Forage yield of Japanese honeysuckle after repeated burning or mowing
John J. Stransky
1984-01-01
Japanese honeysuckle (Lonicera japonica) plantings were burned, mowed, or left untreated in February 1973, and again in March 1978, to measure forage yields from honeysuckle after repeated treatments and to determine whether burning or mowing confines honeysuckle to food plots and prevents accumulation of large, impenetrable mats. Two growing...
Control of Japanese honeysuckle in wildlife borders
Warbach, O.
1953-01-01
1. Japanese honeysuckle, an exotic that can be either a pest or an asset in different localities, makes maintenance of wildlife plantings in the Southeast a difficult problem. 2. A herbicide applied during the winter and strong enough to kill dormant woody plants will stop the spread of honeysuckle from a woods edge for at least two years. 3. A low-percentage 2,4-D water spray applied to honeysuckle growing in bicolor lespedeza borders at a time when honeysuckle is starting growth and bicolor is still dormant will selectively destroy the vine without injuring the border. 4. Studies on control of honeysuckle in multiflora rose, shrub borders, and contour hedges by herbicides are planned for the future.
Lisa A. Schulte; Erik C. Mottl; Brian J. Palik
2011-01-01
Oak forests throughout North America are declining due to changes in disturbance regimes that have led to increased competition from other tree and shrub species. We evaluated associations between oak regeneration, the occurrence of two common invasive shrubs (common buckthorn (Rhamnus cathartica L.) and Tartarian honeysuckle (Lonicera...
Results of herbicide trials to control Japanese honeysuckle
Silas Little; Horace A. Somes
1967-01-01
Three or more annual sprays are required to eliminate Japanese honeysuckle where 2,4-D, a mixture of 2,4-D and 2,4,5-T, or amitrole is applied as either a low-volume (mistblower) or high-volume spray. Dicamba and picloram are more effective. The mixture of 2,4-D and picloram is recommended as the best material for eliminating honeysuckle in a single treatment at the...
Dongjiao Liu; Hao Jiang; Robin Zhang; Kate S. He
2011-01-01
The spatial distribution of most invasive plants is poorly documented and studied. This project examined and compared the spatial distribution of a successful invasive plant, Japanese honeysuckle (Lonicera japonica), in two similar-sized but ecologically distinct watersheds in western Kentucky (Ledbetter Creek) and western Tennessee (Panther Creek)....
Yan, Kun; Cui, Mingxing; Zhao, Shijie; Chen, Xiaobing; Tang, Xiaoli
2016-01-01
Honeysuckle (Lonicera japonica Thunb.) is a traditional medicinal plant in China that is particularly rich in chlorogenic acids, which are phenolic compounds with various medicinal properties. This study aimed to examine the effects of salinity stress on accumulation of chlorogenic acids in honeysuckle, through hydroponic experiments and field trials, and to examine the mechanisms underlying the effects. NaCl stress stimulated the transcription of genes encoding key enzymes in the synthesis of chlorogenic acids in leaves; accordingly, the concentrations of chlorogenic acids in leaves were significantly increased under NaCl stress, as was antioxidant activity. Specifically, the total concentration of leaf chlorogenic acids was increased by 145.74 and 50.34% after 30 days of 150 and 300 mM NaCl stress, respectively. Similarly, the concentrations of chlorogenic acids were higher in the leaves of plants in saline, compared with non-saline, plots, with increases in total concentrations of chlorogenic acids of 56.05 and 105.29% in October 2014 and 2015, respectively. Despite leaf biomass reduction, absolute amounts of chlorogenic acids per plant and phenylalanine ammonia-lyase (PAL) activity were significantly increased by soil salinity, confirming that the accumulation of chlorogenic acids in leaves was a result of stimulation of their synthesis under salinity stress. Soil salinity also led to elevated chlorogenic acid concentrations in honeysuckle flower buds, with significant increases in total chlorogenic acids concentration of 22.42 and 25.14% in May 2014 and 2015, respectively. Consistent with biomass reduction, the absolute amounts of chlorogenic acid per plant declined in flower buds of plants exposed to elevated soil salinity, with no significant change in PAL activity. Thus, salinity-induced chlorogenic acid accumulation in flower buds depended on an amplification effect of growth reduction. In conclusion, salinity stress improved the medicinal quality of
Yan, Kun; Cui, Mingxing; Zhao, Shijie; Chen, Xiaobing; Tang, Xiaoli
2016-01-01
Honeysuckle ( Lonicera japonica Thunb.) is a traditional medicinal plant in China that is particularly rich in chlorogenic acids, which are phenolic compounds with various medicinal properties. This study aimed to examine the effects of salinity stress on accumulation of chlorogenic acids in honeysuckle, through hydroponic experiments and field trials, and to examine the mechanisms underlying the effects. NaCl stress stimulated the transcription of genes encoding key enzymes in the synthesis of chlorogenic acids in leaves; accordingly, the concentrations of chlorogenic acids in leaves were significantly increased under NaCl stress, as was antioxidant activity. Specifically, the total concentration of leaf chlorogenic acids was increased by 145.74 and 50.34% after 30 days of 150 and 300 mM NaCl stress, respectively. Similarly, the concentrations of chlorogenic acids were higher in the leaves of plants in saline, compared with non-saline, plots, with increases in total concentrations of chlorogenic acids of 56.05 and 105.29% in October 2014 and 2015, respectively. Despite leaf biomass reduction, absolute amounts of chlorogenic acids per plant and phenylalanine ammonia-lyase (PAL) activity were significantly increased by soil salinity, confirming that the accumulation of chlorogenic acids in leaves was a result of stimulation of their synthesis under salinity stress. Soil salinity also led to elevated chlorogenic acid concentrations in honeysuckle flower buds, with significant increases in total chlorogenic acids concentration of 22.42 and 25.14% in May 2014 and 2015, respectively. Consistent with biomass reduction, the absolute amounts of chlorogenic acid per plant declined in flower buds of plants exposed to elevated soil salinity, with no significant change in PAL activity. Thus, salinity-induced chlorogenic acid accumulation in flower buds depended on an amplification effect of growth reduction. In conclusion, salinity stress improved the medicinal quality of
Silas Little; Horace A. Somes
1968-01-01
Various herbicides were used to release pine or hardwood seedlings from competition of Japanese honeysuckle, or to eliminate honeysuckle in areas being prepared for regeneration. Considering both the degree of honeysuckle control and the amount of damage to desired trees, we recommend 2,4-D emulsifiable acid with application in late fall for release of hardwoods and in...
Nutrient content and yield of burned or mowed Japanese honeysuckle
John J. Stransky; James N. Hale; Lowell K. Halls
1976-01-01
Burning reduced the dense growth between 3-year-old Japanese honeysuckle plants and prevented the resprouting of runners. Mowing removed the dense accumulation of vines, but the severed runners resprouted to create a uniformly dense carpet. Crude protein of foliage was highest on the burned plots, but neither calcium nor phosphorus were significantly affected by...
Lilac and honeysuckle phenology data 1956-2014.
Rosemartin, Alyssa H; Denny, Ellen G; Weltzin, Jake F; Lee Marsh, R; Wilson, Bruce E; Mehdipoor, Hamed; Zurita-Milla, Raul; Schwartz, Mark D
2015-01-01
The dataset is comprised of leafing and flowering data collected across the continental United States from 1956 to 2014 for purple common lilac (Syringa vulgaris), a cloned lilac cultivar (S. x chinensis 'Red Rothomagensis') and two cloned honeysuckle cultivars (Lonicera tatarica 'Arnold Red' and L. korolkowii 'Zabeli'). Applications of this observational dataset range from detecting regional weather patterns to understanding the impacts of global climate change on the onset of spring at the national scale. While minor changes in methods have occurred over time, and some documentation is lacking, outlier analyses identified fewer than 3% of records as unusually early or late. Lilac and honeysuckle phenology data have proven robust in both model development and climatic research.
Quantity and quality of Japanese honeysuckle on Arkansas Ozark food plots
Charles A. Segelquist; Mitch Rogers; Fred D. Ward
1971-01-01
In the spring of 1968 Japanese honeysuckle was planted on four wildlife food plots in the Arkansas Ozarks. Two years later, with moderate fertilization and occasional mowing, this evergreen species produced 239 ovendry pounds of winter forage per acre, 12 times more than the surrounding forest. The nutrient quality of leaves was consistently high throughout the year....
Invasibility and Effects of Amur Honeysuckle in Southwestern Ohio Forests
Todd F. Hutchinson; John L. Vankat; John L. Vankat
1997-01-01
The Asian exotic Amur honeysuckle (Lonicera maackii [Rupr.] Herder) has become the dominant shrub in many forests in southwestern Ohio and in some other locations in the eastern United States. Our research focused on the invasibility of forest communities and relationships of L. maackii to the abundance of tree seedlings and herbs. We surveyed 93 forest stands near...
[Literature study on species of honeysuckle flower].
Zhang, Wei; Huang, Lu-Qi; Li, Chao-Xia; Li, Jian; Zhang, Rui-Xian
2014-06-01
Honeysuckle flower is a traditional herbal medicine in China Through systemically sorting and studying literature of Chinese medicine, this article pointed out that leech used by the traditional Chinese medicine in ancient time has the features of twist vine, slight purple stem with clothing hair; opposite growing leaves, ovule shape with clothing hair on both side; two flowers growing from one pedicel, labiate corolla with 3.2 cm longth, flower grows from white color to yellow color, each branch axil grows only one pedicel, the involucre is ovoid shape, and the flower season is from mid-March to mid-May. Among all species of caprifoliaceae, only Lonicera japonica Thunb. meets these botanic features. Therefore, L. japonica Thunb. should be used as the orthodox species of herbal honeysuckle flower.
Lilac and honeysuckle phenology data 1956–2014
Rosemartin, Alyssa H.; Denny, Ellen G.; Weltzin, Jake F.; Lee Marsh, R.; Wilson, Bruce E.; Mehdipoor, Hamed; Zurita-Milla, Raul; Schwartz, Mark D.
2015-01-01
The dataset is comprised of leafing and flowering data collected across the continental United States from 1956 to 2014 for purple common lilac (Syringa vulgaris), a cloned lilac cultivar (S. x chinensis ‘Red Rothomagensis’) and two cloned honeysuckle cultivars (Lonicera tatarica ‘Arnold Red’ and L. korolkowii ‘Zabeli’). Applications of this observational dataset range from detecting regional weather patterns to understanding the impacts of global climate change on the onset of spring at the national scale. While minor changes in methods have occurred over time, and some documentation is lacking, outlier analyses identified fewer than 3% of records as unusually early or late. Lilac and honeysuckle phenology data have proven robust in both model development and climatic research. PMID:26306204
Lilac and honeysuckle phenology data 1956–2014
Rosemartin, Alyssa H.; Denny, Ellen G.; Weltzin, Jake F.; Marsh, R. Lee; Wilson, Bruce E.; Mehdipoor, Hamed; Zurita-Milla, Raul; Schwartz, Mark D.
2015-01-01
The dataset is comprised of leafing and flowering data collected across the continental United States from 1956 to 2014 for purple common lilac (Syringa vulgaris), a cloned lilac cultivar (S. x chinensis ‘Red Rothomagensis’) and two cloned honeysuckle cultivars (Lonicera tatarica ‘Arnold Red’ and L. korolkowii ‘Zabeli’). Applications of this observational dataset range from detecting regional weather patterns to understanding the impacts of global climate change on the onset of spring at the national scale. While minor changes in methods have occurred over time, and some documentation is lacking, outlier analyses identified fewer than 3% of records as unusually early or late. Lilac and honeysuckle phenology data have proven robust in both model development and climatic research.
Kong, Fansheng; Yu, Shujuan; Bi, Yongguang; Huang, Xiaojun; Huang, Mengqian
2016-01-01
Objective: To optimize and verify the cellulase extraction of polyphenols from honeysuckle and provide a reference for enzymatic extracting polyphenols from honeysuckle. Materials and Methods: The uniform design was used According to Fick's first law and kinetic model, fitting analysis of the dynamic process of enzymatic extracting polyphenols was conducted. Results: The optimum enzymatic extraction parameters for polyphenols from honeysuckle are found to be 80% (v/v) of alcohol, 35:1 (mL/g) of liquid-solid ratio, 80°C of extraction temperature, 8.5 of pH, 6.0 mg of enzyme levels, and 130 min of extraction time. Under the optimal conditions, the extraction rate of polyphenols was 3.03%. The kinetic experiments indicated kinetic equation had a good linear relationship with t even under the conditions of different levels of enzyme and temperature, which means fitting curve tallies well with the experimental values. Conclusion: The results of quantification showed that the results provide a reference for enzymatic extracting polyphenols from honeysuckle. SUMMARY Lonicerae flos (Lonicera japonica Thunb.) is a material of traditional Chinese medicine and healthy drinks, of which active compounds mainly is polyphenols. At present, plant polyphenols are the hotspots centents of food, cosmetic and medicine, because it has strong bioactivity. Several traditional methods are available for the extraction of plant polyphenols including impregnation, solvent extraction, ultrasonic extraction, hot-water extraction, alkaline dilute alcohol or alkaline water extraction, microwave extraction and Supercritical CO2 extraction. But now, an increasing number of research on using cellulase to extract active ingredients from plants. Enzymatic method is widely used for enzyme have excellent properties of high reaction efficiency and specificity, moderate reaction conditions, shorter extraction time and easier to control, less damage to the active ingredient. At present, the enzymatic
Living with aliens: effects of invasive shrub honeysuckles on avian nesting.
Gleditsch, Jason M; Carlo, Tomás A
2014-01-01
Invasive species have come to the forefront of conservation biology as a major threat to native biodiversity. Habitats dominated by shrub honeysuckles (Lonicera spp.) in the United States have been characterized as "ecological traps" by ecologists. Here we tested this hypothesis by investigating the effects of shrub honeysuckles on the nesting ecology of native birds in seven study sites in central Pennsylvania, USA. We examined how the abundance of shrub honeysuckles influenced the selection of nesting substrates and habitat for a community of common songbirds, and the parental-care behavior and nestling development of gray catbirds (Dumetella carolinensis). We found that birds had a strong bias towards nesting in honeysuckle shrubs, but not necessarily for nesting in honeysuckle-dominated habitats. Nest predation rates were affected by the density of nests in a habitat, but not by the overall abundance of honeysuckles in such habitats. Honeysuckle abundance in the habitat did show significant effects on some parental-care behavioral parameters: catbirds had higher nest visitation rates and shorter visit lengths in areas of high honeysuckle density. On average, Gray catbirds fed fruit 12%±0.31 s.e. of their nestling-feeding bouts, mostly fruits of shrub honeysuckles. Nestlings in sites with high honeysuckle density also showed higher mass:tarsus ratios, suggesting a good (possibly better) physiological condition of catbird nestlings at the time of fledging. Our study shows that honeysuckle-dominated habitats could have equivocal effects on nesting parameters of common species of native birds. We advise more caution in the widespread denomination of novel plant communities with high densities of honeysuckle as "ecological traps" as effects can be null or positive on native birds in certain localities.
2013-04-01
galli Barnyard grass Imperata cylindrica Cogongrass Ligustrum japonicum Japanese privet Ligustrum sinense Chinese Privet Lonicera japonica... Imperata cylindrica Cogongrass Ligustrum japonicum Japanese privet Ligustrum sinense Chinese Privet Lonicera japonica Japanese Honeysuckle...crus-galli Barnyard grass Imperata cylindrica Cogongrass Ligustrum japonicum Japanese privet Ligustrum sinense Chinese Privet Lonicera
Ron Rathfon; Keith Ruble
2007-01-01
Asian bush honeysuckles (Lonicera maackii [Rupr.] Maxim, L. morrowii Gray, and L. tartarica L.) have proved extremely invasive in eastern hardwood forests. In addition to displacing native forest ground flora and associated fauna, these understory shrubs pose a threat to forest regeneration. Effective control strategies need to be...
Emile S. Gardiner; Jimmie L. Yeiser
2006-01-01
We initiated a study on a bottomland site in the southern United States to examine the effects of Japanese honeysuckle (Lonicera japonica Thunberg) control and seedlings of two root classes on survival and growth of underplanted cherrybark oak (Quercus pagoda Raf.) seedlings. Three honeysuckle control treatments were assigned to...
El-Sayed, A M; Mitchell, V J; McLaren, G F; Manning, L M; Bunn, B; Suckling, D M
2009-06-01
This work was undertaken to identify floral compound(s) produced by honeysuckle flowers, Lonicera japonica (Thunberg), that mediate the attraction of New Zealand flower thrips Thrips obscuratus (Crawford). Volatiles were collected during the day and night and analyzed by gas chromatography-mass spectrometry (GC-MS) to determine their emission over these two periods. Nine compounds were identified in the headspace; the main compound was linalool, and the other compounds were germacrene D, E,E-alpha-farnesene, nerolidol, cis-jasmone, cis-3-hexenyl acetate, hexyl acetate, cis-hexenyl tiglate, and indole. There was a quantitative difference between day and night volatiles, with cis-3-hexenyl acetate, hexyl acetate, cis-hexenyl tiglate, and cis-jasmone emitted in higher amounts during the day compared to the night. When the compounds were tested individually in field trapping experiments, only cis-jasmone attracted New Zealand flower thrips in a significant number. In another field trapping experiment, cis-jasmone caught similar numbers of New Zealand flower thrips compared to a floral blend formulated to mimic the ratios of the compounds emitted during the day, while catch with the night-emitted floral blend was not significantly different from the control. Subsequently, two field trapping experiments were conducted to determine the optimal attraction dose for cis-jasmone, a range of 1-100 mg loaded onto a red rubber stopper was tested, and the highest catches were in traps baited with 100 mg loading. A higher range of 100-1000 mg loaded into polyethylene vials was tested, and the highest catch was in traps baited with 500 mg. In another experiment aimed at comparing the attraction efficacy of cis-jasmone with the two other known thrips attractants (ethyl nicotinate and p-anisaldehyde), ethyl nicotinate showed the highest trap catch followed by cis-jasmone. A smaller number of Thrips tabaci (Lindeman) was attracted to traps baited with cis-jasmone. These results
A Phenological Legacy: Leafing and flowering data for lilacs and honeysuckles 1956-2014
Rosemartin, Alyssa; Denny, Ellen G.; Weltzin, Jake F.; ...
2015-07-21
The dataset is comprised of leafing and flowering data collected across the continental United States from 1956 to 2014 for purple common lilac (Syringa vulgaris), a cloned lilac cultivar (S. x chinensis Red Rothomagensis ) and two cloned honeysuckle cultivars (Lonicera tartarica Arnold Red and L. korolkowii Zabeli ). Applications of this observational dataset range from detecting regional weather patterns to understanding the impacts of global climate change on the onset of spring at the national scale. While minor changes in methods have occurred over time, and some documentation is lacking, outlier analyses identified fewer than 3% of records asmore » unusually early or late. Lilac and honeysuckle phenology data have proven robust in both model development and climatic research.« less
Brian M. Hoven; David L. Gorchov; Kathleen S. Knight; Valerie E. Peters
2017-01-01
Invasive insects and plants are major threats to the health and viability of North American forests. Emerald ash borer (Agrilus planipennis) (EAB) may cause extensive changes to forest composition due to rapid ash (Fraxinus spp.) mortality. Invasive shrubs like Amur honeysuckle (Lonicera maackii) may...
Large-Scale Removal of Invasive Honeysuckle Decreases Mosquito and Avian Host Abundance.
Gardner, Allison M; Muturi, Ephantus J; Overmier, Leah D; Allan, Brian F
2017-12-01
Invasive species rank second only to habitat destruction as a threat to native biodiversity. One consequence of biological invasions is altered risk of exposure to infectious diseases in human and animal populations. The distribution and prevalence of mosquito-borne diseases depend on the complex interactions between the vector, the pathogen, and the human or wildlife reservoir host. These interactions are highly susceptible to disturbance by invasive species, including terrestrial plants. We conducted a 2-year field experiment using a Before-After/Control-Impact design to examine how removal of invasive Amur honeysuckle (Lonicera maackii) in a forest fragment embedded within a residential neighborhood affects the abundance of mosquitoes, including two of the most important vectors of West Nile virus, Culex pipiens and Cx. restuans. We also assessed any potential changes in avian communities and local microclimate associated with Amur honeysuckle removal. We found that (1) removal of Amur honeysuckle reduces the abundance of both vector and non-vector mosquito species that commonly feed on human hosts, (2) the abundance and composition of avian hosts is altered by honeysuckle removal, and (3) areas invaded with honeysuckle support local microclimates that are favorable to mosquito survival. Collectively, our investigations demonstrate the role of a highly invasive understory shrub in determining the abundance and distribution of mosquitoes and suggest potential mechanisms underlying this pattern. Our results also give rise to additional questions regarding the general impact of invasive plants on vector-borne diseases and the spatial scale at which removal of invasive plants may be utilized to effect disease control.
Christopher M. Oswalt; Sonja N. Oswalt; W. Keith Moser
2012-01-01
Studies suggest that the southern United States is an area of primary concern with regards to the spread of nonnative invasive plant species. Recent data show that species such as Japanese honeysuckle (Lonicera japonica) and Nepalese browntop (Microstegium vimineum) are invading forests and displacing native species throughout the...
The extent of selected nonnative invasive plants on southern forest lands
Sonja N. Oswalt; Christopher M. Oswalt
2011-01-01
Studies suggest that the southern United States is an area of primary concern with regards to the spread of nonnative invasive plant species. Recent data show that species such as Japanese honeysuckle (Lonicera japonica) and Nepalese browntop (Microstegium vimineum) are invading forests and displacing native species throughout the...
Lonicerae Japonicae Flos and Lonicerae Flos: A Systematic Pharmacology Review
Li, Yujie; Cai, Weiyan; Weng, Xiaogang; Li, Qi; Wang, Yajie; Chen, Ying; Zhang, Wei; Yang, Qing; Guo, Yan; Zhu, Xiaoxin; Wang, Hainan
2015-01-01
Lonicerae japonicae flos, a widely used traditional Chinese medicine (TCM), has been used for several thousand years in China. Chinese Pharmacopeia once included Lonicerae japonicae flos of Caprifoliaceae family and plants of the same species named Lonicerae flos in general in the same group. Chinese Pharmacopeia (2005 Edition) lists Lonicerae japonicae flos and Lonicerae flos under different categories, although they have the similar history of efficacy. In this study, we research ancient books of TCM, 4 main databases of Chinese academic journals, and MEDLINE/PubMed to verify the origins and effects of Lonicerae japonicae flos and Lonicerae flos in traditional medicine and systematically summarized the research data in light of modern pharmacology and toxicology. Our results show that Lonicerae japonicae flos and Lonicerae flos are similar pharmacologically, but they also differ significantly in certain aspects. A comprehensive systematic review and a standard comparative pharmacological study of Lonicerae japonicae flos and Lonicerae flos as well as other species of Lonicerae flos support their clinical safety and application. Our study provides evidence supporting separate listing of Lonicerae japonicae flos and Lonicerae flos in Chinese Pharmacopeia as well as references for revision of relevant pharmacopeial records dealing with traditional efficacy of Lonicerae japonicae flos and Lonicerae flos. PMID:26257818
Evolution of marginal populations of an invasive vine increases the likelihood of future spread
Francis F. Kilkenny; Laura F. Galloway
2015-01-01
The prediction of invasion patterns may require an understanding of intraspecific differentiation in invasive species and its interaction with climate change. We compare Japanese honeysuckle (Lonicera japonica) plants from the core (100-150 yr old) and northern margin (< 65 yr old) of their North American invaded range to determine whether evolution...
Emile S. Gardiner; Jimmie L. Yeiser
1999-01-01
Advance regeneration is frequently inadequate to sufficiently restock the oak component of many bottomland stands, especially on productive sites with high levels of competition. We initiated a study near Beime, AR to examine the effects of pre-plant control of Japanese honeysuckle (Lonicera japonica Thunberg) and seedling quality on establishment...
Sonja N. Oswalt
2006-01-01
Studies suggest that the Southeast is an area of primary concern with regards to the spread of alien plant species (Miller 2003, Stapanian and others 1998). Data collected by Stapanian and others in 1998 showed that Japanese honeysuckle (Lonicera japonica) occurred over 2 million acres in the Southeast, invading forests and displacing native species...
Sonja N. Oswalt
2006-01-01
Studies suggest that the Southeast is an area of primary concern with regards to the spread of alien plant species (Miller 2003, Stapanian and others 1998). Data collected by Stapanian and others in 1998 showed that Japanese honeysuckle (Lonicera japonica) occurred over 2 million acres in the Southeast, invading forests and displacing native species. Among the most...
Yang, Qian-Ru; Zhao, Yuan-Yuan; Hao, Jiang-Bo; Li, Wei-Dong
2016-04-01
The dried flower buds or initial flowers of Lonicerae Japonicae Flos and Lonicerae Flos, which belong to different species of Lonicera or Caprifoliaceae, are usually taken to clear away heat and toxic material and treat the exopathogenic wind-heat. They are two different herbs, and due to various reasons, there are far more controversies. This paper reviews the research on the chemical constituents and their differences between Lonicerae Japonicae Flos and Lonicerae Flos. Both of them contain the similar chemical constituents, such as organic acids, flavonoids, triterpenoidal saponins, iridoids, volatile oils and trace elements. But there are also differences between them. The main differences:Lonicerae Japonicae Flos contains a wealth of iridoids and flavonoids, while Lonicerae Flos contains more kinds of triterpenoidal saponins; the content of chlorogenic acid in Lonicerae Flos is significantly higher than that of Lonicerae Japonicae Flos; the content of rutin, luteoloside,luteolin-7-O-β-D-galactoside and lonicerin in Lonicerae Japonicae Flos is much higher than that of Lonicerae Flos; the content of Fe and Ni in Lonicerae Japonicae Flos is higher, while the content of Mn is higher in Lonicerae Flos. Finally, main problems and suggestions on chemical composition between Lonicerae Japonicae Flos and Lonicerae Flos were also discussed. Copyright© by the Chinese Pharmaceutical Association.
Bol, Sebastiaan; Caspers, Jana; Buckingham, Lauren; Anderson-Shelton, Gail Denise; Ridgway, Carrie; Buffington, C A Tony; Schulz, Stefan; Bunnik, Evelien M
2017-03-16
Olfactory stimulation is an often overlooked method of environmental enrichment for cats in captivity. The best known example of olfactory enrichment is the use of catnip, a plant that can cause an apparently euphoric reaction in domestic cats and most of the Pantherinae. It has long been known that some domestic cats and most tigers do not respond to catnip. Although many anecdotes exist of other plants with similar effects, data are lacking about the number of cats that respond to these plants, and if cats that do not respond to catnip respond to any of them. Furthermore, much is still unknown about which chemicals in these plants cause this response. We tested catnip, silver vine, Tatarian honeysuckle and valerian root on 100 domestic cats and observed their response. Each cat was offered all four plant materials and a control, multiple times. Catnip and silver vine also were offered to nine tigers. The plant materials were analyzed by gas chromatography coupled with mass spectrometry to quantify concentrations of compounds believed to exert stimulating effects on cats. Nearly all domestic cats responded positively to olfactory enrichment. In agreement with previous studies, one out of every three cats did not respond to catnip. Almost 80% of the domestic cats responded to silver vine and about 50% to Tatarian honeysuckle and valerian root. Although cats predominantly responded to fruit galls of the silver vine plant, some also responded positively to its wood. Of the cats that did not respond to catnip, almost 75% did respond to silver vine and about one out of three to Tatarian honeysuckle. Unlike domestic cats, tigers were either not interested in silver vine or responded disapprovingly. The amount of nepetalactone was highest in catnip and only present at marginal levels in the other plants. Silver vine contained the highest concentrations of all other compounds tested. Olfactory enrichment for cats may have great potential. Silver vine powder from dried
The role of silicon in physiology of the medicinal plant (Lonicera japonica L.) under salt stress
NASA Astrophysics Data System (ADS)
Gengmao, Zhao; Shihui, Li; Xing, Sun; Yizhou, Wang; Zipan, Chang
2015-08-01
Silicon(Si) is the only element which can enhance the resistance to multiple stresses. However, the role of silicon in medicinal plants under salt stress is not yet understood. This experiment was conducted to study the effects of silicon addition on the growth, osmotic adjustments, photosynthetic characteristics, chloroplast ultrastructure and Chlorogenic acid (CGA) production of Honeysuckle plant (Lonicera japonica L.) under salt-stressed conditions. Salinity exerted an adverse effect on the plant fresh weight and dry weight, whilst 0.5 g L-1 K2SiO3·nH2O addition obviously improved the plant growth. Although Na+ concentration in plant organs was drastically increased with increasing salinity, higher levels of K+/Na+ ratio was obtained after K2SiO3·nH2O addition. Salinity stress induced the destruction of the chloroplast envelope; however, K2SiO3·nH2O addition counteracted the adverse effect by salinity on the structure of the photosynthetic apparatus. K2SiO3·nH2O addition also enhanced the activities of superoxide dismutase and catalase. To sum up, exogenous Si plays a key role in enhancing its resistance to salt stresses in physiological base, thereby improving the growth and CGA production of Honeysuckle plant.
Zhu, Wei; Zheng, Wen; Hu, Xingjiang; Xu, Xiaobao; Zhang, Lin; Tian, Jingkui
2017-04-01
Lonicera japonica Thunb., also known as Jin Yin Hua and Japanese honeysuckle, is used as a herbal medicine in Asian countries. Its flowers have been used in folk medicine in the clinic and in making food or healthy beverages for over 1500years in China. To investigate the molecular processes involved in L. japonica development from buds to flowers exposed to UV radiation, a comparative proteomics analysis was performed. Fifty-four proteins were identified as differentially expressed, including 42 that had increased expression and 12 that had decreased expression. The levels of the proteins related to glycolysis, TCA/organic acid transformation, major carbohydrate metabolism, oxidative pentose phosphate, stress, secondary metabolism, hormone, and mitochondrial electron transport were increased during flower opening process after exposure to UV radiation. Six metabolites in L. japonica buds and flowers were identified and relatively quantified using LC-MS/MS. The antioxidant activity was performed using a 1,1-diphenyl-2-picrylhydrazyl assay, which revealed that L. japonica buds had more activity than the UV irradiated flowers. This suggests that UV-B radiation induces production of endogenous ethylene in L. japonica buds, thus facilitating blossoming of the buds and activating the antioxidant system. Additionally, the higher metabolite contents and antioxidant properties of L. japonica buds indicate that the L. japonica bud stage may be a more optimal time to harvest than the flower stage when using for medicinal properties. Copyright © 2017 Elsevier B.V. All rights reserved.
Single oral dose toxicity test of blue honeysuckle concentrate in mice.
Kim, Hyung-Soo; Park, Sang-In; Choi, Seung-Hoon; Song, Chang-Hyun; Park, Soo-Jin; Shin, Yong-Kook; Han, Chang-Hyun; Lee, Young Joon; Ku, Sae-Kwang
2015-03-01
The objective of this study was to obtain single oral dose toxicity information for concentrated and lyophilized powder of blue honeysuckle (Lonicera caerulea L., Caprifoliaceae; BHcL) in female and male ICR mice to aid in the process of developing natural origin medicinal ingredients or foods following proximate analysis and phytochemical profile measurement. The proximate analysis revealed that BHcL had an energy value of 3.80 kcal/g and contained 0.93 g/g of carbohydrate, 0.41 g/g of sugar, 0.02 g/g of protein, and 0.20 mg/g of sodium. BHcL did not contain lipids, including saturated lipids, trans fats, or cholesterols. Further, BHcL contained 4.54% of betaine, 210.63 mg/g of total phenols, 159.30 mg/g of total flavonoids, and 133.57 mg/g of total anthocyanins. Following administration of a single oral BHcL treatment, there were no treatment-related mortalities, changes in body weight (bw) or organ weight, clinical signs, necropsy or histopathological findings up to 2,000 mg/kg bw, the limited dosage for rodents of both sexes. We concluded that BHcL is a practically non-toxic material in toxicity potency.
Single Oral Dose Toxicity Test of Blue Honeysuckle Concentrate in Mice
Park, Sang-In; Choi, Seung-Hoon; Song, Chang-Hyun; Park, Soo-Jin; Shin, Yong-Kook; Han, Chang-Hyun; Lee, Young Joon; Ku, Sae-Kwang
2015-01-01
The objective of this study was to obtain single oral dose toxicity information for concentrated and lyophilized powder of blue honeysuckle (Lonicera caerulea L., Caprifoliaceae; BHcL) in female and male ICR mice to aid in the process of developing natural origin medicinal ingredients or foods following proximate analysis and phytochemical profile measurement. The proximate analysis revealed that BHcL had an energy value of 3.80 kcal/g and contained 0.93 g/g of carbohydrate, 0.41 g/g of sugar, 0.02 g/g of protein, and 0.20 mg/g of sodium. BHcL did not contain lipids, including saturated lipids, trans fats, or cholesterols. Further, BHcL contained 4.54% of betaine, 210.63 mg/g of total phenols, 159.30 mg/g of total flavonoids, and 133.57 mg/g of total anthocyanins. Following administration of a single oral BHcL treatment, there were no treatment-related mortalities, changes in body weight (bw) or organ weight, clinical signs, necropsy or histopathological findings up to 2,000 mg/kg bw, the limited dosage for rodents of both sexes. We concluded that BHcL is a practically non-toxic material in toxicity potency. PMID:25874034
Chaowuttikul, Chayanon; Palanuvej, Chanida; Ruangrungsi, Nijsiri
2017-01-01
Lonicera japonica Thunb. or Japanese Honeysuckle has been widely used in traditional medicine for antipyretic. To establish the pharmacognostic specification of L. japonica flowering bud in Thailand and to determine its chlorogenic acid content and in vitro antioxidant activities. Dried L. japonica flowering bud from 15 various herbal drugstores throughout Thailand were investigated for pharmacognostic specification. Their chlorogenic acid contents were quantitatively analyzed by thin layer chromatography (TLC) densitometry with winCATS software. The mobile phase for TLC development consisted of ethyl acetate: formic acid: acetic acid: water (10:1.1:1.1:2.6). Antioxidant activities were investigated by 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging, ferric ion reducing antioxidant power assay, nitric oxide scavenging assay, and β-carotene bleaching assays. Qualified L. japonica flowering bud in Thailand was presented that the contents of loss on drying, total ash, acid-insoluble ash, and water should not be >10.11%, 6.59%, 1.14%, and 10.82% by weight, respectively. The ethanol and water soluble extractive values should not be < 16.46% and 28.88% by weight, respectively. Chlorogenic acid content in L. japonica flowering bud was found to be 2.24 ± 0.50 g/100 g of crude drug. L. japonica flowering bud showed DPPH and nitric oxide scavenging activities as well as reducing power property. This pharmacognostic specification with special reference to the chlorogenic acid content can be used for quality control of L. japonica flowering bud in Thailand. The potential antioxidant of this crude drug was demonstrated in vitro . Pharmacognostic specification of Lonicera japonica flowering bud in Thailand has been establishedThe chlorogenic acid content has been quantified by thin layer chromatography-densitometryThe ethanolic extract of L. japonica flowering bud showed antioxidation potential, especially on reducing power property. Abbreviations Used: TLC: Thin layer
Chaowuttikul, Chayanon; Palanuvej, Chanida; Ruangrungsi, Nijsiri
2017-01-01
Background: Lonicera japonica Thunb. or Japanese Honeysuckle has been widely used in traditional medicine for antipyretic. Objective: To establish the pharmacognostic specification of L. japonica flowering bud in Thailand and to determine its chlorogenic acid content and in vitro antioxidant activities. Materials and Methods: Dried L. japonica flowering bud from 15 various herbal drugstores throughout Thailand were investigated for pharmacognostic specification. Their chlorogenic acid contents were quantitatively analyzed by thin layer chromatography (TLC) densitometry with winCATS software. The mobile phase for TLC development consisted of ethyl acetate: formic acid: acetic acid: water (10:1.1:1.1:2.6). Antioxidant activities were investigated by 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging, ferric ion reducing antioxidant power assay, nitric oxide scavenging assay, and β-carotene bleaching assays. Results: Qualified L. japonica flowering bud in Thailand was presented that the contents of loss on drying, total ash, acid-insoluble ash, and water should not be >10.11%, 6.59%, 1.14%, and 10.82% by weight, respectively. The ethanol and water soluble extractive values should not be < 16.46% and 28.88% by weight, respectively. Chlorogenic acid content in L. japonica flowering bud was found to be 2.24 ± 0.50 g/100 g of crude drug. L. japonica flowering bud showed DPPH and nitric oxide scavenging activities as well as reducing power property. Conclusion: This pharmacognostic specification with special reference to the chlorogenic acid content can be used for quality control of L. japonica flowering bud in Thailand. The potential antioxidant of this crude drug was demonstrated in vitro. SUMMARY Pharmacognostic specification of Lonicera japonica flowering bud in Thailand has been establishedThe chlorogenic acid content has been quantified by thin layer chromatography-densitometryThe ethanolic extract of L. japonica flowering bud showed antioxidation potential
Dissipation of Flonicamid in Honeysuckle and Its Transfer during Brewing Process.
Wang, Yujie; Xue, Jian; Jin, Hongyu; Ma, Shuangcheng
2017-05-01
The dissipation of flonicamid in Honeysuckle and transfer pattern from Honeysuckle to its tea infusion were investigated. Flonicamid was applied on Honeysuckle crop at two dosages, 60 g of active gradient per hectare (g a.i. hm -2 ) and 180 g a.i. hm -2 (recommended and triple the recommended) in Fenqiu, Henan Province in 2015 and 2016. Gas Chromatography-Electron Capture Detector (GC-ECD) detection methods were developed for the analysis of flonicamid residues in honeysuckles and its infusion. The recoveries in both honeysuckles and its infusion ranged from 81.5 to 101.7% with relative standard deviations (RSDs) of 3.2-9.1%. The dissipations of flonicamid in Honeysuckle were found to follow the first order kinetics with half-life ranging between 2.8 and 3.2 d. After recommended dose pesticide application, contents of flonicamid residues were lower than theoretical maximum residue limit (tMRL). Flonicamid residues can easily transfer from Honeysuckle to its tea infusion and transfer rates of flonicamid decrease with the brewing temperature reduction or the brewing times increase. These results are helpful to establish maximum residue limit and develop guidance on the appropriate and secure use of flonicamid in Honeysuckle.
Palíková, Irena; Heinrich, Jan; Bednár, Petr; Marhol, Petr; Kren, Vladimír; Cvak, Ladislav; Valentová, Katerina; Růzicka, Filip; Holá, Veronika; Kolár, Milan; Simánek, Vilím; Ulrichová, Jitka
2008-12-24
The fruit of Lonicera caerulea L. (blue honeysuckle; Caprifoliaceae) and its phenolic fraction were analyzed for nutrients and micronutrients. The phenolic fraction was prepared from berries percolated with 0.1% H3PO4 and SPE using Sepabeads SP207. The sugar and lipid content was analyzed by HPLC and GC-MS. The total content of anthocyanins was determined using the pH differential absorbance method and aliphatic acids by capillary electrophoresis. MicroLC-MS/MS was used for determination of cyanidin-3-glucoside (the predominant anthocyanin), 3,5-diglucoside, and 3-rutinoside, paeonidin-3-glucoside, 3,5-diglucoside, and 3-rutinoside, delphinidin-3-glucoside and 3-rutinoside, pelargonidin-3-glucoside, 3,5-diglucoside, and 3-rutinoside, quercetin, its 3-glucoside, and 3-rutinoside, epicatechin, protocatechuic, gentisic, ellagic, ferulic, caffeic, chlorogenic, and coumaric acids. The phenolic fraction displayed Folin-Ciocalteu reagent reducing (335 +/- 15 microg of gallic acid equivalent/mg) and DPPH and superoxide scavenging activity (IC50 12.1 +/- 0.1 and 115.5 +/- 6.4 microg/mL) and inhibited rat liver microsome peroxidation (IC50 160 +/- 20 microg/mL). The freeze-dried fruit and its phenolic fraction reduced the biofilm formation and adhesion to the artificial surface of Candida parapsilosis, Staphylococcus epidermidis, Escherichia coli, Enterococcus faecalis, and Streptococcus mutans.
Fang, Qingkui; Shi, Yanhong; Cao, Haiqun; Tong, Zhou; Xiao, Jinjing; Liao, Min; Wu, Xiangwei; Hua, Rimao
2017-03-01
The degradation dynamics and dietary risk assessments of thiamethoxam and thiacloprid during Lonicera japonica planting, drying, and tea brewing processes were systematically investigated using high-performance liquid chromatography. The half-lives of thiamethoxam and thiacloprid were 1.0-4.1 d in the honeysuckle flowers and leaves, with degradation rate constants k ranging from -0.169 to -0.696. The safety interval time was 7 d. The sun- and oven-drying (70 °C) percent digestions were 59.4-81.0% for the residues, which were higher than the shade- and oven-drying percentages at lower temperatures (30, 40, 50, and 60 °C, which ranged from 37.7% to 57.0%). The percent transfers of thiamethoxam and thiacloprid were 0-48.4% and 0-25.2%, respectively, for the different tea brewing conditions. On the basis of the results of this study, abiding by the safety interval time is important, and using reasonable drying methods and tea brewing conditions can reduce the transfer of thiamethoxam and thiacloprid to humans.
[Studies on the chemical constituents of Lonicera macranthoides].
Jia, Xiao-Dong; Zhao, Xing-Zeng; Wang, Ming; Dong, Yun-Fa; Feng, Xu
2008-07-01
To study the chemical constituents of flower buds of Lonicera macranthoides. The 90% EtOH extract of Lonicera macranthoides. was successively partitioned with petroleum ether and ethyl acetete. Repeated column chromatography of the ethyl acetete fraction afforded the following compounds (1-9): ginnol (1), triacontanol (2), ursolic acid (3), beta-sitosterol (4), triacontane (5), palmitic acid (6), beta-daucosterol (7), 3-decyl-3-octyldocosan-1-ol (8), 3-dodecyl-3-nonyldocosan-1-ol (9). All compounds except 4 are isolated from this plant for the first time while compounds 2, 3, 5, 8 and 9 are their first time been isolated from genus Lonicera.
Park, Jae-Woo; Bae, Hyunsu; Lee, Gihyun; Hong, Beom-Gi; Yoo, Hye Hyun; Lim, Sung-Jig; Lee, Kyungjin; Kim, Jinsung; Ryu, Bongha; Lee, Beom-Joon; Bae, Jinhyun; Lee, Hyejung; Bu, Youngmin
2013-01-28
Inflammatory bowel diseases (IBD) are chronically relapsing inflammatory disorders of the intestine. Although some therapeutic agents, including steroids, are available for the treatment of IBD, these agents have limited use. Therefore, dietary supplements have emerged as possible interventions for IBD. Japanese honeysuckle flower, the flower of Lonicera japonica, is a well-known dietary supplement and has been used to prevent or treat various inflammatory diseases. In the present study, we investigated the effects of L. japonica on experimental murine colitis. Colitis was induced by 5 % dextran sulphate sodium (DSS) in Balb/c mice. The water extract of L. japonica (LJE) at doses of 20, 100 or 500 mg/kg was orally administered to mice twice per day for 7 d. Body weight, colon length and a histological damage score were assessed to determine the effects on colitis. Cytokine profiles were assessed to examine the effects on helper T (Th) cell-related immunological responses. In addition, CD4⁺CD25⁺Foxp3⁺T cells were analysed in vivo and in vitro for investigating the effects on regulatory T (Treg) cells. LJE showed dose-dependent inhibitory effects against colon shortening, weight loss and histological damage. LJE down-regulated IL-1β, TNF-α, interferon-γ, IL-6, IL-12 and IL-17. However, LJE did not show any significant effects on IL-10, IL-23, transforming growth factor-β1 and Treg cell populations. In conclusion, LJE showed protective effects against DSS-induced colitis via the Th1/Th17 pathway and not via Treg cell-related mechanisms.
Systematic review for geo-authentic Lonicerae Japonicae Flos.
Yang, Xingyue; Liu, Yali; Hou, Aijuan; Yang, Yang; Tian, Xin; He, Liyun
2017-06-01
In traditional Chinese medicine, Lonicerae Japonicae Flos is commonly used as anti-inflammatory, antiviral, and antipyretic herbal medicine, and geo-authentic herbs are believed to present the highest quality among all samples from different regions. To discuss the current situation and trend of geo-authentic Lonicerae Japonicae Flos, we searched Chinese Biomedicine Literature Database, Chinese Journal Full-text Database, Chinese Scientific Journal Full-text Database, Cochrane Central Register of Controlled Trials, Wanfang, and PubMed. We investigated all studies up to November 2015 pertaining to quality assessment, discrimination, pharmacological effects, planting or processing, or ecological system of geo-authentic Lonicerae Japonicae Flos. Sixty-five studies mainly discussing about chemical fingerprint, component analysis, planting and processing, discrimination between varieties, ecological system, pharmacological effects, and safety were systematically reviewed. By analyzing these studies, we found that the key points of geo-authentic Lonicerae Japonicae Flos research were quality and application. Further studies should focus on improving the quality by selecting the more superior of all varieties and evaluating clinical effectiveness.
[Study on Commercial Specification of Lonicerae Japonicae Flos].
Zhou, Jie; Zou, Lin; Liu, Wei; Bian, Li-hua; Wang, Xiao; Zhang, Yong-qing; Dan, Staerk
2015-04-01
To provide the basis data for the institute of commercial specification standard of Lonicerae Japonicae Flos. 39 samples of Lonicerae Japonicae Flos commercial of different grades in market were collected, and vernier caliper and electronic balance were used to measure the numbers of flower bud and blooming rate per 0. 5 g, contamination content, browning degree, milden and rot, length, upside diameter, middle diameter and bottom diameter of Lonicerae Japonicae Flos. The content of neochlorogenic acid, chlorogenic acid, cryptochlorogenic acid, rutin, galuteolin,3,5-icaffeoylquinic acid and 4,5-dicaffeoylquinic acid were detected by HPLC. Correlation analysis, principal component analysis and cluster analysis were used by SPSS to analyze all index data,and the correlation of appearance characteristics and intrinsic active constituents was discussed. The numbers of flower bud and blooming rate per 0. 5 g, contamination content and browning degree were principal component indexes. The length of flower bud showed a significant correlation with galuteolin content, and the browning degree and upside diameter showed a significant correlation with chlorogenic acid content. Lonicerae Japonicae Flos commercial should be divided into four specification grades by sieved indexes.
Cheng, Brian Chi Yan; Yu, Hua; Su, Tao; Fu, Xiu-Qiong; Guo, Hui; Li, Ting; Cao, Hui-Hui; Tse, Anfernee Kai-Wing; Kwan, Hiu-Yee; Yu, Zhi-Ling
2015-11-04
As documented in the Chinese Materia Medica Grand Dictionary (), a herbal formula (RL) consisting of Rosae Multiflorae Fructus (multiflora rose hips) and Lonicerae Japonicae Flos (Japanese honeysuckle flowers) has traditionally been used in treating inflammatory disorders. RL was previously reported to inhibit the expression of various inflammatory mediators regulated by NF-κB and MAPKs that are components of the TLR4 signalling pathways. This study aims to provide further justification for clinical application of RL in treating inflammatory disorders by further delineating the involvement of the TLR4 signalling cascades in the effects of RL on inflammatory mediators. RL consisting of Rosae Multiflorae Fructus and Lonicerae Japonicae Flos (in 5:3 ratio) was extracted using absolute ethanol. We investigated the effect of RL on the production of cytokines and chemokines that are regulated by three key transcription factors of the TLR4 signalling pathways AP-1, NF-κB and IRF3 in LPS-stimulated RAW264.7 cells using the multiplex biometric immunoassay. Phosphorylation of AP-1, NF-κB, IRF3, IκB-α, IKKα/β, Akt, TAK1, TBK1, IRAK-1 and IRAK-4 were examined in LPS-stimulated RAW264.7 cells and THP-1 cells using Western blotting. Nuclear localizations of AP-1, NF-κB and IRF3 were also examined using Western blotting. RL reduced the secretion of various pro-inflammatory cytokines and chemokines regulated by transcription factors AP-1, NF-κB and IRF3. Phosphorylation and nuclear protein levels of these transcription factors were decreased by RL treatment. Moreover, RL inhibited the activation/phosphorylation of IκB-α, IKKα/β, TAK1, TBK1 and IRAK-1. Suppression of the IRAK-1/TAK1 and TBK1/IRF3 signalling pathways was associated with the effect of RL on inflammatory mediators in LPS-stimulated RAW264.7 and THP-1 cells. This provides further pharmacological basis for the clinical application of RL in the treatment of inflammatory disorders. Copyright © 2015 Elsevier
Detection of an abundant plant-based small RNA in consumers
USDA-ARS?s Scientific Manuscript database
Mechanisms of delivery of plant small RNAs to consumers must be addressed in order to harness this technology to positively impact agbiotechnology. Two groups have used honeysuckle (Lonicera japonica) feeding regimes to detect a plant-based small RNA, termed MIR2911, in sera. Meanwhile, numerous gro...
Snagging, Clearing, and Shelterbelt for Flood Control, Snake River, Minnesota.
1982-01-01
Allegheny blackberry (Rubus - allegheniensis), buffaloberry (Shepherdia argentea), chokecherry (Prunus virginiana), honeysuckle (Lonicera tartarica...wolfberry (Symphori- carpos occidentalis), chokecherry , gooseberry (Ribes missouriensis), and wild grape (Vitis sp.), as well as several others. 2.27...American plum, and black willow (Salix niara). Farther away from the river a shrub layer is present consisting of chokecherry , raspberry (Rubus
Snagging and Clearing for Flood Control, Snake River, Minnesota.
1979-07-01
buffaloberry (Shepherdia argentea), chokecherry (Prunus virginiana), honeysuckle (Lonicera tartarica),and multiflora rose (Rosa multiflora). The inner...prickly ash (Zanthoxylum americanum), dogwood (Cornus sp.), wolfberry (Symphori- carpos occidentalia), chokecherry , gooseberry (Ribes missouriensis...American plum, and black willow (Salix nigra). Further away from the river a shrub layer is present consisting of chokecherry , raspberry (Rubus strigosus
Lianas as invasive species in North America: Chapter 28
Leicht-Young, Stacey A.; Pavlovic, Noel B.
2015-01-01
Liana diversity is typically low in the temperate zones; however, the influx of non-native invasive liana species in North America has increased local diversity at the expense of native habitats and species. Some of the most illustrative studies of invasive lianas in temperate North America compared the biological traits of invasive lianas with native congeners or ecological analogs. The majority of these studies focused on two species, Celastrus orbiculatus (oriental bittersweet) and Lonicera japonica (Japanese honeysuckle). Temperate zone lianas generally have higher photosynthetic rates than other early successional species and their host trees. Invasive lianas are having an increasing impact on the dynamics and trajectories of North American plant communities. They often exhibit superior growth and survival compared to their native counterparts, and in some cases, invasive lianas may directly contribute to the decline of their native correlates.
[Study on Chemical Constituents from Roots of Lonicera macranthoides].
Liu, Wen-juan; Chen, Yu; Ma, Xin; Zhao, You-yi; Feng, Xu
2014-12-01
To study chemical constituents of the roots of Lonicera macranthoides. The chemical constituents were isolated and purified by means of several chromatographic techniques and their structures were elucidated by spectroscopic methods. Seven compounds were isolated and identified as ribenol (1), excoecarin C (2), 18-hydroxy-13-epi-manoyloxide (3), asiatic acid (4), oleanolic acid (5), β-sitosterol (6) and β-daucosterol (7). Compounds 1-4 are obtained from this genus for the first time. Compound 5 is obtained from this plant for the first time. All the compounds are found from the roots of Lonicera mac- ranthoides for the first time.
Hu, Xuan; Li, Wei-dong; Li, Ou; Hao, Jiang-bo; Liu, Jia-kun
2012-09-01
To study the effect of gas-turbine green discoloring and drying processing method on the quality of various Lonicerae Japonicae Flos herbs. DIKMA DiamonsilTM-C18 column (4.6 mm x 250 mm, 5 microm) was adopted using HPLC Waters 1525 and eluted with acetonitrile and 0.1% phosphate acid as the mobile phase. The flow rate was 1.0 mL x min(-1) , the column temperature was 25 degrees C the detection wavelength was 355 nm. After being processed by the gas-turbine green discoloring and drying method, tetraploid Lonicerae Japonicae Flos showed a green color. The contents of chlorogenic acid and galuteolin were 5.31% and 0.105% , both significantly higher by 18.0% and 32.1% than those of diploid Lonicerae Japonicae Flos processed by the same method. The content of chlorogenic acid in tetraploid Lonicerae Japonicae Flos processed the gas-turbine green discoloring and drying method were also remarkably higher than that of tetraploid and diploid Lonicerae Japonicae Flos processed by traditional processing method of natural drying. The gas-turbine green discoloring and drying processing method is a new-type drying method suitable for tetraploid Lonicerae Japonicae Flos. Under the condition of gas-turbine green discoloring and drying processing, tetraploid Lonicerae Japonicae Flos shows much higher quality than Lonicerae Japonicae Flos, suggesting that it is a good variety worth popularizing and applying.
Gerald C. Craver
1982-01-01
Procedures for evaluating the extent and distributionof honeysuckle in South Carolina are presented. A multiresource inventory of South Carolina's forest resources, conducted by the Renewable Resources Evaluation Work Unit (RRE), provides the necessary data. Timber stand classifications and a vegetative profile study are used for evaluation. Honeysuckle was found...
Zhao, Yueran; Dou, Deqiang; Guo, Yueqiu; Qi, Yue; Li, Jun; Jia, Dong
2018-06-01
Thirteen trace elements and active constituents of 40 batches of Lonicera japonica flos and Lonicera flos were comparatively studied using inductively coupled plasma mass-spectrometry (ICP-MS) and high-performance liquid chromatography-photodiode array (HPLC-PDA). The trace elements were 24 Mg, 52 Cr, 55 Mn, 57 Fe, 60 Ni, 63 Cu, 66 Zn, 75 As, 82 Se, 98 Mo, 114 Cd, 202 Hg, and 208 Pb, and the active compounds were chlorogenic acid, 3,5-O-dicaffeoylquinc acid, 4,5-O-dicaffeoylquinc acid, luteolin-7-O-glucoside, and 4-O-caffeoylquinic acid. The data of 18 variables were statistically processed using principal component analysis (PCA) and discriminate analysis (DA) to classify L. japonica flos and L. flos. The validated method was developed to divide the 40 samples into two groups based on the PCA in terms of 18 variables. Furthermore, the species of Lonicera was better discriminated by using DA with 12 variables. These results suggest that the method and statistical analysis of the contents of trace elements and chemical components can classify the L. japonica flos and L. flos using 12 variables, such as 3,5-O-dicaffeoylquincacid, luteolin-7-O-glucoside, Cd, Mn, Hg, Pb, Ni, 4-O-caffeoyl-quinic acid, 4,5-O-dicaffeoylquinc acid, Fe, Mg, and Cr.
NASA Astrophysics Data System (ADS)
Yan, Rui; Chen, Jian-bo; Sun, Su-qin; Guo, Bao-lin
2016-11-01
Lonicerae japonicae Flos (LJF) and Lonicerae Flos (LF) are widely-used herbs derived from several plants of the genus Lonicera with similar appearances. LF are usually misused or counterfeited as LJF for economically motivated adulteration. However, the saponins in LF may cause serious side-effects. In this research, the infrared spectroscopic tri-step identification approach is used to develop a simple and rapid method to discriminate LJF and LF to ensure the safety and efficacy of these herbal drugs. In the primary identification by Fourier transform infrared spectra, LJF and LF show different peaks near 1534, 1404, and 781 cm-1. In the secondary identification by the second derivative infrared spectra, LJF and LF show more different peaks near 1078, 1050, 988, 923, 855, 815, and 781 cm-1. In the tertiary identification by the two-dimensional correlation infrared spectra, the differences between LJF and LF are shown more remarkably and convincingly. The results show the potential of the infrared spectroscopic tri-step identification approach in the rapid identification of LJF and LF when the samples are too few to build a statistical recognition rule. This should be very helpful to ensure the quality, safety, and efficacy of LJF and LF for clinical applications.
Jin, Xue-Hai; Ohgami, Kazuhiro; Shiratori, Kenji; Suzuki, Yukari; Koyama, Yoshikazu; Yoshida, Kazuhiko; Ilieva, Iliyana; Tanaka, Tsuneo; Onoe, Kazunori; Ohno, Shigeaki
2006-05-01
The aim of the present study was to investigate the effects of blue honeysuckle extract (BHE), which contains high level of phenolic compounds, on endotoxin-induced uveitis (EIU). Male Lewis rats were randomly divided into 5 groups with 14 rats in each (eight rats for collection of aqueous humor, six rats for histologic examination). EIU was induced by a footpad injection of lipopolysaccharide (LPS). 1, 10, or 100 mg of BHE was injected intravenously immediately after LPS injection. The aqueous humor was collected at 24 h after LPS injection, the number of infiltrating cells, protein concentration, nitric oxide (NO), tumor necrosis factor (TNF)-alpha, and prostaglandin (PG)-E2 levels in the aqueous humor were determined. Some eyes were enucleated for histologic examination and immunohistochemical analysis. Immunohistochemical staining with a monoclonal antibody against activated nuclear factor (NF)-kappaB was performed to evaluate the effect of BHE on NF-kappaB activation. To further clarify the anti-inflammatory effect, RAW264.7 cells (a mouse macrophage cell line) were stimulated with LPS in the presence or absence of BHE and its major phenolics, cyanidin 3-glucoside (C3G), cyanidin 3-rutinoside (C3R), chlorogenic acid (CA). Expression of inducible NO synthase (iNOS) and cyclooxygenase-2 (COX-2) were analyzed by Western blot method. BHE treatment significantly reduced the inflammatory cell infiltration, the protein concentration, the levels of NO, TNF-alpha and PGE2 in the aqueous humor and improved histologic status of the ocular tissue. The number of activated NF-kappaB-positive cells was lower in the iris-ciliary body treated with BHE at 3 h after LPS injection. BHE significantly suppressed the production of NO, PGE2 and TNF-alpha in the culture medium as well as the expression of iNOS and COX-2 by LPS-stimulated RAW264.7 cells in a dose-dependent fashion. C3G, C3R and CA showed no or weak inhibitory effects on the level of inflammatory mediators and the
Shi, Zhilong; Liu, Zhenjie; Liu, Chunsheng; Wu, Mingquan; Su, Haibin; Ma, Xiao; Zang, Yimei; Wang, Jiabo; Zhao, Yanling; Xiao, Xiaohe
2016-01-01
The traditional Chinese medicines Lonicerae Japonicae Flos (LJF, Jinyinhua in Chinese) and Lonicerae Flos (LF, Shanyinhua in Chinese) refer to the flower buds of five plants belonging to the Caprifoliaceae family. Until 2000, all of these were officially listed as a single item, LJF (Jinyinhua), in the Chinese Pharmacopoeia. However, there have recently been many academic controversies concerning the separation and combination of LJF and LF in administrative regulation. Till now there has been little work completed evaluating the relationships between biological activity and chemical properties among these drugs. Microcalorimetry and UPLC were used along with principal component analysis (PCA), hierarchical cluster analysis (HCA), and canonical correlation analysis (CCA) to investigate the relationships between the chemical ingredients and the antibacterial effects of LJF and LF. Using multivariate statistical analysis, LJF and LF could be initially separated according to their chemical fingerprints, and the antibacterial effects of the two herbal drugs were divided into two clusters. This result supports the disaggregation of LJF and LF by the Pharmacopoeia Committee. However, the sample of Lonicera fulvotomentosa Hsu et S. C. Cheng turned out to be an intermediate species, with similar antibacterial efficacy as LJF. The results of CCA indicated that chlorogenic acid and 3,4-Dicaffeoylquinic acid were the major components generating antibacterial effects. Furthermore, 3,4-Dicaffeoylquinic acid could be used as a new marker ingredient for quality control of LJF and LF. PMID:26869929
Gao, Wen; Wang, Rui; Li, Dan; Liu, Ke; Chen, Jun; Li, Hui-Jun; Xu, Xiaojun; Li, Ping; Yang, Hua
2016-01-05
The flowers of Lonicera japonica Thunb. were extensively used to treat many diseases. As the demands for L. japonica increased, some related Lonicera plants were often confused or misused. Caffeoylquinic acids were always regarded as chemical markers in the quality control of L. japonica, but they could be found in all Lonicera species. Thus, a simple and reliable method for the evaluation of different Lonicera flowers is necessary to be established. In this work a method based on single standard to determine multi-components (SSDMC) combined with principal component analysis (PCA) for control and distinguish of Lonicera species flowers have been developed. Six components including three caffeoylquinic acids and three iridoid glycosides were assayed simultaneously using chlorogenic acid as the reference standard. The credibility and feasibility of the SSDMC method were carefully validated and the results demonstrated that there were no remarkable differences compared with external standard method. Finally, a total of fifty-one batches covering five Lonicera species were analyzed and PCA was successfully applied to distinguish the Lonicera species. This strategy simplifies the processes in the quality control of multiple-componential herbal medicine which effectively adapted for improving the quality control of those herbs belonging to closely related species. Copyright © 2015 Elsevier B.V. All rights reserved.
1976-08-01
American elm Lonicera tatarica - tartarian honeysuckle Ulmus rubra - slippery elm Siiibucus canadenis - common elder Ulmus thoiii~sii - cork elm ...community borders the marshes and swamps. 2.060 The predominant species are the trembling aspen (Populus tremuloides), red maple (Acer rubrum), the elms ...succession. The most numerous trees (in descending order) are: white birch, red maple, aspen, sugar maple, black ash, basswood, elm (Ulmus sp.), hemlock
Chen, Liang; Xin, Xiulan; Lan, Rong; Yuan, Qipeng; Wang, Xiaojie; Li, Ye
2014-01-01
Blue honeysuckle fruits are rich in anthocyanins with many beneficial effects such as reduction of the risk of cardiovascular diseases, diabetes and cancers. High-speed counter-current chromatography (HSCCC) was used for the separation of anthocyanin on a preparative scale from blue honeysuckle fruit crude extract with a biphasic solvent system composed of tert-butyl methyl ether/n-butanol/acetonitrile/water/trifluoroacetic acid (2:2:1:5:0.01, v/v) for the first time in this paper. Each injection of 100 mg crude extract yielded 22.8 mg of cyanidin 3-glucoside (C3G) at 98.1% purity. The compound was identified by means of electro-spray ionisation mass (ESI/MS) and (1)H and (13)C nuclear magnetic resonance (NMR) spectra. Copyright © 2013 Elsevier Ltd. All rights reserved.
Concentrating phenolic acids from Lonicera japonica by nanofiltration technology
NASA Astrophysics Data System (ADS)
Li, Cunyu; Ma, Yun; Li, Hongyang; Peng, Guoping
2017-03-01
Response surface analysis methodology was used to optimize the concentrate process of phenolic acids from Lonicera japonica by nanofiltration technique. On the basis of the influences of pressure, temperature and circulating volume, the retention rate of neochlorogenic acid, chlorogenic acid and 4-dicaffeoylquinic acid were selected as index, molecular weight cut-off of nanofiltration membrane, concentration and pH were selected as influencing factors during concentrate process. The experiment mathematical model was arranged according to Box-Behnken central composite experiment design. The optimal concentrate conditions were as following: nanofiltration molecular weight cut-off, 150 Da; solutes concentration, 18.34 µg/mL; pH, 4.26. The predicted value of retention rate was 97.99% under the optimum conditions, and the experimental value was 98.03±0.24%, which was in accordance with the predicted value. These results demonstrate that the combination of Box-Behnken design and response surface analysis can well optimize the concentrate process of Lonicera japonica water-extraction by nanofiltration, and the results provide the basis for nanofiltration concentrate for heat-sensitive traditional Chinese medicine.
Muturi, Ephantus J; Gardner, Allison M; Bara, Jeffrey J
2015-10-01
We examined how leaf litter of alien invasive honeysuckle (Lonicera maackii Rupr.) either alone or in combination with leaf litter of one of two native tree species, sugar maple (Acer saccharum Marshall) and northern red oak (Quercus rubra L.), affects the ecology of Culex restuans Theobald, Ochlerotatus triseriatus Say, and Ochlerotatus japonicus Theobald. Experimental mesocosms containing single species litter or a mixture of honeysuckle and one of two native tree species litter were established at South Farms and Trelease Woods study sites in Urbana, IL, and examined for their effect on 1) oviposition site selection by the three mosquito species, and 2) adult production and body size of Oc. triseriatus and Oc. japonicus. There were no significant effects of study site and leaf treatment on Oc. japonicus and Oc. triseriatus oviposition preference and adult production. In contrast, significantly more Cx. restuans eggs rafts were collected at South Farms relative to Trelease Woods and in honeysuckle litter relative to native tree species litter. Significantly larger adult females of Oc. japonicus and Oc. triseriatus were collected at South Farms relative to Trelease Woods and in honeysuckle litter relative to native tree species litter. Combining honeysuckle litter with native tree species litter had additive effects on Cx. restuans oviposition preference and Oc. japonicus and Oc. triseriatus body size, with the exception of honeysuckle and northern red oak litter combination, which had antagonistic effects on Oc. triseriatus body size. We conclude that input of honeysuckle litter into container aquatic habitats may alter the life history traits of vector mosquito species. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
NASA Astrophysics Data System (ADS)
Wu, Jie; Wang, Xiao-Chen; Liu, Yang; Du, Hui; Shu, Qing-Yan; Su, Shang; Wang, Li-Jin; Li, Shan-Shan; Wang, Liang-Sheng
2016-01-01
Flavones are important secondary metabolites found in many plants. In Lonicera species, flavones contribute both physiological and pharmaceutical properties. However, flavone synthase (FNS), the key enzyme responsible for flavone biosynthesis, has not yet been characterized in Lonicera species. In this study, FNSII genes were identified from Lonicera japonica Thunb. and L. macranthoides Hand.-Mazz. In the presence of NADPH, the recombinant cytochrome P450 proteins encoded by LjFNSII-1.1, LjFNSII-2.1, and LmFNSII-1.1 converted eriodictyol, naringenin, and liquiritigenin to the corresponding flavones directly. The different catalytic properties between LjFNSII-2.1 and LjFNSII-1.1 were caused by a single amino acid substitution at position 242 (glutamic acid to lysine). A methionine at position 206 and a leucine at position 381 contributed considerably to the high catalytic activity of LjFNSII-1.1. In addition, LjFNSII-1.1&2.1 and LmFNSII-1.1 also biosynthesize flavones that were further modified by O-glycosylation in transgenic tobacco. The expression levels of the FNSII genes were consistent with flavone accumulation patterns in flower buds. Our findings suggested that the weak catalytic activity of LmFNSII-1.1 and the relatively low expression of LmFNSII-1.1 in flowers might be responsible for the low levels of flavone accumulation in flower buds of L. macranthoides.
Bonarska-Kujawa, D; Pruchnik, H; Cyboran, S; Żyłka, R; Oszmiański, J; Kleszczyńska, H
2014-07-01
The aim of the present research was to determine the effect of blue honeysuckle fruit and leaf extracts components on the physical properties of erythrocyte and lipid membranes and assess their antioxidant properties. The HPLC analysis showed that the extracts are rich in polyphenol anthocyanins in fruits and flavonoids in leaves. The results indicate that both extracts have antioxidant activity and protect the red blood cell membrane against oxidation induced by UVC irradiation and AAPH. The extracts do not induce hemolysis and slightly increase osmotic resistance of erythrocytes. The research showed that extracts components are incorporated mainly in the external part of the erythrocyte membrane, inducing the formation of echinocytes. The values of generalized polarization and fluorescence anisotropy indicate that the extracts polyphenols alter the packing arrangement of the hydrophilic part of the erythrocyte and lipid membranes, without changing the fluidity of the hydrophobic part. The DSC results also show that the extract components do not change the main phase transition temperature of DPPC membrane. Studies of electric parameters of membranes modified by the extracts showed that they slightly stabilize lipid membranes and do not reduce their specific resistance or capacity. Examination of IR spectra indicates small changes in the degree of hydration in the hydrophilic region of liposomes under the action of the extracts. The location of polyphenolic compounds in the hydrophilic part of the membrane seems to constitute a protective shield of the cell against other substances, the reactive forms of oxygen in particular.
Zhou, Yuyang; Tang, Ren-Cheng
2018-01-01
Recently, there is a growing trend towards the functionalization of silk through nanotechnology for the prevention of fiber damage from microbial attack and the enhancement of hygienic aspects. Considering sustainable development and environmental protection, the eco-friendly fabrication of silver nanoparticles (AgNPs)-modified silk using natural extracts has currently become a hot research area. This study presents a facile strategy for the fabrication of colorful and multifunctional silk fabric using biogenic AgNPs prepared by honeysuckle extract as natural reductant and stabilizing agents. The influences of pH and reactant concentrations on the AgNPs synthesis were investigated. The color characteristics and functionalities of AgNPs treated silk were evaluated. The results revealed that the particle size of AgNPs decreased with increasing pH. The diameter of AgNPs decreased with increasing amount of honeysuckle extract and reducing amount of silver nitrate. The transmission electron microscopy image showed that the AgNPs were spherical in shape with a narrow size distribution. The treated silk showed excellent antibacterial activities against E. coli and S. aureus, and certain antioxidant activity. Both of the antibacterial and antioxidant activities were well maintained even after 30 washing cycles. This work provides a sustainable and eco-friendly approach to the fabrication of AgNPs coated silk for colorful and long-term multifunctional textiles using honeysuckle extract. Copyright © 2017 Elsevier B.V. All rights reserved.
Invasive plant species alters consumer behavior by providing refuge from predation.
Dutra, Humberto P; Barnett, Kirk; Reinhardt, Jason R; Marquis, Robert J; Orrock, John L
2011-07-01
Understanding the effects of invasive plants on native consumers is important because consumer-mediated indirect effects have the potential to alter the dynamics of coexistence in native communities. Invasive plants may promote changes in consumer pressure due to changes in protective cover (i.e., the architectural complexity of the invaded habitat) and in food availability (i.e., subsidies of fruits and seeds). No experimental studies have evaluated the relative interplay of these two effects. In a factorial experiment, we manipulated cover and food provided by the invasive shrub Amur honeysuckle (Lonicera maackii) to evaluate whether this plant alters the foraging activity of native mammals. Using tracking plates to quantify mammalian foraging activity, we found that removal of honeysuckle cover, rather than changes in the fruit resources it provides, reduced the activity of important seed consumers, mice in the genus Peromyscus. Two mesopredators, Procyon lotor and Didelphis virginiana, were also affected. Moreover, we found rodents used L. maackii for cover only on cloudless nights, indicating that the effect of honeysuckle was weather-dependent. Our work provides experimental evidence that this invasive plant species changes habitat characteristics, and in so doing alters the behavior of small- and medium-sized mammals. Changes in seed predator behavior may lead to cascading effects on the seeds that mice consume.
NASA Astrophysics Data System (ADS)
Faulkner, Jerry L.; Clebsch, Edward E. C.; Sanders, William L.
1989-09-01
The purpose of this study was to provide the National Park Service with quantitative information regarding the effect of fire on fuel loads and pest species such as Lonicera japonica, Ligustrum sinense, and Rhus radicans. Three study areas of ten plots each were located in Chickamauga Battlefield Reservation of the Chickamauga and Chattanooga National Military Park. Fuel weights, aboveground biomass of honeysuckle, and counts of privet and poison ivy were collected both before and after prescribed fire. Additionally, one fourth of each of 14 plots was treated with glyphosate (tradename Roundup) to test for the use of fire as a herbicide pretreatment. This was a randomized block design with subsampling. Prescribed burning did significantly (α = 0.05) reduce fuel loads and the biomass of honeysuckle on burned plots. There was a statistically different response in fuel load reduction between fall and winter burns. Poison ivy significantly increased on burned plots, while privet counts did not vary significantly. Applications of glyphosate negatively impacted all three target species. Honeysuckle appeared to be damaged more readily on untreated plots, while no difference in response was noted on privet. Significantly more poison ivy growing points were killed by herbicide applications on burned plots than on unburned plots.
Yuan, Yuan; Wang, Zhouyong; Jiang, Chao; Wang, Xumin; Huang, Luqi
2014-01-25
Chlorogenic acids (CGAs) and luteolin are active compounds in Lonicera japonica, a plant of high medicinal value in traditional Chinese medicine. This study provides a comprehensive overview of gene families involved in chlorogenic acid and luteolin biosynthesis in L. japonica, as well as its substitutes Lonicera hypoglauca and Lonicera macranthoides. The gene sequence feature and gene expression patterns in various tissues and buds of the species were characterized. Bioinformatics analysis revealed that 14 chlorogenic acid and luteolin biosynthesis-related genes were identified from the L. japonica transcriptome assembly. Phylogenetic analyses suggested that the function of individual gene could be differentiation and induce active compound diversity. Their orthologous genes were also recognized in L. hypoglauca and L. macranthoides genomic datasets, except for LHCHS1 and LMC4H2. The expression patterns of these genes are different in the tissues of L. japonica, L. hypoglauca and L. macranthoides. Results also showed that CGAs were controlled in the first step of biosynthesis, whereas both steps controlled luteolin in the bud of L. japonica. The expression of LJFNS2 exhibited positive correlation with luteolin levels in L. japonica. This study provides significant information for understanding the functional diversity of gene families involved in chlorogenic acid and the luteolin biosynthesis, active compound diversity of L. japonica and its substitutes, and the different usages of the three species. Copyright © 2012. Published by Elsevier B.V.
Controlling exotic plants in your forest
James H. Miller
1999-01-01
The author discusses the impacts of exotic plants and suggests control and rehabilitation measures. Trees, shrubs, and vines addressed include silk tree or mimosa, Chinese and Japanese privet, kudzu, multiflora rose, Japanese honeysuckle, and Chinese wisteria.
New Cholinesterase Inhibitory Constituents from Lonicera quinquelocularis
Khan, Dilfaraz; Khan, Hidayat Ullah; Khan, Farmanullah; Khan, Shafiullah; Badshah, Syed; Khan, Abdul Samad; Samad, Abdul; Ali, Farman; Khan, Ihsanullah; Muhammad, Nawshad
2014-01-01
A phytochemical investigation on the ethyl acetate soluble fraction of Lonicera quinquelocularis (whole plant) led to the first time isolation of one new phthalate; bis(7-acetoxy-2-ethyl-5-methylheptyl) phthalate (3) and two new benzoates; neopentyl-4-ethoxy-3, 5-bis (3-methyl-2-butenyl benzoate (4) and neopentyl-4-hydroxy-3, 5-bis (3-methyl-2-butenyl benzoate (5) along with two known compounds bis (2-ethylhexyl phthalate (1) and dioctyl phthalate (2). Their structures were established on the basis of spectroscopic analysis and by comparison with available data in the literature. All the compounds (1–5) were tested for their acetylcholinesterase (AChE) and butyrylcholinesterase (BChE) inhibitory activities in dose dependent manner. The IC50 (50% inhibitory effect) values of compounds 3 and 5 against AChE were 1.65 and 3.43 µM while the values obtained against BChE were 5.98 and 9.84 µM respectively. Compounds 2 and 4 showed weak inhibition profile. PMID:24733024
Liu, Xuehui; Zhou, Rongrong; Shen, Bingbing; Chen, Lin; Zhou, Qingyijun; Wan, Dan; Huang, Luqi; Zhang, Shuihan
2017-01-01
Lonicera macranthoides is a Chinese herb that contains a large number of bioactive spanions possessing important pharmacological activities, such as anti-tumour activity. However, detailed information about their anti-tumor activity and bioactive compounds is limited. In order to evaluate the scientific basis, the method of high-speed counter-current chromatography (HSCCC) combined with high performance liquid chromatography mass spectrometry (HPLC-ESI-QTOF/MS) has been developed to separate, purify and analyze saponins from Lonicera macranthoides. Four main saponins, Macranthoidin B (I), Macranthoidin A (II), Macranthoides B (III) and Akebia saponin D (IV) were separated by HSCCC with the solvent systems of ethyl acetate-nbutanol- water (3:2:5) and n-butanol-water-methanol-ethyl acetate (1:6:0.5:4). The purities of these four bioactive ingredients (I-IV) identified and detected by HPLC-ESI-QTOF/MS were 95.1%, 92.7%, 91.8% and 96.3%, respectively. The separated saponins were evaluated for their cytotoxic activities against six tumor cell lines (MCF-7, Hela, A549, HepG2, HT29 and Eca109). Results show that compounds I-IV exhibited particular significant anti-tumor activities against human mammary adenocarcinoma MCF-7 cell with IC50 values ranging from 12.7 to 30.8 µM. It was demonstrated that the combinative method using HPLC-ESI-QTOF/MS and HSCCC was suitable for rapid screening and isolating saponins of Lonicera macranthoides and the isolated compounds have great potential for the development of new antitumor drugs. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Zhou, Wei; Wang, Haidan; Zhu, Xuanxuan; Shan, Jinjun; Yin, Ailing; Cai, Baochang; Di, Liuqing
2013-01-01
The current study aims to investigate the effect of chitosan derivatives on the intestinal absorption and bioavailabilities of forsythoside A (FTA) and Chlorogenic acid (CHA), the major active components in Flos Lonicerae - Fructus Forsythiae herb couple. Biopharmaceutics and pharmacokinetics properties of the two compounds have been characterized in vitro, in situ as well as in rats. Based on the identified biopharmaceutics characteristics of the two compounds, the effect of chitosan derivatives as an absorption enhancer on the intestinal absorption and pharmacokinetics of FTA and CHA in pure compound form as well as extract form were investigated in vitro, in situ and in vivo. Both FTA and CHA demonstrated very limited intestinal permeabilities, leading to oral bioavailabilities being only 0.50% and 0.13% in rats, respectively. Results from both in vitro, in situ as well as in vivo studies consistently indicated that Chito-oligosaccharide (COS) at dosage of 25 mg/kg could enhance intestinal permeabilities significantly as well as the in vivo bioavailabilities of both FTA and CHA than CMCs in Flos Lonicerae - Fructus Forsythiae herb couple preparations, and was safe for gastrointestine from morphological observation. Besides, treatment with Flos Lonicerae - Fructus Forsythiae herb couple preparations with COS at the dosage of 25 mg/kg prevented MDCK damage after influenza virus propagation, which was significantly better than control. The current findings not only identified the usefulness of COS for the improved delivery of Flos Lonicerae - Fructus Forsythiae preparations but also demonstrated the importance of biopharmaceutical characterization in the dosage form development of traditional Chinese medicine. PMID:23675483
Howarth, Dianella G.; Martins, Tiago; Chimney, Edward; Donoghue, Michael J.
2011-01-01
Background and Aims The expression of floral symmetry genes is examined in the CYCLOIDEA lineage following duplication, and these are linked to changes in flower morphology. The study focuses on Dipsacales, comparing DipsCYC2 gene expression in Viburnum (radially symmetrical Adoxaceae) to members of early-diverging lineages of the bilaterally symmetrical Caprifoliaceae (Diervilla and Lonicera). Methods Floral tissue from six species, which included dorsal, lateral and ventral regions of the corolla, was dissected. RNA was extracted from these tissues and each copy of DipsCYC2 was amplified with reverse transcriptase PCR. Key Results Members of DipsCYC2 were expressed across the corolla in the radially symmetrical Viburnum plicatum. A shift to bilaterally symmetrical flowers at the base of the Caprifoliaceae was accompanied by a duplication of the DipsCYC2 gene, resulting in DipsCYC2A and DipsCYC2B, and by loss of expression of both of these copies in the ventral petal. In Lonicera (Caprifolieae), there is a shift from flowers with two dorsally and three ventrally oriented corolla lobes to a clear differentiation of dorsal, lateral and ventral lobes. This shift entailed a decoupling of expression of DipsCYC2A and DipsCYC2B; DipsCYC2B continues to be expressed in the dorsal and lateral lobes, while DipsCYC2A expression is restricted to just the two dorsal lobes. A reversion to more radially symmetrical flowers within Lonicera was accompanied by a re-expansion of expression of both DipsCYC2A and DipsCYC2B. Conclusions The transition to bilateral symmetry in Caprifoliaceae involved: (a) duplication of an ancestral DipsCYC2 gene; (b) the loss of expression of both of these copies in the ventral petal; and (c) changes in the zone of expression, with one copy continuing to be expressed across the dorsal and lateral petals, and the other copy becoming restricted in expression to the dorsal corolla lobes. PMID:21478175
Antioxidant capacity and phenolic compounds of Lonicerae macranthoides by HPLC-DAD-QTOF-MS/MS.
Hu, Xin; Chen, Lin; Shi, Shuyun; Cai, Ping; Liang, Xuejuan; Zhang, Shuihan
2016-05-30
Lonicerae macranthoides with strong antioxidant activity is commonly used in traditional Chinese medicine and folk tea/beverage. However, detailed information about its antioxidant activity and bioactive compounds is limited. Then at first, we comparatively evaluated total phenolic content (TPC), total flavonoid content (TFC) and antioxidant activities of water extract, petroleum ether, ethyl acetate and n-butanol fractions of L. macranthoides. Ethyl acetate fraction exhibited the highest level of TPC (207.38 mg GAE/g DW), TFC (53.06 mg RE/g DW) and the best DPPH scavenge activity and reducing power. n-Butanol fraction showed the best ABTS(+) and O2(-) scavenging activities. Interestingly, water extract, ethyl acetate and n-butanol fractions showed stronger antioxidant activities than positive control, butylated hydroxytoluene (BHT). After that, thirty-one antioxidant phenolic compounds, including twenty-two phenolic acids and nine flavonoids, were screened by DPPH-HPLC experiment and then identified using HPLC-DAD-QTOF-MS/MS. It is noted that twenty-one compounds (1, 3-4, 6-17, 19, 23, 26, 28-29, and 31), as far as was known, were discovered from L. macranthoide for the first time, and eleven of them (3-4, 10-17, and 23) were reported in Lonicera species for the first time. Results indicated that L. macranthoides could serve as promising source of rich antioxidants in foods, beverages and medicines for health promotion. Copyright © 2016 Elsevier B.V. All rights reserved.
Woody invasions of urban trails and the changing face of urban forests in the great plains, USA
Nemec, K.T.; Allen, Craig R.; Alai, A.; Clements, G.; Kessler, A.C.; Kinsell, T.; Major, A.; Stephen, B.J.
2011-01-01
Corridors such as roads and trails can facilitate invasions by non-native plant species. The open, disturbed habitat associated with corridors provides favorable growing conditions for many non-native plant species. Bike trails are a corridor system common to many urban areas that have not been studied for their potential role in plant invasions. We sampled five linear segments of urban forest along bike trails in Lincoln, Nebraska to assess the invasion of woody non-native species relative to corridors and to assess the composition of these urban forests. The most abundant plant species were generally native species, but five non-native species were also present: white mulberry (Morus alba), common buckthorn (Rhamnus cathartica), tree-of-heaven (Ailanthus altissima), honeysuckle (Lonicera spp.) and elm (Ulmus spp.). The distribution of two of the woody species sampled, common buckthorn and honeysuckle, significantly decreased with increasing distance from a source patch of vegetation (P = 0.031 and 0.030). These linear habitats are being invaded by non-native tree and shrub species, which may change the structure of these urban forest corridors. If non-native woody plant species become abundant in the future, they may homogenize the plant community and reduce native biodiversity in these areas. ?? 2011 American Midland Naturalist.
2012-11-01
the most common. Japanese honeysuckle and Chinese tallow are limited to are- as along the fence line, and mimosa was only found in two locations at the...HAWKINSVILLE AFSSS Scientific Name Common Name Albizia julibrissin* mimosa Ampelopsis arborea peppervine Andropogon virginicus broomsedge bluestem
Zhou, Wei; Tan, Xiaobin; Shan, Jinjun; Wang, Shouchuan; Yin, Ailing; Cai, Baochang; Di, Liuqing
2014-01-01
The Flos Lonicerae-Fructus Forsythiae herb couple is the basic components of Chinese herbal preparations (Shuang-Huang-Lian tablet, Yin-Qiao-Jie-Du tablet and Fufang Qin-Lan oral liquid), and its pharmacological effects were significantly higher than that in Flos Lonicerae or Fructus Forsythiae, but the reasons remained unknown. In the present study, pattern recognition analysis (hierarchical cluster analysis (HCA) and principal component analysis (PCA)) combined with UHPLC-ESI/LTQ-Orbitrap MS system were performed to study the chemical constitution difference between co-decoction and mixed decoction in the term of chemistry. Besides, the pharmacokinetics in vivo and intestinal absorption in vitro combined with pattern recognition analysis were used to reveal the discrepancy between herb couple and single herbs in the view of biology. The observation from the chemical view in vitro showed that there was significant difference in quantity between co-decoction and mixed decoction by HCA, and the exposure level of isoforsythoside and 3, 5-dicaffeoylquinic acid in co-decoction, higher than that in mixed decoction, directly resulted in the discrepancy between co-decoction and mixed decoction using both PCA and HCA. The observation from the pharmacokinetics displayed that the exposure level in vivo of neochlorogenic acid, 3, 4-dicaffeoylquinic acid, isoforsythoside and forsythoside A, higher than that in single herbs, was the main factor contributing to the difference by both PCA and HCA, interestingly consistent with the results obtained from Caco-2 cells in vitro, which indicated that it was because of intestinal absorption improvement of neochlorogenic acid, 3, 4-dicaffeoylquinic acid, isoforsythoside and forsythoside A that resulted in a better efficacy of herb couple than that of single herbs from the perspective of biology. The results above illustrated that caffeic acid derivatives in Flos Lonicerae-Fructus Forsythiae herb couple could be considered as chemical
Zhou, Wei; Tan, Xiaobin; Shan, Jinjun; Wang, Shouchuan; Yin, Ailing; Cai, Baochang; Di, Liuqing
2014-01-01
The Flos Lonicerae-Fructus Forsythiae herb couple is the basic components of Chinese herbal preparations (Shuang-Huang-Lian tablet, Yin-Qiao-Jie-Du tablet and Fufang Qin-Lan oral liquid), and its pharmacological effects were significantly higher than that in Flos Lonicerae or Fructus Forsythiae, but the reasons remained unknown. In the present study, pattern recognition analysis (hierarchical cluster analysis (HCA) and principal component analysis (PCA)) combined with UHPLC-ESI/LTQ-Orbitrap MS system were performed to study the chemical constitution difference between co-decoction and mixed decoction in the term of chemistry. Besides, the pharmacokinetics in vivo and intestinal absorption in vitro combined with pattern recognition analysis were used to reveal the discrepancy between herb couple and single herbs in the view of biology. The observation from the chemical view in vitro showed that there was significant difference in quantity between co-decoction and mixed decoction by HCA, and the exposure level of isoforsythoside and 3, 5-dicaffeoylquinic acid in co-decoction, higher than that in mixed decoction, directly resulted in the discrepancy between co-decoction and mixed decoction using both PCA and HCA. The observation from the pharmacokinetics displayed that the exposure level in vivo of neochlorogenic acid, 3, 4-dicaffeoylquinic acid, isoforsythoside and forsythoside A, higher than that in single herbs, was the main factor contributing to the difference by both PCA and HCA, interestingly consistent with the results obtained from Caco-2 cells in vitro, which indicated that it was because of intestinal absorption improvement of neochlorogenic acid, 3, 4-dicaffeoylquinic acid, isoforsythoside and forsythoside A that resulted in a better efficacy of herb couple than that of single herbs from the perspective of biology. The results above illustrated that caffeic acid derivatives in Flos Lonicerae-Fructus Forsythiae herb couple could be considered as chemical
Identification of understory invasive exotic plants with remote sensing in urban forests
NASA Astrophysics Data System (ADS)
Shouse, Michael; Liang, Liang; Fei, Songlin
2013-04-01
Invasive exotic plants (IEP) pose a significant threat to many ecosystems. To effectively manage IEP, it is important to efficiently detect their presences and determine their distribution patterns. Remote sensing has been a useful tool to map IEP but its application is limited in urban forests, which are often the sources and sinks for IEP. In this study, we examined the feasibility and tradeoffs of species level IEP mapping using multiple remote sensing techniques in a highly complex urban forest setting. Bush honeysuckle (Lonicera maackii), a pervasive IEP in eastern North America, was used as our modeling species. Both medium spatial resolution (MSR) and high spatial resolution (HSR) imagery were employed in bush honeysuckle mapping. The importance of spatial scale was also examined using an up-scaling simulation from the HSR object based classification. Analysis using both MSR and HSR imagery provided viable results for IEP distribution mapping in urban forests. Overall mapping accuracy ranged from 89.8% to 94.9% for HSR techniques and from 74.6% to 79.7% for MSR techniques. As anticipated, classification accuracy reduces as pixel size increases. HSR based techniques produced the most desirable results, therefore is preferred for precise management of IEP in heterogeneous environment. However, the use of MSR techniques should not be ruled out given their wide availability and moderate accuracy.
Liu, Rong; Lai, Ke; Xiao, Yu; Ren, Jing
2017-12-01
Chlorogenic acid (ChA) is the major compound in Shuang-Huang-Lian (SHL), which is mainly composed of ChA, baicalin, and Forsythia suspense Thunb Vahl. The effects of co-existing compounds in SHL and Lonicera japanica Thunb on the absorption of ChA was investigated. According to 3 × 3 Latin-square test, ChA alone, the extracts of Lonicera japanica, or the mixture of ChA, baicalin and Forsythia suspense (ChA effective doses is 60 mg/kg) was separately given to six beagles for seven days. The oral pharmacokinetic parameters of ChA in plasma, urine and faeces were quantified by HPLC/UV and analyzed. The pharmacokinetic parameters of ChA alone, the extracts of Lonicera japanica, and the mixture of ChA, baicalin, and Forsythia suspense were as followed: C max (2.350 ± 0.483, 1.655 ± 0.576, 2.332 ± 0.606 μg/mL), AUC 0-∞ (6.324 ± 1.853, 4.216 ± 1.886, 6.074 ± 1.473 μg·h/mL), t 1/2 (0.911 ± 0.187, 1.204 ± 0.309, 1.094 ± 0.193 h), and T max (1.861 ± 0.499, 1.000 ± 0.459, 1.833 ± 0.279 h). Accumulative fraction excretion of ChA in urine were 0.73 ± 0.55, 1.25 ± 1.23, 1.05 ± 0.96%, while that in faeces were 0.68 ± 0.94, 0.19 ± 0.40, and 1.76 ± 3.57%. Co-existing compounds in SHL have no effect on the absorption of ChA, while the concomitant compounds in Lonicera japanica could decrease that of ChA. ChA in Beagles might have high biological transformation.
Electrochemical Determination of the Antioxidant Potential of Some Less Common Fruit Species
Gazdik, Zbynek; Krska, Boris; Adam, Vojtech; Saloun, Jan; Pokorna, Tunde; Reznicek, Vojtech; Horna, Ales; Kizek, Rene
2008-01-01
Various berries and fruit types of less common fruit species are known to contain antioxidants. Consumption of high amounts of antioxidant flavonoids, which display a variety of biological properties, including antiproliferative and anti-inflammatory activity, may have a positive impact on human health, particularly for the prevention of cancer and other inflammatory diseases. In these studies, based on the hypothesis that the fruit extract with the highest content would possess significantly higher health benefits, flavonoid-rich extracts were obtained from some less common fruit species – Blue Honeysuckles (Lonicera Kamtschatica and Lonicera edulis, Turcz. ex. Freyn), Saskatoon berry (Amelanchier alnifolia Nutt.) and Chinese Hawthorn (Crataegus pinnatifida BUNGE) – grown from germplasm held at the Mendel University of Agriculture and Forestry in Brno, Czech Republic and then characterized in terms of biological value based on the results from a relative antioxidant capacity assessment. The antioxidant content evaluation was based on the total flavonoid amount, determined by liquid chromatography with electrochemical detection (HPLC-ED). A DPPH• test was applied as a reference. The antioxidant content measured in Chinese Hawthorn fruit extract identified it as a potent source of flavonoid antioxidants, with a content 9-fold higher than that seen in Amelanchier fruit. The multifunctional HPLC-ED array method coupled with a DPPH• reference appears to be the optimal analytical progress, accurately reflecting the nutritive-therapeutic properties of a fruit. PMID:27873945
NASA Astrophysics Data System (ADS)
Chen, Jianbo; Guo, Baolin; Yan, Rui; Sun, Suqin; Zhou, Qun
2017-07-01
With the utilization of the hand-held equipment, Fourier transform infrared (FT-IR) spectroscopy is a promising analytical technique to minimize the time cost for the chemical identification of herbal materials. This research examines the feasibility of the hand-held FT-IR spectrometer for the on-site testing of herbal materials, using Lonicerae Japonicae Flos (LJF) and Lonicerae Flos (LF) as examples. Correlation-based linear discriminant models for LJF and LF are established based on the benchtop and hand-held FT-IR instruments. The benchtop FT-IR models can exactly recognize all articles of LJF and LF. Although a few LF articles are misjudged at the sub-class level, the hand-held FT-IR models are able to exactly discriminate LJF and LF. As a direct and label-free analytical technique, FT-IR spectroscopy has great potential in the rapid and automatic chemical identification of herbal materials either in laboratories or in fields. This is helpful to prevent the spread and use of adulterated herbal materials in time.
Impacts of invasive nonnative plant species on the rare forest herb Scutellaria montana
NASA Astrophysics Data System (ADS)
Sikkema, Jordan J.; Boyd, Jennifer N.
2015-11-01
Invasive plant species and overabundant herbivore populations have the potential to significantly impact rare plant species given their increased risk for local extirpation and extinction. We used interacting invasive species removal and grazer exclusion treatments replicated across two locations in an occurrence of rare Scutellaria montana (large-flowered skullcap) in Chattanooga, Tennessee, USA, to assess: 1) competition by invasive Ligustrum sinense (Chinese privet) and Lonicera japonica (Japanese honeysuckle) and 2) the role of invasive species in mediating Oedocoilus virginianus (white-tailed deer) grazing of S. montana. Contrary to our hypothesis that invasive species presence would suppress S. montana directly via competition, S. montana individuals experienced a seasonal increase in stem height when invasive species were intact but not when invasive species were removed. Marginally significant results indicated that invasive species may afford S. montana protection from grazers, and we suggest that invasive species also could protect S. montana from smaller herbivores and/or positively influence abiotic conditions. In contrast to growth responses, S. montana individuals protected from O. virginianus exhibited a decrease in flowering between seasons relative to unprotected plants, but invasive species did not affect this variable. Although it has been suggested that invasive plant species may negatively influence S. montana growth and fecundity, our findings do not support related concerns. As such, we suggest that invasive species eradication efforts in S. montana habitat could be more detrimental than positive due to associated disturbance. However, the low level of invasion of our study site may not be representative of potential interference in more heavily infested habitat.
Dynamic selective environments and evolutionary traps in human-dominated landscapes.
Rodewald, Amanda D; Shustack, Daniel P; Jones, Todd M
2011-09-01
Human activities can alter selective environments in ways that can reduce the usefulness of certain ornamental traits as honest signals of individual quality and, in some cases, may create evolutionary traps, where rapid changes in selective environments result in maladaptive behavioral decisions. Using the sexually dichromatic, socially monogamous Northern Cardinal (Cardinalis cardinalis) as a model, we hypothesized that urbanization would erode the relationship between plumage coloration and reproductive success. Because the exotic Amur honeysuckle (Lonicera maackii) provides carotenoids, is a preferred habitat attribute, and increases vulnerability to nest predation, we predicted the presence of an evolutionary trap, whereby the brightest males would achieve the lowest reproductive success. Working at 14 forests in Ohio, USA, 2006-2008, we measured plumage color, monitored reproduction, and quantified habitat within territories. In rural landscapes, the brightest males bred earliest in the season and secured more preferred territories; however, annual reproduction declined with plumage brightness. Coloration of urban males was not associated with territory attributes or reproduction. Female redness across all landscapes was negatively related to reproduction. Poor reproductive performance of otherwise higher-quality males probably resulted from preferences for honeysuckle, which reduces annual reproduction when used as a nesting substrate early in the season. In this way, exotic shrubs prompted an evolutionary trap that was avoided in urban forests where anthropogenic resources disassociated male color and reproductive phenology and success. Our study illustrates how modified selective environments in human-dominated landscapes might shape microevolutionary processes in wild bird populations.
Paradise lost: alien plant invaders compromising productive, rich state forests
Nancy J. Loewenstein; James H. Miller; Erwin Chamblis
2008-01-01
Kudzu and Chinese privet along Alabama roadways are a familiar sight and Japanese honeysuckle is so commonplace it has practically become a part of Southern culture. But are these and other invasive plants really having a negative impact on forests? Just how bad is the invasive plant problem? What are the most effective ways to combat invasive plants?
Zhang, Jingru; Wu, Minlin; Li, Weidong; Bai, Genben
2017-12-01
For many centuries, Lonicera japonica has been used as an effective herb for the treatment of inflammation and swelling because of the presence of bioactive components such as chlorogenic acid (CGA). To clarify the relationship between L. japonica hydroxycinnamoyl CoA quinate hydroxycinnamoyl transferase (HQT) gene expression and CGA content, an HQT eukaryotic expression system was constructed using Gateway cloning. L. japonica callus transformed with HQT was obtained using Agrobacterium tumefaciens-mediated transformation. We found a positive correlation between CGA content, determined by High-Performance Liquid Chromatography (HPLC), and the expression of HQT, analyzed by semi-quantitative RT-PCR. This study demonstrates that the HQT gene positively regulates CGA synthesis and lays the foundation for further study into enhancing efficacious components of medicinal plants. Copyright © 2017. Published by Elsevier Masson SAS.
Orrock, John L; Dutra, Humberto P; Marquis, Robert J; Barber, Nicholas
2015-04-01
Direct and indirect effects can play a key role in invasions, but experiments evaluating both are rare. We examined the roles of direct competition and apparent competition by exotic Amur honeysuckle (Lonicera maackii) by manipulating (1) L. maackii vegetation, (2) presence of L. maackii fruits, and (3) access to plants by small mammals and deer. Direct competition with L. maackii reduced the abundance and richness of native and exotic species, and native consumers significantly reduced the abundance and richness of native species. Although effects of direct competition and consumption were more pervasive, richness of native plants was also reduced through apparent competition, as small-mammal consumers reduced richness only when L. maackii fruits were present. Our experiment reveals the multiple, interactive pathways that affect the success and impact of an invasive exotic plant: exotic plants may directly benefit from reduced attack by native consumers, may directly exert strong competitive effects on native plants, and may also benefit from apparent competition.
[Study on seed quality test and quality standard of Lonicera macranthoides].
Zhang, Ying; Xu, Jin; Li, Long-Yun; Cui, Guang-Lin; She, Yue-Hui
2016-04-01
Referring to the rules for agricultural seed testing (GB/T 3543-1995) issued by China, the test of sampling, purity, thousand seed weight, moisture, viability, relative conductivity and germination rate had been studied for seed quality test methods of Lonicera macranthoides. The seed quality from 38 different collection areas was measured to establish quality classification standard by K-means clustering. The results showed that at least 7.5 g seeds should be sampled, and passed 20-mesh sieve for purity analysis.The 500-seed method used to measure thousand seed weight. The moisture was determined by crushed seeds dried in high temperature (130±2) ℃ for 3 h.The viability determined by 25 ℃ 0.1% TTC stained 5h in dark. 1.0 g seeds soaked in 50 ml ultra pure water in 25 ℃ for 12 hours to determine the relative conductivity. The seed by 4 ℃stratification for 80 days were cultured on paper at 15 ℃. Quality of the seeds from different areas was divided into three grades. The primary seed quality classification standard was established.The I grade and II grade were recommend use in production. Copyright© by the Chinese Pharmaceutical Association.
Therapeutic Effects of Blue Honeysuckle on Lesions of Hyperthyroidism in Rats.
Park, Sang-In; Lee, Young Joon; Choi, Seong Hun; Park, Soo Jin; Song, Chang-Hyun; Ku, Sae-Kwang
2016-01-01
Hyperthyroidism is a hypermetabolic syndrome characterized by an overproduction of thyroid hormones, which enhances the hormone-induced oxidative stress responsible for some complications in the liver, heart and muscle. Blue honeysuckle (BH) is an edible berry, rich in polyphenols, especially flavonoids or anthocyanins, known as strong antioxidants. The chemo-protective activities of the berry have been connected to the improvement of symptoms in cancer, diabetes mellitus, tumor or cardiovascular diseases. Therefore, the therapeutic effects of BH were examined in hyperthyroidism rat model. The hyperthyroidism was induced by injection with levothyroxine (LT4), and the model was treated with distilled water (LT4 control), propylthiouracil (PTU) or BH at 3 dosages of 500, 250 and 125[Formula: see text]mg/kg. The treatment was performed once a day for 15 days. Compared to LT4 control, the oral administration of BH dose-dependently ameliorated the hyperthyroidism, reducing thyroid hormones and increasing thyroid stimulating hormones. These effects were accompanied by improvement of body weight loss and atrophy in the thyroid gland, liver and epididymal fat pads. BH treatments also reduced the levels of hepatic enzymes (AST and ALT), which suggests BH exerts protective effects on hepatocytes. BH might also be involved in the augmentation of the anti-oxidant activities, supported by increased endogenous antioxidant (glutathione). In addition, the histopathological analyses revealed the beneficial effects of BH on the atrophic changes and cellular injuries in the thyroid gland, liver and epididymal fat pads. The therapeutic potentials of BH were either similar or more effective than PTU. These results provide valuable information that will guide more detailed studies to use the BH as a complementary and alternative medicine.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Park, Sun Hong; Roh, Eunmiri; Kim, Hyun Soo
Highlights: •Lonicerae flos extract (HS-23) is a clinical candidate, Phase I for sepsis treatment. •Here, HS-23 or its major constituents rescued LPS-induced septic mortality in mice. •As a mechanism, they directly inhibited IRAK-4-catalyzed kinase activity. •Thus, they suppressed LPS-induced expression of NF-κB/AP-1-target inflammatory genes. -- Abstract: Lonicerae flos extract (HS-23) is a clinical candidate currently undergoing Phase I trial in lipopolysaccharide (LPS)-injected healthy human volunteers, but its molecular basis remains to be defined. Here, we investigated protective effects of HS-23 or its major constituents on Escherichia coli LPS-induced septic mortality in mice. Intravenous treatment with HS-23 rescued LPS-intoxicated C57BL/6J micemore » under septic conditions, and decreased the levels of cytokines such as tumor necrosis factor α (TNF-α), interleukin (IL)-1β and high-mobility group box-1 (HMGB-1) in the blood. Chlorogenic acid (CGA) and its isomers were assigned as major constituents of HS-23 in the protection against endotoxemia. As a molecular mechanism, HS-23 or CGA isomers inhibited endotoxin LPS-induced autophosphorylation of the IL-1 receptor-associated kinase 4 (IRAK-4) in mouse peritoneal macrophages as well as the kinase activity of IRAK-4 in cell-free reactions. HS-23 consequently suppressed downstream pathways critical for LPS-induced activation of nuclear factor (NF)-κB or activating protein 1 (AP-1) in the peritoneal macrophages. HS-23 also inhibited various toll-like receptor agonists-induced nitric oxide (NO) production, and down-regulated LPS-induced expression of NF-κB/AP-1-target inflammatory genes in the cells. Taken together, HS-23 or CGA isomers exhibited anti-inflammatory therapy against LPS-induced septic mortality in mice, at least in part, mediated through the inhibition of IRAK-4.« less
Wang, Ju-Le; Sun, Yang; Zhou, Hui-Ying; Xu, Qiang; Dun, Zhu
2006-01-01
To explore the effects of traditional Tibetan medicine, Fructus Lonicerae microphyllae (FLM) on phagecytosis and cytokines production of murine macrophages. The phagecytosis of murine macrophages was analyzed by neutral red phagecytosis assay. The activities of IL-1 and TNF-alpha were measured by biological methods. The mRNA of TNF-alpha and INF-gamma expressed by macrophages was detected by RT-PCR. The phagecytosis of murine macrophages was significantly enhanced by FLM at a concentration from 1 microg x mL(-1) to 100 microg x mL(-1) and the secretions of IL-1, and TNF-alpha from macrophages were markedly induced by FLM. Meanwhile, FLM also increased the expression of TNF-alpha mRNA and INF-gamma mRHA from macrophages in vitro. FLM could promote phagecytosis and cytokines production of murine macrophages.
Jiang, Min; Han, Yan-qi; Zhou, Meng-ge; Zhao, Hong-zhi; Xiao, Xue; Hou, Yuan-yuan; Gao, Jie; Bai, Gang; Luo, Guo-an
2014-01-01
Flos Lonicerae Japonicae (FLJ) is an important cash crop in eastern Asia, and it is an anti-inflammatory Traditional Chinese Medicine. There are large variations in the quality of the marketed FLJ products. To find marker ingredients useful for quality control, a tandem technology integrating ultra-performance liquid chromatography/quadrupole time-of-flight mass spectrometry (UPLC-Q/TOF), principal component analysis (PCA), heat map analysis and hierarchical cluster analysis coupled with a NF-κB luciferase reporter gene assay were used to identify the different ingredients from the green bud, white bud, flowering stage and leaf stages, as well as to screen the anti-inflammatory activity of FLJ compositions. As flowering progressed, the anti-inflammatory effects of FLJ gradually decreased; however, chlorogenic acid, swertiamarin and sweroside should be used to evaluate the quality of FLJ products.
Jiang, Min; Han, Yan-qi; Zhou, Meng-ge; Zhao, Hong-zhi; Xiao, Xue; Hou, Yuan-yuan; Gao, Jie; Bai, Gang; Luo, Guo-an
2014-01-01
Flos Lonicerae Japonicae (FLJ) is an important cash crop in eastern Asia, and it is an anti-inflammatory Traditional Chinese Medicine. There are large variations in the quality of the marketed FLJ products. To find marker ingredients useful for quality control, a tandem technology integrating ultra-performance liquid chromatography/quadrupole time-of-flight mass spectrometry (UPLC-Q/TOF), principal component analysis (PCA), heat map analysis and hierarchical cluster analysis coupled with a NF-κB luciferase reporter gene assay were used to identify the different ingredients from the green bud, white bud, flowering stage and leaf stages, as well as to screen the anti-inflammatory activity of FLJ compositions. As flowering progressed, the anti-inflammatory effects of FLJ gradually decreased; however, chlorogenic acid, swertiamarin and sweroside should be used to evaluate the quality of FLJ products. PMID:24809338
[Impact of storage conditions and time on herb of Lonicera macranthoides].
Ma, Peng; Li, Long-Yun; Zhang, Ying
2014-03-01
To study the effect of different storage conditions and storage time on herb quality of Lonicera macranthoides, different packaging materials including vacuum plastic bags, plastic bags, woven bags, sealed with endometrial bags, paper bags, sack bags were selected for the study under different storage conditions including room temperature, 5 degrees C refrigerator, low temperature of - 20 degrees C refrigerator and desiccator. Twenty-four batches of samples were used for the study, and active ingredients were determined. The experimental results showed that the ingredients in each storage group changed with the storage time, storage conditions (storage environment, packaging). Under the same storage time, the storage environment (temperature, humidity) had effect on the stability of herb quality. Low temperature had less effect on herb quality. The effect of packaging on herb quality was as following: plastic vacuum packaging > woven with endometrial sealed packaging > plastic bag > woven bag > sack bags > paper bags. Under the same storage conditions, with the increase of storage time, caffeic acid content increased slowly, and other five ingredients content decreased gradually. Storage time affected significantly on the intrinsic quality (chemical composition) and appearance of herb. It is suggested that low temperature (5 degrees C), dark and sealed storage are suitable for storage of L. macranthoides herb, the storage time should be not more than 24 months.
Protection of Flos Lonicerae against acetaminophen-induced liver injury and its mechanism.
Jiang, Ping; Sheng, Yu-chen; Chen, Yu-hao; Ji, Li-li; Wang, Zheng-tao
2014-11-01
This study aims to observe the protective action of Flos Lonicerae (FL) aqueous extract against acetaminophen (AP)-induced liver injury and its mechanism. Results show that FL decreases AP-increased serum alanine/aspartate transaminases (ALT/AST) activity, as well as total bilirubin (TB) amount, in mice. Histological evaluation of the liver further confirms the protection of FL against AP-induced hepatotoxicity. TdT-mediated biotin-dUTP nick-end labeling (TUNEL) assay shows that FL reduces AP-increased apoptotic cells. Furthermore, AP-decreased liver glutamate-cysteine ligase (GCL) enzymatic activity and glutathione (GSH) amount are both reversed by FL because of the increased expression of the catalytic subunit of GCL (GCLC) protein. The amount of chlorogenic acid (CGA), caffeic acid, and luteolin, the main active compounds in FL, is detected by high-performance liquid chromatography (HPLC). In addition, cell viability assay demonstrates that polyphenols in FL, such as CGA, caffeic acid, as well as isochlorogenic acids A, B, and C, can reverse AP-induced cytotoxicity. In conclusion, FL can prevent AP-induced liver injury by inhibiting apoptosis. The cellular antioxidant enzyme GCL is also involved in such protection. Polyphenols may be the main active hepato-protective ingredients in FL. Copyright © 2014 Elsevier B.V. All rights reserved.
Li, Guizhen; Wang, Wei; Wang, Qian; Zhu, Tao
2016-02-01
Deep eutectic solvents (DES) were synthesized with choline chloride (ChCl), and DES modified molecular imprinted polymers (DES-MIPs), DES modified non-imprinted polymers (DES-NIPs, without template), MIPs and NIPs were prepared in an identical procedure. Fourier transform infrared spectrometer (FT-IR) and field emission scanning electron microscopy (FE-SEM) were used to characterize the obtained polymers. Rebinding experiment and solid-phase extraction (SPE) were used to prove the high selectivity adsorption properties of the polymers. Box-Behnken design (BBD) with three factors was used to optimize the extraction condition of chlorogenic acid (CA) from honeysuckles. The optimum extraction conditions were found to be ultrasonic time optimized (20 min), the volume fraction of ethanol (60%) and ratio of liquid to material (15 mL g(-1)). Under these conditions, the mean extraction yield of CA was 12.57 mg g(-1), which was in good agreement with the predicted BBD model value. Purification of hawthorn extract was achieved by SPE process, and SPE recoveries of CA were 72.56, 64.79, 69.34 and 60.08% by DES-MIPs, DES-NIPs, MIPs and NIPs, respectively. The results showed DES-MIPs had potential for promising functional adsorption material for the purification of bioactive compounds. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Gardner, Allison M; Allan, Brian F; Frisbie, Lauren A; Muturi, Ephantus J
2015-06-16
Exotic invasive plants alter the structure and function of native ecosystems and may influence the distribution and abundance of arthropod disease vectors by modifying habitat quality. This study investigated how invasive plants alter the ecology of Culex pipiens, an important vector of West Nile virus (WNV) in northeastern and midwestern regions of the United States. Field and laboratory experiments were conducted to test the hypothesis that three native leaf species (Rubus allegheniensis, blackberry; Sambucus canadensis, elderberry; and Amelanchier laevis, serviceberry), and three exotic invasive leaf species (Lonicera maackii, Amur honeysuckle; Elaeagnus umbellata, autumn olive; and Rosa multiflora, multiflora rose) alter Cx. pipiens oviposition site selection, emergence rates, development time, and adult body size. The relative abundance of seven bacterial phyla in infusions of the six leaf species also was determined using quantitative real-time polymerase chain reaction to test the hypothesis that variation in emergence, development, and oviposition site selection is correlated to differences in the diversity and abundance of bacteria associated with different leaf species, important determinants of nutrient quality and availability for mosquito larvae. Leaf detritus from invasive honeysuckle and autumn olive yielded significantly higher adult emergence rates compared to detritus from the remaining leaf species and honeysuckle alleviated the negative effects of intraspecific competition on adult emergence. Conversely, leaves of native blackberry acted as an ecological trap, generating high oviposition but low emergence rates. Variation in bacterial flora associated with different leaf species may explain this asymmetrical production of mosquitoes: emergence rates and oviposition rates were positively correlated to bacterial abundance and diversity, respectively. We conclude that the displacement of native understory plant species by certain invasive shrubs
Rai, Amit; Kamochi, Hidetaka; Suzuki, Hideyuki; Nakamura, Michimi; Takahashi, Hiroki; Hatada, Tomoki; Saito, Kazuki; Yamazaki, Mami
2017-01-01
Lonicera japonica is one of the most important medicinal plants with applications in traditional Chinese and Japanese medicine for thousands of years. Extensive studies on the constituents of L. japonica extracts have revealed an accumulation of pharmaceutically active metabolite classes, such as chlorogenic acid, luteolin and other flavonoids, and secoiridoids, which impart characteristic medicinal properties. Despite being a rich source of pharmaceutically active metabolites, little is known about the biosynthetic enzymes involved, and their expression profile across different tissues of L. japonica. In this study, we performed de novo transcriptome assembly for L. japonica, representing transcripts from nine different tissues. A total of 22 Gbps clean RNA-seq reads from nine tissues of L. japonica were used, resulting in 243,185 unigenes, with 99,938 unigenes annotated based on a homology search using blastx against the NCBI-nr protein database. Unsupervised principal component analysis and correlation studies using transcript expression data from all nine tissues of L. japonica showed relationships between tissues, explaining their association at different developmental stages. Homologs for all genes associated with chlorogenic acid, luteolin, and secoiridoid biosynthesis pathways were identified in the L. japonica transcriptome assembly. Expression of unigenes associated with chlorogenic acid was enriched in stems and leaf-2, unigenes from luteolin were enriched in stems and flowers, while unigenes from secoiridoid metabolic pathways were enriched in leaf-1 and shoot apex. Our results showed that different tissues of L. japonica are enriched with sets of unigenes associated with specific pharmaceutically important metabolic pathways and, therefore, possess unique medicinal properties. The present study will serve as a resource for future attempts for functional characterization of enzyme coding genes within key metabolic processes.
Japanese Competitiveness and Japanese Management.
ERIC Educational Resources Information Center
Minabe, Shigeo
1986-01-01
Analyzes and compares Japanese and American industrial policy and labor practices. Proposes that certain aspects of the Japanese system be adapted by American businesses for purpose of increasing international competitiveness. Proposes specific actions and plans for both the Japanese and American systems. (ML)
Zhang, Shui-Han; Hu, Xin; Shi, Shu-Yun; Huang, Lu-Qi; Chen, Wei; Chen, Lin; Cai, Ping
2016-05-01
A major challenge of profiling chlorogenic acids (CGA) in natural products is to effectively detect unknown or minor isomeric compounds. Here, we developed an effective strategy, typical ultraviolet (UV) spectra in combination with diagnostic mass fragmentation analysis based on HPLC-DAD-QTOF-MS/MS, to comprehensively profile CGA in the buds of Lonicera macranthoides. First, three CGA UV patterns were obtained by UV spectra screening. Second, 13 types of CGA classified by molecular weights were found by thorough analysis of CGA peaks using high-resolution MS. Third, selected ion monitoring (SIM) was carried out for each type of CGA to avoid overlooking of minor ones. Fourth, MS/MS spectra of each CGA were investigated. Then 70 CGA were identified by matching their UV spectra, accurate mass signals and fragmentation patterns with standards or previously reported compounds, including six caffeoylquinic acids (CQA), six diCQA, one triCQA, three caffeoylshikimic acids (CSA), six diCSA, one triCSA, three p-coumaroylquinic acids (pCoQA), four p-coumaroylcaffeoylquinic acids (pCoCQA), four feruloylquinic acids (FQA), five methyl caffeoylquinates (MCQ), three ethyl caffeoylquinates (ECQ), three dimethoxycinnamoylquinic acids (DQA), six caffeoylferuloylquinic acids (CFQA), six methyl dicaffeoylquinates (MdiCQ), four FQA glycosides (FQAG), six MCQ glycosides (MCQG), and three ethyl dicaffeoylquinates (EdiCQ). Forty-five of them were discovered from Lonicera species for the first time, and it is noted that CGA profiles were investigated for the first time in L. macranthoides. Results indicated that the developed method was a useful approach to explore unknown and minor isomeric compounds from complex natural products.
Tan, Mu-xiu; Zeng, Wen-wen; Wei, Peng-xiao; Mo, Qiao-cheng; Pu, Zu-ning; Cen, Xiu-fen; Shi, Feng-hua
2015-05-01
To explore the germination conditions of Lonicera hypoglauca sand culture seeds and the effects of sand culture seedlings sterilization. 0.1% HgCl2 with different sterilization time, different illumination time and temperature culture condition were adopted to study the germination conditions of sand culture seeds. Different sterilization treatments and different hardening-seedling days were used to test the sterilization effect of sand culture seedlings. The sterilization effect of the combination of 75% ethanol 30 s + 0.1% HgCl2 5 min on Lonicera hypoglauca seeds was the optimum,with the average pollution rate of 15.56%, and the average germination rate reached 51.11%. The combination of varied temperature-room temperature under light for 12 h/d was the best, with the average germination rate peaked at 75.49%, and the average germination potential reached 68.36%. The treatment of detergent liquor scrub-tap water wash on the part above the hypocotyl, which was sand cultured under the opening condition and had no root, showed the best sterilization effect, with the average pollution rate was zero, and the average survival rate peaked at 100.00%. The sterilization effect of sand culture seedlings, which was disinfected after cleaning by detergent liquor scrub-tap water wash after hardening-seeding for 30 days, was the best, with the average pollution rate of 50.00%, and the average survival rate of 100.00%. The best sterilization effect is the combination of 75% ethanol 30 s + 0.1% HgCl2 5 min; Lighting for 12 h/d of varied temperature-room temperature is regarded as the optimum culture condition. The treatment of detergent liquor scrub-tap water wash treatment on the part above the hypocotyl,which is sand cultured under the opening condition and had no root, shows the best sterilization effect. For the sand culture seedlings, before inoculated in subculture medium, should be hardening-seedling for some days and sterilized after detergent liquor scrub-tap water wash.
An assessment of Japanese honeysuckle in northern U.S. forests
Cassandra M. Kurtz; Mark H. Hansen
2015-01-01
This publication is part of a series that provides an overview of the presence of invasive plant species monitored on an extensive systematic network of plots measured by the Forest Inventory and Analysis (FIA) program of the U.S. Forest Service, Northern Research Station (NRS). Each research note features one of the invasive plants monitored on forested plots by NRS...
Gao, Wen; Yang, Hua; Qi, Lian-Wen; Liu, E-Hu; Ren, Mei-Ting; Yan, Yu-Ting; Chen, Jun; Li, Ping
2012-07-06
Plant-based medicines become increasingly popular over the world. Authentication of herbal raw materials is important to ensure their safety and efficacy. Some herbs belonging to closely related species but differing in medicinal properties are difficult to be identified because of similar morphological and microscopic characteristics. Chromatographic fingerprinting is an alternative method to distinguish them. Existing approaches do not allow a comprehensive analysis for herbal authentication. We have now developed a strategy consisting of (1) full metabolic profiling of herbal medicines by rapid resolution liquid chromatography (RRLC) combined with quadrupole time-of-flight mass spectrometry (QTOF MS), (2) global analysis of non-targeted compounds by molecular feature extraction algorithm, (3) multivariate statistical analysis for classification and prediction, and (4) marker compounds characterization. This approach has provided a fast and unbiased comparative multivariate analysis of the metabolite composition of 33-batch samples covering seven Lonicera species. Individual metabolic profiles are performed at the level of molecular fragments without prior structural assignment. In the entire set, the obtained classifier for seven Lonicera species flower buds showed good prediction performance and a total of 82 statistically different components were rapidly obtained by the strategy. The elemental compositions of discriminative metabolites were characterized by the accurate mass measurement of the pseudomolecular ions and their chemical types were assigned by the MS/MS spectra. The high-resolution, comprehensive and unbiased strategy for metabolite data analysis presented here is powerful and opens the new direction of authentication in herbal analysis. Copyright © 2012 Elsevier B.V. All rights reserved.
Tang, Zhuxing; Zang, Shuliang; Zhang, Xiangmin
2012-01-01
In this study, a novel infrared-assisted extraction method coupled capillary electrophoresis (CE) is employed to determine chlorogenic acid from a traditional Chinese medicine (TCM), honeysuckle. The effects of pH and the concentration of the running buffer, separation voltage, injection time, IR irradiation time, and anhydrous ethanol in the extraction concentration were investigated. The optimal conditions were as follows: extraction time, 30 min; extraction solvent, 80% (v/v) ethanol in water solution; and 50 mmol/L borate buffer (pH 8.7) was used as the running buffer at a separation voltage of 16 kV. The samples were injected electrokinetically at 16 kV for 8 s. Good linearity (r2 > 0.9996) was observed over the concentration ranges investigated, and the stability of the solutions was high. Recoveries of the chlorogenic acid were from 95.53% to 106.62%, and the relative standard deviation was below 4.1%. By using this novel IR-assisted extraction method, a higher extraction efficiency than those extracted with conventional heat-reflux extraction was found. The developed IR-assisted extraction method is simple, low-cost, and efficient, offering a great promise for the quick determination of active compounds in TCM. The results indicated that IR-assisted extraction followed by CE is a reliable method for quantitative analysis of active ingredient in TCM. PMID:22291060
Gan, Lu; Fu, Chunhua; Zhang, Libin; Yu, Longjiang; Li, Maoteng
2014-01-01
Lonicera confusa was a medical plant which could adapt to the Ca-rich environment in the karst area of China. The photosynthesis, relative chlorophyll content,differentially expressed genes (DEGs) and differentially expressed proteins (DEPs) of L. confusa that cultivated in calcareous and sandstone soils were investigated. The results showed that the relative chlorophyll content and net photosynthesis rate of L. confusa in calcareous soil are much higher than that planted in sandstone soil, the higher content of calcium might play a role in keeping the chloroplast from harm and showed higher photosynthesis rate. The transpiration and stomata conductance were decreased in calcareous soil, which might result from the closure of stomata. The GeneFishing and proteomic results showed that the expression of DEGs and DEPs were critical for photosynthesis and stomata closure, such as RuBisCO, photosynthetic electron transfer c and malate dehydrogenase varied in the leaves of L. confusa that cultivated in different soils. These DEGs or DEPs were further found to be directly or indirectly regulated by calcium sensor proteins. This study enriched our knowledge of the molecular mechanism of high net photosynthesis rate and lower transpiration of L. confusa that cultivated in the calcareous soil in some degree. PMID:24959829
Zhou, Yulu; Zhou, Ting; Pei, Qi; Liu, Shikun; Yuan, Hong
2014-01-01
Chlorogenic acid (ChA) is proposed as the major bioactive compounds of Lonicerae Japonicae Flos (LJF). Forty-two Wistar rats were randomly divided into seven groups to investigate the pharmacokinetics and tissue distribution of ChA, via oral administration of LJF extract, using ibuprofen as internal standard, employing a high performance liquid chromatography in conjunction with tandem mass spectrometry. Analytes were extracted from plasma samples and tissue homogenate by liquid–liquid extraction with acetonitrile, separated on a C 18 column by linear gradient elution, and detected by electrospray ionization mass spectrometry in negative selected multiple reaction monitoring mode. Our results successfully demonstrate that the method has satisfactory selectivity, linearity, extraction recovery, matrix effect, precision, accuracy, and stability. Using noncompartment model to study pharmacokinetics, profile revealed that ChA was rapidly absorbed and eliminated. Tissue study indicated that the highest level was observed in liver, followed by kidney, lung, heart, and spleen. In conclusion, this method was suitable for the study on pharmacokinetics and tissue distribution of ChA after oral administration. PMID:25140190
Handling Japanese without a Japanese Operating System.
ERIC Educational Resources Information Center
Hatasa, Kazumi; And Others
1992-01-01
The Macintosh HyperCard environment has become a popular platform for Japanese language courseware because of its flexibility and ease of programing. This project created Japanese bitmap font files for the JIS Levels 1 and 2, and writing XFCNs for font manipulation, Japanese kana input, and answer correction. (12 references) (Author/LB)
Shen, Jin-Jing; Gong, Xing-Chu; Pan, Jian-Yang; Qu, Hai-Bin
2017-03-01
Design space approach was applied in this study to optimize the lime milk precipitation process of Lonicera Japonica (Jinyinhua) aqueous extract. The evaluation indices for this process were total organic acid purity and amounts of 6 organic acids obtained from per unit mass of medicinal materials. Four critical process parameters (CPPs) including drop speed of lime milk, pH value after adding lime milk, settling time and settling temperature were identified by using the weighted standardized partial regression coefficient method. Quantitative models between process evaluation indices and CPPs were established by a stepwise regression analysis. A design space was calculated by a Monte-Carlo simulation method, and then verified. The verification test results showed that the operation within the design space can guarantee the stability of the lime milk precipitation process. The recommended normal operation space is as follows: drop speed of lime milk of 1.00-1.25 mL•min⁻¹, pH value of 11.5-11.7, settling time of 1.0-1.2 h, and settling temperature of 10-20 ℃.. Copyright© by the Chinese Pharmaceutical Association.
[Study on influence factors of seed germination and seeding growth of Lonicera macranthoides].
Xu, Jin; Zhang, Ying; Cui, Guang-Lin; She, Yue-Hui; Li, Long-Yun
2016-01-01
In order to improve reproductive efficiency and quality standard, the influence factors of seed germination and seeding growth of Lonicera macranthoides werew studied. The fruit and seed morphological characteristics of L. macranthoides were observed, the seed water absorbing capacity was determined, and different wet sand stratification time, temperature and germination bed treatment were set up. The effects of the parameters on seed germination and seedling growth were analysed. There was no obstacles of water absorption on L. macranthoides seed, quantity for 22 h water absorption was close to saturation. In the first 80 d, with the increase of the stratification time, seed initial germination time was shortened, germination rate and germination potential was improved. Stratification for 100 d, germination rate decreased. At 15 ℃, seed germination and seedling growth indicators were the best. The seedling cotyledon width in light was significantly higher than that in dark. Seeds on the top of paper and top of sand germination rate, germination potential, and germination index was significantly higher than that of other germination bed and mildew rate is low. The optimal conditions of seeds germination test was stratified in 4 ℃ wet sand for 80 d, 15 ℃ illuminate culture on the top of paper or top of sand. The first seeding counting time was the 4th day after beginning the test, the final time was the 23th day. The germination potential statistical time was the 13th day after beginning the test. Copyright© by the Chinese Pharmaceutical Association.
Effects of inhalable microparticle of flower of Lonicera japonica in a mouse model of COPD.
Park, Yang-Chun; Jin, Mirim; Kim, Seung-Hyung; Kim, Min-Hee; Namgung, Uk; Yeo, Yoon
2014-01-01
Flower of Lonicera japonica (FLJ) is a traditional herbal medicine widely used in East Asia as an anti-inflammatory and anti-oxidative agent. The purpose of this study is to develop an inhalable powder formulation of FLJ and to evaluate its biological effects in a mouse model of chronic obstructive pulmonary disease (COPD). Inhalable dry powder containing FLJ was produced by spray-drying with leucine as an excipient. Its aerodynamic properties and anti-inflammatory activities were evaluated using the Anderson cascade impactor (ACI) and a mouse model of COPD, respectively. FLJ microparticle (FLJmp) had a hollow spherical shape in electron microscopy and showed aerodynamic properties suitable for inhalation (fine particle fraction of 54.0 ± 4.68% and mass median aerodynamic diameter of 4.6 ± 0.34μm). FLJmp decreased TNF-α and IL-6 expression in RAW264.7 cells activated by lipopolysaccharide (LPS). In mice challenged with LPS and cigarette smoke solution (CSS) to develop COPD, FLJmp decreased the levels of TNF-α and IL-6 in bronchoalveolar fluidas well as the number of inflammatory cells including neutrophils in peripheral blood. In addition, FLJmp induced recovery of elastin and collagen distribution, reduction of caspase-3 expression in lung tissues of COPD mice. Inhalational delivery of FLJ using a microparticle system is a promising strategy for the treatment of COPD. © 2013 Elsevier Ireland Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Fan, Li; Lin, Changhu; Duan, Wenjuan; Wang, Xiao; Liu, Jianhua; Liu, Feng
2015-01-01
An ultrahigh pressure extraction (UPE)-high performance liquid chromatography (HPLC)/diode array detector (DAD) method was established to evaluate the quality of Lonicera japonica Thunb. Ten active components, including neochlorogenic acid, chlorogenic acid, 4-dicaffeoylquinic acid, caffeic acid, rutin, luteoloside, isochlorogenic acid B, isochlorogenic acid A, isochlorogenic acid C, and quercetin, were qualitatively evaluated and quantitatively determined. Scanning electron microscope images elucidated the bud surface microstructure and extraction mechanism. The optimal extraction conditions of the UPE were 60% methanol solution, 400 MPa of extraction pressure, 3 min of extraction time, and 1:30 (g/mL) solid:liquid ratio. Under the optimized conditions, the total extraction yield of 10 active components was 57.62 mg/g. All the components showed good linearity (r2 ≥ 0.9994) and recoveries. This method was successfully applied to quantify 10 components in 22 batches of L. japonica samples from different areas. Compared with heat reflux extraction and ultrasonic-assisted extraction, UPE can be considered as an alternative extraction technique for fast extraction of active ingredient from L. japonica.
Effects of two long-term mowing regimes on vegetation
Perry, M.C.; Deller, A.S.
2000-01-01
Wildlife managers have for many years been interested in the role of mowing as a management technique to benefit wildlife. Two long-term mowing regimes (60 years of similar management) were evaluated at Patuxent Research Refuge during the summer of 1997 to better understand the influence of mowing on vegetation communities. Mowing ceased in 1997 due to reduction in maintenance funds, which facilitated the identification of mature grasses. The previous mowing regimes included (1) lawn areas that had been mowed with rotary mowers approximately every 24 weeks and (2) meadow areas that had been mowed approximately once a year with a brushhog. Each regime had two replications. Vegetation was sampled in 20, 1 m2 plots per area (n=80) and percent cover visually estimated by species. The percent ground cover of the dominant vegetation on the lawn area was 40.0% red fescue (Festuca rubra), 26.5% white clover (Trifolium repens), and 18.0% Kentucky blue grass (Poa pratensis). The percent ground cover of the dominant vegetation in the meadow area was 33.2% meadow fescue (Festuca elatior), 9.9% sweet vernal grass (Anthoxanthum odoratum), 9.2% orchard grass (Dactylis glomerata), 6.3% Japanese honeysuckle (Lonicera japonica), and 5.2% red fescue. The sites were sampled again in 1999 with the major difference being the absence of white clover in the lawn areas, believed to be a result of the drought conditions in recent years. All percent ground covers for the dominant vegetation were significantly different (P<0.01) between the two mowing regimes. Species richness was higher in both years in the meadow regime (74, 62) versus the lawn regime (33, 23). Frequently mowed lawn areas may provide better grazing forage for herbivores, such as geese, rabbits, and deer, however, meadow areas may provide greater plant biomass (232 vs. 63 g/m2) and greater diversity of plant species. The meadow regime also appeared to have greater seed production and cover, which is favored by a wider
Do American born Japanese children still grow faster than native Japanese?
Kano, K; Chung, C S
1975-09-01
Growth patterns of Japanese schoolchildren in Hawaii, composed of 2,954 boys and 3,213 girls aged between 11 and 17, were compared with those comparable groups of Japanese schoolchildren in Japan based on the data published by the Japanese Ministry of Education. Growth characteristics studied were height, weight, and relative weight index, weight/(height). The Hawaii-Japanese boys were taller at early ages but the difference disappeared by age 16. Native Japanese girls were shorter than Hawaii-Japanese until age 13, but they overtook the latter by age 14, exceeding them in height after age 15. A similar pattern was found in weights of girls but the Hawaii-Japanese boys remained consistently heavier by 5.0 to 9.0 kg than native Japanese. The relative weight measure indicated that the Hawaii boys were more "obese" than native Japanese boys for the growth period studied; whereas the same tendency was maintained until age 15 in girls. These observations indicate a marked degree of convergence of the patterns of physical growth of the two populations, whose differences were unmistakably in favor of American born children in earlier studies. It is concluded that the convergence is due largely to the improved environmental conditions in Japan in recent years.
Celli, Giovana Bonat; Ghanem, Amyl; Brooks, Marianne Su-Ling
2015-11-01
Haskap berries (Lonicera caerulea L.) are a rich source of bioactive molecules. As such, the extraction of anthocyanins is important for the development of many value-added products and functional food ingredients. In this paper, the ultrasound-assisted extraction (UAE) of anthocyanins from haskap berries was investigated. Significant independent variables were screened and optimized using Plackett-Burman (PB) and Box-Behnken (BB) designs, respectively. The mathematical model showed a high coefficient of determination (R(2)=0.9396) and the optimum conditions for the extraction were as follows: liquid/solid ratio 25:1 (mL/g), solvent composition of 80% ethanol, addition of 0.5% formic acid, ultrasound bath temperature of 35°C for 20 min. Under these conditions, the total anthocyanin content of 22.73 mg cyaniding 3-glucoside equivalents (C3G)/g dry weight (DW) was consistent with the predicted response of 22.45 mg C3G/g DW from the model (mean error of 1.28%). Five anthocyanins were identified in the optimized extract, namely cyanidin 3,5-diglucoside, cyanidin 3-glucoside, cyanidin 3-rutinoside, pelargonidin 3-glucoside, and peonidin 3-glucoside. Thus, UAE is a suitable technique for the extraction of anthocyanins from haskap berries. Copyright © 2015 Elsevier B.V. All rights reserved.
Zheng, Ruijuan; Zhong, Jianhai; Zhao, Chenhao; Lang, Xiaoling; Hu, Zhibiao; Luo, Jiangshui
2017-08-01
In this paper, a novel and ultrasensitive electrochemiluminescent sensor employing a solvothermal-synthesized CdS nanorod-modified pencil graphite electrode (CdS/PGE) for the determination of chlorogenic acid (CA) is fabricated. In the first step, the PGE surface is modified using CdS nanorods. In the next step, the developed electrode is used to detect CA using a electrochemiluminescent (ECL) technique, in which potassium persulfate (K 2 S 2 O 8 ) served as a co-reactant. The possible ECL mechanism is investigated, and the influences of pH and cyclic voltammetric scanning rate on the signal response are studied. The ECL intensity decreases quantitatively in relation to the concentration of the target molecule. Under optimized conditions, the linear correlation between the quenched ECL intensity and the logarithm of CA concentration is observed in the range from 2 × 10 -9 to 8 × 10 -7 mol L -1 with a limit of detection of 1 × 10 -9 mol L -1 . This proposed method is applied to the analysis of CA in honeysuckle flower, giving recoveries of 99-107%. The experimental results demonstrate that this ECL sensor shows good stability and reproducibility. Copyright © 2016 John Wiley & Sons, Ltd.
Yuasa, Isao; Akane, Atsushi; Yamamoto, Toshimichi; Matsusue, Aya; Endoh, Minoru; Nakagawa, Mayumi; Umetsu, Kazuo; Ishikawa, Takaki; Iino, Morio
2018-04-24
It is sometimes necessary to determine whether a forensic biological sample came from a Japanese person. In this study, we developed a 60-locus SNP assay designed for the differentiation of Japanese people from other East Asians using entirely and nearly Japanese-specific alleles. This multiplex assay consisted of 6 independent PCR reactions followed by single nucleotide extension. The average number and standard deviation of Japanese-specific alleles possessed by an individual were 0.81 ± 0.93 in 108 Koreans from Seoul, 8.87 ± 2.89 in 103 Japanese from Tottori, 17.20 ± 3.80 in 88 Japanese from Okinawa, and 0 in 220 Han Chinese from Wuxi and Changsha. The Koreans had 0-4 Japanese-specific alleles per individual, whereas the Japanese had 4-26 Japanese-specific alleles. Almost all Japanese were distinguished from the Koreans and other people by the factorial correspondence and principal component analyses. The Snipper program was also useful to estimate the degree of Japaneseness. The method described here was successfully applied to the differentiation of Japanese from non-Japanese people in forensic cases. This Japanese-specific SNP assay was named Japaneseplex. Copyright © 2018 Elsevier B.V. All rights reserved.
Kim, E. T.; Kim, C. -H.; Min, K. -S.; Lee, S. S.
2012-01-01
This study was conducted to evaluate effects of plant extracts on methanogenesis and rumen microbial diversity in in vitro. Plant extracts (Artemisia princeps var. Orientalis; Wormwood, Allium sativum for. Pekinense; Garlic, Allium cepa; Onion, Zingiber officinale; Ginger, Citrus unshiu; Mandarin orange, Lonicera japonica; Honeysuckle) were obtained from the Plant Extract Bank at Korea Research Institute of Bioscience and Biotechnology. The rumen fluid was collected before morning feeding from a fistulated Holstein cow fed timothy and commercial concentrate (TDN; 73.5%, crude protein; 19%, crude fat; 3%, crude fiber; 12%, crude ash; 10%, Ca; 0.8%, P; 1.2%) in the ratio of 3 to 2. The 30 ml of mixture, comprising McDougall buffer and rumen liquor in the ratio of 4 to 1, was dispensed anaerobically into serum bottles containing 0.3 g of timothy substrate and plant extracts (1% of total volume, respectively) filled with O2-free N2 gas and capped with a rubber stopper. The serum bottles were held in a shaking incubator at 39°C for 24 h. Total gas production in all plant extracts was higher (p<0.05) than that of the control, and total gas production of ginger extract was highest (p<0.05). The methane emission was highest (p<0.05) at control, but lowest (p<0.05) at garlic extract which was reduced to about 20% of methane emission (40.2 vs 32.5 ml/g DM). Other plant extracts also resulted in a decrease in methane emissions (wormwood; 8%, onion; 16%, ginger; 16.7%, mandarin orange; 12%, honeysuckle; 12.2%). Total VFAs concentration and pH were not influenced by the addition of plant extracts. Acetate to propionate ratios from garlic and ginger extracts addition samples were lower (p<0.05, 3.36 and 3.38 vs 3.53) than that of the control. Real-time PCR indicted that the ciliate-associated methanogen population in all added plant extracts decreased more than that of the control, while the fibrolytic bacteria population increased. In particular, the F. succinogens community
Kim, E T; Kim, C-H; Min, K-S; Lee, S S
2012-06-01
This study was conducted to evaluate effects of plant extracts on methanogenesis and rumen microbial diversity in in vitro. Plant extracts (Artemisia princeps var. Orientalis; Wormwood, Allium sativum for. Pekinense; Garlic, Allium cepa; Onion, Zingiber officinale; Ginger, Citrus unshiu; Mandarin orange, Lonicera japonica; Honeysuckle) were obtained from the Plant Extract Bank at Korea Research Institute of Bioscience and Biotechnology. The rumen fluid was collected before morning feeding from a fistulated Holstein cow fed timothy and commercial concentrate (TDN; 73.5%, crude protein; 19%, crude fat; 3%, crude fiber; 12%, crude ash; 10%, Ca; 0.8%, P; 1.2%) in the ratio of 3 to 2. The 30 ml of mixture, comprising McDougall buffer and rumen liquor in the ratio of 4 to 1, was dispensed anaerobically into serum bottles containing 0.3 g of timothy substrate and plant extracts (1% of total volume, respectively) filled with O2-free N2 gas and capped with a rubber stopper. The serum bottles were held in a shaking incubator at 39°C for 24 h. Total gas production in all plant extracts was higher (p<0.05) than that of the control, and total gas production of ginger extract was highest (p<0.05). The methane emission was highest (p<0.05) at control, but lowest (p<0.05) at garlic extract which was reduced to about 20% of methane emission (40.2 vs 32.5 ml/g DM). Other plant extracts also resulted in a decrease in methane emissions (wormwood; 8%, onion; 16%, ginger; 16.7%, mandarin orange; 12%, honeysuckle; 12.2%). Total VFAs concentration and pH were not influenced by the addition of plant extracts. Acetate to propionate ratios from garlic and ginger extracts addition samples were lower (p<0.05, 3.36 and 3.38 vs 3.53) than that of the control. Real-time PCR indicted that the ciliate-associated methanogen population in all added plant extracts decreased more than that of the control, while the fibrolytic bacteria population increased. In particular, the F. succinogens community
Haryu, Etsuko; Zhao, Lihua
2007-10-01
Do non-native speakers of the Japanese language understand the symbolic values of Japanese onomatopoeia matching a voiced/unvoiced consonant with a big/small sound made by a big/small object? In three experiments, participants who were native speakers of Japanese, Japanese-learning Chinese, or Chinese without knowledge of the Japanese language were shown two pictures. One picture was of a small object making a small sound, such as a small vase being broken, and the other was of a big object making a big sound, such as a big vase being broken. Participants were presented with two novel onomatopoetic words with voicing contrasts, e.g.,/dachan/vs./tachan/, and were told that each word corresponded to one of the two pictures. They were then asked to match the words to the corresponding pictures. Chinese without knowledge of Japanese performed only at chance level, whereas Japanese and Japanese-learning Chinese successfully matched a voiced/unvoiced consonant with a big/small object respectively. The results suggest that the key to understanding the symbolic values of voicing contrasts in Japanese onomatopoeia is some basic knowledge that is intrinsic to the Japanese language.
The Japanese Mind: Understanding Contemporary Japanese Culture.
ERIC Educational Resources Information Center
Davies, Roger J., Ed.; Ikeno, Osamu, Ed.
This collection of essays offers an overview of contemporary Japanese culture, and can serve as a resource for classes studying Japan. The 28 essays offer an informative, accessible look at the values, attitudes, behavior patterns, and communication styles of modern Japan from the unique perspective of the Japanese people. Filled with examples…
What Is Business Japanese? Designing a Japanese Course for Business Communication.
ERIC Educational Resources Information Center
Koike, Shohei
Experiences in developing "Business Japanese" courses for the undergraduate major in Language and International Trade at Eastern Michigan University are described. In 1987, six new courses in Japanese were proposed so that Japanese could be offered as a language specialty in the program. Issues considered in defining business Japanese…
Williams, John Kino Yamaguchi; Else, 'Iwalani R. N.; Goebert, Deborah A.; Nishimura, Stephanie T.; Hishinuma, Earl S.; Andrade, Naleen N.
2013-01-01
Few studies have examined the effect of ethnicity and cultural identity on substance use among Asian and Pacific Islander adolescents. A cross-sequential study conducted in Hawai'i with 144 Japanese American and part-Japanese American adolescents assessed a model integrating Japanese ethnicity, cultural identity, substance use, major life events, and social support. Japanese American adolescents scored higher on the Japanese Culture Scale and on the Peers’ Social Support than the part-Japanese American adolescents. Significant associations for substance use and impairment included culturally intensified events and Japanese cultural identity- behavior subset. Models had good overall fits and suggested that conflict surrounding cultural identity may contribute to substance use. PMID:23480213
Wound repair and anti-inflammatory potential of Lonicera japonica in excision wound-induced rats.
Chen, Wei-Cheng; Liou, Shorong-Shii; Tzeng, Thing-Fong; Lee, Shiow-Ling; Liu, I-Min
2012-11-23
Lonicera japonica Thunb. (Caprifoliaceae), a widely used traditional Chinese medicinal plant, is used to treat some infectious diseases and it may have uses as a healthy food and applications in cosmetics and as an ornamental groundcover. The ethanol extract of the flowering aerial parts of L. japonica (LJEE) was investigated for its healing efficiency in a rat excision wound model. Excision wounds were inflicted upon three groups of eight rats each. Healing was assessed by the rate of wound contraction in skin wound sites in rats treated with simple ointment base, 10% (w/w) LJEE ointment, or the reference standard drug, 0.2% (w/w) nitrofurazone ointment. The effects of LJEE on the contents of hydroxyproline and hexosamine during healing were estimated. The antimicrobial activity of LJEE against microorganisms was also assessed. The in vivo anti-inflammatory activity of LJEE was investigated to understand the mechanism of wound healing. LJEE exhibited significant antimicrobial activity against Staphylococcus aureus, Staphylococcus epidermidis, Escherichia coli, Candida albicans, and Candida tropicalis. The ointment formulation prepared with 10% (w/w) LJEE exhibited potent wound healing capacity as evidenced by the wound contraction in the excision wound model. The contents of hydroxyproline and hexosamine also correlated with the observed healing pattern. These findings were supported by the histopathological characteristics of healed wound sections, as greater tissue regeneration, more fibroblasts, and angiogenesis were observed in the 10% (w/w) LJEE ointment-treated group. The results also indicated that LJEE possesses potent anti-inflammatory activity, as it enhanced the production of anti-inflammatory cytokines that suppress proinflammatory cytokine production. The results suggest that the antimicrobial and anti-inflammatory activities of LJEE act synergistically to accelerate wound repair.
Jaiswal, Rakesh; Müller, Heiko; Müller, Anja; Karar, Mohamed Gamaleldin Elsadig; Kuhnert, Nikolai
2014-12-01
The chlorogenic acids, chlorogenic acid glycosides and flavonoids of the leaves of Lonicera henryi L. (Caprifoliaceae) were investigated qualitatively by liquid chromatography tandem mass spectrometry. Thirty-one chlorogenic acids and their glycosides were detected and characterized to their regioisomeric level on the basis of their unique fragmentation pattern in the negative ion mode tandem MS spectra. All of them were extracted for the first time from this source and thirteen of them were not reported previously in nature. For the positive identification of chlorogenic acid glycosides by LC-MS(n), multiple reaction monitoring and targeted MS(n) experiments were performed. We have developed an LC-MS(n) method for the systematic identification of chlorogenic acid glycosides and were also able to discriminate between chlorogenic acids and their isobaric glycosides. It was also possible to discriminate between 5-O-(3'-O-caffeoyl glucosyl)quinic acid and 5-O-(4'-O-caffeoyl glucosyl)quinic acid by LC-MS(n). This method can be applied for the rapid and positive identification of chlorogenic acids and their glycosides in plant materials, food and beverages. Copyright © 2014 Elsevier Ltd. All rights reserved.
Homogamy and Intermarriage of Japanese and Japanese Americans with Whites Surrounding World War II
ERIC Educational Resources Information Center
Ono, Hiromi; Berg, Justin
2010-01-01
Although some sociologists have suggested that Japanese Americans quickly assimilated into mainstream America, scholars of Japanese America have highlighted the heightened exclusion that the group experienced. This study tracked historical shifts in the exclusion level of Japanese and Japanese Americans in the United States surrounding World War…
The Anglo-Japanese Alliance and Japanese Expansionism 1902-1923.
1992-06-05
Alienation 1919-1952. London: Cambridge University Press. 1982. • The Oriains of the Russo-Japanese War. London: Longman Group Limited. 1985. Nitobe ... Inazo . Bushido - The Soul of Japan. Tokyo: Tuttle. 1981. Okamoto, Shumpei. The Japan Oliaarchv and the Russo-Japanese War. New York: Columbia
NASA Astrophysics Data System (ADS)
Jiang, Qiu-Yun; Zhuo, Feng; Long, Shi-Hui; Zhao, Hai-Di; Yang, Dan-Jing; Ye, Zhi-Hong; Li, Shao-Shan; Jing, Yuan-Xiao
2016-02-01
A greenhouse pot experiment was conducted to study the impact of arbuscular mycorrhizal fungi-Glomus versiforme (Gv) and Rhizophagus intraradices (Ri) on the growth, Cd uptake, antioxidant indices [glutathione reductase (GR), ascorbate peroxidase (APX), superoxide dismutase (SOD), catalase (CAT), ascorbate (ASA), glutathione (GSH) and malonaldehyde (MDA)] and phytochelatins (PCs) production of Lonicera japonica in Cd-amended soils. Gv and Ri significantly increased P acquisition, biomass of shoots and roots at all Cd treatments. Gv significantly decreased Cd concentrations in shoots and roots, and Ri also obviously reduced Cd concentrations in shoots but increased Cd concentrations in roots. Meanwhile, activities of CAT, APX and GR, and contents of ASA and PCs were remarkably higher in Gv/Ri-inoculated plants than those of uninoculated plants, but lower MDA and GSH contents in Gv/Ri-inoculated plants were found. In conclusion, Gv and Ri symbiosis alleviated Cd toxicity of L. japonica through the decline of shoot Cd concentrations and the improvement of P nutrition, PCs content and activities of GR, CAT, APX in inoculated plants, and then improved plant growth. The decrease of shoot Cd concentrations in L. japonica inoculated with Gv/Ri would provide a clue for safe production of this plant from Cd-contaminated soils.
ERIC Educational Resources Information Center
Williams, John Kino Yamaguchi; Goebert, Deborah; Hishinuma, Earl; Miyamoto, Robin; Anzai, Neal; Izutsu, Satoru; Yanagida, Evelyn; Nishimura, Stephanie; Andrade, Naleen; Baker, F. M.
2002-01-01
Develops and assesses a model integrating Japanese ethnicity, cultural identity, and anxiety in Japanese American and part-Japanese American high school seniors. Japanese American adolescents scored higher on the scale and reported fewer anxiety symptoms than part-Japanese American adolescents. The model had a good overall fit, suggesting that…
Wound repair and anti-inflammatory potential of Lonicera japonica in excision wound-induced rats
2012-01-01
Background Lonicera japonica Thunb. (Caprifoliaceae), a widely used traditional Chinese medicinal plant, is used to treat some infectious diseases and it may have uses as a healthy food and applications in cosmetics and as an ornamental groundcover. The ethanol extract of the flowering aerial parts of L. japonica (LJEE) was investigated for its healing efficiency in a rat excision wound model. Methods Excision wounds were inflicted upon three groups of eight rats each. Healing was assessed by the rate of wound contraction in skin wound sites in rats treated with simple ointment base, 10% (w/w) LJEE ointment, or the reference standard drug, 0.2% (w/w) nitrofurazone ointment. The effects of LJEE on the contents of hydroxyproline and hexosamine during healing were estimated. The antimicrobial activity of LJEE against microorganisms was also assessed. The in vivo anti-inflammatory activity of LJEE was investigated to understand the mechanism of wound healing. Results LJEE exhibited significant antimicrobial activity against Staphylococcus aureus, Staphylococcus epidermidis, Escherichia coli, Candida albicans, and Candida tropicalis. The ointment formulation prepared with 10% (w/w) LJEE exhibited potent wound healing capacity as evidenced by the wound contraction in the excision wound model. The contents of hydroxyproline and hexosamine also correlated with the observed healing pattern. These findings were supported by the histopathological characteristics of healed wound sections, as greater tissue regeneration, more fibroblasts, and angiogenesis were observed in the 10% (w/w) LJEE ointment-treated group. The results also indicated that LJEE possesses potent anti-inflammatory activity, as it enhanced the production of anti-inflammatory cytokines that suppress proinflammatory cytokine production. Conclusions The results suggest that the antimicrobial and anti-inflammatory activities of LJEE act synergistically to accelerate wound repair. PMID:23173654
Qi, Lian-Wen; Chen, Chun-Yun; Li, Ping
2009-10-01
A fast liquid chromatography method with diode-array detection (DAD) and time-of-flight mass spectrometry (TOF-MS) has been developed for analysis of constituents in Flos Lonicerae Japonicae (FLJ), a traditional Chinese medicine derived from the flower bud of Lonicera japonica. The chromatographic analytical time decreased to 25 min without sacrificing resolution using a column packed with 1.8-microm porous particles (4.6 x 50 mm), three times faster than the performance of conventional 5.0-microm columns (4.6 x 150 mm). Four major groups of compounds previously isolated from FLJ were structurally characterized by DAD-TOF-MS: iridoid glycosides showed maximum UV absorption at 240 nm; phenolic acids at 217, 242, and 326 nm; flavonoids at 255 and 355 nm; while saponins had no absorption. In electrospray ionization (ESI)-TOF-MS experiments, elimination of a glucose unit (162 Da), and successive losses of H(2)O, CH(3)OH and CO, were generally observed in iridoid glycosides; saponins were characterized by a series of identical aglycone ions; phenolic acids typically generated a base peak at [M-H-caffeoyl](-) by loss of a caffeic acid unit (162 Da) and several marked quinic acid moiety ions; cleavage of the glycosidic bond (loss of 162 or 308 Da), subsequent losses of H(2)O, CO, RDA and C-ring fragmentation were the most possible fragmentation pathways for flavonoids. By accurate mass measurements within 4 ppm error for each molecular ion and subsequent fragment ions, as well as the 'full mass spectral' information of TOF-MS, a total of 41 compounds including 13 iridoid glycosides, 11 phenolic acids, 7 saponins, and 10 flavonoids were identified in a methanolic extract of FLJ. Copyright (c) 2009 John Wiley & Sons, Ltd.
Statistical Machine Translation of Japanese
2007-03-01
hiragana and katakana) syllabaries…………………….. 20 3.2 Sample Japanese sentence showing kanji and kana……………………... 21 3.5 Japanese formality example...syllabary. 19 Figure 3.1. Japanese kana syllabaries, hiragana for native Japanese words, word endings, and particles, and katakana for foreign...Figure 3.2. Simple Japanese sentence showing the use of kanji, hiragana , and katakana. Kanji is used for nouns and verb, adjective, and
Cipollini, Don; Stevenson, Randall; Enright, Stephanie; Eyles, Alieta; Bonello, Pierluigi
2008-02-01
Lonicera maackii is an invasive shrub in North America for which allelopathic effects toward other plants or herbivores have been suspected. We characterized the major phenolic metabolites present in methanol extracts of L. maackii leaves. In addition, we examined the effects of methanol-water extracts of L. maackii leaves on seed germination of a target plant species and on feeding preference and growth rate of a generalist insect herbivore. A total of 13 individual major and minor compounds were detected in crude leaf extracts by high-performance liquid chromatography coupled to electronspray ionization-tandem mass spectrometry (ESI-MS/MS). Extracts were dominated by two major flavones, apigenin and luteolin, and their glucoside derivatives, apigenin-7-glucoside and luteolin-7-glucoside. Quantities of these compounds, along with chlorogenic acid, varied between two sampling points. Leaf extracts that contained these compounds were inhibitory to seed germination of Arabidopsis thaliana. In addition, treatment of artificial diet with leaf extracts deterred feeding of the generalist herbivore, Spodoptera exigua, in choice experiments but had no effect on growth rate in short-term no-choice bioassays. Purified apigenin tended to deter feeding by S. exigua and inhibited seed germination of A. thaliana. We conclude that leaves of L. maackii contain phenolic compounds, including apigenin and chlorogenic acid, capable of having biological effects on other plants and insects.
Güngör, Derya; Bornstein, Marc H; De Leersnyder, Jozefien; Cote, Linda; Ceulemans, Eva; Mesquita, Batja
2013-07-01
The present study tests the hypothesis that involvement with a new culture instigates changes in personality of immigrants that result in (a) better fit with the norms of the culture of destination and (b) reduced fit with the norms of the culture of origin. Participants were 40 Japanese first-generation immigrants to the United States, 57 Japanese monoculturals, and 60 U.S. monoculturals. All participants completed the Jackson Personality Inventory (JPI) as a measure of the Big Five; immigrants completed the Japanese American Acculturation Scale. Immigrants' fits with the cultures of destination and origin were calculated by correlating Japanese American mothers' patterns of ratings on the Big Five with the average patterns of ratings of European Americans and Japanese on the same personality dimensions. Japanese Americans became more "American" and less "Japanese" in their personality as they reported higher participation in the U.S. culture. The results support the view that personality can be subject to cultural influence.
ERIC Educational Resources Information Center
Taylor, Harvey M.
Each culture has its own nonverbal as well as its verbal language. Movements, gestures and sounds have distinct and often conflicting interpretations in different countries. For Americans communicating with Japanese, misunderstandings are of two types: Japanese behavior which is completely new to the American, and Japanese behavior which is…
Detraditionalisation: Japanese Students in the USA.
ERIC Educational Resources Information Center
Ueno, Junko
2001-01-01
Focuses on the identity formation of Japanese students temporarily living in the United States. The students were enrolled in Japanese Saturday school and in American public schools. Student interviews reveal a mixture of Japanese and American characteristics. Suggests Japanese students do not reject either culture--Japanese or American--but that…
Gibbons, Laura E; McCurry, Susan; Rhoads, Kristoffer; Masaki, Kamal; White, Lon; Borenstein, Amy R; Larson, Eric B; Crane, Paul K
2009-02-01
The Cognitive Abilities Screening Instrument (CASI) was designed for use in cross-cultural studies of Japanese and Japanese-American elderly in Japan and the U.S.A. The measurement equivalence in Japanese and English had not been confirmed in prior studies. We analyzed the 40 CASI items for differential item functioning (DIF) related to test language, as well as self-reported proficiency with written Japanese, age, and educational attainment in two large epidemiologic studies of Japanese-American elderly: the Kame Project (n=1708) and the Honolulu-Asia Aging Study (HAAS; n = 3148). DIF was present if the demographic groups differed in the probability of success on an item, after controlling for their underlying cognitive functioning ability. While seven CASI items had DIF related to language of testing in Kame (registration of one item; recall of one item; similes; judgment; repeating a phrase; reading and performing a command; and following a three-step instruction), the impact of DIF on participants' scores was minimal. Mean scores for Japanese and English speakers in Kame changed by <0.1 SD after accounting for DIF related to test language. In HAAS, insufficient numbers of participants were tested in Japanese to assess DIF related to test language. In both studies, DIF related to written Japanese proficiency, age, and educational attainment had minimal impact. To the extent that DIF could be assessed, the CASI appeared to meet the goal of measuring cognitive function equivalently in Japanese and English. Stratified data collection would be needed to confirm this conclusion. DIF assessment should be used in other studies with multiple language groups to confirm that measures function equivalently or, if not, form scores that account for DIF.
Japanese Encephalitis: Frequently Asked Questions
... the vaccine, what should I do? What is Japanese encephalitis? Japanese encephalitis (JE) is a potentially severe ... cause inflammation of the brain (encephalitis). Where does Japanese encephalitis occur? JE occurs in Asia and parts ...
Gagné, Raymond J
2016-08-30
Three new Nearctic genera of gall midges (Diptera: Cecidomyiidae), each with a new species, are described: Helianthecis Gagné for Helianthecis capitum Gagné, new species, that lives in flower heads of Helianthus spp. (Asteraceae) from North Dakota to Texas; Lonicerae Gagné for Lonicerae russoi Gagné, new species, and Lonicerae lonicera (Felt), new combination, that form bud galls on Lonicera spp. (Caprifoliaceae) in California; and Chiosperma Gagné for Chiosperma turgidum Gagné, new species, that forms a bud gall on Symphoricarpos albus (L.) S.F. Blake (Caprifoliaceae) in Washington. The three new genera belong to the supertribe Lasiopteridi and are placed in the tribe Oligotrophini. The tribes Oligotrophini and Rhopalomyiini are combined.
Güngör, Derya; Bornstein, Marc H.; De Leersnyder, Jozefien; Cote, Linda; Ceulemans, Eva; Mesquita, Batja
2013-01-01
The present study tests the hypothesis that involvement with a new culture instigates changes in personality of immigrants that result in (a) better fit with the norms of the culture of destination and (b) reduced fit with the norms of the culture of origin. Participants were 40 Japanese first-generation immigrants to the United States, 57 Japanese monoculturals, and 60 U.S. monoculturals. All participants completed the Jackson Personality Inventory (JPI) as a measure of the Big Five; immigrants completed the Japanese American Acculturation Scale. Immigrants’ fits with the cultures of destination and origin were calculated by correlating Japanese American mothers’ patterns of ratings on the Big Five with the average patterns of ratings of European Americans and Japanese on the same personality dimensions. Japanese Americans became more “American” and less “Japanese” in their personality as they reported higher participation in the U.S. culture. The results support the view that personality can be subject to cultural influence. PMID:23935211
NASA Astrophysics Data System (ADS)
Yang, Yue; Wang, Lei; Wu, Yongjiang; Liu, Xuesong; Bi, Yuan; Xiao, Wei; Chen, Yong
2017-07-01
There is a growing need for the effective on-line process monitoring during the manufacture of traditional Chinese medicine to ensure quality consistency. In this study, the potential of near infrared (NIR) spectroscopy technique to monitor the extraction process of Flos Lonicerae Japonicae was investigated. A new algorithm of synergy interval PLS with genetic algorithm (Si-GA-PLS) was proposed for modeling. Four different PLS models, namely Full-PLS, Si-PLS, GA-PLS, and Si-GA-PLS, were established, and their performances in predicting two quality parameters (viz. total acid and soluble solid contents) were compared. In conclusion, Si-GA-PLS model got the best results due to the combination of superiority of Si-PLS and GA. For Si-GA-PLS, the determination coefficient (Rp2) and root-mean-square error for the prediction set (RMSEP) were 0.9561 and 147.6544 μg/ml for total acid, 0.9062 and 0.1078% for soluble solid contents, correspondingly. The overall results demonstrated that the NIR spectroscopy technique combined with Si-GA-PLS calibration is a reliable and non-destructive alternative method for on-line monitoring of the extraction process of TCM on the production scale.
Homogamy and Intermarriage of Japanese and Japanese Americans With Whites Surrounding World War II.
Ono, Hiromi; Berg, Justin
2010-10-01
Although some sociologists have suggested that Japanese Americans quickly assimilated into mainstream America, scholars of Japanese America have highlighted the heightened exclusion that the group experienced. This study tracked historical shifts in the exclusion level of Japanese and Japanese Americans in the United States surrounding World War II with homogamy and intermarriage with Whites for the prewar (1930-1940) and resettlement (1946-1966) marriage cohorts. The authors applied log-linear models to census microsamples (N = 1,590,416) to estimate the odds ratios of homogamy versus intermarriage. The unadjusted odds ratios of Japanese Americans declined between cohorts and appeared to be consistent with the assimilation hypothesis. Once compositional influences and educational pairing patterns were adjusted, however, the odds ratios increased and supported the heightened exclusion hypothesis.
Tarn, Derjung M.; Meredith, Lisa S.; Kagawa-Singer, Marjorie; Matsumura, Shinji; Bito, Seiji; Oye, Robert K.; Liu, Honghu; Kahn, Katherine L.; Fukuhara, Shunichi; Wenger, Neil S.
2005-01-01
PURPOSE Trust is a cornerstone of the physician-patient relationship. We investigated the relation of patient characteristics, religiosity, acculturation, physician ethnicity, and insurance-mandated physician change to levels of trust in Japanese American and Japanese patients. METHODS A self-administered, cross-sectional questionnaire in English and Japanese (completed in the language of their choice) was given to community-based samples of 539 English-speaking Japanese Americans, 340 Japanese-speaking Japanese Americans, and 304 Japanese living in Japan. RESULTS Eighty-seven percent of English-speaking Japanese Americans, 93% of Japanese-speaking Japanese Americans, and 58% of Japanese living in Japan responded to trust items and reported mean trust scores of 83, 80, and 68, respectively, on a scale ranging from 0 to 100. In multivariate analyses, English-speaking and Japanese-speaking Japanese American respondents reported more trust than Japanese respondents living in Japan (P values <.001). Greater religiosity (P <.001), less desire for autonomy (P <.001), and physician-patient relationships of longer duration (P <.001) were related to increased trust. Among Japanese Americans, more acculturated respondents reported more trust (P <.001), and Japanese physicians were trusted more than physicians of another ethnicity. Among respondents prompted to change physicians because of insurance coverage, the 48% who did not want to switch reported less trust in their current physician than in their former physician (mean score of 82 vs 89, P <.001). CONCLUSIONS Religiosity, autonomy preference, and acculturation were strongly related to trust in one’s physician among the Japanese American and Japanese samples studied and may provide avenues to enhance the physician-patient relationship. The strong relationship of trust with patient-physician ethnic match and the loss of trust when patients, in retrospect, report leaving a preferred physician suggest unintended
Liu, Suwen; You, Lu; Zhao, Yuhua; Chang, Xuedong
2018-05-01
The hypocholesterolemic effect of Lonicera caerulea berry extract rich in polyphenols (LCBP) on high cholesterol-induced hypercholesterolemia and lipoprotein metabolite changes was examined in Caco-2 cells and rats. Cyanidin-3-glucoside, catechin, and chlorogenic acid are the major phenolic components of LCBP. The cholesterol-reducing effect and antioxidant capacity of these components were compared in Caco-2 cells. LCBP (80 μg/mL) and cyanidin-3-glucoside, catechin, and chlorogenic acid (50 μM) were found to be effective (p < 0.05). Rats were fed a high cholesterol diet (HCD) with or without LCBP supplementation (75, 150, and 300 mg/kg body weight intragastrically once daily) for 12 weeks. Compared with the HCD control group, LCBP supplementation at 150 and 300 mg/kg decreased the levels of TC, TG, and LDL-C, but increased that of HDL-C. LCBP treatment promoted greater neutral and acidic sterol excretion (p < 0.05) and improved the antioxidant capacity of the colon tissue, colon contents, and blood. Moreover, trimethylamine N-oxide (TMAO) levels were decreased in serum (p < 0.05). NPC1L1, ACAT2, and MTP mRNA and protein expression were reduced and ABCG5/8 expression was increased (p < 0.05) after LCBP treatment. Our results suggest that LCBP could be used as a functional food for the prevention and treatment of diseases related to excessive cholesterol accumulation. Copyright © 2018 Elsevier Ltd. All rights reserved.
The modern Japanese color lexicon.
Kuriki, Ichiro; Lange, Ryan; Muto, Yumiko; Brown, Angela M; Fukuda, Kazuho; Tokunaga, Rumi; Lindsey, Delwin T; Uchikawa, Keiji; Shioiri, Satoshi
2017-03-01
Despite numerous prior studies, important questions about the Japanese color lexicon persist, particularly about the number of Japanese basic color terms and their deployment across color space. Here, 57 native Japanese speakers provided monolexemic terms for 320 chromatic and 10 achromatic Munsell color samples. Through k-means cluster analysis we revealed 16 statistically distinct Japanese chromatic categories. These included eight chromatic basic color terms (aka/red, ki/yellow, midori/green, ao/blue, pink, orange, cha/brown, and murasaki/purple) plus eight additional terms: mizu ("water")/light blue, hada ("skin tone")/peach, kon ("indigo")/dark blue, matcha ("green tea")/yellow-green, enji/maroon, oudo ("sand or mud")/mustard, yamabuki ("globeflower")/gold, and cream. Of these additional terms, mizu was used by 98% of informants, and emerged as a strong candidate for a 12th Japanese basic color term. Japanese and American English color-naming systems were broadly similar, except for color categories in one language (mizu, kon, teal, lavender, magenta, lime) that had no equivalent in the other. Our analysis revealed two statistically distinct Japanese motifs (or color-naming systems), which differed mainly in the extension of mizu across our color palette. Comparison of the present data with an earlier study by Uchikawa & Boynton (1987) suggests that some changes in the Japanese color lexicon have occurred over the last 30 years.
Homogamy and Intermarriage of Japanese and Japanese Americans With Whites Surrounding World War II
Ono, Hiromi; Berg, Justin
2010-01-01
Although some sociologists have suggested that Japanese Americans quickly assimilated into mainstream America, scholars of Japanese America have highlighted the heightened exclusion that the group experienced. This study tracked historical shifts in the exclusion level of Japanese and Japanese Americans in the United States surrounding World War II with homogamy and intermarriage with Whites for the prewar (1930–1940) and resettlement (1946–1966) marriage cohorts. The authors applied log-linear models to census microsamples (N = 1,590,416) to estimate the odds ratios of homogamy versus intermarriage. The unadjusted odds ratios of Japanese Americans declined between cohorts and appeared to be consistent with the assimilation hypothesis. Once compositional influences and educational pairing patterns were adjusted, however, the odds ratios increased and supported the heightened exclusion hypothesis. PMID:21116449
Cultural Competence in Business Japanese.
ERIC Educational Resources Information Center
Koike, Shohei
Cultural competence in business Japanese requires more than superficial knowledge of business etiquette. One must truly understand why Japanese people think and act differently from their American counterparts. For example, instruction in the use of Japanese taxis must be accompanied by instruction in the concept and implications of seating order…
Statistics in Japanese universities.
Ito, P K
1979-01-01
The teaching of statistics in the U.S. and Japanese universities is briefly reviewed. It is found that H. Hotelling's articles and subsequent relevant publications on the teaching of statistics have contributed to a considerable extent to the establishment of excellent departments of statistics in U.S. universities and colleges. Today the U.S. may be proud of many well-staffed and well-organized departments of theoretical and applied statistics with excellent undergraduate and graduate programs. On the contrary, no Japanese universities have an independent department of statistics at present, and the teaching of statistics has been spread among a heterogeneous group of departments of application. This was mainly due to the Japanese government regulation concerning the establishment of a university. However, it has recently been revised so that an independent department of statistics may be started in a Japanese university with undergraduate and graduate programs. It is hoped that discussions will be started among those concerned on the question of organization of the teaching of statistics in Japanese universities as soon as possible. PMID:396154
1987-10-05
Hazelnut Hazelnut Poison ivy Round-leaved Black currant Hazelnut dogwood’ Juneberry Round-leaved Downy arrowwood Chokecherry dogwood Poison ivy...Poison ivy Chokecherry Wild grape Sandbar Willow Black raspberry Bush honeysuckle Smooth wild rose Virginia creeper Bush honeysuckle Juneberry
Basic English Writers' Japanese-English Wordbook.
ERIC Educational Resources Information Center
Daniels, F. J.
The author of this Japanese-English wordbook suggests that it may be used by Japanese writers of English, by those translating from Japanese into English, and by learners of Japanese, in addition to its main intended uses as an aid to the preparation of teaching material and as a work of reference for teachers. A translator will need to supplement…
Kula, Marta; Głód, Daniel; Krauze-Baranowska, Mirosława
2016-11-30
Lonicera caerulea is a shrub native to the Northen Hemisphere, with its fruits having a long tradition of being used in traditional medicine. The flowers, although a potential source of diverse phenolic compounds have not been studied in terms of phenolic content. In this paper, a 2D LC heart-cutting system, operating in both on-line and off-line modes, was developed and successfully employed in identification and quantification of secondary metabolites in the flowers of L. caerulea. A total of 51 compounds have been resolved and identified as either flavonoids, phenolic acids or iridoids. Flavonoids were the dominating group of compounds, alongside substantial levels of both phenolic acids and iridoids. A comparison between three varieties of L. caerulea flowers revealed that 'Wojtek' contained markedly more flavonols and phenolic acids than the remaining two varieties, whereas iridoids were at similar levels. Heart-cutting 2D LC method used in this study offers a convenient approach and an effective tool for secondary metabolite analysis in L. caerulea flowers, and possibly other species from the genus. Copyright © 2016 Elsevier B.V. All rights reserved.
1989-06-01
United States. The chief function of this principle is to cut--it separates all things. It classifies everything into black and white, good and bad . The...content included articles on masturbation , petting, and 99 intercourse. One of Japan’s all time best selling books in recent years, Totto-chan, is a...to the th: every Japanese will be judged by whether he celebrates this or not. That is how people will be determined to be good Japanese or bad 112
Sawai, Tadashi; Sakai, Tatsuo
2010-03-01
In the second decade of the Showa period, great changes were made in the Japanese anatomical terms. It has been proposed that the presentation of JNA (Jenaer nomina anatomica) was one of the factors leading to the change. The Japanese language reform campaign, however, played an important role. The party kokugoaigo doumei and its successor kokugo kyokai required concise and unified technical terms. The anatomical nomenclature committee of the Japanese Association of Anatomists worked to satisfy this requirement. The committee consulted with nomenclature committees of other medical associations and took account of their opinions. The anatomical nomenclature committee abandoned the literal translation from Latin to Japanese and shaped a succinct Japanese terminology. Modern Japanese anatomical terms are based on this terminology.
ERIC Educational Resources Information Center
Tatsumi, Naofumi
2012-01-01
Previous research shows that American learners of Japanese (AJs) tend to differ from native Japanese speakers in their compliment responses (CRs). Yokota (1986) and Shimizu (2009) have reported that AJs tend to respond more negatively than native Japanese speakers. It has also been reported that AJs' CRs tend to lack the use of avoidance or…
Park, Sun Hong; Roh, Eunmiri; Kim, Hyun Soo; Baek, Seung-Il; Choi, Nam Song; Kim, Narae; Hwang, Bang Yeon; Han, Sang-Bae; Kim, Youngsoo
2013-12-13
Lonicerae flos extract (HS-23) is a clinical candidate currently undergoing Phase I trial in lipopolysaccharide (LPS)-injected healthy human volunteers, but its molecular basis remains to be defined. Here, we investigated protective effects of HS-23 or its major constituents on Escherichia coli LPS-induced septic mortality in mice. Intravenous treatment with HS-23 rescued LPS-intoxicated C57BL/6J mice under septic conditions, and decreased the levels of cytokines such as tumor necrosis factor α (TNF-α), interleukin (IL)-1β and high-mobility group box-1 (HMGB-1) in the blood. Chlorogenic acid (CGA) and its isomers were assigned as major constituents of HS-23 in the protection against endotoxemia. As a molecular mechanism, HS-23 or CGA isomers inhibited endotoxin LPS-induced autophosphorylation of the IL-1 receptor-associated kinase 4 (IRAK-4) in mouse peritoneal macrophages as well as the kinase activity of IRAK-4 in cell-free reactions. HS-23 consequently suppressed downstream pathways critical for LPS-induced activation of nuclear factor (NF)-κB or activating protein 1 (AP-1) in the peritoneal macrophages. HS-23 also inhibited various toll-like receptor agonists-induced nitric oxide (NO) production, and down-regulated LPS-induced expression of NF-κB/AP-1-target inflammatory genes in the cells. Taken together, HS-23 or CGA isomers exhibited anti-inflammatory therapy against LPS-induced septic mortality in mice, at least in part, mediated through the inhibition of IRAK-4. Copyright © 2013 Elsevier Inc. All rights reserved.
Japanese American Identity Dilemma.
ERIC Educational Resources Information Center
Maykovich, Minako K.
The major theme of this book is the label "Quiet American" for the Japanese American. In order to locate Japanese Americans sociologically and psychologically in the structure of American society, various concepts such as "marginal man,""alienation," and "inauthenticity" are examined, specifying these…
Population structure in Japanese rice population
Yamasaki, Masanori; Ideta, Osamu
2013-01-01
It is essential to elucidate genetic diversity and relationships among even related individuals and populations for plant breeding and genetic analysis. Since Japanese rice breeding has improved agronomic traits such as yield and eating quality, modern Japanese rice cultivars originated from narrow genetic resource and closely related. To resolve the population structure and genetic diversity in Japanese rice population, we used a total of 706 alleles detected by 134 simple sequence repeat markers in a total of 114 cultivars composed of 94 improved varieties and 20 landraces, which are representative and important for Japanese rice breeding. The landraces exhibit greater gene diversity than improved lines, suggesting that landraces can provide additional genetic diversity for future breeding. Model-based Bayesian clustering analysis revealed six subgroups and admixture situation in the cultivars, showing good agreement with pedigree information. This method could be superior to phylogenetic method in classifying a related population. The leading Japanese rice cultivar, Koshihikari is unique due to the specific genome constitution. We defined Japanese rice diverse sets that capture the maximum number of alleles for given sample sizes. These sets are useful for a variety of genetic application in Japanese rice cultivars. PMID:23641181
ERIC Educational Resources Information Center
Tsukada, Kimiko
2012-01-01
This study aimed to compare the perception of short vs. long vowel contrasts in Japanese and Modern Standard Arabic (MSA) by four groups of listeners differing in their linguistic backgrounds: native Arabic (NA), native Japanese (NJ), non-native Japanese (NNJ) and Australian English (OZ) speakers. The NNJ and OZ groups shared the first language…
Body composition and anthropometry in Japanese and Australian Caucasian males and Japanese females.
Kagawa, Masaharu; Binns, Colin B; Hills, Andrew P
2007-01-01
The total amount and location of fat deposition are important factors in the development of obesity and the metabolic syndrome. To date there have been no reported studies of ethnic and gender differences in body composition and fat distribution patterns in Japanese and Australian young adults. The aim of this study was to assess body composition of young Japanese and Australian Caucasian adults using whole-body dual energy x-ray absorptiometry (DXA) and anthropometry to examine body fat deposition patterns. Body composition of 45 Japanese males and 42 Australian Caucasian males living in Australia (aged 18-40 years) and 139 Japanese females living in Japan (aged 18-27 years) were measured using whole-body DXA scanning and anthropometry. Differences in relationships between BMI and waist circumference (WC), sum of skinfolds (SigmaSF) and %BF obtained from DXA were assessed using multivariate analyses. Distinct gender and ethnic differences (p<0.05) in bone density and waist circumference were observed but no gender differences in BMI and bone mineral content and no ethnic differences in sum of skinfolds and %BF. Both Japanese males and females showed a greater %BF at given BMI, WC and SigmaSF values (p<0.05). The results indicate differences in relationships between %BF and anthropometric measures in young Japanese compared to Caucasians and the importance of population-specific cut-off points for these indices. These findings also have implications for the development of chronic disease and further research, including studies in other Asian countries, is recommended.
The Japanese containerless experiments
NASA Technical Reports Server (NTRS)
Azuma, Hisao
1990-01-01
There are three sets of Japanese containerless experiments. The first is Drop dynamics research. It consists of acoustic levitation and large amplitude drop oscillation. The second is Optical materials processing in an acoustic levitation furnace. And the third is Electrostatic levitator development by two different Japanese companies.
Intercultural Communication Problems in Japanese Multinationals.
ERIC Educational Resources Information Center
Nishiyama, Kazuo
Many large Japanese-owned multinational corporations have established successful subsidiaries in the United States, but distinct ethnic and cultural differences have caused communication problems between Japanese managers and American laborers and business people. Many top executives of the Japanese subsidiaries are sent to the United States on a…
Shattering Myths: Japanese American Educational Issues.
ERIC Educational Resources Information Center
Yoshiwara, Florence M.
An historical review of the immigration and resettlement patterns, and a demographic profile of Japanese Americans reveals a myth of the "successful minority." Since the founding of the Japanese American Citizens League in 1928, Japanese Americans have defeated alien land laws, discriminatory immigration quotas, anti-miscengenation laws,…
[History of Japanese Committee for Anatomical Nomenclature].
Kimura, Kunihiko
2008-12-01
This paper records a history of the Japanese Committee of Anatomical Nomenclature since 1990, as a supplement to the previous report (1991), explains a progressing of the edition of Japanese medical terms by the Japanese Association of Medical Sciences and the Ministry of Education, Sciences and Culture, and points out of some problems on terms in Japanese.
Zha, Liangping; Liu, Shuang; Liu, Juan; Jiang, Chao; Yu, Shulin; Yuan, Yuan; Yang, Jian; Wang, Yaolong; Huang, Luqi
2017-01-01
The content of active compounds differ in buds and flowers of Lonicera japonica (FLJ) and L. japonica var. chinensis (rFLJ). Chlorogenic acid (CGAs) were major active compounds of L. japonica and regarded as measurements for quality evaluation. However, little is known concerning the formation of active compounds at the molecular level. We quantified the major CGAs in FLJ and rFLJ, and found the concentrations of CGAs were higher in the buds of rFLJ than those of FLJ. Further analysis of CpG methylation of CGAs biosynthesis genes showed differences between FLJ and rFLJ in the 5'-UTR of phenylalanine ammonia-lyase 2 ( PAL2 ). We identified 11 LjbZIP proteins and 24 rLjbZIP proteins with conserved basic leucine zipper domains, subcellular localization, and electrophoretic mobility shift assay showed that the transcription factor LjbZIP8 is a nuclear-localized protein that specifically binds to the G-box element of the LjPAL2 5'-UTR. Additionally, a transactivation assay and LjbZIP8 overexpression in transgenic tobacco indicated that LjbZIP8 could function as a repressor of transcription. Finally, treatment with 5-azacytidine decreased the transcription level of LjPAL2 and CGAs content in FLJ leaves. These results raise the possibility that DNA methylation might influence the recruitment of LjbZIP8, regulating PAL2 expression level and CGAs content in L. japonica .
ERIC Educational Resources Information Center
Tanaka, Sachiko Oda
1995-01-01
Describes the use of English in the media in Japan, focusing on the role and history of English-language newspapers, radio, and television programs, as well as the proliferation of English-language films shown in Japanese cinemas. Discusses the implications of English in the Japanese media. (20 references) (MDM)
Ordinal Expressions in Japanese. Papers in Japanese Linguistics, Vol. 2, No. 1.
ERIC Educational Resources Information Center
Backus, Robert L.
The varied forms and semantic factors of Japanese ordinal expressions are related to one another in a coherent system. In Japanese, the cardinal number form is a numeral compound in construction with a referent. The numeral compound consists of a number and a numeral adjunct. Numeral adjuncts are derived from bound forms, or numeral suffixes, and…
Takada, Kenta
2012-01-01
Seasonal changes in the popularity of fireflies [usually Genji-fireflies (Luciola cruciata Motschulsky) in Japan] and Japanese rhinoceros beetles [Allomyrina dichotoma (Linne)] were investigated to examine whether contemporary Japanese are interested in visible emergence of these insects as seasonal events. The popularity of fireflies and Japanese rhinoceros beetles was assessed by the Google search volume of their Japanese names, “Hotaru” and “Kabuto-mushi” in Japanese Katakana script using Google Trends. The search volume index for fireflies and Japanese rhinoceros beetles was distributed across seasons with a clear peak in only particular times of each year from 2004 to 2011. In addition, the seasonal peak of popularity for fireflies occurred at the beginning of June, whereas that for Japanese rhinoceros beetles occurred from the middle of July to the beginning of August. Thus seasonal peak of each species coincided with the peak period of the emergence of each adult stage. These findings indicated that the Japanese are interested in these insects primarily during the time when the two species are most visibly abundant. Although untested, this could suggest that fireflies and Japanese rhinoceros beetles are perceived by the general public as indicators or symbols of summer in Japan. PMID:26466535
First Course in Japanese: Character Workbook.
ERIC Educational Resources Information Center
Niwa, Tamako
This character workbook is an introduction to Japanese writing designed to be used in conjunction with Parts One and Two of this introductory course in Japanese. All the "hiragana", several "katakana", and 88 Japanese characters are introduced in this text. The workbook, consisting of 30 lessons, is divided into three parts.…
Developing Instructional Materials for Business Japanese.
ERIC Educational Resources Information Center
Koike, Shohei
Business Japanese should be the study of Japanese language and culture for business communication and should include values and beliefs and institutional constraints on which the Japanese act as well as business etiquette and terminology. Topics to be covered in instruction will vary depending on the role (seller, buyer, or colleague) played by…
Japanese Quality Control Circles.
ERIC Educational Resources Information Center
Nishiyama, Kazuo
In recent years, United States scholars with an interest in international business and organizational communication have begun to notice the success of Japanese "quality control circles." These are small groups, usually composed of seven to ten workers, who are organized at the production levels within most large Japanese factories. A…
Generations and Identity: The Japanese American.
ERIC Educational Resources Information Center
Kitano, Harry H. L.
The story of people of Japanese descent in the United States is told in its historic context. The Japanese came to America with cultural values that differed greatly from the mainstream U.S. society. They were also set apart by appearance. Conflict between Japan and the United States exacerbated the problems between the Japanese Americans and the…
The Work Values of Japanese Women.
ERIC Educational Resources Information Center
Engel, John W.
Empirical studies of Japanese work ethics have tended to focus on male workers while neglecting women. In addition, work values in both Japan and the United States appear to be changing. More information is needed on the work values of American and Japanese female workers. A study was conducted to explore the work ethics of Japanese women and to…
Technological Diversification of Japanese Industry.
ERIC Educational Resources Information Center
Kodama, Fumio
1986-01-01
Describes an approach for measuring industrial technological diversification behavior. Identifies sectoral patterns of Japanese industry as related to diversification behaviors. Delineates the mechanisms and effectiveness of Japanese corporate and government policies relevant to diversification. (ML)
Bornstein, Marc H.; Cote, Linda R.; Haynes, O. Maurice; Suwalsky, Joan T. D.; Bakeman, Roger
2011-01-01
Cultural variation in relations and moment-to-moment contingencies of infant-mother person-oriented and object-oriented interactions were examined and compared in 118 Japanese, Japanese American immigrant, and European American dyads with 5.5-month-olds. Infant and mother person-oriented behaviors were positively related in all cultural groups, but infant and mother object-oriented behaviors were positively related only among European Americans. In all groups, infant and mother behaviors within each modality were mutually contingent. Culture moderated lead-lag relations: Japanese infants were more likely than their mothers to respond in object-oriented interactions, European American mothers were more likely than their infants to respond in person-oriented interactions. Japanese American dyads behaved more like European American dyads. Interaction, infant effects, and parent socialization findings are set in cultural and accultural models of transactions between young infants and their mothers. PMID:22860874
Pretending to Be Japanese: Artistic Play in a Japanese-American Church and Family
ERIC Educational Resources Information Center
Goto, Courtney T.
2008-01-01
With high rates of out-marriage and dwindling need for bilingual worship, Japanese-American churches face a critical question: "Why retain the Japanese part of our identity?" This article explores how one layperson (Naomi Takahashi Goto) draws from her experience as an artist, teacher, and mother to help her congregation answer this question.…
New Frontiers for Japanese Youth
ERIC Educational Resources Information Center
Tucker, Frank H.
1974-01-01
Japanese literature, television, movies, and school texts from 1935 to 1955 are analyzed for their influence and contribution to Japanese youths' pioneering spirit and frontiermindedness. "Asian Affairs" is published by the American-Asian Educational Exchange, New York. (DE)
8 CFR 349.1 - Japanese renunciation of nationality.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Japanese renunciation of nationality. 349.1... NATIONALITY § 349.1 Japanese renunciation of nationality. A Japanese who renounced United States nationality... void, shall complete Form N-576, Supplemental Affidavit to be Submitted with Applications of Japanese...
Lifestyle characteristics assessment of Japanese in Pittsburgh, USA.
Hirooka, Nobutaka; Takedai, Teiichi; D'Amico, Frank
2012-04-01
Lifestyle-related chronic diseases such as cancer and cardiovascular disease are the greatest public health concerns. Evidence shows Japanese immigrants to a westernized environment have higher incidence of lifestyle-related diseases. However, little is known about lifestyle characteristics related to chronic diseases for Japanese in a westernized environment. This study is examining the gap in lifestyle by comparing the lifestyle prevalence for Japanese in the US with the Japanese National Data (the National Health and Nutrition Survey in Japan, J-NHANS) as well as the Japan National Health Promotion in the twenty-first Century (HJ21) goals. Japanese adults were surveyed in Pittsburgh, USA, regarding their lifestyle (e.g., diet, exercise, smoking, stress, alcohol, and oral hygiene). The prevalence was compared with J-NHANS and HJ21 goals. Ninety-three responded (response rate; 97.9%). Japanese men (n = 38) and women (n = 55) in Pittsburgh smoke less than Japanese in Japan (P < 0.001 for both genders). Japanese in Pittsburgh perform less physical activity in daily life and have lower prevalence of walking more than 1 h per day (P < 0.001 for both genders). Japanese women in Pittsburgh have significantly higher prevalence of stress than in Japan (P = 0.004). Japanese men in Pittsburgh do not reach HJ21 goal in weight management, BMI, use of medicine or alcohol to sleep, and sleep quality. Japanese women in Pittsburgh do not reach HJ21 goal in weight management and sleep quality. In conclusion, healthy lifestyle promotion including exercise and physical activity intervention for Japanese living in a westernized environment is warranted.
Vandenberg, Helen
2017-01-01
From 1896 to 1942, a Japanese hospital operated in the village of Steveston, British Columbia, Canada. For the first 4 years, Japanese Methodist missionaries utilized a small mission building as a makeshift hospital, until a larger institution was constructed by the local Japanese Fishermen's Association in 1900. The hospital operated until the Japanese internment, after the attack on Pearl Harbor during World War II. This study offers important commentary about the relationships between health, hospitals, and race in British Columbia during a period of increased immigration and economic upheaval. From the unique perspective of Japanese leaders, this study provides new insight about how Japanese populations negotiated hospital care, despite a context of severe racial discrimination. Japanese populations utilized Christianization, fishing expertise, and hospital work to garner more equitable access to opportunities and resources. This study demonstrates that in addition to providing medical treatment, training grounds for health-care workers, and safe refuge for the sick, hospitals played a significant role in confronting broader racialized inequities in Canada's past.
Cheng, Brian Chi-Yan; Ma, Xiao-Qing; Kwan, Hiu-Yee; Tse, Kai-Wing; Cao, Hui-Hui; Su, Tao; Shu, Xin; Wu, Zheng-zhi; Yu, Zhi-ling
2014-05-14
A herbal formula (RL) consisting of Rosae Multiflorae Fructus (Yingshi) and Lonicerae Japonicae Flos (Jinyinhua) has been traditionally used to treat inflammatory disorders. This study aims to investigate the anti-inflammatory mode and mechanism of action of the ethanol extract of RL so as to provide a pharmacological basis for the use of RL in treating inflammatory diseases. RL consisting of Yingshi and Jinyinhua (in 5:3 ratio) was extracted using absolute ethanol. We investigated its effects on nitric oxide (NO), interleukin-6 (IL-6), tumour necrosis factor (TNF)-α, inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), mitogen-activated protein kinases (MAPKs) and nuclear factor κB (NFκB) in mouse RAW 264.7 macrophages activated with lipopolysaccharide (LPS). RL could decrease the secretion of NO, IL-6 and TNF-α into the culture medium and the cellular protein levels of iNOS and COX-2, which were associated with the reduction of the phosphorylation/activation of JNK and p38, and the inhibition of the transcriptional activity of NF-κB. The present study demonstrated an inhibitory effect of RL on the inflammatory mediators regulated by the NF-κB and MAPK signalling pathways in LPS-stimulated RAW 264.7 macrophages, providing a pharmacological basis for RL in the control of inflammatory disorders. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Some Design Issues for an Online Japanese Textbook
ERIC Educational Resources Information Center
Nagata, Noriko
2010-01-01
This paper discusses several design issues in the development of a new online Japanese textbook, called "Robo-Sensei: Japanese Curriculum with Automated Feedback". When it is completed, the new online textbook will present a full Japanese curriculum. It extends a previously published online software program, "Robo-Sensei: Personal Japanese Tutor"…
The Semantics and Pragmatics of Japanese Focus Particles
ERIC Educational Resources Information Center
Hasegawa, Akio
2011-01-01
Japanese has a rich set of focus particles, several exclusive and additive particles, and, in addition, contrastive particles. This thesis provides a formal description of the meanings of Japanese focus particles and addresses two general questions: "What kinds concepts do Japanese focus particles express?" and "Why does Japanese have a larger…
Re-Examining Patriotism in Japanese Education: Analysis of Japanese Elementary School Moral Readers
ERIC Educational Resources Information Center
Anzai, Shinobu
2015-01-01
In 1947 the Fundamental Law of Education (FLE) defined the pacifist principles for post-war Japanese education and was revised in 2006 for the first time in nearly 60 years. The revised FLE stipulates the importance of teaching love for country and region and Japanese culture and traditions with special emphasis on moral education. Today, this…
Park, Y M; Matsumoto, K; Seo, Y J; Shinkoda, H; Park, K P
1997-08-01
The Morningness-Eveningness Questionnaire and Life Habits Inventory were given to three groups of the same mean age: 533 Korean students, 468 Japanese students, and 311 Japanese workers. The distributions of scores on the questionnaire for these three groups are normal; however the Japanese students' distribution was slightly skewed towards the Evening type. The self-reported waking times and bedtimes for the three groups were late in the order of Morning, Intermediate, and Evening types. It is noteworthy, however, that the Korean students woke earlier than the Japanese students, and the workers always went to bed and woke earlier than the students. For the groups the variations in bedtime, waking time, and length of sleep were large, the sleep latency was long, and mood of the participants upon waking was bad in the order of the Morning. Intermediate, and Evening types. The scores of the Korean students were distributed more highly in the Morning type than were the Japanese students', but the students' sleep habits in both countries were quite similar. The subjects categorized as Evening types had more irregular sleep habits than those of the Morning type. In comparison with the student groups, Japanese workers of the same mean age had higher scores and slightly different sleep habits. The change in sleep habits could be seen as a result of the demands of employment, and the probable basis for difference in scores.
Japanese Characters in Written Japanese.
ERIC Educational Resources Information Center
Buck, James H.
From the sixth to the eighth century A.D., Japan was the recipient of massive cultural infusions from China. This acceptance of the Chinese pattern included, and to a great extent was based on, the acceptance of the Chinese language. The Chinese writing system was applied to Japanese because there was no other model to follow and in spite of the…
Japanese/Korean Linguistics, Volume 8.
ERIC Educational Resources Information Center
Silva, David J., Ed.
A collection of research in Japanese and Korean linguistics includes: "Repetition, Reformulation, and Definitions: Prosodic Indexes of Elaboration in Japanese" (Mieko Banno); "Projection of Talk Using Language, Intonation, Deictic and Iconic Gestures and Other Body Movements" (Keiko Emmett); "Turn-taking in Japanese…
Geochemical aspects of some Japanese lavas.
NASA Technical Reports Server (NTRS)
Philpotts, J. A.; Martin, W.; Schnetzler, C. C.
1971-01-01
K, Rb, Sr, Ba and rare-earth concentrations in some Japanese lavas have been determined by mass-spectrometric stable-isotope dilution. The samples fall into three rare-earth groups corresponding to tholeiitic, high alumina and alkali basalts. Japanese tholeiites have trace element characteristics similar to those of oceanic ridge tholeiites except for distinctly higher relative concentrations of Ba. Japanese lavas may result from various degrees of partial fusion of amphibole eclogite.
Sugahara, Kanako; Kaneko, Yuko; Ito, Satoshi; Yamanaka, Keisuke; Sakio, Hitoshi; Hoshizaki, Kazuhiko; Suzuki, Wajiro; Yamanaka, Norikazu; Setoguchi, Hiroaki
2011-01-01
Japanese horse chestnut (Aesculus turbinata: Hippocastanaceae) is one of the typical woody plants that grow in temperate riparian forests in the Japanese Archipelago. To analyze the phylogeography of this plant in the Japanese Archipelago, we determined cpDNA haplotypes for 337 samples from 55 populations covering the entire distribution range. Based on 1,313 bp of two spacers, we determined ten haplotypes that are distinguished from adjacent haplotypes by one or two steps. Most of the populations had a single haplotype, suggesting low diversity. Spatial analysis of molecular variance suggested three obvious phylogeographic structures in western Japan, where Japanese horse chestnut is scattered and isolated in mountainous areas. Conversely, no clear phylogeographic structure was observed from the northern to the southern limit of this species, including eastern Japan, where this plant is more common. Rare and private haplotypes were also found in southwestern Japan, where Japanese horse chestnuts are distributed sparsely. These findings imply that western Japan might have maintained a relatively large habitat for A. turbinata during the Quaternary climatic oscillations, while northerly regions could not.
Zha, Liangping; Liu, Shuang; Liu, Juan; Jiang, Chao; Yu, Shulin; Yuan, Yuan; Yang, Jian; Wang, Yaolong; Huang, Luqi
2017-01-01
The content of active compounds differ in buds and flowers of Lonicera japonica (FLJ) and L. japonica var. chinensis (rFLJ). Chlorogenic acid (CGAs) were major active compounds of L. japonica and regarded as measurements for quality evaluation. However, little is known concerning the formation of active compounds at the molecular level. We quantified the major CGAs in FLJ and rFLJ, and found the concentrations of CGAs were higher in the buds of rFLJ than those of FLJ. Further analysis of CpG methylation of CGAs biosynthesis genes showed differences between FLJ and rFLJ in the 5′-UTR of phenylalanine ammonia-lyase 2 (PAL2). We identified 11 LjbZIP proteins and 24 rLjbZIP proteins with conserved basic leucine zipper domains, subcellular localization, and electrophoretic mobility shift assay showed that the transcription factor LjbZIP8 is a nuclear-localized protein that specifically binds to the G-box element of the LjPAL2 5′-UTR. Additionally, a transactivation assay and LjbZIP8 overexpression in transgenic tobacco indicated that LjbZIP8 could function as a repressor of transcription. Finally, treatment with 5-azacytidine decreased the transcription level of LjPAL2 and CGAs content in FLJ leaves. These results raise the possibility that DNA methylation might influence the recruitment of LjbZIP8, regulating PAL2 expression level and CGAs content in L. japonica. PMID:28740500
Chambers, D W
1998-01-01
The Japanese do not work harder or even use different approaches so much as they aim for a different result--one that balances process and results and extends the definition of quality beyond the product itself to include cost and convenience to the customer as well. Ten methods of the Japanese kaizen culture of work are presented with applications and contrasts to American dentistry.
Japanese Language School: Aid or Hindrance to the Americanization of Japanese Americans in Hawaii?
ERIC Educational Resources Information Center
Shoho, Alan R.
A study examined the experiences of 60 Japanese immigrants to Hawaii (Niseis), aged 61-80, who attended Japanese-language schools as children. Using a case study oral history approach, the study gathered oral testimonies through semi-structured interviews. Historical documents were also used as primary sources of information about the schools.…
Japanese encephalitis - the prospects for new treatments.
Turtle, Lance; Solomon, Tom
2018-04-26
Japanese encephalitis is a mosquito-borne disease that occurs in Asia and is caused by Japanese encephalitis virus (JEV), a member of the genus Flavivirus. Although many flaviviruses can cause encephalitis, JEV causes particularly severe neurological manifestations. The virus causes loss of more disability-adjusted life years than any other arthropod-borne virus owing to the frequent neurological sequelae of the condition. Despite substantial advances in our understanding of Japanese encephalitis from in vitro studies and animal models, studies of pathogenesis and treatment in humans are lagging behind. Few mechanistic studies have been conducted in humans, and only four clinical trials of therapies for Japanese encephalitis have taken place in the past 10 years despite an estimated incidence of 69,000 cases per year. Previous trials for Japanese encephalitis might have been too small to detect important benefits of potential treatments. Many potential treatment targets exist for Japanese encephalitis, and pathogenesis and virological studies have uncovered mechanisms by which these drugs could work. In this Review, we summarize the epidemiology, clinical features, prevention and treatment of Japanese encephalitis and focus on potential new therapeutic strategies, based on repurposing existing compounds that are already suitable for human use and could be trialled without delay. We use our newly improved understanding of Japanese encephalitis pathogenesis to posit potential treatments and outline some of the many challenges that remain in tackling the disease in humans.
NASA Astrophysics Data System (ADS)
Ishimoto, Michi; Thornton, Ronald K.; Sokoloff, David R.
2014-12-01
This study assesses the Japanese translation of the Force and Motion Conceptual Evaluation (FMCE). Researchers are often interested in comparing the conceptual ideas of students with different cultural backgrounds. The FMCE has been useful in identifying the concepts of English-speaking students from different backgrounds. To identify effectively the conceptual ideas of Japanese students and to compare them to those of their English-speaking counterparts, more work is required. Because of differences between the Japanese and English languages, and between the Japanese and American educational systems, it is important to assess the Japanese translation of the FMCE, a conceptual evaluation originally developed in English for American students. To assess its appropriateness, we examined the performance of a large sample of students on the translated version of the FMCE and then compared the results to those of English-speaking students. The data comprise the pretest results of 1095 students, most of whom were first-year students at a midlevel engineering school between 2003 and 2012. Basic statistics and the classical test theory indices of the translated FMCE indicate that its reliability and discrimination are appropriate to assess Japanese students' concepts about force and motion. In general, the preconcepts of Japanese students assessed with the Japanese translation of the FMCE are quite similar to those of American students assessed with the FMCE, thereby supporting the validity of the translated version. However, our findings do show (1) that only a small percentage of Japanese students grasped Newtonian concepts and (2) that the percentage of Japanese students who used two different concept models together to answer some questions seems to be higher than that of American students.
Vandenberg, Helen
2017-01-01
From 1896 to 1942, a Japanese hospital operated in the village of Steveston, British Columbia, Canada. For the first 4 years, Japanese Methodist missionaries utilized a small mission building as a makeshift hospital, until a larger institution was constructed by the local Japanese Fishermen's Association in 1900. The hospital operated until the Japanese internment, after the attack on Pearl Harbor during World War II. This study offers important commentary about the relationships between health, hospitals, and race in British Columbia during a period of increased immigration and economic upheaval. From the unique perspective of Japanese leaders, this study provides new insight about how Japanese populations negotiated hospital care, despite a context of severe racial discrimination. Japanese populations utilized Christianization, fishing expertise, and hospital work to garner more equitable access to opportunities and resources. This study demonstrates that in addition to providing medical treatment, training grounds for health-care workers, and safe refuge for the sick, hospitals played a significant role in confronting broader racialized inequities in Canada's past.
2001-12-01
This thesis explores whether there is a uniquely Japanese method of conflict management Given the delicate balance of stability in Northeast Asia...Japanese leadership needs to use conflict management tools to resolve territorial claims with the governments of China, Russia, and South Korea, Given
Yanagawa, Toru; Yamaguchi, Akira; Harada, Hiroyuki; Yamagata, Kenji; Ishibashi, Naomi; Noguchi, Masayuki; Onizawa, Kojiro; Bukawa, Hiroki
2011-01-01
Cheilitis glandularis (CG) is a rare disorder characterized by swelling of the lip with hyperplasia of the labial salivary glands. CG is most frequently encountered in the lower lip, in middle-aged to older Caucasian men; however Asian cases were rarely reported. In this paper we present two cases of CG in Asian-Japanese men. One was a 23-year-old male with CG of the superficial suppurative type. The other was a 54-year-old male with deep suppurative type. We also reviewed the Japanese cases of CG in the literature and discussed about clinical feature of Japanese CG. PMID:21991474
Persistence of Ethnicity: The Japanese of Colorado.
ERIC Educational Resources Information Center
Endo, Russell
This paper presents an overview of the history of Japanese in Colorado. Japanese immigrants first came to Colorado between 1900 and 1910 as railroad laborers. Some became coal miners in southern Colorado; most others became farm laborers. Although the Japanese population during this period was small, communities developed in several locales. The…
Inequities in Japanese Urban Schools
ERIC Educational Resources Information Center
Gordon, June A.
2005-01-01
Interviews with Japanese public school educators allow a distinctive view of how the continuing economic decline in Japan has affected educational motivation and decision-making among students and parents. The nature of socioeconomic stratification within Japanese educational opportunity is seen as a continuing situation exacerbated by the costs…
Wu, Shusong; Yano, Satoshi; Chen, Jihua; Hisanaga, Ayami; Sakao, Kozue; He, Xi; He, Jianhua; Hou, De-Xing
2017-06-28
Lonicera caerulea L. berry polyphenols (LCBP) are considered as major components for bioactivity. This study aimed to clarify the molecular mechanisms by monitoring inflammatory and antioxidant mediator actions in lipopolysaccharide (LPS)-induced mouse paw edema and macrophage cell model. LCBP significantly attenuated LPS-induced paw edema (3.0 ± 0.1 to 2.8 ± 0.1 mm, P < 0.05) and reduced (P < 0.05) serum levels of monocyte chemotactic protein-1 (MCP-1, 100.9 ± 2.3 to 58.3 ± 14.5 ng/mL), interleukin (IL)-10 (1596.1 ± 424.3 to 709.7 ± 65.7 pg/mL), macrophage inflammatory protein (MIP)-1α (1761.9 ± 208.3 to 1369.1 ± 56.4 pg/mL), IL-6 (1262.8 ± 71.7 to 499.0 ± 67.1 pg/mL), IL-4 (93.3 ± 25.7 to 50.7 ± 12.5 pg/mL), IL-12(p-70) (580.4 ± 132.0 to 315.2 ± 35.1 pg/mL), and tumor necrosis factor-α (TNF-α, 2045.5 ± 264.9 to 1270.7 ± 158.6 pg/mL). Cell signaling analysis revealed that LCBP inhibited transforming growth factor β activated kinase-1 (TAK1)-mediated mitogen-activated protein kinase (MAPK) and nuclear factor-κB (NF-κB) pathways, and enhanced the expression of nuclear factor (erythroid-derived 2)-like 2 (Nrf2) and manganese-dependent superoxide dismutase (MnSOD) in earlier response. Moreover, cyanidin 3-glucoside (C3G) and (-)-epicatechin (EC), two major components of LCBP, directly bound to TAK1. These data demonstrated that LCBP might inhibit LPS-induced inflammation by modulating both inflammatory and antioxidant mediators.
Sexual partner preference in female Japanese macaques.
Vasey, Paul L
2002-02-01
Whether animals ever exhibit a preference for same-sex sexual partners is a subject of debate. Japanese macaques represent excellent models for examining issues related to sexual preference in animals because females, in certain populations, routinely engage in both heterosexual and homosexual behavior over the course of their life spans. Multiple lines of evidence indicate that female homosexual behavior in Japanese macaques is a sexual behavior, not a sociosexual one. Additional evidence indicates that female Japanese macaques do not engage in homosexual behavior simply because acceptable male mates are unavailable or unmotivated to copulate. Patterns of sexual partner choice by female Japanese macaques that are the focus of intersexual competition indicate that females of this species choose same-sex sexual partners even when they are simultaneously presented with a motivated, opposite-sex alternative. Thus, in some populations of Japanese macaques, females prefer certain same-sex sexual partners relative to certain male mates, and vice versa. Taken together, this evidence suggests that female Japanese macaques are best characterized as bisexual in orientation, not preferentially homosexual or preferentially heterosexual.
A Japanese Agenda for Management Development.
ERIC Educational Resources Information Center
Lim, Howard
1982-01-01
Discusses myths about the Japanese management styles; what the West can learn from the Japanese; the concept of nonlinear management; and training modules which teach self-discipline, tolerance, and nonlinear management. (CT)
Asian Pacific Perspectives: Japanese Americans.
ERIC Educational Resources Information Center
Los Angeles Unified School District, CA.
These instructional materials on Japanese Americans for elementary students were developed through the K.E.Y.S. project (Knowledge of English Yields Success). Information is included on early immigrants, their historical and cultural background, and current problems of Japanese Americans. Resource guides describe the purpose of the unit, how to…
Academic report on burnout among Japanese nurses.
Kitaoka, Kazuyo; Masuda, Shinya
2013-12-01
Japanese nurses have increasingly experienced "burnout" in the past several years. Studies on Japanese nurses are required in order to explore how to prevent nursing burnout. The objectives of this report were to: (i) introduce the concept, definition, and measurement of burnout; (ii) look at an overview of the prevalence, possible causes, and consequences of burnout among Japanese nurses; and (iii) explore how to prevent burnout among nurses. The authors and co-researchers have been studying burnout among Japanese workers for more than 15 years. Therefore, previously performed studies were reviewed and summarized. In Japan, approximately 36% of human services professionals, such as nurses, were burned out compared to 18% of civil servants, and 12% of company employees. It was quite obvious that nurses are prone to burnout. The possible causes and consequences of burnout among Japanese nurses were reviewed. Excessive workloads and interpersonal conflict in the workplace were possible causes of burnout among Japanese nurses. The consequences of nurse burnout are potentially very serious, including medical accidents/errors. Issues to prevent nursing burnout were then reviewed. Enhancement of cognitive coping skills for female nurses and problem-solving skills for male nurses could contribute to prevention of burnout in nurses. The authors' previous study revealed that the new model of the organizational context of burnout developed by Leiter and Maslach could be applied to Japanese. Further examination is needed. This report supports the call to scale up burnout prevention strategy for Japanese nurses. © 2012 The Authors. Japan Journal of Nursing Science © 2012 Japan Academy of Nursing Science.
Japanese Neurosurgeons and Microsurgical Anatomy: A Historical Review
MATSUSHIMA, Toshio; KAWASHIMA, Masatou; MATSUSHIMA, Ken; WANIBUCHI, Masahiko
2015-01-01
Research in microneurosurgical anatomy has contributed to great advances in neurosurgery in the last 40 years. Many Japanese neurosurgeons have traveled abroad to study microsurgical anatomy and played major roles in advancing and spreading the knowledge of anatomy, overcoming their disadvantage that the cadaver study has been strictly limited inside Japan. In Japan, they initiated an educational system for surgical anatomy that has contributed to the development and standardization of Japanese neurosurgery. For example, the Japanese Society for Microsurgical Anatomy started an annual educational meeting in the middle of 1980s and published its proceedings in Japanese every year for approximately 20 years. These are some of the achievements that bring worldwide credit to Japanese neurosurgeons. Not only should Japanese neurosurgeons improve their educational system but they should also contribute to the international education in this field, particularly in Asia. PMID:25797782
Issei: Japanese Immigrants in Hawaii.
ERIC Educational Resources Information Center
Kimura, Yukiko
Coming to Hawaii before July 1, 1924, when the Japanese Exclusion Act became effective, the experiences of the Issei or first generation are described. Divided into four parts, this book examines the experiences of Japanese immigrants in Hawaii from 1885 through 1970. Part 1, "The Formation and Stabilization of the Issei Community,"…
Pair-List Readings in Korean-Japanese, Chinese-Japanese and English-Japanese Interlanguage
ERIC Educational Resources Information Center
Marsden, Heather
2008-01-01
In English and Chinese, questions with a "wh"-object and a universally quantified subject (e.g. "What did everyone buy?") allow an individual answer ("Everyone bought apples.") and a pair-list answer ("Sam bought apples, Jo bought bananas, Sally bought..."). By contrast, the pair-list answer is reportedly unavailable in Japanese and Korean. This…
Osada, Toshihiro; Tanaka, Yuki; Yamada, Akira; Sasaki, Eiji; Utsugi, Teruhiro
2018-03-07
About one-third of the Japanese population suffers from Japanese cedar pollinosis, which is frequently accompanied by Japanese cypress pollinosis. Recently, a novel major Japanese cypress pollen allergen, Cha o 3, was discovered. However, whether a Cha o 3 homolog is present in Japanese cedar pollen remains to be determined. Western blot analysis was performed using Cha o 3-specific antiserum. In addition, cloning of the gene encoding Cry j 4 was conducted using total cDNA from the male flower of Japanese cedar trees. Allergen potency and cross-reactivity were investigated using a T-cell proliferation assay, basophil activation test, and ImmunoCAP inhibition assay. A low amount of Cha o 3 homolog protein was detected in Japanese cedar pollen extract. The deduced amino acid sequence of Cry j 4 showed 84% identity to that of Cha o 3. Cross-reactivity between Cry j 4 and Cha o 3 was observed at the T cell and IgE levels. Cry j 4 was discovered as a counterpart allergen of Cha o 3 in Japanese cedar pollen, with a relationship similar to that between Cry j 1-Cha o 1 and Cry j 2-Cha o 2. Our findings also suggest that allergen-specific immunotherapy (ASIT) using Japanese cedar pollen extract does not induce adequate immune tolerance to Cha o 3 due to the low amount of Cry j 4 in Japanese cedar pollen. Therefore, ASIT using Cha o 3 or cypress pollen extract coupled with Japanese cedar pollen extract is required in order to optimally control allergy symptoms during Japanese cypress pollen season. Copyright © 2018 Japanese Society of Allergology. Production and hosting by Elsevier B.V. All rights reserved.
Marine Biodiversity in Japanese Waters
Fujikura, Katsunori; Lindsay, Dhugal; Kitazato, Hiroshi; Nishida, Shuhei; Shirayama, Yoshihisa
2010-01-01
To understand marine biodiversity in Japanese waters, we have compiled information on the marine biota in Japanese waters, including the number of described species (species richness), the history of marine biology research in Japan, the state of knowledge, the number of endemic species, the number of identified but undescribed species, the number of known introduced species, and the number of taxonomic experts and identification guides, with consideration of the general ocean environmental background, such as the physical and geological settings. A total of 33,629 species have been reported to occur in Japanese waters. The state of knowledge was extremely variable, with taxa containing many inconspicuous, smaller species tending to be less well known. The total number of identified but undescribed species was at least 121,913. The total number of described species combined with the number of identified but undescribed species reached 155,542. This is the best estimate of the total number of species in Japanese waters and indicates that more than 70% of Japan's marine biodiversity remains un-described. The number of species reported as introduced into Japanese waters was 39. This is the first attempt to estimate species richness for all marine species in Japanese waters. Although its marine biota can be considered relatively well known, at least within the Asian-Pacific region, considering the vast number of different marine environments such as coral reefs, ocean trenches, ice-bound waters, methane seeps, and hydrothermal vents, much work remains to be done. We expect global change to have a tremendous impact on marine biodiversity and ecosystems. Japan is in a particularly suitable geographic situation and has a lot of facilities for conducting marine science research. Japan has an important responsibility to contribute to our understanding of life in the oceans. PMID:20689840
Developmental Sentence Scoring for Japanese
ERIC Educational Resources Information Center
Miyata, Susanne; MacWhinney, Brian; Otomo, Kiyoshi; Sirai, Hidetosi; Oshima-Takane, Yuriko; Hirakawa, Makiko; Shirai, Yasuhiro; Sugiura, Masatoshi; Itoh, Keiko
2013-01-01
This article reports on the development and use of the Developmental Sentence Scoring for Japanese (DSSJ), a new morpho-syntactical measure for Japanese constructed after the model of Lee's English Developmental Sentence Scoring model. Using this measure, the authors calculated DSSJ scores for 84 children divided into six age groups between 2;8…
Seasonal allergic conjunctivitis induced by Japanese pear pollen.
Yanagisawa, S; Nagaki, Y; Hiraki, S; Kadoi, C; Hayasaka, S; Teranishi, H
1999-01-01
To evaluate the ocular findings in patients with Japanese pear (Pyrus pyrifolia Nakai) pollinosis. Twenty-two farmers working on artificial pollination in Japanese pear orchards were examined for ocular itching, conjunctival conditions, presence of eosinophils in the conjunctival specimen, and nasal symptoms. Serum IgE antibody to Japanese pear pollen was determined in 16 farmers. Of the 22 subjects, 3 (Nos. 3, 4, and 13) exhibited ocular itching, conjunctival hyperemia, eosinophils in the conjunctival specimen, and positive serum IgE antibodies to Japanese pear pollen. In these patients, the conjunctivitis disappeared after treatment with topical cromoglycate. The present study demonstrated that seasonal allergic conjunctivitis may be induced by Japanese pear pollen (entomophilous flower pollen).
Acquisition of Japanese contracted sounds in L1 phonology
NASA Astrophysics Data System (ADS)
Tsurutani, Chiharu
2002-05-01
Japanese possesses a group of palatalized consonants, known to Japanese scholars as the contracted sounds, [CjV]. English learners of Japanese appear to treat them initially as consonant + glide clusters, where there is an equivalent [Cj] cluster in English, or otherwise tend to insert an epenthetic vowel [CVjV]. The acquisition of the Japanese contracted sounds by first language (L1) learners has not been widely studied compared with the consonant clusters in English with which they bear a close phonetic resemblance but have quite a different phonological status. This is a study to investigate the L1 acquisition process of the Japanese contracted sounds (a) in order to observe how the palatalization gesture is acquired in Japanese and (b) to investigate differences in the sound acquisition processes of first and second language (L2) learners: Japanese children compared with English learners. To do this, the productions of Japanese children ranging in age from 2.5 to 3.5 years were transcribed and the pattern of misproduction was observed.
Nishimura, Terumi; Murakami, Kentaro; Livingstone, M Barbara E; Sasaki, Satoshi; Uenishi, Kazuhiro
2015-08-28
While Japanese diets have attracted considerable attention because of, for example, the long-life expectancy in Japan, their health benefits have not been examined. In the present study, we cross-sectionally examined whether adherence to the food-based Japanese dietary guidelines is associated with metabolic risk factors in 1083 Japanese women aged 18-22 years. Based on the Japanese Food Guide Spinning Top, adherence to the food-based Japanese dietary guidelines was assessed using dietary information on consumed servings of grain dishes, vegetable dishes, fish and meat dishes, milk and fruits and energy from snacks and alcoholic beverages during the preceding month, which was derived from a comprehensive diet history questionnaire. Higher dietary adherence was associated with higher intakes of protein, carbohydrate, dietary fibre, Na, K and vitamin C, and lower intakes of total and saturated fat. There was also an inverse association between dietary adherence and dietary energy density. After adjustment for potential confounding factors, dietary adherence was inversely associated with waist circumference (P for trend = 0·002). It also showed an inverse association with LDL-cholesterol concentrations (P for trend = 0·04). There was no association with the other metabolic risk factors examined, including BMI, systolic and diastolic blood pressure, total and HDL-cholesterol, TAG, glucose, glycated Hb and insulin concentrations. In conclusion, higher adherence to the food-based Japanese dietary guidelines, which was characterised by favourable dietary intakes of foods and nutrients as well as lower energy density, was associated with lower waist circumference and LDL-cholesterol concentrations in this group of young Japanese women.
ERIC Educational Resources Information Center
Caudill, William; Frost, Lois
Previous studies have shown that American mothers, in contrast to Japanese, do more lively chatting to their babies, and that as a result, the American babies have a generally higher level of vocalization and, particularly, they respond with greater amounts of happy vocalization and gross motor activity than do Japanese babies. Thus, it appears…
Assessment of Nonnative Invasive Plants in the DOE Oak Ridge National Environmental Research Park
DOE Office of Scientific and Technical Information (OSTI.GOV)
Drake, S.J.
The Department of Energy (DOE) National Environmental Research Park at Oak Ridge, Tennessee, is composed of second-growth forest stands characteristic of much of the eastern deciduous forest of the Ridge and Valley Province of Tennessee. Human use of natural ecosystems in this region has facilitated the establishment of at least 167 nonnative, invasive plant species on the Research Park. Our objective was to assess the distribution, abundance, impact, and potential for control of the 18 most abundant invasive species on the Research Park. In 2000, field surveys were conducted of 16 management areas on the Research Park (14 Natural Areas,more » 1 Reference Area, and Walker Branch Watershed) and the Research Park as a whole to acquire qualitative and quantitative data on the distribution and abundance of these taxa. Data from the surveys were used to rank the relative importance of these species using the ''Alien Plant Ranking System, Version 5.1'' developed by the U.S. Geological Survey. Microstegium (Microstegium vimineum) was ranked highest, or most problematic, for the entire Research Park because of its potential impact on natural systems, its tendency to become a management problem, and how difficult it is to control. Microstegium was present in 12 of the 16 individual sites surveyed; when present, it consistently ranked as the most problematic invasive species, particularly in terms of its potential impact on natural systems. Japanese honeysuckle (Lonicera japonica) and Chinese privet (Ligustrum sinense) were the second- and third-most problematic plant species on the Research Park; these two species were present in 12 and 9 of the 16 sites surveyed, respectively, and often ranked second- or third-most problematic. Other nonnative, invasive species, in decreasing rank order, included kudzu (Pueraria montma), multiflora rose (Rosa multiflora), Chinese lespedeza (Lespedeza cuneara), and other species representing a variety of life forms and growth forms
Generational Differences in Japanese Attitudes toward Women's Employment.
ERIC Educational Resources Information Center
Engel, John W.
Traditional ideals discourage Japanese women from working outside the home. This study was conducted to explore generational differences in Japanese attitudes toward women's employment and to interpret those differences in terms of social change. Questionnaires were distributed to approximately 900 Japanese men and women. Subjects were classified…
Japanese International Business Communication: The Place of English.
ERIC Educational Resources Information Center
Hilton, Chadwick B.
1992-01-01
Examines the use of English in Japanese business communication. Finds that English is an important element of Japanese international business policy and that an awareness of both Japanese corporate commitment to employee English proficiency and of the complexities of the use of English for special purposes benefits business communicators involved…
Japanese Flagship Universities at a Crossroads
ERIC Educational Resources Information Center
Yonezawa, Akiyoshi
2007-01-01
The increasing pace and scope of global structural change has left Japanese flagship universities at a crossroads. Reflecting upon historical trends, current policy changes and respective institutional strategies for global marketing among Japanese top research universities, the author discusses possible future directions for these institutions…
Hotel Employees' Japanese Language Experiences: Implications and Suggestions.
ERIC Educational Resources Information Center
Makita-Discekici, Yasuko
1998-01-01
Analyzes the Japanese language learning experiences of 13 hotel employees in Guam. Results of the study present implications and suggestions for a Japanese language program for the hotel industry. The project began as a result of hotel employees frustrations when they were unable to communicate effectively with their Japanese guests. (Auth/JL)
Kagawa, Masaharu; Saito, Yoko; Kerr, Deborah; Uchida, Hayato; Binns, Colin W
2006-01-01
The aim of the study was to determine the nutritional status and nutrient intakes of young Japanese males living in Australia and compared with Japanese males living in Japan and Australian Caucasian males. Four-day dietary records were obtained from 65 Japanese living in Australia (JA), 81 Japanese living in Japan (JJ), and 70 Australian Caucasian males (AA) aged 18-30 years old, together with body composition and physical activity level assessments using anthropometry and the questionnaire. Australian males were significantly taller and heavier than the Japanese counterparts and also showed a greater percent body fat (%BF) and height-corrected sum of skinfolds compared with Japanese males living in Japan (%BF: JJ = 16.6 +/- 5.2, AA = 18.7 +/- 5.6; height corrected sum of skinfolds: JJ = 78.8 +/- 37.3, AA = 96.0 +/- 39.5) (P<0.05). A greater proportion of Australian Caucasian males (98.6%) were involved in vigorous physical exercise than Japanese males (JA = 72.3%; JJ = 85.2%). The JA group consumed a greater amount of energy from protein and fat sources as well as greater calcium, iron, dietary fibre and niacin equivalents intakes than the JJ group (P<0.05). The results suggest that Japanese males living in Australia consumed more energy-dense westernised diet than Japanese males living in Japan. Because of lower physical activity level than Australian males, consumption of energy-dense diet may increase the risk of weight gain among Japanese males who stay in Australia for a long-term.
The Sound Pattern of Japanese Surnames
ERIC Educational Resources Information Center
Tanaka, Yu
2017-01-01
Compound surnames in Japanese show complex phonological patterns, which pose challenges to current theories of phonology. This dissertation proposes an account of the segmental and prosodic issues in Japanese surnames and discusses their theoretical implications. Like regular compound words, compound surnames may undergo a sound alternation known…
Japanese Children's Understanding of Notational Systems
ERIC Educational Resources Information Center
Takahashi, Noboru
2012-01-01
This study examined Japanese children's understanding of two Japanese notational systems: "hiragana" and "kanji". In three experiments, 126 3- to 6-year-olds were asked to name words written in hiragana or kanji as they appeared with different pictures. Consistent with Bialystok ("Journal of Experimental Child…
Japanese Experiment Module arrival
2007-03-29
Several components for delivery to the International Space Station sit in test stands inside the Space Station Processing Facility highbay. To the right, from back to front, are the Japanese Experiment Module, the Raffaello multi-purpose logistics module, and the European Space Agency's Columbus scientific research module. To the left in front is the starboard truss segment S5. Behind it is the test stand that will hold the Experiment Logistics Module Pressurized Section for the Japanese Experiment Module. The logistics module is one of the components of the Japanese Experiment Module or JEM, also known as Kibo, which means "hope" in Japanese. Kibo comprises six components: two research facilities -- the Pressurized Module and Exposed Facility; a Logistics Module attached to each of them; a Remote Manipulator System; and an Inter-Orbit Communication System unit. Kibo also has a scientific airlock through which experiments are transferred and exposed to the external environment of space. Kibo is Japan's first human space facility and its primary contribution to the station. Kibo will enhance the unique research capabilities of the orbiting complex by providing an additional environment in which astronauts can conduct science experiments. The various components of JEM will be assembled in space over the course of three Space Shuttle missions. The first of those three missions, STS-123, will carry the Experiment Logistics Module Pressurized Section aboard the Space Shuttle Endeavour, targeted for launch in 2007.
Azuma, Koichiro; Curb, J David; Kadowaki, Takashi; Edmundowicz, Daniel; Kadowaki, Sayaka; Masaki, Kamal H; El-Saed, Aiman; Nishio, Yoshihiko; Seto, Todd B; Okamura, Tomonori; Cetinel, Cemal; Kadota, Aya; Sutton-Tyrrell, Kim; Miura, Katsuyuki; Evans, Rhobert W; Takamiya, Tomoko; Maegawa, Hiroshi; Miljkovic, Iva; Kuller, Lewis H; Ueshima, Hirotsugu; Kelley, David E; Sekikawa, Akira
2013-01-01
We recently reported that Japanese had higher liver fat at a lower level of BMI compared with non-Hispanic whites (NHW). We hypothesize that ethnic difference in fat storage capacity contributes to this ethnic difference in liver fat. To examine this, we assessed liver fat among 244 Japanese-American aged 40-49, using regional computed-tomography images, along with metabolic variables. Despite the similar BMI between Japanese-Americans and NHW men, Japanese-Americans had more liver fat (liver to spleen attenuation ratio: 1.03 ± 0.22 for Japanese-Americans, and 1.07 ± 0.15 for NHW men; p < 0.05) and tended to have a greater disposition for fatty liver with an increase in BMI than NHW, indicating a clear difference between the two groups. In addition, liver fat is less in Japanese-Americans compared with Japanese men (1.03 ± 0.22 vs. 1.01 ± 0.16; p < 0.05), despite of a much higher BMI. These ethnic differences support the hypothesis that higher fat storage capacity indeed seems to be associated with less liver fat. In all the groups, liver fat content strongly correlated with triglycerides, homeostasis model assessment-insulin resistance, and C-reactive protein (CRP). Nevertheless, these metabolic variables were worse in Japanese-Americans, despite of less liver fat, compared with Japanese. Moreover, CRP levels were least among Japanese with highest liver fat, and highest among NHW men with least liver fat, despite of a strong positive association between CRP and fatty liver within each population. Fat content in the liver is intermediate for Japanese-Americans compared with Japanese and NHW men, which supports the hypothesis of less fat storage capacity among Japanese, closely linked to ethnic difference in predisposition to fatty liver. © 2011 Asian Oceanian Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.
Japanese experiment module (JEM)
NASA Technical Reports Server (NTRS)
Kato, T.
1986-01-01
Japanese hardware elements studied during the definition phase of phase B are described. The hardware is called JEM (Japanese Experiment Module) and will be attached to the Space Station core. JEM consists of a pressurized module, an exposed facility, a scientific/equipment airlock, a local remote manipulator, and experimental logistic module. With all those hardware elements JEM will accommodate general scientific and technology development research (some of the elements are to utilize the advantage of the microgravity environment), and also accommodate control panels for the Space Station Mobile Remote Manipulator System and attached payloads.
Anthropometric differences in preschool children of Japanese ancestry in Lima, Peru.
Shimabuku, Roberto; Teruya, Alberto; Nakachi, Graciela
2009-08-01
Ethnic differences in the pattern and trend of growth and weight have been described in studies of migrant populations. Our objective was to compare anthropometric parameters and overweight prevalence in third and fourth generation Japanese descendant preschoolers within the Peruvian preschool population. A total of 337 measurements of height and weight from 284 children, three to five years of age, were taken over three years in one Japanese-Peruvian preschool center in Lima, Peru. The data of each parameter were classified into three ethnic groups according to their parents' surnames: Japanese descendant children (n = 104), with both parents with Japanese surnames; Japanese-Peruvian descendant (n = 93), one parent with a Japanese surname and one with a non-Japanese surname; and Peruvian descendant (n = 140), both parents with non-Japanese surnames. We used the National Center for Health Statistics (NCHS) 2000 growth charts as reference values to obtain centiles, Z scores, and body mass index (BMI). In boys, the three groups differed significantly in height, weight, BMI, Z scores, and overweight prevalence. Peruvian descendant boys were taller and heavier than Japanese-Peruvian and Japanese descendants. Moreover, Japanese-Peruvian descendant boys were taller and heavier than Japanese descendant boys. In girls, there were no significant differences in height and weight and in overweight prevalence among the three ethnic groups. Japanese descendants in Peru have height, weight and BMI values similar to those of Japanese children in Japan but lesser than Peruvian children. These findings may be related to differences in ethnic background.
Study on Japanese Cornmint in Mississippi
USDA-ARS?s Scientific Manuscript database
Japanese cornmint (Mentha canadensis L.) is a subtropical essential oil crop grown in Asia and South America. The essential oil of Japanese cornmint is the source for production of crystal (-)-menthol, which is a major aromatic agent used as a flavor, fragrance, and cooling sensation vector in the ...
Risk factors for coronary artery calcification in Japanese patients.
Shikada, Tomoki; Washio, Masakazu; Nishizaki, Akiko; Kakino, Takamori; Ooe, Kensuke; Ishibashi, Yuuji; Sagara, Shuuichirou; Morishige, Kunio; Tashiro, Hideki
2015-07-01
Because the prevalence of coronary artery calcification is lower among Japanese than among Western individuals, aspects of the Japanese lifestyle might be related to the development of calcification. We aimed to clarify the relationship between coronary artery calcium scores in Japanese patients and various lifestyle factors among the Japanese population. Study subjects were patients aged ≥20 years who underwent multidetector-row computed tomography. A total of 201 patients agreed to take part in this study and answered a questionnaire regarding lifestyle, medical history, and other factors. Old age, current and former smoking, sedentary work, short sleep time, coronary artery stenosis, treatment with statins, medical history of cerebrovascular disease, medical history of angina pectoris, medical history of ischemic heart disease, and medical history of dyslipidemia were associated with higher odds ratios than the other factors examined, while the Japanese-style breakfast (e.g. boiled rice, miso soup, grilled fish) was associated with lower odds ratios. In this study, smoking, sedentary work, short sleep time, and the Japanese-style breakfast were lifestyle factors related to coronary artery calcification. The lifestyle of Japanese people may be related to coronary calcification. Copyright © 2014 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.
Chen, Zexiong; Tang, Ning; You, Yuming; Lan, Jianbin; Liu, Yiqing; Li, Zhengguo
2015-01-01
Lonicera macranthoides Hand.-Mazz (L. macranthoides) is a medicinal herb that is widely distributed in southern China. The biosynthetic and metabolic pathways for a core secondary metabolite in L. macranthoides, chlorogenic acid (CGA), have been elucidated in many species. However, the mechanisms of CGA biosynthesis and the related gene regulatory network in L. macranthoides are still not well understood. In this study, CGA content was quantified by high performance liquid chromatography (HPLC), and CGA levels differed significantly among three tissues; specifically, the CGA content in young leaves (YL) was greater than that in young stems (YS), which was greater than that in mature flowers (MF). Transcriptome analysis of L. macranthoides yielded a total of 53,533,014 clean reads (average length 90 bp) and 76,453 unigenes (average length 703 bp). A total of 3,767 unigenes were involved in biosynthesis pathways of secondary metabolites. Of these unigenes, 80 were possibly related to CGA biosynthesis. Furthermore, differentially expressed genes (DEGs) were screened in different tissues including YL, MF and YS. In these tissues, 24 DEGs were found to be associated with CGA biosynthesis, including six phenylalanine ammonia lyase (PAL) genes, six 4-coumarate coenzyme A ligase (4CL) genes, four cinnamate 4-Hydroxylase (C4H) genes, seven hydroxycinnamoyl transferase/hydroxycinnamoyl-CoA quinate transferase HCT/HQT genes and one coumarate 3-hydroxylase (C3H) gene.These results further the understanding of CGA biosynthesis and the related regulatory network in L. macranthoides. PMID:26381882
Are Australian Fans of Anime and Manga Motivated to Learn Japanese Language?
ERIC Educational Resources Information Center
Armour, William S.; Iida, Sumiko
2016-01-01
Recent research into Japanese as a foreign language education has strongly emphasized the link between Japanese popular culture and learning Japanese. However, these studies have only targeted Japanese language learners in formal education contexts and have largely ignored those who are not studying Japanese or studying Japanese informally. This…
Japanese encephalitis in a French traveler to Nepal.
Lagarde, S; Lagier, J-C; Charrel, R; Quérat, G; Vanhomwegen, J; Desprès, P; Pelletier, J; Kaphan, E
2014-02-01
Japanese encephalitis is frequent in Asia, with a severe prognosis, but rare in travelers. Culex mosquitoes transmit Japanese encephalitis virus. Risk factors are destination, duration of stay, summer and fall seasons, outdoor activities, and type of accommodation. We report the case of a French traveler to Nepal with neutralization-based serological confirmed Japanese encephalitis. He presented classical clinical (viral syndrome before an encephalitis status with behavioral disorder, global hypotonia, mutism, movement disorders, seizure, and coma), radiological (lesions of thalami, cortico-spinal tracts, and brainstem) and biological features (lymphocytic meningitis). Nowadays, the presence of Japanese encephalitis virus in Nepal, including mountain areas, is established but Japanese encephalitis remains rare in travelers returning from this area and neurologist physicians need to become familiar with this. We recommend vaccination for travelers spending a long period of time in Nepal and having at-risk outdoor activities.
Japanese Moral Education Past and Present.
ERIC Educational Resources Information Center
Khan, Yoshimitsu
For generations, moral development has been both a conscious aim and a formal process in Japanese education. This book investigates the history and development of Japanese moral education and analyzes and compares current moral education with the concepts of the Imperial Rescript on Education (1890) and the "shushin" moral education of…
The Strategies Used in Japanese Advertisement.
ERIC Educational Resources Information Center
Kurose, Yuki
This paper investigates the possibility of using Japanese advertising language as a teaching tool in the second language classroom. First, it reviews the aims of advertising and the advantages of learning advertising language in the classroom based on previous research. Next, it discusses language strategies used in Japanese advertising,…
Numeral Incorporation in Japanese Sign Language
ERIC Educational Resources Information Center
Ktejik, Mish
2013-01-01
This article explores the morphological process of numeral incorporation in Japanese Sign Language. Numeral incorporation is defined and the available research on numeral incorporation in signed language is discussed. The numeral signs in Japanese Sign Language are then introduced and followed by an explanation of the numeral morphemes which are…
Intercultural Orientations as Japanese Language Learners' Motivation in Mainland China
ERIC Educational Resources Information Center
Lv, Leining; Gao, Xuesong; Teo, Timothy
2017-01-01
This article reports on a study that investigated how 665 Japanese language learners, who had started learning Japanese at different times in the last 3 decades, had been motivated to learn Japanese in China. Analysis of the survey data revealed that the participants displayed similar intercultural orientations when learning Japanese despite the…
Japanese Experiment Module arrival
2007-03-29
The Experiment Logistics Module Pressurized Section for the Japanese Experiment Module arrives at the Space Station Processing Facility. The logistics module is one of the components of the Japanese Experiment Module or JEM, also known as Kibo, which means "hope" in Japanese. Kibo comprises six components: two research facilities -- the Pressurized Module and Exposed Facility; a Logistics Module attached to each of them; a Remote Manipulator System; and an Inter-Orbit Communication System unit. Kibo also has a scientific airlock through which experiments are transferred and exposed to the external environment of space. Kibo is Japan's first human space facility and its primary contribution to the station. Kibo will enhance the unique research capabilities of the orbiting complex by providing an additional environment in which astronauts can conduct science experiments. The various components of JEM will be assembled in space over the course of three Space Shuttle missions. The first of those three missions, STS-123, will carry the Experiment Logistics Module Pressurized Section aboard the Space Shuttle Endeavour, targeted for launch in 2007.
Japanese Experiment Module arrival
2007-03-29
Inside the Space Station Processing Facility, the Experiment Logistics Module Pressurized Section for the Japanese Experiment Module is revealed after the top of the crate is removed. The logistics module is one of the components of the Japanese Experiment Module or JEM, also known as Kibo, which means "hope" in Japanese. Kibo comprises six components: two research facilities -- the Pressurized Module and Exposed Facility; a Logistics Module attached to each of them; a Remote Manipulator System; and an Inter-Orbit Communication System unit. Kibo also has a scientific airlock through which experiments are transferred and exposed to the external environment of space. Kibo is Japan's first human space facility and its primary contribution to the station. Kibo will enhance the unique research capabilities of the orbiting complex by providing an additional environment in which astronauts can conduct science experiments. The various components of JEM will be assembled in space over the course of three Space Shuttle missions. The first of those three missions, STS-123, will carry the Experiment Logistics Module Pressurized Section aboard the Space Shuttle Endeavour, targeted for launch in 2007.
Japanese Experiment Module arrival
2007-03-29
The Experiment Logistics Module Pressurized Section for the Japanese Experiment Module arrives at the Space Station Processing Facility for uncrating. The logistics module is one of the components of the Japanese Experiment Module or JEM, also known as Kibo, which means "hope" in Japanese. Kibo comprises six components: two research facilities -- the Pressurized Module and Exposed Facility; a Logistics Module attached to each of them; a Remote Manipulator System; and an Inter-Orbit Communication System unit. Kibo also has a scientific airlock through which experiments are transferred and exposed to the external environment of space. Kibo is Japan's first human space facility and its primary contribution to the station. Kibo will enhance the unique research capabilities of the orbiting complex by providing an additional environment in which astronauts can conduct science experiments. The various components of JEM will be assembled in space over the course of three Space Shuttle missions. The first of those three missions, STS-123, will carry the Experiment Logistics Module Pressurized Section aboard the Space Shuttle Endeavour, targeted for launch in 2007.
Japanese Suffixal Accentuation and Lexical Phonology.
ERIC Educational Resources Information Center
Tsujimura, Natsuko
A study examined the applicability of the Ordering Hypothesis to Japanese suffixes. The hypothesis, which claims that affixes that trigger phonological rules (cyclical affixes) do not appear external to affixes that do not, is found to be an inappropriate assumption in Japanese. Examples in English and Chamorro support this finding. It is…
Japanese-Style Management: A Bibliometric Study.
ERIC Educational Resources Information Center
Noguchi, Sachie
1988-01-01
Reports results of a bibliometric study of the literature on Japanese-style management published in western languages from 1971-84 in order to: (1) determine Japanese contributions to the literature; (2) determine whether there are nuclear journals for the subject; and (3) investigate how the flow of information from Japan to overseas countries…
Metabolic syndrome in overweight and obese Japanese children.
Yoshinaga, Masao; Tanaka, Satoru; Shimago, Atsushi; Sameshima, Koji; Nishi, Junichiro; Nomura, Yuichi; Kawano, Yoshifumi; Hashiguchi, Jun; Ichiki, Takeo; Shimizu, Shinichiro
2005-07-01
To determine the prevalence of and sex differences related to the metabolic syndrome among obese and overweight elementary school children. Subjects were 471 overweight or obese Japanese children. Children meeting at least three of the following five criteria qualified as having the metabolic syndrome: abdominal obesity, elevated blood pressure, low high-density lipoprotein-cholesterol levels, high triglyceride levels, and high fasting glucose levels. Fasting insulin levels were also examined. Japanese obese children were found to have a significantly lower prevalence (17.7%) of the metabolic syndrome than U.S. obese adolescents (28.7%, p = 0.0014). However, Japanese overweight children had a similar incidence (8.7%) of the metabolic syndrome compared with U.S. overweight adolescents (6.8%). Hyperinsulinemia in girls and abdominal obesity in boys are characteristic features of individual metabolic syndrome factors in Japanese children. The prevalence of the metabolic syndrome is not lower in preteen Japanese overweight children than in U.S. overweight adolescents, although it is significantly lower in Japanese obese preteen children than in U.S. obese adolescents. Primary and secondary interventions are needed for overweight preteen children in Japan.
Domingos, João Américo; Soares, Luana Silva; Bandeira, Larissa M; Bonin, Camila Mareti; Vicente, Ana C P; Zanella, Louise; Puga, Marco Antonio Moreira; Tozetti, Inês Aparecida; Motta-Castro, Ana Rita Coimbra; da Cunha, Rivaldo Venâncio
2017-01-01
The lifetime risk of HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) development differs among ethnic groups. To better understand these differences, this prospective cohort study was conducted to investigate the cytokine profile and the HTLV-1 proviral load (PVL) in Japanese and non-Japanese populations with HAM/TSP and asymptomatic carriers (ACs). The serum IL-2, IL-4, IL-6, IL-10, IL-17, TNF-α, and IFN-γ levels were quantified using the Cytometric Bead Array in 40 HTLV-1-infected patients (11 HAM/TSP and 29 ACs) and 18 healthy controls (HCs) in Brazil. Among ACs, 15 were Japanese descendants and 14 were non-Japanese. Of 11 patients with HAM/TSP, only one was a Japanese descendant. The HTLV-1 PVL was quantified by real-time PCR. The HTLV-1 PVL was 2.7-fold higher in HAM/TSP patients than ACs. Regardless of the clinical outcome, the PVL was significantly higher in patients younger than 60 years than older patients. The HAM/TSP and ACs had higher IL-10 serum concentrations than that of HCs. The ACs also showed higher IL-6 serum levels than those of HCs. According to age, the IL-10 and IL-6 levels were higher in ACs non-Japanese patients older than 60 years. HAM/TSP patients showed a positive correlation between IL-6 and IL-17 and a negative correlation between the PVL and IL-17 and IFN-γ. In the all ACs, a significant positive correlation was observed between IL-2 and IL-17 and a negative correlation was detected between IL-10 and TNF-α. Only 6.25% of the Japanese patients were symptomatic carriers, compared with 41.67% of the non-Japanese patients. In conclusion, this study showed that high levels of HTLV-1 PVL was intrinsicaly associated with the development of HAM/TSP. A higher HTLV-1 PVL and IL10 levels found in non-Japanese ACs over 60 years old, which compared with the Japanese group depicts that the ethnic background may interfere in the host immune status. More researches also need to be undertaken regarding the host genetic
Domingos, João Américo; Soares, Luana Silva; Bandeira, Larissa M.; Bonin, Camila Mareti; Vicente, Ana C. P.; Zanella, Louise; Puga, Marco Antonio Moreira; Tozetti, Inês Aparecida; Motta-Castro, Ana Rita Coimbra; da Cunha, Rivaldo Venâncio
2017-01-01
The lifetime risk of HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) development differs among ethnic groups. To better understand these differences, this prospective cohort study was conducted to investigate the cytokine profile and the HTLV-1 proviral load (PVL) in Japanese and non-Japanese populations with HAM/TSP and asymptomatic carriers (ACs). The serum IL-2, IL-4, IL-6, IL-10, IL-17, TNF-α, and IFN-γ levels were quantified using the Cytometric Bead Array in 40 HTLV-1-infected patients (11 HAM/TSP and 29 ACs) and 18 healthy controls (HCs) in Brazil. Among ACs, 15 were Japanese descendants and 14 were non-Japanese. Of 11 patients with HAM/TSP, only one was a Japanese descendant. The HTLV-1 PVL was quantified by real-time PCR. The HTLV-1 PVL was 2.7-fold higher in HAM/TSP patients than ACs. Regardless of the clinical outcome, the PVL was significantly higher in patients younger than 60 years than older patients. The HAM/TSP and ACs had higher IL-10 serum concentrations than that of HCs. The ACs also showed higher IL-6 serum levels than those of HCs. According to age, the IL-10 and IL-6 levels were higher in ACs non-Japanese patients older than 60 years. HAM/TSP patients showed a positive correlation between IL-6 and IL-17 and a negative correlation between the PVL and IL-17 and IFN-γ. In the all ACs, a significant positive correlation was observed between IL-2 and IL-17 and a negative correlation was detected between IL-10 and TNF-α. Only 6.25% of the Japanese patients were symptomatic carriers, compared with 41.67% of the non-Japanese patients. In conclusion, this study showed that high levels of HTLV-1 PVL was intrinsicaly associated with the development of HAM/TSP. A higher HTLV-1 PVL and IL10 levels found in non-Japanese ACs over 60 years old, which compared with the Japanese group depicts that the ethnic background may interfere in the host immune status. More researches also need to be undertaken regarding the host genetic
Yun, Sang-Im; Lee, Young-Min
2014-01-01
Japanese encephalitis (JE) is an infectious disease of the central nervous system caused by Japanese encephalitis virus (JEV), a zoonotic mosquito-borne flavivirus. JEV is prevalent in much of Asia and the Western Pacific, with over 4 billion people living at risk of infection. In the absence of antiviral intervention, vaccination is the only strategy to develop long-term sustainable protection against JEV infection. Over the past half-century, a mouse brain-derived inactivated vaccine has been used internationally for active immunization. To date, however, JEV is still a clinically important, emerging, and re-emerging human pathogen of global significance. In recent years, production of the mouse brain-derived vaccine has been discontinued, but 3 new cell culture-derived vaccines are available in various parts of the world. Here we review current aspects of JEV biology, summarize the 4 types of JEV vaccine, and discuss the potential of an infectious JEV cDNA technology for future vaccine development. PMID:24161909
Acoustic Sources of Accent in Second Language Japanese Speech.
Idemaru, Kaori; Wei, Peipei; Gubbins, Lucy
2018-05-01
This study reports an exploratory analysis of the acoustic characteristics of second language (L2) speech which give rise to the perception of a foreign accent. Japanese speech samples were collected from American English and Mandarin Chinese speakers ( n = 16 in each group) studying Japanese. The L2 participants and native speakers ( n = 10) provided speech samples modeling after six short sentences. Segmental (vowels and stops) and prosodic features (rhythm, tone, and fluency) were examined. Native Japanese listeners ( n = 10) rated the samples with regard to degrees of foreign accent. The analyses predicting accent ratings based on the acoustic measurements indicated that one of the prosodic features in particular, tone (defined as high and low patterns of pitch accent and intonation in this study), plays an important role in robustly predicting accent rating in L2 Japanese across the two first language (L1) backgrounds. These results were consistent with the prediction based on phonological and phonetic comparisons between Japanese and English, as well as Japanese and Mandarin Chinese. The results also revealed L1-specific predictors of perceived accent in Japanese. The findings of this study contribute to the growing literature that examines sources of perceived foreign accent.
Business Japanese, a HyperCard Simulation.
ERIC Educational Resources Information Center
Saito-Abbott, Yoshiko; Abbott, Thomas
This paper describes Business Japanese (BJ), a HyperCard based tutorial designed as courseware for use in a third-year Japanese course at the University of Texas, Austin (UTA). A major objective was to develop good courseware based on proven language learning theory that would integrate theory, practice, and technology. BJ stresses a realistic and…
Adult perceptions of phonotactic violations in Japanese
NASA Astrophysics Data System (ADS)
Fais, Laurel; Kajikawa, Sachiyo; Werker, Janet; Amano, Shigeaki
2004-05-01
Adult Japanese speakers ``hear'' epenthetic vowels in productions of Japanese-like words that violate the canonical CVCVCV form by containing internal consonant clusters (CVCCV) [Dupoux et al., J. Exp. Psychol. 25, 1568-1578 (1999)]. Given this finding, this research examined how Japanese adults rated the goodness of Japanese-like words produced without a vowel in the final syllable (CVC), and words produced without vowels in the penultimate and final syllables (CVCC). Furthermore, in some of these contexts, voiceless vowels may appear in fluent, casual Japanese productions, especially in the Kanto dialect, and in some, such voiceless vowels may not appear. Results indicate that both Kanto and Kinki speakers rated CVC productions for contexts in which voiceless vowels are not allowed as the worst; they rated CVC and CVCC contexts in which voiceless vowel productions are allowed as better. In these latter contexts, the CVC words, which result from the loss of one, final, vowel, are judged to be better than the CVCC words, which result from the loss of two (final and penultimate) vowels. These results mirror the relative seriousness of the phonotactic violations and indicate listeners have tacit knowledge of these regularities in their language.
[Emotional display rules of Japanese and Koreans].
Lee, Ye-jin; Matsumoto, Yoshiyuki
2011-12-01
Hypothetical stories designed to arouse feelings of happiness, sadness, or anger were presented to Japanese (n = 310) and Koreans (n = 286) university students. They were asked to rate the intensity of the emotion experienced, and to select the corresponding facial expression to display in an individual situation and in a social situation. Analyses of covariance were conducted on the rating scores of facial expression using the intensities of emotion as the covariance, except for happiness where the within-class regression coefficients were not homogeneous. The results showed that Japanese and Koreans shared the emotional display rules about the expressions of emotions in individual situations more than in social situations. Japanese thought that they should suppress emotions more than Koreans did. Moreover, the differences in facial expressions between Japanese and Koreans were greater in the individual situations than in the social situations.
1990-06-01
baseline knowledge of the 6 0L aa Y.S 00 evolution of Japanese Defense Policy focused on major defense-policy agreements and issues. The baseline...bilaterally with their Japanese counterparts. (Japanese soldiers stationed in northern Japan are excellent military skiers .) U.S. soldiers who receive...other cases, interviewees had knowledge and expertise regarding the evolution of bilateral exercises and negotiations necessary to initiate bilateral
Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G
2017-07-19
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.
Japanese Robotic SFA during Expedition 22
2010-03-10
ISS022-E-089764 (10 March 2010) --- Looking through the Kibo airlock, the Japanese robotic Small Fine Arm (SFA), also known as ?Ko-bot?, is featured in this image photographed by an Expedition 22 crew member in the Kibo laboratory of the International Space Station during its installation on the external Japanese Experiment Module - Exposed Facility.
[Evaluation of "Japanese Journal of Psychology" using citation analysis].
Kato, Tsukasa; Baba, Mamiko; Tabata, Naoya; Shimoda, Shunsuke; Fukuda, Mildki; Okubo, Nobutoshi
2013-06-01
This study investigated the professional impact of "Japanese Journal of Psychology." Thirty four psychological journals written in Japanese were selected to register articles in a new database. This database included approximately 23,900 articles published through 2010. Using citations extracted from the references and footnotes in these scholarly journals, the Psychology Citation Index for Japanese Papers was created. The citation impact factors in Japanese psychology was determined on the basis of the number of times a journal was cited, cumulative impact factors, and the cited half-life of the journal; five years was a valid period for impact factor of psychological journals in Japan. The changes in the 5-year impact factors of "Japanese Journal of Psychology" were reviewed by comparing it with other journals.
Crane, Paul K; Gruhl, Jonathan C; Erosheva, Elena A; Gibbons, Laura E; McCurry, Susan M; Rhoads, Kristoffer; Nguyen, Viet; Arani, Keerthi; Masaki, Kamal; White, Lon
2010-11-01
Spoken bilingualism may be associated with cognitive reserve. Mastering a complicated written language may be associated with additional reserve. We sought to determine if midlife use of spoken and written Japanese was associated with lower rates of late life cognitive decline. Participants were second-generation Japanese-American men from the Hawaiian island of Oahu, born 1900-1919, free of dementia in 1991, and categorized based on midlife self-reported use of spoken and written Japanese (total n included in primary analysis = 2,520). Cognitive functioning was measured with the Cognitive Abilities Screening Instrument scored using item response theory. We used mixed effects models, controlling for age, income, education, smoking status, apolipoprotein E e4 alleles, and number of study visits. Rates of cognitive decline were not related to use of spoken or written Japanese. This finding was consistent across numerous sensitivity analyses. We did not find evidence to support the hypothesis that multilingualism is associated with cognitive reserve.
Shiraishi, Takeshi; Okada, Yoshinori; Sekine, Yasuo; Chida, Masayuki; Bando, Toru; Minami, Masato; Oto, Takahiro; Nagayasu, Takeshi; Date, Hiroshi; Kondo, Takashi
2009-08-01
The year 2008 marked the 10th anniversary of the Japanese lung transplantation program started in accordance with the Japanese Organ Transplant Law, which took effect in 1997. A total of 105 lung transplantations, including 39 deceased-donor transplants and 66 living-related transplants, had been performed as of the end of 2007. This article is the 2008 official report of the Japanese Society of Lung and Heart-Lung Transplantation. It summarizes the data for clinical lung transplantation during the period 1998-2007 and discusses the current status of Japanese lung transplantation. The overall 5-year survival rate was 67.0%: including 53.4% and 74.6% for deceased-donor lung transplantation and living-donor lobar lung transplantation groups, respectively. The total operation-related and 1-month mortality rates after surgery were 3.8% and 10.4%, respectively. These data are better, or at least acceptable, in comparison with the international registry data.
Gruhl, Jonathan C.; Erosheva, Elena A.; Gibbons, Laura E.; McCurry, Susan M.; Rhoads, Kristoffer; Nguyen, Viet; Arani, Keerthi; Masaki, Kamal; White, Lon
2010-01-01
Objectives. Spoken bilingualism may be associated with cognitive reserve. Mastering a complicated written language may be associated with additional reserve. We sought to determine if midlife use of spoken and written Japanese was associated with lower rates of late life cognitive decline. Methods. Participants were second-generation Japanese-American men from the Hawaiian island of Oahu, born 1900–1919, free of dementia in 1991, and categorized based on midlife self-reported use of spoken and written Japanese (total n included in primary analysis = 2,520). Cognitive functioning was measured with the Cognitive Abilities Screening Instrument scored using item response theory. We used mixed effects models, controlling for age, income, education, smoking status, apolipoprotein E e4 alleles, and number of study visits. Results. Rates of cognitive decline were not related to use of spoken or written Japanese. This finding was consistent across numerous sensitivity analyses. Discussion. We did not find evidence to support the hypothesis that multilingualism is associated with cognitive reserve. PMID:20639282
Education for International Understanding in Japanese Schools.
ERIC Educational Resources Information Center
Sato, Teruo
1979-01-01
Describes the evolution and current status of education for international understanding within the Japanese school system. Topics discussed include the UNESCO associated schools, Japanese schools overseas, experimental schools for students who have returned from abroad, curricula, and objectives by grade level. (DB)
Nucleotide sequences of Japanese isolates of citrus vein enation virus.
Nakazono-Nagaoka, Eiko; Fujikawa, Takashi; Iwanami, Toru
2017-03-01
The genomic sequences of five Japanese isolates of citrus vein enation virus (CVEV) isolates that induce vein enation were determined and compared with that of the Spanish isolate VE-1. The nucleotide sequences of all Japanese isolates were 5,983 nt in length. The genomic RNA of Japanese isolates had five potential open reading frames (ORF 0, ORF 1, ORF 2, ORF 3, and ORF 5) in the positive-sense strand. The nucleotide sequence identity among the Japanese isolates and Spanish isolate VE-1 ranged from 98.0% to 99.8%. Comparison of the partial amino acid sequences of ten Japanese isolates and three Spanish isolates suggested that four amino acid residues, at positions of 83, 104, and 113 in ORF 2 and position 41 in ORF 5, might be unique to some Japanese isolates.
Regional Classification of Traditional Japanese Folk Songs
NASA Astrophysics Data System (ADS)
Kawase, Akihiro; Tokosumi, Akifumi
In this study, we focus on the melodies of Japanese folk songs, and examine the basic structures of Japanese folk songs that represent the characteristics of different regions. We sample the five largest song genres within the music corpora of the Nihon Min-yo Taikan (Anthology of Japanese Folk Songs), consisting of 202,246 tones from 1,794 song pieces from 45 prefectures in Japan. Then, we calculate the probabilities of 24 transition patterns that fill the interval of the perfect fourth pitch, which is the interval that maintains most of the frequency for one-step and two-step pitch transitions within 11 regions, in order to determine the parameters for cluster analysis. As a result, we successively classify the regions into two basic groups, eastern Japan and western Japan, which corresponds to geographical factors and cultural backgrounds, and also match accent distributions in the Japanese language.
Offers and Requests: Performance by Japanese Learners of English.
ERIC Educational Resources Information Center
Fukushima, Saeko
1990-01-01
A comparison of native and nonnative (Japanese) English speakers' expressions for offers and requests found that Japanese subjects were typically too direct in most situations and sounded rude, even when they intended to be polite. This suggests that the pragmatic competence of Japanese learners of English needs to be reinforced in language…
The Japanese Automobile Worker: A Microcosm of Japan's Success.
ERIC Educational Resources Information Center
Kaderabeck, Elizabeth A.
A teaching unit on the Japanese automobile worker was developed from a compilation of on-site interviews with Japanese company managers and production line employees, and official publications of the Japanese car industry. The unit is designed to present a balanced picture of Japan's economic success and labor relations and to develop global…
Zhou, M; Ye, J
2017-11-28
Japanese physicians of Edo Period (1603-1867) wrote many dietetic books, by combining the knowledge system (content and compiling style) and thoughts of diet therapy from China with local condition in Japan. Among them, the Pao chu bei yong wo ming ben cao ( Japanese Materia Medica Prepared for Kitchen ), written by Mukai Genshou, a physician in the early Edo, is the earliest comprehensive work of dietetic materia medica. In this book, the choice and usage of Japanese dietetic materia medica reveals obvious Japanese local color, including the name, morphology, cultivation, collection, identification, nature and flavor, and indication etc., reflecting the sprouting idea of edible herbal plant at the beginning of Edo period and the characteristic of absorbing Chinese diet thoughts by Japanese physician. This is the important first-hand historical material to understand the development of Japanese dietetic herbalism in early Edo and its dietotherapy culture.
The Japanese and the American First-Line Supervisor.
ERIC Educational Resources Information Center
Bryan, Leslie A., Jr.
1982-01-01
Compares the American and Japanese first-line supervisor: production statistics, supervisory style, company loyalty, management style, and communication. Also suggests what Americans might learn from the Japanese methods. (CT)
Japanese Experiment Module arrival
2007-03-29
Inside the Space Station Processing Facility, workers monitor progress as a huge crane is used to remove the top of the crate carrying the Experiment Logistics Module Pressurized Section for the Japanese Experiment Module. The logistics module is one of the components of the Japanese Experiment Module or JEM, also known as Kibo, which means "hope" in Japanese. Kibo comprises six components: two research facilities -- the Pressurized Module and Exposed Facility; a Logistics Module attached to each of them; a Remote Manipulator System; and an Inter-Orbit Communication System unit. Kibo also has a scientific airlock through which experiments are transferred and exposed to the external environment of space. Kibo is Japan's first human space facility and its primary contribution to the station. Kibo will enhance the unique research capabilities of the orbiting complex by providing an additional environment in which astronauts can conduct science experiments. The various components of JEM will be assembled in space over the course of three Space Shuttle missions. The first of those three missions, STS-123, will carry the Experiment Logistics Module Pressurized Section aboard the Space Shuttle Endeavour, targeted for launch in 2007.
Standardisation of the Japanese diet for use in animal experiments.
Sugawara, Saeko; Mizowaki, Yui; Iwagaki, Yui; Sakamoto, Yu; Yamamoto, Kazushi; Tsuduki, Tsuyoshi
2017-11-01
The aim of this study was to develop a purified diet that mimics the characteristics of the Japanese diet using readily available materials with a simpler composition and a focus on quality, with the goal of facilitating performance of studies on the Japanese diet worldwide. The utility of the new diet was examined as a mimic of the standard Japanese diet for use in animal experiments. We examined whether a key characteristic of the Japanese diet of being less likely to cause obesity could be reproduced. The mimic diet had a balance of protein, fat and carbohydrate based on the 1975 Japanese diet, which is the least likely to cause obesity, and materials chosen with reference to the National Health and Nutrition Survey (NHNS). To examine similarities of the mimic diet with the model 1975 Japanese diet, we created a menu of the 1975 diet based on the NHNS and prepared the freeze-dried and powdered diet. The mimic diet, the 1975 Japanese diet, a control AIN-93G diet and a Western diet were fed to mice for 4 weeks. As a result, the mimic diet and the 1975 diet resulted in less accumulation of visceral fat and liver fat. Mice given these two diets showed similar effects. This indicates that the mimic diet used in this study has characteristics of the 1975 Japanese diet and could be used as a standard Japanese diet in animal experiments.
Aoyagi, Kiyoshi; Ross, Philip D; Nevitt, Michael C; Davis, James W; Wasnich, Richard D; Hayashi, Takuo; Takemoto, Tai-ichiro
2001-01-01
Background Japanese (both in Japan and Hawaii) have a lower incidence of falls and of hip fracture than North American and European Caucasians, but the reasons for these differences are not clear. Subjects and Methods A cross-sectional study. We compared neuromuscular risk factors for falls using performance-based measures (chair stand time, usual and rapid walking speed, and grip strength) among 163 Japanese women in Japan, 681 Japanese-American women in Hawaii and 9403 Caucasian women in the United States aged 65 years and over. Results After adjusting for age, the Caucasian women required about 40% more time to complete 5 chair stands than either group of Japanese. Walking speed was about 10% slower among Caucasians than native Japanese, whereas Japanese-American women in Hawaii walked about 11% faster than native Japanese. Grip strength was greatest in Japan, which may reflect the rural farming district that this sample was drawn from. Additional adjustment for height, weight or body mass index increased the adjusted means of chair stand time and grip strength among Japanese, but the differences remained significant. Conclusions Both native Japanese and Japanese-American women in Hawaii performed better than Caucasians on chair stand time and walking speed tests, and native Japanese had greater grip strength than Japanese in Hawaii and Caucasians. The biological implications of these differences in performance are uncertain, but may be useful in planning future comparisons between populations. PMID:11696243
Subarashii: Encounters in Japanese Spoken Language Education.
ERIC Educational Resources Information Center
Bernstein, Jared; Najmi, Amir; Ehsani, Farzad
1999-01-01
Describes Subarashii, an experimental computer-based interactive spoken-language education system designed to understand what a student is saying in Japanese and respond in a meaningful way in spoken Japanese. Implementation of a preprototype version of the Subarashii system identified strengths and limitations of continuous speech recognition…
Connective Choice between Native and Japanese Speakers.
ERIC Educational Resources Information Center
Tabuki, Masatoshi; Shimatani, Hiroshi
A study investigated the use of connectors in English conversation between native Japanese-speakers and teachers outside the classroom. Data were drawn from six videotaped conversations between pairs of Japanese students, all learning beginning-level English, with conversational support provided by English teachers. The functions of four…
Japanese Educational Patterns in Science and Engineering
ERIC Educational Resources Information Center
Birnbaum, Henry
1973-01-01
Describes the Japanese educational system, and outlines some of the obstacles faced by students in progressing through successive levels from elementary school to university. Emphasizes undergraduate education, especially in science and engineering. The organization of the Japanese school system is schematically presented in a diagram. (JR)
NASA Astrophysics Data System (ADS)
Tateishi, Makiko; Xiang, Yang; Matsuda, Hiroki; Saito, Takami; Sun, Haotian; Otsuki, Kyoichi; Kasahara, Tamao; Onda, Yuichi
2014-05-01
Water source area of Japan is often covered by forest, and 40 % of forest cover is coniferous plantation. Thinning has become a major tool in the management of plantation in recent years, but its effects on water cycle and its components are yet to be evaluated well. In this study, we investigated the changes in evapotranspiration and its components, including stand transpiration and canopy interception loss, after thinning in 50 years old Japanese cedar and Japanese cypress plantation at Yayama experimental catchment in Fukuoka, Japan. We established study plot in each Japanese cedar and Japanese cypress stand. Sap flow measurement was conducted for evaluating stand transpiration in each plot. Through fall and stem flow were also monitored to estimate canopy interception loss. The experiments were conducted over two years. During the measurements, 50 % of trees were thinned randomly in entire catchment, which has an area of 2.98 ha. Stem density was changed from 3945 to 1977 trees per ha after thinning. The reduction of daily stand transpiration in the studied Japanese cedar and cypress stands after thinning were 31.6 % and 48.2 % under the same condition of microclimate, respectively. These values were comparable to the changes in total sapwood area, 34.2 % and 44.5 %, and sap flow density did not change after thinning. It implies that sapwood area is a primary determinant of stand transpiration. Canopy interception ratios were 27 % and 26 % for Japanese cedar and cypress before thinning, and the ratios decreased to 24 % and 21 % after thinning, respectively. Thus, we obtained the changes in annual evapotranspiration and its components at catchment scale by using observation and models. The changes in partitioning of evapotranspiration is also discussed. The evapotranspiration before and after thinning were also compared to water balance data in this study site.
Bilingual Dual Coding in Japanese Returnee Students.
ERIC Educational Resources Information Center
Taura, Hideyuki
1998-01-01
Investigates effects of second-language acquisition age, length of exposure to the second language, and Japanese language specificity on the bilingual dual coding hypothesis proposed by Paivio and Desrochers (1980). Balanced Japanese-English bilingual returnee (having resided in an English-speaking country) subjects were presented with pictures to…
Genetic researches on growth traits of Japanese quail
NASA Astrophysics Data System (ADS)
Atalay, Sertaç
2017-04-01
The main objective of the poultry industry is to increase genetic capacity of animals. Growth is one of the most important economic trait in poultry production. Thus, to obtain genetically superior animals related to growth traits is one of the most important issues of poultry breeding programs. Japanese quail is one of the most productive animals in poultry species. Although Japanese quail is small body size, It has high meat and egg production yield. Japanese quail has also important breeding advantages such as short time generation interval, capacity to have a great number of birds per unit area, great reproductive performance, high resistance to diseases and low breeding cost. Therefore, Japanese quail has great advantages for genetic researches and can be used as model animal for major poultry species.
Korean speech sound development in children from bilingual Japanese-Korean environments
Kim, Jeoung Suk; Lee, Jun Ho; Choi, Yoon Mi; Kim, Hyun Gi; Kim, Sung Hwan; Lee, Min Kyung
2010-01-01
Purpose This study investigates Korean speech sound development, including articulatory error patterns, among the Japanese-Korean children whose mothers are Japanese immigrants to Korea. Methods The subjects were 28 Japanese-Korean children with normal development born to Japanese women immigrants who lived in Jeonbuk province, Korea. They were assessed through Computerized Speech Lab 4500. The control group consisted of 15 Korean children who lived in the same area. Results The values of the voice onset time of consonants /ph/, /t/, /th/, and /k*/ among the children were prolonged. The children replaced the lenis sounds with aspirated or fortis sounds rather than replacing the fortis sounds with lenis or aspirated sounds, which are typical among Japanese immigrants. The children showed numerous articulatory errors for /c/ and /l/ sounds (similar to Koreans) rather than errors on /p/ sounds, which are more frequent among Japanese immigrants. The vowel formants of the children showed a significantly prolonged vowel /o/ as compared to that of Korean children (P<0.05). The Japanese immigrants and their children showed a similar substitution /n/ for /ɧ/ [Japanese immigrants (62.5%) vs Japanese-Korean children (14.3%)], which is rarely seen among Koreans. Conclusion The findings suggest that Korean speech sound development among Japanese-Korean children is influenced not only by the Korean language environment but also by their maternal language. Therefore, appropriate language education programs may be warranted not only or immigrant women but also for their children. PMID:21189968
Communication attitudes of Japanese school-age children who stutter.
Kawai, Norimune; Healey, E Charles; Nagasawa, Taiko; Vanryckeghem, Martine
2012-01-01
Past research with the Communication Attitude Test (CAT) has shown it to be a valid and reliable instrument for assessing speech-associated attitude of children who stutter (CWS). However, in Japan, the CAT has not been used extensively to examine the communication attitude of CWS. The purpose of this study was to determine if a Japanese version of the CAT could differentiate between the communication attitude of Japanese elementary school CWS and children who do not stutter (CWNS). A Japanese translation of the 1991 version of the Communication Attitude Test-Revised (CAT-R) was used in this study. Eighty Japanese CWS and 80 gender- and grade level-matched CWNS participated in the study. The results showed that CWS had a significantly more negative communication attitude than CWNS. Both CWS and CWNS in 1st grade showed significantly more positive communication attitudes than children in 2nd, 3rd, 4th, 5th, and 6th grades. Furthermore, a link between stuttering severity and CWS' communication attitude was found. Additional research is needed to confirm the results of the current study, which indicate that the communication attitude of Japanese CWS becomes more negative as they get older. The reader will be able to: (1) Describe the process that was used to develop a Japanese version of the Communication Attitude Test (CAT-J). (2) Discuss attitude differences between Japanese children who stutter and those who do not and how grade level impacts a negative attitude toward communication. (3) Explain the link between stuttering severity and attitudes of Japanese children who stutter. Copyright © 2012 Elsevier Inc. All rights reserved.
Japanese Encephalitis Virus in Meningitis Patients, Japan
Ito, Mikako; Takao, Shinichi; Shimazu, Yukie; Fukuda, Shinji; Miyazaki, Kazuo; Kurane, Ichiro; Takasaki, Tomohiko
2005-01-01
Cerebrospinal fluid specimens from 57 patients diagnosed with meningitis were tested for Japanese encephalitis virus. Total RNA was extracted from the specimens and amplified. Two products had highest homology with Nakayama strain and 2 with Ishikawa strain. Results suggest that Japanese encephalitis virus causes some aseptic meningitis in Japan. PMID:15757569
Argumentative Strategies in American and Japanese English.
ERIC Educational Resources Information Center
Kamimura, Taeko; Oi, Kyoko
1998-01-01
A study examined differences in argumentative strategies in Japanese and American English by analyzing English essays on capital punishment written by 22 American high school seniors and 30 Japanese college sophomores. Differences were found in the organizational patterns, content and use of rational appeals, preference for type of diction, and…
A MANUAL OF JAPANESE WRITING, BOOK 1.
ERIC Educational Resources Information Center
CHAPLIN, HAMAKO ITO; MARTIN, SAMUEL E.
THIS IS THE FIRST OF THREE VOLUMES WRITTEN TO TEACH THE 881 ESSENTIAL OR "EDUCATION" CHARACTERS TO ENGLISH-SPEAKING STUDENTS OF JAPANESE. THE AUTHORS ASSUME THAT THE STUDENTS HAVE ALREADY LEARNED THE HIRAGANA AND KATAKANA SYLLABARIES AND HAVE A BASIC KNOWLEDGE OF JAPANESE GRAMMAR. ORTHOGRAPHIC CONVENTIONS USED FOLLOW CLOSELY THOSE…
Travel-related health problems in Japanese travelers.
Mizuno, Yasutaka; Kudo, Koichiro
2009-09-01
Although the number of Japanese individuals traveling abroad has increased steadily, reaching approximately 17.3 million in 2007, the incidence of various travel-related health problems in Japan remains unknown. The travel-related health problems of Japanese travelers returning to Japan from abroad are analyzed by assessing the records. Data were collected retrospectively on returning travelers who visited the authors' travel clinic during the period from January 2005 through to December 2006 with any health problem acquired overseas. A total of 345 patients were included in this study (200 male, 145 female; average age, 34+/-12.3 years). Reasons for travel included leisure (45.8%); business (39.1%); visiting friends and relatives or accompanying other travelers (8.7%); volunteering (3.8%); and long stays in order to study or live (2.6%). The most visited destination was Asia (n=260), followed by Africa (n=105). The most commonly reported health problems were gastro-intestinal infections (39.1%), followed by respiratory tract infections (16.2%), animal bites (8.1%), and skin problems (5.8%). Together, malaria and dengue accounted for 10% of diagnoses in 125 febrile patients (36.2%). Although the profile of travel-related health problems in Japanese travelers is similar to that of Western travelers, the characteristics of travel were quite different. Therefore Japanese travel advice should be tailored to suit the Japanese traveler.
Hu, Wen; Guo, Ting; Jiang, Wen-Jun; Dong, Guang-Li; Chen, Da-Wei; Yang, Shi-Lin; Li, He-Ran
2015-06-01
The present study was designed to establish and optimize a new method for extracting chlorogenic acid and cynaroside from Lonicera japonica Thunb. through orthogonal experimental designl. A new ultrahigh pressure extraction (UPE) technology was applied to extract chlorogenic acid and cynaroside from L. japonica. The influential factors, including solvent type, ethanol concentration, extraction pressure, time, and temperature, and the solid/liquid ratio, have been studied to optimize the extraction process. The optimal conditions for the UPE were developed by quantitative analysis of the extraction products by HPLC-DAD in comparison with standard samples. In addition, the microstructures of the medicinal materials before and after extraction were studied by scanning electron microscopy (SEM). Furthermore, the extraction efficiency of different extraction methods and the 2, 2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activities of the extracts were investigated. The optimal conditions for extracting chlorogenic acid and cynaroside were as follows: ethanol concentration, 60%; extraction pressure, 400 MPa; extraction time, 2 min; extraction temperature, 30 °C; and the solid/liquid ratio, 1 : 50. Under these conditions, the yields of chlorogenic acid and cynaroside were raised to 4.863% and 0.080%, respectively. Compared with other extraction methods, such as heat reflux extraction (HRE), ultrasonic extraction (UE), and Sohxlet extraction (SE), the UPE method showed several advantages, including higher extraction yield, shorter extraction time, lower energy consumption, and higher purity of the extracts. This study could help better utilize L. japonica flower buds as a readily accessible source of natural antioxidants in food and pharmaceutical industries. Copyright © 2015 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.
Harnessing Furigana to Improve Japanese Learners' Ability to Read Kanji
ERIC Educational Resources Information Center
Kirwan, Leigh
2005-01-01
The historical development of written Japanese has resulted in an extremely complex system. Modern Japanese is usually written in logosyllabic script consisting of a combination of "kanji," the Chinese characters, and "kana," the Japanese syllables originally formed from them. There are two types of "kana," the…
Other Japanese Educations and Japanese Education Otherwise. Review Essay
ERIC Educational Resources Information Center
Takayama, Keita
2011-01-01
Education in the United States was in a state of "crisis" at the time of the 1983 release of "A Nation at Risk," the landmark report on the US education reform. This was the time when the rising Japanese economy started threatening the post-war US economic dominance and conservative figures such as Ronald Reagan gained popular…
The Stroop effect in English-Japanese bilinguals: the effect of phonological similarity.
Sumiya, Hiromi; Healy, Alice F
2008-01-01
English-Japanese bilinguals performed a Stroop color-word interference task with both English and Japanese stimuli and responded in both English and Japanese. The Japanese stimuli were either the traditional color terms (TCTs) written in Hiragana or loanwords (LWs) from English written in Katakana. Both within-language and between-language interference were found for all combinations of stimuli and responses. The between-language interference was larger for Katakana LWs (phonologically similar to English) than for Hiragana TCTs, especially with Japanese responses. The magnitude of this phonological effect increased with self-rated reading fluency in Japanese. Overall responding was slower and the Stroop effect larger with English than with Japanese stimuli. These results suggest that unintentional lexical access elicits automatic phonological processing even with intermediate-level reading proficiency.
7 CFR 301.48-6 - Movement of live Japanese beetles.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 5 2014-01-01 2014-01-01 false Movement of live Japanese beetles. 301.48-6 Section... INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE DOMESTIC QUARANTINE NOTICES Japanese Beetle Quarantine and Regulations § 301.48-6 Movement of live Japanese beetles. Regulations requiring a permit for and otherwise...
7 CFR 301.48-6 - Movement of live Japanese beetles.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 5 2013-01-01 2013-01-01 false Movement of live Japanese beetles. 301.48-6 Section... INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE DOMESTIC QUARANTINE NOTICES Japanese Beetle Quarantine and Regulations § 301.48-6 Movement of live Japanese beetles. Regulations requiring a permit for and otherwise...
7 CFR 301.48-6 - Movement of live Japanese beetles.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 5 2010-01-01 2010-01-01 false Movement of live Japanese beetles. 301.48-6 Section... INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE DOMESTIC QUARANTINE NOTICES Japanese Beetle Quarantine and Regulations § 301.48-6 Movement of live Japanese beetles. Regulations requiring a permit for and otherwise...
The Japanese value of harmony and nursing ethics.
Konishi, Emiko; Yahiro, Michiko; Nakajima, Naoko; Ono, Miki
2009-09-01
Harmony is one of the most fundamental Japanese values. It is derived from Confucianism and encompasses a state of mind, an action process and outcomes of the action. This article draws on research data and discusses Japanese nurses' perceptions of harmony as reflected in their everyday practice. The most important virtues for these nurses were reported as politeness and respect for other persons. The outcome from the nurses' harmonious practice, it is claimed, benefited patients and created peaceful, harmonious relationships for all. Because of the unique link between harmony and the location of interaction, the ideal 'workplace harmony' threatened some nurses' professional decision making. These nurses confused harmony with conformity by superficial agreement. The Japanese seniority system could be a major factor contributing to this problem. Ethics education that includes traditional values and concepts in Japanese culture is strongly urged.
The Art of Japanese Masks and Kimonos
ERIC Educational Resources Information Center
Brooks, Nancy Johnston
2009-01-01
Japanese masks have been worn for a number of reasons. In the past they were often used in plays and celebrations. Today in Japan, social masks are essential in many party gatherings as a form of expressing one's personality. In this article, the author describes an art project wherein students created Japanese masks and kimonos.
Distinctive Features of Japanese Education. NIER Occasional Paper 01/91.
ERIC Educational Resources Information Center
National Inst. for Educational Research, Tokyo (Japan).
For the past decade there has been a surge of international interest in Japanese education in the wake of its economic and technological successes. This paper discusses eight distinctive features of Japanese education, identifying their advantages and disadvantages and how they have been brought about. These eight features of Japanese schooling…
ERIC Educational Resources Information Center
Fujikawa, Nobuo
1997-01-01
Sketches the characteristics of the Japanese educational tradition and analyzes conflicts between modern western pedagogies and traditional education. Argues that Japanese socialization processes stress a specifically Japanese construction of the "self" and of behavior. Concludes that Japanese educators should be more aware of this…
Paleolithic Contingent in Modern Japanese: Estimation and Inference using Genome-wide Data
He, Yungang; Wang, Wei R.; Xu, Shuhua; Jin, Li; SNP Consortium, Pan-Asia
2012-01-01
The genetic origins of Japanese populations have been controversial. Upper Paleolithic Japanese, i.e. Jomon, developed independently in Japanese islands for more than 10,000 years until the isolation was ended with the influxes of continental immigrants about 2,000 years ago. However, the knowledge of origin of Jomon and its contribution to the genetic pool of contemporary Japanese is still limited, albeit the extensive studies using mtDNA and Y chromosomes. In this report, we aimed to infer the origin of Jomon and to estimate its contribution to Japanese by fitting an admixture model with missing data from Jomon to a genome-wide data from 94 worldwide populations. Our results showed that the genetic contributions of Jomon, the Paleolithic contingent in Japanese, are 54.3∼62.3% in Ryukyuans and 23.1∼39.5% in mainland Japanese, respectively. Utilizing inferred allele frequencies of the Jomon population, we further showed the Paleolithic contingent in Japanese had a Northeast Asia origin. PMID:22482036
Center for Japanese Study Abroad. Fastback 386.
ERIC Educational Resources Information Center
Jassey, William
The Center for Japanese Study Abroad (CJSA) is a Japanese immersion and study abroad program implemented as a magnet program at inner-city Brien MacMahon High School in Norwalk, Connecticut. The program is supported by a grant from the state department of education. Attended by 60-70 students from high schools in southern Fairfield County…
Classroom Silence: Voices from Japanese EFL Learners
ERIC Educational Resources Information Center
Harumi, Seiko
2011-01-01
This article explores Japanese EFL learners' classroom silence in a Japanese EFL context. The existence of silence in second language learning contexts can be a source of conflict between students and teachers and even among students themselves. It can also be an obstacle to acquiring the target language. In order to tackle this problem and to…
Kondoh, Shun; Chiba, Hirofumi; Nishikiori, Hirotaka; Umeda, Yasuaki; Kuronuma, Koji; Otsuka, Mitsuo; Yamada, Gen; Ohnishi, Hirofumi; Mori, Mitsuru; Kondoh, Yasuhiro; Taniguchi, Hiroyuki; Homma, Sakae; Takahashi, Hiroki
2016-09-01
The clinical course of idiopathic pulmonary fibrosis (IPF) shows great inter-individual differences. It is important to standardize the severity classification to accurately evaluate each patient׳s prognosis. In Japan, an original severity classification (the Japanese disease severity classification, JSC) is used. In the United States, the new multidimensional index and staging system (the GAP model) has been proposed. The objective of this study was to evaluate the model performance for the prediction of mortality risk of the JSC and GAP models using a large cohort of Japanese patients with IPF. This is a retrospective cohort study including 326 patients with IPF in the Hokkaido prefecture from 2003 to 2007. We obtained the survival curves of each stage of the GAP and JSC models to perform a comparison. In the GAP model, the prognostic value for mortality risk of Japanese patients was also evaluated. In the JSC, patient prognoses were roughly divided into two groups, mild cases (Stages I and II) and severe cases (Stages III and IV). In the GAP model, there was no significant difference in survival between Stages II and III, and the mortality rates in the patients classified into the GAP Stages I and II were underestimated. It is difficult to predict accurate prognosis of IPF using the JSC and the GAP models. A re-examination of the variables from the two models is required, as well as an evaluation of the prognostic value to revise the severity classification for Japanese patients with IPF. Copyright © 2016 The Japanese Respiratory Society. Published by Elsevier B.V. All rights reserved.
Kids Explore America's Japanese American Heritage. Westridge Young Writers Workshop.
ERIC Educational Resources Information Center
Jefferson County School District R-1, Denver, CO.
This book was written by 94 students, aged 8-14, at Westridge Elementary School (Littleton, Colorado) during a summer enrichment class. The book was written for anyone who wants to learn about Japanese-American culture and heritage. Chapter 1 gives an overview of Japanese history before American contact, the immigration of Japanese to America, the…
Low mitochondrial DNA diversity of Japanese Polled and Kuchinoshima feral cattle.
Mannen, Hideyuki; Yonesaka, Riku; Noda, Aoi; Shimogiri, Takeshi; Oshima, Ichiro; Katahira, Kiyomi; Kanemaki, Misao; Kunieda, Tetsuo; Inayoshi, Yousuke; Mukai, Fumio; Sasazaki, Shinji
2017-05-01
This study aims to estimate the mitochondrial genetic diversity and structure of Japanese Polled and Kuchinoshima feral cattle, which are maintained in small populations. We determined the mitochondrial DMA (mtDNA) displacement loop (D-loop) sequences for both cattle populations and analyzed these in conjunction with previously published data from Northeast Asian cattle populations. Our findings showed that Japanese native cattle have a predominant, Asian-specific mtDNA haplogroup T4 with high frequencies (0.43-0.81). This excluded Kuchinoshima cattle (32 animals), which had only one mtDNA haplotype belonging to the haplogroup T3. Japanese Polled showed relatively lower mtDNA diversity in the average sequence divergence (0.0020) than other Wagyu breeds (0.0036-0.0047). Japanese Polled have been maintained in a limited area of Yamaguchi, and the population size is now less than 200. Therefore, low mtDNA diversity in the Japanese Polled could be explained by the decreasing population size in the last three decades. We found low mtDNA diversity in both Japanese Polled and Kuchinoshima cattle. The genetic information obtained in this study will be useful for maintaining these populations and for understanding the origin of Japanese native cattle. © 2016 Japanese Society of Animal Science.
[Molecular authentication of Jinyinhua formula granule by using allele-specific PCR].
Jiang, Chao; Tu, Li-Chan; Yuan, Yuan; Huang, Lu-Qi; Gao, Wei; Jin, Yan
2017-07-01
Traditional authentication method is hard to identify herb's authenticity of traditional Chinese medicine(TCM) formula granules because they have lost all their morphological characteristics. In this study, a new allele-specific PCR method was established for identifying the authentication of Jinyinhua formula granule (made from Lonicerae Japonicae Flos) based on an SNP site in trnL-trnF fragment. Genomic DNA was successfully extracted from Lonicerae Japonicae Flos and its formula granules by using an improved spin column method and then PCR was performed with the designed primer. Approximately 110 bp specific bands was obtained only in the authentic Lonicerae Japonicae Flos and its formula granules, while no bands were found in fake mixed products. In addition, the PCR product sequence was proved from Lonicerae Japonicae Flos trnL-trnF sequence by using BLAST method. Therefore, DNA molecular authentication method could make up the limitations of character identification method and microscopic identification, and quickly identify herb's authenticity of TCM formula granules, with enormous potential for market supervision and quality control. Copyright© by the Chinese Pharmaceutical Association.
COMPARING 3D FOOT SHAPE MODELS BETWEEN TAIWANESE AND JAPANESE FEMALES.
Lee, Yu-Chi; Kouchi, Makiko; Mochimaru, Masaaki; Wang, Mao-Jiun
2015-06-01
This study compares foot shape and foot dimensions between Taiwanese and Japanese females. One hundred Taiwanese and 100 Japanese female 3D foot scanning data were used for comparison. To avoid the allometry effect, data from 23 Taiwanese and 19 Japanese with foot length between 233 to 237 mm were used for shape comparison. Homologous models created for the right feet of the 42 subjects were analyzed by Multidimensional Scaling. The results showed that there were significant differences in the forefoot shape between the two groups, and Taiwanese females had slightly wider feet with straighter big toe than Japanese females. The results of body and foot dimension comparison indicated that Taiwanese females were taller, heavier and had larger feet than Japanese females, while Japanese females had significantly larger toe 1 angle. Since some Taiwanese shoemakers adopt the Japanese shoe sizing system for making shoes, appropriateness of the shoe sizing system was also discussed. The present results provide very useful information for improving shoe last design and footwear fit for Taiwanese females.
An Analysis of Japanese Medical Periodicals
Taniguchi, Mayumi
1965-01-01
Medical periodicals published in Japan were studied by analyzing the journals abstracted in Igaku Chuo Zasshi (ICZ), the most comprehensive abstracting service for Japanese medical journal articles. Since the inauguration of medical periodicals in 1869, the number of journals has increased remarkably. In 1963 ICZ abstracted 1,074 journals published in Japan (960 in Japanese and 114 in other languages). Of these 1,074 titles, 855 were on medical sciences, of which 740 were substantive. A subject analysis of the substantive journals in ICZ, as compared to the 124 Japanese journals currently indexed in Index Medicus, was also made. Data were presented relating the number of periodicals to the size of the medical scene in Japan and the United States, and it was pointed out that good control of the literature, by whatever methods, requires a knowledge of the extent of the publications. PMID:14223738
Affective Variables and Japanese L2 Reading Ability
ERIC Educational Resources Information Center
Kondo-Brown, Kimi
2006-01-01
This study investigates how 17 affective factors are related to Japanese second language (L2) reading comprehension and "kanji" knowledge test scores of 43 university students in advanced Japanese courses. Major findings are that: a) reading comprehension ability and "kanji" knowledge have direct associations with…
Learning from Japanese Middle School Math Teachers. Fastback.
ERIC Educational Resources Information Center
Whitman, Nancy C.
This document reviews the Japanese educational system and examines middle school education in particular to identify cultural differences and help improve educational quality in the United States. Contents include: (1) "An Overview of Japanese Education"; (2) "Teacher Behavior in the Classroom"; (3) "Teacher Behavior…
[Dentistry in Korean during the Japanese occupation].
Shin, Jae-Eu
2004-12-01
The Japanese introduction of dentistry into Korea was for treating the Japanese residing in Korea Noda-Oji was the first Japanese dentist for Japanese people in Korea in 1893, and Narajaki doyoyo, an invited dentist was posted in the Korean headquarter of Japanese army in September, 1905. The imperialist Japan licensed the dental technicians (yipchisa) without limit and controlled them generously so they could practice dentistry freely. This measure was contrary to that in Japan. (In Japan no new dental technician was licensed.) Komori, a dental technician opened his laboratory at Chungmuro in 1902. The dental technician had outnumbered by 1920. In 1907, the first Korean dental technician Sung-Ryong Choi practiced dentistry in Jongno. The imperialist Japan made the regulations for dental technicians to set a limit to the advertisement and medical practice of dental technicians. The first Korean dentists Suk-Tae Ham was register No. 1 in the dentist license. The Kyungsung dental school was established by Nagira Dasoni for the purpose of educating some Korean people that contributed to Japanese colonization. It made progress with the help of Japan, it was was given the approval of the establishment of the professional school in January the 25th, 1929. It was intended to produce Korean dentists in the first place but became the school for Japanese students later on. The association of Chosun dentist, which had been founded by Narajaki doyoyo, was managed by Japanese dentists in favor of the colonial ruling. The Hansung Association of Dentists established in 1925 was the organization made by the necessity of the association for Koreans only. The Japanese forcefully annexed the Association of Hansung Dentists (Koreans only) to the Association of Kyungsung Dentists to avoid collective actions of Korean dentists in the name of 'Naesunilche' -- 'Japan and Korea and one'. Their invading intention was shown in the event of 'decayed tooth preventive day'. Japanese controlled
LEARN JAPANESE--ELEMENTARY SCHOOL TEXT, VOLUME II.
ERIC Educational Resources Information Center
SATO, YAEKO; AND OTHERS
THIS TEXT WAS WRITTEN FOR THE USE OF THE ELEMENTARY SCHOOL TEACHER OF JAPANESE. IT IS TO BE USED IN THE SECOND SEMESTER OF JAPANESE LANGUAGE STUDY AND FOLLOWS THE AUDIO-LINGUAL ORIENTATION OF VOLUME I. THE MAIN GOAL OF BOTH VOLUMES IS "TO ELEVATE THE PUPIL'S MOTIVATION AND TO CULTIVATE PROPER PRONUNCIATION HABITS." THE NEW ITEMS IN VOLUME II…
Telling her story: narrating a Japanese lesbian community.
Welker, James
2010-01-01
This article explores queer Japanese women's narratives of their own histories and the history of the "Japanese lesbian community," which has been constructed as a space outside the heterosexual mainstream, a space where queer women can find at least temporary refuge. It begins with the acknowledgment that the evolution and the shape of the community, along with the identities of the women who comprise it, are shifting and contested. This article specifically looks at the long history of the lesbian bar scene as well as more recent history of lesbian dance parties; the early role of lesbian feminism and activism; lesbian community-based and commercial publications, paying special attention to the critical role translation has played in Japanese lesbian discourse and the construction of multiple lesbian identities; and, finally, lesbian, gay, bisexual, and transgender (LGBT) pride events and film festivals, through which the larger LGBT community has been gaining increasing visibility. This article argues that while some of the building blocks of the community are borrowed, from the "West" as well as from the Japanese gay community, there has also been creative translation, adaptation, and resistance to these imports. The resulting Japanese lesbian community is a complex and local construct, an innovative bricolage firmly sited in Japan.
Sexuality education in Japanese medical schools.
Shirai, M; Tsujimura, A; Abdelhamed, A; Horie, S
2017-07-01
The present study aimed to investigate current sexuality education in Japanese medical schools and the impact of position title in the Japanese Society for Sexual Medicine (JSSM). Questionnaires were mailed to urology departments in all Japanese medical schools. The responses were evaluated according to four factors: the number of lecture components, curriculum hours, degree of satisfaction with the components and degree of satisfaction with the curriculum hours. We also investigated differences in these four factors among three groups: Directors, Council members and non-members of the JSSM. The medians of curriculum hours and the number of the lecture components were 90.0 min and 7.0, respectively. The curriculum hours of the Directors (140.0 min) were significantly longer than those of the non-members (90.0 min; P<0.05). The number of lecture components taught by Directors (9.5) was significantly higher than that of the Council (4.0; P<0.01) and non-members (7.0; P<0.05). More than half of the faculties were not satisfied with the lecture components and curriculum hours. This is the first study on sexuality education in Japanese medical schools. It showed the inadequacy of both curriculum hours and lecture components, and that the position title of department chair affects sexuality education in medical schools.
U.S. and Japanese Source Reliance for Environmental Information.
ERIC Educational Resources Information Center
Pierce, John C.; And Others
1988-01-01
Examines environmental information source reliance among American and Japanese citizens. Finds that the Japanese are inclined to rely on non-mass media sources, whereas Americans exhibit greater differentiation among sources. (RS)
Mori, Masanori; Kuwama, Yuichiro; Ashikaga, Takamaru; Parsons, Henrique A; Miyashita, Mitsunori
2018-01-01
Acculturation is the phenomenon of the attitudinal changes of individuals who come into continuous contact with another culture. Despite the long history of Japanese immigration to America, little is known about the impact of acculturation on perceptions of a good death. To examine differences in perceptions of a good cancer death among Japanese Americans (JA/A), Japanese living in America (J/A), and the Japanese living in Japan (J/J). We administered surveys among JA/A and J/A and used historical J/J data for reference. Primary endpoint was the proportion of respondents who expressed the necessity of core and optional items of the Good Death Inventory. Group differences ≥20% were deemed clinically important. In total, 441 survey responses in America and 2548 in Japan were obtained. More than 80% of respondents consistently considered nine of 10 core items necessary without significant group differences. No core item reached a ≥20% group difference. Three of the eight optional items reached ≥20% group difference: fighting against disease until one's last moment (49%, P < 0.0001; 52%, P < 0.0001; and 73% in JA/A, J/A, and J/J, respectively), knowing what to expect about one's condition in the future (83%, P < 0.0001; 80%, P < 0.0001; and 58%, respectively), and having faith (64%, P = 0.0548; 43%, P = 0.0127; and 38%, respectively). Although most core items of a good death were preserved throughout the levels of acculturation, perceptions of some optional items shifted away from Japanese attitudes as individuals became more acculturated. Understanding of different levels of acculturation may help clinicians provide culturally sensitive end-of-life care. Copyright © 2017 American Academy of Hospice and Palliative Medicine. Published by Elsevier Inc. All rights reserved.
The Effectiveness of a Japanese Language Course on Cross-Cultural Competence.
ERIC Educational Resources Information Center
Miyamoto, Yumi; Rasmussen, Roger
1998-01-01
A quasi-experimental research design was employed to measure the effectiveness of a Japanese language and culture course entitled "Japanese for the Business Community." The study analyzed seven cross-cultural competence attributes in interactions with Japanese people in business settings. (Auth/JL)
Japanese women's experiences of pharmacological pain relief in New Zealand.
Doering, Keiko; Patterson, Jean; Griffiths, Christine R
2014-06-01
In Japan, most women manage labour pain without pharmacological interventions. However, New Zealand statistics show a high percentage of epidural use amongst Asian women. Entonox (a gas mixture of nitrous oxide and oxygen) and pethidine are also available to women in New Zealand. This article investigates how Japanese women in New Zealand respond to the use of pharmacological pain relief in labour. The study was guided by two research questions: (1) How do Japanese women experience and manage labour pain in New Zealand? (2) How do they feel about the use of pharmacological pain relief? Thirteen Japanese women who had given birth in New Zealand were interviewed individually or in a focus group. The conversations were analysed using thematic analysis. Although in Japan very few women use pain relief, nine women received epidural and/or Entonox out of 11 women who experienced labour pain. The contrast between their Japanese cultural expectations and their birth experiences caused some of the women subsequent personal conflict. Japanese women's cultural perspectives and passive attitudes were demonstrated to influence the decision-making process concerning pain relief. It was concluded that understanding Japanese cultural worldviews and approaches to the role of pain in labour would help maternity providers in their provision of appropriate care for Japanese women. Copyright © 2013 Australian College of Midwives. Published by Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Usuda-Sato, K.; Iizuka, R.; Yamaoka, H.; Handa, T.
2018-02-01
Translation of information from English is an essential step toward ensuring the involvement of non-English speakers in global events. The NameExoWorlds competition, led by the International Astronomical Union (IAU), was held from 9 July 2014 to 15 December 2015. It was a unique event that invited the public to name celestial bodies. In Japan, language acts as a significant barrier for amateur astronomers and school students to participate in global events hosted in English. To address this concern, we established a domestic working group to set up a Japanese website and provided a translation of the IAU's official site for the NameExoWorlds competition. We also developed additional original information in Japanese when needed and sent announcements to a mailing lists of astronomy societies in Japan. As a result, 28% of the registered groups and 47% of proposals for names were from Japan, making Japan the most active country for these stages of the competition. After the competition had ended, we carried out a survey in the Japanese astronomy community and received 124 responses. We found that most of the Japanese participants referred to our official Japanese website in order to overcome the language barrier and participate in the competition. This article explores our work of translating the competition information into Japanese and our evaluation of the impact of this action on the uptake by Japanese astronomy enthusiasts.
Economic Statistics and Information Concerning the Japanese Auto Industry
DOT National Transportation Integrated Search
1980-12-01
The report examines the following aspects of the Japanese automobile Industry: Identification of Japanese agencies that receive statistical data on the automobile industry; Determination of research and development and capital investment procedures; ...
Japanese Educational System Improving Ongoing Practice in Schools.
ERIC Educational Resources Information Center
Arimoto, Masahiro
1995-01-01
Describes the Japanese education system's unique characteristics. Japanese schools provide a prescribed curriculum, with pupils confined to desks. Teachers identify with their schools and are committed to service. Teachers and students try to improve schools by working harder. Understanding school effectiveness requires frameworks deeply rooted in…
Standardization of Weed Pollen Extracts, Japanese Hop and Mugwort, in Korea
Jeong, Kyoung Yong; Son, Mina; Choi, Soo-Young; Park, Kyung Hee; Park, Hye Jung; Hong, Chein-Soo; Lee, Jae-Hyun
2016-01-01
Purpose Japanese hop (Humulus spp.) and mugwort (Artemisia spp.) are notable causes of autumn pollinosis in East Asia. However, Japanese hop and mugwort pollen extracts, which are widely used for the diagnosis, have not been standardized. This study was performed to standardize Japanese hop and mugwort pollen extracts. Materials and Methods Allergen extracts were prepared in a standardized way using locally collected Humulus japonicus and purchased Artemisia vulgaris pollens. The immunoglobulin E (IgE) reactivities of prepared extracts were compared with commercial extracts via IgE immunoblotting and inhibition analyses. Intradermal skin tests were performed to determine the bioequivalent allergy unit (BAU). Results The IgE reactive components of the extracts via IgE immunoblotting were similar to those of commercial extracts. A 11-kDa allergen showed the strongest IgE reactivity in Japanese hop, as did a 28-kDa allergen in mugwort pollen extracts. Allergenic potencies of the investigatory Japanese hop and mugwort extracts were essentially indistinguishable from the commercial ones. Sums of erythema of 50 mm by the intradermal skin test (ΣED50) were calculated to be 14.4th and 13.6th three-fold dilutions for Japanese hop and mugwort extracts, respectively. Therefore, the allergenic activity of the prepared extracts was 90827.4 BAU/mg for Japanese hop and 34412 BAU/mg for mugwort. Conclusion We produced Japanese hop and mugwort pollen extracts using a standardized method. Standardized Japanese hop and mugwort pollen extracts will facilitate the production of improved diagnostic and immunotherapeutic reagents. PMID:26847293
Sociocultural dilemma of Japanese steeplejacks.
Iwata, H
1997-12-01
Japanese steeplejacks are good at working in high places as construction workers, and they have been called tobi for a longtime. They now play an important role in completing modern civil engineering projects and in the construction of high-rise buildings; however, their lifestyle is considered by most to be quaint but outdated. Originally, they were unskilled workmen at construction sites. In the 18th century, they were engaged in repairing houses or setting up scaffolding, helping carpenters, but they worked as firefighters whenever fires broke out. Their traditional work system did not change throughout the Meiji era, although Japanese society became greatly modernized. After World War II, the industrialization of Japanese society required highly developed technology in civil engineering and architecture. This provided an opportunity for them to establish their positions as trained professional workers. However, the number of skilled tobi professionals has continued to decrease because the younger generation does not consider this profession desirable career. Improving not only the professional skills but also the way of living to the extent as a modern high-tech society demands will be the key for the tobi's work system to become attractive.
Compulsory "Foreign Language Activities" in Japanese Primary Schools
ERIC Educational Resources Information Center
Hashimoto, Kayoko
2011-01-01
From 2011, the new curriculum for introducing English to Japanese primary schools will be fully implemented in the form of "foreign language activities". This innovation forms part of the government's plan to cultivate "Japanese with English abilities", a development based on the awareness, particularly in the business sector,…
On the Processing of Japanese Wh-Questions: An ERP Study
Ueno, Mieko; Kluender, Robert
2009-01-01
The processing of Japanese wh-questions was investigated using event-related brain potentials (ERPs). Unlike in English or German, a wh-element in Japanese need not be displaced from its canonical position, but instead needs a corresponding Q(uestion)-particle to indicate its interrogative scope. We tested to see if there were any processing correlates specific to these features of Japanese wh-questions. Both mono-clausal and bi-clausal Japanese wh-questions elicited right-lateralized anterior negativity (RAN) between wh-words and corresponding Q-particles, relative to structurally-equivalent yes/no-question control conditions. These results suggest a reliable neural processing correlate of the dependency between wh-elements and Q-particles in Japanese, which is similar to effects of (left) anterior negativity seen between wh-fillers and gaps in English and German, but with a right- rather than left-lateralized distribution. It is suggested that wh-in-situ questions in Japanese are processed by the incremental formation of a long-distance dependency between wh-elements and their Q-particles, resulting in a working memory load for keeping track of the scopeless wh-elements. PMID:19501576
Hisagi, Miwako; Shafer, Valerie L.; Strange, Winifred; Sussman, Elyse S.
2015-01-01
This study examined automaticity of discrimination of a Japanese length contrast for consonants (miʃi vs. miʃʃi) in native (Japanese) and non-native (American-English) listeners using behavioral measures and the event-related potential (ERP) mismatch negativity (MMN). Attention to the auditory input was manipulated either away from the auditory input via a visual oddball task (Visual Attend), or to the input by asking the listeners to count auditory deviants (Auditory Attend). Results showed a larger MMN when attention was focused on the consonant contrast than away from it for both groups. The MMN was larger for consonant duration increments than decrements. No difference in MMN between the language groups was observed, but the Japanese listeners did show better behavioral discrimination than the American English listeners. In addition, behavioral responses showed a weak, but significant correlation with MMN amplitude. These findings suggest that both acoustic-phonetic properties and phonological experience affects automaticity of speech processing. PMID:26119918
Japanese Culture in the United States of America; An Annotated Bibliography.
ERIC Educational Resources Information Center
Connor, John W., Comp.
This bibliography describes and briefly reviews, from an anthropological perspective, books and articles on the Japanese in the United States. Works cited include: (1) bibliographies; (2) general studies on Japanese Americans; (3) works dealing with the cultural heritage of the Japanese immigrant generation; (4) literature on the Japanese…
Taming the Wild: Approaches to Nature in Japanese Early Childhood Education
ERIC Educational Resources Information Center
Burke, Rachael S.
2014-01-01
The Japanese early childhood curriculum provides ample opportunities for children to interact with nature and to learn about natural phenomena. However, using Kalland (1995) and Martinez's (2008) theories about Japanese constructions of nature, this paper argues that most Japanese early childhood experiences do not constitute direct contact with…
Normalizing Social Networking in a Beginners' Japanese Course
ERIC Educational Resources Information Center
Morofushi, Mari; Pasfield-Neofitou, Sarah Ellen
2014-01-01
With the spread of the Internet, students now have greater opportunities to use Japanese outside of the classroom. For example, they can interact with other Japanese speakers through instant messaging or social networking, or utilize online dictionaries and translation tools to decipher websites in ways that would be impossible with traditional…
Sibling Relationships Cognition in Japanese Female University Students
ERIC Educational Resources Information Center
Sawai, Misae; Kato, Daiki
2017-01-01
This study examined the factor structure of sibling relationships in Japanese female university students. Two hundred and fifteen Japanese female university students participated in this study. The Adult Sibling Relationship Scale (ASRQ, Stocker et al., 1997) was used to measure sibling relationship cognition. The model was constructed as a result…
Japanese High School Teachers' Views on Pupil Misbehaviour
ERIC Educational Resources Information Center
Kyriacou, Chris
2010-01-01
This study aimed to explore Japanese high school teachers' views of pupil misbehaviour in order to contribute to the growing international literature on discipline in schools. A total of 141 Japanese high school teachers completed a questionnaire which explored their views regarding the factors accounting for pupil misbehaviour, the frequency of…
Women among First Authors in Japanese Cardiovascular Journal.
Fujii, Tomoko; Matsuyama, Tasuku; Takeuchi, Jiro; Hara, Masahiko; Kitamura, Tetsuhisa; Yamauchi-Takihara, Keiko
2018-03-30
The representation of women in Japanese academic medicine is not evident. We aimed to assess trends related to the proportion of female first authors in Japanese cardiovascular journals.We reviewed original research articles in 6 journals published in English by Japanese societies between 2006 and 2015 related to cardiovascular fields. We conducted a multivariable logistic regression analysis to assess the factors associated with the gender of first authors and plotted the trend of predicted probability for female first authors over the study period. Of 7,005 original articles, 1,330 (19.0%) had female first authors. Affiliations located in Japan (adjusted odds ratio [aOR], 0.76; 95% confidence interval [CI], 0.71-0.81), concurrent first and corresponding authors (aOR, 0.69; 95% CI, 0.64-0.74), and the total number of listed authors (aOR, 0.97; 95% CI, 0.95-0.99) were negatively associated with female first authors. The adjusted probability of a female first author increased from 13% to 20% on an average between 2006 and 2009, but the increase reached a plateau after 2010.Female first authors of original research articles published in Japanese cardiovascular journals increased over the examined decade. However, the representation of women is still low and has plateaued in recent years. A gender gap in authorship for Japanese cardiovascular journals remains.
Content Analysis of Life Exhibitions in Japanese Science Museums and Centres
ERIC Educational Resources Information Center
Kazama, Tomoko; Ogawa, Masakata
2015-01-01
Life exhibitions in Japanese science museums (SMs) face difficulties in coping with rapid progress in the life sciences owing to certain constraints around the frequency of exhibit renovations, and the Japanese indigenous understanding of the natural world (Shizen) that Japanese visitors unconsciously bring with them. To what extent do current…
NASA Astrophysics Data System (ADS)
Fudano, Hiroko
A project work in which learners of a foreign language engage in a task with the native speakers is one of the effective ways to bring in ample real communication opportunities to a classroom. This scheme also gives both parties meaningful experiences for intercultural understanding. This paper reports a “Pythagoras” machine production project in which international students were paired up with Japanese students as a part of a Japanese for science and technology course in a summer intensive program. Based on the participants‧ course evaluation data, the paper also discusses the effectiveness of the project for Japanese language learning and for promoting intercultural understanding.
2011 Japanese Nuclear Incident
EPA’s RadNet system monitored the environmental radiation levels in the United States and parts of the Pacific following the Japanese Nuclear Incident. Learn about EPA’s response and view historical laboratory data and news releases.
Japanese guidelines for childhood asthma 2017.
Arakawa, Hirokazu; Hamasaki, Yuhei; Kohno, Yoichi; Ebisawa, Motohiro; Kondo, Naomi; Nishima, Sankei; Nishimuta, Toshiyuki; Morikawa, Akihiro
2017-04-01
The Japanese Guideline for the Diagnosis and Treatment of Allergic Diseases 2017 (JAGL 2017) includes a minor revision of the Japanese Pediatric Guideline for the Treatment and Management of Asthma 2012 (JPGL 2012) by the Japanese Society of Pediatric Allergy and Clinical Immunology. The section on child asthma in JAGL 2017 provides information on how to diagnose asthma between infancy and adolescence (0-15 years of age). It makes recommendations for best practices in the management of childhood asthma, including management of acute exacerbations and non-pharmacological and pharmacological management. This guideline will be of interest to non-specialist physicians involved in the care of children with asthma. JAGL differs from the Global Initiative for Asthma Guideline in that JAGL emphasizes diagnosis and early intervention of children with asthma at <2 years or 2-5 years of age. The first choice of treatment depends on the severity and frequency of symptoms. Pharmacological management, including step-up or step-down of drugs used for long-term management based on the status of asthma control levels, is easy to understand; thus, this guideline is suitable for the routine medical care of children with asthma. JAGL also recommends using a control test in children, so that the physician aims for complete control by avoiding exacerbating factors and appropriately using anti-inflammatory drugs (for example, inhaled corticosteroids and leukotriene receptor antagonists). Copyright © 2016 Japanese Society of Allergology. Production and hosting by Elsevier B.V. All rights reserved.
Tanko Bushi: Designing a Japanese-American Dance Experience
ERIC Educational Resources Information Center
Sweeting, Terry; Werner, Peter; Williams, Lori H.; Crump, Alyssa
2012-01-01
Many folk dances reflect the everyday activities of the people, celebrating the commonplace through physical forms of expression. The traditional Japanese folk dance, Tanko Bushi, is still performed in Japan and among Japanese-Americans today, and its theme of coal mining makes it relatable to many cultures around the world. With its traditional…
Business Communication Needs of Japanese Companies in Malaysia
ERIC Educational Resources Information Center
Su, Yeoh Lee; Mahadi, Tengku Sepora Tengku; Singh, Manjet Kaur Mehar
2016-01-01
Business relationship between Japan and Malaysia has developed very quickly in recent years. This has caused a dramatic increase in the need for individuals who possess language skills to function in Japanese businesses. In order to investigate the needs of our Malaysian graduates, a survey was conducted involving graduates of Japanese language…
Video Game Play in British and Japanese Adolescents
ERIC Educational Resources Information Center
Colwell, John; Kato, Makiko
2005-01-01
Results from research into negative correlates of computer/video game play in the United Kingdom and in Japan are presented, with new analyses across cultures. Patterns of play are similar, although Japanese adolescents have been playing for longer, they play fewer aggressive games, and there is greater perceived concern by Japanese parents.…
Japanese Americans: The Evolution of a Subculture. Ethnic Groups in American Life Series.
ERIC Educational Resources Information Center
Kitano, Harry H. L.
Japanese-American accomplishments are a logical outcome of Japanese-American culture and institutions, but, more importantly, of the energy and spirit of the hundreds of thousands of Japanese, some prominent figures now, who have made places for themselves in the American society. Nevertheless, the Japanese-American, like any American, must adapt…
[Study of Japanese anatomical terms, such as 'sphenoid bone'].
Sawai, Tadashi
2008-12-01
Japanese anatomical terms (butterfly-shaped bone) have an interesting history. Galen named a bone (wedge-like). This Greek term was introduced into Latin anatomical texts by transcribing into 'os sphnoides' or translating it as 'os cuneiforme'. Both terms mean equally wedge-like bone. From 16th century on, these two terms prevailed in European anatomical textbooks, but in 18th century some anatomists merged this bone with some kinds of winged creatures and named their wings "Ala major' and 'Ala minor'. In mid-19th century English-Chinese anatomical book, this bone was named (butterfly bone) by a medical missionary Benjamin Hobson. This term was introduced into Japanese textbooks. In Meiji Era both terms were used in Japanese textbooks, and (wedged-like bone). Some anatomists insisted on using because this echoed original Latin term's sense. Eventually, Japanese Associations of Anatomists adopted in 1943.
The fine-scale genetic structure and evolution of the Japanese population.
Takeuchi, Fumihiko; Katsuya, Tomohiro; Kimura, Ryosuke; Nabika, Toru; Isomura, Minoru; Ohkubo, Takayoshi; Tabara, Yasuharu; Yamamoto, Ken; Yokota, Mitsuhiro; Liu, Xuanyao; Saw, Woei-Yuh; Mamatyusupu, Dolikun; Yang, Wenjun; Xu, Shuhua; Teo, Yik-Ying; Kato, Norihiro
2017-01-01
The contemporary Japanese populations largely consist of three genetically distinct groups-Hondo, Ryukyu and Ainu. By principal-component analysis, while the three groups can be clearly separated, the Hondo people, comprising 99% of the Japanese, form one almost indistinguishable cluster. To understand fine-scale genetic structure, we applied powerful haplotype-based statistical methods to genome-wide single nucleotide polymorphism data from 1600 Japanese individuals, sampled from eight distinct regions in Japan. We then combined the Japanese data with 26 other Asian populations data to analyze the shared ancestry and genetic differentiation. We found that the Japanese could be separated into nine genetic clusters in our dataset, showing a marked concordance with geography; and that major components of ancestry profile of Japanese were from the Korean and Han Chinese clusters. We also detected and dated admixture in the Japanese. While genetic differentiation between Ryukyu and Hondo was suggested to be caused in part by positive selection, genetic differentiation among the Hondo clusters appeared to result principally from genetic drift. Notably, in Asians, we found the possibility that positive selection accentuated genetic differentiation among distant populations but attenuated genetic differentiation among close populations. These findings are significant for studies of human evolution and medical genetics.
The fine-scale genetic structure and evolution of the Japanese population
Katsuya, Tomohiro; Kimura, Ryosuke; Nabika, Toru; Isomura, Minoru; Ohkubo, Takayoshi; Tabara, Yasuharu; Yamamoto, Ken; Yokota, Mitsuhiro; Liu, Xuanyao; Saw, Woei-Yuh; Mamatyusupu, Dolikun; Yang, Wenjun; Xu, Shuhua
2017-01-01
The contemporary Japanese populations largely consist of three genetically distinct groups—Hondo, Ryukyu and Ainu. By principal-component analysis, while the three groups can be clearly separated, the Hondo people, comprising 99% of the Japanese, form one almost indistinguishable cluster. To understand fine-scale genetic structure, we applied powerful haplotype-based statistical methods to genome-wide single nucleotide polymorphism data from 1600 Japanese individuals, sampled from eight distinct regions in Japan. We then combined the Japanese data with 26 other Asian populations data to analyze the shared ancestry and genetic differentiation. We found that the Japanese could be separated into nine genetic clusters in our dataset, showing a marked concordance with geography; and that major components of ancestry profile of Japanese were from the Korean and Han Chinese clusters. We also detected and dated admixture in the Japanese. While genetic differentiation between Ryukyu and Hondo was suggested to be caused in part by positive selection, genetic differentiation among the Hondo clusters appeared to result principally from genetic drift. Notably, in Asians, we found the possibility that positive selection accentuated genetic differentiation among distant populations but attenuated genetic differentiation among close populations. These findings are significant for studies of human evolution and medical genetics. PMID:29091727
Language as Fluid: A Description of the Conduit Metaphor in Japanese.
ERIC Educational Resources Information Center
Nomura, Masuhiro
1993-01-01
The question of how 'communication' is metaphorized in Japanese is examined and this metaphorization is contrasted with Reddy's (1979) conduit metaphor. A claim is made that there is a strong tendency for Japanese to conceptualize 'word' as 'fluid' and to fuse 'word' and 'meaning.' English, which unlike Japanese, has overt count/mass and…
Western and Japanese Discourse Style in a Consensus-Building Task Discussion
ERIC Educational Resources Information Center
Hirabayashi, Haruma; Long, Christopher
2011-01-01
The current study analyzes discourse style differences between western and Japanese interlocutors in a group consensus-building task discussion. Four discussants (American male, Japanese male, German female and Japanese female) first created a ranking of 5 life values and then participated in a group discussion to arrive at a common group ranking.…
Sex and cultural differences in spatial performance between Japanese and North Americans.
Sakamoto, Maiko; Spiers, Mary V
2014-04-01
Previous studies have suggested that Asians perform better than North Americans on spatial tasks but show smaller sex differences. In this study, we evaluated the relationship between long-term experience with a pictorial written language and spatial performance. It was hypothesized that native Japanese Kanji (a complex pictorial written language) educated adults would show smaller sex differences on spatial tasks than Japanese Americans or North Americans without Kanji education. A total of 80 young healthy participants (20 native Japanese speakers, 20 Japanese Americans-non Japanese speaking, and 40 North Americans-non Japanese speaking) completed the Rey Complex Figure Test (RCFT), the Mental Rotations Test (MRT), and customized 2D and 3D spatial object location memory tests. As predicted, main effects revealed men performed better on the MRT and RCFT and women performed better on the spatial object location memory tests. Also, as predicted, native Japanese performed better on all tests than the other groups. In contrast to the other groups, native Japanese showed a decreased magnitude of sex differences on aspects of the RCFT (immediate and delayed recall) and no significant sex difference on the efficiency of the strategy used to copy and encode the RCFT figure. This study lends support to the idea that intensive experience over time with a pictorial written language (i.e., Japanese Kanji) may contribute to increased spatial performance on some spatial tasks as well as diminish sex differences in performance on tasks that most resemble Kanji.
Yamamoto, Mayumi; Tomotake, Masahito; Ohmori, Tetsuro
2008-08-01
In recent years, the problem of interpersonal relationships has been reported to be associated with various adolescent psychiatric problems. Egocentrism is one factor related to the problem of interpersonal relationships. The Adolescent Egocentrism-Sociocentrism (AES) scale is used to assess egocentrism in Western countries, but no such scale has been developed in Japan. The purpose of our current study was to develop the Japanese version of the AES scale and investigate the relationship between the egocentrism assessed by the AES scale and the self-consciousness assessed by the Japanese version of the self-consciousness scale. The original version of the AES scale was first translated into Japanese using the forward-backward method and examined for factorial reliability and validity. The results demonstrated that the Japanese version of the AES scale shows adequate factorial reliability and validity, but different from the original version the "egocentrism personal fable" subscale which measures the feeling that oneself is special and unique was not extracted in the Japanese version. We found a moderate correlation between the non-social focuses of the AES scale and the public self-consciousness subscale of the self-consciousness scale. This correlation suggests that a strong attention of others' view on oneself results in the avoidance of others. The Japanese version of the AES scale can examine egocentrism adequately together with sociocentrism and non-social focuses. As this scale is self-reporting and easy to complete, it may have practical utility in a clinical setting.
Skills and Life Strategies of Japanese Business Women.
ERIC Educational Resources Information Center
Iwao, Sumiko
In this paper, case studies of two successful Japanese businesswomen illustrate how traditional Japanese cultural values and female sex roles have enabled women to succeed in business. These two cases were chosen as representative from a sample of 56. The businesses discussed are in very different sectors of the economy. One is a traditional and…
Mapping Japanese medical terms to UMLS Metathesaurus.
Onogi, Yuzo; Ohe, Kazuhiko; Tanaka, Masaaki; Nozoe, Atsutake; Sasaki, Tetsuro; Sato, Megumi; Kikuchi, Yuko; Shinohara, Tsuneki; Suzuki, Hiromichi; Kaihara, Shigekoto; Seyama, Yousuke
2004-01-01
This paper introduces and reports the results for a project to map Japanese medical terms to the UMLS Metathesaurus. The "Thesaurus for Medical and Health related Terms version 5" published in 2003 by the Japan Medical Abstracts Society and UMLS version 2002AC provided by NLM were used in this study. The goal was to judge the validity of the correlation between the Japanese and English terms that belong to the same MeSH concept. Fifteen medicine, nursing, and library science professionals, excluding JAMAS, used a custom designed Web interface to perform this task. About 10% of the concepts were judged as invalid, and the reasoning behind these failures were analyzed. Experience from this project can be used to estimate the manpower required to revise the Japanese thesaurus after future revisions to UMLS or MeSH.
ERIC Educational Resources Information Center
Kurokawa, Shozo
This paper examines the following points: (1) how Japanese personal pronouns are used according to the speakers' social constraints, and (2) differences between males and females of the same occupational group in their use of personal pronouns. The dialect analyzed is the speech of Japanese faculty members at the University of Hawaii. A speaker of…
Daily Life in Japanese High Schools. ERIC Digest.
ERIC Educational Resources Information Center
Johnson, Marcia L.; Johnson, Jeffrey R.
This ERIC Digest asserts that the Japanese education system is one of the most influential agents molding Japanese youth. This influence is especially great due to the large amount of time students spend in schools. Six topics examine aspects of daily high school life: (1) Getting to School; (2) At School; (3) Extracurricular Activities; (4)…
Bumping into Someone: Japanese Students' Perceptions and Observations
ERIC Educational Resources Information Center
Lieske, Carmella
2010-01-01
This pilot study explores the apologies Japanese nursing college students thought they would use in their L1 (i.e. Japanese) and their L2 (i.e. English) when bumping into each other. The students completed a questionnaire, the results of which indicated that they believed they should always apologize for bumping into someone. The paper describes…
The decline in BMI among Japanese women after World War II.
Maruyama, Shiko; Nakamura, Sayaka
2015-07-01
The body mass index (BMI) of the Japanese is significantly lower than is found in other high-income countries. Moreover, the average BMI of Japanese women is lower than that of Japanese men, and the age-specific BMI of Japanese women has decreased over time. The average BMI of Japanese women at age 25 decreased from 21.8 in 1948 to 20.4 in 2010 whereas that of men increased from 21.4 to 22.3 over the same period. We examine the long-term BMI trend in Japan by combining several historical data sources spanning eleven decades, from 1901 to 2012, to determine not only when but also how the BMI decline among women began: whether its inception was period-specific or cohort-specific. Our nonparametric regression analysis generated five findings. First, the BMI of Japanese women peaked with the 1930s birth cohort. This means that the trend is cohort-specific. Second, the BMI of men outpaced that of women in the next cohort. Third, the BMI of Japanese children, boys and girls alike, increased steadily throughout the 20th century. Fourth, the gender difference in the BMI trend is due to a gender difference in the weight trend, not the height trend. Fifth, these BMI trends are observed in urban and rural populations alike. We conclude that the BMI decline among Japanese women began with those who were in their late teens shortly after World War II. Copyright © 2015 Elsevier B.V. All rights reserved.
[Development of a Japanese version of the TALE scale].
Ochiai, Tsutomu; Oguchi, Takashi
2013-12-01
The Thinking About Life Experiences (TALE) Scale (Bluck & Alea, 2011) has three subscales that assess the self, social, and directive functions of autobiographical memory. This study constructs a Japanese version of the TALE Scale and examines its reliability and validity. Fifteen items that assess the three functions of autobiographical memory were translated into Japanese. We conducted an online investigation with 600 men and women between 20-59 years of age. In Study 1, exploratory and confirmatory factor analysis identified that the three-factor structure of the Japanese version of the TALE Scale was the same as the original TALE Scale. Sufficient internal consistency of the scale was found, and the construct validity of the scale was supported by correlation analysis. Study 2 confirmed that the test-retest reliabilities of the three subscales were sufficient. Thus, this Japanese version of the TALE Scale is useful to assess autobiographical memory functions in Japan.
ERIC Educational Resources Information Center
Vincent, Jill; Vincent, Claire
2004-01-01
Between the 17th and 19th centuries, the Japanese government closed its borders to the outside world in an attempt to become more powerful. Foreign books were banned, people could not travel, and foreigners were not allowed to enter the country. One result of this isolation was the flourishing of sangaku--wooden tablets inscribed with intricately…
ERIC Educational Resources Information Center
Oshima, Ryoko; Harvey, Sharon
2017-01-01
Student attrition and falling tertiary education enrolments afflict languages education across the "inner circle" English speaking world. In the southern hemisphere, in New Zealand and Australia, Japanese has become one of the most successful languages of education. However, numbers of students are now declining. This paper examines why…
[The registry report of Japanese lung transplantation--2009].
2010-07-01
To scrutinize the status of lung transplantation in Japan, the Japanese Society of Lung and Heart-Lung Transplantation started to collect and present registry data from 2005. This is the 5th official registry report of Japanese lung transplantation. The data of cadaveric lung transplantation and living-donor lobar transplantation performed by the end of 2008 were registered to the database and analyzed with respect to the number of transplants, recipient survival rates, recipient functional and working status, and cause of death after transplantation. Survival rates were calculated by the Kaplan-Meier method. Fifty-three (30 single and 23 bilateral) cadaveric lung transplantations and 77 living-donor lobar transplantations were performed by the end of 2008. Five-year survival rates of cadaveric single and bilateral lung transplantations were 61.9% and 62.5%, respectively, which were both superior to those in the International Registry (47.1% and 55.0%, respectively). Five-year and 10-year survival rates of living-donor lobar transplantation were excellent at 79.9% and 77.0%, respectively. The functional status of >80% of recipients was restored to Hugh-Jones I or II after transplantation. Infection was the leading cause of death after lung transplantation. The results of Japanese lung transplantation are so far satisfactory although we should note the small number of lung transplant cases in Japan. The Japanese Society of Lung and Heart-Lung Transplantation will continue to present the annual report of Japanese lung transplantation.
Verb-raising and Numeral Classifiers in Japanese: Incompatible Bedfellows.
ERIC Educational Resources Information Center
Fukushima, Kazuhiko
2003-01-01
Examines verb raising in Japanese and looks at Koizumi's (2000) evidence for verb-raising based on data involving, among other things, numeral classifiers. Demonstrates that Koizumi's evidence based on numeral classifiers does not support his claim that verb-raising occurs in Japanese. (Author/VWL)
Sinha, Akhouri A; Morgan, Jenifer L; Betre, Konjit; Wilson, Michael J; Le, Chap; Marks, Leonard S
2008-01-01
Japanese-American (J-A) men who have immigrated to the U.S.A. and acquired the Western lifestyle usually have more invasive prostate cancer (PCa) than native Japanese (NJ) living in Japan. The specific reasons for these differences remain unknown. The objective of this study was to examine immunostainings of cathepsin B (CB) and its endogenous inhibitor stefin A (SA) in tissue microarray (TMA) and radical prostatectomy (RP) tissue sections in the hope of obtaining insights into the invasiveness of PCa in Japanese patients. TMA and RP sections were evaluated in 50 men (25 NJ and 25 J-A) for CB and SA reaction products. The CB and SA immunostainings were imaged directly from microscope slides to a computer using a high performance charge coupled device (CCD) digital camera, quantified using Metamorph software, analyzed using the two-sample t-test, and confirmed by multiple regression analysis. The CB and SA proteins were localized in the carcinomatous glands and isolated cancer cells in the TMA and RP sections. The Gleason scores and pre-surgery serum total prostate-specific antigen (PSA) levels did not differ significantly in the NJ and J-A patients (p = 0.14, p = 0.16, respectively). The Chi-square analysis of clinical stage versus place of birth showed that the NJ patients had significantly more T2a and T2b clinical stages than the J-A patients who had more advanced T2c and T3a stages (p = 0.003). The CB and SA immunostainings and their ratios in Gleason score 6 tumors did not show any difference, but the CB:SA ratios in score > or = 7 tumors approached significance levels. The overall matching of specimens according to the Gleason grade/score, pre-RP serum total PSA levels, clinical stage and age prior to evaluation of immunostainings greatly minimizes subjectivity associated with the evaluation of markers in this ethnic sub-population of PCa patients. CB and SA immunostaining is similar in Japanese patients who have organ-confined and moderately
Characteristics of MUTYH variants in Japanese colorectal polyposis patients.
Takao, Misato; Yamaguchi, Tatsuro; Eguchi, Hidetaka; Tada, Yuhki; Kohda, Masakazu; Koizumi, Koichi; Horiguchi, Shin-Ichiro; Okazaki, Yasushi; Ishida, Hideyuki
2018-06-01
The base excision repair gene MUTYH is the causative gene of colorectal polyposis syndrome, which is an autosomal recessive disorder associated with a high risk of colorectal cancer. Since few studies have investigated the genotype-phenotype association in Japanese patients with MUTYH variants, the aim of this study was to clarify the clinicopathological findings in Japanese patients with MUTYH gene variants who were detected by screening causative genes associated with hereditary colorectal polyposis. After obtaining informed consent, genetic testing was performed using target enrichment sequencing of 26 genes, including MUTYH. Of the 31 Japanese patients with suspected hereditary colorectal polyposis, eight MUTYH variants were detected in five patients. MUTYH hotspot variants known for Caucasians, namely p.G396D and p.Y179D, were not among the detected variants.Of five patients, two with biallelic MUTYH variants were diagnosed with MUTYH-associated polyposis, while two others had monoallelic MUTYH variants. One patient had the p.P18L and p.G25D variants on the same allele; however, supportive data for considering these two variants 'pathogenic' were lacking. Two patients with biallelic MUTYH variants and two others with monoallelic MUTYH variants were identified among Japanese colorectal polyposis patients. Hotspot variants of the MUTYH gene for Caucasians were not hotspots for Japanese patients.
Enke, Ulrike; Ishihara, Aeka
2017-06-01
The heart of this article is the transmission of selected chapters from the Japanese bacteriologist Taichi Kitashima's (1870-1956) autobiographical memoirs (in Japanese, Jiden) published in 1955, in which Kitashima reports on his stay in Marburg in a very personal and subjective way. Like other Japanese physicians of his generation, Kitashima spent several years in Germany in order to work with the serum researcher Emil von Behring and continued his education there. The contact came through Kitashima's teacher Shibasaburô Kitasato, who had worked with Behring in Berlin on questions of immunology. The memoir gives insight into Behring's laboratory work and his relation to his "subordinates". The editors investigate to what extent Kitashima's assessment, made from a distance of fifty years, of his stay in Germany as "wasted time" was accurate, given the advantages that arose from having been part of a vibrant European scientific community, including encounters in the Pasteur Institute in Paris, and why he cultivated his contacts with Germany and the Behring family during National Socialism.
Sequential-Simultaneous Analysis of Japanese Children's Performance on the Japanese McCarthy.
ERIC Educational Resources Information Center
Ishikuma, Toshinori; And Others
This study explored the hypothesis that Japanese children perform significantly better on simultaneous processing than on sequential processing. The Kaufman Assessment Battery for Children (K-ABC) served as the criterion of the two types of mental processing. Regression equations to predict Sequential and Simultaneous processing from McCarthy…
Beliefs about Overcoming Psychological Problems among British and Japanese Students.
ERIC Educational Resources Information Center
Furnham, Adrian; Ota, Hiromi; Tatsuro, Hosoe; Koyasu, Masuo
2000-01-01
Examines the cultural differences among Japanese students, British students, and Japanese students studying in Britain, concerning their beliefs on overcoming five psychological problems: depression, obesity, smoking cessation, agoraphobia, and lack of confidence. (CMK)
Reimagining Japanese Education: Borders, Transfers, Circulations, and the Comparative
ERIC Educational Resources Information Center
Willis, David Blake, Ed.; Rappleye, Jeremy, Ed.
2011-01-01
Sparked by the confluence of accelerating domestic transformation and increasingly explicit impacts from "globalization", the Japanese education system has undergone tremendous changes during the turbulence of the past decade. This volume, which brings together some of the foremost scholars in the field of Japanese education, analyzes…
Disruption and Reconnection: Counseling Young Adolescents in Japanese Schools.
ERIC Educational Resources Information Center
LeTendre, Gerald K.
1995-01-01
Using two case studies, examines the systems used by Japanese middle school teacher/counselors to counsel troubled early adolescents. The system works well for prevention, but can substantially drain a teacher's time. Cautions against wholesale adoption of Japanese organizational techniques in California schools, since teachers are already…
Japanese for Tourism and Trade
ERIC Educational Resources Information Center
Klarberg, F.
1974-01-01
Discusses the desirability of Japanese as a second language for Australians in tourism and trade industries. Initial instruction using Roman alphabet followed by job training in Japan is recommended. (RM)
Midlife use of written Japanese and protection from late life dementia
Crane, Paul K.; Gibbons, Laura E.; Arani, Keerthi; Nguyen, Viet; Rhoads, Kristoffer; McCurry, Susan M.; Launer, Lenore; Masaki, Kamal; White, Lon
2011-01-01
Background The cognitive reserve hypothesis would predict that use of written Japanese should confer protection against dementia because of the complexity of its ideograms compared with written English. We sought to test this hypothesis in analyses from a longitudinal study of Japanese-American men. Methods Participants were second-generation Japanese-American men (Nisei) on the island of Oahu, Hawaii, who were seen in 1965 and in subsequent examinations to detect dementia beginning in 1991-1993. Use of spoken and written Japanese was self-reported in 1965 (Analyses 1 and 2), and mid-life use of written Japanese and written English was self-reported in 1994-1996 (Analysis 3). We analyzed prevalent dementia outcomes in 1991-1993 (Analysis 1, n=3,139) using logistic regression, and incident dementia outcomes in 1994-2002 (Analysis 2, n=2,299) and in 1997-2002 (Analysis 3, n=1,655) using Cox proportional hazards regression. Dementia outcomes included all-cause dementia, probable and possible Alzheimer disease, and probable vascular dementia. We adjusted models for probable and possible confounders. Results Participants who reported proficiency with written Japanese were older and had lower incomes. For Analysis 1, there were 154 prevalent cases of dementia, 74 of Alzheimer disease, and 43 of vascular dementia; for Analysis 2, 236 incident cases of dementia, 138 of Alzheimer disease, and 45 of vascular dementia; and for Analysis 3, 125 incident cases of dementia, 80 of Alzheimer disease, and 20 of vascular dementia. There was no relationship in adjusted models between self-reported proficiency with written Japanese and any dementia outcomes. Conclusions Proficiency with written Japanese does not appear to be protective for dementia. PMID:19593152
Japanese children's family drawings and their link to attachment.
Behrens, Kazuko Y; Kaplan, Nancy
2011-09-01
This study explored the applicability of family drawings as a tool to estimate attachment security in a sample of Japanese six-year-olds (N = 47), applying Kaplan and Main's ( 1986 ) Family Drawing system. Maternal secure/insecure attachment status judged by the Adult Attachment Interview predicted family drawings' secure/insecure distinction produced by Japanese six-year-olds. However, insecure Japanese drawings took forms not seen in the original Berkeley drawings, such as a lineup of faces alone. Further examination of the Japanese children's drawings using global rating scales (Fury, Carlson, & Sroufe, 1997 ) yielded significant gender differences, rarely reported in the attachment literature, with girls scoring higher in scales that predict attachment security and boys scoring higher in scales that predict attachment insecurity. However, attachment security, as captured in the drawings, was not related to attachment security, observed behaviorally using Main and Cassidy's ( 1988 ) sixth-year reunion system. Implications of the findings are discussed in light of measurements, gender, and culture.
Evaluating genetic risk for prostate cancer among Japanese and Latinos
Cheng, Iona; Chen, Gary K.; Nakagawa, Hidewaki; He, Jing; Wan, Peggy; Laurie, Cathy; Shen, Jess; Sheng, Xin; Pooler, Loreall C.; Crenshaw, Andrew T.; Mirel, Daniel B.; Takahashi, Atsushi; Kubo, Michiaki; Nakamura, Yusuke; Al Olama, Ali Amin; Benlloch, Sara; Donovan, Jenny L.; Guy, Michelle; Hamdy, Freddie C.; Kote-Jarai, Zsofia; Neal, David E.; Wilkens, Lynne R.; Monroe, Kristine R.; Stram, Daniel O.; Muir, Kenneth; Eeles, Rosalind A.; Easton, Douglas F.; Kolonel, Laurence N.; Henderson, Brian E.; Le Marchand, Loïc; Haiman, Christopher A.
2012-01-01
Background There have been few genome-wide association studies (GWAS) of prostate cancer among diverse populations. To search for novel prostate cancer risk variants, we conducted GWAS of prostate cancer in Japanese and Latinos. In addition, we tested prostate cancer risk variants and developed genetic risk models of prostate cancer for Japanese and Latinos. Methods Our first stage GWAS of prostate cancer included Japanese (cases/controls=1,033/1,042) and Latino (cases/controls=1,043/1,057) from the Multiethnic Cohort. Significant associations from stage 1 (P < 1.0×10−4) were examined in silico in GWAS of prostate cancer (stage 2) in Japanese (cases/controls=1,583/3,386) and Europeans (cases/controls=1,854/1,894). Results No novel stage 1 SNPs outside of known risk regions reached genome-wide significance. For Japanese, in stage 1, the most notable putative novel association was seen with 10 SNPs (P<8.0. x10−6) at chromosome 2q33; however, this was not replicated in stage 2. For Latinos, the most significant association was observed with rs17023900 at the known 3p12 risk locus (stage 1: OR=1.45; P=7.01×10−5 and stage 2: OR=1.58; P =3.05×10−7). The majority of the established risk variants for prostate cancer, 79% and 88%, were positively associated with prostate cancer in Japanese and Latinos (stage I), respectively. The cumulative effects of these variants significantly influence prostate cancer risk (OR per allele=1.10; P = 2.71×10−25 and OR=1.07; P = 1.02×10−16 for Japanese and Latinos, respectively). Conclusion and Impact Our GWAS of prostate cancer did not identify novel genome-wide significant variants. However, our findings demonstrate that established risk variants for prostate cancer significantly contribute to risk among Japanese and Latinos. PMID:22923026
Evaluating genetic risk for prostate cancer among Japanese and Latinos.
Cheng, Iona; Chen, Gary K; Nakagawa, Hidewaki; He, Jing; Wan, Peggy; Laurie, Cathy C; Shen, Jess; Sheng, Xin; Pooler, Loreall C; Crenshaw, Andrew T; Mirel, Daniel B; Takahashi, Atsushi; Kubo, Michiaki; Nakamura, Yusuke; Al Olama, Ali Amin; Benlloch, Sara; Donovan, Jenny L; Guy, Michelle; Hamdy, Freddie C; Kote-Jarai, Zsofia; Neal, David E; Wilkens, Lynne R; Monroe, Kristine R; Stram, Daniel O; Muir, Kenneth; Eeles, Rosalind A; Easton, Douglas F; Kolonel, Laurence N; Henderson, Brian E; Le Marchand, Loïc; Haiman, Christopher A
2012-11-01
There have been few genome-wide association studies (GWAS) of prostate cancer among diverse populations. To search for novel prostate cancer risk variants, we conducted GWAS of prostate cancer in Japanese and Latinos. In addition, we tested prostate cancer risk variants and developed genetic risk models of prostate cancer for Japanese and Latinos. Our first-stage GWAS of prostate cancer included Japanese (cases/controls = 1,033/1,042) and Latino (cases/controls = 1,043/1,057) from the Multiethnic Cohort (MEC). Significant associations from stage I (P < 1.0 × 10(-4)) were examined in silico in GWAS of prostate cancer (stage II) in Japanese (cases/controls = 1,583/3,386) and Europeans (cases/controls = 1,854/1,894). No novel stage I single-nucleotide polymorphism (SNP) outside of known risk regions reached genome-wide significance. For Japanese, in stage I, the most notable putative novel association was seen with 10 SNPs (P ≤ 8.0 × 10(-6)) at chromosome 2q33; however, this was not replicated in stage II. For Latinos, the most significant association was observed with rs17023900 at the known 3p12 risk locus (stage I: OR = 1.45; P = 7.01 × 10(-5) and stage II: OR = 1.58; P = 3.05 × 10(-7)). The majority of the established risk variants for prostate cancer, 79% and 88%, were positively associated with prostate cancer in Japanese and Latinos (stage I), respectively. The cumulative effects of these variants significantly influence prostate cancer risk (OR per allele = 1.10; P = 2.71 × 10(-25) and OR = 1.07; P = 1.02 × 10(-16) for Japanese and Latinos, respectively). Our GWAS of prostate cancer did not identify novel genome-wide significant variants. However, our findings show that established risk variants for prostate cancer significantly contribute to risk among Japanese and Latinos. ©2012 AACR.
Transcultural stress factors of Japanese mothers living in the United Kingdom.
Ozeki, Nobuko
2008-01-01
The aim of this study was to describe the stressors experienced by Japanese mothers living in the United Kingdom. An ethnomethodological design was used by means of an openended, in-depth interview. Semistructured interviews were conducted with 10 Japanese mothers living in the United Kingdom. Analysis was performed using the KJ (Kawakito Jiro) method, equivalent to content analysis and data reduction. The main stressors were participation in the small hierarchical society of the Japanese business climate, isolation, language and cultural barriers, and raising Japanese children in a British cultural context. Unsatisfactory experiences of childbirth, child rearing, and contacts with medical services were reported. Recognizing cultural differences and the difficulties that may be experienced by Japanese clients is a first step. Resources may be provided to help these clients widen their social contacts and improve communication with providers of health care and education for their children.
3. View of Japanese village, type C structure, facing eastsoutheast ...
3. View of Japanese village, type C structure, facing east-southeast - Nevada Test Site, Japanese Village, Type C Structure, Area 4, Yucca Flat, 4-04 Road near Rainier Mesa Road, Mercury, Nye County, NV
Japanese Patterns of Behavior.
ERIC Educational Resources Information Center
Lebra, Takie Sugiyama
This book attempts to shed light on the seemingly contradictory aspects of Japanese behavior. Separate chapters, grounded in interaction-oriented social scientific theory, focus on the themes of social relativism, belongingness, empathy, dependency, occupying the proper place, reciprocity, situational interaction, early socialization, selfhood,…
Validation of the Japanese Version of the Body Vigilance Scale.
Saigo, Tatsuo; Takebayashi, Yoshitake; Tayama, Jun; Bernick, Peter J; Schmidt, Norman B; Shirabe, Susumu; Sakano, Yuji
2016-06-01
The Body Vigilance Scale is a self-report measure of attention to bodily sensations. The measure was translated into Japanese and its reliability, validity, and factor structure were verified. Participants comprised 286 university students (age: 19 ± 1 years). All participants were administered the scale, along with several indices of anxiety (i.e., Anxiety Sensitivity Index, Short Health Anxiety Inventory Illness Likelihood Scale, Social Interaction Anxiety Scale, and Hospital Anxiety and Depression Scale). The Japanese version of the Body Vigilance Scale exhibited a unidimensional factor structure and strong internal consistency. Construct validity was demonstrated by significant correlations with the above measures. Results suggest that the Japanese version of the scale is a reliable, valid tool for measuring body vigilance in Japanese university students. © The Author(s) 2016.
Citation Behaviors Observed in Japanese EFL Students' Argumentative Writing
ERIC Educational Resources Information Center
Kamimura, Taeko
2014-01-01
Effective use of outside source texts is one of the key components of successful academic writing. This study aims at clarifying Japanese university EFL students' citation behaviors in producing argumentative writing. Twenty-six Japanese university EFL students wrote an argumentative essay. Their essays were analyzed quantitatively by six…
Clarendon Alternative School Japanese Bilingual Bicultural Program: Curriculum Sampler.
ERIC Educational Resources Information Center
San Francisco Unified School District, CA.
Sample lessons and instructional materials from a Japanese bilingual/bicultural elementary school program are presented. The lessons are designed to integrate Japanese language instruction with content instruction, using thematic units related to the core curriculum. The ten lessons are organized by target grade (K-5), and describe classroom…
Work Environment and Japanese Fathers' Involvement in Child Care
ERIC Educational Resources Information Center
Ishii-Kuntz, Masako
2013-01-01
Previous studies mainly examined individual and family factors affecting Japanese fathers' involvement in child care. Along with these factors, we examine how work-related factors such as father-friendly environment at work, workplace's accommodation of parental needs, job stress, and autonomy are associated with Japanese men's participation in…
English/Japanese Professional Interpretation: Its Linguistic and Conceptual Problems.
ERIC Educational Resources Information Center
Ishikawa, Luli
1995-01-01
A study of simultaneous interpretation from Japanese to English focused on problems inherent in simultaneous language processing. Data were drawn from a discussion session at an international conference of physicians concerning nuclear war. Transcription of the Japanese source text (romanized), English product, and a gloss of lexical equivalents…
Japanese and Korean Kindergartners' Perspectives of Play Using Photos
ERIC Educational Resources Information Center
Izumi-Taylor, Satomi; Ro, Yeonsun; Han, Jihee; Ito, Yoko
2017-01-01
The purpose of the study was to examine Japanese and Korean kindergarteners' perspectives by asking them to photograph play and explain why their photos represent play (photo elicitation interviews). The participants consisted of 50 kindergarteners on Japan's main island and 50 kindergarteners in South Korea. Japanese and Korean kindergartners…
Integrating Language and Content: Challenges in a Japanese Supplementary School in Victoria
ERIC Educational Resources Information Center
Okumura, Shinji; Obara, Yumi
2017-01-01
The Melbourne International School of Japanese (MISJ) is a supplementary Saturday school which offers Japanese language and mathematics taught in Japanese from kindergarten to senior secondary level. Classes are scheduled on Saturdays from 9am to 3pm and approximately half of the program is dedicated to mathematics. While mathematics education…
Overcoming Ambivalence: The Case for Japanese Martial Internationalism
2002-09-01
served this effort. All of these liberal reforms culminated in the establishment of the bicameral National Diet and the development and adoption of...widespread protests, in July Kishi forced through the Diet passage of the renewed treaty using police to drive opposition party members from the Diet ...serious discussions of constitutional reforms to permit overseas Japanese military activities. In June 1992, with great difficulties, the Japanese Diet
The Japanese artificial organs scene: current status.
Mitamura, Yoshinori; Murabayashi, Shun
2005-08-01
Artificial organs and regenerative medicine are the subjects of very active research and development (R&D) in Japan and various artificial organs are widely used in patients. Results of the R&D are presented at the annual conference of the Japanese Society for Artificial Organs (JSAO). Progress in the fields of artificial organs and regenerative medicine are reviewed annually in the Japanese Journal of Artificial Organs. The official English-language journal of JSAO, Journal of Artificial Organs, also publishes many original articles by Japanese researchers. Although the annual conference and the publications of JSAO provide the world with update information on artificial organs and regenerative medicine in Japan, the information is not always understood appropriately in the rest of the world, mainly due to language problems. This article therefore introduces the current status of artificial organs and regenerative medicine in Japan. Artificial hearts and metabolic support systems are reviewed here and other interesting areas such as regenerative medicine can be found elsewhere.
Non-Grammatical Reflexive Binding Phenomena: The Case of Japanese.
ERIC Educational Resources Information Center
Sakakibara, Sonoko
Two non-syntactic phenomena of Japanese reflexive binding by "zibun" ("self") are analyzed with respect to a pragmatic use condition on "zibun," a culture-specific condition, and the Maxim of Politeness (Fukada 1986). The first phenomenon is the tendency by native speakers of Japanese to avoid referring to an honored…
Curricular, Relational, and Physical Spaces in the Japanese Hoikuen
ERIC Educational Resources Information Center
Ferguson, Daniel E.; Kuby, Candace R.
2015-01-01
Recent scholarship looks at the relationship of learning to space and place within educational research. The purpose of this article was to put data produced from teaching in four Japanese preschools into conversation with spatial theory and Ma, a Japanese spatial esthetic. We seek to understand "how" and "what" spaces…
Motivational Factors Affecting Online Learning by Japanese MBA Students
ERIC Educational Resources Information Center
Kikuchi, Hisayo
2006-01-01
In Japan, Internet based learning is still at an early stage. However, adult learners in Japanese society expect the development of flexible e-learning programs. This case study examines motivational factors affecting online learning in a Japanese and Australian MBA program, using observations, interviews and a questionnaire survey. The data were…
Yonekura, Syuji; Okamoto, Yoshitaka; Nakayama, Satoshi
Japanese cypress pollen is a major causative allergen of seasonal allergic rhinitis in Japan. Although ImmunoCAP-specific immunoglobulin E (IgE) reagent Japanese cypress pollen has been widely used as a diagnostic aid, its sensitivity requires enhancement. This study evaluated an improved version of this reagent. Serum samples from 61 subjects who underwent Japanese cypress pollen exposure testing in an environmental challenge chamber in Chiba University were assessed using the conventional ImmunoCAPspecific IgE Japanese cypress pollen product and the improved product. In addition, specific IgE for Cha o 1 and Cha o 2, the primary allergen components of Japanese cypress pollen, was evaluated and their reactivity to specific IgE was compared between the conventional and improved products. The antibody titer of the improved product was approximately 1.8-fold that of the conventional product. In addition, higher correlations with Cha o 1 and Cha o 2 were observed for the improved product than for the conventional product. The clinical sensitivity (≥class 2) in 56 exposure test-positive subjects was better for the improved product (80.4%) than for the conventional product (71.4%). An improvement of the ImmunoCAP-specific IgE reagent Japanese cypress pollen resulted in enhanced Japanese cypress pollen-specific IgE sensitivity. The primary reason for this appeared to be an improved Cha o 1- and Cha o 2-specific IgE detectability.
Comparison of Motivational Factors between Japanese and United States High School Students
ERIC Educational Resources Information Center
Kavanaugh, Debbie
2009-01-01
Spanning multiple subjects and age groups, U.S. students rate poorly while Japanese students rate highly when subject to international testing. Japanese children complete twice as much homework as their U.S. counterparts and sometimes attend school on Saturdays. The literature review looks at motivation in both U.S. American and Japanese students…
Oral self-care behaviours: comparing Greek and Japanese dental students.
Polychronopoulou, Argy; Kawamura, Makoto
2005-11-01
This study explored cross-cultural differences of self-reported oral health behaviours between Greek and Japanese dental students. The sample population included 877 dental students, 539 students registered at the University of Athens Dental School, and 338 registered at the Hiroshima University Dental School. Oral health behaviour was assessed using the Greek and Japanese versions of a 20-item questionnaire entitled Hiroshima University-Dental Behavioural Inventory (HU-DBI). The mean questionnaire score of the Japanese students (7.40) was significantly greater than that of the Greek peers (6.86, P = 0.001), indicating better oral self-care behaviour amongst the Japanese students; however, the overall difference was mainly attributed to their additional sixth study year. Greek and Japanese students provided significantly different answers to 14 of 20 HU-DBI items. Greeks significantly more often were required by their dentist to evaluate their brushing technique (OR = 14.4, P < 0.01), checked their teeth in the mirror after brushing (OR = 8.1, P < 0.01), worried about bad breath (OR = 6.7, P < 0.01), and believed that gum disease is preventable by tooth brushing alone (OR = 2.1, P < 0.05), whereas their Japanese peers significantly more often felt comfortable to clean their teeth without the use of a toothpaste (OR = 0.3, P < 0.01), believed that they take much time to brush their teeth (OR = 0.3, P < 0.01), used a child-sized toothbrush (OR = 0.2, P < 0.01), and put off going to the dentist until having toothache (OR = 0.4, P < 0.01). Considerable differences in dental health attitudes/behaviour exist amongst students in the two countries reflecting the different culture and the health education system of the students; moreover, it is possible to distinguish Greek dental students from Japanese peers with a probability of more than 89% by using the HU-DBI instrument.
The 2016 American Orthopaedic Association-Japanese Orthopaedic Association Traveling Fellowship.
Nandi, Sumon; Cho, Samuel K; Freedman, Brett A; Firoozabadi, Reza
2017-06-07
The American Orthopaedic Association-Japanese Orthopaedic Association (AOA-JOA) Traveling Fellowship, which began in 1992 as a collaborative effort between the 2 orthopaedic communities, is aimed at fostering leadership among early-career surgeons through clinical, academic, and cultural exchange. Over 3 weeks, we experienced an extraordinary journey that led us across nearly 800 miles of the picturesque Japanese countryside, with stops at 6 distinguished academic centers. The opportunity to become personally acquainted with orthopaedic leaders in Japan, learn from their experiences, and immerse ourselves in the ancient and storied culture of a beautiful country was one that we will not soon forget. Along the way, we accumulated a wealth of information while enjoying the legendary hospitality of the Japanese people. There is a ubiquitous challenge in delivering cost-effective, accessible health care while maintaining a commitment to education and research. The U.S. orthopaedic community may take solace in the fact that our Japanese colleagues stand with us as partners in this pursuit, and our relationship with them continues to grow stronger through endeavors such as the AOA-JOA Traveling Fellowship. We look forward to honoring our Japanese colleagues in 2017 when we host them in the United States.
New Japanese encephalitis vaccines: alternatives to production in mouse brain.
Halstead, Scott B; Thomas, Stephen J
2011-03-01
Japanese encephalitis virus (JEV), a flavivirus maintained in a zoonotic cycle and transmitted by the mosquito Culex tritaeniorhynchus, causes epidemics of encephalitis throughout much of Asia. Resident populations, including short- or long-term visitors to enzootic regions, are at risk of infection and disease. For the past several decades, killed viral vaccines prepared in tissue culture or mouse brain have been used effectively to immunize travelers and residents of enzootic countries. Cost, efficacy and safety concerns led to the development of a live-attenuated virus vaccine (SA14-14-2) and more recently, to the licensure in the USA, Europe, Canada, and Australia of a purified inactivated, tissue culture-based Japanese encephalitis vaccine (IXIARO(®), referred to as IC51; Intercell AG, Vienna, Austria). In addition, a live-attenuated yellow fever-Japanese encephalitis chimeric vaccine (IMOJEV™, referred to as Japanese encephalitis-CV; Sanofi Pasteur, Lyon, France) was recently licensed in Australia and is under review in Thailand. A broad portfolio of safe and effective Japanese encephalitis vaccines has become available to meet the needs of at-risk populations; when appropriately delivered, these new vaccines should greatly diminish the burden of disease.
Effects of Social Environment on Japanese and American Communication.
ERIC Educational Resources Information Center
Kitao, Kenji; Kitao, S. Kathleen
The social backgrounds of Japanese and Americans differ in ways that impede complete communication. The Japanese people, historically controlled by the forces of nature, have formed groups as the minimum functioning social units. The individual is only part of the group, and individual rights and obligations have not been clearly developed.…
Gender Representation in Japanese EFL Textbooks--A Corpus Study
ERIC Educational Resources Information Center
Lee, Jackie F. K.
2018-01-01
This paper seeks to investigate whether the Japanese government's attempt to promote a 'gender-equal' society in recent decades and the improved status of women are reflected in patterns of gender representation in Japanese English as a foreign language textbooks. The study made an analysis of four popular series of English language textbooks…
Tadokoro, Yukari; Oshima, Tomohiro; Fukuchi, Toshihiko; Kanner, Andres M; Kanemoto, Kousuke
2012-09-01
We validated and translated into Japanese the English version of the screening instrument Neurological Disorders Depression Inventory for Epilepsy (NDDI-E) to identify major depressive episodes in patients with epilepsy. A total of 159 Japanese subjects with epilepsy underwent a psychiatric structured interview with the Japanese version of the Mini International Neuropsychiatric Interview (M.I.N.I.-J) followed by completion of the Japanese version of NDDI-E (NDDI-E-J). Twelve participants met the M.I.N.I.-J criteria of current major depressive episode. Participants had no difficulties completing the NDDI-E-J. Its Cronbach's alpha coefficient was 0.83 and a cut-off score greater than 16 provided a sensitivity of 0.92, a specificity of 0.89, and a negative predictive value of 0.99. The NDDI-E-J appears to be useful for primary care clinicians to screen for major depressive episodes in epilepsy patients. Routine use of this brief and self-administered instrument in busy clinical settings will likely improve management of depression in Japanese individuals with epilepsy. Copyright © 2012 Elsevier Inc. All rights reserved.
The Japanese Academic Profession.
ERIC Educational Resources Information Center
Shimbori, Michiya
1981-01-01
The history of Japanese higher education includes development of a patronage system that, despite the broadening of the system, still affects faculty careers. Institutional ranking limits professional mobility, and individuals may spend undergraduate, graduate, and faculty careers at the same institution. Teaching abroad is also severely limited.…
Langenbeck's Archives--an international communication forum between Japanese and German surgeons.
Kitajima, Masaki; Hiki, Yoshiki
2010-04-01
Japan's first encounter with Western Medicine was in 1543. Japanese doctors were introduced to surgical treatment by Portuguese missionaries who visited Japan mainly to propagate Christianity and trade with Japan. Until that time, Japanese doctors have treated internal diseases by using mainly traditional Chinese medicine and had not experienced modern Western medicine, particularly surgery. In 1639, the Tokugawa shogunate issued the policy of seclusion (national isolation policy) and prohibited contacts with foreign countries except the Netherlands and China. All European culture came into Japan through Dutch traders. Japanese doctors studied medical books written in Dutch, but could not imagine that the original versions had been written by German doctors. Japanese doctors who studied Dutch medicine founded private schools in various places nationwide, prompting the development of Western medicine. In 1868 the Edo shogunate collapsed, and the newly established Meiji government opened Japan to the rest of the world. In an effort to introduce European civilization, which had been closed to the Japanese under the 250 years, the Meiji government followed Western styles when framing policy and building social systems. In terms of medicine, for the sake of reaching the world's highest level, the government decided to learn from Germans. Many of the young Japanese doctors travelled to Germany. However, as a world war loomed ahead, interchange with foreign countries became difficult. Peace was threatened, and even the progress of science was impeded. Although the United States led the world in the medical field, some Japanese doctors still studied in Germany after World War II to learn their medical traditions and look at the starting point of clinical medicine; and they continued the interchange between Japan and Germany. While continuing active relationship, in 1990, the German and Japanese Surgical Societies was established, and planned to hold a triennial joint
Issues in healthcare services in Malaysia as experienced by Japanese retirees.
Kohno, Ayako; Musa, Ghazali; Nik Farid, Nik Daliana; Abdul Aziz, Norlaili; Nakayama, Takeo; Dahlui, Maznah
2016-05-05
Worldwide, international retirement migration is growing in its popularity and Japanese retirees choose Malaysia as their most preferred destination. This study examines the pertinent issues related to healthcare services as experienced by Japanese retirees in this country. From January to March 2015, we conducted focus group discussions with 30 Japanese retirees who live in Kuala Lumpur and Ipoh. Guided by the social-ecological model, we discovered seven pertinent themes: 'language barriers','healthcare decisions', 'medical check-ups','healthcare insurance', 'nursing and palliative care', 'trust and distrust of healthcare services', and 'word-of-mouth information'. We identified seven pertinent issues related to healthcare services among Japanese retirees in Malaysia, of which four are especially important. These issues are explained as integrated themes within the social-ecological model. Language barriers prohibit them from having difficulty accessing to healthcare in Malaysia, but lack of will to improve their language skills exist among them. For that reason, they rely heavily on word-of-mouth information when seeking for healthcare. As a consequence, some develop feelings of trust and distrust of healthcare services. In addition, we have identified the needs for provide nursing and palliative care among Japanese retirees in Malaysia. Based on the magnitude of the discussion, we concluded that there are four crucial healthcare issues among Japanese retirees; 'language barriers', 'trust and distrust of healthcare services', 'word-of-mouth information' and 'nursing and palliative care'. We propose that further dialogue by healthcare stakeholders should be carried out to improve further the healthcare service provisions for Japanese retirees in Malaysia.
Applying RUG-III in Japanese Long-Term Care Facilities.
ERIC Educational Resources Information Center
Ikegami, Naoki; And Others
1994-01-01
Tested U.S. nursing home case-mix system, Resource Utilization Groups, Version III (RUG-III) in Japanese long-term care facilities. Measured staff time and resident characteristics for 871 patients. Found acceptable reliability for items defining RUG-III, and system explained 44% of variance in wage-weighted staff time (cost). Japanese and U.S.…
Contrastive Pragmatics of English and Japanese Offers and Requests.
ERIC Educational Resources Information Center
Christianson, Kiel
This paper analyzes a study by Fukushima (1990) of the English offers and responses of Japanese English as a foreign language (EFL) college students and reports on an experiment designed to address the perceived weaknesses of Fukushima's work. Fukushima's study found that many Japanese EFL learners could not use appropriate levels of politeness in…
Assessing Japanese Language Needs for Business and Professional Use.
ERIC Educational Resources Information Center
Saito, Yoshiko
A study is reported that aimed to: (1) assess perceived needs of Japanese language by students and business faculty; (2) assess Japanese language needs of business professionals who work with Japan; (3) determine what language abilities and levels of proficiency are desired; and (4) identify perceived problem areas and ways that they are handled…
Silence in the Second Language Classrooms of Japanese Universities
ERIC Educational Resources Information Center
King, Jim
2013-01-01
Japanese language learners' proclivity for silence has been alluded to by various writers (e.g. Anderson 1993; Korst 1997; Greer 2000) and is supported by plenty of anecdotal evidence, but large-scale, empirical studies aimed at measuring the extent of macro-level silence within Japanese university L2 classrooms are notably lacking. This article…
Oto, Takahiro; Okada, Yoshinori; Bando, Toru; Minami, Masato; Shiraishi, Takeshi; Nagayasu, Takeshi; Chida, Masayuki; Okumura, Meinoshin; Date, Hiroshi; Miyoshi, Shinichiro; Kondo, Takashi
2013-04-01
The Japanese Organ Transplant Law was amended, and the revised law took effect in July 2010 to overcome extreme donor shortage and to increase the availability of donor organs from brain-dead donors. It is now possible to procure organs from children. The year 2011 was the first year that it was possible to examine the results of this first extensive revision of the Japanese Organ Transplant Law, which took effect in 1997. Currently, seven transplant centers, including Tohoku, Dokkyo, Kyoto, Osaka, Okayama, Fukuoka and Nagasaki Universities, are authorized to perform lung transplantation in Japan, and by the end of 2011, a total of 239 lung transplants had been performed. The number of transplants per year and the ratio of brain-dead donor transplants increased dramatically after the revision of the Japanese Organ Transplant Law. The survival rates for lung transplant recipients registered with the Japanese Society for Lung and Heart-lung Transplantation were 93.3 % at 1 month, 91.5 % at 3 months, 86.3 % at 1 year, 79.0 % at 3 years, and 73.1 % at 5 years. The survival curves for brain-dead donor and living-donor lung transplantation were similar. The survival outcomes for both brain-dead and living-donor lung transplants were better than those reported by the International Society for Heart and Lung Transplantation. However, donor shortage remains a limitation of lung transplantation in Japan. The lung transplant centers in Japan should continue to make a special effort to save critically ill patients waiting for lung transplantation.
Teaching Japanese-American Incarceration
ERIC Educational Resources Information Center
Miksch, Karen L.; Ghere, David
2004-01-01
Few events in American history are so universally deplored as the incarceration of Japanese Americans during World War II. The United States government has acknowledged the error and the injustice that resulted with an official Presidential apology and a Congressional disbursement of reparations to the victims of the incarceration policy. The…
Japanese Experiences: "Hentai" Narratives
ERIC Educational Resources Information Center
Kama, Amit
2011-01-01
For those acquainted with Japanese lesbian, gay, bisexual, and transgender (LGBT) issues, "Queer Voices from Japan" can be good reading. But with only 1 of its 22 chapters informative for researchers, those interested in LGBT youth studies will only indirectly gain insight into a non-Western perspective on youth and sexuality.
Factors affecting Japanese retirees' healthcare service utilisation in Malaysia: a qualitative study
Kohno, Ayako; Nik Farid, Nik Daliana; Musa, Ghazali; Abdul Aziz, Norlaili; Nakayama, Takeo; Dahlui, Maznah
2016-01-01
Objective While living overseas in another culture, retirees need to adapt to a new environment but often this causes difficulties, particularly among those elderly who require healthcare services. This study examines factors affecting healthcare service utilisation among Japanese retirees in Malaysia. Design We conducted 6 focus group discussions with Japanese retirees and interviewed 8 relevant medical services providers in-depth. Guided by the Andersen Healthcare Utilisation Model, we managed and analysed the data, using QSR NVivo 10 software and the directed content analysis method. Setting We interviewed participants at Japan Clubs and their offices. Participants 30 Japanese retirees who live in Kuala Lumpur and Ipoh, and 8 medical services providers. Results We identified health beliefs, medical symptoms and health insurance as the 3 most important themes, respectively, representing the 3 dimensions within the Andersen Healthcare Utilisation Model. Additionally, language barriers, voluntary health repatriation to Japan and psychological support were unique themes that influence healthcare service utilisation among Japanese retirees. Conclusions The healthcare service utilisation among Japanese retirees in Malaysia could be partially explained by the Andersen Healthcare Utilisation Model, together with some factors that were unique findings to this study. Healthcare service utilisation among Japanese retirees in Malaysia could be improved by alleviating negative health beliefs through awareness programmes for Japanese retirees about the healthcare systems and cultural aspects of medical care in Malaysia. PMID:27006344
Will Japanese Women Ever Achieve Equality? Sex-Role Differentiations Related to Education.
ERIC Educational Resources Information Center
Inoue, Yukiko
Controversy exists concerning whether or not sex discrimination is the norm in Japan and what will happen with the status of Japanese women. One U.S. scholar was surprised after talking to female students at a Japanese college that only a few of them had a view of their future. It is fair to say that Japanese women are not taught to become…
Fallout from Bikini: the explosion of Japanese medicine.
Homei, Aya
2007-12-01
On 23 September 1954, Mr Aikichi Kuboyama died, the first Japanese victim of the Bikini incident--an American hydrogen bomb experiment on Bikini Atoll that took place on 1 March under the codename Operation Castle. This tragedy had several important consequences, influencing post-war negotiations between Japan and the United States over nuclear weapons, stimulating Japanese research into the biological effects of radiation and inspiring a commitment to the treatment of radiation sickness.
Doing Business in the Global Village: Japanese Professionals on EL Needs in Singapore
ERIC Educational Resources Information Center
Yoneda, Mitaka
2015-01-01
This paper presents an analysis of English language (EL) education from the perspectives of Japanese and non-Japanese professionals in Singapore, based on their experiences of "doing business" in Singapore. As established career business people, the perspectives of Japanese participants offer a retrospective evaluation of their…
History and progress of Japanese acupuncture.
Kobayashi, Akiko; Uefuji, Miwa; Yasumo, Washiro
2010-09-01
After Chiso brought acupuncture to Japan from Wu (China) in the sixth century, it has progressed in unique ways within the various historical milieus of the past 1500 years. Ishitsu-rei, the first medical law of Japan established in 701, explains the medical system of acupuncture in detail showing that acupuncture was being administered under the authorization of the national government. For the next 1200 years, acupuncture continued to be an important facet of public health in Japan. From the Azuchimomoyama through the Edo period, the knowledge exchange with China became active and people who studied in China developed new styles and techniques of acupuncture treatment and organized their own private schools or ryu-ha in Japan. In 1635, when the Edo government decided to close the country, Japan cut-off exchange with foreign countries for over 200 years. The national isolation caused some development that was unique to Japan. During that time, acupuncture filtered into people's everyday lives. Moxibustion, in particular, became popular as a treatment that ordinary people could practice by themselves. Also in this period of isolation, Western medicine was imported from Holland, the only country allowed to maintain trade with Japan. This novel modern medicine had a strong impact on Japanese medicine, which has its foundation of Chinese traditional medicine. At the same time, Japanese acupuncture was introduced into Europe via Holland. When Japan opened its borders in 1865 period, the new government was eager to accept Western culture to the extent of prohibiting the progress of Japanese acupuncture for a period of time. Even so, Japanese acupuncture has survived and flourished up to the present day due to the strong demand and the great efforts of the practitioners. Scientific studies are now in the process of establishing a firm evidence base for over a millennium of clinical use, respecting the classic ideas of the traditional treatment.
Japanese supercomputer technology.
Buzbee, B L; Ewald, R H; Worlton, W J
1982-12-17
Under the auspices of the Ministry for International Trade and Industry the Japanese have launched a National Superspeed Computer Project intended to produce high-performance computers for scientific computation and a Fifth-Generation Computer Project intended to incorporate and exploit concepts of artificial intelligence. If these projects are successful, which appears likely, advanced economic and military research in the United States may become dependent on access to supercomputers of foreign manufacture.
The Lived Experiences of "Taibatsu" in Japanese High School Wrestling
ERIC Educational Resources Information Center
Kumate, James M.; Falcous, Mark
2015-01-01
The issue of "taibatsu" (physical punishment) in Japanese sport has received high-profile media and public attention in recent years. This article addresses the retrospective experiences of "taibatsu" within Japanese high school wrestling, drawing upon a three-month ethnography that included semi-structured interviews. Our…
Beliefs and Practices of Writing Instruction in Japanese Elementary Schools
ERIC Educational Resources Information Center
Spence, Lucy K.; Kite, Yuriko
2018-01-01
Focusing on writing instruction within an era of international curricular reform, this study analysed classroom observations, educator interviews, and documents related to Japanese elementary writing instruction. A deductive approach using discourses of writing framework and an inductive approach to Japanese cultural practices uncovered beliefs…
5. NORTHWEST FACADE OF JAPANESE TEA HOUSE, 1950s, BY YOSHIMIERA ...
5. NORTHWEST FACADE OF JAPANESE TEA HOUSE, 1950s, BY YOSHIMIERA IN SUKIYA SHOIN STYLE AFTER THE KATSURA IMPERIAL VILLA - Kykuit, Japanese Tea House, 200 Lake Road, Pocantico Hills, Westchester County, NY
Potent antioxidant and radical-scavenging activities of traditional Japanese cereal grains.
Higashi-Okai, Kiyoka; Ishida, Emi; Nakamura, Yumiko; Fujiwara, Satomi; Okai, Yasuji
2008-12-01
To estimate the preventive potential of Japanese traditional cereals against oxygen radical-related chronic diseases such as cardiovascular diseases and diabetes, antioxidant and radical-scavenging activities in the extracts of five Japanese traditional cereal grains were analyzed by using an assay system of lipid peroxidation and a radical compound, 1,1-diphenyl-2-picrylhydrazyl (DPPH). DPPH radical-scavenging activities in the extracts of Japanese cereal grains were divided into two groups. One group including Japanese sorghum, black rice and red rice showed strong radical-scavenging activities, but the other group including Japanese barnyard millet and foxtail millet did not exhibit significant radical-scavenging activities. The DPPH radical-scavenging activities of these extracts were closely correlated to the contents of phenolic compound in the extracts, but not to the sugar or protein content in the extracts. In contrast, all the methanol and water extracts of the cereal grains caused significant antioxidant activities against hydroperoxide generation in the peroxidation of linoleic acid, in which the water extracts of these cereal grains caused much higher antioxidant activities than the methanol extracts of the same cereals. These results suggest that Japanese traditional cereals contain qualitatively different principles associated with antioxidant and radical-scavenging activities, and possible principles responsible for the antioxidant and radical-scavenging activities in the cereal grains are discussed.
Unaccusative Mismatches in Japanese.
ERIC Educational Resources Information Center
Tsujimura, Natsuko
Two instances of unaccusative verb mismatches in Japanese are examined. An unaccusative mismatch is the situation in which a different accusative diagnostic singles out different classes of intransitive verbs within and across languages. One type of unaccusative mismatch has to do with group C verbs, or verbs of manner with protagonist control.…
ERIC Educational Resources Information Center
Rubin, Michael; Funato, Makiko
This set of materials for Japanese second language instruction was designed for students who can be taught most effectively through a functional, conversational approach. It is intended as a supplement to the regular course of study so that all students, regardless of ability level, can be provided with an effective instructional program. It…
An overview of Japanese occupational health.
Reich, M R; Frumkin, H
1988-01-01
This paper provides an overview of Japanese occupational health and evaluates the current situation from three perspectives. Major occupational health hazards are assessed using four sources of data, showing patterns similar to those found in other advanced industrial societies. Institutional structures for occupational health policy are then examined, illustrating strengths and weaknesses of the Japanese legal and administrative systems. Trade union activities are presented, indicating the constraints of enterprise unions, and the tendency for a greater orientation toward compensation than prevention. Significant occupational health problems persist among marginal workers in Japan, including women and various minority groups. The analysis demonstrates a record for occupational health in Japan considerably more mixed than the conventional view. PMID:2968056
Language, Culture and Ethnicity: Interplay of Ideologies within a Japanese Community in Brazil
ERIC Educational Resources Information Center
Sakuma, Tomoko
2011-01-01
This dissertation is a sociolinguistic study of the ideologies about language, culture and ethnicity among Japanese immigrants and descendants in Brazil (hereafter, Nikkeis) who gather at a local Japanese cultural association, searching for what it means to be "Japanese" in Brazil. This study focuses on how linguistic behaviors are…
World War I, international participation and reorganisation of the Japanese chemical community.
Kikuchi, Yoshiyuki
2011-07-01
What kind of "war" did Japanese chemists fight during World War I, and what impact did their experiences have on Japanese chemistry in its aftermath? By focusing on the role of Jōji Sakurai (1858-1939), this paper attempts to answer these questions by looking at the drastic changes in the international relationships of the Japanese chemical community caused by the war. It examines how the Japanese National Research Council was established in 1920 as part of the International Research Council, a product of the reconfiguration of international scientific powers triggered by World War I. This paper argues that Sakurai advocated the establishment of the National Research Council after the American model of wartime mobilisation of science, coordinated fractured Japanese chemical communities for international functions, and facilitated Japan's participation and increased influence in international scientific associations such as the International Union of Pure and Applied Chemistry, established in 1919.
7 CFR 301.48-6 - Movement of live Japanese beetles.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 5 2012-01-01 2012-01-01 false Movement of live Japanese beetles. 301.48-6 Section 301.48-6 Agriculture Regulations of the Department of Agriculture (Continued) ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE DOMESTIC QUARANTINE NOTICES Japanese Beetle Quarantine and...
7 CFR 301.48-6 - Movement of live Japanese beetles.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 5 2011-01-01 2011-01-01 false Movement of live Japanese beetles. 301.48-6 Section 301.48-6 Agriculture Regulations of the Department of Agriculture (Continued) ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE DOMESTIC QUARANTINE NOTICES Japanese Beetle Quarantine and...
Changes in Academic Entrepreneurship among Japanese University Bioscientists, 1980-2012
ERIC Educational Resources Information Center
Kameo, Nahoko
2014-01-01
The dissertation examines how Japanese university scientists in the biosciences responded to legal and institutional changes in academic entrepreneurship. Beginning in the 1990s, the Japanese government initiated a series of policy initiatives that attempted to imitate the U.S. academic environment's approach to promoting entrepreneurship. Using…
Food nitrogen footprint reductions related to a balanced Japanese diet.
Oita, Azusa; Nagano, Ichiro; Matsuda, Hiroyuki
2018-04-01
Dietary choices largely affect human-induced reactive nitrogen accumulation in the environment and resultant environmental problems. A nitrogen footprint (NF) is an indicator of how an individual's consumption patterns impact nitrogen pollution. Here, we examined the impact of changes in the Japanese diet from 1961 to 2011 and the effect of alternative diets (the recommended protein diet, a pescetarian diet, a low-NF food diet, and a balanced Japanese diet) on the food NF. The annual per capita Japanese food NF has increased by 55% as a result of dietary changes since 1961. The 1975 Japanese diet, a balanced omnivorous diet that reportedly delays senescence, with a protein content similar to the current level, reduced the current food NF (15.2 kg N) to 12.6 kg N, which is comparable to the level in the recommended protein diet (12.3 kg N). These findings will help consumers make dietary choices to reduce their impacts on nitrogen pollution.
Antiinflammatory effect of Japanese horse chestnut (Aesculus turbinata) seeds.
Sato, Itaru; Kofujita, Hisayoshi; Suzuki, Tadahiko; Kobayashi, Haruo; Tsuda, Shuji
2006-05-01
The antiinflammatory effects of Japanese horse chestnut (Aesculus turbinata) seeds were examined in vivo and in vitro. The extract of this seed (HCSE) inhibited croton oil-induced swelling of the mouse concha. HCSE inhibited cyclooxygenase (COX) -1 and -2 activities, but had no effect on 15-lipoxygenase and phospholipase A2 activities. Inhibition of COX-2 occurred at a lower concentration of HCSE than for COX-1. Japanese horse chestnut seeds contain coumarins and saponins, but these chemicals did not inhibit COX activities. These results suggest that the antiinflammatory effect of Japanese horse chestnut seeds is caused, at least partly, by the inhibition of COX. The inhibitor of COX in this seed may be a chemical(s) other than coumarins and saponins.
Officials welcome the arrival of the Japanese Experiment Module
2007-04-17
In the Space Station Processing Facility, NASA and Japanese Aerospace and Exploration Agency (JAXA) officials welcome the arrival of the Experiment Logistics Module Pressurized Section for the Japanese Experiment Module, or JEM, to the Kennedy Space Center. Seen here at right are JAXA representatives, including Japanese astronaut Takao Doi (center of front row), who is a crew member for mission STS-123 that will deliver the module to the space station. The new International Space Station component arrived at Kennedy March 12 to begin preparations for its future launch on mission STS-123. It will serve as an on-orbit storage area for materials, tools and supplies. It can hold up to eight experiment racks and will attach to the top of another larger pressurized module.
Availability of Japanese subsidies for international telemedicine projects.
Nakajima, I; Tsurumi, T; Sawada, Y; Juzoji, H; Ogushi, Y
1999-10-01
In this article, the authors report the methods for obtaining subsidies for overseas telemedicine projects from Japanese sources based on their own personal experiences. The Japanese Government is already subsidizing such specialized NGOs (Non-Governmental Organizations) as the Telemedicine Society of Japan and Basic Human Needs and, Japanese trading companies are also hiring telemedicine experts. Prospective methods for obtaining subsidies are outlined as under the following headings: Assistance without compensation, Technology transfer, Grass-roots grant assistance, the Telecommunications Advancement Organization, Postal Savings for International Voluntary Aid, Venture business development funds provided by the Ministry of International Trade and Industry, Mission demonstration satellites by the National Space Development Agency of Japan, the Sasakawa Pacific Island Nations Fund, and International Communications Foundation. Key points of the applications are noted under (1) Degree of contribution to local residents, (2) Significance of project continuation and (3) Novelty and economic impact.
Adaptive ingredients against food spoilage in Japanese cuisine.
Ohtsubo, Yohsuke
2009-12-01
Billing and Sherman proposed the antimicrobial hypothesis to explain the worldwide spice use pattern. The present study explored whether two antimicrobial ingredients (i.e. spices and vinegar) are used in ways consistent with the antimicrobial hypothesis. Four specific predictions were tested: meat-based recipes would call for more spices/vinegar than vegetable-based recipes; summer recipes would call for more spices/vinegar than winter recipes; recipes in hotter regions would call for more spices/vinegar; and recipes including unheated ingredients would call for more spices/vinegar. Spice/vinegar use patterns were compiled from two types of traditional Japanese cookbooks. Dataset I included recipes provided by elderly Japanese housewives. Dataset II included recipes provided by experts in traditional Japanese foods. The analyses of Dataset I revealed that the vinegar use pattern conformed to the predictions. In contrast, analyses of Dataset II generally supported the predictions in terms of spices, but not vinegar.
Japanese workplace health management in pneumoconiosis prevention
JP, Naw Awn; Imanaka, Momo; Suganuma, Narufumi
2016-01-01
Objective: The Japanese government established the Pneumoconiosis Law in 1960 to protect health and promote the welfare of workers engaged in dust-exposed works. This article describes Japanese practice in workplace health management as regulated by the Pneumoconiosis Law to reduce pneumoconiosis in Japan. Methods: We collected information addressing pneumoconiosis and the health care of dust-exposed workers. We included all types of scientific papers found through a PubMed search as well as official reports, guidelines, and relevant laws published by the Ministry of Health, Labour and Welfare (MHLW) of Japan and other academic institutions. Results: In the past, pneumoconiosis has been a major cause of mortality and morbidity for Japanese workers engaged in dust-exposed work. The Pneumoconiosis Law introduced a system of pneumoconiosis health examination and health supervision to protect workers' health. According to the periodic pneumoconiosis health examination reports in Japan, the prevalence of pneumoconiosis fell from the highest reported figure of 17.4% in 1982, where 265,720 examinations were conducted, to 1% in 2013 in which 243,740 workers were examined. The number of new cases of pneumoconiosis dropped from 6,842 cases in 1980 to 227 cases in 2013. One hundred and seventy two workers were diagnosed as having pneumoconiosis complications in 1980; however, the number fell to five in 2013. Conclusion: After reaching its peak in the 1980s, pneumoconiosis and its complications fell each year. The achievement of Japanese pneumoconiosis prevention can be credited to a comprehensive provision for worker health, regulated by a thorough legal framework. PMID:27980247
Fujii, Tsukasa; Ogino, Satoshi; Arimoto, Hiroe; Irifune, Morihiro; Iwata, Nobuko; Ookawachi, Ichiro; Kikumori, Hiroshi; Seo, Ritsu; Takeda, Mariko; Tamaki, Akiko; Baba, Kenji; Nose, Michihiro
2006-10-01
The number of patients with Japanese cedar pollinosis (JCP) is increasing, and now, has extended up to about 15% of the Japanese. It is reported that the QOL is an important outcome in the JCP treatment. This study aimed to evaluate the QOL in patients with JCP by means of the SF-8 Health Survey (Japanese Version), a new, even shorter generic health survey. 411 patients with JCP who visited 10 ENT clinics in Osaka from March 14 to March 26 (peak pollen season) were questioned, and 204 patients without any treatments in this season were engaged in this study as subjects. In this study, the QOL scores were evaluated using the SF-8. This is an 8-item version of the SF-36 that yields a comparable 8-dimension health profile and comparable estimates of summary scores for the physical and mental components of health. The QOL score depressed in the patients with JCP compared with healthy subjects (Japanese national norms). Both Mental Component Score (MCS) and Physical Component Score (PCS) scores decreased more in females than in males. In females, MCS were significantly lower than national norms. The older the patients were, the lower PCS scores were showed. The severity of nasal symptoms influenced the PCS scores. These results showed the tendency similar to the early studies using SF-36 questionnaire. The sensitivity of SF-8 in the individual is not better than that of other specific QOL questionnaires, but SF-8 can be answered in a short time compared with other questionnaires including SF-36. We suggested that SF-8 become a useful questionnaire in the future.
A Japanese version of the Rosenberg Self-Esteem Scale: translation and equivalence assessment.
Mimura, Chizu; Griffiths, Peter
2007-05-01
A Japanese version of the Rosenberg Self-Esteem Scale (RSES) was developed through the forward-backward translation procedure. Married couples consisting of a native English speaker and a native Japanese speaker acted as translators to enhance the representativeness of language in the target population. Multiple translations were produced, and a panel of reviewers identified problems in conceptual and semantic equivalence between the original scale and the translated version. The Japanese version was altered accordingly with reference to alternate Japanese forms from the original English to Japanese translations. The altered translation was again retranslated into English, and problematic differences were checked. This forward-backward process was repeated until satisfactory agreement had been attained. The RSES was administered to 222 native English speakers, and the developed Japanese version (RSES-J) was administered to 1320 native Japanese speakers. Factor analysis revealed nearly identical factor structure and structural coefficients of the items between two sets of data. Target rotation confirmed the factorial agreement of the two scales in different cultural groups. High Cronbach's alpha coefficients supported the reliability of test scores on both versions. The equivalence between the RSES and the RSES-J was supported in this study. It is suggested that the RSES and the RSES-J are potential tools for comparative cross-cultural studies.
Japanese International Female Students' Experience of Discrimination, Prejudice, and Stereotypes
ERIC Educational Resources Information Center
Bonazzo, Claude; Wong, Y. Joel
2007-01-01
This qualitative study examined four Japanese international female college students' experience of discrimination, prejudice, and stereotypes in a predominately white university. Four themes emerged from the analysis of data: (1) overt forms of prejudice and discrimination; (2) stereotypes common to Asians; (3) stereotypes unique to the Japanese;…
Japanese Fathers of Preschoolers and Their Involvement in Child Care
ERIC Educational Resources Information Center
Ishii-kuntz, Masako; Makino, Katsuko; Kato, Kuniko; Tsuchiya, Michiko
2004-01-01
We examine how relative resources, time availability, gender ideology, living arrangement, child-care demand, and job satisfaction are associated with the levels of younger Japanese fathers involvement in child care for preschoolers. A theoretical model that includes these factors is tested using 1994 data collected from Japanese fathers and…
"Delays and Vexation": Jack London and the Russo-Japanese War.
ERIC Educational Resources Information Center
Sweeney, Michael S.
1998-01-01
Contributes to scholarship on journalism history and censorship by discussing Jack London's efforts as a war correspondent to cover the Russo-Japanese War in Korea and Manchuria in 1904. Focuses on the difficulties he encountered as a result of systematic and highly restrictive censorship by the Japanese. (SR)
Synchronous versus Asynchronous CMC and Transfer to Japanese Oral Performance
ERIC Educational Resources Information Center
Hirotani, Maki
2009-01-01
This study investigated the effects of synchronous and asynchronous CMC (computer-mediated communication)on the development of linguistic features of learners' speech in Japanese. Using learners from fourth-semester Japanese classes, the following research questions were examined: (a) Does CMC have positive effects on the development of oral…
Semantic Bias in the Acquisition of Relative Clauses in Japanese
ERIC Educational Resources Information Center
Ozeki, Hiromi; Shirai, Yasuhiro
2010-01-01
This study analyzes the acquisition of relative clauses in Japanese to determine the semantic and functional characteristics of children's relative clauses in spontaneous speech. Longitudinal data from five Japanese children are analyzed and compared with English data (Diessel & Tomasello, 2000). The results show that the relative clauses produced…
Japanese Physical Education Teachers' Beliefs about Teaching Students with Disabilities
ERIC Educational Resources Information Center
Sato, Takahiro; Hodge, Samuel R.; Murata, Nathan M.; Maeda, Julienne K.
2007-01-01
The purpose of this study was to describe Japanese physical education (PE) teachers' beliefs about teaching students with disabilities in integrated classes. Participants were five Japanese PE teachers (one women and four men). The research was descriptive and qualitative, using an interviewing method. Data were gathered in interviews, analysed…
The Integration of Religious Traditions in Japanese Children's View of Death and Afterlife
ERIC Educational Resources Information Center
Sagara-Rosemeyer, Miharu; Davies, Betty
2007-01-01
Open and public discussion of death, particularly among children, remains one of the greatest Japanese societal taboos; therefore, little is known about Japanese children's perceptions of death. To explore Japanese children's notions of life and death, 16 healthy children (7 girls and 9 boys, mean age 8.9) were each interviewed 3 times and asked…
Ecological Effects in Cross-Cultural Differences Between U.S. and Japanese Color Preferences.
Yokosawa, Kazuhiko; Schloss, Karen B; Asano, Michiko; Palmer, Stephen E
2016-09-01
We investigated cultural differences between U.S. and Japanese color preferences and the ecological factors that might influence them. Japanese and U.S. color preferences have both similarities (e.g., peaks around blue, troughs around dark-yellow, and preferences for saturated colors) and differences (Japanese participants like darker colors less than U.S. participants do). Complex gender differences were also evident that did not conform to previously reported effects. Palmer and Schloss's (2010) weighted affective valence estimate (WAVE) procedure was used to test the Ecological Valence Theory's (EVT's) prediction that within-culture WAVE-preference correlations should be higher than between-culture WAVE-preference correlations. The results supported several, but not all, predictions. In the second experiment, we tested color preferences of Japanese-U.S. multicultural participants who could read and speak both Japanese and English. Multicultural color preferences were intermediate between U.S. and Japanese preferences, consistent with the hypothesis that culturally specific personal experiences during one's lifetime influence color preferences. Copyright © 2015 Cognitive Science Society, Inc.
The Impact of Western Criticisms of Japanese Rhetorical Approaches on Learners of Japanese
ERIC Educational Resources Information Center
McKinley, Jim
2014-01-01
For learners of Japanese, a conundrum arises at university level as they are expected to be able to shift between direct and indirect language in various writing tasks. The apparent indirectness in inductive language is required of regular writing tasks such as response essays and e-mails, while the directness of deductive academic writing, a…
Case Study on Codeswitching in a Japanese-English Bilingual Family
ERIC Educational Resources Information Center
Numadate, Jenny
2008-01-01
This paper showcases a case study documenting the intended and actual language practices of a Japanese-English bicultural family. The study focuses on a family consisting of a Japanese father, Australian mother, son and daughter living in Japan. The parents were interviewed by questionnaire to determine their intended language practices. The…
Children of the "Danchi": A Japanese Primary School for Newcomers
ERIC Educational Resources Information Center
Gordon, June A.
2009-01-01
Practices and policies of Japanese schooling for immigrant and marginalised students are examined through the lens of a primary school which serves one of the largest foreign student populations in Japan. Student families include Southeast Asian refugees, South American immigrants of Japanese descent, recent and longstanding Chinese and Koreans,…
Variability in Written Japanese: Towards a Sociolinguistics of Script Choice.
ERIC Educational Resources Information Center
Smith, Janet S.; Schmidt, David L.
1996-01-01
Tests widely-held associations among script types, genres, writers, and target readers via statistical analysis in popular Japanese fiction. Subjects texts to lexical analysis to see whether choice of vocabulary can account for variability in script selection. Finds that Japanese writers fashion their script type choices to specific contexts, as…
Morita, K; Nabeshima, T; Buerano, C C
2015-08-01
Japanese encephalitis (JE) is an inflammation of the central nervous system in humans and animals, specifically horses and cattle. The disease, which can sometimes be fatal, is caused by the flavivirus Japanese encephalitis virus (JEV), of which there are five genotypes (genotypes 1, 2, 3, 4 and 5). The transmission cycle of the virus involves pigs and wild birds as virus amplifiers and mosquitoes as vectors for transferring the virus between amplifying hosts and to dead- end hosts, i.e. humans, horses and cattle. In horses and cattle the disease is usually asymptomatic, but when clinical signs do occur they include fever, decreased appetite, frothing at the mouth, rigidity of the legs and recumbency, and neurological signs, such as convulsive fits, circling, marked depression and disordered consciousness. In pigs, it can cause abortion and stillbirths. At present, the virus is detected in a wide area covering eastern and southern Asia, Indonesia, northern Australia, Papua New Guinea and Pakistan. JEV RNA has also been detected in Italy, first in dead birds in 1997 and 2000 and then in mosquitoes in 2010. Genotype shift, i.e. a change of genotype from genotype 3 to genotype 1, has occurred in some countries, namely Japan, South Korea, Chinese Taipei and Vietnam. Laboratory methods are available for confirming the causative agent of the disease. There are control measures to prevent or minimise infection and, among them, vaccination is one of the most important and one which should be adopted in endemic and epidemic areas.
Japanese Americans' health concerns and depressive symptoms: implications for disaster counseling.
Cheung, Monit; Leung, Patrick; Tsui, Venus
2013-07-01
This study examined factors contributing to depressive symptoms among Japanese Americans. Data were collected in Houston, Texas, in 2008, before the March 2011 Japan earthquake, through a community survey including demographic and mental health questions and the Hopkins Symptoms Checklist. Among 43 Japanese American respondents in this convenience sample, the depression prevalence was 11.6 percent. Chi-square results found that having anxiety symptoms and holding a master's degree had statistically significant relationships with depressive symptoms. An independent sample t test found that those having depressive symptoms experienced significantly more health issues than those without depressive symptoms. When these statistically significant variables were entered into a logistic regression model, the overall effect of having health issues, anxiety symptoms, and a master's degree collectively predicted depressive symptoms. It was also found that Japanese Americans rarely consult mental health professionals; in particular, female Japanese American respondents tend to seek help from religious leaders. As implied by these findings, the reluctance of Japanese Americans to seek formal help can be explained by social stigma, a health-oriented approach to treatment, and other cultural considerations. Practice implications focus on disaster counseling with a connection between mental health needs and health care support.
Yanagihara, Katsunori; Watanabe, Akira; Aoki, Nobuki; Matsumoto, Tetsuya; Yoshida, Masaki; Sato, Junko; Wakamura, Tomotaro; Sunakawa, Keisuke; Kadota, Junichi; Kiyota, Hiroshi; Iwata, Satoshi; Kaku, Mitsuo; Hanaki, Hideaki; Ohsaki, Yoshinobu; Fujiuchi, Satoru; Takahashi, Manabu; Takeuchi, Kenichi; Takeda, Hiroaki; Ikeda, Hideki; Miki, Makoto; Nakanowatari, Susumu; Takahashi, Hiroshi; Utagawa, Mutsuko; Nishiya, Hajime; Kawakami, Sayoko; Morino, Eriko; Takasaki, Jin; Mezaki, Kazuhisa; Chonabayashi, Naohiko; Tanaka, Chie; Sugiura, Hideko; Goto, Hajime; Saraya, Takeshi; Kurai, Daisuke; Katono, Yasuhiro; Inose, Rika; Niki, Yoshihito; Takuma, Takahiro; Kudo, Makoto; Ehara, Shigeru; Sato, Yoshimi; Tsukada, Hiroki; Watabe, Nobuei; Honma, Yasuo; Mikamo, Hiroshige; Yamagishi, Yuka; Nakamura, Atsushi; Ohashi, Minoru; Seki, Masafumi; Hamaguchi, Shigeto; Toyokawa, Masahiro; Fujikawa, Yasunori; Mitsuno, Noriko; Ukimura, Akira; Miyara, Takayuki; Nakamura, Takahito; Mikasa, Keiichi; Kasahara, Kei; Ui, Koji; Fukuda, Saori; Nakamura, Akihiro; Morimura, Mika; Yamashita, Mikio; Takesue, Yoshio; Wada, Yasunao; Sugimoto, Keisuke; Kusano, Nobuchika; Nose, Motoko; Mihara, Eiichirou; Kuwabara, Masao; Doi, Masao; Watanabe, Yaeko; Tokuyasu, Hirokazu; Hino, Satoshi; Negayama, Kiyoshi; Mukae, Hiroshi; Kawanami, Toshinori; Ota, Toshiyuki; Fujita, Masaki; Honda, Junichi; Hiramatsu, Kazufumi; Aoki, Yosuke; Fukuoka, Mami; Magarifuchi, Hiroki; Nagasawa, Zenzo; Kaku, Norihito; Fujita, Jiro; Higa, Futoshi; Tateyama, Masao
2017-09-01
The nationwide surveillance on antimicrobial susceptibility of bacterial respiratory pathogens from the patients in Japan was conducted by Japanese Society of Chemotherapy, Japanese association for infectious diseases and Japanese society for Clinical Microbiology in 2012. The isolates were collected from clinical specimens obtained from well-diagnosed adult patients with respiratory tract infections during the period between January and December in 2012 by three societies. Antimicrobial susceptibility testing was conducted at the central reference laboratory according to the method recommended by Clinical Laboratory Standard Institutes. Susceptibility testing was evaluated in 1236 strains (232 Staphylococcus aureus, 225 Streptococcus pneumoniae, 16 Streptococcus pyogenes, 231 Haemophilus influenzae, 147 Moraxella catarrhalis, 167 Klebsiella pneumoniae and 218 Pseudomonas aeruginosa). Ratio of methicillin-resistant S. aureus was 51.3%, and those of penicillin-intermediate S. pneumoniae was 0.4%. Among H. influenzae, 5.6% of them were found to be β-lactamase-producing ampicillin-resistant strains, and 37.2% to be β-lactamase-non-producing ampicillin-resistant strains. Extended spectrum β-lactamase-producing K. pneumoniae and multi-drug resistant P. aeruginosa with metallo β-lactamase were 4.2% and 3.2%, respectively. Continuous national surveillance is important to determine the actual situation of the resistance shown by bacterial respiratory pathogens to antimicrobial agents. Copyright © 2017 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Social Networks and the Maintenance of Conformity: Japanese sojourner women
Saint Arnault, Denise; Roles, Deborah J.
2011-01-01
Asian immigrant women have the lowest utilization of mental health services of any ethnic minority (Garland, Lau, Yeh & McCabe 2005). Because help seeking for distress occurs within social networks, we examined how social networks supported or disabled help seeking for Japanese sojourners living in the US. Unfortunately, most of the literature about Japanese social relationships focuses on men in organizational settings. This study used intensive ethnographic interviewing with 49 Japanese expatriate women to examine how social relationships influenced psychosocial distress and help seeking. We found that the women in these samples engaged in complex, highly regulated, complicated and obligatory relationships through their primary affiliation with other “company wives.” Like many immigrant women, increased traditional cultural norms (referred to in Japanese as ryoosai kenbo, or good wives and wise mothers), were expected from these modern women, and the enactment of these roles was enforced through scrutiny, gossip and the possibility of ostracism. Fears of scrutiny was described by the women as a primary barrier to their self-disclosure and ultimate help seeking. Understanding the social organization and support within the Japanese women's community is central to understanding how culturally specific social networks can both give support, as well as create social constraints to help seeking. Health oriented prevention programs must consider these social factors when evaluating the immigration stressors faced by these families. PMID:23162609
Social Networks and the Maintenance of Conformity: Japanese sojourner women.
Saint Arnault, Denise; Roles, Deborah J
2012-08-01
Asian immigrant women have the lowest utilization of mental health services of any ethnic minority (Garland, Lau, Yeh & McCabe 2005). Because help seeking for distress occurs within social networks, we examined how social networks supported or disabled help seeking for Japanese sojourners living in the US. Unfortunately, most of the literature about Japanese social relationships focuses on men in organizational settings. This study used intensive ethnographic interviewing with 49 Japanese expatriate women to examine how social relationships influenced psychosocial distress and help seeking. We found that the women in these samples engaged in complex, highly regulated, complicated and obligatory relationships through their primary affiliation with other "company wives." Like many immigrant women, increased traditional cultural norms (referred to in Japanese as ryoosai kenbo, or good wives and wise mothers), were expected from these modern women, and the enactment of these roles was enforced through scrutiny, gossip and the possibility of ostracism. Fears of scrutiny was described by the women as a primary barrier to their self-disclosure and ultimate help seeking. Understanding the social organization and support within the Japanese women's community is central to understanding how culturally specific social networks can both give support, as well as create social constraints to help seeking. Health oriented prevention programs must consider these social factors when evaluating the immigration stressors faced by these families.
Altered brain activity for phonological manipulation in dyslexic Japanese children
Yamamoto, Hisako; Oba, Kentaro; Terasawa, Yuri; Moriguchi, Yoshiya; Uchiyama, Hitoshi; Seki, Ayumi; Koeda, Tatsuya; Inagaki, Masumi
2013-01-01
Because of unique linguistic characteristics, the prevalence rate of developmental dyslexia is relatively low in the Japanese language. Paradoxically, Japanese children have serious difficulty analysing phonological processes when they have dyslexia. Neurobiological deficits in Japanese dyslexia remain unclear and need to be identified, and may lead to better understanding of the commonality and diversity in the disorder among different linguistic systems. The present study investigated brain activity that underlies deficits in phonological awareness in Japanese dyslexic children using functional magnetic resonance imaging. We developed and conducted a phonological manipulation task to extract phonological processing skills and to minimize the influence of auditory working memory on healthy adults, typically developing children, and dyslexic children. Current experiments revealed that several brain regions participated in manipulating the phonological information including left inferior and middle frontal gyrus, left superior temporal gyrus, and bilateral basal ganglia. Moreover, dyslexic children showed altered activity in two brain regions. They showed hyperactivity in the basal ganglia compared with the two other groups, which reflects inefficient phonological processing. Hypoactivity in the left superior temporal gyrus was also found, suggesting difficulty in composing and processing phonological information. The altered brain activity shares similarity with those of dyslexic children in countries speaking alphabetical languages, but disparity also occurs between these two populations. These are initial findings concerning the neurobiological impairments in dyslexic Japanese children. PMID:24052613
Infant sleeping arrangements and cultural values among contemporary Japanese mothers
Shimizu, Mina; Park, Heejung; Greenfield, Patricia M.
2014-01-01
We examined infant sleeping arrangements and cultural values of Japanese mothers in 2008 and 2009. Based on Greenfield's theory of social change and human development, we predicted that social change in Japan over the last decades (higher economic and education level, urbanization, complex technology, more women in the work force) would lead to a decline in mother-infant co-sleeping, compared with published findings concerning Japanese sleeping arrangements in the 1960s and 1980s. We also predicted that the practice of having babies sleep in their own beds and/or own rooms would be supported by ethnotheories stressing infant independence and other values adaptive in an urban, technologically sophisticated, relatively wealthy, and highly educated populace. Fifty-one Japanese mothers' comments posted on Internet parenting forums were analyzed. Contrary to our hypothesis, co-sleeping was as frequent among Japanese mothers in 2008-2009 as it had been in the 1960s and 1980s. However, analysis of the values of co-sleeping mothers revealed frequent discrepancies between values and practices. In contrast, the minority of mothers whose babies slept alone in a separate room all expressed consonant values. Our qualitative analysis indicates that it is not always easy for Japanese mothers to construct values for child rearing and gender roles that integrate traditional infant care practices with current sociodemographic conditions. PMID:25191281
Altered brain activity for phonological manipulation in dyslexic Japanese children.
Kita, Yosuke; Yamamoto, Hisako; Oba, Kentaro; Terasawa, Yuri; Moriguchi, Yoshiya; Uchiyama, Hitoshi; Seki, Ayumi; Koeda, Tatsuya; Inagaki, Masumi
2013-12-01
Because of unique linguistic characteristics, the prevalence rate of developmental dyslexia is relatively low in the Japanese language. Paradoxically, Japanese children have serious difficulty analysing phonological processes when they have dyslexia. Neurobiological deficits in Japanese dyslexia remain unclear and need to be identified, and may lead to better understanding of the commonality and diversity in the disorder among different linguistic systems. The present study investigated brain activity that underlies deficits in phonological awareness in Japanese dyslexic children using functional magnetic resonance imaging. We developed and conducted a phonological manipulation task to extract phonological processing skills and to minimize the influence of auditory working memory on healthy adults, typically developing children, and dyslexic children. Current experiments revealed that several brain regions participated in manipulating the phonological information including left inferior and middle frontal gyrus, left superior temporal gyrus, and bilateral basal ganglia. Moreover, dyslexic children showed altered activity in two brain regions. They showed hyperactivity in the basal ganglia compared with the two other groups, which reflects inefficient phonological processing. Hypoactivity in the left superior temporal gyrus was also found, suggesting difficulty in composing and processing phonological information. The altered brain activity shares similarity with those of dyslexic children in countries speaking alphabetical languages, but disparity also occurs between these two populations. These are initial findings concerning the neurobiological impairments in dyslexic Japanese children.
Suzuki, Nozomu; Goto, Yoshihito; Ota, Haruka; Kito, Kumiko; Mano, Fumika; Joo, Erina; Ikeda, Kaori; Inagaki, Nobuya; Nakayama, Takeo
2018-01-01
International interest in the Japanese diet has grown in recent years. The aim of this systematic review was to evaluate and organize the Japanese diet and dietary characteristics from an epidemiological perspective, mainly focusing on the nutritional and dietary elements. PubMed, Web of Science, Japan Medical Abstracts Society, JDream III, and CiNii databases were searched. The eligibility criteria included research with an epidemiological study design that was either cross-sectional, cohort, or case-control-based that defined the dietary patterns of the Japanese diet using dietary pattern analysis. A total of 39 research articles that described the Japanese diet were included. The data that were extracted included the following: implementing country, location, study design, participant characteristics, key outcomes, methods used in the analysis of dietary patterns, and descriptions of the Japanese diet. As a result of the systematic review analyzing the descriptions of the Japanese diet from 39 selected articles, we were able to aggregate the descriptions into 16 categories from 33 factors. After performing a content analysis using a further aggregation of categories, we found that the top three applicable categories were soybeans/soybean-derived products, seafood, and vegetables; these were followed by rice and miso soup. The Japanese dietary content was found to be diverse based on an examination of epidemiological studies; however, we were able to aggregate the content into 16 categories. The Japanese diet is considered to be a dietary pattern that contains a combination of factors: the dietary staple, side dishes, and soup.
Factor structure of the Japanese Interpersonal Competence Scale.
Matsudaira, Tomomi; Fukuhara, Taihei; Kitamura, Toshinori
2008-04-01
Assessing social competence is important for clinical and preventive interventions of depression. The aim of the present paper was to examine the factor structure of the Japanese Interpersonal Competence Scale (JICS). Exploratory and confirmatory factor analysis was performed on the survey responses of 730 participants. Simultaneous multigroup analyses were conducted to confirm factor stability across psychological health status and sex differences. Two factors, which represent Perceptive Ability and Self-Restraint, were confirmed to show a moderate correlation. Perceptive Ability involves a more cognitive aspect of social competence, while Self-Restraint involves a more behavioral aspect, both of which are considered to reflect the emotion-based relating style specific to the Japanese people: indulgent dependence (amae) and harmony (wa). In addition, Self-Restraint may be linked to social functioning. Both constructs may confound a respondent's perceived confidence. Despite its shortcomings, the JICS is a unique measure of social competence in the Japanese cultural context.
Experiences of Japanese Nurse Scholars: Insights for U.S. Faculty.
ERIC Educational Resources Information Center
Doutrich, Dawn
2001-01-01
Phenomenological analysis of interviews with 22 Japanese nurses with graduate degrees from U.S. schools and 3 Japanese nurse consultants showed how graduate education changed their ways of being and sense of self. They became more verbal, direct, and articulate about personal preferences. Some experienced a sense of loss or alienation upon…
Development of Text Reading in Japanese: An Eye Movement Study
ERIC Educational Resources Information Center
Jincho, Nobuyuki; Feng, Gary; Mazuka, Reiko
2014-01-01
This study examined age-group differences in eye movements among third-grade, fifth-grade, and adult Japanese readers. In Experiment 1, Japanese children, but not adults, showed a longer fixation time on logographic kanji words than on phonologically transparent hiragana words. Further, an age-group difference was found in the first fixation…
"Juku" and the Performance of Japanese Students: An American Perspective.
ERIC Educational Resources Information Center
Dolly, John P.
This report outlines the role of after school programs (Juku) in preparing Japanese students for high school and university entrance examinations and presents some growing concerns about the movement. Juku plays a major role in insuring the success of Japanese students on tests administered within the country and on international comparisons made…
Nakano, Hideki; Kodama, Takayuki; Ukai, Kazumasa; Kawahara, Satoru; Horikawa, Shiori; Murata, Shin
2018-01-01
In this study, we aimed to (1) translate the English version of the Kinesthetic and Visual Imagery Questionnaire (KVIQ), which assesses motor imagery ability, into Japanese, and (2) investigate the reliability and validity of the Japanese KVIQ. We enrolled 28 healthy adults in this study. We used Cronbach’s alpha coefficients to assess reliability reflected by the internal consistency. Additionally, we assessed validity reflected by the criterion-related validity between the Japanese KVIQ and the Japanese version of the Movement Imagery Questionnaire-Revised (MIQ-R) with Spearman’s rank correlation coefficients. The Cronbach’s alpha coefficients for the KVIQ-20 were 0.88 (Visual) and 0.91 (Kinesthetic), which indicates high reliability. There was a significant positive correlation between the Japanese KVIQ-20 (Total) and the Japanese MIQ-R (Total) (r = 0.86, p < 0.01). Our results suggest that the Japanese KVIQ is an assessment that is a reliable and valid index of motor imagery ability. PMID:29724042
Nakano, Hideki; Kodama, Takayuki; Ukai, Kazumasa; Kawahara, Satoru; Horikawa, Shiori; Murata, Shin
2018-05-02
In this study, we aimed to (1) translate the English version of the Kinesthetic and Visual Imagery Questionnaire (KVIQ), which assesses motor imagery ability, into Japanese, and (2) investigate the reliability and validity of the Japanese KVIQ. We enrolled 28 healthy adults in this study. We used Cronbach’s alpha coefficients to assess reliability reflected by the internal consistency. Additionally, we assessed validity reflected by the criterion-related validity between the Japanese KVIQ and the Japanese version of the Movement Imagery Questionnaire-Revised (MIQ-R) with Spearman’s rank correlation coefficients. The Cronbach’s alpha coefficients for the KVIQ-20 were 0.88 (Visual) and 0.91 (Kinesthetic), which indicates high reliability. There was a significant positive correlation between the Japanese KVIQ-20 (Total) and the Japanese MIQ-R (Total) (r = 0.86, p < 0.01). Our results suggest that the Japanese KVIQ is an assessment that is a reliable and valid index of motor imagery ability.
Kohno, Ayako; Nik Farid, Nik Daliana; Musa, Ghazali; Abdul Aziz, Norlaili; Nakayama, Takeo; Dahlui, Maznah
2016-03-22
While living overseas in another culture, retirees need to adapt to a new environment but often this causes difficulties, particularly among those elderly who require healthcare services. This study examines factors affecting healthcare service utilisation among Japanese retirees in Malaysia. We conducted 6 focus group discussions with Japanese retirees and interviewed 8 relevant medical services providers in-depth. Guided by the Andersen Healthcare Utilisation Model, we managed and analysed the data, using QSR NVivo 10 software and the directed content analysis method. We interviewed participants at Japan Clubs and their offices. 30 Japanese retirees who live in Kuala Lumpur and Ipoh, and 8 medical services providers. We identified health beliefs, medical symptoms and health insurance as the 3 most important themes, respectively, representing the 3 dimensions within the Andersen Healthcare Utilisation Model. Additionally, language barriers, voluntary health repatriation to Japan and psychological support were unique themes that influence healthcare service utilisation among Japanese retirees. The healthcare service utilisation among Japanese retirees in Malaysia could be partially explained by the Andersen Healthcare Utilisation Model, together with some factors that were unique findings to this study. Healthcare service utilisation among Japanese retirees in Malaysia could be improved by alleviating negative health beliefs through awareness programmes for Japanese retirees about the healthcare systems and cultural aspects of medical care in Malaysia. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/
Motion Verbs with Goal PPs in the L2 Acquisition of English and Japanese.
ERIC Educational Resources Information Center
Inagaki, Shunji
2001-01-01
Suggests that Japanese learners will learn manner-of-motion verbs with goal prepositional phrases in English from positive feedback. Immediate Japanese learners of English and advanced learners of Japanese were tested using a grammaticality judgment task with pictures. Results support the prediction. (Author/VWL)
Htun, N C; Ishikawa-Takata, K; Kuroda, A; Tanaka, T; Kikutani, T; Obuchi, S P; Hirano, H; Iijima, K
2016-02-01
Early and effective screening for age-related malnutrition is an essential part of providing optimal nutritional care to older populations. This study was performed to evaluate the adaptation of the original SCREEN II questionnaire (Seniors in the Community: Risk Evaluation for Eating and Nutrition, version II) for use in Japan by examining its measurement properties and ability to predict nutritional risk and sarcopenia in community-dwelling older Japanese people. The ultimate objective of this preliminary validation study is to develop a license granted full Japanese version of the SCREEN II. The measurement properties and predictive validity of the NRST were examined in this cross-sectional study of 1921 community-dwelling older Japanese people. Assessments included medical history, and anthropometric and serum albumin measurements. Questions on dietary habits that corresponded to the original SCREEN II were applied to Nutritional Risk Screening Tool (NRST) scoring system. Nutritional risk was assessed by the Geriatric Nutrition Risk Index (GNRI) and the short form of the Mini-Nutritional Assessment (MNA-SF). Sarcopenia was diagnosed according to the criteria of the European Working Group on Sarcopenia in Older People. The nutritional risk prevalences determined by the GNRI and MNA-SF were 5.6% and 34.7%, respectively. The prevalence of sarcopenia was 13.3%. Mean NRST scores were significantly lower in the nutritionally at-risk than in the well-nourished groups. Concurrent validity analysis showed significant correlations between NRST scores and both nutritional risk parameters (GNRI or MNA-SF) and sarcopenia. The areas under the receiver operating characteristic curves (AUC) of NRST for the prediction of nutritional risk were 0.635 and 0.584 as assessed by GNRI and MNA-SF, respectively. AUCs for the prediction of sarcopenia were 0.602 (NRST), 0.655 (age-integrated NRST), and 0.676 (age and BMI-integrated NRST). These results indicate that the NRST is a
The Japanese Keigo Verbal Marker
ERIC Educational Resources Information Center
Rahayu, Ely Triasih
2013-01-01
This research studies Japanese "keigo" in the office domain, a case study at XXX Corporation Japan. "Keigo" consists of "sonkeigo," "kenjougo," and "teineigo." Each of those speech levels is going to be analyzed based on linguistic and nonlinguistic factors. In this qualitative research, the data…
[History of the German-Japanese Society of Dermatology].
Nishioka, Kiyoshi
2017-03-01
The relationships between German and Japanese dermatology are traditionally very strong. This fact led Professor Hornstein and Professor Nishiyama to organize joint meetings of dermatologists from both countries. The first meeting of the German-Japanese Society of Dermatology was held in Erlangen, Germany, following the 16th World Congress of Dermatology in 1967. Since then, meetings have been held alternating between Germany and Japan. These meetings were successfully organized by professors from both countries. In this article, I present memorable photos from these joint meetings.
Japanese Economic Victory Over America: Fact or Fiction
1990-04-01
together. 8 ENDNOTES CHAPTER I 1. Kobayashi Kaorli, "That Yen for Power," Japan Quarterly, Vol. 36, No. 2, April-June 1989, p. 217. 2. S. Prakarah Sethi... Nobuaki Namiki;and Carl L. Swanson, The False Promise cf the Japanese Miracle, p. 8. 3. Ibid., p. 7. 4. Ibid., p. 7. 5. U. S. Central Intelligence...Parakash S. Sethi; Nobuaki Namiki; and Carl E. Swanson, The False Promise of the Japanese Miracle, p. 43. 6. U.S. Department of Labor, p. 15. 7. Akino
[Clinical features of idiopathic restless legs syndrome in Japanese patients].
Kume, Akito; Kume, Hideaki
2010-06-01
Little is known about the diagnosis and management of restless legs syndrome (RLS) in Japanese neurology clinics. To validate the diagnostic criteria of the International RLS Study Group (IRLSSG) and the treatment algorithm of the Mayo Clinic in a Japanese neurology clinic setting and to clarify the features of Japanese patients with idiopathic RLS. Patients with RLS symptoms were examined by a neurologist and the assessment included neurological examination, tests for periodic limb movements (PLM) and dopaminergic response, and the clinical diagnosis was made according to IRLSSG diagnostic criteria. Patients diagnosed with idiopathic RLS were treated with dopaminergic agents and the efficacy was evaluated. The study subjects were 151 Japanese patients who presented with RLS symptoms. Idiopathic RLS was diagnosed in 113 patients, secondary RLS in 16 and RLS mimics in 22. The cause of RLS mimics was either myelopathy, radiculopathy or neuropathy in 11 patients. The mean age of patients with idiopathic RLS was 50.1 (SD 20.0) years, 63% were woman, 97% had daily RLS, 31% had family history (40% of the early-onset subgroup), 86% reported unpleasant sensations in the lower legs, 43% had PLM in the daytime suggested immobilization test, 81% suffered from insomnia, 49% had limitations of work and activities, 71% reported impaired mood, 27% had consulted physicians about their symptoms, 4% had been diagnosed with RLS, 73% improved after dopaminergic treatments, and 33% experienced complete remission. The clinical features of Japanese patients with idiopathic RLS were identical to those reported in western countries, which suggests that IRLSSG diagnostic criteria and Mayo Clinic treatment algorism are valid in Japanese neurology clinics. Both patients and physicians were not fully aware of RLS in this country. Neurological examination was important in excluding RLS mimics and making a diagnosis of RLS.
Peace Education in Japanese Universities. Peace Education Miniprints No. 36.
ERIC Educational Resources Information Center
Fujita, Hideo; Ito, Takehiko
This paper contends that peace education is necessary for all university students in Japan for several reasons: students are going to take leading roles in society; the world is changing rapidly; and university teachers have a social responsibility not to repeat the faults of Japanese teachers in World War II. Japanese peace education has been…
Picture This Character: Using Imagery To Teach a Japanese Syllabary.
ERIC Educational Resources Information Center
Thompson, Joyce D.; Wakefield, John F.
This study examined the effectiveness of imagery to teach native English speakers to associate hiragana characters (a Japanese script) with the spoken Japanese syllables that the characters represent. Twenty-one adults in a psychology of learning class for teachers were taught to picture a hiragana character in such a way as to establish an…
Interlanguage Pragmatics Study of Indirect Complaint among Japanese ESL Learners
ERIC Educational Resources Information Center
Baba, Junko
2010-01-01
This interlanguage pragmatics study of linguistic expressions of affect focuses on how Japanese learners of English may express themselves in an affect-laden speech act of indirect complaint. The English as a Second Language (ESL) learners' data are compared with the baseline data of native speakers of Japanese (JJ) and American English (AA). The…
Differences in reported linguistic thermal sensation between Bangla and Japanese speakers.
Khatun, Aklima; Hasib, Md Abdul; Nagano, Hisaho; Taimura, Akihiro
2017-06-05
Thermal sensation is a fundamental variable used to determine thermal comfort and is most frequently evaluated through the use of subjective reports in the field of environmental physiology. However, there has been little study of the relationship between the semantics of the words used to describe thermal sensation and the climatic background. The present study investigates the linguistic differences in thermal reports from native speakers of Bangla and Japanese. A total of 1141 university students (932 in Bangladesh and 209 in Japan) responded to a questionnaire survey consisting of 20 questions. Group differences between Bangladeshi and Japanese respondents were then tested with a chi-square test in a crosstab analysis using SPSS (version 21). For the Bangla-speaking respondents, the closest feeling of thermal comfort was "neutral" (66.6%) followed by "slightly cool" (10.2%), "slightly cold" (6.0%), "slightly hot" (4.1%), and "cold" (3.8%). For the Japanese respondents, the closest feeling of thermal comfort was "cool" (38.3%) followed by "slightly cool" (20.4%), "neutral" (14.6%), "slightly warm" (13.1%), and "warm" (10.7%). Of the Bangladeshi respondents, 37.7% reported that they were sensitive to cold weather and 18.1% reported that they were sensitive to hot weather. Of the Japanese respondents, 20.6% reported that they were sensitive to cold weather and 29.2% reported that they were sensitive to hot weather. Of the Bangladeshi respondents, 51.4% chose "higher than 29 °C" as hot weather and 38.7% of the Japanese respondents chose "higher than 32 °C" as hot weather. In the case of cold weather, 43.1% of the Bangladeshi respondents selected "lower than 15 °C" as cold weather and 53.4% of the Japanese respondents selected "lower than 10 °C" as cold weather. Most of the Bangla-speaking respondents chose "neutral" as the most comfortable temperature, and most of the Japanese respondents chose "cool." Most of the Bangladeshi respondents reported that they
How the Japanese Learn To Work. Second Edition. Nissan Institute/Routledge Japanese Studies Series.
ERIC Educational Resources Information Center
Dore, Ronald; Sako, Mari
This book examines how the Japanese learn to work by exploring the following topics: common assumptions about vocational education and training (VET) that Japan brings into question; Japan's general education system and the moral quality and prestige status of the teaching and learning process; screening processes within Japan's education system…
German words: still used by Japanese obstetrics and gynecology doctors.
Matsubara, Shigeki
2018-03-01
German used to be frequently employed in Japanese obstetric and gynecologic (OBGYN) practice; however, it is now less frequently used. Description and analysis of this situation may shed some light on the change of OBGYN practice and education in Japan, which may at least partly hold true to counties other than Japan. Three eras were classified according to the relationship between German and Japanese OBGYN, with each era characterized. Frequently used German words in Japanese OBGYN practice were described as examples. German words have become less frequently used with each successive generation. Even though English may suffice in practical OBGYN practice, German usage will still be passed on to these new generations.
A Japanese logographic character frequency list for cognitive science research.
Chikamatsu, N; Yokoyama, S; Nozaki, H; Long, E; Fukuda, S
2000-08-01
This paper describes a Japanese logographic character (kanji) frequency list, which is based on an analysis of the largest recently available corpus of Japanese words and characters. This corpus comprised a full year of morning and evening editions of a major newspaper, containing more than 23 million kanji characters and more than 4,000 different kanji characters. This paper lists the 3,000 most frequent kanji characters, as well as an analysis of kanji usage and correlations between the present list and previous Japanese frequency lists. The authors believe that the present list will help researchers more accurately and efficiently control the selection of kanji characters in cognitive science research and interpret related psycholinguistic data.
Risk and promotive factors related to depressive symptoms among Japanese youth.
Laser, Julie; Luster, Tom; Oshio, Toko
2007-10-01
Symptoms of depression include feelings of sadness, loneliness, suicidal ideation, and self-dislike. Adolescent depression is viewed as a problem in Japan, but there is little research on the correlates of depression in Japanese youth. Therefore, the purpose of this study was to investigate the prevalence of depression in Japanese youth and to examine correlates of depression using a risk and promotive factor framework. This study examined the symptoms of depression among 802 Japanese youth attending postsecondary schools in the Sapporo area. Separate analyses were conducted for males and females to determine whether the importance of risk and promotive factors varied by gender. The results showed that many factors that had been linked to depressive symptoms in Western samples were predictive of depressive symptoms in Japanese youth. The risk and promotive factors accounted for 50% and 59% of the variance in depressive symptoms for the female and male subsamples, respectively.
Reciprocal Predicates in Japanese.
ERIC Educational Resources Information Center
Ishii, Yasuo
A study of reciprocals in Japanese compares two kinds: (1) a verbal suffix "aw"; and (2) an NP argument "otagai." Although "otagai" appears to be taken care of by syntactic binding theory, it is proposed that there is no evidence for the existence of a syntactic position of the object NP in the case of "aw." The suffix can be characterized as…
Umemura, Tomo; Traphagan, John W
2015-12-01
Attachment theorists believe that children rely on their caregivers for protection and exploration. Due to this emphasis on independent exploration, however, the extent to which this notion of secure-base behavior is valid in societies emphasizing belongingness, such as Japan, has been questioned. By conducting an in-depth exploration of two Japanese collectivistic concepts, amae and ie, the present paper reexamines the relevance of secure-base behavior in Japan. Current discussions of amae have relied on psychoanalytic concepts that were developed in Western culture, and thus may not accurately represent Japanese parent-child relations. By examining another traditional concept of the family system, ie, this paper proposes that attachment theory is relevant in Japanese culture because children's individual competence is important to their families.
The evolution of Japanese employer-sponsored retirement plans.
Rajnes, David
2007-01-01
This article examines the development of Japanese voluntary employer-sponsored retirement plans with an emphasis on recent trends. Until 2001, companies in Japan offered retirement benefits as lump-sum severance payments and/or benefits from one of two types of defined benefit (DB) pension plans. One type of DB plan was based on the occupational pension model used in the United States before the adoption of the Employee Retirement Income Security Act of 1974 (ERISA), but lacked the funding, vesting, and other protective features contained in ERISA. The other type of DB plan allowed companies to opt out of the earnings-related portion of social security, commonly referred to as "contracting out." Landmark laws passed in 2001 introduced a new generation of occupational retirement plans to employers and employees. One law increased funding requirements and enhanced employee protections for employer-sponsored DB plans, while a second law introduced defined contribution (DC) plans for several reasons, chiefly to increase retirement savings and help boost Japanese financial markets. These laws complemented earlier changes in the tax code and financial accounting standards already affecting employer-sponsored retirement plans. As a result, new retirement plan designs will replace most prereform era company retirement plans by 2012. In 2001, the experience of 401(k) plans in the United States, where 42 million participants had accumulated more than $1.8 trillion in assets over 20 years, attracted considerable attention among Japanese lawmakers finalizing provisions of the DC pension law. Even with government support and encouragement from the financial services industry, Japanese companies have not adopted these new DC plans in large numbers. As a result, occupational retirement plans in Japan have remained predominantly DB-a surprising development in light of the shift in a number of countries from DB to DC plans observed in recent decades. However, recent proposals to
Conveying misinformation: Top-ranked Japanese books on tobacco
2011-01-01
Background Tobacco control efforts in Japan have lagged other high income countries, possibly because the Japanese government partially owns Japan Tobacco, Inc. In Japan, tobacco use is still often regarded as an issue of manners rather than an issue of health. Information about tobacco is available, but may not always be accurate. We explored what information Japanese consumers might access by reading popular Japanese books about tobacco. Methods We searched Amazon.com Japan using the term "Tobacco", identifying the top 12 books by "relevance" and "bestselling." We eliminated duplicates and books not concerned with tobacco use and classified the remaining books as pro-smoking, anti-smoking, or neutral. We reviewed the pro-smoking books, published 2004-2009, and analyzed examples of misinformation by theme. Results Pro-smoking popular books conveyed five types of misinformation: doubt about science; suggestions that smoking increased health, longevity, virility, etc.; trivializing tobacco's effects; attacking public health advocates/authorities; and linking tobacco use with authenticity, history, or civil rights. At least one book was authored by a former Japan Tobacco employee; another used a popular Japan Tobacco advertising phrase. Conclusions Creating doubt and confusion about tobacco serves tobacco industry interests and re-creates a strategy developed by US tobacco interests more than 40 years ago. Japanese readers may be misled by texts such as those reviewed. Tobacco control and public health advocates in Japan and globally should expose and counter such misinformation. "Naming and shaming" may be effective. PMID:21261991
Conveying misinformation: Top-ranked Japanese books on tobacco.
Kanamori, Yuko; Malone, Ruth E
2011-01-24
Tobacco control efforts in Japan have lagged other high income countries, possibly because the Japanese government partially owns Japan Tobacco, Inc. In Japan, tobacco use is still often regarded as an issue of manners rather than an issue of health. Information about tobacco is available, but may not always be accurate. We explored what information Japanese consumers might access by reading popular Japanese books about tobacco. We searched Amazon.com Japan using the term "Tobacco", identifying the top 12 books by "relevance" and "bestselling." We eliminated duplicates and books not concerned with tobacco use and classified the remaining books as pro-smoking, anti-smoking, or neutral. We reviewed the pro-smoking books, published 2004-2009, and analyzed examples of misinformation by theme. Pro-smoking popular books conveyed five types of misinformation: doubt about science; suggestions that smoking increased health, longevity, virility, etc.; trivializing tobacco's effects; attacking public health advocates/authorities; and linking tobacco use with authenticity, history, or civil rights. At least one book was authored by a former Japan Tobacco employee; another used a popular Japan Tobacco advertising phrase. Creating doubt and confusion about tobacco serves tobacco industry interests and re-creates a strategy developed by US tobacco interests more than 40 years ago. Japanese readers may be misled by texts such as those reviewed. Tobacco control and public health advocates in Japan and globally should expose and counter such misinformation. "Naming and shaming" may be effective.
On the Teaching of Japanese: The State of the Art.
ERIC Educational Resources Information Center
Martin, Samuel E.
Until the coming of World War II, little interest was shown in the teaching of Japanese outside Japan except for the elementary schools set up to inculcate the ways of the homeland among the offspring of Japanese emigrants to places like Hawaii, the Pacific Coast of North America, and Brazil. A few European and American universities offered…
Effects of Three Types of Japanese Honey on Full-Thickness Wound in Mice
Nakajima, Yukari; Nakano, Yuki; Fuwano, Sono; Hayashi, Natsumi; Hiratoko, Yukiho; Kinoshita, Ayaka; Miyahara, Megumi; Mochizuki, Tsuyoshi; Nishino, Kasumi; Tsuruhara, Yusuke; Yokokawa, Yoshika; Iuchi, Terumi; Kon, Yuka; Mukai, Kanae; Kitayama, Yukie; Murakado, Naoko; Okuwa, Mayumi; Nakatani, Toshio
2013-01-01
Although many previous studies reported that honey promotes wound healing, no study has examined the effects of Japanese honey. The aim of this study was to investigate the effects of three types of Japanese honey, Acacia, Buckwheat flour, and Chinese milk vetch honey, on wound healing in comparison with hydrocolloid dressing. Circular full-thickness skin wounds were produced on male mice. Japanese honey or hydrocolloid dressing was applied daily to the mice for 14 days. The ratio of wound area for the hydrocolloid dressing group increased initially in the inflammatory and early proliferative phases and then decreased rapidly to heal with scarring. However, the ratios of wound area for the Japanese honey groups decreased in the inflammatory phase, increased in the proliferative phase, and decreased in the proliferative phase, and some wounds were not completely covered with new epithelium. These findings indicate that using Japanese honey alone has limited benefit, but since it reduces wound size in the inflammatory phase, it is possible to apply a combined treatment in which Japanese honey is applied only in the inflammatory phase, followed by hydrocolloid dressing from the proliferative phase, which would effectively contract the wound. PMID:23401714
Japanese at Mimosa Elementary School.
ERIC Educational Resources Information Center
Uchihara, Azusa
2001-01-01
Describes the Japanese program at Mimosa Elementary School in Roswell, Georgia. The success of the program has been aided by collaborative team teaching, a spiraled curriculum, creative teaching methods, Teacher -made materials, and communication among teachers, parents, and administrators. he challenges are also discussed. (Author/VWL)
The development of fears of compassion scale Japanese version
Asano, Kenichi; Tsuchiya, Masao; Ishimura, Ikuo; Lin, Shuzhen; Matsumoto, Yuki; Miyata, Haruko; Kotera, Yasuhiro; Shimizu, Eiji; Gilbert, Paul
2017-01-01
Objectives Cultivation of compassion is a useful way to treat mental problems, but some individuals show resistance. Fears of compassion can be an obstacle for clinicians when providing psychotherapy, and for clients when engaging in interpersonal relationships. Despite its importance, a Japanese version of fears of compassion scales (for others, from others, and for self) has not yet been developed. This study developed a Japanese version of the Fears of Compassion Scales and tested its reliability and validity. Design This study used a cross-sectional design, and a self-report procedure for collecting data. Methods A total of 485 students (121 males and 364 females) answered self-report questionnaires, including the draft Fears of Compassion Scales—Japanese version. Results There were distinctive factor structures for fear of compassion from others, and for self. The fear of compassion from others scale consisted of concern about compassion from others and avoidance of compassion from others. All scales had good internal consistency, test-retest reliability, face validity, and construct validity. Discrimination and difficulty were also calculated. Conclusions These results indicate that the Fears of Compassion Scales—Japanese version is a well-constructed and useful measure to assess fears of compassion and the existence of cultural differences in fears of compassion. PMID:29023461
The development of fears of compassion scale Japanese version.
Asano, Kenichi; Tsuchiya, Masao; Ishimura, Ikuo; Lin, Shuzhen; Matsumoto, Yuki; Miyata, Haruko; Kotera, Yasuhiro; Shimizu, Eiji; Gilbert, Paul
2017-01-01
Cultivation of compassion is a useful way to treat mental problems, but some individuals show resistance. Fears of compassion can be an obstacle for clinicians when providing psychotherapy, and for clients when engaging in interpersonal relationships. Despite its importance, a Japanese version of fears of compassion scales (for others, from others, and for self) has not yet been developed. This study developed a Japanese version of the Fears of Compassion Scales and tested its reliability and validity. This study used a cross-sectional design, and a self-report procedure for collecting data. A total of 485 students (121 males and 364 females) answered self-report questionnaires, including the draft Fears of Compassion Scales-Japanese version. There were distinctive factor structures for fear of compassion from others, and for self. The fear of compassion from others scale consisted of concern about compassion from others and avoidance of compassion from others. All scales had good internal consistency, test-retest reliability, face validity, and construct validity. Discrimination and difficulty were also calculated. These results indicate that the Fears of Compassion Scales-Japanese version is a well-constructed and useful measure to assess fears of compassion and the existence of cultural differences in fears of compassion.
Influence of facial convexity on facial attractiveness in Japanese.
Ioi, H; Nakata, S; Nakasima, A; Counts, Al
2007-11-01
The purpose of this study was to assess and determine the range of the top three most-favored facial profiles for each sex from a series of varying facial convexity, and to evaluate the clinically acceptable facial profiles for Japanese adults. Questionnaire-based study. Silhouettes of average male and female profiles were constructed from the profiles of 30 Japanese males and females with normal occlusions. Chin positions were protruded or retruded by 2 degrees , 4 degrees , 6 degrees , 8 degrees and 10 degrees , respectively, from the average profile. Forty-one orthodontists and 50 dental students were asked to select the three most-favored profiles for each sex, and they were also asked to indicate whether they would seek surgical orthodontic treatment if that image represented their own profile. For males, both the orthodontists and dental students chose the average profile as the most-favored profile. For females, both the orthodontists and dental students chose a slightly more retruded chin position as the most-favored profile. Japanese raters tended to choose class II profiles as more acceptable profiles than class III profiles for both males and females. These findings suggest that Japanese patients with class III profiles tend to seek surgical orthodontic treatment more often.
Autobiographical memory functions in young Japanese men and women.
Maki, Yoichi; Kawasaki, Yayoi; Demiray, Burcu; Janssen, Steve M J
2015-01-01
The present study examined whether the three major functions of autobiographical memory observed in Western societies (i.e., directing-behaviour, social-bonding and self-continuity) also exist in an East Asian society. Two self-report measures were used to assess the autobiographical memory functions of Japanese men and women. Japanese young adults (N = 451, ages 17-28 years) first completed the original Thinking About Life Experiences (TALE) Questionnaire. They subsequently received three TALE items that represented memory functions and attempted to recall a specific instance of memory recall for each item. Confirmatory factor analyses on the TALE showed that the three functions were replicated in the current sample. However, Japanese participants reported lower levels of all three functions than American participants in a previous study. We also explored whether there was an effect of gender in this Japanese sample. Women reported higher levels of the self-continuity and social-bonding functions than men. Finally, participants recalled more specific instances of memory recall for the TALE items that had received higher ratings on the TALE, suggesting that the findings on the first measure were supported by the second measure. Results are discussed in relation to the functional approach to autobiographical memory in a cross-cultural context.
History and Progress of Japanese Acupuncture
Uefuji, Miwa; Yasumo, Washiro
2010-01-01
After Chiso brought acupuncture to Japan from Wu (China) in the sixth century, it has progressed in unique ways within the various historical milieus of the past 1500 years. Ishitsu-rei, the first medical law of Japan established in 701, explains the medical system of acupuncture in detail showing that acupuncture was being administered under the authorization of the national government. For the next 1200 years, acupuncture continued to be an important facet of public health in Japan. From the Azuchimomoyama through the Edo period, the knowledge exchange with China became active and people who studied in China developed new styles and techniques of acupuncture treatment and organized their own private schools or ryu-ha in Japan. In 1635, when the Edo government decided to close the country, Japan cut-off exchange with foreign countries for over 200 years. The national isolation caused some development that was unique to Japan. During that time, acupuncture filtered into people's everyday lives. Moxibustion, in particular, became popular as a treatment that ordinary people could practice by themselves. Also in this period of isolation, Western medicine was imported from Holland, the only country allowed to maintain trade with Japan. This novel modern medicine had a strong impact on Japanese medicine, which has its foundation of Chinese traditional medicine. At the same time, Japanese acupuncture was introduced into Europe via Holland. When Japan opened its borders in 1865 period, the new government was eager to accept Western culture to the extent of prohibiting the progress of Japanese acupuncture for a period of time. Even so, Japanese acupuncture has survived and flourished up to the present day due to the strong demand and the great efforts of the practitioners. Scientific studies are now in the process of establishing a firm evidence base for over a millennium of clinical use, respecting the classic ideas of the traditional treatment. PMID:18955321
Bagchus, Wilhelmina; Wolna, Peter; Uhl, Wolfgang
2018-01-01
Recombinant hCG (r-hCG) was approved in Japan in 2016. As a prerequisite for a Phase III study in Japan related to this approval, the pharmacokinetic (PK) profile of r-hCG was investigated. An open-label, partly randomized, single-center, single-dose, group-comparison, Phase I PK-bridging study was done that compared a single 250 μg dose of r-hCG with a single 5000 IU dose of urinary hCG (u-hCG) in healthy Japanese women, as well as comparing a single 250 μg dose of r-hCG in Japanese and Caucasian women. The Japanese participants were randomized 1:1 to receive either r-hCG or u-hCG, while the Caucasian participants were weight-matched to the Japanese participants who were receiving r-hCG in a 1:1 fashion. The primary PK parameters were the area under the serum concentration-time curve from time 0 extrapolated to infinity (AUC 0-∞ ) and the maximum serum concentration (C max ). The mean serum hCG concentration-time profiles of r-hCG in the Japanese and Caucasian participants were a similar shape, but the level of overall exposure was ~20% lower in the Japanese participants. For the Japanese participants, r-hCG resulted in an 11% lower C max but a 19% higher AUC 0-∞ compared with u-hCG. No new safety signal was identified. This study cannot exclude a potential difference in the PK profile of r-hCG between Japanese and Caucasian participants. However, this study does not indicate that there are clinically relevant differences in the serum PK of r-hCG and u-hCG in the Japanese participants.
A comparison of hand-arm vibration syndrome between Malaysian and Japanese workers.
Su, Anselm Ting; Fukumoto, Jin; Darus, Azlan; Hoe, Victor C W; Miyai, Nobuyuki; Isahak, Marzuki; Takemura, Shigeki; Bulgiba, Awang; Yoshimasu, Kouichi; Maeda, Setsuo; Miyashita, Kazuhisa
2013-01-01
The aim of this study was to investigate the clinical characteristics of HAVS in a tropical environment in comparison with a temperate environment. We conducted a series medical examinations among the forestry, construction and automobile industry workers in Malaysia adopting the compulsory medical examination procedure used by Wakayama Medical University for Japanese vibratory tools workers. We matched the duration of vibration exposure and compared our results against the Japanese workers. We also compared the results of the Malaysian tree fellers against a group of symptomatic Japanese tree fellers diagnosed with HAVS. Malaysian subjects reported a similar prevalence of finger tingling, numbness and dullness (Malaysian=25.0%, Japanese=21.5%, p=0.444) but had a lower finger skin temperature (FST) and higher vibrotactile perception threshold (VPT) values as compared with the Japanese workers. No white finger was reported in Malaysian subjects. The FST and VPT of the Malaysian tree fellers were at least as bad as the Japanese tree fellers despite a shorter duration (mean difference=20.12 years, 95%CI=14.50, 25.40) of vibration exposure. Although the vascular disorder does not manifest clinically in the tropical environment, the severity of HAVS can be as bad as in the temperate environment with predominantly neurological disorder. Hence, it is essential to formulate national legislation for the control of the occupational vibration exposure.
Canadian and Japanese Teachers' Conceptions of Critical Thinking: A Comparative Study
ERIC Educational Resources Information Center
Howe, Edward R.
2004-01-01
Canadian and Japanese secondary teachers' conceptions of critical thinking were compared and contrasted. Significant cross-cultural differences were found. While Canadian teachers tended to relate critical thinking to the cognitive domain, Japanese teachers emphasized the affective domain. The quantitative data, effectively reduced through factor…
ERIC Educational Resources Information Center
Itakura, Hiroko
2009-01-01
Subordinate femininity associated with feminine Japanese has been found to pose barriers for foreign language learners of Japanese, especially among Western female learners of Japanese. The present study investigates attitudes towards the use of both masculine and feminine Japanese among non-native professional speakers of Japanese. The latter's…
Information Systems for the Museum of Japanese History, Archaeology and Folklore
NASA Astrophysics Data System (ADS)
Terui, Takehiko
General idea and outline of museums of Japanese history, archaeology and folklore are introduced, and the relationship between exhibits and information in them is described. Then the information systems of these museums are explained in some detail. As an example, the author describes the information systems for the museum of Japanese history, archaeology and folklore by comparing the computer system with the traditional manual system. Japanese language processing and image handling derived from the systems are also described. Significance and problems of nationwide information network linking these museums each other, and problems of staffs in the information sections are mentioned.
ERIC Educational Resources Information Center
Yasuike, Akiko
2011-01-01
This study examines the ways in which Japanese corporate transnationalism affects husbands' involvement in family life and marital relationships primarily from a perspective of wives. It is based on interviews with 22 Japanese wives and 4 husbands. Studies of Japanese corporate transnationalism treat men as mere supervisors to local workers or…
Interlingual Encounter in Pierre Garnier and Niikuni Seiichi's French-Japanese Concrete Poetry
ERIC Educational Resources Information Center
Wong, Elaine S.
2015-01-01
In the latter half of the 1960s, without meeting each other and without knowing each other's language, French poet Pierre Garnier and Japanese poet Niikuni Seiichi [Japanese characters omitted] collaborated to create French-Japanese concrete poems. This essay examines the interlingual encounters in the two poets' bilingual poems that facilitate…
Psychometric properties of the Japanese version of the Social Phobia Inventory.
Nagata, Toshihiko; Nakajima, Takenori; Teo, Alan R; Yamada, Hisashi; Yoshimura, Chiho
2013-04-01
The aim of the current study was to study the psychometric properties of the Japanese version of the Social Phobia Inventory (SPIN-J) among Japanese subjects with social anxiety disorder (SAD). The sample consisted of 86 subjects with SAD and 86 controls. Diagnosis was based on a modified version of the Structured Clinical Interview for the DSM-IV. In addition to the SPIN-J, clinician-administered and self-rating scales, including the Japanese versions of the Liebowitz Social Anxiety Scale, the Social Phobia Scale, and the Social Interaction Anxiety Scale, were used. The SPIN-J showed adequate internal consistency (0.82-0.96) for the total and subscales. Correlations between the SPIN-J and the Liebowitz Social Anxiety Scale, the Social Phobia Scale, and the Social Interaction Anxiety Scale ranged from 0.83 to 0.89 and indicated adequate concurrent validity. A cut-off point of 22 between subjects with SAD and controls showed a sensitivity of 96.5% and specificity of 87.2%, indicating robust discriminant validity. The SPIN-J showed adequate reliability and validity for use as a screening tool for social anxiety disorder in Japanese clinical settings. © 2013 The Authors. Psychiatry and Clinical Neurosciences © 2013 Japanese Society of Psychiatry and Neurology.
ERIC Educational Resources Information Center
Delgado Algarra, Emilio José
2016-01-01
Most of the studies focus on the teaching of foreign languages indicate that little attention is paid to the prosodic features both didactic materials and teaching-learning processes (Martinsen, Avord and Tanner, 2014). In this context and throughout this article, an analysis of the didactical and technical dimensions of OJAD (Japanese Accent…
The borderline of 'empire': Japanese maritime quarantine in Busan c.1876-1910.
Kim, Jeong-Ran
2013-04-01
This paper seeks to balance the regional and thematic focus of cholera historiography by examining maritime quarantine in Busan, as it was devised and implemented by Japanese officials and doctors during the pre-colonial period. It also places the relationship between Korea and Japan in the context of relations with China, Russia and Britain. This paper shows that quarantine measures in Busan and other Korean ports reflected the rise of Japanese imperial power and the increasing desire on the part of the Japanese to establish an effective borderline for their regional empire. From 1879 Japan began to impose maritime quarantine in Busan, where Japanese influence was very strong even before the colonial period, though at that time Japan was unable to perform quarantine in its own ports independently due to the objections of Western powers, particularly Britain. Victories in the Sino-Japanese and Russo-Japanese wars established Japan as a regional power on equal terms with the West, and as the dominant power in Korea and Eastern Asia. With the acquisition of the right to impose quarantine in its homeland, Japan strengthened and extended the range of quarantine from Japan to Korea, China and Russia. Now quarantine screened Japan from potentially harmful agents – pathogenic and political – and its functions diversified further as modernisation and imperial expansion gathered pace. The reliance which Japan placed upon quarantine in maintaining its empire explains why it was increasingly out of step with other powers regarding international sanitary precautions. The Japanese maritime quarantine in Busan during this period therefore shows many aspects of Japan’s ‘national empire’.
The Past: The Road from Isolation. Through Japanese Eyes, Volume 1. Revised Edition.
ERIC Educational Resources Information Center
Minear, Richard H.; Clark, Leon E., Ed.
A Japanese view of Japan and the world is presented in this book, which is the first of two volumes which can be used in secondary and college courses. The reality of everyday life as experienced by the Japanese people is recreated in the series. Almost all of the material in both volumes has been written by Japanese and has been taken from a…
ERIC Educational Resources Information Center
Marriott, Helen; And Others
The report on the status of Japanese language teaching in Australia gives a broad view of Japanese study and discusses current educational issues in some detail. An introductory chapter offers a brief overview of the history, objectives, and issues of Japanese language instruction in Australia. The second chapter details features of instructional…
Zhang, Jia-Yu; Zhang, Qian; Li, Ning; Wang, Zi-Jian; Lu, Jian-Qiu; Qiao, Yan-Jiang
2013-01-30
A method of modified diagnostic fragment-ion-based extension strategy (DFIBES) coupled to DFIs (diagnostic fragmentation ions) intensity analysis was successfully established to simultaneously screen and identify the chlorogenic acids (CGAs) in Flos Lonicerae Japonicae (FLJ) by HPLC-ESI-MS(n). DFIs, such as m/z 191 [quinic acid-H](-), m/z 179 [caffeic acid-H](-) and m/z 173 [quinic acid-H-H2O](-) were determined or proposed from the fragmentation patterns analysis of corresponding reference substances for every chemical family of CGAs. A "structure extension" method was then proposed based on the well-demonstrated fragmentation patterns and was successively applied into the rapid screening of CGAs in FLJ. Considering that substitution isomerism is a common phenomenon, a full ESI-MS(n) fragmentation analysis according to the intensity of DFIs has been performed to identify the CGA isomers. Based on the DFIs and intensity analysis, 41 peaks attributed to CGAs including 4 caffeoylquinic acids (CQA), 7 CQA glycosides, 6 dicaffeoylquinic acids (DiCQA), 10 DiCQA glycosides, 1 tricaffeoylquinic acids (TriCQA), 4p-coumaroylquinic acids (pCoQA), 3 feruloylquinic acids (FQA) and 6 caffeoylferuloylquinic acids (CFQA) were identified preliminarily in a 65-min chromatographic run. It was the first time to systematically report the presence of CGAs in FLJ, especially for CQA glycosides, DiCQA glycosides, TriCQA, pCoQA and CFQA. All the results indicated that the method of developed DFIBES coupled to DFIs analysis was feasible, reliable and universal for screening and identifying the constituents with the same carbon skeletons especially the isomeric compounds from the complex extract of TCMs. Copyright © 2012 Elsevier B.V. All rights reserved.
Blending Buddhism, Shinto, and the Secular: Japanese Conceptualizations of the Divine
ERIC Educational Resources Information Center
Crane, Lauren Shapiro; Bruce, Jessica L.; Salmon, Ptamonie Y.; Eich, R. Tony; Brandewie, Erika N.
2012-01-01
This qualitative interview study investigated Japanese understandings of spirituality, religion, and The Divine. Thirteen native Japanese living in central Ohio (6 male, 7 female) answered open-ended questions about spiritual or religious activities they engaged in, motivations for engaging in them, what constitutes sacredness, why humanity and…
Entrepreneurialism in Japanese and UK Universities: Governance, Management, Leadership, and Funding
ERIC Educational Resources Information Center
Yokoyama, Keiko
2006-01-01
This paper scrutinises organisational change in Japanese and UK universities which are engaged in entrepreneurial activities. The study focuses on recent changes in governance, management, leadership, and funding in these universities. The paper argues there are convergent trends between Japanese and UK universities in terms of increasing…
Japanese and American College Students' Perceptions and Attitudes towards Maternal Employment.
ERIC Educational Resources Information Center
Luck, Lisa; And Others
This study investigated American and Japanese college students' attitudes towards maternal employment. A total of 248 American students at Ursinus College in Pennsylvania and 98 Japanese students at Tohokugakuin University in Japan participated in the study. Students answered a questionnaire about the consequences of maternal employment for…
"Those Anime Students": Foreign Language Literacy Development through Japanese Popular Culture
ERIC Educational Resources Information Center
Fukunaga, Natsuki
2006-01-01
Using multiliteracies and sociocultural perspectives on language and literacy learning, this article describes three Japanese as a foreign language (JFL) students' literacy development through involvement with Japanese popular culture. As part of a larger qualitative ethnographic study, the author interviewed JFL learners who have a particular…
[Chapter 5. The internationalization of the Japanese pharmaceutical industry (1980-2010)].
Yongue, Julia S
2014-01-01
The Japanese pharmaceutical industry experienced a period of rapid and economic growth following the introduction of the national healthcare system in 1961. Triggered by a major revision in Japanese legislation from process to substance patents, leading Japanese pharmaceutical companies began to invest in research and development (R&D). By the mid-1980s, some had managed to develop their first internationally marketable drugs, many of which were antibiotics. The emergence of novel drugs gave companies the impetus to engage in progressively more appreciable investments in Asia, Europe and the United States. In the 1980s, internationalization was mainly inwardly focused so as to limit firms' exposure to risk. However, as profits increased in the 1990s from the sale of new drugs, Japanese pharmaceutical companies were able to engage in even more sizeable, outwardly focused investments. By 2010, Japan's leading pharmaceutical enterprises had succeeded in putting place three types of global operations: manufacturing, marketing and R&D.
Deverbal Nominals and Telicity in Japanese.
ERIC Educational Resources Information Center
Tsujimura, Natsuko; Iida, Masayo
1999-01-01
Investigates deverbal nominalization involving the suffix "kake" in Japanese. Argues that kake nominalization induces two different meanings, the halfway and the inception reading, and different constraints are called for depending on these two meanings. (Author/VWL)
Predicting the reading skill of Japanese children.
Ogino, Tatsuya; Hanafusa, Kaoru; Morooka, Teruko; Takeuchi, Akihito; Oka, Makio; Ohtsuka, Yoko
2017-02-01
To clarify cognitive processes underlining the development of reading in children speaking Japanese as their first language, we examined relationships between performances of cognitive tasks in the preschool period and later reading abilities. Ninety-one normally developing preschoolers (41 girls and 50 boys; 5years 4months to 6years 4months, mean 5years 10months) participated as subjects. We conducted seven cognitive tasks including phonological awareness tasks, naming tasks, and working memory tasks in the preschool period. In terms of reading tasks, the hiragana naming task was administered in the preschool period; the reading times, which is a composite score of the monomoraic syllable reading task, the word and the non-word reading tasks, and the single sentence reading task, was evaluated in first and second grade; and the kanji reading task (naming task) was tested in second grade. Raven's colored progressive matrices and picture vocabulary test revised were also conducted in first grade. Correlation analyses between task scores and stepwise multiple regression analyses were implemented. Tasks tapping phonological awareness, lexical access, and verbal working memory showed significant correlations with reading tasks. In the multiple regression analyses the performances in the verbal working memory task played a key role in predicting character naming task scores (the hiragana naming task and the kanji reading task) while the digit naming task was an important predictor of reading times. Unexpectedly, the role of phonological (mora) awareness was modest among children speaking Japanese. Cognitive functions including phonological awareness, digit naming, and verbal working memory (especially the latter two) were involved in the development of reading skills of children speaking Japanese. Copyright © 2016 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.
Sugar intakes from snacks and beverages in Japanese children.
Takeichi, Hitomi; Taniguchi, Hiromi; Fukinbara, Mina; Tanaka, Nobuko; Shikanai, Saiko; Sarukura, Nobuko; Hsu, Tzu-Fang; Wong, Yueching; Yamamoto, Shigeru
2012-01-01
While sugar intake is an important factor for obesity, diabetes and dental caries, sugars are also important energy sources, especially for rapidly growing children. Children like sugar-rich sweet foods. However, intake for Japanese children is not known due to a lack of studies and sugar composition data. This study was designed to determine sugar intakes from snacks and beverages in Japanese school children. A nutrition survey was conducted for 3 weekdays for 283 Japanese school children (7, 10 and 13 y old) in 8 prefectures from different areas of Japan. The methods for the survey were the weighing method for school lunches and the 24-h recall method for other foods. To estimate sugar intakes, the sugar composition table that was recently compiled by us for 135 beverages, cakes and other sweets was used. Height and weight were measured. They were similar to Japanese averages. Energy intakes were also similar to the results of the Japanese National Health and Nutrition Surveys. Sugar eaten outside meals was 24.7±15.5 g/d. From the National Health and Nutrition Surveys conducted in 2009, the mean sucrose intake from meals including some home-made cookies for 7-14-y-old children was 5.5 g/d, suggesting the mean total sugar intake of these children was about 30 g/d. This was within the range of FAO/WHO recommendation (less than 10% of energy intake, 49 g for these children. Mean intakes among age groups were not significantly different (p>0.05), but the intake for girls was lower than for boys in the oldest age group (p<0.05). Contributions of each sugar to total intake were sucrose 64%, fructose 14%, glucose 13% and lactose 9%. Fructose and glucose were mainly from isomerized sugar. Contributions of food groups to total intake were beverages 25%, baked goods 19% and ice cream 17%, respectively, covering 61% of all. In conclusion, we revealed that the average sugar intake of Japanese children was within the range of the FAO/WHO recommendation, though the effects of
Goto, Seiko; Gianfagia, Thomas J; Munafo, John P; Fujii, Eijiro; Shen, Xuting; Sun, Minkai; Shi, Bertram Emil; Liu, Congcong; Hamano, Hiroshi; Herrup, Karl
2017-07-01
This study is to examine how viewing a Japanese garden affects Japanese patients with dementia. In a previous study, authors explored the effect on individuals with Alzheimer's disease of viewing an indoor Japanese garden at a nursing home in the United States and reported that viewing the garden significantly reduced the heart rate, evoked short-term and long-term memories, and improved behavioral symptoms. However, it was unclear whether these effects were caused by the design of Japanese garden or unfamiliarity of the design to Caucasians. We constructed a Japanese garden on the rooftop of a hospital in Japan and assessed with a total of 25 subjects on the following categories: (1) eye movement, (2) heart rate, and (3) behavior under four different conditions: (a) open view of the site before construction of the Japanese garden (the control space), (b) open view of the Japanese garden, (c) view of the Japanese garden through closed door, and (d) view of Japanese garden through closed door with the chrysanthemum scent. Findings/Results: Viewers' eyes scanned larger area while viewing the Japanese garden, and viewing the Japanese garden significantly reduced heart rate and improved behavioral symptoms than the control space. We also found that the effect of viewing the same Japanese garden differed across three conditions: the view through an open door, a closed door, and a closed door with added scent.
Kaihan, Ahmad Baseer; Yasuda, Yoshinari; Katsuno, Takayuki; Kato, Sawako; Imaizumi, Takahiro; Ozeki, Takaya; Hishida, Manabu; Nagata, Takanobu; Ando, Masahiko; Tsuboi, Naotake; Maruyama, Shoichi
2017-12-01
The Oxford Classification is utilized globally, but has not been fully validated. In this study, we conducted a comparative analysis between the Oxford Classification and Japanese Histologic Classification (JHC) to predict renal outcome in Japanese patients with IgA nephropathy (IgAN). A retrospective cohort study including 86 adult IgAN patients was conducted. The Oxford Classification and the JHC were evaluated by 7 independent specialists. The JHC, MEST score in the Oxford Classification, and crescents were analyzed in association with renal outcome, defined as a 50% increase in serum creatinine. In multivariate analysis without the JHC, only the T score was significantly associated with renal outcome. While, a significant association was revealed only in the JHC on multivariate analysis with JHC. The JHC and T score in the Oxford Classification were associated with renal outcome among Japanese patients with IgAN. Superiority of the JHC as a predictive index should be validated with larger study population and cohort studies in different ethnicities.
Preliminary Results form the Japanese Total Lightning Network
NASA Astrophysics Data System (ADS)
Hobara, Y.; Ishii, H.; Kumagai, Y.; Liu, C.; Heckman, S.; Price, C. G.; Williams, E. R.
2015-12-01
We report on the initial observational results from the first Japanese Total Lightning Detection Network (JTLN) in relation to severe weather phenomena. The University of Electro-Communications (UEC) has deployed the Earth Networks (EN) Total Lightning System over Japan to carry out research on the relationship between thunderstorm activity and severe weather phenomena since 2013. In this paper we first demonstrate the current status of our new network followed by the initial scientific results. The lightning jump algorithm was applied to our total lightning data to study the relationship between total lighting activity and hazardous weather events such as gust fronts and tornadoes over land reported by the JMA (Japanese Meteorological Agency) in 2014. As a result, a clear increase in total lighting flash rate as well as lightning jumps are observed prior to most hazardous weather events (~20 min) indicating potential usefulness for early warning in Japan. Furthermore we are going to demonstrate the relationship of total lightning activities with meteorological radar data focusing particularly on Japanese Tornadic storms.
Histomorphometric study of brachiocephalic artery of Japanese quail
Shariati, Sarah; Rahmanifar, Farhad; Tamadon, Amin
2015-01-01
Brachiocephalic arteries in quails are large arteries which are arising separately from the aortic arch. The aim of the present study was to determine the histomorphometric aspects of brachiocephalic arteries in the Japanese quail. The different layers of the brachiocephalic artery were studied quantitatively in 10, 20 and 60 days-old Japanese quail; (n = 6) and both sexes. Luminal diameter, thickness of the intima, media and adventitia, the percentage of the intima, media and adventitia, as compared with the total wall thickness were determined. It was found that luminal diameter and whole artery thickness increased by age (p < 0.05). In addition, the tunica media was the thickest layer, then tunica intima and at last tunica adventitia (p < 0.05). The muscularity of the right brachiocephalic artery was more than that of the left one (p < 0.05). Histomorphometric study of brachiocephalic arteries of Japanese quails showed that increasing of age causes increase of internal and external diameters of the artery and this increase in females was more than males. PMID:26893806
Histomorphometric study of brachiocephalic artery of Japanese quail.
Shariati, Sarah; Rahmanifar, Farhad; Tamadon, Amin
2015-01-01
Brachiocephalic arteries in quails are large arteries which are arising separately from the aortic arch. The aim of the present study was to determine the histomorphometric aspects of brachiocephalic arteries in the Japanese quail. The different layers of the brachiocephalic artery were studied quantitatively in 10, 20 and 60 days-old Japanese quail; (n = 6) and both sexes. Luminal diameter, thickness of the intima, media and adventitia, the percentage of the intima, media and adventitia, as compared with the total wall thickness were determined. It was found that luminal diameter and whole artery thickness increased by age (p < 0.05). In addition, the tunica media was the thickest layer, then tunica intima and at last tunica adventitia (p < 0.05). The muscularity of the right brachiocephalic artery was more than that of the left one (p < 0.05). Histomorphometric study of brachiocephalic arteries of Japanese quails showed that increasing of age causes increase of internal and external diameters of the artery and this increase in females was more than males.
Technology and Participation in Japanese Factories: The Consequences for Morale and Productivity.
ERIC Educational Resources Information Center
Hull, Frank; Azumi, Koya
1988-01-01
By fully using their human resources, Japanese factories mass produce goods of low cost and high quality. Participation in Japanese factories occurs in a more hierarchical framework than advocated in the Western model of worker democracy. (JOW)
Foundation and progress of Japanese society of toxicologic pathology*.
Konishi, Yoichi; Enomoto, Makoto; Hayashi, Yuzo
2011-03-01
The Japanese Society of Toxicologic Pathology (JSTP) has a differing conceptual framework from the Japanese Society of Pathology (JSP) and Japanese Society of Toxicology (JST) and was founded in 1985 by the leadership of late Dr. Yasukazu Nishiyama with the cooperation of several founding members and the support of JSP. The aim of the JSTP is to improve the human and animal health using an interdisciplinary scientific approach based on pathology and toxicology. In its development as a professional society, the JSTP has established society rules and activities. The JSTP has grown in terms of membership and financial aspects and is now recognized not only domestically but also internationally as a well-organized scientific society. To maintain the high professional standard and visibility of JSTP, we here provide the historical background of the society as a basis for current members to contribute to the continued improvement of our scientific organization.