment

    NASA Astrophysics Data System (ADS)

    Goddard, D.; Thomas, D.; Maraston, C.; Westfall, K.; Etherington, J.; Riffel, R.; Mallmann, N. D.; Zheng, Z.; Argudo-Fernández, M.; Bershady, M.; Bundy, K.; Drory, N.; Law, D.; Yan, R.; Wake, D.; Weijmans, A.; Bizyaev, D.; Brownstein, J.; Lane, R. R.; Maiolino, R.; Masters, K.; Merrifield, M.; Nitschelm, C.; Pan, K.; Roman-Lopes, A.; Storchi-Bergmann, T.

    2017-02-01

    We study the internal radial gradients of stellar population properties within 1.5 Re and analyse the impact of galaxy environment. We use a representative sample of 721 galaxies with masses ranging between 109 M⊙ and 1011.5 M⊙ from the SDSS-IV survey MaNGA. We split this sample by morphology into early-type and late-type galaxies. Using the full spectral fitting code FIREFLY, we derive the light and mass-weighted stellar population properties, age and metallicity, and calculate the gradients of these properties. We use three independent methods to quantify galaxy environment, namely the Nth nearest neighbour, the tidal strength parameter Q and distinguish between central and satellite galaxies. In our analysis, we find that early-type galaxies generally exhibit shallow light-weighted age gradients in agreement with the literature and mass-weighted median age gradients tend to be slightly positive. Late-type galaxies, instead, have negative light-weighted age gradients. We detect negative metallicity gradients in both early- and late-type galaxies that correlate with galaxy mass, with the gradients being steeper and the correlation with mass being stronger in late-types. We find, however, that stellar population gradients, for both morphological classifications, have no significant correlation with galaxy environment for all three characterizations of environment. Our results suggest that galaxy mass is the main driver of stellar population gradients in both early and late-type galaxies, and any environmental dependence, if present at all, must be very subtle.

  19. Different populations of parvalbumin- and calbindin-D28k-immunoreactive neurons contain GABA and accumulate 3H-D-aspartate in the dorsal horn of the rat spinal cord.

    PubMed

    Antal, M; Polgár, E; Chalmers, J; Minson, J B; Llewellyn-Smith, I; Heizmann, C W; Somogyi, P

    1991-12-01

    The colocalization of parvalbumin (PV), calbindin-D28k (CaBP), GABA immunoreactivities, and the ability to accumulate 3H-D-aspartate selectively were investigated in neurons of laminae I-IV of the dorsal horn of the rat spinal cord. Following injection of 3H-D-aspartate into the basal dorsal horn (laminae IV-VI), perikarya selectively accumulating 3H-D-aspartate were detected in araldite embedded semithin sections by autoradiography, and consecutive semithin sections were treated to reveal PV, CaBP and GABA by postembedding immunocytochemistry. Perikarya accumulating 3H-D-aspartate were found exclusively in laminae I-III, and no labelled somata were found in deeper layers or in the intermediolateral column although the labelled amino acid clearly spread to these regions. More than half of the labelled cells were localized in lamina II. In this layer, 16.4% of 3H-D-aspartate-labelled perikarya were also stained for CaBP. In contrast to CaBP, PV or GABA was never detected in neurons accumulating 3H-D-aspartate. A high proportion of PV-immunoreactive perikarya were also stained for GABA in laminae II and III (70.0% and 61.2% respectively). However, the majority of CaBP-immunoreactive perikarya were GABA-negative. GABA-immunoreactivity was found in less than 2% of the total population of cells stained for CaBP in laminae I-IV. A significant proportion of the GABA-negative but PV-immunoreactive neurons also showed CaBP-immunoreactivity in laminae II and IV. These results show that out of the two calcium-binding proteins, CaBP is a characteristic protein of a small subpopulation of neurons using excitatory amino acids and PV is a characteristic protein of a subpopulation of neurons utilizing GABA as a transmitter. However, both proteins are present in additional subgroups of neurons, and neuronal populations using inhibitory or excitatory amino acid transmitters are heterogeneous with regard to their content of calcium-binding proteins in the dorsal horn of the rat spinal cord.

  20. Analysis of pharmacokinetics of Gd-DTPA for dynamic contrast-enhanced magnetic resonance imaging.

    PubMed

    Taheri, Saeid; Shah, N Jon; Rosenberg, Gary A

    2016-09-01

    The pharmacokinetics (PK) of the contrast agent Gd-DTPA administered intravenously (i.v.) for contrast-enhanced MR imaging (DCE-MRI) is an important factor for quantitative data acquisition. We studied the effect of various initial bolus doses on the PK of Gd-DTPA and analyzed population PK of a lower dose for intra-subject variations in DCE-MRI. First, fifteen subjects (23-85years, M/F) were randomly divided into four groups for DCE-MRI with different Gd-DTPA dose: group-I, 0.1mmol/kg, n=4; group-II, 0.05mmol/kg, n=4; group-III, 0.025mmol/kg, n=4; and group-IV, 0.0125mmol/kg, n=3. Sequential fast T1 mapping sequence, after a bolus i.v. Gd-DTPA administered, and a linear T1-[Gd-DTPA] relationship were used to estimate the PK of Gd-DTPA. Secondly, MR-acquired PKs of Gd-DTPA from 58 subjects (28-80years, M/F) were collected retrospectively, from an ongoing study of the brain using DCE-MRI with Gd-DTPA at 0.025mmol/kg, to statistically analyze population PK of Gd-DTPA. We found that the PK of Gd-DTPA (i.v. 0.025mmol/kg) had a half-life of 37.3±6.6min, and was a better fit into a linear T1-[Gd-DTPA] relationship than higher doses (up to 0.1mmol/kg). The area under the curve (AUC) for 0.025mmol/kg was 3.37±0.46, which was a quarter of AUC of 0.1mmol/kg. In population analysis, a dose of 0.025mmol/kg of Gd-DTPA provided less than 5% subject-dependent variation in the PK of Gd-DTPA. Administration of 0.025mmol/kg Gd-DTPA enabled us to estimate [Gd-DTPA] from T1 by using a linear relationship that has a lower estimation error compared to a non-linear relationship. DCE-MRI with a quarter dose of Gd-DTPA is more sensitive to detect changes in [Gd-DTPA]. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Prevalence of Temporomandibular Disorders in an Adult Brazilian Community Population Using the Research Diagnostic Criteria (Axes I and II) for Temporomandibular Disorders (The Maringá Study).

    PubMed

    Progiante, Patrícia Saram; Pattussi, Marcos Pascoal; Lawrence, Herenia P; Goya, Suzana; Grossi, Patrícia Krieger; Grossi, Márcio Lima

    2015-01-01

    The primary objective of this study was to assess the prevalence of temporomandibular disorders (TMDs) and comorbid factors (sleep bruxism and headaches). This study was a cross-sectional population survey in the city of Maringá, state of Paraná, Brazil. Axes I and II of the Research Diagnostic Criteria for TMD (RDC/TMD) were used for assessment of TMD signs and symptoms. The population was users of the Brazilian public health system (SUS), of both sexes, between the ages of 20 and 65 years, and not seeking treatment for TMD. The selected population (N = 1,643) was composed mostly of (a) women (65.9%), (b) married or single individuals (90.6%), (c) Caucasians (70.1%), (d) individuals aged 32.7 ± 10.3 years, (e) individuals earning a medium income (75.1%), and (f) those who had completed a high school education or higher (79.9%). According to the chronic pain grade classification (CPG) in the RDC/TMD Axis II, 36.2% of the population had some degree of TMD pain (CPG I to IV); however, only 5.1% had severe limitation due to pain (CPG III or IV). In the RDC/TMD Axis I diagnoses, 29.5% presented with muscle disorders (group I), 7.9% with disk displacements (group II), and 39.1% with other joint disorders (group III). Headaches were present in 67.9% and awake and sleep bruxism in 30% and 33.4% of the population, respectively. The prevalence of signs and symptoms of TMD was high in this population, but with low disability; however, the proportion of patients in need of treatment was much lower.

  2. Drosophila Nociceptors Mediate Larval Aversion to Dry Surface Environments Utilizing Both the Painless TRP Channel and the DEG/ENaC Subunit, PPK1

    PubMed Central

    Johnson, Wayne A.; Carder, Justin W.

    2012-01-01

    A subset of sensory neurons embedded within the Drosophila larval body wall have been characterized as high-threshold polymodal nociceptors capable of responding to noxious heat and noxious mechanical stimulation. They are also sensitized by UV-induced tissue damage leading to both thermal hyperalgesia and allodynia very similar to that observed in vertebrate nociceptors. We show that the class IV multiple-dendritic(mdIV) nociceptors are also required for a normal larval aversion to locomotion on to a dry surface environment. Drosophila melanogaster larvae are acutely susceptible to desiccation displaying a strong aversion to locomotion on dry surfaces severely limiting the distance of movement away from a moist food source. Transgenic inactivation of mdIV nociceptor neurons resulted in larvae moving inappropriately into regions of low humidity at the top of the vial reflected as an increased overall pupation height and larval desiccation. This larval lethal desiccation phenotype was not observed in wild-type controls and was completely suppressed by growth in conditions of high humidity. Transgenic hyperactivation of mdIV nociceptors caused a reciprocal hypersensitivity to dry surfaces resulting in drastically decreased pupation height but did not induce the writhing nocifensive response previously associated with mdIV nociceptor activation by noxious heat or harsh mechanical stimuli. Larvae carrying mutations in either the Drosophila TRP channel, Painless, or the degenerin/epithelial sodium channel subunit Pickpocket1(PPK1), both expressed in mdIV nociceptors, showed the same inappropriate increased pupation height and lethal desiccation observed with mdIV nociceptor inactivation. Larval aversion to dry surfaces appears to utilize the same or overlapping sensory transduction pathways activated by noxious heat and harsh mechanical stimulation but with strikingly different sensitivities and disparate physiological responses. PMID:22403719

  3. WarpIV: In situ visualization and analysis of ion accelerator simulations

    DOE PAGES

    Rubel, Oliver; Loring, Burlen; Vay, Jean -Luc; ...

    2016-05-09

    The generation of short pulses of ion beams through the interaction of an intense laser with a plasma sheath offers the possibility of compact and cheaper ion sources for many applications--from fast ignition and radiography of dense targets to hadron therapy and injection into conventional accelerators. To enable the efficient analysis of large-scale, high-fidelity particle accelerator simulations using the Warp simulation suite, the authors introduce the Warp In situ Visualization Toolkit (WarpIV). WarpIV integrates state-of-the-art in situ visualization and analysis using VisIt with Warp, supports management and control of complex in situ visualization and analysis workflows, and implements integrated analyticsmore » to facilitate query- and feature-based data analytics and efficient large-scale data analysis. WarpIV enables for the first time distributed parallel, in situ visualization of the full simulation data using high-performance compute resources as the data is being generated by Warp. The authors describe the application of WarpIV to study and compare large 2D and 3D ion accelerator simulations, demonstrating significant differences in the acceleration process in 2D and 3D simulations. WarpIV is available to the public via https://bitbucket.org/berkeleylab/warpiv. The Warp In situ Visualization Toolkit (WarpIV) supports large-scale, parallel, in situ visualization and analysis and facilitates query- and feature-based analytics, enabling for the first time high-performance analysis of large-scale, high-fidelity particle accelerator simulations while the data is being generated by the Warp simulation suite. Furthermore, this supplemental material https://extras.computer.org/extra/mcg2016030022s1.pdf provides more details regarding the memory profiling and optimization and the Yee grid recentering optimization results discussed in the main article.« less

  4. Discrimination, Racial/Ethnic Identity, and Substance Use Among Latina/os: Are They Gendered?

    PubMed

    Molina, Kristine M; Jackson, Benita; Rivera-Olmedo, Noemi

    2016-02-01

    Prior research suggests that stronger racial/ethnic identification offsets negative effects of discrimination on substance use. Yet research in this area and on whether gender modifies this association is limited for Latina/os. The purpose of the present study is to examine whether different sources of discrimination (everyday and racial/ethnic) are associated with substance use (alcohol use disorder, smoking), if racial/ethnic identity buffers this association, and the potential moderating role of gender among these variables. We present cross-sectional, US population-based data from the Latina/o adult sample (1427 females and 1127 males) of the National Latino and Asian American Study. Respondents completed self-reported measures of everyday and racial/ethnic discrimination, racial/ethnic identity, smoking status, and Diagnostic and Statistical Manual of Mental Disorders, 4th edition (DSM-IV) lifetime alcohol use disorder. Weighted logistic regression analyses showed that before inclusion of three-way interactions and adjusting for covariates, everyday discrimination predicted increased risk for any DSM-IV lifetime alcohol use disorders. Moderation analyses revealed that the effect of everyday discrimination on the risk of being a current smoker was strongest for Latino men with high levels of racial/ethnic identity compared to those with low racial/ethnic identity. No differences were noted among Latino women. There were no main or interaction effects of racial/ethnic discrimination for any substance use outcome. Findings suggest differential associations for type of discrimination and outcome and that the role of racial/ethnic identity is gender-specific for smoking, appearing particularly detrimental for Latino men reporting high levels of racial/ethnic identity.

  5. Posttraumatic stress disorder after cancer diagnosis in adults: A meta-analysis.

    PubMed

    Swartzman, Samantha; Booth, Josephine N; Munro, Alastair; Sani, Fabio

    2017-04-01

    Since the introduction of serious illness as a potential traumatic stressor in the fourth version of the Diagnostic and Statistical Manual of Mental Disorders (DSM-IV), research on the prevalence and predictors of posttraumatic stress disorder (PTSD) after cancer diagnosis has proliferated. Studies have reported widely varying estimates of the number of people with PTSD after cancer. The aim of this review is to synthesize quantitative data from studies reporting the proportion of people with PTSD among groups of cancer survivors. We undertook a diversified literature search strategy and identified 120 samples from 110 sources reporting a proportion of cancer survivors with PTSD. Of these, 11 studies, containing 12 samples, reported estimates of PTSD in cancer survivors compared to matched controls. A random effects meta-analysis estimated the odds ratio as 1.66 (95% confidence interval (CI): 1.09-2.53) for PTSD in cancer survivors compared to controls, although some of this apparent increase may have arisen from publication bias. Factors influencing the reported proportion of a postcancer sample with PTSD included measurement type (clinical interview vs. self-report instrument), type of cancer, type of treatment, geographic region, whether the term "posttraumatic stress" was in the title or abstract, prior trauma, age, and time since diagnosis. PTSD, diagnosed according to DSM-IV criteria, is more common in survivors of cancer than it is in the general population. Estimates of the occurrence of PTSD in patients with a history of cancer depend upon clinical and demographic factors, as well as upon study design. © 2016 Wiley Periodicals, Inc.

  6. On the origin of the warm-hot absorbers in the Milky Way's halo

    NASA Astrophysics Data System (ADS)

    Marasco, A.; Marinacci, F.; Fraternali, F.

    2013-08-01

    Disc galaxies like the Milky Way are expected to be surrounded by massive coronae of hot plasma that may contain a significant fraction of the so-called missing baryons. We investigate whether the local (|vLSR| < 400 km s-1) warm-hot absorption features observed towards extra-Galactic sources or halo stars are consistent with being produced by the cooling of the Milky Way's corona. In our scheme, cooling occurs at the interface between the disc and the corona and it is triggered by positive supernova feedback. We combine hydrodynamical simulations with a dynamical 3D model of the galactic fountain to predict the all-sky distribution of this cooling material, and we compare it with the observed distribution of detections for different `warm' (Si III, Si IV, C II, C IV) and `hot' (O VI) ionized species. The model reproduces the position-velocity distribution and the column densities of the vast majority of warm absorbers and about half of O VI absorbers. We conclude that the warm-hot gas responsible for most of the detections lies within a few kiloparsec from the Galactic plane, where high-metallicity material from the disc mixes efficiently with the hot corona. This process provides an accretion of a few M⊙ yr- 1 of fresh gas that can easily feed the star formation in the disc of the Galaxy. The remaining O VI detections are likely to be a different population of absorbers, located in the outskirts of the Galactic corona and/or in the circumgalactic medium of nearby galaxies.

  7. High Velocity Jet Noise Source Location and Reduction. Task 3. Experimental Investigation of Suppression Principles. Volume IV. Laser Velocimeter Time Dependent Cross Correlation Measurements.

    DTIC Science & Technology

    1978-12-01

    Density Filter Figure 4-4. Reference-Scatter or Direct Doppler Arrangement. L z--Scattering Miro 00 t! Volume L c K022 Laer Q7 K Photo Bea --nKO Tube...America, Vol. 30 No. 4, 1958, pp 318- 322 . 42. Seiner, J.M. and Reethof, G., "On the Distribution of Source Coherency in Subsonic Jets," AIAA 74-4 (1974). 43

  8. A Search for Wave Induced Particle Precipitation from Lightning and Transmitter Sources

    DTIC Science & Technology

    1988-01-01

    Observed and Modeled Event 50 Transmitter Whistler Sources 58 Summary 60 Chapter 4 The Wave Induced Particle Precipitation Campaign Instrumentation 63...101 ’ iii - k~rUM-rIF%9www Chapter 7 Summary and Conclusions Summary 102 Conclusions 105 Bibliography 107 iv LIST OF TABLES Number Page 1. Model ...Precipitation Bursts 56 2. X-Ray Detector Differential Channels 75 vB -- - -- - LIST OF FIGURES Number Page 1. Global Electrical circuit 2 2. Vertical

  9. Evaluation of pharmacokinetic and pharmacodynamic parameters following single dose of sitagliptin in healthy Indian males.

    PubMed

    Sangle, Ganesh V; Patil, Mohan; Deshmukh, Nitin J; Shengule, Sushant A; Kamble, Shantibhushan; Vuppalavanchu, Kiran Kumar; Kale, Sushil; Baig, Mirza Layeeq Ahmed; Singh, Geetchandra; Shaikh, Javed; Tripathi, Jitendra; Aravindababu, P

    2018-05-01

    Sitagliptin, a dipeptidyl peptidase (DPP)-IV inhibitor approved for the treatment of type 2 diabetes, is reported to be more efficacious in Indian patients than non-Indian patient population. The objective of the study was to evaluate pharmacokinetic and pharmacodynamic (PK/PD) parameters of single-dose sitagliptin 100 mg (Januvia) in healthy Indian male participants. In a randomised, single-dose, open-label, three-treatment, three-period, three-sequence, crossover bioavailability study, 18 healthy male participants received single-dose of sitagliptin under fasted and fed conditions. PK parameters (C max , T max , AUC 0-∞ and t 1/2 ) were determined using Phoenix WinNonlin software. PD parameters [DPP-IV inhibition, active glucagon-like peptide-1 (GLP-1) and insulin] were determined using established methods. PK parameters expressed in mean (SD) were C max 491.7 (135.9) ng/mL; AUC 0-∞ 4256.1 (509.9) ng· hr/mL, T max 2.9 (1.0) hr and t 1/2 10.4 (3.0) hr. The weighted average (WA) plasma DPP-4 inhibition over 24 h was 89.6% and WA of plasma active GLP-1 over 2 h after standardised meal (geometric mean ratio) was 11.1 (9.9) pM/L which is two- to- four fold higher compared to that reported in other populations. The mean average (SD) AUC of plasma insulin over 2 h of standardised meal was 47.9 (24.9) μIU/mL. Although, there are differences in pharmacokinetic parameters, no clinically meaningful differences were observed with respect to DPP-IV inhibition between Indian and non-Indian population.

  10. Repeated faecal occult blood testing is associated with decreased advanced colorectal cancer risk: A population-based study.

    PubMed

    James, Paul D; Rabeneck, Linda; Yun, Lingsong; Paszat, Lawrence; Baxter, Nancy N; Govindarajan, Anand; Antonova, Lilia; Tinmouth, Jill M

    2017-01-01

    Objective To evaluate the association between repeated faecal occult blood testing and advanced colorectal cancer risk at population level in Canada. Methods A retrospective cohort study of all Ontario residents aged 56-74 diagnosed with colorectal cancer from 1 April 2007 to 31 March 2010, identified using health administrative data. The primary outcome was stage IV colorectal cancer, and primary exposure was faecal occult blood testing use within five years prior to colorectal cancer diagnosis. Patients were categorized into four mutually exclusive groups based on their exposure to faecal occult blood testing in the five years prior to colorectal cancer diagnosis: none, pre-diagnostic, repeated, and sporadic. Logistic regression was utilized to adjust for confounders. Results Of 7753 patients (median age 66, interquartile range 61-70, 62% male) identified, 1694 (22%) presented with stage I, 2056 (27%) with stage II, 2428 (31%) with stage III, and 1575 (20%) with stage IV colorectal cancer. There were 4092 (53%) with no record of prior faecal occult blood testing, 1485 (19%) classified as pre-diagnostic, 1693 (22%) as sporadic, and 483 (6%) as repeated faecal occult blood testing. After adjusting for confounders, patients who had repeated faecal occult blood testing were significantly less likely to present with stage IV colorectal cancer at diagnosis (Odds ratio 0.46, 95% Confidence Interval 0.34-0.62) than those with no prior faecal occult blood testing. Conclusions Repeated faecal occult blood testing is associated with a decreased risk of advanced colorectal cancer. Our findings support the use of organized screening programmes that employ repeated faecal occult blood testing to improve colorectal cancer outcomes at population level.

  11. Interdisciplinary Systems-Based Intervention to Improve IV Hydration during Parenteral Administration of Acyclovir.

    PubMed

    Dubrofsky, Lisa; Kerzner, Ryan S; Delaunay, Chloë; Kolenda, Camille; Pepin, Jocelyne; Schwartz, Blair C

    2016-01-01

    Intravenous (IV) hydration is considered a protective factor in reducing the incidence of acyclovir-induced nephrotoxicity. A systems-based review of cases of acyclovir-associated acute kidney injury can be used to examine institution-, care provider-, and task-related factors involved in administering the drug and can serve as a basis for developing a quality improvement intervention to achieve safer administration of acyclovir. To explore the effectiveness of the study institution's inter-disciplinary quality improvement intervention in increasing the dilution of acyclovir before IV administration. After conducting a systems-based review for intervention development, a retrospective analysis was undertaken to compare IV administration of acyclovir in the 6-month periods before and after implementation of the intervention. The study population was a sequential sample of all patients over 18 years of age who were seen in the emergency department or admitted to a ward and who received at least one IV dose of acyclovir at the study institution. The primary outcome was the volume in which each acyclovir dose was delivered. The secondary outcomes were the hourly rate of fluid administration, the frequency of an increase in hourly hydration rate, and the incidence of acute kidney injury. Eighty-four patients (44 in the pre-intervention period and 40 in the post-intervention period) received IV acyclovir and had evaluable data for the primary outcome. The median volume in which the acyclovir dose was administered was significantly higher in the post-intervention group (250 mL versus 100 mL, p < 0.001). In this study, an easily implemented intervention significantly increased the volume of IV fluid administered to patients receiving acyclovir. Adequately powered prospective studies are suggested to investigate the effectiveness of this intervention on the clinically relevant incidence of acyclovir-induced nephrotoxicity.

  12. Dipeptidyl peptidase-IV inhibitor use associated with increased risk of ACE inhibitor-associated angioedema.

    PubMed

    Brown, Nancy J; Byiers, Stuart; Carr, David; Maldonado, Mario; Warner, Barbara Ann

    2009-09-01

    Dipeptidyl peptidase-IV (DPP-IV) inhibitors decrease degradation of the incretins. DPP-IV inhibitors also decrease degradation of peptides, such as substance P, that may be involved in the pathogenesis of angiotensin-converting enzyme (ACE) inhibitor-associated angioedema. This study tested the hypothesis that DPP-IV inhibition affects risk of clinical angioedema, by comparing the incidence of angioedema in patients treated with the DPP-IV inhibitor vildagliptin versus those treated with comparator in Phase III randomized clinical trials. Prospectively defined angioedema-related events were adjudicated in a blinded fashion by an internal medicine adjudication committee and expert reviewer. Concurrent ACE inhibitor or angiotensin receptor blocker exposure was ascertained from case report forms. Study drug exposure was ascertained from unblinded data from phase III studies. Odds ratios and 95% confidence intervals comparing angioedema risk in vildagliptin-treated and comparator-treated patients were calculated for the overall population and for patients taking ACE inhibitors or angiotensin receptor blockers, using both an analysis of pooled data and a meta-analysis (Peto method). Overall, there was no association between vildagliptin use and angioedema. Among individuals taking an ACE inhibitor, however, vildagliptin use was associated with an increased risk of angioedema (14 confirmed cases among 2754 vildagliptin users versus 1 case among 1819 comparator users: odds ratio 4.57 [95% confidence interval 1.57 to 13.28]) in the meta-analysis. Vildagliptin use may be associated with increased risk of angioedema among patients taking ACE inhibitors, although absolute risk is small. Physicians confronted with angioedema in a patient taking an ACE inhibitor and DPP-IV inhibitor should consider this possible drug-drug interaction.

  13. The effect of draft DSM-V criteria on posttraumatic stress disorder prevalence.

    PubMed

    Calhoun, Patrick S; Hertzberg, Jeffrey S; Kirby, Angela C; Dennis, Michelle F; Hair, Lauren P; Dedert, Eric A; Beckham, Jean C

    2012-12-01

    This study was designed to examine the concordance of proposed DSM-V posttraumatic stress disorder (PTSD) criteria with DSM-IV classification rules and examine the impact of the proposed DSM-V PTSD criteria on prevalence. The sample (N = 185) included participants who were recruited for studies focused on trauma and health conducted at an academic medical center and VA medical center in the southeastern United States. The prevalence and concordance between DSM-IV and the proposed DSM-V classifications were calculated based on results from structured clinical interviews. Prevalence rates and diagnostic efficiency indices including sensitivity, specificity, area under the curve (AUC), and Kappa were calculated for each of the possible ways to define DSM-V PTSD. Ninety-five percent of the sample reported an event that met both DSM-IV PTSD Criterion A1 and A2, but only 89% reported a trauma that met Criterion A on DSM-V. Results examining concordance between DSM-IV and DSM-V algorithms indicated that several of the algorithms had AUCs above 0.90. The requirement of two symptoms from both Clusters D and E provided strong concordance to DSM-IV (AUC = 0.93; Kappa = 0.86) and a greater balance between sensitivity and specificity than requiring three symptoms in both Clusters D and E. Despite several significant changes to the diagnostic criteria for PTSD for DSM-V, several possible classification rules provided good concordance with DSM-IV. The magnitude of the impact of DSM-V decision rules on prevalence will be largely affected by the DSM-IV PTSD base rate in the population of interest. © 2012 Wiley Periodicals, Inc.

  14. Probing the X-Ray Binary Populations of the Ring Galaxy NGC 1291

    NASA Technical Reports Server (NTRS)

    Luo, B.; Fabbiano, G.; Fragos, T.; Kim, D. W.; Belczynski, K.; Brassington, N. J.; Pellegrini, S.; Tzanavaris, P.; Wang, J.; Zezas, A.

    2012-01-01

    We present Chandra studies of the X-ray binary (XRB) populations in the bulge and ring regions of the ring galaxy NGC 1291. We detect 169 X-ray point sources in the galaxy, 75 in the bulge and 71 in the ring, utilizing the four available Chandra observations totaling an effective exposure of 179 ks. We report photometric properties of these sources in a point-source catalog. There are approx. 40% of the bulge sources and approx. 25% of the ring sources showing > 3(sigma) long-term variability in their X-ray count rate. The X-ray colors suggest that a significant fraction of the bulge (approx. 75%) and ring (approx. 65%) sources are likely low-mass X-ray binaries (LMXBs). The spectra of the nuclear source indicate that it is a low-luminosity AGN with moderate obscuration; spectral variability is observed between individual observations. We construct 0.3-8.0 keV X-ray luminosity functions (XLFs) for the bulge and ring XRB populations, taking into account the detection incompleteness and background AGN contamination. We reach 90% completeness limits of approx.1.5 x 10(exp 37) and approx. 2.2 x 10(exp 37) erg/s for the bulge and ring populations, respectively. Both XLFs can be fit with a broken power-law model, and the shapes are consistent with those expected for populations dominated by LMXBs. We perform detailed population synthesis modeling of the XRB populations in NGC 1291 , which suggests that the observed combined XLF is dominated by aD old LMXB population. We compare the bulge and ring XRB populations, and argue that the ring XRBs are associated with a younger stellar population than the bulge sources, based on the relative over-density of X-ray sources in the ring, the generally harder X-ray color of the ring sources, the overabundance of luminous sources in the combined XLF, and the flatter shape of the ring XLF.

  15. Resonant tunneling diodes as sources for millimeter and submillimeter wavelengths

    NASA Technical Reports Server (NTRS)

    Vanbesien, O.; Bouregba, R.; Mounaix, P.; Lippens, D.; Palmateer, L.; Pernot, J. C.; Beaudin, G.; Encrenaz, P.; Bockenhoff, E.; Nagle, J.

    1992-01-01

    High-quality Resonant Tunneling Diodes have been fabricated and tested as sources for millimeter and submillimeter wavelengths. The devices have shown excellent I-V characteristics with peak-to-valley current ratios as high as 6:1 and current densities in the range of 50-150 kA/cm(exp 2) at 300 K. Used as local oscillators, the diodes are capable of state of the art output power delivered by AlGaAs-based tunneling devices. As harmonic multipliers, a frequency of 320 GHz has been achieved by quintupling the fundamental oscillation of a klystron source.

  16. ASTRONAUTICS INFORMATION. ABSTRACTS, VOLUME IV, NO. 5. Abstracts 4,428- 4,521

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hardgrove, B.J.; Warren, F.L. comps.

    1961-11-01

    A bibliography on astronautics is presented covering the period of November 1961. The 93 references are on flight dynamics, vehicle technology, communications, guidance, control, manned flight, space medicine, and space science. Author, subject, and source indexes are included. (M.C.G.)

  17. 40 CFR 442.25 - Pretreatment standards for existing sources (PSES).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... contribute to a discharge that would be incompatible with treatment at the POTW; (iv) All spent cleaning solutions, including interior caustic washes, interior presolve washes, interior detergent washes, interior..., prerinse/pre-steam wastes, spent cleaning solutions); (ix) Information on the volumes, content, and...

  18. 40 CFR 442.15 - Pretreatment standards for existing sources (PSES).

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... contribute to a discharge that would be incompatible with treatment at the POTW; (iv) All spent cleaning solutions, including interior caustic washes, interior presolve washes, interior detergent washes, interior..., prerinse/pre-steam wastes, spent cleaning solutions); (ix) Information on the volumes, content, and...

  19. 40 CFR 442.15 - Pretreatment standards for existing sources (PSES).

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... contribute to a discharge that would be incompatible with treatment at the POTW; (iv) All spent cleaning solutions, including interior caustic washes, interior presolve washes, interior detergent washes, interior..., prerinse/pre-steam wastes, spent cleaning solutions); (ix) Information on the volumes, content, and...

  20. 40 CFR 442.25 - Pretreatment standards for existing sources (PSES).

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... contribute to a discharge that would be incompatible with treatment at the POTW; (iv) All spent cleaning solutions, including interior caustic washes, interior presolve washes, interior detergent washes, interior..., prerinse/pre-steam wastes, spent cleaning solutions); (ix) Information on the volumes, content, and...

  1. 40 CFR 442.15 - Pretreatment standards for existing sources (PSES).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... contribute to a discharge that would be incompatible with treatment at the POTW; (iv) All spent cleaning solutions, including interior caustic washes, interior presolve washes, interior detergent washes, interior..., prerinse/pre-steam wastes, spent cleaning solutions); (ix) Information on the volumes, content, and...

  2. 40 CFR 442.25 - Pretreatment standards for existing sources (PSES).

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... contribute to a discharge that would be incompatible with treatment at the POTW; (iv) All spent cleaning solutions, including interior caustic washes, interior presolve washes, interior detergent washes, interior..., prerinse/pre-steam wastes, spent cleaning solutions); (ix) Information on the volumes, content, and...

  3. 40 CFR 63.1313 - Emission standards.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 11 2010-07-01 2010-07-01 true Emission standards. 63.1313 Section 63...) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS FOR SOURCE CATEGORIES National Emission Standards for Hazardous Air Pollutant Emissions: Group IV Polymers and Resins § 63.1313 Emission standards. (a...

  4. Potential Aquifer Vulnerability in Regions Down-Gradient from Uranium In Situ Recovery (ISR) Sites

    EPA Science Inventory

    Sandstone-hosted roll-front uranium ore deposits originate when U(VI) dissolved in groundwater is reduced and precipitated as insoluble U(IV) minerals. Groundwater redox geochemistry, aqueous complexation, and solute migration are instrumental in leaching uranium from source rock...

  5. 10 CFR 851.27 - Reference sources.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ..., NY 10036. Telephone number: 212-642-4980, or go to: http://www.ansi.org. (iv) National Fire....nfpa.org. (v) American Conference of Governmental Industrial Hygienist (ACGIH), 1330 Kemper Meadow Drive, Cincinnati, OH 45240. Telephone number 513-742-2020, or go to: http://www.acgih.org. (vi...

  6. 40 CFR 63.1326 - Batch process vents-recordkeeping provisions.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... PROGRAMS (CONTINUED) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS FOR SOURCE CATEGORIES (CONTINUED) National Emission Standards for Hazardous Air Pollutant Emissions: Group IV Polymers and Resins... requirements for Group 2 batch process vents that are exempt from the batch mass input limitation provisions...

  7. Mixed-source reintroductions lead to outbreeding depression in second-generation descendents of a native North American fish

    USGS Publications Warehouse

    Huff, D.D.; Miller, L.M.; Chizinski, C.J.; Vondracek, B.

    2011-01-01

    Reintroductions are commonly employed to preserve intraspecific biodiversity in fragmented landscapes. However, reintroduced populations are frequently smaller and more geographically isolated than native populations. Mixing genetically, divergent sources are often proposed to attenuate potentially low genetic diversity in reintroduced populations that may result from small effective population sizes. However, a possible negative tradeoff for mixing sources is outbreeding depression in hybrid offspring. We examined the consequences of mixed-source reintroductions on several fitness surrogates at nine slimy sculpin (Cottus cognatus) reintroduction sites in south-east Minnesota. We inferred the relative fitness of each crosstype in the reintroduced populations by comparing their growth rate, length, weight, body condition and persistence in reintroduced populations. Pure strain descendents from a single source population persisted in a greater proportion than expected in the reintroduced populations, whereas all other crosstypes occurred in a lesser proportion. Length, weight and growth rate were lower for second-generation intra-population hybrid descendents than for pure strain and first-generation hybrids. In the predominant pure strain, young-of the-year size was significantly greater than any other crosstype. Our results suggested that differences in fitness surrogates among crosstypes were consistent with disrupted co-adapted gene complexes associated with beneficial adaptations in these reintroduced populations. Future reintroductions may be improved by evaluating the potential for local adaptation in source populations or by avoiding the use of mixed sources by default when information on local adaptations or other genetic characteristics is lacking. ?? 2011 Blackwell Publishing Ltd.

  8. Quality of the relationship between origin of childhood perception of attachment and outcome of attachment associated with diagnosis of PTSD in adult Finnish war children and Finnish combat veterans from World War II (1939-1945) - DSM-IV applications of the attachment theory.

    PubMed

    Andersson, Pentti Kalevi

    2015-06-01

    Using diagnoses exclusively, comparable evaluations of the empirical evidence relevant to the content can be made. The term holocaust survivor syndrome according to the DSM-IV classification encompasses people with diagnoses of posttraumatic stress disorders and psychopathological symptoms exposed to the Nazi genocide from 1933-1945 identified by Natan Kellermann, AMCHA, Israel (1999). The relationships between disorders of affectionate parenting and the development of dysfunctional models on one hand, and various psychopathological disorders on the other hand were investigated. Multi-axial assessment based on PTSD diagnosis (APA, 2000) with DSM-IV classification criteria of holocaust survivor syndrome and child survivor syndrome earlier found in holocaust survivors was used as criteria for comparison among Finnish sub-populations. Symptoms similar to those previously described in association with holocaust survivor syndrome and child survivor syndrome were found in the population of Finnish people who had been displaced as children between 1939-1945. Complex PTSD syndrome is found among survivors of prolonged or repeated trauma who have coping strategies intended to assist their mental survival. Surviving Finnish child evacuees had symptoms at similar level to those reported among holocaust survivors, though Finnish combat veterans exhibited good mental adjustment with secure attachment.

  9. Relationship between personality disorder dimensions and verbal memory functioning in a community population.

    PubMed

    Park, Subin; Hong, Jin Pyo; Lee, Hochang B; Samuels, Jack; Bienvenu, O Joseph; Chung, Hye Yoon; Eaton, William W; Costa, Paul T; Nestadt, Gerald

    2012-03-30

    Based on the Baltimore Epidemiologic Catchment Area (ECA) follow-up survey, we examined relationships between dimensions of Diagnostic and Statistical Manual of Mental Disorders (DSM-IV) personality disorders and both subjective and objective memory functioning in a community population. Our study subjects consisted of 736 individuals from the ECA follow-up study of the original Baltimore ECA cohort, conducted between 1993 and 1996 and available for assessment in the Hopkins Epidemiology Study of Personality Disorders from 1997 to 1999. Subjects were assessed for DSM-IV personality disorders using a semi-structured instrument, the International Personality Disorder Examination, and were asked about a subjective appraisal of memory. Verbal memory function, including immediate recall, delayed recall, and recognition, were also evaluated. Multiple linear regression analyses were used to determine associations between personality dimensions of DSM-IV Axis II traits and subjective and objective memory functioning. Scores on schizoid and schizotypal personality dimensions were associated with subjective and objective memory dysfunction, both with and without adjustment for Axis I disorders. Borderline, antisocial, avoidant, and dependent personality disorder scores were associated with subjective memory impairment only, both with and without adjustment for Axis I disorders. This study suggests that subjective feelings of memory impairment and/or objective memory dysfunction are associated with specific personality disorder dimensions. Copyright © 2011 Elsevier Ltd. All rights reserved.

  10. Semiparametric methods for estimation of a nonlinear exposure-outcome relationship using instrumental variables with application to Mendelian randomization.

    PubMed

    Staley, James R; Burgess, Stephen

    2017-05-01

    Mendelian randomization, the use of genetic variants as instrumental variables (IV), can test for and estimate the causal effect of an exposure on an outcome. Most IV methods assume that the function relating the exposure to the expected value of the outcome (the exposure-outcome relationship) is linear. However, in practice, this assumption may not hold. Indeed, often the primary question of interest is to assess the shape of this relationship. We present two novel IV methods for investigating the shape of the exposure-outcome relationship: a fractional polynomial method and a piecewise linear method. We divide the population into strata using the exposure distribution, and estimate a causal effect, referred to as a localized average causal effect (LACE), in each stratum of population. The fractional polynomial method performs metaregression on these LACE estimates. The piecewise linear method estimates a continuous piecewise linear function, the gradient of which is the LACE estimate in each stratum. Both methods were demonstrated in a simulation study to estimate the true exposure-outcome relationship well, particularly when the relationship was a fractional polynomial (for the fractional polynomial method) or was piecewise linear (for the piecewise linear method). The methods were used to investigate the shape of relationship of body mass index with systolic blood pressure and diastolic blood pressure. © 2017 The Authors Genetic Epidemiology Published by Wiley Periodicals, Inc.

  11. Neurocognitive and neurodevelopmental impact of prenatal methamphetamine exposure: A comparison study of prenatally exposed children with nonexposed ADHD peers.

    PubMed

    Brinker, Michael J; Cohen, Jodie G; Sharrette, Johnathan A; Hall, Trevor A

    2017-11-29

    Prenatal methamphetamine exposure has become an increasingly pervasive concern, especially in rural-based populations and populations of lower socioeconomic status. While research has begun to highlight the effects of prenatal methamphetamine exposure, the long-term impact of this exposure remains an under-investigated topic. This study attempts to investigate the neurocognitive and neurodevelopmental effects of prenatal methamphetamine exposure by comparing the index and full-scale IQ scores on the WISC-IV between a sample of clinically referred children prenatally exposed to methamphetamine (N = 80) and a sample of clinically referred nonexposed children diagnosed with ADHD (N = 44). Children prenatally exposed to methamphetamine showed significantly lower scores on all WISC-IV domains when compared to peers with ADHD. When taking into account polysubstance exposure to alcohol, these differences remained statistically significant, with the exception of the Processing Speed Index (PSI); children reported to have been prenatally exposed to methamphetamine and to alcohol (PME) remained below ADHD peers on all other WISC-IV index scores. Within the prenatally exposed sample, regression analyses indicated that age was a significant negative predictor of PSI scores. Overall findings suggest that prenatal methamphetamine exposure is associated with a notable cognitive impact independent of polysubstance exposure to alcohol, and that the impact of this exposure on processing speed skills may become more pronounced with age.

  12. Semiparametric methods for estimation of a nonlinear exposure‐outcome relationship using instrumental variables with application to Mendelian randomization

    PubMed Central

    Staley, James R.

    2017-01-01

    ABSTRACT Mendelian randomization, the use of genetic variants as instrumental variables (IV), can test for and estimate the causal effect of an exposure on an outcome. Most IV methods assume that the function relating the exposure to the expected value of the outcome (the exposure‐outcome relationship) is linear. However, in practice, this assumption may not hold. Indeed, often the primary question of interest is to assess the shape of this relationship. We present two novel IV methods for investigating the shape of the exposure‐outcome relationship: a fractional polynomial method and a piecewise linear method. We divide the population into strata using the exposure distribution, and estimate a causal effect, referred to as a localized average causal effect (LACE), in each stratum of population. The fractional polynomial method performs metaregression on these LACE estimates. The piecewise linear method estimates a continuous piecewise linear function, the gradient of which is the LACE estimate in each stratum. Both methods were demonstrated in a simulation study to estimate the true exposure‐outcome relationship well, particularly when the relationship was a fractional polynomial (for the fractional polynomial method) or was piecewise linear (for the piecewise linear method). The methods were used to investigate the shape of relationship of body mass index with systolic blood pressure and diastolic blood pressure. PMID:28317167

  13. Pore-Scale Characterization of Biogeochemical Controls on Iron and Uranium Speciation under Flow Conditions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pearce, Carolyn I.; Wilkins, Michael J.; Zhang, Changyong

    2012-09-17

    Etched silicon microfluidic pore network models (micromodels) with controlled chemical and redox gradients, mineralogy, and microbiology under continuous flow conditions are used for the incremental development of complex microenvironments that simulate subsurface conditions. We demonstrate the colonization of micromodel pore spaces by an anaerobic Fe(III)-reducing bacterial species (Geobacter sulfurreducens) and the enzymatic reduction of a bioavailable Fe(III) phase within this environment. Using both X-ray Microprobe and X-ray Absorption Spectroscopy, we investigate the combined effects of the precipitated Fe(III) phases and the microbial population on uranium biogeochemistry under flow conditions. Precipitated Fe(III) phases within the micromodel were most effectively reduced inmore » the presence of an electron shuttle (AQDS), and Fe(II) ions adsorbed onto the precipitated mineral surface without inducing any structural change. In the absence of Fe(III), U(VI) was effectively reduced by the microbial population to insoluble U(IV), which was precipitated in discrete regions associated with biomass. In the presence of Fe(III) phases, however, both U(IV) and U(VI) could be detected associated with biomass, suggesting re-oxidation of U(IV) by localized Fe(III) phases. These results demonstrate the importance of the spatial localization of biomass and redox active metals, and illustrate the key effects of pore-scale processes on contaminant fate and reactive transport.« less

  14. Relationships between lumbar inter-vertebral motion and lordosis in healthy adult males: a cross sectional cohort study.

    PubMed

    du Rose, Alister; Breen, Alan

    2016-03-10

    Intervertebral motion impairment is widely thought to be related to chronic back disability, however, the movements of inter-vertebral pairs are not independent of each other and motion may also be related to morphology. Furthermore, maximum intervertebral range of motion (IV-RoMmax) is difficult to measure accurately in living subjects. The purpose of this study was to explore possible relationships between (IV-RoMmax) and lordosis, initial attainment rate and IV-RoMmax at other levels during weight-bearing flexion using quantitative fluoroscopy (QF). Continuous QF motion sequences were recorded during controlled active sagittal flexion of 60° in 18 males (mean age 27.6 SD 4.4) with no history of low back pain in the previous year. IV-RoMmax, lordotic angle, and initial attainment rate at all inter-vertebral levels from L2-S1 were extracted. Relationships between IV-RoMmax and the other variables were explored using correlation coefficients, and simple linear regression was used to determine the effects of any significant relationships. Within and between observer repeatability of IV-RoMmax and initial attainment rate measurements were assessed in a sub-set of ten participants, using the intra-class correlation coefficient (ICC) and standard error of measurement (SEM). QF measurements were highly repeatable, the lowest ICC for IV-RoMmax, being 0.94 (0.80-0.99) and highest SEM (0.76°). For initial attainment rate the lowest ICC was 0.84 (0.49-0.96) and the highest SEM (0.036). The results also demonstrated significant positive and negative correlations between IV-RoMmax and IV-RoMmax at other lumbar levels (r = -0.64-0.65), lordosis (r = -0.52-0.54), and initial attainment rate (r = -0.64-0.73). Simple linear regression analysis of all significant relationships showed that these predict between 28 and 42 % of the variance in IV-RoMmax. This study found weak to moderate effects of individual kinematic variables and lumbar lordosis on IV-RoMmax at other intervertebral levels. These effects, when combined, may be important when such levels are being considered by healthcare professionals as potential sources of pain generation. Multivariate investigations in larger samples are warranted.

  15. 40 CFR 125.63 - Establishment of a monitoring program.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... to the extent practicable: (i) Periodic surveys of the biological communities and populations which... surveys; (ii) Periodic determinations of the accumulation of toxic pollutants and pesticides in organisms... surveys and to measure the accumulation of toxic pollutants and pesticides; and (iv) Where the discharge...

  16. 40 CFR 125.63 - Establishment of a monitoring program.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... to the extent practicable: (i) Periodic surveys of the biological communities and populations which... surveys; (ii) Periodic determinations of the accumulation of toxic pollutants and pesticides in organisms... surveys and to measure the accumulation of toxic pollutants and pesticides; and (iv) Where the discharge...

  17. 40 CFR 125.63 - Establishment of a monitoring program.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... to the extent practicable: (i) Periodic surveys of the biological communities and populations which... surveys; (ii) Periodic determinations of the accumulation of toxic pollutants and pesticides in organisms... surveys and to measure the accumulation of toxic pollutants and pesticides; and (iv) Where the discharge...

  18. 40 CFR 125.63 - Establishment of a monitoring program.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... to the extent practicable: (i) Periodic surveys of the biological communities and populations which... surveys; (ii) Periodic determinations of the accumulation of toxic pollutants and pesticides in organisms... surveys and to measure the accumulation of toxic pollutants and pesticides; and (iv) Where the discharge...

  19. 40 CFR 125.63 - Establishment of a monitoring program.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... to the extent practicable: (i) Periodic surveys of the biological communities and populations which... surveys; (ii) Periodic determinations of the accumulation of toxic pollutants and pesticides in organisms... surveys and to measure the accumulation of toxic pollutants and pesticides; and (iv) Where the discharge...

  20. Hepatitis-C prevalence in an urban native-American clinic: a prospective screening study.

    PubMed Central

    Neumeister, Amy S.; Pilcher, LaVada E.; Erickson, Judi M.; Langley, Lora L.; Murphy, Mary M.; Haukaas, Nicole M.; Mailliard, Mark E.; Larsen, Jennifer L.

    2007-01-01

    BACKGROUND: Native-American populations are disproportionately burdened by chronic liver disease, and the prevalence of hepatitis C (HCV) in native Americans is unknown. PURPOSE: To determine the prevalence of hepatitis C in a local native-American population via a prospective screening study. PROCEDURES: Two-hundred-forty-three native Americans (161 females/82 males) using an urban clinic and representing > 30 tribes from across the United States were screened. Mean age was 41 +/- 1 years. Hepatitis-C screening was by anti-HCV with confirmation by HCV RNA. A questionnaire assessed potential risk factors for HCV. FINDINGS: Anti-HCV antibodies were found in 11.5% (95% CI: 7.5-15.5%). HCV RNA was present by polymerase chain reaction (PCR) in 8.6% (95% CI: 5.1-12.1%) and was more common in males [13.4% (95% CI: 6.0-20.8%)] than females [6.2% (95% CI: 2.5-9.9%)]. The most common potential risk factors for chronic HCV infection were intravenous (IV) drug or cocaine use (p < 0.0001), tattoos > 5 years old (p < 0.0001) and having a sexual partner with HCV (p = 0.0063). CONCLUSION: HCV prevalence is higher in an urban native-American clinic population than reported in the general U.S. population. Use of IV drugs is the most prevalent risk factor, but tattoos and sexual transmission may also be important. PMID:17444428

Top