Science.gov

Sample records for joining region elements

  1. Finite Element Modeling and Optimization of Mechanical Joining Technology

    NASA Astrophysics Data System (ADS)

    Chenot, Jean-Loup; Bouchard, Pierre-Olivier; Massoni, Elisabeth; Mocellin, Katia; Lasne, Patrice

    2011-05-01

    The main scientific ingredients are recalled for developing a general finite element code and model accurately large plastic deformation of metallic materials during joining processes. Multi material contact is treated using the classical master and slave approach. Rupture may occur in joining processes or even be imposed in self piercing riveting and it must be predicted to evaluate the ultimate strength of joins. Damage is introduced with a generalized uncoupled damage criterion, or by utilizing a coupled formulation with a Lemaître law. Several joining processes are briefly analyzed in term of specific scientific issues: riveting, self piercing riveting, clinching, crimping, hemming and screwing. It is shown that not only the joining process can be successfully simulated and optimized, but also the strength of the assembly can be predicted in tension and in shearing.

  2. Finite element thermal analysis for PMMA/st.st.304 laser direct joining

    NASA Astrophysics Data System (ADS)

    Hussein, Furat I.; Salloomi, Kareem N.; Akman, E.; Hajim, K. I.; Demir, A.

    2017-01-01

    This work is concerned with building a three-dimensional (3D) ab-initio models that is capable of predicting the thermal distribution of laser direct joining processes between Polymethylmethacrylate (PMMA) and stainless steel 304(st.st.304). ANSYS® simulation based on finite element analysis (FEA) was implemented for materials joining in two modes; laser transmission joining (LTJ) and conduction joining (CJ). ANSYS® simulator was used to explore the thermal environment of the joints during joining (heating time) and after joining (cooling time). For both modes, the investigation is carried out when the laser spot is at the middle of the joint width, at 15 mm from the commencement point (joint edge) at traveling time of 3.75 s. Process parameters involving peak power (Pp=3 kW), pulse duration (τ=5 ms), pulse repetition rate (PRR=20 Hz) and scanning speed (v=4 mm/s) are applied for both modes.

  3. Finite Element Simulation of Plastic Joining Processes of Steel and Aluminum Alloy Sheets

    SciTech Connect

    Mori, K.; Abe, Y.; Kato, T.

    2007-05-17

    Various high tensile strength steel sheets and an aluminum alloy sheet were joined with a self-piercing rivet. It is not easy to weld the aluminum alloy sheet and high tensile strength sheets by means of conventional resistance welding because of very different melting points. To obtain optimum joining conditions, joining defects were categorized into separation of the sheets and an inner fracture. The joining range of ultra high tensile strength steel and aluminum alloy sheets was extended by means of dies optimized by finite element simulation. The joint strength is greatly influenced by not only the strength of the sheets and rivets but also the ratio of the thickness of the lower sheet to the total thickness. In addition, mechanical clinching of high strength steel and aluminum alloy sheets was simulated.

  4. Finite Element Simulation of Plastic Joining Processes of Steel and Aluminum Alloy Sheets

    NASA Astrophysics Data System (ADS)

    Mori, K.; Abe, Y.; Kato, T.

    2007-05-01

    Various high tensile strength steel sheets and an aluminum alloy sheet were joined with a self-piercing rivet. It is not easy to weld the aluminum alloy sheet and high tensile strength sheets by means of conventional resistance welding because of very different melting points. To obtain optimum joining conditions, joining defects were categorized into separation of the sheets and an inner fracture. The joining range of ultra high tensile strength steel and aluminum alloy sheets was extended by means of dies optimized by finite element simulation. The joint strength is greatly influenced by not only the strength of the sheets and rivets but also the ratio of the thickness of the lower sheet to the total thickness. In addition, mechanical clinching of high strength steel and aluminum alloy sheets was simulated.

  5. Rigorous joining of advanced reduced-dimensional beam models to three-dimensional finite element models

    NASA Astrophysics Data System (ADS)

    Song, Huimin

    In the aerospace and automotive industries, many finite element analyses use lower-dimensional finite elements such as beams, plates and shells, to simplify the modeling. These simplified models can greatly reduce the computation time and cost; however, reduced-dimensional models may introduce inaccuracies, particularly near boundaries and near portions of the structure where reduced-dimensional models may not apply. Another factor in creation of such models is that beam-like structures frequently have complex geometry, boundaries and loading conditions, which may make them unsuitable for modeling with single type of element. The goal of this dissertation is to develop a method that can accurately and efficiently capture the response of a structure by rigorous combination of a reduced-dimensional beam finite element model with a model based on full two-dimensional (2D) or three-dimensional (3D) finite elements. The first chapter of the thesis gives the background of the present work and some related previous work. The second chapter is focused on formulating a system of equations that govern the joining of a 2D model with a beam model for planar deformation. The essential aspect of this formulation is to find the transformation matrices to achieve deflection and load continuity on the interface. Three approaches are provided to obtain the transformation matrices. An example based on joining a beam to a 2D finite element model is examined, and the accuracy of the analysis is studied by comparing joint results with the full 2D analysis. The third chapter is focused on formulating the system of equations for joining a beam to a 3D finite element model for static and free-vibration problems. The transition between the 3D elements and beam elements is achieved by use of the stress recovery technique of the variational-asymptotic method as implemented in VABS (the Variational Asymptotic Beam Section analysis). The formulations for an interface transformation matrix and

  6. Immunoglobulin V/J recombination is accompanied by deletion of joining site and variable region segments.

    PubMed Central

    Seidman, J G; Nau, M M; Norman, B; Kwan, S P; Scharff, M; Leder, P

    1980-01-01

    A site-specific recombination event is responsible for the somatic activation of immunoglobulin genes and for generating a major share of immunoglobulin gene diversity. Although several possible mechanisms can be proposed to account for this process, recombinatio accompanied by deletion is a particularly attractive mechanism because it might utilize inverted repeat sequences noted on the 3' side of all variable regions and on the 5' side of all joining site segments thus far studied. Testing this model is complicated by the fact that antibody cells are at least diploid and gene segments on the inactive chromosome can obscure deletions occurring within the active gene. Accordingly, we have screened several immunoglobulin-producing plasmacytoma lines to select those in which both chromosomes are rearranged. By using appropriate cell lines and variable and joining region probes in in situ hybridization experiments, we show that recombination is accompanied by the deletion of both variable and joining region genes. These experiments also allow us to map the site of V/J recombination of several active immunoglobulin genes and suggest an order and orientation for variable, joining, and constant region sequences. Images PMID:6777777

  7. Recombination events near the immunoglobulin Cmu gene join variable and constant region genes, switch heavy-chain expression, or inactivate the locus.

    PubMed

    Cory, S; Webb, E; Gough, J; Adams, J M

    1981-04-28

    Immunoglobulin heavy-chain expression is initiated by recombination between a variable region (VH) gene and one of several joining region (JH) genes located near the mu constant region (Cmu) gene, and the active VH gene can subsequently switch to another CH gene. That the general mechanism for CH switching involves recombination between sites within the JH-Cmu intervening sequence and the 5' flanking region of another CH gene is supported here by Southern blot hybridization analysis of eight IgG- and IgA-secreting plasmacytomas. An alternative model requiring successive VH linkage to similar JH clusters near each CH gene is shown to be very unlikely since the mouse genome appears to contain only one complement of the JH locus and no JH gene was detectable within large cloned sequences flanking germline C gamma 3 and C gamma 1 genes. Thus, VH-JH joining and CH switching are mediated by separate regions of "the joining-switch" or J-S element. In each plasmacytoma examined, the J-S element had undergone recombination within both the JH locus and the switch region and was shown to be linked to the functional CH gene in an IgG3, and IgG1, and three IgA secretors. Both JH joining and CH switching occurred by deletion of DNA. Switch recombination occurred at more than one site within the J-S element in different lines, even for recombination with the same CH gene. Significantly, although heavy-chain expression is restricted to one allele ("allelic exclusion"), all rearranged in each plasmacytoma. Some rearrangements were aberrant, involving, for example, deletion of all JH genes from the allele. Hence, an error-prone recombination machinery may account for allelic exclusion in many plasmacytomas.

  8. Koffka's effect is mediated by figure thickness at the joining region.

    PubMed

    Huang, Abigail E; Hon, Alice J; Li, Xintong; McCormick, Meghan C; Patel, Dina A; Chubb, Charles; Altschuler, Eric L

    2011-01-01

    Three-quarters of a century ago Gestalt psychologist Kurt Koffka described a remarkable effect: when a contiguous gray ring is placed on a background half one shade of gray, half another, the ring appears homogeneous. However, if the ring is divided, the two halves of the ring appear different shades of gray, the half of the ring on the darker background appearing lighter than the half of the ring on the lighter background. The Gestalt principle of continuity is used to explain this effect. But what microscopic principles might be mediating this effect? Recently we found sufficiently thin rings (annuli) appear heterogeneous even when geometrically continuous. Here, using crescent-shaped figures instead of the circular annuli used for the traditional Koffka effect, we show that this effect of thickness of the ring is mediated by the thickness at the boundary of the region where the halves of the figure are joined.

  9. MECHANICALLY-JOINED PLATE-TYPE ALUMINUM-CLAD FUEL ELEMENT

    DOEpatents

    Erwin, J.H.

    1962-12-11

    A method of fabricating MTR-type fuel elements is described wherein dove- tailed joints are used to fasten fuel plates to supporting side members. The method comprises the steps of dove-tailing the lateral edges of the fuel plates, inserting the dove-tailed edges into corresponding recesses which are provided in a pair of supporting side members, and compressing the supporting side members in a direction so as to close the recesses onto the dove-tailed edges. (AEC)

  10. Explosive Joining

    NASA Technical Reports Server (NTRS)

    1989-01-01

    Laurence J. Bement of Langley Research Center invented a technique to permit metal joining operations under hazardous or inaccessible conditions. The process, which provides a joint with double the strength of the parent metal, involves the use of very small quantities of ribbon explosive to create hermetically sealed joints. When the metal plates are slammed together by the explosion's force, joining is accomplished. The collision causes a skin deep melt and ejection of oxide films on the surfaces, allowing a linkup of electrons that produce superstrong, uniform joints. The technique can be used to join metals that otherwise would not join and offers advantages over mechanical fasteners and adhesives. With Langley assistance, Demex International Ltd. refined and commercialized the technology. Applications include plugging leaking tubes in feedwater heaters. Demex produces the small plugs, associated sleeves and detonators. The technology allows faster plugging, reduces downtime, cuts plugging costs and increases reliability.

  11. Ceramic joining

    SciTech Connect

    Loehman, R.E.

    1996-04-01

    This paper describes the relation between reactions at ceramic-metal interfaces and the development of strong interfacial bonds in ceramic joining. Studies on a number of systems are described, including silicon nitrides, aluminium nitrides, mullite, and aluminium oxides. Joints can be weakened by stresses such as thermal expansion mismatch. Ceramic joining is used in a variety of applications such as solid oxide fuel cells.

  12. Generation and reactivation of T-cell receptor A joining region pseudogenes in primates

    SciTech Connect

    Thiel, C.; Lanchbury, J.S.; Otting, N.

    1996-06-01

    Tandemly duplicated T-cell receptor (Tcr) AJ (J{alpha}) segments contribute significantly to TCRA chain junctional region diversity in mammals. Since only limited data exists on TCRA diversity in nonhuman primates, we examined the TCRAJ regions of 37 chimpanzee and 71 rhesus macaque TCRA cDNA clones derived from inverse polymerase chain reaction on peripheral blood mononuclear cell cDNA of healthy animals. Twenty-five different TCRAJ regions were characterized in the chimpanzee and 36 in the rhesus macaque. Each bears a close structural relationship to an equivalent human TCRAJ region. Conserved amino acid motifs are shared between all three species. There are indications that differences between nonhuman primates and humans exist in the generation of TCRAJ pseudogenes. The nucleotide and amino acid sequences of the various characterized TCRAJ of each species are reported and we compare our results to the available information on human genomic sequences. Although we provide evidence of dynamic processes modifying TCRAJ segments during primate evolution, their repertoire and primary structure appears to be relatively conserved. 21 refs., 2 figs.

  13. Joined ceramic product

    DOEpatents

    Henager, Jr., Charles W [Kennewick, WA; Brimhall, John L [West Richland, WA

    2001-08-21

    According to the present invention, a joined product is at least two ceramic parts, specifically bi-element carbide parts with a bond joint therebetween, wherein the bond joint has a metal silicon phase. The bi-element carbide refers to compounds of MC, M.sub.2 C, M.sub.4 C and combinations thereof, where M is a first element and C is carbon. The metal silicon phase may be a metal silicon carbide ternary phase, or a metal silicide.

  14. Method of joining ceramics

    DOEpatents

    Henager, Jr., Charles H.; Brimhall, John L.

    2000-01-01

    According to the method of the present invention, joining a first bi-element carbide to a second bi-element carbide, has the steps of: (a) forming a bond agent containing a metal carbide and silicon; (b) placing the bond agent between the first and second bi-element carbides to form a pre-assembly; and (c) pressing and heating the pre-assembly in a non-oxidizing atmosphere to a temperature effective to induce a displacement reaction creating a metal silicon phase bonding the first and second bi-element carbides.

  15. Joining of tubes by gas detonation forming

    NASA Astrophysics Data System (ADS)

    Jenkouk, Vahid; Patil, Sandeep; Markert, Bernd

    2016-08-01

    For many applications, such as in structural components, it is required to join two tubes - sometimes with dissimilar material properties. Only few research studies have investigated the joining of tubular metallic components by means of high-velocity forming processes. In this paper, we present the novel process of joining of two tubes by a gas detonation pressure wave. In particular, the joining of a copper and a steel tube is discussed by means of a finite element study and a conducted experiment.

  16. Joining SI3N4 for Advanced Turbomachinery Applications

    SciTech Connect

    GLASS, S. JILL; LOEHMAN, RONALD E.; HOSKING, F. MICHAEL; STEPHENS JR., JOHN J.; VIANCO, PAUL T.; NEILSEN, MICHAEL K.; WALKER, CHARLES A.; POLLINGER, J.P.; MAHONEY, F.M.; QUILLEN, B.G.

    2000-07-01

    The main objective of this project was to develop reliable, low-cost techniques for joining silicon nitride (Si{sub 3}N{sub 4}) to itself and to metals. For Si{sub 3}N{sub 4} to be widely used in advanced turbomachinery applications, joining techniques must be developed that are reliable, cost-effective, and manufacturable. This project addressed those needs by developing and testing two Si{sub 3}N{sub 4} joining systems; oxynitride glass joining materials and high temperature braze alloys. Extensive measurements were also made of the mechanical properties and oxidation resistance of the braze materials. Finite element models were used to predict the magnitudes and positions of the stresses in the ceramic regions of ceramic-to-metal joints sleeve and butt joints, similar to the geometries used for stator assemblies.

  17. Cohabitation of insulators and silencing elements in yeast subtelomeric regions.

    PubMed Central

    Fourel, G; Revardel, E; Koering, C E; Gilson, E

    1999-01-01

    In budding yeast, the telomeric DNA is flanked by a combination of two subtelomeric repetitive sequences, the X and Y' elements. We have investigated the influence of these sequences on telomeric silencing. The telomere-proximal portion of either X or Y' dampened silencing when located between the telomere and the reporter gene. These elements were named STARs, for subtelomeric anti-silencing regions. STARs can also counteract silencer-driven repression at the mating-type HML locus. When two STARs bracket a reporter gene, its expression is no longer influenced by surrounding silencing elements, although these are still active on a second reporter gene. In addition, an intervening STAR uncouples the silencing of neighboring genes. STARs thus display the hallmarks of insulators. Protection from silencing is recapitulated by multimerized oligonucleotides representing Tbf1p- and Reb1p-binding sites, as found in STARs. In contrast, sequences located more centromere proximal in X and Y' elements reinforce silencing. They can promote silencing downstream of an insulated expressed domain. Overall, our results suggest that the silencing emanating from telomeres can be propagated in a discontinuous manner via a series of subtelomeric relay elements. PMID:10228166

  18. Precision Joining Center

    SciTech Connect

    Powell, J.W.; Westphal, D.A.

    1991-08-01

    A workshop to obtain input from industry on the establishment of the Precision Joining Center (PJC) was held on July 10--12, 1991. The PJC is a center for training Joining Technologists in advanced joining techniques and concepts in order to promote the competitiveness of US industry. The center will be established as part of the DOE Defense Programs Technology Commercialization Initiative, and operated by EG G Rocky Flats in cooperation with the American Welding Society and the Colorado School of Mines Center for Welding and Joining Research. The overall objectives of the workshop were to validate the need for a Joining Technologists to fill the gap between the welding operator and the welding engineer, and to assure that the PJC will train individuals to satisfy that need. The consensus of the workshop participants was that the Joining Technologist is a necessary position in industry, and is currently used, with some variation, by many companies. It was agreed that the PJC core curriculum, as presented, would produce a Joining Technologist of value to industries that use precision joining techniques. The advantage of the PJC would be to train the Joining Technologist much more quickly and more completely. The proposed emphasis of the PJC curriculum on equipment intensive and hands-on training was judged to be essential.

  19. An investigation of the weld region on the SAE 1020 joined with metal active gas and determination of the mismatch factor

    SciTech Connect

    Meric, C.; Tokdemir, M.

    1999-10-01

    In this study, the joining process of SAE 1020 low carbon steel, generally used in the industry, has been completed using the metal active gas (MAG) weld method. The goal of this study was to examine the mismatch between base and weld metal. After the joining process, mechanical properties of the samples of the base metal (BM), the heat affected zone (HAZ), and the weld metal (WM) were investigated, and the crack tip opening displacement (CTOD) test was performed.

  20. Study on the validity region of Energy Finite Element Analysis

    NASA Astrophysics Data System (ADS)

    Kong, Xiangjie; Chen, Hualing; Zhu, Danhui; Zhang, Wenbo

    2014-04-01

    The validity domain of Energy Finite Element Analysis (EFEA) is studied in this paper. The validity region and criterion of EFEA are studied theoretically from the formation of reverberant plane wave field, one of the main assumptions of EFEA. The studies are acquired by virtue of the equation of radiative energy transfer method, a similar wave method that can express the direct field and its conversion relationship with reverberant field exactly. The result shows that the SEA criterion of diffuse field derived by Le Bot can be used as a good indicator for the EFEA validity. Numerical simulations on a rectangular plate with different physical parameters are applied to validate the criterion. The validity region and the diagrams of validity of EFEA are assessed and discussed. Some noteworthy conclusions about EFEA are drawn.

  1. Stress concentration around an atelectatic region: a finite element model.

    PubMed

    Makiyama, A M; Gibson, L J; Harris, R S; Venegas, J G

    2014-09-15

    Lung parenchyma surrounding an atelectatic region is thought to be subjected to increased stress compared with the rest of the lung. Using 37 hexagonal cells made of linear springs, Mead et al. (1970) measured a stress concentration greater than 30% in the springs surrounding a stiffer central cell. We re-examine the problem using a 2D finite element model of 500 cells made of thin filaments with a non-linear stress-strain relationship. We study the consequences of increasing the central stiff region from one to nine contiguous cells in regular hexagonal honeycombs and random Voronoi honeycombs. The honeycomb structures were uniformly expanded with strains of 15%, 30%, 45% and 55% above their resting, non-deformed geometry. The curve of biaxial stress vs. fractional area change has a similar shape to that of the pressure-volume curve of the lung, showing an initial regime with relatively flat slope and a final regime with decreasing slope, tending toward an asymptote. Regular honeycombs had little variability in the maximum stress in radially oriented filaments adjacent to the central stiff region. In contrast, some filaments in random Voronoi honeycombs were subjected to stress concentration approximately 16 times the average stress concentration in the radially oriented filaments adjacent to the stiff region. These results may have implications in selecting the appropriate strategy for mechanical ventilation in ARDS and defining a "safe" level of alveolar pressure for ventilating atelectatic lungs.

  2. Precision Joining Center

    NASA Technical Reports Server (NTRS)

    Powell, John W.

    1991-01-01

    The establishment of a Precision Joining Center (PJC) is proposed. The PJC will be a cooperatively operated center with participation from U.S. private industry, the Colorado School of Mines, and various government agencies, including the Department of Energy's Nuclear Weapons Complex (NWC). The PJC's primary mission will be as a training center for advanced joining technologies. This will accomplish the following objectives: (1) it will provide an effective mechanism to transfer joining technology from the NWC to private industry; (2) it will provide a center for testing new joining processes for the NWC and private industry; and (3) it will provide highly trained personnel to support advance joining processes for the NWC and private industry.

  3. Joining of dissimilar materials

    DOEpatents

    Tucker, Michael C; Lau, Grace Y; Jacobson, Craig P

    2012-10-16

    A method of joining dissimilar materials having different ductility, involves two principal steps: Decoration of the more ductile material's surface with particles of a less ductile material to produce a composite; and, sinter-bonding the composite produced to a joining member of a less ductile material. The joining method is suitable for joining dissimilar materials that are chemically inert towards each other (e.g., metal and ceramic), while resulting in a strong bond with a sharp interface between the two materials. The joining materials may differ greatly in form or particle size. The method is applicable to various types of materials including ceramic, metal, glass, glass-ceramic, polymer, cermet, semiconductor, etc., and the materials can be in various geometrical forms, such as powders, fibers, or bulk bodies (foil, wire, plate, etc.). Composites and devices with a decorated/sintered interface are also provided.

  4. Pulse joining cartridges

    DOEpatents

    Golovashchenko, Sergey Fedorovich; Bonnen, John Joseph Francis

    2016-08-23

    A pulsed joining tool includes a tool body that defines a cavity that receives an inner tubular member and an outer tubular member and a pulse joining cartridge. The tubular members are nested together with the cartridge being disposed around the outer tubular member. The cartridge includes a conductor, such as a wire or foil, that extends around the outer tubular member and is insulated to separate a supply segment from a return segment. A source of stored electrical energy is discharged through the conductor to join the tubular members with an electromagnetic force pulse.

  5. Joining Steel Armor - Intermix

    DTIC Science & Technology

    1979-03-01

    TARADCOM a d ki Lk A el B~ 0el RWET0 TECHNICAL REPORT NO. 12311 JOINING STEEL ARMOR - INTERMIX March 1979 U U * S* ’ "U .by B. . A.SCEV * U...authorized documents. O "if TECHNICAL REPORT NO. 12311 JOINING STEEL ARMOR - INTERMIX BY B. A. SCHEVO March 1979 AMS: 3197..6D.4329 TARADCOM ARMOR AND...Intermix Process ...... ........ 3 Test Procedures - Intermix Armor ........ ......... 4 Mock Hull ................. ..................... 5 Results

  6. Joined concentric tubes

    DOEpatents

    DeJonghe, Lutgard; Jacobson, Craig; Tucker, Michael; Visco, Steven

    2013-01-01

    Tubular objects having two or more concentric layers that have different properties are joined to one another during their manufacture primarily by compressive and friction forces generated by shrinkage during sintering and possibly mechanical interlocking. It is not necessary for the concentric tubes to display adhesive-, chemical- or sinter-bonding to each other in order to achieve a strong bond. This facilitates joining of dissimilar materials, such as ceramics and metals.

  7. Joined Beryllium Mirror Demonstrator

    NASA Technical Reports Server (NTRS)

    Stahl, H. Philip; Parsonage, Tom; Burdine, Robert (Technical Monitor)

    2001-01-01

    Fabrications of large Beryllium optical components are fundamentally limited by available facility capabilities. To overcome this limitation, NASA funded Brush Wellman Corp to study a Be joining process. Four 76 mm diameters samples and a 0.5 mm diameter Joined Beryllium Mirror Demonstrator (JBMD) were fabricated. This presentation will review the fabrication of these samples and summarize the results of their cryogenic testing at MSFCs XRCF.

  8. Advanced Joining Technology

    DTIC Science & Technology

    1982-01-01

    cracking in welding of alloy 713C . Filler-metal thermal expansion characteristics and mechanical properties may influence HAZ soundness. Filler-metal...aluminum-, and titanium-base alloys ; superalloys (both nickel and cobalt base); and ceramics. The detailed review of ceramic-to-ceramic and ceramic...building. The Air Force has funded work on forming and joining of aluminum powder metal alloys , and the Army conducted a metals joining technology

  9. Universal connectors for joining stringers

    NASA Technical Reports Server (NTRS)

    Harrison, Jr., Ernest (Inventor)

    1987-01-01

    This invention is a lightweight, universal connector that joins stringers at various angles. The connectors 10 are fabricated from fiber-epoxy resin strips that wrap around stringers 30 and have ends, tabs 16 and 18, which extend in one general direction. The inside surface of the first tab 16 lies on a plane defined by the stringers being joined, and the second tab 18 is separated from the first tab 16 by a distance equal to their thickness. Stringers 30 of different shapes and sizes are joined by alternately bonding the first tab 16 of one connector between the first 16 and second 18 tabs of another connector. Tee-joints are formed by using web elements 41 and 42 which each partially wrap around a stringer 3010 and have tabs 411 and 421 which are offset, and are bonded between tabs 16 and 18 of universal connectors 109 and 1010 bonded to another stringer 309. Sharp corners are trimmed from the tabs so that a gusset area remains between the stringers for support. Acute angle through obtuse angle joints are formed by trimming those edges of the tabs which lie against the stringers. A specific application of the invention is a Walker 60, utilized by handicapped individuals, fabricated from composite materials that is 40% lighter than similar metallic structures.

  10. Convective Enhancement of Icing Roughness Elements in Stagnation Region Flows

    NASA Technical Reports Server (NTRS)

    Hughes, Michael T.; McClain, Stephen T.; Vargas, Mario; Broeren, Andy

    2015-01-01

    To improve existing ice accretion simulation codes, more data regarding ice roughness and its effects on convective heat transfer are required. To build on existing research on this topic, this study used the Vertical Icing Studies Tunnel (VIST) at NASA Glenn Research to model realistic ice roughness in the stagnation region of a NACA 0012 airfoil. Using the VIST, a test plate representing the leading 2% chord of the airfoil was subjected to flows of 7.62 m/s (25 ft/s), 12.19 m/s (40 ft/s), and 16.76 m/s (55 ft/s). The test plate was fitted with 3 surfaces, each with a different representation of ice roughness: 1) a control surface with no ice roughness, 2) a surface with ice roughness with element height scaled by 10x and streamwise rough zone width from the stagnation point scaled by 10x, and 3) a surface with ice roughness with element height scaled by 10x and streamwise rough zone width from the stagnation point scaled by 25x. Temperature data from the tests were recorded using an infrared camera and thermocouples imbedded in the test plate. From the temperature data, a convective heat transfer coefficient map was created for each case. Additional testing was also performed to validate the VIST's flow quality. These tests included five-hole probe and hot-wire probe velocity traces to provide flow visualization and to study boundary layer formation on the various test surfaces. The knowledge gained during the experiments will help improve ice accretion codes by providing heat transfer coefficient validation data and by providing flow visualization data helping understand current and future experiments performed in the VIST.

  11. Duct Joining System

    DOEpatents

    Proctor, John P.

    2001-02-27

    A duct joining system for providing an air-tight seal and mechanical connection for ducts and fittings is disclosed. The duct joining system includes a flexible gasket affixed to a male end of a duct or fitting. The flexible gasket is affixed at an angle relative to normal of the male end of the duct. The female end of the other duct includes a raised bead in which the flexible gasket is seated when the ducts are properly joined. The angled flexible gasket seated in the raised bead forms an air-tight seal as well as fastens or locks the male end to the female end. Alternatively, when a flexible duct is used, a band clamp with a raised bead is clamped over the female end of the flexible duct and over the male end of a fitting to provide an air tight seal and fastened connection.

  12. Duct joining system

    DOEpatents

    Proctor, John P.; deKieffer, Robert C.

    2001-01-01

    A duct joining system for providing an air-tight seal and mechanical connection for ducts and fittings is disclosed. The duct joining system includes a flexible gasket affixed to a male end of a duct or fitting. The flexible gasket is affixed at an angle relative to normal of the male end of the duct. The female end of the other duct includes a raised bead in which the flexible gasket is seated when the ducts are properly joined. The angled flexible gasket seated in the raised bead forms an air-tight seal as well as fastens or locks the male end to the female end. Alternatively, when a flexible duct is used, a band clamp with a raised bead is clamped over the female end of the flexible duct and over the male end of a fitting to provide an air tight seal and fastened connection.

  13. Come Join the Band

    ERIC Educational Resources Information Center

    Olson, Cathy Applefeld

    2011-01-01

    A growing number of students in Blue Springs, Missouri, are joining the band, drawn by a band director who emphasizes caring and inclusiveness. In the four years since Melissia Goff arrived at Blue Springs High School, the school's extensive band program has swelled. The marching band alone has gone from 100 to 185 participants. Also under Goff's…

  14. On the problem of embedding picture elements in regions

    NASA Technical Reports Server (NTRS)

    Yakimovsky, Y.; Cunningham, R.

    1976-01-01

    A few new algorithms for region growing in pictures were developed. These algorithms are a step toward finding a satisfactory solution to the image segmentation problem, and in-depth understanding of the problems of nonsemantic image segmentation. The algorithms utilize a sequential decision approach for region boundaries detection. The sequential decisions are supported by a stochastic algorithm that maintains local statistics of the region near the boundaries as the region grows. A few illustrations of the algorithm's performance are included.

  15. Multicolor printing plate joining

    NASA Technical Reports Server (NTRS)

    Waters, W. J. (Inventor)

    1984-01-01

    An upper plate having ink flow channels and a lower plate having a multicolored pattern are joined. The joining is accomplished without clogging any ink flow paths. A pattern having different colored parts and apertures is formed in a lower plate. Ink flow channels each having respective ink input ports are formed in an upper plate. The ink flow channels are coated with solder mask and the bottom of the upper plate is then coated with solder. The upper and lower plates are pressed together at from 2 to 5 psi and heated to a temperature of from 295 F to 750 F or enough to melt the solder. After the plates have cooled and the pressure is released, the solder mask is removed from the interior passageways by means of a liquid solvent.

  16. Welding and joining: A compilation

    NASA Technical Reports Server (NTRS)

    1975-01-01

    A compilation is presented of NASA-developed technology in welding and joining. Topics discussed include welding equipment, techniques in welding, general bonding, joining techniques, and clamps and holding fixtures.

  17. Trace element characteristics of lithospheric and asthenospheric mantle in the Rio Grande rift region

    SciTech Connect

    Perry, F.V.

    1994-06-01

    Trace element analyses of 10 mafic volcanic rocks from the Colorado Plateau transition zone, Colorado Plateau, Rio Grande rift, and Great Plains were obtained to characterize the trace element characteristics of asthenospheric and lithospheric mantle beneath these regions. Characterization of these mantle reservoirs using the trace element contents of basalts allows one to track the response of the lithosphere to continental rifting and extension.

  18. Spatial distribution and source identification of trace elements in topsoil from heavily industrialized region, Aliaga, Turkey.

    PubMed

    Kara, Melik; Dumanoğlu, Yetkin; Altıok, Hasan; Elbir, Tolga; Odabası, Mustafa; Bayram, Abdurrahman

    2014-10-01

    Topsoil samples (n = 40) were collected from a heavily industrialized region in Turkey. The region includes several scrap processing iron-steel plants with electric arc furnaces (EAFs), a petroleum refinery, a petrochemical complex, steel rolling mills, a natural gas-fired power plant, ship-breaking yards and very dense transportation activities. The region has undergone a rapid transition from an agricultural region to a heavily industrialized region in the last three decades. Collected soil samples were analyzed for 48 trace elements using inductively coupled plasma-mass spectrometry (ICP-MS). The elemental distribution pattern in the region indicated that Nemrut area with dense iron-steel production activities was a hotspot for elemental pollution. In addition to crustal elements, concentrations of anthropogenic trace elements (i.e., Fe, Zn, Pb, Mn, Cu, Cd, Cr and Mo) were very high in the area influencing many parts of the region. Elemental compositions of fugitive sources polluting the soil (i.e., paved and unpaved roads, slag piles, EAFs filter dust piles and coal piles) were also determined. The methods (enrichment factors [EFs] and the index of geoaccumulation [Igeo]) used for determination of pollution status of soil showed that Cr, Ag, Zn, As and Pb were the strongly contaminating elements for the region. Principal component analysis (PCA) clearly indicated that anthropogenic sources (steel production, refinery and petrochemical processes and traffic) were important sources in this region.

  19. Quantitative spectral trace element analysis of pathogenic biominerals from residents of the Omsk region

    NASA Astrophysics Data System (ADS)

    Golovanova, O. A.; Bel'Skaya, L. V.; Berezina, N. Yu.

    2006-11-01

    We have used x-ray fluorescence elemental analysis to analyze a collection of 170 kidney stones, 89 dental calculi (tartar), and 120 gallstones from patients in the Omsk region. According to the experimental results, we observed 36 elements in the kidney stones, 14 elements in the tartar, and 13 elements in the gallstones. We used inductively coupled plasma atomic emission spectroscopy to establish the elemental composition of saliva and bile samples. Comparison of the compositions of the saliva and tartar and also comparison of the compositions of the bile and gallstones showed that biological fluids (saliva and bile) are the likely source of trace elements for pathogenic mineralizations.

  20. Joining of Beryllium

    SciTech Connect

    Goldberg, A

    2006-02-01

    A handbook dealing with the many aspects of beryllium that would be important for the users of this metal is currently being prepared. With an introduction on the applications, advantages and limitations in the use of this metal the following topics will be discussed in this handbook: physical, thermal, and nuclear properties; extraction from the ores; purification and casting of ingots; production and types of beryllium powders; consolidation methods, grades, and properties; mechanical properties with emphasis on the various factors affecting these properties; forming and mechanical working; welding, brazing, bonding, and fastening; machining; powder deposition; corrosion; health aspects; and examples of production of components. This report consists of ''Section X--Joining'' from the handbook. The prefix X is maintained here for the figures, tables and references. In this section the different methods used for joining beryllium and the advantages, disadvantages and limitations of each are presented. The methods discussed are fusion welding, brazing, solid state bonding (diffusion bonding and deformation bonding), soldering, and mechanical fastening. Since beryllium has a high affinity for oxygen and nitrogen with the formation of oxides and nitrides, considerable care must be taken on heating the metal, to protect it from the ambient atmosphere. In addition, mating surfaces must be cleaned and joints must be designed to minimize residual stresses as well as locations for stress concentration (notch effects). In joining any two metals the danger exists of having galvanic corrosion if the part is subjected to moisture or to any type of corroding environment. This becomes a problem if the less noble (anodic) metal has a significantly smaller area than the more noble (cathodic) metal since the ions (positive charges) from the anodic (corroding) metal must correspond to the number of electrons (negative charges) involved at the cathode. Beryllium is anodic to almost

  1. Low temperature joining of ceramic composites

    DOEpatents

    Barton, Thomas J.; Anderson, Iver E.; Ijadi-Maghsoodi, Sina; Nosrati, Mohammad; Unal, Ozer

    1999-01-12

    A method of joining similar or dissimilar ceramic and ceramic composite materials, such as SiC continuous fiber ceramic composites, at relatively low joining temperatures uses a solventless, three component bonding agent effective to promote mechanical bond toughness and elevated temperature strength to operating temperatures of approximately 1200 degrees C. The bonding agent comprises a preceramic precursor, an aluminum bearing powder, such as aluminum alloy powder, and mixtures of aluminum metal or alloy powders with another powder, and and boron powder in selected proportions. The bonding agent is disposed as an interlayer between similar or dissimilar ceramic or cermaic composite materials to be joined and is heated in ambient air or inert atmosphere to a temperature not exceeding about 1200 degrees C. to form a strong and tough bond joint between the materials. The bond joint produced is characterized by a composite joint microstructure having relatively soft, compliant aluminum bearing particulate regions dispersed in a ceramic matrix.

  2. Low temperature joining of ceramic composites

    DOEpatents

    Barton, T.J.; Anderson, I.E.; Ijadi-Maghsoodi, S.; Nosrati, M.; Unal, O.

    1999-01-12

    A method of joining similar or dissimilar ceramic and ceramic composite materials, such as SiC continuous fiber ceramic composites, at relatively low joining temperatures uses a solventless, three component bonding agent effective to promote mechanical bond toughness and elevated temperature strength to operating temperatures of approximately 1200 degrees C. The bonding agent comprises a preceramic precursor, an aluminum bearing powder, such as aluminum alloy powder, and mixtures of aluminum metal or alloy powders with another powder, and boron powder in selected proportions. The bonding agent is disposed as an interlayer between similar or dissimilar ceramic or ceramic composite materials to be joined and is heated in ambient air or inert atmosphere to a temperature not exceeding about 1200 degrees C. to form a strong and tough bond joint between the materials. The bond joint produced is characterized by a composite joint microstructure having relatively soft, compliant aluminum bearing particulate regions dispersed in a ceramic matrix. 3 figs.

  3. Low temperature joining of ceramic composites

    DOEpatents

    Barton, Thomas J.; Anderson, Iver E.; Ijadi-Maghsoodi, Sina; Nosrati, Mohammad; Unal, Ozer

    1999-07-13

    A method of joining similar or dissimilar ceramic and ceramic composite materials, such as SiC continuous fiber ceramic composites, at relatively low joining temperatures uses a solventless, three component bonding agent effective to promote mechanical bond toughness and elevated temperature strength to operating temperatures of approximately 1200 degrees C. The bonding agent comprises a preceramic precursor, an aluminum bearing powder, such as aluminum alloy powder, and mixtures of aluminum metal or alloy powders with another powder, and and boron powder in selected proportions. The bonding agent is disposed as an interlayer between similar or dissimilar ceramic or ceramic composite materials to be joined and is heated in ambient air or inert atmosphere to a temperature not exceeding about 1200 degrees C. to form a strong and tough bond joint between the materials. The bond joint produced is characterized by a composite joint microstructure having relatively soft, compliant aluminum bearing particulate regions dispersed in a ceramic matrix.

  4. Low temperature joining of ceramic composites

    DOEpatents

    Barton, T.J.; Anderson, I.E.; Ijadi-Maghsoodi, S.; Nosrati, M.; Unal, O.

    1999-07-13

    A method of joining similar or dissimilar ceramic and ceramic composite materials, such as SiC continuous fiber ceramic composites, at relatively low joining temperatures uses a solventless, three component bonding agent effective to promote mechanical bond toughness and elevated temperature strength to operating temperatures of approximately 1200 C. The bonding agent comprises a preceramic precursor, an aluminum bearing powder, such as aluminum alloy powder, and mixtures of aluminum metal or alloy powders with another powder, and boron powder in selected proportions. The bonding agent is disposed as an interlayer between similar or dissimilar ceramic or ceramic composite materials to be joined and is heated in ambient air or inert atmosphere to a temperature not exceeding about 1200 C to form a strong and tough bond joint between the materials. The bond joint produced is characterized by a composite joint microstructure having relatively soft, compliant aluminum bearing particulate regions dispersed in a ceramic matrix. 3 figs.

  5. Low temperature joining of ceramic composites

    DOEpatents

    Barton, Thomas J.; Anderson, Iver E.; Ijadi-Maghsoodi, Sina; Nosrati, Mohammad; Unal, Ozer

    2001-04-10

    A method of joining similar or dissimilar ceramic and ceramic composite materials, such as SiC continuous fiber ceramic composites, at relatively low joining temperatures uses a solventless, three component bonding agent effective to promote mechanical bond toughness and elevated temperature strength to operating temperatures of approximately 1200 degrees C. The bonding agent comprises a preceramic precursor, an aluminum bearing powder, such as aluminum alloy powder, and mixtures of aluminum metal or alloy powders with another powder, and and boron powder in selected proportions. The bonding agent is disposed as an interlayer between similar or dissimilar ceramic or cermaic composite materials to be joined and is heated in ambient air or inert atmosphere to a temperature not exceeding about 1200 degrees C. to form a strong and tough bond joint between the materials. The bond joint produced is characterized by a composite joint microstructure having relatively soft, compliant aluminum bearing particulate regions dispersed in a ceramic matrix.

  6. Trace elements and rare earth elements in wet deposition of Lijiang, Mt. Yulong region, southeastern edge of the Tibetan Plateau.

    PubMed

    Guo, Junming; Kang, Shichang; Huang, Jie; Sillanpää, Mika; Niu, Hewen; Sun, Xuejun; He, Yuanqing; Wang, Shijing; Tripathee, Lekhendra

    2017-02-01

    In order to investigate the compositions and wet deposition fluxes of trace elements and rare earth elements (REEs) in the precipitation of the southeastern edge of the Tibetan Plateau, 38 precipitation samples were collected from March to August in 2012 in an urban site of Lijiang city in the Mt. Yulong region. The concentrations of most trace elements and REEs were higher during the non-monsoon season than during the monsoon season, indicating that the lower concentrations of trace elements and REEs observed during monsoon had been influenced by the dilution effect of increased precipitation. The concentrations of trace elements in the precipitation of Lijiang city were slightly higher than those observed in remote sites of the Tibetan Plateau but much lower than those observed in the metropolises of China, indicating that the atmospheric environment of Lijiang city was less influenced by anthropogenic emissions, and, as a consequence, the air quality was still relatively good. However, the results of enrichment factor and principal component analysis revealed that some anthropogenic activities (e.g., the increasing traffic emissions from the rapid development of tourism) were most likely important contributors to trace elements, while the regional/local crustal sources rather than anthropogenic activities were the predominant contributors to the REEs in the wet deposition of Lijiang city. Our study was relevant not only for assessing the current status of the atmospheric environment in the Mt. Yulong region, but also for specific management actions to be implemented for the control of atmospheric inputs and the health of the environment for the future.

  7. Elemental characterization of PM1 in a heavy traffic region

    NASA Astrophysics Data System (ADS)

    Ambade, Balram

    Eight hours samples of airborne aerosols PM1 were collected during summer (August-September) and winter (October-November) form one year 2010- 2011 in a intense traffic area of Rajnandgaon city, India. Inductively coupled plasma mass spectroscopy was employed to measure heavy metals (Hg, Cd, Ni, Pb, As). Water-soluble ions (Na+, NH4 +, K+, Ca2+, Cl-, NO3 -, and SO42-) and carbonaceous mass (elemental and organic carbon) were detected using ion chromatograph and CHN analyzer, respectively. The results indicate that the composition of PM10 on intense traffic area is highly affected by automobile emissions. Based on the chemical information, positive matrix factorization (PMF) was used to identify PM sources. A total of five source types were identified, including soil dust, vehicle emissions, sea salt, industrial emissions and secondary aerosols, and their contributions were estimated using PMF. The crustal enrichment factors (EF) were calculated using Al as a reference for the trace metal species to identify the sources

  8. To Join or Not to Join

    SciTech Connect

    Wiley, H. S.

    2010-03-01

    At about this time every year, I renew my memberships to several scientific societies, and every year I ask myself the same question: “Should I bother?” In years past, the answer was easy because being a member came with tangible benefits, such as inexpensive journals and the ability to submit abstracts to annual meetings. Nowadays, these perks don’t seem very important. Most society journals are freely available online, and the proliferation of scientific meetings has made it easier to find venues to present my current research. Thus, the volume with which I ask that question—“should I bother?”—has steadily increased. Most scientific societies were established to promote the development and acceptance of a particular field of research. Society journals and annual meetings were the primary way this was accomplished. More recently, the larger societies have expanded their roles to include lobbying for increases in research funding and providing career advice. Although these are worthwhile activities, I don’t need to belong to multiple scientific societies to support them. I almost always renew my society memberships, but I think that it is more out of a sense of tradition than need. Clearly, I am not the only scientist who is ambivalent about societies. Judging from their newsletters, many of the larger societies are struggling with stagnant or declining memberships, especially among young scientists. Although it is the youngest scientists who potentially have the most to gain from a scientific society (from networking, career advice), they are the ones who usually are most poorly served by those societies. This is because scientific societies generally cater to the status quo, not to the new and emerging elements of a field.

  9. Elemental Abundances from Very Low Abundance HII Regions

    NASA Astrophysics Data System (ADS)

    Skillman, Evan D.; Terlevich, Roberto J.; Terlevich, Elena

    1992-12-01

    In 1987 we initiated a program to mitigate the deficiency of known low metallicity galaxies. Following our discoveries of very low abundance H II regions in nearby dwarf galaxies (Skillman et al. 1988, 1989a,b), we used the IDS on the INT to to collect spectra of dwarf galaxies in the Second Byurakan Survey (SBS) of UV excess galaxies. Our survey of over 40 SBS galaxies was completed in January 1990 and we have identified roughly one dozen very low metallicity H II galaxies. Now, with a significant sample of these galaxies, several observational programs are possible; foremost of these is the measurement of the primordial helium abundance (eg., Pagel et al. 1992). We report here on observations from March 1991 and 1992 using the ISIS spectrograph on the WHT to obtain very high quality spectra of 8 of these newly discovered metal-poor galaxies. The ISIS double spectrograph allows simultaneous observations of the blue (3600 - 5100 Angstroms) and red (6300 - 6800 Angstroms). Thus, He, N, O, Ne and S abundances can be derived with relatively small observational uncertainties. We compare our new observations with those in the literature. Our preliminary analysis indicates a slightly larger scatter in He/H at low O/H than had been seen previously. The small scatter may have been due simply to the paucity of observations at low metallicity. References: Pagel, B.E.J., Simonson, E.A., Terlevich, R.J., & Edmunds, M.G. 1992, MNRAS, 255, 325 Skillman, E.D., Kennicutt, R.C., & Hodge, P.W. 1989a, ApJ, 347, 875 Skillman, E.D., Melnick, J., Terlevich, R., & Moles, M. 1988, A&A, 196, 31 Skillman, E.D., Terlevich, R., & Melnick, J. 1989b, MNRAS, 240, 563

  10. Geochemical baseline distribution of harmful elements in the surface soils of Campania region.

    NASA Astrophysics Data System (ADS)

    Albanese, Stefano; Lima, Annamaria; Qu, Chengkai; Cicchella, Domenico; Buccianti, Antonella; De Vivo, Benedetto

    2015-04-01

    Environmental geochemical mapping has assumed an increasing relevance and the separation of values to discriminate between anthropogenic pollution and natural (geogenic) sources has become crucial to address environmental problems affecting the quality of life of human beings. In the last decade, a number of geochemical prospecting projects, mostly focused on surface soils (topsoils), were carried out at different scales (from regional to local) across the whole Campania region (Italy) to characterize the distribution of both harmful elements and persistent organic pollutants (POP) in the environment and to generating a valuable database to serve as reference in developing geomedical studies. During the 2014, a database reporting the distribution of 53 chemical elements in 3536 topsoil samples, collected across the whole region, was completed. The geochemical data, after necessary quality controls, were georeferenced and processed in a geochemistry dedicated GIS software named GEODAS. For each considered element a complete set of maps was generated to depict both the discrete and the spatially continuous (interpolated) distribution of elemental concentrations across the region. The interpolated maps were generated using the Multifractal Inverse Distance eighted (MIDW) algorithm. Subsequently, the S-A method, also implemented in GEODAS, was applied to MIDW maps to eliminate spatially limited anomalies from the original grid and to generate the distribution patterns of geochemical baselines for each element. For a selected group of elements geochemical data were also treated by means of a Compositional Data Analysis (CoDA) aiming at investigating the regionalised structure of the data by considering the joint behaviour of several elements constituting for each sample its whole composition. A regional environmental risk assessment was run on the basis of the regional distribution of heavy metals in soil, land use types and population. The risk assessment produced a

  11. Joining of alumina ceramics and nickel alloy

    SciTech Connect

    Ariga, Tadashi; Nitta, Yuji; Miyazawa, Yasuyuki

    1994-12-31

    Joining of alumina ceramics to nickel alloy was made using the various types of Ag-Cu-Ti brazing filler metal. Ti-containing brazing filler metal was produced by physical vapor deposition (PVD) method on the joining area of the alumina ceramics. The joinability of the brazing filler metal was estimated by its mechanical properties. And the composition and structure of the ceramic-metal bond zone in the alumina ceramics-nickel alloy joints were analyzed by SEM, EPMA and X-ray diffraction examinations. Some of brazing filler metal achieved the highest shear strength 100 MPa at room temperature. The elemental distributions of the interface between alumina ceramics and Ag-Cu-Ti brazing filler metal was shown to form the reaction layer consisting titanium oxide.

  12. UNC-45/CRO1/She4p (UCS) Protein Forms Elongated Dimer and Joins Two Myosin Heads Near Their Actin Binding Region

    SciTech Connect

    H Shi; G Blobel

    2011-12-31

    UNC-45/CRO1/She4p (UCS) proteins have variously been proposed to affect the folding, stability, and ATPase activity of myosins. They are the only proteins known to interact directly with the motor domain. To gain more insight into UCS function, we determined the atomic structure of the yeast UCS protein, She4p, at 2.9 {angstrom} resolution. We found that 16 helical repeats are organized into an L-shaped superhelix with an amphipathic N-terminal helix dangling off the short arm of the L-shaped molecule. In the crystal, She4p forms a 193-{angstrom}-long, zigzag-shaped dimer through three distinct and evolutionary conserved interfaces. We have identified She4p's C-terminal region as a ligand for a 27-residue-long epitope on the myosin motor domain. Remarkably, this region consists of two adjacent, but distinct, binding epitopes localized at the nucleotide-responsive cleft between the nucleotide- and actin-filament-binding sites. One epitope is situated inside the cleft, the other outside the cleft. After ATP hydrolysis and Pi ejection, the cleft narrows at its base from 20 to 12 {angstrom} thereby occluding the inside the cleft epitope, while leaving the adjacent, outside the cleft binding epitope accessible to UCS binding. Hence, one cycle of higher and lower binding affinity would accompany one ATP hydrolysis cycle and a single step in the walk on an actin filament rope. We propose that a UCS dimer links two myosins at their motor domains and thereby functions as one of the determinants for step size of myosin on actin filaments.

  13. Snowpack deposition of trace elements in the Athabasca oil sands region, Canada.

    PubMed

    Guéguen, C; Cuss, C W; Cho, S

    2016-06-01

    The total recoverable and dissolved concentrations of 29 metals and metalloids were analyzed in snowpack collected at 91 sites in the Athabasca oil sands region, Canada in winter 2011. Based on deposition pattern from geographical centre, three groups were found: Type-1 metals (i.e. dissolved and total recoverable V; Mo) showed a significant exponential decrease with distance, suggesting oil sands development sources; Type-2 elements (e.g. Al, Sb, As, Ba, Fe, Ni, Tl, and Ti and Zn) showed exponentially decline patterns but with some local point sources; Type-3 elements (e.g. Cd, Cl, Cr, Mn, Sr and Th) deposition pattern represented local sources. A self-organizing map showed that sites with the highest elemental concentrations (Cluster I) were mainly located in the vicinity of upgrading facilities and along the north-south transects. The lowest elemental concentration sites (Cluster III) were the most distal sites or located in the western region of the study area.

  14. HIP Joining of Cemented Carbides

    SciTech Connect

    Derby, B.; Miodownik, M.

    1999-04-01

    Hot Isostatic Pressing (HIP) is investigated as a technique for joining the cermet WC-15% Co to itself. Encapsulation of the specimens prior to HIPing was carried out using steel encapsulation, glass encapsulation and self encapsulation. The bonds were evaluated using a four point bend method. It is shown that the glass and steel encapsulation methods have a number of inherent problems which make them inappropriate for near net shape processing. In contrast the novel self encapsulation method, described for the first time in this communication, is both simple and effective, producing joined material with bulk strength. The concept of self encapsulation is potentially widely applicable for joining composite materials.

  15. [Principal component analysis of mineral elements and fatty acids composition in flaxseed from ten different regions].

    PubMed

    Xing, Li; Zhao, Feng-Min; Cao, You-Fu; Wang, Mei; Mei, Shuai; Li, Shao-Ping; Cai, Zhi-Yong

    2014-09-01

    Flaxseed is a kind of biomass with high edible and medical value. It is rich in many kinds of nutrients and mineral elements. China is one of the important producing places of flaxseed. In order to explore the main characteristic constituents of mineral elements and fatty acids in flaxseed, the study of analyzing the mineral elements and fatty acid composition from 10 different regions was carried out. The contents of seventeen kinds of mineral elements in flaxseed were determined by inductively coupled plasma mass spectrometry (ICP-MS). The contents of fatty acids of the flaxseed oil obtained under the same conditions were determined by gas chromatography-mass spectrometer (GC-MS). The principal component analysis (PCA) method was applied to the study of analyzing the mineral elements and fatty acid compositions in flaxseeds. The difference in mineral elements and fatty acids of flaxseed from different regions were discussed. The main characteristic constituents of mineral elements and fatty acids were analyzed. The results showed that K, Sr, Mg, Ni, Co, Cr, Cd, Se, Zn and Cu were the main characteristic constituents of the mineral elements. At the same time, C16:0, C18:0, C18: 2, C18:3, C20:0 and C20:1 were the main characteristic constituents of the fatty acids. The combination of ICP-MS, GS-MS and PCA can reveal the characteristics and difference of mineral elements and fatty acids from different regions. The results would provide important theoretical basis for the reasonable and effective utilization of flaxseed.

  16. Regional clarkes of chemical elements in soils of southern European Russia

    NASA Astrophysics Data System (ADS)

    D'yachenko, V. V.; Matasova, I. Yu.

    2016-10-01

    Distribution patterns of 19 elements in soils of the southern part of European Russian were estimated on the basis of the analysis of more than 9000 soil samples; regional clarkes of the elements were compared with their global clarkes, The obtained data attest to the fact that southern Russia is characterized by increased concentrations of most of the microelements with a tendency for their rise in the recent decades. The great role of the aerial migration and deposition of elements results in the enrichment of the soils with technophilic elements, so that the geochemical convergence of the soils is observed. It can be concluded that natural element abundances in soils are subjected to the technogenic transformation reflecting the high rate of contamination of the biosphere.

  17. Identification of the functional elements in the promoter region of human DNA topoisomerase IIIbeta gene.

    PubMed

    Cho, Young Hoon; Park, Jee Young; Han, Sang Youp; Chung, In Kwon

    2004-09-17

    In this study, we have isolated and characterized the promoter region of the human DNA topoisomerase IIIbeta (hTOP3beta) gene. The 5' RACE assay showed a short exon 1 encoding only the 35-bp untranslated region and suggested the presence of multiple transcription initiation sites. The hTOP3beta gene promoter lacks a canonical TATA box or initiation element and is moderately high in GC content. Transient expression of a luciferase reporter gene under the control of serially deleted 5'-flanking sequence identified an activator element between -141 and -119 upstream of the transcription initiation site and a second regulatory element between -91 and -71. On the basis of scanning mutations of triple nucleotides, we demonstrated that a 5'GGAACC3' element between -117 and -112 plays a critical role in the up-regulation of the basal transcription activity. Changing the 5'GGAACC3' sequence leads to markedly reduced promoter activity. Gel mobility shift assays revealed that the 5'GGAACC3' element is required for DNA binding by the transcription factor complex. These observations lead to the conclusion that the positive regulatory region including the 5'GGAACC3' core element is essential for efficient expression of the hTOP3beta gene as well as for the binding of as yet unidentified regulatory factor(s).

  18. Environmentally compliant adhesive joining technology

    SciTech Connect

    Tira, J.S.

    1996-08-01

    Adhesive joining offers one method of assembling products. Advantages of adhesive joining/assembly include distribution of applied forces, lighter weight, appealing appearance, etc. Selecting environmentally safe adhesive materials and accompanying processes is paramount in today`s business climate if a company wants to be environmentally conscious and stay in business. Four areas of adhesive joining (adhesive formulation and selection, surface preparation, adhesive bonding process, waste and pollution generation/cleanup/management) all need to be carefully evaluated before adhesive joining is selected for commercial as well as military products. Designing for six sigma quality must also be addressed in today`s global economy. This requires material suppliers and product manufacturers to work even closer together.

  19. Spain to Join ESO

    NASA Astrophysics Data System (ADS)

    2006-02-01

    /infrared astronomical observing site in Europe and site of the Spanish 10m GranTeCan telescope now nearing completion. With the high quality of Spanish astronomical research as well as the technological competence of Spanish industry, it is only fitting that Spain should join ESO, world-leader in ground-based astronomy. Through ESO Spain will enjoy full access both to all of ESO's current facilities and to unrestricted participation in the great projects that ESO is planning for the future. Spain is already an active partner of the Atacama Large Millimeter Array (ALMA), whose construction and operations are led on behalf of Europe by ESO. ESO's Council approved the admission of Spain at its 107th meeting held in Garching on 7 and 8 December 2005. High resolution images and their captions are available on this page.

  20. Human polyomavirus JCV late leader peptide region contains important regulatory elements

    SciTech Connect

    Akan, Ilhan; Sariyer, Ilker Kudret; Biffi, Renato; Palermo, Victoria; Woolridge, Stefanie; White, Martyn K.; Amini, Shohreh |; Khalili, Kamel; Safak, Mahmut . E-mail: msafak@temple.edu

    2006-05-25

    Transcription is a complex process that relies on the cooperative interaction between sequence-specific factors and the basal transcription machinery. The strength of a promoter depends on upstream or downstream cis-acting DNA elements, which bind transcription factors. In this study, we investigated whether DNA elements located downstream of the JCV late promoter, encompassing the late leader peptide region, which encodes agnoprotein, play regulatory roles in the JCV lytic cycle. For this purpose, the entire coding region of the leader peptide was deleted and the functional consequences of this deletion were analyzed. We found that viral gene expression and replication were drastically reduced. Gene expression also decreased from a leader peptide point mutant but to a lesser extent. This suggested that the leader peptide region of JCV might contain critical cis-acting DNA elements to which transcription factors bind and regulate viral gene expression and replication. We analyzed the entire coding region of the late leader peptide by a footprinting assay and identified three major regions (region I, II and III) that were protected by nuclear proteins. Further investigation of the first two protected regions by band shift assays revealed a new band that appeared in new infection cycles, suggesting that viral infection induces new factors that interact with the late leader peptide region of JCV. Analysis of the effect of the leader peptide region on the promoter activity of JCV by transfection assays demonstrated that this region has a positive and negative effect on the large T antigen (LT-Ag)-mediated activation of the viral early and late promoters, respectively. Furthermore, a partial deletion analysis of the leader peptide region encompassing the protected regions I and II demonstrated a significant down-regulation of viral gene expression and replication. More importantly, these results were similar to that obtained from a complete deletion of the late leader

  1. Double-strand break repair based on short-homology regions is suppressed under terminal deoxynucleotidyltransferase expression, as revealed by a novel vector system for analysing DNA repair by nonhomologous end joining.

    PubMed

    Maezawa, So; Nakano, Saori; Kuniya, Takaaki; Koiwai, Osamu; Koiwai, Kotaro

    2016-01-01

    We have constructed a novel, nonhomologous end-joining (NHEJ) assay vector (NAV), containing mKate2, Venus and ccdB genes. Cotransfection of NAV with a construct expressing the restriction enzyme I-SceI generated a double-strand break (DSB) in NAV that excised mKate2 and ccdB. Repair of this DSB produced an intact vector that expressed Venus, a green fluorescent protein. Because cells bearing the repaired NAV lacked the ccdB gene which slows cell proliferation, the cultures were enriched in cells containing repaired DSBs. DNA sequence analysis of the DSB junctions indicated that the repair was carried out mainly by using the closest homology sequence. Use of the NAV yielded rapid results within 3 days after transfection. We then used the NAV to analyse NHEJ in cells overexpressing terminal deoxynucleotidyltransferase (TdT). The results indicated that TdT suppresses DNA repair that is based on short (one- or two-base) homology regions, to efficiently add deoxynucleotides during VDJ recombination in lymphoid cells.

  2. Trace Element Contamination in Tissues of Four Bird Species from the Rift Valley Region, Ethiopia.

    PubMed

    Yohannes, Yared Beyene; Ikenaka, Yoshinori; Nakayama, Shouta M M; Mizukawa, Hazuki; Ishizuka, Mayumi

    2017-02-01

    Concentrations of ten trace elements (Hg, As, Cd, Pb, Co, Cr, Cu, Ni, Se and Zn) were determined in different tissues (liver, kidney, muscle, heart and brain) of African sacred ibis (Threskiornis aethiopicus), Hamerkop (Scopus umbretta), marabou stork (Leptoptilos crumeniferus) and great white pelican (Pelecanus onocrotalus) inhabiting the Ethiopian Rift Valley region. There were differences in trace element patterns among the bird species. Significantly (p < 0.05) higher concentrations of Cd (5.53 µg/g dw ± 2.94) in kidney and Hg (0.75 µg/g ww ± 0.30) in liver were observed in the great white pelican compared to the other species, and liver concentrations of these two elements showed positive correlations with trophic level. Concentrations of toxic elements (As, Cd, Pb and Hg) in liver were below their respective toxicological thresholds, indicating that the data may provide baseline information for future studies.

  3. Seasonal and spatial variations of atmospheric trace elemental deposition in the Aliaga industrial region, Turkey

    NASA Astrophysics Data System (ADS)

    Kara, Melik; Dumanoglu, Yetkin; Altiok, Hasan; Elbir, Tolga; Odabasi, Mustafa; Bayram, Abdurrahman

    2014-11-01

    Atmospheric bulk deposition (wet + dry deposition) samples (n = 40) were collected concurrently at ten sites in four seasons between June 2009 and April 2010 in the Aliaga heavily industrialized region, Turkey, containing a number of significant air pollutant sources. Analyses of trace elements were carried out using inductively coupled plasma-mass spectrometry (ICP-MS). While there were significant differences in the particulate matter (PM) deposition fluxes among the sampling sites, seasonal variations were not statistically significant (Kruskal-Wallis test, p < 0.05). Both PM deposition and elemental fluxes were increased at the sampling sites in the vicinity of industrial activities. The crustal elements (i.e., Ca, Mg) and some anthropogenic elements (such as Fe, Zn, Mn, Pb, Cu, and Cr) were high, and the highest fluxes were mostly measured in summer and winter seasons. The enrichment factor (EF) and principal component analysis (PCA) was applied to the data to determine the possible sources in the study area. High EF values were obtained for the anthropogenic elements such as Ag, Cd, Zn, Pb, Cu and Sb. The possible sources were identified as anthropogenic sources (i.e., iron-steel production) (45.4%), crustal and re-suspended dust (27.1%), marine aerosol (7.9%), and coal and wood combustion (8.2%). Thus, the iron-steel production and its related activities were found to be the main pollutant sources for this region.

  4. Explosive Spot Joining of Metals

    NASA Technical Reports Server (NTRS)

    Bement, Laurence J. (Inventor); Perry, Ronnie B. (Inventor)

    1997-01-01

    The invention is an apparatus and method for wire splicing using an explosive joining process. The apparatus consists of a prebend, U-shaped strap of metal that slides over prepositioned wires. A standoff means separates the wires from the strap before joining. An adhesive means holds two ribbon explosives in position centered over the U-shaped strap. A detonating means connects to the ribbon explosives. The process involves spreading strands of each wire to be joined into a flat plane. The process then requires alternating each strand in alignment to form a mesh-like arrangement with an overlapped area. The strap slides over the strands of the wires. and the standoff means is positioned between the two surfaces. The detonating means then initiates the ribbon explosives that drive the strap to accomplish a high velocity. angular collision between the mating surfaces. This collision creates surface melts and collision bonding resulting in electron-sharing linkups.

  5. Bonding and Joining Technology: a Compilation

    NASA Technical Reports Server (NTRS)

    1971-01-01

    A collection of articles concerning the methods and uses of aerospace bonding and joining techniques in industrial processes is presented. Data include methods to bond and join metal components, joining techniques for adhesive materials, and shop hints for bonding and joining a variety of other items and materials.

  6. Requirement for both H and L chain V regions, VH and VK joining amino acids, and the unique H chain D region for the high affinity binding of an anti-phosphotyrosine antibody.

    PubMed

    Ruff-Jamison, S; Glenney, J R

    1993-04-15

    Sequence analysis of a panel of antibodies to phosphotyrosine revealed predominant H and L chain V regions in the immune response and a unique D segment in the Py20 mAb, which exhibits a high affinity for phosphotyrosine. In order to determine the influence of somatic diversity on the high affinity binding of Py20, H and L chain V regions were expressed in Escherichia coli as an Fv dimer. Whereas the H or L chain V regions of Py20 alone were unable to bind phosphotyrosine, the Fv binds phosphotyrosine with an affinity comparable with the intact IgG as determined by fluorescence quenching experiments (1.55 x 10(-7) M vs 1.25 x 10(-7) M, respectively). Substitution of the Py20 V regions with other IgG V regions that differed greatly in sequence abolished binding. A high affinity Py20-combining site was dependent on the presence of the unique D-D segment. Replacement of the Py20 D-D region with a single homologous D region resulted in a decrease in affinity (5.9 x 10(-7) M). Substitution of this D-D region for the D region of another anti-phosphotyrosine antibody that is known to bind phosphotyrosine weakly (1 x 10(-3) M) conferred high affinity binding. Removal of three tyrosines from the first of the two D regions was accompanied by a fivefold reduction in affinity for phosphotyrosine. In addition, changing the VK and VH junctional amino acids resulted in a complete loss of binding. Therefore, the formation of the high affinity Py20 combining site requires both a H and L chain that are similar in sequence to those of Py20 including the unique D region and the junctional amino acids.

  7. The Kuril Islands as a potential region for aquaculture: Trace elements in chum salmon.

    PubMed

    Khristoforova, Nadezhda K; Tsygankov, Vasiliy Yu; Lukyanova, Olga N; Boyarova, Margarita D

    2016-06-01

    The Kuril Islands region is considered promising for development of salmon aquaculture. There are 41 salmon fish hatcheries in the Sakhalin Island and the Kuril Islands, 34 of them are hatcheries of the chum. Therefore, concentrations of six elements (Zn, Cu, Cd, Pb, As, and Hg) were determined in chum salmon were caught in this region. The contents of toxic elements (Cd, Pb, As, and Hg) don't exceed their maximum permissible concentrations (MPC) according to the Russian sanitary standards, but concentration of Pb are closely to MPC. Increased concentrations of Pb in wild chum have the natural origin. The unusual conditions of the Western Pacific are formed under the influence such factors as volcanism and upwelling.

  8. Toxic and essential elements in butter from the Black Sea region, Turkey.

    PubMed

    Dervisoglu, Muhammet; Gul, Osman; Yazici, Fehmi; Guvenc, Dilek; Atmaca, Enes; Aksoy, Abdurrahman

    2014-01-01

    In this study, 88 randomly selected samples of butter produced in the Black Sea region of Turkey were purchased from different retail markets during different periods and investigated for toxic and essential elements content. Quantitative analyses of elements in the samples were performed using an inductively coupled plasma-mass spectroscopy (ICP-MS). Mean concentrations of As, Cr, Cu, Fe, Mn, Ni, Pb, Se and Zn in the butter samples were 18.93, 100.32, 384.66, 4199.1, 887.47, 168.64, 56.13, 16.34 and 384.66 µg kg(-1), respectively. Cd and Co were detected in 19 (mean content 0.29 µg kg(-1)) and 81 (mean content 3.81 µg kg(-1)) samples of 88 butter samples, respectively. However, the dietary intake of these elements by the population of the Black Sea region is currently well below the dietary reference intake (DRI) and provisional tolerable weekly intake (PTWI) levels of essential and toxic elements.

  9. Mapping overlapping functional elements embedded within the protein-coding regions of RNA viruses

    PubMed Central

    Firth, Andrew E.

    2014-01-01

    Identification of the full complement of genes and other functional elements in any virus is crucial to fully understand its molecular biology and guide the development of effective control strategies. RNA viruses have compact multifunctional genomes that frequently contain overlapping genes and non-coding functional elements embedded within protein-coding sequences. Overlapping features often escape detection because it can be difficult to disentangle the multiple roles of the constituent nucleotides via mutational analyses, while high-throughput experimental techniques are often unable to distinguish functional elements from incidental features. However, RNA viruses evolve very rapidly so that, even within a single species, substitutions rapidly accumulate at neutral or near-neutral sites providing great potential for comparative genomics to distinguish the signature of purifying selection. Computationally identified features can then be efficiently targeted for experimental analysis. Here we analyze alignments of protein-coding virus sequences to identify regions where there is a statistically significant reduction in the degree of variability at synonymous sites, a characteristic signature of overlapping functional elements. Having previously tested this technique by experimental verification of discoveries in selected viruses, we now analyze sequence alignments for ∼700 RNA virus species to identify hundreds of such regions, many of which have not been previously described. PMID:25326325

  10. Automatic connector joins structural columns

    NASA Technical Reports Server (NTRS)

    Jacquemin, G. G.

    1980-01-01

    Connector snap-locks over toothed bolthead mounted on column end, forming rigid joint that will not bend or twist. Connector is used in conventional construction to install temporary structures or as mechanical coupler. Up to nine receptacles can be clustered in one node to join up to nine converging columns.

  11. Joining NZP ceramics. Final report

    SciTech Connect

    Nicklas, K.D.; Richey, M.W.; Holcombe, C.E. Jr.; Santella, M.L.

    1995-09-26

    Objective was to assess techniques for joining NZP ceramics, a new family of ceramic materials that have low coefficient of thermal expansion, low thermal conductivity, and excellent thermal-shock resistance. Initially, the authors evaluated laser-beam welding over volatile fluxing agents (ferric oxide, copper oxide, boric acid, and boron nitride). They also examined other laser, arc-welding, brazing, and cold joining techniques. The NZP materials were capable of sustaining the thermal stresses associated with these joining processes without substantial cracking. Of the volatile fluxes, only the copper oxide promoted weld fusion. Efforts to accomplish fusion by laser-beam welding over copper, titanium, stainless steel, yttrium barium copper oxide, fused silica glass, and mullite/alumina were unsuccessful. Gas-tungsten arc welding accompanied by porosity, irregularities, and cracking was achieved on copper sheet sandwiched between NZP tiles. Attempts at conventional oxy-acetylene welding and torch brazing were unproductive. Silica-based oxide mixtures and copper oxide-based materials show potential for development into filler materials for furnace brazing, and phosphate-based cements show promise as a means of cold joining.

  12. Accumulation of metallic elements by Amanita muscaria from rural lowland and industrial upland regions.

    PubMed

    Lipka, Krzysztof; Falandysz, Jerzy

    2017-03-04

    This study was carried out on the accumulation and occurrence of Ag, Al, Ba, Ca, Cd, Co, Cu, Fe, Hg, K, Mg, Mn, Na, Rb, Sr and Zn in the mushroom Amanita muscaria and forest topsoil from two lowland sites in the Tuchola Pinewoods in the north-central region and an upland site in the Świetokrzyskie Mountains in the south-central region of Poland. Topsoil from the upland location showed Ag, Al, Ba, Ca, Cd, Co, Cu, Fe, Hg, Na and Zn at significantly higher concentration levels (pseudo-total fraction and often also the labile or extractable fraction) than at both lowland locations, where topsoil was richer in Mg, and similar in Rb. Amanita muscaria from the upland region differed from individuals collected in the lowland sites by higher concentration levels of Cd, Cu, Hg and Mn in caps. This could be related to higher concentration levels of the metallic elements in topsoil in the upland region. On other side, A. muscaria from the upland site was poorer in Co and Fe in caps, and in Ca, Co, Fe and Sr in stipes. In spite of the differences in content of the geogenic metallic elements in topsoil between the lowland and upland locations, A. muscaria from both regions was able to regulate uptake and accumulation of Ag, Al, Ba, Ca, K, Mg, Na, Rb and Zn, which were at similar concentration levels in caps but not necessarily in stipes.

  13. Thin shells joining local cosmic string geometries

    NASA Astrophysics Data System (ADS)

    Eiroa, Ernesto F.; Rubín de Celis, Emilio; Simeone, Claudio

    2016-10-01

    In this article we present a theoretical construction of spacetimes with a thin shell that joins two different local cosmic string geometries. We study two types of global manifolds, one representing spacetimes with a thin shell surrounding a cosmic string or an empty region with Minkowski metric, and the other corresponding to wormholes which are not symmetric across the throat located at the shell. We analyze the stability of the static configurations under perturbations preserving the cylindrical symmetry. For both types of geometries we find that the static configurations can be stable for suitable values of the parameters.

  14. The Join-Up Meeting

    NASA Technical Reports Server (NTRS)

    Cameron, W. Scott

    2002-01-01

    I recently took on a new assignment and, as is my norm, I scheduled a series of one-hour, 1:1 join-up meetings with the various lead personnel on the team and their hierarchy. During one of these meetings, the person I was meeting with informed me how pleasantly surprised she was that I had scheduled this meeting as very few individuals took the time anymore to have them. I was shocked. I was taught that establishing a 1:1 relationship with the people on your team is critical to the project's success. This was the first time I'd heard anything like this about join-up meetings. I filed this feedback away. Later I was talking to my project manager-mentor, and he indicated he had finished his join-up meetings with every person in his new organization. He also indicated his predecessor had conducted few, if any, join-up meetings. Again, I was shocked. When I reflected on these two experiences, I realized a very negative trend might be emerging in our fast-paced, schedule-driven, 500-e-mail-per-day, cell-phone -ringing, 24/7 -communication, multi-tasking work lives: NO FACE TIME! Face time is what you spend with people to talk about the project you are working on, their expectations of you, your expectations of them, your hierarchy's expectations about each of you, and/or-last but certainly not least-what each of you plans on achieving during the project. A 1:1, face-to-face, join-up meeting is the only way I know to build solid trust between the project manager and the team members and their hierarchy.

  15. [Concentration distribution of metal elements in atmospheric aerosol under different weather conditions in Qingdao Coastal Region].

    PubMed

    Chen, Xiao-Jing; Qi, Jian-Hua; Liu, Ning; Zhang, Xiang-Yu; Shen, Heng-Qing; Liu, Ming-Xu

    2014-10-01

    To know the influence of different weather conditions on the concentration of metal elements in aerosols in the coastal region, total suspended particles (TSP) samples were collected from April to May 2012, and August 2012 to March 2013 in the Qingdao coastal region, and common trace metals were analyzed by using Inductively Coupled Plasma-Mass Spectrometry (ICP-MS) and Inductively Coupled Plasma-Atomic Emission Spectrometry (ICP-AES). The results showed that Al, Ca, Fe, Na, K and Mg were the dominant metal elements in TSP, and the sum of the six elements accounted for 94.2% of the sum of all metals. TSP and metal elements had significant monthly variations, Fe, Al, K, Ca, Mg, Zn, Ba, Mn, Ti, Sr and Li had the highest concentration in November and January, while Be, Sc, Co, Ni and Cr showed the highest value in January. Na had the highest concentration in August, November and February, and the lowest in December. Pb had the highest concentration in January and February, and the lowest in August and December. Enrichment factors indicated that Be, Co, Al, Ca, Fe, K, Mg, Mn, Sr and Ti were mainly affected by natural sources; Li, Cr, Ni, Zn, Ba and Na were affected by natural sources and part of anthropogenic sources; Pb was mainly from anthropogenic sources. Different weather conditions had great impact on TSP and metal elements concentrations, all the measured metals had the highest concentrations in smog except Ti. Compared with the sunny day, the concentration of atmospheric particulate Ti decreased, while the other elements increased by 1 to 4 times in smog. Li, Be, Cr, Ni, Al, Fe, Mg and Mn had little variation in concentration in foggy day, and the concentration of Pb and Na increased considerably. The concentration of Co, Ca and Ti reduced obviously in fog. Except for Cr, Co and Ti, the other elements increased by 1 to 3 times in haze. Most of the elements had the minimal enrichment factors in sunny day, while the other had the maximal enrichment factor in

  16. Integrated Conceptual Design of Joined-Wing SensorCraft Using Response Surface Models

    DTIC Science & Technology

    2006-11-01

    element and wind tunnel analysis of the joined- wing concept. He detailed several distinct advantages of a joined- wing configuration over a more...optimized” joined- wing and geometric perturbations of that model. Following Wolkovich, Smith, Cliff and Stonum performed calculations and wind tunnel ...location at 60 percent of the fore wing semispan. Wind tunnel data confirmed the design predictions for reduced bending moment on the forward wing , and a

  17. Source origin of trace elements in PM from regional background, urban and industrial sites of Spain

    NASA Astrophysics Data System (ADS)

    Querol, X.; Viana, M.; Alastuey, A.; Amato, F.; Moreno, T.; Castillo, S.; Pey, J.; de la Rosa, J.; Sánchez de la Campa, A.; Artíñano, B.; Salvador, P.; García Dos Santos, S.; Fernández-Patier, R.; Moreno-Grau, S.; Negral, L.; Minguillón, M. C.; Monfort, E.; Gil, J. I.; Inza, A.; Ortega, L. A.; Santamaría, J. M.; Zabalza, J.

    Despite their significant role in source apportionment analysis, studies dedicated to the identification of tracer elements of emission sources of atmospheric particulate matter based on air quality data are relatively scarce. The studies describing tracer elements of specific sources currently available in the literature mostly focus on emissions from traffic or large-scale combustion processes (e.g. power plants), but not on specific industrial processes. Furthermore, marker elements are not usually determined at receptor sites, but during emission. In our study, trace element concentrations in PM 10 and PM 2.5 were determined at 33 monitoring stations in Spain throughout the period 1995-2006. Industrial emissions from different forms of metallurgy (steel, stainless steel, copper, zinc), ceramic and petrochemical industries were evaluated. Results obtained at sites with no significant industrial development allowed us to define usual concentration ranges for a number of trace elements in rural and urban background environments. At industrial and traffic hotspots, average trace metal concentrations were highest, exceeding rural background levels by even one order of magnitude in the cases of Cr, Mn, Cu, Zn, As, Sn, W, V, Ni, Cs and Pb. Steel production emissions were linked to high levels of Cr, Mn, Ni, Zn, Mo, Cd, Se and Sn (and probably Pb). Copper metallurgy areas showed high levels of As, Bi, Ga and Cu. Zinc metallurgy was characterised by high levels of Zn and Cd. Glazed ceramic production areas were linked to high levels of Zn, As, Se, Zr, Cs, Tl, Li, Co and Pb. High levels of Ni and V (in association) were tracers of petrochemical plants and/or fuel-oil combustion. At one site under the influence of heavy vessel traffic these elements could be considered tracers (although not exclusively) of shipping emissions. Levels of Zn-Ba and Cu-Sb were relatively high in urban areas when compared with industrialised regions due to tyre and brake abrasion, respectively.

  18. A COMPARISON OF ELEMENTAL ABUNDANCE RATIOS IN SEP EVENTS IN FAST AND SLOW SOLAR WIND REGIONS

    SciTech Connect

    Kahler, S. W.; Tylka, A. J.; Reames, D. V.

    2009-08-10

    The solar energetic (E > 1 MeV nucleon{sup -1}) particles (SEPs) observed in gradual events at 1 AU are assumed to be accelerated by coronal/interplanetary shocks from ambient thermal or suprathermal seed particles. If so, then the elemental abundances of SEPs produced in different solar wind (SW) stream types (transient, fast, and slow) might be systematically distinguished from each other. We look for these differences in SEP energy spectra and in elemental abundance ratios (including Mg/Ne and Fe/C, which compare low/high first ionization potential elements), in a large number of SEP time intervals over the past solar cycle. The SW regions are characterized by the three-component stream classification of Richardson et al. Our survey shows no significant compositional or energy spectral differences in the 5-10 MeV nucleon{sup -1} range for SEP events of different SW stream types. This result extends the earlier finding that SEP events are observed frequently in fast SW streams, although their higher Alfven and SW flow speeds should constrain SEP production by coronal mass ejection-driven shocks in those regions. We discuss the implications of our results for shock seed populations and cross-field propagation.

  19. Enrichment of short interspersed transposable elements to embryonic stem cell-specific hypomethylated gene regions.

    PubMed

    Muramoto, Hiroki; Yagi, Shintaro; Hirabayashi, Keiji; Sato, Shinya; Ohgane, Jun; Tanaka, Satoshi; Shiota, Kunio

    2010-08-01

    Embryonic stem cells (ESCs) have a distinctive epigenome, which includes their genome-wide DNA methylation modification status, as represented by the ESC-specific hypomethylation of tissue-dependent and differentially methylated regions (T-DMRs) of Pou5f1 and Nanog. Here, we conducted a genome-wide investigation of sequence characteristics associated with T-DMRs that were differentially methylated between ESCs and somatic cells, by focusing on transposable elements including short interspersed elements (SINEs), long interspersed elements (LINEs) and long terminal repeats (LTRs). We found that hypomethylated T-DMRs were predominantly present in SINE-rich/LINE-poor genomic loci. The enrichment for SINEs spread over 300 kb in cis and there existed SINE-rich genomic domains spreading continuously over 1 Mb, which contained multiple hypomethylated T-DMRs. The characterization of sequence information showed that the enriched SINEs were relatively CpG rich and belonged to specific subfamilies. A subset of the enriched SINEs were hypomethylated T-DMRs in ESCs at Dppa3 gene locus, although SINEs are overall methylated in both ESCs and the liver. In conclusion, we propose that SINE enrichment is the genomic property of regions harboring hypomethylated T-DMRs in ESCs, which is a novel aspect of the ESC-specific epigenomic information.

  20. Joining Dental Ceramic Layers With Glass

    PubMed Central

    Saied, MA; Lloyd, IK; Haller, WK; Lawn, BR

    2011-01-01

    Objective Test the hypothesis that glass-bonding of free-form veneer and core ceramic layers can produce robust interfaces, chemically durable and aesthetic in appearance and, above all, resistant to delamination. Methods Layers of independently produced porcelains (NobelRondo™ Press porcelain, Nobel BioCare AB and Sagkura Interaction porcelain, Elephant Dental) and matching alumina or zirconia core ceramics (Procera alumina, Nobel BioCare AB, BioZyram yttria stabilized tetragonal zirconia polycrystal, Cyrtina Dental) were joined with designed glasses, tailored to match thermal expansion coefficients of the components and free of toxic elements. Scanning electron microprobe analysis was used to characterize the chemistry of the joined interfaces, specifically to confirm interdiffusion of ions. Vickers indentations were used to drive controlled corner cracks into the glass interlayers to evaluate the toughness of the interfaces. Results The glass-bonded interfaces were found to have robust integrity relative to interfaces fused without glass, or those fused with a resin-based adhesive. Significance The structural integrity of the interfaces between porcelain veneers and alumina or zirconia cores is a critical factor in the longevity of all-ceramic dental crowns and fixed dental prostheses. PMID:21802131

  1. Convection from Hemispherical and Conical Model Ice Roughness Elements in Stagnation Region Flows

    NASA Technical Reports Server (NTRS)

    Hughes, Michael T.; Shannon, Timothy A.; McClain, Stephen T.; Vargas, Mario; Broeren, Andy

    2016-01-01

    To improve ice accretion prediction codes, more data regarding ice roughness and its effects on convective heat transfer are required. The Vertical Icing Studies Tunnel (VIST) at NASA Glenn Research was used to model realistic ice roughness in the stagnation region of a NACA 0012 airfoil. In the VIST, a test plate representing the leading 2% chord of the airfoil was subjected to flows of 7.62 m/s (25 ft/s), 12.19 m/s (40 ft/s), and 16.76 m/s (55 ft/s). The test plate was fitted with multiple surfaces or sets of roughness panels, each with a different representation of ice roughness. The sets of roughness panels were constructed using two element distribution patterns that were created based on a laser scan of an iced airfoil acquired in the Icing Research Tunnel at NASA Glenn. For both roughness patterns, surfaces were constructed using plastic hemispherical elements, plastic conical elements, and aluminum conical elements. Infrared surface thermometry data from tests run in the VIST were used to calculate area averaged heat transfer coefficient values. The values from the roughness surfaces were compared to the smooth control surface, showing convective enhancement as high as 400% in some cases. The data gathered during this study will ultimately be used to improve the physical modeling in LEWICE or other ice accretion codes and produce predictions of in-flight ice accretion on aircraft surfaces with greater confidence.

  2. Joining of polymer composite materials

    SciTech Connect

    Magness, F.H.

    1990-11-01

    Under ideal conditions load bearing structures would be designed without joints, thus eliminating a source of added weight, complexity and weakness. In reality the need for accessibility, repair, and inspectability, added to the size limitations imposed by the manufacturing process and transportation/assembly requirements mean that some minimum number of joints will be required in most structures. The designer generally has two methods for joining fiber composite materials, adhesive bonding and mechanical fastening. As the use of thermoplastic materials increases, a third joining technique -- welding -- will become more common. It is the purpose of this document to provide a review of the available sources pertinent to the design of joints in fiber composites. The primary emphasis is given to adhesive bonding and mechanical fastening with information coming from documentary sources as old as 1961 and as recent as 1989. A third, shorter section on composite welding is included in order to provide a relatively comprehensive treatment of the subject.

  3. A paradigm for human body finite element model integration from a set of regional models.

    PubMed

    Thompson, A B; Gayzik, F S; Moreno, D P; Rhyne, A C; Vavalle, N A; Stitzel, J D

    2012-01-01

    Computational modeling offers versatility, scalability, and cost advantages to researchers in the trauma and injury biomechanics communities. The Global Human Body Models Consortium (GHBMC) is a group of government, industry, and academic researchers developing human body models (HBMs) that aim to become the standard tool to meet this growing research need. The objective of this study is to present the methods used to develop the average seated male occupant model (M50, weight = 78 kg, height = 175 cm) from five separately validated body region models (BRMs). BRMs include the head, neck, thorax, abdomen, and a combined pelvis and lower extremity model. Modeling domains were split at the atlanto-occipital joint, C7-T1 boundary, diaphragm, abdominal cavity (peritoneum/retroperitoneum), and the acetabulum respectively. BRM meshes are based on a custom CAD model of the seated male built from a multi-modality imaging protocol of a volunteer subject found in literature.[1] Various meshing techniques were used to integrate the full body model (FBM) including 1-D beam and discrete element connections (e.g. ligamentous structures), 2D shell nodal connections (e.g. inferior vena cava to right atrium), 3D hexahedral nodal connections (e.g. soft tissue envelope connections between regions), and contact definitions varying from tied (muscle insertions) to sliding (liver and diaphragm contact). The model was developed in a general-purpose finite element code, LS-Dyna (LTSC, Livermore, CA) R4.2.1., and consists of 1.95 million elements and 1.3 million nodes. The element breakdown by type is 41% hexahedral, 33.7% tetrahedral, 19.5% quad shells and 5% tria shell. The integration methodology presented highlights the viability of using a collaborative development paradigm for the construction of HBMs, and will be used as template for expanding the suite of GHBMC models.

  4. Inventory Survey of Geodiversity Elements in a Regional Territory: Applied to the Biga Peninsula, Northwestern Turkey

    NASA Astrophysics Data System (ADS)

    Sedat Çetiner, Ziya; Ertekin, Can; Filiz, Nurdan

    2016-04-01

    Representative geodiversity elements such as minerals, rocks, fossils, landforms, etc are key components in order to obtain data for the pursuit of geo-research. The scientific worth of geodiversity is not only related to how the geosphere works but also is connected with the conservation of earth materials for present and future geo-knowledge and geoscience milieu. Hence, the nonrenewable nature of geodiversity elements in the human time scale is taken into account for the conservation of natural diversity or simply geo-conservation. Geodiversity as an abiotic element ascribes to in situ or ex situ features both of which maintain scientific value and are used by various societies such as in teaching, tourism, etc. Ex situ elements are known as fossils, minerals and rocks found in museum collections on the other hand in situ features are known as geosites for which there are certain sub-categories such as geomorphological (landform), hydrogeological, paleontological, structural, stratigraphic sequence and lithological. Due to the plethora of geological data dispersed among geodiversity elements, the first crucial step is to execute an inventory solid study. The scope of this study is to survey geodiversity features of potential natural sites distributed the entire sectors of the Biga Peninsula of Northwestern Turkey. In the territory, there are 37 natural sites with their own data set. This data describing their boundaries and administrative features were acquired from Directorate General for Preservation of Natural Heritage. Then, site boundaries, regional published geological maps, surface hydrologic and anthropic attributes were overlaid conceiving as a single unit. Before initiating the inventory survey, the criteria scale were established for geoscience value and geo-tourism potential. In these two frames, geodiversity elements were labeled and tabulated by their representativeness, integrity, rarity, scientific knowledge, scenery, interpretative potential and

  5. Regional left ventricular myocardial contractility and stress in a finite element model of posterobasal myocardial infarction.

    PubMed

    Wenk, Jonathan F; Sun, Kay; Zhang, Zhihong; Soleimani, Mehrdad; Ge, Liang; Saloner, David; Wallace, Arthur W; Ratcliffe, Mark B; Guccione, Julius M

    2011-04-01

    Recently, a noninvasive method for determining regional myocardial contractility, using an animal-specific finite element (FE) model-based optimization, was developed to study a sheep with anteroapical infarction (Sun et al., 2009, "A Computationally Efficient Formal Optimization of Regional Myocardial Contractility in a Sheep With Left Ventricular Aneurysm," ASME J. Biomech. Eng., 131(11), p. 111001). Using the methodology developed in the previous study (Sun et al., 2009, "A Computationally Efficient Formal Optimization of Regional Myocardial Contractility in a Sheep With Left Ventricular Aneurysm," ASME J. Biomech. Eng., 131(11), p. 111001), which incorporates tagged magnetic resonance images, three-dimensional myocardial strains, left ventricular (LV) volumes, and LV cardiac catheterization pressures, the regional myocardial contractility and stress distribution of a sheep with posterobasal infarction were investigated. Active material parameters in the noninfarcted border zone (BZ) myocardium adjacent to the infarct (T(max_B)), in the myocardium remote from the infarct (T(max_R)), and in the infarct (T(max_I)) were estimated by minimizing the errors between FE model-predicted and experimentally measured systolic strains and LV volumes using the previously developed optimization scheme. The optimized T(max_B) was found to be significantly depressed relative to T(max_R), while T(max_I) was found to be zero. The myofiber stress in the BZ was found to be elevated, relative to the remote region. This could cause further damage to the contracting myocytes, leading to heart failure.

  6. Transposable element fragments in protein-coding regions and their contributions to human functional proteins.

    PubMed

    Wu, Ming; Li, Li; Sun, Zhirong

    2007-10-15

    Transposable elements (TEs) and their contributions to protein-coding regions are of particular interest. Here we searched for TE fragments in Homo sapiens at both the transcript and protein levels. We found evidence in support of TE exonization and its association with alternative splicing. Despite recent findings that long evolutionary times are required to incorporate TE into proteins, we found many functional proteins with translated TE cassettes derived from young TEs. Analyses of two Bcl-family proteins and Alu-encoded segments suggest the coding and functional potential of TE sequences.

  7. [Dynamics of elements distribution in blood, depending on age, by example of Moscow Region residents].

    PubMed

    Yuvs, G G; Ignatova, T N; Anuchin, A M; Lebedeva, V L; Shilov, V V; Khapalyuk, A V

    2015-01-01

    Elemental status of a person determines the qualitative and quantitative content of chemical elements in the human body. This marker allows us to estimate the level of imbalance of chemical elements and therefore health risks. The method for simultaneous quantitative and qualitative analysis of 67 elements in biomaterials has been proposed. The detailed elemental analysis of whole blood samples of 1711 healthy people (age range 0-100 years) of Moscow Region has been performed. A number of patterns of age-related changes of the element status conditionally healthy people has been estimated. Na content in the samples increased with the age of the person. Presumably, this result reflects the studied populations nutrition disorders associated with immoderate consumption of table salt. The maximum content of Ca was observed in blood samples of people age range 0-20 years (66-69 mg/kg), the Ca content in the blood samples of people age range 26-85 years was significantly lower (59-62 mg/kg). The maximum decrease of Ca was detected in blood samples of people age range of 85-100 years (57-59 mg/kg). Thisreductionin the concentration of Ca, apparently due to age-related changes of Ca balance, correlates with decrease of bone mineral density and bone mass. Iron content decreased in the blood samples of people age range 10-100 years from 480 to 390 mg/kg. Selenium content in blood of people age range 0-25 years linearly increased, remained stable high in the blood of people age range 25-55 years (0,13-0,136 mg/kg) and then gradually decreased. A graph of As content dependence from a person's age is a mirror image of the graph of Se content dependence from a person's age, which is evidence of the antagonistic effects of these elements. Graphic changes in the content of rare earth elements Eu and Ho reflect the unidirectional trend of these elements accumulation. The maximum content of these elements was observed in blood samples of people age range of 25-65 years. Perhaps a

  8. Models of H II regions - Heavy element opacity, variation of temperature

    NASA Technical Reports Server (NTRS)

    Rubin, R. H.

    1985-01-01

    A detailed set of H II region models that use the same physics and self-consistent input have been computed and are used to examine where in parameter space the effects of heavy element opacity is important. The models are briefly described, and tabular data for the input parameters and resulting properties of the models are presented. It is found that the opacities of C, Ne, O, and to a lesser extent N play a vital role over a large region of parameter space, while S and Ar opacities are negligible. The variation of the average electron temperature T(e) of the models with metal abundance, density, and T(eff) is investigated. It is concluded that by far the most important determinator of T(e) is metal abundance; an almost 7000 K difference is expected over the factor of 10 change from up to down abundances.

  9. The physical structure of Magellanic Cloud H II regions. II. Elemental abundances

    NASA Astrophysics Data System (ADS)

    Vermeij, R.; van der Hulst, J. M.

    2002-09-01

    Based on a new data set of optical and infrared spectra described in Vermeij et al. (\\cite{Ronald}), we analyse the gas-phase elemental abundances of a sample of H Ii regions in the Large and Small Magellanic Cloud. The combined optical and infrared data set gives us access to all the ionization stages of astrophysically important elements such as sulfur and oxygen. We self-consistently determine the electron temperatures and densities for the \\elem{O}{+}, \\elem{S}{++} and \\elem{O}{++} ionization zones, and use these parameters in the derivation of the ionic fractions. We discuss the uncertainties on these ionic fractions. The different relations between the electron temperatures as proposed by Garnett (\\cite{Garnett}) and Thuan et al. (\\cite{Thuan}) are confronted with our results. We find our electron temperatures to be consistent with these relations, although the relation between Te,[S Iii] and Te, [O Iii] might be slightly steeper than predicted. We investigate the reliability of the Ionization Correction Factors (ICFs) used in the derivation of the full elemental abundances of sulfur and neon. We conclude that the prescription for the ICF used to derive the sulfur abundance as given by Stasińska (\\cite{Stas1}) for alpha = 3 is accurate for \\elem{O}{+}/O > 0.20. No conclusions could be drawn for neon. Avoiding the use of ICFs as much as possible, we then proceed to derive the full elemental abundances. We calculate a grid of general photoionization models to compare our results with the ``bright-line'' abundance diagnostics for oxygen (R23) and sulfur (S23(4)). The reliability of the newly proposed S234 parameter (Oey & Shields \\cite{oey}) which includes emission lines from \\elem{S}{+}, \\elem{S}{++} and \\elem{S}{+3} is checked. We find a very good agreement between the S234 models and our analysis results. Finally, we compare the heavy element-to-oxygen ratios of our sample objects to those of giant H Ii regions in a large sample of low

  10. Trace elements in particulate matter from metropolitan regions of Northern China: Sources, concentrations and size distributions.

    PubMed

    Pan, Yuepeng; Tian, Shili; Li, Xingru; Sun, Ying; Li, Yi; Wentworth, Gregory R; Wang, Yuesi

    2015-12-15

    Public concerns over airborne trace elements (TEs) in metropolitan areas are increasing, but long-term and multi-site observations of size-resolved aerosol TEs in China are still lacking. Here, we identify highly elevated levels of atmospheric TEs in megacities and industrial sites in a Beijing-Tianjin-Hebei urban agglomeration relative to background areas, with the annual mean values of As, Pb, Ni, Cd and Mn exceeding the acceptable limits of the World Health Organization. Despite the spatial variability in concentrations, the size distribution pattern of each trace element was quite similar across the region. Crustal elements of Al and Fe were mainly found in coarse particles (2.1-9 μm), whereas the main fraction of toxic metals, such as Cu, Zn, As, Se, Cd and Pb, was found in submicron particles (<1.1 μm). These toxic metals were enriched by over 100-fold relative to the Earth's crust. The size distributions of Na, Mg, K, Ca, V, Cr, Mn, Ni, Mo and Ba were bimodal, with two peaks at 0.43-0.65 μm and 4.7-5.8 μm. The combination of the size distribution information, principal component analysis and air mass back trajectory model offered a robust technique for distinguishing the main sources for airborne TEs, e.g., soil dust, fossil fuel combustion and industrial emissions, at different sites. In addition, higher elemental concentrations coincided with westerly flow, indicating that polluted soil and fugitive dust were major sources of TEs on the regional scale. However, the contribution of coal burning, iron industry/oil combustion and non-ferrous smelters to atmospheric metal pollution in Northern China should be given more attention. Considering that the concentrations of heavy metals associated with fine particles in the target region were significantly higher than those in other Asian sites, the implementations of strict environmental standards in China are required to reduce the amounts of these hazardous pollutants released into the atmosphere.

  11. Characterization of elements in the irrigated water in the Changjiang River Delta Region

    NASA Astrophysics Data System (ADS)

    Yuan, X.

    2009-12-01

    Introduction The river networks are dominated in the Changjiang River Delta Region. Most agricultural areas are irrigated with these small rivers. Rivers also receive the effluence from point and nonpoint sources. It is significative to recognize the distribution and potential hazard of irrigated water in this populated area. Study area and sampling The study area covers about 1.1×106 km2, including 16 cities from the northside of Changjiang River in Jiangsu to the middle Zhejiang. Ninety samples were collected in rural irrigated rivers. And the major cations, anions and trace elements of water were determined. Results We observe that Ca2+ is obviously higher in cations, and Cl-, SO42- higher in anions. The southern Jiangsu and coast of middle Zhejiang show high Na+, the hill area of southern Jiangsu and northern Zhejiang show high Ca2+. HCO3- is relatively uniform distributed in these areas. The high SO42- in a few samples occour in industrial spots of Jiangsu and Zhejiang. Cl- increases in waters along the coast. NO3- fluctuates and disperses in samples. Trace elements in waters are unevenly distributed. The two sides of Changjiang River have high As and Cr. Mercury is higher in southern Jiangsu than in other areas. Iron shows an enrichment in the middle Zhejiang. Compared with the background concentrations of trace elements in the lower Changjiang River, Pb, Cu and Cd are much higher in middle Zhejiang than in other areas. But Zn of most samples are lower than the background value.Cu is associated with organic matter in water. Dicussion The research area consists of hill, plain and coast, where farms, industries and houses distribute. In the hilly area of carbonate-dominated, the waters show high Ca2+ and HCO3-, rivers have high Cl- in vicinity of sea. NO3- and SO42- are strongly influenced by anthopogenic input. NO3- shows a high concentration in areas of fertilizer usage. SO42- increases in areas with a lot of industrial discharge. The distribution of trace

  12. Flexible Friction Stir Joining Technology

    SciTech Connect

    Feng, Zhili; Lim, Yong Chae; Mahoney, Murray; Sanderson, Samuel; Larsen, Steve; Steel, Russel; Fleck, Dale; Fairchild, Doug P; Wasson, Andrew J; Babb, Jon; Higgins, Paul

    2015-07-23

    Reported herein is the final report on a U.S. Department of Energy (DOE) Advanced Manufacturing Office (AMO) project with industry cost-share that was jointly carried out by Oak Ridge National Laboratory (ORNL), ExxonMobil Upstream Research Company (ExxonMobil), and MegaStir Technologies (MegaStir). The project was aimed to advance the state of the art of friction stir welding (FSW) technology, a highly energy-efficient solid-state joining process, for field deployable, on-site fabrications of large, complex and thick-sectioned structures of high-performance and high-temperature materials. The technology innovations developed herein attempted to address two fundamental shortcomings of FSW: 1) the inability for on-site welding and 2) the inability to weld thick section steels, both of which have impeded widespread use of FSW in manufacturing. Through this work, major advance has been made toward transforming FSW technology from a “specialty” process to a mainstream materials joining technology to realize its pervasive energy, environmental, and economic benefits across industry.

  13. Price Chopper Joins EPAs Food Recovery Challenge Program

    EPA Pesticide Factsheets

    (New York, NY - January 14, 2016) Today, U.S. Environmental Protection Agency Regional Administrator Judith A. Enck was joined by Mona Golub, Vice President of Public Relations and Consumer Services for Price Chopper and Market 32; Joseph Berman, Manager o

  14. 53BP1 regulates DNA resection and the choice between classical and alternative end joining during class switch recombination.

    PubMed

    Bothmer, Anne; Robbiani, Davide F; Feldhahn, Niklas; Gazumyan, Anna; Nussenzweig, Andre; Nussenzweig, Michel C

    2010-04-12

    Class switch recombination (CSR) diversifies antibodies by joining highly repetitive DNA elements, which are separated by 60-200 kbp. CSR is initiated by activation-induced cytidine deaminase, an enzyme that produces multiple DNA double-strand breaks (DSBs) in switch regions. Switch regions are joined by a mechanism that requires an intact DNA damage response and classical or alternative nonhomologous end joining (A-NHEJ). Among the DNA damage response factors, 53BP1 has the most profound effect on CSR. We explore the role of 53BP1 in intrachromosomal DNA repair using I-SceI to introduce paired DSBs in the IgH locus. We find that the absence of 53BP1 results in an ataxia telangiectasia mutated-dependent increase in DNA end resection and that resected DNA is preferentially repaired by microhomology-mediated A-NHEJ. We propose that 53BP1 favors long-range CSR in part by protecting DNA ends against resection, which prevents A-NHEJ-dependent short-range rejoining of intra-switch region DSBs.

  15. Geographic patterns of elemental deposition in the Aegean region of Turkey indicated by the lichen, Xanthoria parietina (L.) Th. Fr.

    PubMed

    Yenisoy-Karakaş, S; Tuncel, S G

    2004-08-15

    Lichen samples from different parts of the world have been known to accumulate elements to a greater degree than higher plants, if they are exposed to these elements from the atmosphere or from water and sediments. It has been hypothesized that lichens can be used to monitor air pollution around point and area emission sources. Local variation (variation in substrate, age and morphology of lichen samples) of element concentrations would not be large enough to affect the concentration patterns in large areas. We tested this hypothesis in the Aegean region of Turkey, which is very urbanized and industrialized. No such study has been conducted before in this part of the country. A total of 234 samples of the lichen Xanthoria parietina were collected from a 51,800-km2 area. Samples were washed and analyzed by INAA and ICP-AES for 35 elements. The range of the concentrations for most of the elements on a local scale was an order of magnitude lower than for the element concentrations on a regional scale. The mean local coefficient of variance (CV) was found to be 15, providing that the local variation did not affect the concentration of elements in the sampling region. According to cluster analysis, 8 (As, Hg, Pb, Sb, Fe, Mn, Na and K) elements are indicative of important local pollution locations and their zone of impact in the region. By mapping the concentrations of eight indicative elements in lichen Xanthoria parietina of the Aegean region, it was possible to relate deposition to the existence of known sources of pollution in certain areas. Location of pollution sources such as iron-steel plants, and coal burning in the cities, industrial activity and two important coal-fired power plants generally corresponded with locations of highest element accumulations in the lichens.

  16. On the Measurement of Elemental Abundance Ratios in Inner Galaxy H II Regions

    NASA Astrophysics Data System (ADS)

    Simpson, Janet P.; Rubin, Robert H.; Colgan, Sean W. J.; Erickson, Edwin F.; Haas, Michael R.

    2004-08-01

    Although variations in elemental abundance ratios in the Milky Way certainly exist, details remain uncertain, particularly in the inner Galaxy, where stars and H II regions in the Galactic plane are obscured optically. In this paper we revisit two previously studied, inner Galaxy H II regions: G333.6-0.2 and W43. We observed three new positions in G333.6-0.2 with the Kuiper Airborne Observatory and reobserved the central position with the Infrared Space Observatory's Long Wavelength Spectrometer in far-infrared lines of S++, N++, N+, and O++. We also added the N+ lines at 122 and 205 μm to the suite of lines measured in W43 by Simpson and coworkers. The measured electron densities range from ~40 to over 4000 cm-3 in a single H II region, indicating that abundance analyses must consider density variations, since the critical densities of the observed lines range from 40 to 9000 cm-3. We propose a method to handle density variations and make new estimates of the S/H and N/H abundance ratios. We find that our sulfur abundance estimates for G333.6-0.2 and W43 agree with the S/H abundance ratios expected for the S/H abundance gradient previously reported by Simpson and coworkers, with the S/H values revised to be smaller as a result of changes in collisional excitation cross sections. The estimated N/H, S/H, and N/S ratios are the most reliable because of their small corrections for unseen ionization states (<~10%). The estimated N/S ratios for the two sources are smaller than what would be calculated from the N/H and S/H ratios in our previous paper. We compute models of the two H II regions to estimate corrections for the other unseen ionization states. We find, with large uncertainties, that oxygen does not have a high abundance, with the result that the N/O ratio is as high (~0.35) as previously reported. The reasons for the uncertainty in the ionization corrections for oxygen are both the nonuniqueness of the H II region models and the sensitivity of these models

  17. Sensitivity-based finite element model updating using constrained optimization with a trust region algorithm

    NASA Astrophysics Data System (ADS)

    Bakir, Pelin Gundes; Reynders, Edwin; De Roeck, Guido

    2007-08-01

    The use of changes in dynamic system characteristics to detect damage has received considerable attention during the last years. Within this context, FE model updating technique, which belongs to the class of inverse problems in classical mechanics, is used to detect, locate and quantify damage. In this study, a sensitivity-based finite element (FE) model updating scheme using a trust region algorithm is developed and implemented in a complex structure. A damage scenario is applied on the structure in which the stiffness values of the beam elements close to the beam-column joints are decreased by stiffness reduction factors. A worst case and complex damage pattern is assumed such that the stiffnesses of adjacent elements are decreased by substantially different stiffness reduction factors. The objective of the model updating is to minimize the differences between the eigenfrequency and eigenmodes residuals. The updating parameters of the structure are the stiffness reduction factors. The changes of these parameters are determined iteratively by solving a nonlinear constrained optimization problem. The FE model updating algorithm is also tested in the presence of two levels of noise in simulated measurements. In all three cases, the updated MAC values are above 99% and the relative eigenfrequency differences improve substantially after model updating. In cases without noise and with moderate levels of noise; detection, localization and quantification of damage are successfully accomplished. In the case with substantially noisy measurements, detection and localization of damage are successfully realized. Damage quantification is also promising in the presence of high noise as the algorithm can still predict 18 out of 24 damage parameters relatively accurately in that case.

  18. Element concentrations in surface soils of the Coconino Plateau, Grand Canyon region, Coconino County, Arizona

    USGS Publications Warehouse

    Van Gosen, Bradley S.

    2016-09-15

    This report provides the geochemical analyses of a large set of background soils collected from the surface of the Coconino Plateau in northern Arizona. More than 700 soil samples were collected at 46 widespread areas, sampled from sites that appear unaffected by mineralization and (or) anthropogenic contamination. The soils were analyzed for 47 elements, thereby providing data on metal concentrations in soils representative of the plateau. These background concentrations can be used, for instance, for comparison to metal concentrations found in soils potentially affected by natural and anthropogenic influences on the Coconino Plateau in the Grand Canyon region of Arizona.The soil sampling survey revealed low concentrations for the metals most commonly of environmental concern, such as arsenic, cobalt, chromium, copper, mercury, manganese, molybdenum, lead, uranium, vanadium, and zinc. For example, the median concentrations of the metals in soils of the Coconino Plateau were found to be comparable to the mean values previously reported for soils of the western United States.

  19. On the Measurement of Elemental Abundance Ratios in Inner Galaxy H II Regions

    NASA Technical Reports Server (NTRS)

    Simpson, Janet P.; Rubin, Robert H.; Colgan, Sean W. J.; Erickson, Edwin F.; Haas, Michael R.

    2004-01-01

    Although abundance gradients in the Milky Way Galaxy certainly exist, details remain uncertain, particularly in the inner Galaxy, where stars and H II regions in the Galactic plane are obscured optically. In this paper we revisit two previously studied, inner Galaxy H II regions: G333.6-0.2 and W43. We observed three new positions in G333.6-0.2 with the Kuiper Airborne Observatory and reobserved the central position with the Infrared Space Observatory's Long Wavelength Spectrometer in far-infrared lines of S++, N++, N+, and O++. We also added the N+ lines at 122 and 205 microns to the suite of lines measured in W43 by Simpson et al.. The measured electron densities range from approx. 40 to over 4000 per cu cm in a single HII region, indicating that abundance analyses must consider density variations, since the critical densities of the observed lines range from 40 to 9000 per cu cm. We propose a method to handle density variations and make new estimates of the S/H and N/H abundance ratios. We find that our sulfur abundance estimates for G333.6-0.2 and W43 agree with the S/H abundance ratios expected for the gradient previously reported by Simpson et al., with the S/H values revised to be smaller owing to changes in collisional excitation cross sections. The estimated N/H, S/H, and N/S ratios are the most reliable because of their small corrections for unseen ionization states (< or approx. 10%). The estimated N/S ratios for the two sources are smaller than what would be calculated from the N/H and S/H ratios in our previous paper. If all low excitation H II regions had similar changes to their N/S ratios as a result of adding measurements of N+ to previous measurements of N++, there would be no or only a very small gradient in N/S. This is interesting because nitrogen is considered to be a secondary element and sulfur is a primary element in galactic chemical evolution calculations. We compute models of the two H II regions to estimate corrections for the other

  20. Rare earth element components in atmospheric particulates in the Bayan Obo mine region.

    PubMed

    Wang, Lingqing; Liang, Tao; Zhang, Qian; Li, Kexin

    2014-05-01

    The Bayan Obo mine, located in Inner Mongolia, China, is the largest light rare earth body ever found in the world. The research for rare earth elements (REEs) enrichment in atmospheric particulates caused by mining and ore processing is fairly limited so far. In this paper, atmospheric particulates including total suspended particulate (TSP) matter and particles with an equivalent aerodynamic diameter less than 10 μm (PM10) were collected around the Bayan Obo mine region, in August 2012 and March 2013, to analyze the levels and distributions of REEs in particles. The total concentrations of REEs for TSP were 149.8 and 239.6 ng/m(3), and those for PM10 were 42.8 and 68.9 ng/m(3), in August 2012 and March 2013, respectively. Enrichment factor was calculated for all 14 REEs in the TSP and PM10 and the results indicated that REEs enrichment in atmosphere particulates was caused by anthropogenic sources and influenced by the strong wind in springtime. The spatial distribution of REEs in TSP showed a strong gradient concentration in the prevailing wind direction. REE chondrite normalized patterns of TSP and PM10 were similar and the normalized curves inclined to the right side, showing the conspicuous fractionation between the light REEs and heavy REE, which supported by the chondrite normalized concentration ratios calculated for selected elements (La(N)/Yb(N), La(N)/Sm(N), Gd(N)/Yb(N)).

  1. Translational repression by a miniature inverted-repeat transposable element in the 3′ untranslated region

    PubMed Central

    Shen, Jianqiang; Liu, Juhong; Xie, Kabin; Xing, Feng; Xiong, Fang; Xiao, Jinghua; Li, Xianghua; Xiong, Lizhong

    2017-01-01

    Transposable elements constitute a substantial portion of eukaryotic genomes and contribute to genomic variation, function, and evolution. Miniature inverted-repeat transposable elements (MITEs), as DNA transposons, are widely distributed in plant and animal genomes. Previous studies have suggested that retrotransposons act as translational regulators; however, it remains unknown how host mRNAs are influenced by DNA transposons. Here we report a translational repression mechanism mediated by a stowaway-like MITE (sMITE) embedded in the 3′-untranslated region (3′-UTR) of Ghd2, a member of the CCT (CONSTANS [CO], CO-LIKE and TIMING OF CAB1) gene family in rice. Ghd2 regulates important agronomic traits, including grain number, plant height and heading date. Interestingly, the translational repression of Ghd2 by the sMITE mainly relies on Dicer-like 3a (OsDCL3a). Furthermore, other MITEs in the 3′-UTRs of different rice genes exhibit a similar effect on translational repression, thus suggesting that MITEs may exert a general regulatory function at the translational level. PMID:28256530

  2. Solubility of aerosol trace elements: Sources and deposition fluxes in the Canary Region

    NASA Astrophysics Data System (ADS)

    López-García, Patricia; Gelado-Caballero, María Dolores; Collado-Sánchez, Cayetano; Hernández-Brito, José Joaquín

    2017-01-01

    African dust inputs have important effects on the climate and marine biogeochemistry of the subtropical North Atlantic Ocean. The impact of dust inputs on oceanic carbon uptake and climate is dependent on total dust deposition fluxes as well as the bioavailability of nutrients and metals in the dust. In this work, the solubility of trace metals (Fe, Al, Mn, Co and Cu) and ions (Ca, sulphate, nitrate and phosphate) has been estimated from the analysis of a long-time series of 109 samples collected over a 3-year period in the Canary Islands. Solubility is primarily a function of aerosol origin, with higher solubility values corresponding to aerosols with more anthropogenic influence. Using soluble fractions of trace elements measured in this work, atmospheric deposition fluxes of soluble metals and nutrients have been calculated. Inputs of dissolved nutrients (P, N and Fe) have been estimated for the mixed layer. Considering that P is the limiting factor when ratios of these elements are compared with phytoplankton requirements, an increase of 0.58 nM of P in the mixed layer (∼150 m depth) and in a year can be estimated, which can support an increase of 0.02 μg Chla L-1 y-1. These atmospheric inputs of trace metals and nutrients appear to be significant relative to the concentrations reported in this region, especially during the summer months when the water column is more stratified and deep-water nutrient inputs are reduced.

  3. Multi-Region Boundary Element Analysis for Coupled Thermal-Fracturing Processes in Geomaterials

    NASA Astrophysics Data System (ADS)

    Shen, Baotang; Kim, Hyung-Mok; Park, Eui-Seob; Kim, Taek-Kon; Wuttke, Manfred W.; Rinne, Mikael; Backers, Tobias; Stephansson, Ove

    2013-01-01

    This paper describes a boundary element code development on coupled thermal-mechanical processes of rock fracture propagation. The code development was based on the fracture mechanics code FRACOD that has previously been developed by Shen and Stephansson (Int J Eng Fracture Mech 47:177-189, 1993) and FRACOM (A fracture propagation code—FRACOD, User's manual. FRACOM Ltd. 2002) and simulates complex fracture propagation in rocks governed by both tensile and shear mechanisms. For the coupled thermal-fracturing analysis, an indirect boundary element method, namely the fictitious heat source method, was implemented in FRACOD to simulate the temperature change and thermal stresses in rocks. This indirect method is particularly suitable for the thermal-fracturing coupling in FRACOD where the displacement discontinuity method is used for mechanical simulation. The coupled code was also extended to simulate multiple region problems in which rock mass, concrete linings and insulation layers with different thermal and mechanical properties were present. Both verification and application cases were presented where a point heat source in a 2D infinite medium and a pilot LNG underground cavern were solved and studied using the coupled code. Good agreement was observed between the simulation results, analytical solutions and in situ measurements which validates an applicability of the developed coupled code.

  4. Field Test of a Hybrid Finite-Difference and Analytic Element Regional Model.

    PubMed

    Abrams, D B; Haitjema, H M; Feinstein, D T; Hunt, R J

    2016-01-01

    Regional finite-difference models often have cell sizes that are too large to sufficiently model well-stream interactions. Here, a steady-state hybrid model is applied whereby the upper layer or layers of a coarse MODFLOW model are replaced by the analytic element model GFLOW, which represents surface waters and wells as line and point sinks. The two models are coupled by transferring cell-by-cell leakage obtained from the original MODFLOW model to the bottom of the GFLOW model. A real-world test of the hybrid model approach is applied on a subdomain of an existing model of the Lake Michigan Basin. The original (coarse) MODFLOW model consists of six layers, the top four of which are aggregated into GFLOW as a single layer, while the bottom two layers remain part of MODFLOW in the hybrid model. The hybrid model and a refined "benchmark" MODFLOW model simulate similar baseflows. The hybrid and benchmark models also simulate similar baseflow reductions due to nearby pumping when the well is located within the layers represented by GFLOW. However, the benchmark model requires refinement of the model grid in the local area of interest, while the hybrid approach uses a gridless top layer and is thus unaffected by grid discretization errors. The hybrid approach is well suited to facilitate cost-effective retrofitting of existing coarse grid MODFLOW models commonly used for regional studies because it leverages the strengths of both finite-difference and analytic element methods for predictions in mildly heterogeneous systems that can be simulated with steady-state conditions.

  5. Join-Graph Propagation Algorithms

    PubMed Central

    Mateescu, Robert; Kask, Kalev; Gogate, Vibhav; Dechter, Rina

    2010-01-01

    The paper investigates parameterized approximate message-passing schemes that are based on bounded inference and are inspired by Pearl's belief propagation algorithm (BP). We start with the bounded inference mini-clustering algorithm and then move to the iterative scheme called Iterative Join-Graph Propagation (IJGP), that combines both iteration and bounded inference. Algorithm IJGP belongs to the class of Generalized Belief Propagation algorithms, a framework that allowed connections with approximate algorithms from statistical physics and is shown empirically to surpass the performance of mini-clustering and belief propagation, as well as a number of other state-of-the-art algorithms on several classes of networks. We also provide insight into the accuracy of iterative BP and IJGP by relating these algorithms to well known classes of constraint propagation schemes. PMID:20740057

  6. Analysis of 22 Elements in Milk, Feed, and Water of Dairy Cow, Goat, and Buffalo from Different Regions of China.

    PubMed

    Zhou, Xuewei; Qu, Xueyin; Zhao, Shengguo; Wang, Jiaqi; Li, Songli; Zheng, Nan

    2017-03-01

    The objectives of this study were to measure the concentrations of elements in raw milk by inductively coupled plasma-mass spectrometry (ICP-MS) and evaluate differences in element concentrations among animal species and regions of China. Furthermore, drinking water and feed samples were analyzed to investigate whether the element concentrations in raw milk are correlated with those in water and feed. All samples were analyzed by ICP-MS following microwave-assisted acid digestion. The mean recovery of the elements was 98.7 % from milk, 103.7 % from water, and 93.3 % from a certified reference material (cabbage). Principal component analysis results revealed that element concentrations differed among animal species and regions. Correlation analysis showed that trace elements Mn, Fe, Ni, Ga, Se, Sr, Cs, U in water and Co, Ni, Cu, Se, U in feed were significantly correlated with those in milk (p < 0.05). Toxic and potential toxic elements Cr, As, Cd, Tl, Pb in water and Al, Cr, As, Hg, Tl in feed were significantly correlated with those in milk (p < 0.05). Results of correlation analysis revealed that elements in water and feed might contribute to the elements in milk.

  7. Computational identification of new structured cis-regulatory elements in the 3'-untranslated region of human protein coding genes.

    PubMed

    Chen, Xiaowei Sylvia; Brown, Chris M

    2012-10-01

    Messenger ribonucleic acids (RNAs) contain a large number of cis-regulatory RNA elements that function in many types of post-transcriptional regulation. These cis-regulatory elements are often characterized by conserved structures and/or sequences. Although some classes are well known, given the wide range of RNA-interacting proteins in eukaryotes, it is likely that many new classes of cis-regulatory elements are yet to be discovered. An approach to this is to use computational methods that have the advantage of analysing genomic data, particularly comparative data on a large scale. In this study, a set of structural discovery algorithms was applied followed by support vector machine (SVM) classification. We trained a new classification model (CisRNA-SVM) on a set of known structured cis-regulatory elements from 3'-untranslated regions (UTRs) and successfully distinguished these and groups of cis-regulatory elements not been strained on from control genomic and shuffled sequences. The new method outperformed previous methods in classification of cis-regulatory RNA elements. This model was then used to predict new elements from cross-species conserved regions of human 3'-UTRs. Clustering of these elements identified new classes of potential cis-regulatory elements. The model, training and testing sets and novel human predictions are available at: http://mRNA.otago.ac.nz/CisRNA-SVM.

  8. Transcriptional regulatory elements in the noncoding region of human papillomavirus type 6

    SciTech Connect

    Wu, Tzyy-Choou.

    1989-01-01

    The structure and function of the transcriptional regulatory region of human papillomavirus type 6 (HPV-6) has been investigated. To investigate tissue specific gene expression, a sensitive method to detect and localize HPV-6 viral DNA, mRNA and protein in plastic-embedded tissue sections of genital and respiratory tract papillomata by using in situ hybridization and immunoperoxidase assays has been developed. This method, using ultrathin sections and strand-specific {sup 3}H labeled riboprobes, offers the advantages of superior morphological preservation and detection of viral genomes at low copy number with good resolution, and the modified immunocytochemistry provides better sensitivity. The results suggest that genital tract epithelium is more permissive for HPV-6 replication than respiratory tract epithelium. To study the tissue tropism of HPV-6 at the level of regulation of viral gene expression, the polymerase chain reaction was used to isolate the noncoding region (NCR) of HPV-6 in independent isolates. Nucleotide sequence analysis of molecularly cloned DNA identified base substitutions, deletions/insertions and tandem duplications. Transcriptional regulatory elements in the NCR were assayed in recombinant plasmids containing the bacterial gene for chloramphenicol acetyl transferase.

  9. Simplified Explosive Joining of Tubes to Fittings

    NASA Technical Reports Server (NTRS)

    Bement, L. J.; Bailey, J. W.; Perry, R.; Finch, M. S.

    1987-01-01

    Technique simplifies tube-to-fitting joining, as compared to fusion welding, and provides improvement on standard procedures used to join tubes explosively to tube fittings. Special tool inserted into tube to be joined. Tool allows strip of ribbon explosive to be placed right at joint. Ribbon explosive and mild detonating fuse allows use of smaller charge. Assembled tool storable, and process amenable to automation. Assembly of components, insertion of tool into weld site, and joining operation mechanized without human contact. Used to assemble components in nuclear reactors or in other environments hostile to humans.

  10. Affordable, Robust Ceramic Joining Technology (ARCJoint) Developed

    NASA Technical Reports Server (NTRS)

    Steele, Gynelle C.

    2001-01-01

    Affordable, Robust Ceramic Joining Technology (ARCJoint) is a method for joining high temperature- resistant ceramic pieces together, establishing joints that are strong, and allowing joining to be done in the field. This new way of joining allows complex shapes to be formed by joining together geometrically simple shapes. The joining technology at NASA is one of the enabling technologies for the application of silicon-carbide-based ceramic and composite components in demanding and high-temperature applications. The technology is being developed and tested for high-temperature propulsion parts for aerospace use. Commercially, it can be used for joining ceramic pieces used for high temperature applications in the power-generating and chemical industries, as well as in the microelectronics industry. This innovation could yield big payoffs for not only the power-generating industry but also the Silicon Valley chipmakers. This technology, which was developed at the NASA Glenn Research Center by Dr. Mrityunjay Singh, is a two-step process involving first using a paste to join together ceramic pieces and bonding them by heating the joint to 110 to 120 C for between 10 and 20 min. This makes the joint strong enough to be handled for the final joining. Then, a silicon-based substance is applied to the joint and heated to 1400 C for 10 to 15 min. The resulting joint is as strong as the original ceramic material and can withstand the same high temperatures.

  11. Bio- and toxic elements in edible wild mushrooms from two regions of potentially different environmental conditions in eastern Poland.

    PubMed

    Brzezicha-Cirocka, Justyna; Mędyk, Małgorzata; Falandysz, Jerzy; Szefer, Piotr

    2016-11-01

    In the present study, the composition of bio-elements (K, Na, Mg, Ca, Fe, Cu, Zn) and toxic elements (Ag, Cd) in seven edible mushrooms from the rural and woodland region of Morąg (north-eastern Poland) and the rural and industrial region of the Tarnobrzeska Upland (south-eastern Poland) were investigated using a validated method. The species examined were Boletus edulis, Cantharellus cibarius, Leccinum aurantiacum, Leccinum versipelle, Lycoperdon perlatum, Suillus luteus, and Xerocomus subtomentosus. Final determination was carried out by flame atomic absorption spectroscopy (FAAS) after microwave-assisted decomposition of sample matrices with solutions of concentrated nitric acid in the pressurized polytetrafluoroethylene vessels. The contents of the alkali elements and alkali earth elements were determined in the species surveyed. The alkali elements, earth alkali elements, and transition metals (Ag, Cu, Zn, Fe, and Mn) were at typical concentrations as was determined for the same or similar species elsewhere in Poland and Europe. The results may suggest a lack of local and regional emissions of those metallic elements from industrialization of some sites in the Tarnobrzeska Plain. Cadmium was at elevated concentrations in L. versipelle from the Tarnobrzeska Plain but the reason-pollution or geogenic source-was unknown, while it was at typical concentrations in other species.

  12. Spatial variation in total element concentration in soil within the Northern Great Plains coal region, and regional soil chemistry in Bighorn and Wind River basins, Wyoming and Montana

    USGS Publications Warehouse

    Severson, R.C.; Tidball, R.R.

    1979-01-01

    PART A: To objectively determine the changes in chemical character of an area subjected to mining and reclamation, prior information is needed. This study represents a broadscale inventory of total chemical composition of the surficial materials of the Northern Great Plains coal region (western North and South Dakota, eastern Montana, and northeastern Wyoming); data are given for 41 elements in A and C soil horizons. An unbalanced, nested, analysis-of-variance design was used to quantify variation in total content of elements between glaciated and unglaciated terrains, for four increasingly smaller geographic scales, and to quantify variation due to sample preparation and analysis. From this statistical study, reliable maps on a regional basis (>100 km) were prepared for C, K, and Rb in A and C soil horizons; for N a, Si, Th, D, and Zn in A-horizon soil; and for As, Ca, Ge, and Mg in C-horizon soil. The distribution of variance components for the remaining 29 elements did not permit the construction of reliable maps. Therefore, a baseline value for each of these elements is given as a measure of the total element concentration in the soils of the Northern Great Plains coal region. The baseline is expressed as the 95-percent range in concentration to be expected in samples of natural soils. PART B: A reconnaissance study of total concentrations of 38 elements in samples of soils (0-40 cm deep, composite) from the Bighorn and Wind River Basins of Montana and Wyoming indicates that the geographic variation for most elements occurs locally (5 km or less). However, in the Bighorn Basin, Zn exhibits significant regional variation (between geologic units); and in the Wind River Basin, AI, Cr, K, Mn, Mo, Ni, U, and V exhibit similar variation. For the remaining elements, the lack of regional variation suggests that a single summary statistic can be used to estimate a baseline value that reflects the range in concentration to be expected in samples of soils in each basin

  13. Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element.

    PubMed Central

    Frayne, E G; Kellems, R E

    1986-01-01

    Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element. Images PMID:3714472

  14. Joining of advanced materials by superplastic deformation

    DOEpatents

    Goretta, Kenneth C.; Routbort, Jules L.; Gutierrez-Mora, Felipe

    2005-12-13

    A method for utilizing superplastic deformation with or without a novel joint compound that leads to the joining of advanced ceramic materials, intermetallics, and cermets. A joint formed by this approach is as strong as or stronger than the materials joined. The method does not require elaborate surface preparation or application techniques.

  15. Joining of advanced materials by superplastic deformation

    DOEpatents

    Goretta, Kenneth C.; Routbort, Jules L.; Gutierrez-Mora, Felipe

    2008-08-19

    A method for utilizing superplastic deformation with or without a novel joint compound that leads to the joining of advanced ceramic materials, intermetallics, and cermets. A joint formed by this approach is as strong as or stronger than the materials joined. The method does not require elaborate surface preparation or application techniques.

  16. Efficient Joins with Compressed Bitmap Indexes

    SciTech Connect

    Computational Research Division; Madduri, Kamesh; Wu, Kesheng

    2009-08-19

    We present a new class of adaptive algorithms that use compressed bitmap indexes to speed up evaluation of the range join query in relational databases. We determine the best strategy to process a join query based on a fast sub-linear time computation of the join selectivity (the ratio of the number of tuples in the result to the total number of possible tuples). In addition, we use compressed bitmaps to represent the join output compactly: the space requirement for storing the tuples representing the join of two relations is asymptotically bounded by min(h; n . cb), where h is the number of tuple pairs in the result relation, n is the number of tuples in the smaller of the two relations, and cb is the cardinality of the larger column being joined. We present a theoretical analysis of our algorithms, as well as experimental results on large-scale synthetic and real data sets. Our implementations are efficient, and consistently outperform well-known approaches for a range of join selectivity factors. For instance, our count-only algorithm is up to three orders of magnitude faster than the sort-merge approach, and our best bitmap index-based algorithm is 1.2x-80x faster than the sort-merge algorithm, for various query instances. We achieve these speedups by exploiting several inherent performance advantages of compressed bitmap indexes for join processing: an implicit partitioning of the attributes, space-efficiency, and tolerance of high-cardinality relations.

  17. Fine-scale map of encyclopedia of DNA elements regions in the Korean population.

    PubMed

    Yoo, Yeon-Kyeong; Ke, Xiayi; Hong, Sungwoo; Jang, Hye-Yoon; Park, Kyunghee; Kim, Sook; Ahn, TaeJin; Lee, Yeun-Du; Song, Okryeol; Rho, Na-Young; Lee, Moon Sue; Lee, Yeon-Su; Kim, Jaeheup; Kim, Young J; Yang, Jun-Mo; Song, Kyuyoung; Kimm, Kyuchan; Weir, Bruce; Cardon, Lon R; Lee, Jong-Eun; Hwang, Jung-Joo

    2006-09-01

    The International HapMap Project aims to generate detailed human genome variation maps by densely genotyping single-nucleotide polymorphisms (SNPs) in CEPH, Chinese, Japanese, and Yoruba samples. This will undoubtedly become an important facility for genetic studies of diseases and complex traits in the four populations. To address how the genetic information contained in such variation maps is transferable to other populations, the Korean government, industries, and academics have launched the Korean HapMap project to genotype high-density Encyclopedia of DNA Elements (ENCODE) regions in 90 Korean individuals. Here we show that the LD pattern, block structure, haplotype diversity, and recombination rate are highly concordant between Korean and the two HapMap Asian samples, particularly Japanese. The availability of information from both Chinese and Japanese samples helps to predict more accurately the possible performance of HapMap markers in Korean disease-gene studies. Tagging SNPs selected from the two HapMap Asian maps, especially the Japanese map, were shown to be very effective for Korean samples. These results demonstrate that the HapMap variation maps are robust in related populations and will serve as an important resource for the studies of the Korean population in particular.

  18. Application of the finite element groundwater model FEWA to three regional aquifers

    SciTech Connect

    Wong, K.F.V.; Yeh, G.T.

    1986-06-01

    This report documents the calibration with field data and predictive application of a finite element model of water through aquifers (FEWA). FEWA was described in a report written by G.T. Yeh and D.D. Huff in 1983. The model was first compared with the United States Geological Survey (USGS) two-dimensional model and found superior in treating anisotropic media when the coordinates cannot be made to coincide with the principal directions of hydraulic conductivities. In addition, there was no necessity to define nodal points outside the region, as required by the USGS model. FEWA was next calibrated with measured potentiometric surfaces from the Love Canal area in New York and the Conesville area in Ohio. There were satisfactory matches between computed results and available field data. The calibration and predictive runs of FEWA were then accomplished with the Hialeah-Preston well field data over the Biscayne aquifer in south Florida. The calibration run yielded two values of hydraulic conductivity in the area, and the predictive run gave results that matched well with available data. 18 refs., 28 figs.

  19. Eco-environmental implications of elemental and carbon isotope distributions in ornithogenic sediments from the Ross Sea region, Antarctica

    NASA Astrophysics Data System (ADS)

    Liu, Xiaodong; Nie, Yaguang; Sun, Liguang; Emslie, Steven D.

    2013-09-01

    Seabirds have substantial influence on geochemical circulation of elements, serving as a link for substance exchange between their foraging area and colonies. In this study, we investigated the elemental and carbon isotopic composition of five penguin-affected sediment profiles excavated from Ross Island and Beaufort Island in the Ross Sea region, Antarctica. Among the three main constituents of the sediments (including weathered bedrock, guano and algae), guano was the main source of organic matter and nutrients, causing selective enrichment of several elements in each of the sediment profiles. In the 22 measured elements, As, Cd, Cu, P, S, Se and Zn were identified as penguin bio-elements in the Ross Sea region through statistical analysis and comparison with local end-member environmental media such as weathered bedrock, fresh guano and fresh algae. Carbon isotopic composition in the ornithogenic sediments showed a mixing feature of guano and algae. Using a two-member isotope mixing equation, we were able to reconstruct the historical change of guano input and algal bio-mass. Compared with research in other parts of Antarctic, Arctic, and South China Sea, we found apparent overlap of avian bio-elements including As, Cd, Cu, P, Se, and Zn. Information on the composition and behavior of bio-elements in seabird guano on a global scale, and the role that bio-vectors play in the geochemical circulation between land and sea, will facilitate future research on avian ecology and paleoclimatic reconstruction.

  20. Melting temperature highlights functionally important RNA structure and sequence elements in yeast mRNA coding regions.

    PubMed

    Qi, Fei; Frishman, Dmitrij

    2017-03-07

    Secondary structure elements in the coding regions of mRNAs play an important role in gene expression and regulation, but distinguishing functional from non-functional structures remains challenging. Here we investigate the dependence of sequence-structure relationships in the coding regions on temperature based on the recent PARTE data by Wan et al. Our main finding is that the regions with high and low thermostability (high Tm and low Tm regions) are under evolutionary pressure to preserve RNA secondary structure and primary sequence, respectively. Sequences of low Tm regions display a higher degree of evolutionary conservation compared to high Tm regions. Low Tm regions are under strong synonymous constraint, while high Tm regions are not. These findings imply that high Tm regions contain thermo-stable functionally important RNA structures, which impose relaxed evolutionary constraint on sequence as long as the base-pairing patterns remain intact. By contrast, low thermostability regions contain single-stranded functionally important conserved RNA sequence elements accessible for binding by other molecules. We also find that theoretically predicted structures of paralogous mRNA pairs become more similar with growing temperature, while experimentally measured structures tend to diverge, which implies that the melting pathways of RNA structures cannot be fully captured by current computational approaches.

  1. Discrete elements within the SV40 enhancer region display different cell-specific enhancer activities.

    PubMed Central

    Ondek, B; Shepard, A; Herr, W

    1987-01-01

    The SV40 enhancer contains three genetically defined elements, called A, B and C, that can functionally compensate for one another. By using short, synthetic DNA oligonucleotides, we show that each of these elements can act autonomously as an enhancer when present as multiple tandem copies. Analysis of a progressive series of B element oligomers shows a single element is ineffective as an enhancer and that the activity of two or more elements increases with copy number. Assay in five different cell lines of two separate enhancers containing six tandem copies of either the B or C element shows that these elements possess different cell-specific activities. Parallel oligomer enhancer constructs containing closely spaced double point mutations display no enhancer activity in any of the cell lines tested, indicating that these elements represent single units of enhancer function. These elements contain either a 'core' or 'octamer' consensus sequence but these consensus sequences alone are not sufficient for enhancer activity. The different cell-specific activities of the B and C elements are consistent with functional interactions with different trans-acting factors. We discuss how tandem duplication of such dissimilar elements, as in the wild-type SV40 72-bp repeats, can serve to expand the conditions under which an enhancer can function. Images Fig. 2. Fig. 3. Fig. 4. PMID:3036487

  2. Austria Declares Intent To Join ESO

    NASA Astrophysics Data System (ADS)

    2008-04-01

    At a press conference today at the University of Vienna's Observatory, the Austrian Science Minister Johannes Hahn announced the decision by the Austrian Government to seek membership of ESO from 1 July this year. ESO PR Photo 11/08 ESO PR Photo 11/08 Announcing Austria's Intent to Join ESO Said Minister Hahn: "With membership of ESO, Austria's scientists will receive direct access to the world's leading infrastructure in astronomy. This strengthens Austria as a place for research and provides an opportunity for young researchers to continue their work from here. With this move, Austria takes an important step in the reinforcement of Europe's science and research infrastructure." The decision constitutes a major breakthrough for Austrian scientists who have argued for membership of ESO for many years. Seeking membership in ESO also marks a step towards the further development of the European Research and Innovation Area, an important element of Europe's so-called Lisbon Strategy. "ESO welcomes the Austrian bid to join our organisation. I salute the Austrian Government for taking this important step and look forward to working closely with our Austrian friends and colleagues in the years to come," commented the ESO Director General, Tim de Zeeuw. For Austrian astronomers, ESO membership means not only unrestricted access to ESO's world-leading observational facilities including the world's most advanced optical telescope, the Very Large Telescope, and full participation in the quasi-global ALMA project, but also the possibility to participate on a par with their European colleagues in the future projects of ESO, including the realisation of ESO's Extremely Large Telescope project (E-ELT), which is currently in the design phase. All these projects require some of the most advanced technologies in key areas such as optics, detectors, lightweight structures, etc. Austrian participation in ESO opens the door for Austrian industry and major research institutes of the

  3. Concentrations and solubility of trace elements in fine particles at a mountain site, southern China: regional sources and cloud processing

    NASA Astrophysics Data System (ADS)

    Li, T.; Wang, Y.; Li, W. J.; Chen, J. M.; Wang, T.; Wang, W. X.

    2015-05-01

    The concentrations and solubility of twelve trace elements in PM2.5 at Mt. Lushan, southern China, were investigated during the summer of 2011 and the spring of 2012. The average PM2.5 mass was 55.2 ± 20.1 μg m-3 during the observation period. Temporal variations of all trace elements including total and water-soluble fractions with several dust storm spikes for total fraction Al and Fe were observed. The enrichment factor (EF) values were one order of magnitude higher for the water-soluble fractions vs. the total fractions of trace elements. Four major emission sources were classified by principal component analysis (PCA), namely nonferrous metal mining and smelting (for Cr, As, Ba and parts of Zn), coal combustion (for Pb, Zn, Se, Cu and Mn), crustal materials (for Al and Fe) and municipal solid waste incineration (for Cd and Mo). Trajectory cluster analysis and the potential source contribution function (PSCF) consistently identified the Yangtze River Delta (YRD), the Pearl River Delta (PRD) and parts of Hunan and Jiangxi as the major source regions and pathways for anthropogenic elements, while northern China was identified for crustal elements. In contrast, the local Jiangxi area has become the most significant contributor to the solubility of most trace elements, apart from the YRD with severe air pollution. In addition, the solubility alteration of trace elements in cloud events was investigated and transmission electron microscopy (TEM) analysis indicated that the irreversible alteration of particle morphology by cloud processing was highly responsible for the enhancement of element solubility. Our work implies an important role of regional anthropogenic pollution and cloud processing in the evolution of trace element solubility during transport.

  4. Atmospheric deposition of trace elements recorded in snow from the Mt. Nyainqêntanglha region, southern Tibetan Plateau.

    PubMed

    Huang, Jie; Kang, Shichang; Zhang, Qianggong; Guo, Junming; Chen, Pengfei; Zhang, Guoshuai; Tripathee, Lekhendra

    2013-08-01

    In May 2009, snowpit samples were collected from a high-elevation glacier in the Mt. Nyainqêntanglha region on the southern Tibetan Plateau. A set of elements (Al, V, Cr, Mn, Co, Ni, Cu, Zn, Cd, Hg and Pb) was analyzed to investigate the concentrations, deposition fluxes of trace elements, and the relative contributions from anthropogenic and natural sources deposited on the southern Tibetan Plateau. Concentrations of most of the trace elements in snowpit samples from the Zhadang glacier are significantly lower than those examined from central Asia (e.g., eastern Tien Shan), with higher concentrations during the non-monsoon season than during the monsoon season. The elements of Al, V, Cr, Mn, Co, and Ni display low crustal enrichment factors (EFs), while Cu, Zn, Cd, Hg, and Pb show high EF values in the snow samples, suggesting anthropogenic inputs are potentially important for these elements in the remote, high-elevation atmosphere on the southern Tibetan Plateau. Together with the fact that the concentration levels of such elements in the Mt. Nyainqêntanglha region are significantly higher than those observed on the south edge of the Tibetan Plateau, our results suggest that the high-elevation atmosphere on the southern Tibetan Plateau may be more sensitive to variations in the anthropogenic emissions of atmospheric trace elements than that in the central Himalayas. Moreover, the major difference between deposition fluxes estimated in our snow samples and those recently measured at Nam Co Station for elements such as Cr and Cu may suggest that atmospheric deposition of some of trace elements reconstructed from snowpits and ice cores could be grossly underestimated on the Tibetan Plateau.

  5. On the optimality of the neighbor-joining algorithm

    PubMed Central

    Eickmeyer, Kord; Huggins, Peter; Pachter, Lior; Yoshida, Ruriko

    2008-01-01

    The popular neighbor-joining (NJ) algorithm used in phylogenetics is a greedy algorithm for finding the balanced minimum evolution (BME) tree associated to a dissimilarity map. From this point of view, NJ is "optimal" when the algorithm outputs the tree which minimizes the balanced minimum evolution criterion. We use the fact that the NJ tree topology and the BME tree topology are determined by polyhedral subdivisions of the spaces of dissimilarity maps R+(n2) to study the optimality of the neighbor-joining algorithm. In particular, we investigate and compare the polyhedral subdivisions for n ≤ 8. This requires the measurement of volumes of spherical polytopes in high dimension, which we obtain using a combination of Monte Carlo methods and polyhedral algorithms. Our results include a demonstration that highly unrelated trees can be co-optimal in BME reconstruction, and that NJ regions are not convex. We obtain the l2 radius for neighbor-joining for n = 5 and we conjecture that the ability of the neighbor-joining algorithm to recover the BME tree depends on the diameter of the BME tree. PMID:18447942

  6. Concentrations and solubility of trace elements in fine particles at a mountain site, southern China: regional sources and cloud processing

    NASA Astrophysics Data System (ADS)

    Li, T.; Wang, Y.; Li, W. J.; Chen, J. M.; Wang, T.; Wang, W. X.

    2015-08-01

    The concentrations and solubility of twelve trace elements in PM2.5 at Mt. Lushan, southern China, were investigated during the summer of 2011 and the spring of 2012. The average PM2.5 mass was 55.2 ± 20.1 μg m-3 during the observation period. Temporal variations of all trace elements including total and water-soluble fractions with several dust storm spikes in total fractions of Al and Fe were observed. The enrichment factor (EF) values were 1 order of magnitude higher for the water-soluble fractions versus the total fractions of trace elements. Four major emission sources, namely nonferrous metal mining and smelting (for Cr, As, Ba and parts of Zn), coal combustion (for Pb, Zn, Se, Cu and Mn), crustal materials (for Al and Fe) and municipal solid waste incineration (for Cd and Mo), were classified by principal component analysis (PCA). Trajectory cluster analysis and the potential source contribution function (PSCF) consistently identified the Yangtze River delta (YRD), the Pearl River delta (PRD), and the neighbouring provinces of Mt. Lushan as the major source regions and transport pathways for anthropogenic elements. Northern China was identified as a major source region for crustal elements. It should be noted that apart from the YRD, the area around Mt. Lushan has become the most significant contributor to the solubility of most trace elements. Element solubility can be partially determined by emission sources. However, enhanced solubility of trace elements corresponding to increased concentrations of sulfate after the occurrence of cloud events indicated significant effects of cloud processing on aerosol element dissolution. Metal particles mixed with sulfate in cloud droplet residues were further investigated through transmission electron microscopy (TEM) analysis. Irreversible alteration of particle morphology by cloud processing was confirmed to be highly responsible for the enhancement of trace element solubility. The findings from this study imply an

  7. Investigation of trace elements in ancient pottery from Jenini, Brong Ahafo region, Ghana by INAA and Compton suppression spectrometry

    NASA Astrophysics Data System (ADS)

    Nyarko, B. J. B.; Bredwa-Mensah, Y.; Serfor-Armah, Y.; Dampare, S. B.; Akaho, E. H. K.; Osae, S.; Perbi, A.; Chatt, A.

    2007-10-01

    Concentrations of trace elements in ancient pottery excavated from Jenini in the Brong Ahafo region of Ghana were determined using instrumental neutron activation analysis (INAA) in conjunction with both conventional and Compton suppression counting. Jenini was a slave Camp of Samory Toure during the indigenous slavery and the Trans-Atlantic slave trade. Pottery fragments found during the excavation of the grave tombs of the slaves who died in the slave camps were analysed. In all, 26 trace elements were determined in 40 pottery fragments. These elemental concentrations were processed using multivariate statistical methods, cluster, factor and discriminant analyses in order to determine similarities and correlation between the various samples. The suitability of the two counting systems for determination of trace elements in pottery objects has been evaluated.

  8. Method of joining metallic and composite components

    NASA Technical Reports Server (NTRS)

    Semmes, Edmund B. (Inventor)

    2010-01-01

    A method is provided for joining a metallic member to a structure made of a composite matrix material. One or more surfaces of a portion of the metallic member that is to be joined to the composite matrix structure is provided with a plurality of outwardly projecting studs. The surface including the studs is brought into engagement with a portion of an uncured composite matrix material so that fibers of the composite matrix material intertwine with the studs, and the metallic member and composite structure form an assembly. The assembly is then companion cured so as to join the metallic member to the composite matrix material structure.

  9. Microwave joining of SiC

    SciTech Connect

    Silberglitt, R.; Ahmad, I.; Tian, Y.L.

    1997-04-01

    The purpose of this work is to optimize the properties of SiC-SiC joints made using microwave energy. The current focus is on identification of the most effective joining methods for scale-up to large tube assemblies, including joining using SiC produced in situ from chemical precursors. During FY 1996, a new microwave applicator was designed, fabricated and tested that provides the capability for vacuum baking of the specimens and insulation and for processing under inert environment. This applicator was used to join continuous fiber-reinforced (CFCC) SiC/SiC composites using a polymer precursor to form a SiC interlayer in situ.

  10. Joining of ceramics for high temperature applications

    NASA Technical Reports Server (NTRS)

    Vilpas, Martti

    1987-01-01

    Summarized is a literature survey of the methods for joining ceramics to ceramics or ceramics to metals for high temperature applications. Also mechanical properties and potential applications of the joints are considered. The joining of ceramics is usually carried out by brazing or diffusion bonding. Especially the latter has been found useful, increasing the application of bonded ceramics. The possibility of using electron beam and laser beam welding for joining ceramics has also recently been investigated. The bonding of ceramics has found numerous applications typical for high operating temperatures, i.e., sensors and thermocouples.

  11. Spectra in the 60 )angstrom) to 345 )angstrom) wavelength region of elements injected into the PLT tokamak

    SciTech Connect

    Wouters, A.; Schwob, J.L.; Suckewer, S.; Seely, J.F.; Feldman, U.; Dave, J.H.

    1988-03-01

    High resolution spectra of the elements Fe, Ni, Zn, Ge, Se, and Mo injected into the PLT tokamak were recorded by the 2-meter Schwob-Fraenkel soft X-ray multichannel spectrometer (SOXMOS). Spectra were recorded every 50 ms during the time before and after injection. The spectral lines of the injected element were very strong in the spectrum recorded immedately after injection, and the transition in the injected element were easily distinguished from the transitions in te intrinsic elements (C, O, Ti, Cr, Fe, and Ni). An accurate wavelength scale was established using well-known reference transitions in the intrinsic elements. The spectra recorded just prior to injection were substracted from the spectra recorded after injection, and the resulting spectrum was composed almost entirely of transitions from the injected element. A large number of ..delta..n + 0 transitions between the ground and the first excited configurations in the Li I through K I isoelectronic sequences of the injected elements were identified in the wavelength region 60 )angstrom) to 345 )angstrom). 33 refs., 5 figs., 1 tab.

  12. Finite Element Modelling of the Glenohumeral Capsule Can Help Assess the Tested Region during a Clinical Exam

    PubMed Central

    Ellis, Benjamin J; Drury, Nicholas J.; Moore, Susan M.; McMahon, Patrick J.; Weiss, Jeffrey A.; Debski, Richard E.

    2013-01-01

    The objective of this research was to examine the efficacy of evaluating the region of the glenohumeral capsule being tested by clinical exams for shoulder instability using finite element models of the glenohumeral joint. Specifically, the regions of high capsule strain produced by glenohumeral joint positions commonly used during a clinical exam were identified. Kinematics that simulated a simple translation test with an anterior load at three external rotation angles were applied to a validated, subject-specific finite element model of the glenohumeral joint at 60° of abduction. Maximum principal strains on the glenoid side of the IGHL were significantly higher than the maximum principal strains on the humeral side, for all three regions of the IGHL at 30° and 60° of external rotation. These regions of localized strain indicate that these joint positions might be used to test the glenoid side of the IGHL during this clinical exam, but are not useful for assessing the humeral side of the IGHL. The use of finite element models will facilitate the search for additional joint positions that isolate high strains to other IGHL regions, including the humeral side of the IGHL. PMID:20013435

  13. An optical region elemental abundance analysis of the chemically peculiar HgMn star chi Lupi

    NASA Technical Reports Server (NTRS)

    Wahlgren, Glenn M.; Adelman, Saul J.; Robinson, Richard D.

    1994-01-01

    The optical spectrum of the chemically peculiar HgMn type binary star chi Lupi has been analyzed to determine atmospheric parameters and elemental abundances. Echelle spectra were obtained with the 3.9 m Anglo-Australian telescope to exploit the extreme shape-lined nature of the spectrum. This study was undertaken in support of ultraviolet analyses currently underway that utilize echell spectra obtained with the Hubble Space Telescope. For the B9.5 V primary star we obtain T(sub eff) = 10650 K, log g = 3.9, and xi = 0 km/s, while for the A2 V secondary, T(sub eff) = 9200 K, log g = 4.0, and xi = 2 km/s. Most of the elemental abundances are typical of HgMn stars with similar T(sub eff) showing an overall iron-peak elemental abundance distribution that is basically solar in nature with enhancement of the light elements Si, P, and S, as well as all detected elements heavier than the iron group. Abundances for several elements have been determined for the first time in this star, including several of the rare-earths. The secondary star spectrum shows Am star characteristics. We also discuss the relative merits of the equivalent width and synthetic spectrum techniques in determining the elemental abundences, concluding that the synthetic spectrum technique is necessary for obtaining abundances with the utmost accuracy.

  14. Leap to explore the region of neutron-rich heavy element isotopes

    SciTech Connect

    Hoffman, D.C.

    1985-10-01

    The research aims of the Large Einsteinium Activation Program (LEAP) are described. This program is a major initiative to exploit currently existing expertise in heavy element research and the potential for producing very heavy actinide target materials such as 285-day /sup 254/Es at the High Flux Isotope Reactor at Oak Ridge National Laboratory. The stated aims of the program are to produce heavy element isotopes, to conduct chemical studies of these isotopes, to study the nuclear properties of such isotopes, and to produce a superheavy element (183 neutrons) by the using a /sup 254/Es target and /sup 48/Ca projectiles. 13 refs., 2 figs., 2 tabs. (DWL)

  15. Microwave joining of high-purity alumina

    SciTech Connect

    Cozzi, A.D.; Clark, D.E.; Ferber, M.K.

    1996-12-31

    Microwave hybrid heating (MHH) was used to join 99.5% pure alumina pieces 25 mm diameter and 25 mm long using 94% pure alumina as the interlayer material. The interlayer material was cut from a rod into discs approximately 2 mm thick. Joining was performed in a home model microwave oven. Temperatures for joining ranged from 1450{degrees}C to 1550{degrees}C and pressures from 1-3 MPa. For comparison, similar joints were made in a conventional furnace. Joined specimens were tested using four-point bend at room temperature. Statistical analysis was utilized to determine the relative effect of the different processing parameters on the strength of the joint.

  16. Steps to Join Green Power Partnership

    EPA Pesticide Factsheets

    The U.S. EPA's Green Power Partnership is a voluntary partnership program designed to reduce the environmental impact of electricity generation by promoting renewable energy. This page details steps organizations should take to join the Partnership.

  17. Inventory of available data elements for the San Bernardino, California region

    NASA Technical Reports Server (NTRS)

    Christenson, J.; Michel, R.

    1981-01-01

    Elements of data sets that are available to be integrated for the San Bernardino vertical data integration project are given. Each of the data sets has specified for it the ownership, validity, accuracy and technical requirements for integration.

  18. A Comparison of Elemental Abundance Ratios in SEP Events in Fast and Slow Solar Wind Regions

    DTIC Science & Technology

    2009-07-24

    that the elemental abundances of gradual SEP events reflect the composition of the solar corona , implying that the ambient coronal thermal ions...point at the top of the corona , although the plasma near Earth emerged ~4 days prior to its arrival at 1 AU. Thus energetic-particle and solar -wind...TYPE REPRINT 3. DATES COVERED (From - To) 4. TITLE AND SUBTITLE A Comparison of Elemental Abundance Ratios in SEP Events in Fast and Slow Solar

  19. Cardiomyopathy mutations reveal variable region of myosin converter as major element of cross-bridge compliance.

    PubMed

    Seebohm, B; Matinmehr, F; Köhler, J; Francino, A; Navarro-Lopéz, F; Perrot, A; Ozcelik, C; McKenna, W J; Brenner, B; Kraft, T

    2009-08-05

    The ability of myosin to generate motile forces is based on elastic distortion of a structural element of the actomyosin complex (cross-bridge) that allows strain to develop before filament sliding. Addressing the question, which part of the actomyosin complex experiences main elastic distortion, we suggested previously that the converter domain might be the most compliant region of the myosin head domain. Here we test this proposal by studying functional effects of naturally occurring missense mutations in the beta-myosin heavy chain, 723Arg --> Gly (R723G) and 736Ile --> Thr (I736T), in comparison to 719Arg --> Trp (R719W). All three mutations are associated with hypertrophic cardiomyopathy and are located in the converter region of the myosin head domain. We determined several mechanical parameters of single skinned slow fibers isolated from Musculus soleus biopsies of hypertrophic cardiomyopathy patients and healthy controls. Major findings of this study for mutation R723G were i), a >40% increase in fiber stiffness in rigor with a 2.9-fold increase in stiffness per myosin head (S( *)(rigor R723G) = 0.84 pN/nm S( *)(rigor WT) = 0.29 pN/nm); and ii), a significant increase in force per head (F( *)(10 degrees C), 1.99 pN vs. 1.49 pN = 1.3-fold increase; F( *)(20 degrees C), 2.56 pN vs. 1.92 pN = 1.3-fold increase) as well as stiffness per head during isometric steady-state contraction (S( *)(active10 degrees C), 0.52 pN/nm vs. 0.28 pN/nm = 1.9-fold increase). Similar changes were found for mutation R719W (2.6-fold increase in S( *)(rigor); 1.8-fold increase in F( *)(10 degrees C), 1.6-fold in F( *)(20 degrees C); twofold increase in S( *)(active10 degrees C)). Changes in active cross-bridge cycling kinetics could not account for the increase in force and active stiffness. For the above estimates the previously determined fraction of mutated myosin in the biopsies was taken into account. Data for wild-type myosin of slow soleus muscle fibers support previous

  20. Rare earth elements upon assessment of reasons of the geophagy in Sikhote-Alin region (Russian Federation), Africa and other world regions.

    PubMed

    Panichev, Alexander M; Popov, Vladimir K; Chekryzhov, Igor Yu; Seryodkin, Ivan V; Stolyarova, Tatiana A; Zakusin, Sergey V; Sergievich, Alexandr A; Khoroshikh, Pavel P

    2016-12-01

    Rocks eaten by wild animals on the Bolshoy Shanduyskiy kudur in the Sikhote-Alin region (Russian Federation) are zeolite-clay mineral complexes-products of weathering of zeolitized vitric tuffs of rhyolite composition, deposited in aqueous medium within the volcanic caldera of about 55 million years ago. By composition of rock-forming oxides, the tuffs refer to high-potassium calc-alkaline series. In trace elements of most favorite kudurites of the Bolshoy Shanduyskiy kudur, there are significantly increased contents of most of rare earth elements (2-5 times in comparison with surrounding rocks). The results of our analysis of geological and geochemical data on kudurs and kudurites in another part of the Sikhote-Alin, as well as on other regions of the world (particularly, in Africa and Indonesia), taking into account new data on the prevalence of rare earth elements in living matter and their medical and biological properties, enable us to consider the version of causal connection of the geophagy with rare earth elements.

  1. Effects of Linker Length and Transient Secondary Structure Elements in the Intrinsically Disordered Notch RAM Region on Notch Signaling.

    PubMed

    Sherry, Kathryn P; Johnson, Scott E; Hatem, Christine L; Majumdar, Ananya; Barrick, Doug

    2015-11-06

    Formation of the bivalent interaction between the Notch intracellular domain (NICD) and the transcription factor CBF-1/RBP-j, Su(H), Lag-1 (CSL) is a key event in Notch signaling because it switches Notch-responsive genes from a repressed state to an activated state. Interaction of the intrinsically disordered RBP-j-associated molecule (RAM) region of NICD with CSL is thought to both disrupt binding of corepressor proteins to CSL and anchor NICD to CSL, promoting interaction of the ankyrin domain of NICD with CSL through an effective concentration mechanism. To quantify the role of disorder in the RAM linker region on the effective concentration enhancement of Notch transcriptional activation, we measured the effects of linker length variation on activation. The resulting activation profile has general features of a worm-like chain model for effective concentration. However, deviations from the model for short sequence deletions suggest that RAM contains sequence-specific structural elements that may be important for activation. Structural characterization of the RAM linker with sedimentation velocity analytical ultracentrifugation and NMR spectroscopy reveals that the linker is compact and contains three transient helices and two extended and dynamic regions. To test if these secondary structure elements are important for activation, we made sequence substitutions to change the secondary structure propensities of these elements and measured transcriptional activation of the resulting variants. Substitutions to two of these nonrandom elements (helix 2, extended region 1) have effects on activation, but these effects do not depend on the nature of the substituting residues. Thus, the primary sequences of these elements, but not their secondary structures, are influencing signaling.

  2. Selected translocation of plasmid genes: frequency and regional specificity of translocation of the Tn3 element.

    PubMed

    Kretschmer, P J; Cohen, S N

    1977-05-01

    A procedure is described that selects for the insertion of transposable antibiotic resistance elements in a variety of recipient replicons. The selected translocation procedure, which employs a plasmid having a temperature-sensitive defect in replication as a donor of transposable genetic elements, was used to investigate certain characteristics of the translocation process. Our results indicate that translocation of the Tn3 element from plasmid to plasmid occurs at a 10(3)- to 10(4)-times-higher frequency than from plasmid to chromosome. In both cases, continued accumulation of Tn3 on recipient genomes is prevented by development of an apparent equilibrium when only a small fraction of molecules in the recipient population contain Tn3. An alternative method for estimation of translocation frequency has shown that the translocation process is temperature sensitive and that its frequency is unaffected by the presence of host recA mutation. Insertions of Tn3 onto the 65 X 10(6)-dalton R6-5 plasmid in Escherichia coli are clustered on EcoRI fragments 3 (8 of 23 insertions) and 9 (7 of 23 insertions), which contain 12 and 5%, respectively, of the R6-5 genome. The occurrence of multiple insertions of Tn3 within EcoRI fragment 9, which contains the IS1 element and a terminus of the Tn4 element, is consistent with earlier evidence indicating that terminal deoxyribonucleic acid sequences of already present transposable elements may provide recognition sequences for subsequent illegitimate recombinational events.

  3. New cis-regulatory elements in the Rht-D1b locus region of wheat

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fifteen gene-containing BACs with accumulated length of 1.82-Mb from the Rht-D1b locus region weresequenced and compared in detail with the orthologous regions of rice, sorghum, and maize. Our results show that Rht-D1b represents a conserved genomic region as implied by high gene sequence identity...

  4. Discriminative study of a potato (Solanum tuberosum L.) cultivation region by measuring the stable isotope ratios of bio-elements.

    PubMed

    Chung, Ill-Min; Kim, Jae-Kwang; Jin, Yong-Ik; Oh, Yong-Taek; Prabakaran, Mayakrishnan; Youn, Kyoung-Jin; Kim, Seung-Hyun

    2016-12-01

    Compared to other foods, the use of common bio-elements to identify the geographical origin of potato remains limited. Thus, this study aimed to verify whether the cultivation regions of raw potato tubers could be determined by the stable isotope composition analysis of bio-elements. δ(13)CVPDB and δ(15)NAIR in potato were influenced by region and cultivar, whereas δ(18)OVSMOW and δ(34)SVCDT were only influenced by region (p<0.0001). A two-dimensional plot of δ(18)OVSMOW and δ(34)SVCDT effectively distinguished between high and low altitude regions, and also reliably discriminated Wanju, Haenam, and Boseong cultivars in low altitude regions. δ(34)SVCDT was the main component that was responsible for the separation of samples in the principal component analysis (eigenvector of -0.6209) and orthogonal projection to latent structure-discriminant analysis (VIP value of 1.0566). In conclusion, this study improves our understanding of how the isotope composition of potato tubers varies with respect to cultivation regions and cultivars.

  5. In which regions is breast-feeding safer from the impact of toxic elements from the environment?

    PubMed

    Cinar, Nursan; Ozdemir, Sami; Yucel, Oya; Ucar, Fatma

    2011-11-01

    Owing to its unique nutritional and immunological characteristics, breast milk is the most important food source for infants. But, children are at greater risk for exposure to environmental toxicants from breast milk. The aim of this study was to evaluate the influence of environmental pollution on essential and toxic element contents of breast milk and determine the risky locations in our population. This study was conducted on women who were breastfeeding (n=90). Milk samples were collected at three locations in Marmara region, Turkey: highly industrialized region highly affected by pollution, urbanized region moderately and rural area that is affected little. Breast milk samples (5 mL) were collected at approximately one month postpartum (mature milk). The concentrations of cadmium (Cd), cobalt (Co), chromium (Cr), copper (Cu), iron (Fe), manganese (Mn), nickel (Ni), lead (Pb) and zinc (Zn) in milk samples were compared to the milk samples coming from different locations.Lead, cadmium, nickel, chromium, iron and manganese levels in the breast milk are highest and engrossing especially in rural areas compared to the other regions but cobalt, copper, zinc levels are highest in highly industrial areas. The levels of essential and toxic elements in breast milk can vary in different regions. The levels presented in our study are above some countries' data albeit not at toxic levels. Because of global effects, environmental pollution is not the problem for industrializing regions only. Rural area also may not be safe for breastfeed babies.

  6. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  7. Elemental and organic carbon in aerosols over urbanized coastal region (southern Baltic Sea, Gdynia).

    PubMed

    Lewandowska, Anita; Falkowska, Lucyna; Murawiec, Dominika; Pryputniewicz, Dorota; Burska, Dorota; Bełdowska, Magdalena

    2010-09-15

    Studies on PM 10, total particulate matter (TSP), elemental carbon (EC) and organic carbon (OC) concentrations were carried out in the Polish coastal zone of the Baltic Sea, in urbanized Gdynia. The interaction between the land, the air and the sea was clearly observed. The highest concentrations of PM 10, TSP and both carbon fractions were noted in the air masses moving from southern and western Poland and Europe. The EC was generally of primary origin and its contribution to TSP and PM 10 mass was on average 2.3% and 3.7% respectively. Under low wind speed conditions local sources (traffic and industry) influenced increases in elemental carbon and PM 10 concentrations in Gdynia. Elemental carbon demonstrated a pronounced weekly cycle, yielding minimum values at the weekend and maximum values on Thursdays. The role of harbors and ship yards in creating high EC concentrations was clearly observed. Concentration of organic carbon was ten times higher than that of elemental carbon, and the average OC contribution to PM 10 mass was very high (31.6%). An inverse situation was observed when air masses were transported from over the Atlantic Ocean, the North Sea and the Baltic Sea. These clean air masses were characterized by the lowest concentrations of all analysed compounds. Obtained results for organic and elemental carbon fluxes showed that atmospheric aerosols can be treated, along with water run-off, as a carbon source for the coastal waters of the Baltic Sea. The enrichment of surface water was more effective in the case of organic carbon (0.27+/-0.19 mmol m(-2) d(-1)). Elemental carbon fluxes were one order of magnitude smaller, on average 0.03+/-0.04 mmol m(-2) d(-1). We suggest that in some situations atmospheric carbon input can explain up to 18% of total carbon fluxes into the Baltic coastal waters.

  8. CpG methylation at GATA elements in the regulatory region of CCR3 positively correlates with CCR3 transcription.

    PubMed

    Uhm, Tae Gi; Lee, Seol Kyung; Kim, Byung Soo; Kang, Jin Hyun; Park, Choon Sik; Rhim, Tai Youn; Chang, Hun Soo; Kim, Do Jin; Chung, Il Yup

    2012-04-30

    DNA methylation may regulate gene expression by restricting the access of transcription factors. We have previously demonstrated that GATA-1 regulates the transcription of the CCR3 gene by dynamically interacting with both positively and negatively acting GATA elements of high affinity binding in the proximal promoter region including exon 1. Exon 1 has three CpG sites, two of which are positioned at the negatively acting GATA elements. We hypothesized that the methylation of these two CpGs sites might preclude GATA-1 binding to the negatively acting GATA elements and, as a result, increase the availability of GATA-1 to the positively acting GATA element, thereby contributing to an increase in GATA-1-mediated transcription of the gene. To this end, we determined the methylation of the three CpG sites by bisulfate pyrosequencing in peripheral blood eosinophils, cord blood (CB)-derived eosinophils, PBMCs, and cell lines that vary in CCR3 mRNA expression. Our results demonstrated that methylation of CpG sites at the negatively acting GATA elements severely reduced GATA-1 binding and augmented transcription activity in vitro. In agreement, methylation of these CpG sites positively correlated with CCR3 mRNA expression in the primary cells and cell lines examined. Interestingly, methylation patterns of these three CpG sites in CB-derived eosinophils mostly resembled those in peripheral blood eosinophils. These results suggest that methylation of CpG sites at the GATA elements in the regulatory regions fine-tunes CCR3 transcription.

  9. Regional annulus fibre orientations used as a tool for the calibration of lumbar intervertebral disc finite element models.

    PubMed

    Malandrino, Andrea; Noailly, Jérôme; Lacroix, Damien

    2013-01-01

    The collagen network of the annulus fibrosus largely controls the functional biomechanics of the lumbar intervertebral discs (IVDs). Quantitative anatomical examinations have shown bundle orientation patterns, possibly coming from regional adaptations of the annulus mechanics. This study aimed to show that the regional differences in annulus mechanical behaviour could be reproduced by considering only fibre orientation changes. Using the finite element method, a lumbar annulus was modelled as a poro-hyperelastic material in which fibres were represented by a direction-dependent strain energy density term. Fibre orientations were calibrated to reproduce the annulus tensile behaviours measured for four different regions: posterior outer, anterior outer, posterior inner and anterior inner. The back-calculated fibre angles and regional patterns as well as the global disc behaviour were comparable with anatomical descriptions reported in the literature. It was concluded that annulus fibre variations might be an effective tool to calibrate lumbar spine IVD and segment models.

  10. Hotspots for Vitamin-Steroid-Thyroid Hormone Response Elements Within Switch Regions of Immunoglobulin Heavy Chain Loci Predict a Direct Influence of Vitamins and Hormones on B Cell Class Switch Recombination.

    PubMed

    Hurwitz, Julia L; Penkert, Rhiannon R; Xu, Beisi; Fan, Yiping; Partridge, Janet F; Maul, Robert W; Gearhart, Patricia J

    2016-03-01

    Vitamin A deficiencies are common throughout the world and have a significant negative influence on immune protection against viral infections. Mouse models demonstrate that the production of IgA, a first line of defense against viruses at mucosal sites, is inhibited in the context of vitamin A deficiency. In vitro, the addition of vitamin A to activated B cells can enhance IgA expression, but downregulate IgE. Previous reports have demonstrated that vitamin A modifies cytokine patterns, and in so doing may influence antibody isotype expression by an indirect mechanism. However, we have now discovered hundreds of potential response elements among Sμ, Sɛ, and Sα switch sites within immunoglobulin heavy chain loci. These hotspots appear in both mouse and human loci and include targets for vitamin receptors and related proteins (e.g., estrogen receptors) in the nuclear receptor superfamily. Full response elements with direct repeats are relatively infrequent or absent in Sγ regions although half-sites are present. Based on these results, we pose a hypothesis that nuclear receptors have a direct effect on the immunoglobulin heavy chain class switch recombination event. We propose that vitamin A may alter S site accessibility to activation-induced deaminase and nonhomologous end-joining machinery, thereby influencing the isotype switch, antibody production, and protection against viral infections at mucosal sites.

  11. Distinct 3'-untranslated region elements regulate stage-specific mRNA accumulation and translation in Leishmania.

    PubMed

    McNicoll, François; Müller, Michaela; Cloutier, Serge; Boilard, Nathalie; Rochette, Annie; Dubé, Marthe; Papadopoulou, Barbara

    2005-10-21

    We recently characterized a large developmentally regulated gene family in Leishmania encoding the amastin surface proteins. While studying the regulation of these genes, we identified a region of 770 nucleotides (nt) within the 2055-nt 3'-untranslated region (3'-UTR) that regulates stage-specific gene expression at the level of translation. An intriguing feature of this 3'-UTR regulatory region is the presence of a approximately 450-nt element that is highly conserved among several Leishmania mRNAs. Here we show, using a luciferase reporter system and polysome profiling experiments, that the 450-nt element stimulates translation initiation of the amastin mRNA in response to heat shock, which is the main environmental change that the parasite encounters upon its entry into the mammalian host. Deletional analyses depicted a second region of approximately 100 nucleotides located at the 3'-end of several amastin transcripts, which also activates translation in response to elevated temperature. Both 3'-UTR regulatory elements act in an additive manner to stimulate amastin mRNA translation. In addition, we show that acidic pH encountered in the phagolysosomes of macrophages, the location of parasitic differentiation, triggers the accumulation of amastin transcripts by a distinct mechanism that is independent of the 450-nt and 100-nt elements. Overall, these important findings support the notion that stage-specific post-transcriptional regulation of the amastin mRNAs in Leishmania is complex and involves the coordination of distinct mechanisms controlling mRNA stability and translation that are independently triggered by key environmental signals inducing differentiation of the parasite within macrophages.

  12. Influence of Regional Difference in Bone Mineral Density on Hip Fracture Site in Elderly Females by Finite Element Analysis.

    PubMed

    Lin, Z L; Li, P F; Pang, Z H; Zheng, X H; Huang, F; Xu, H H; Li, Q L

    2015-11-01

    Hip fracture is a kind of osteoporotic fractures in elderly patients. Its important monitoring indicator is to measure bone mineral density (BMD) using DXA. The stress characteristics and material distribution in different parts of the bones can be well simulated by three-dimensional finite element analysis. Our previous studies have demonstrated a linear positive correlation between clinical BMD and the density of three-dimensional finite element model of the femur. However, the correlation between the density variation between intertrochanteric region and collum femoris region of the model and the fracture site has not been studied yet. The present study intends to investigate whether the regional difference in the density of three-dimensional finite element model of the femur can be used to predict hip fracture site in elderly females. The CT data of both hip joints were collected from 16 cases of elderly female patients with hip fractures. Mimics 15.01 software was used to reconstruct the model of proximal femur on the healthy side. Ten kinds of material properties were assigned. In Abaqus 6.12 software, the collum femoris region and intertrochanteric region were, respectively, drawn for calculating the corresponding regional density of the model, followed by prediction of hip fracture site and final comparison with factual fracture site. The intertrochanteric region/collum femoris region density was [(1.20 ± 0.02) × 10(6)] on the fracture site and [(1.22 ± 0.03) × 10(6)] on the non-fracture site, and the difference was statistically significant (P = 0.03). Among 16 established models of proximal femur on the healthy side, 14 models were consistent with the actual fracture sites, one model was inconsistent, and one model was unpredictable, with the coincidence rate of 87.5 %. The intertrochanteric region or collum femoris region with lower BMD is more prone to hip fracture of the type on the corresponding site.

  13. Spatio-temporal flow analysis in bileaflet heart valve hinge regions: potential analysis for blood element damage.

    PubMed

    Simon, Hélène A; Dasi, Lakshmi P; Leo, Hwa-Liang; Yoganathan, Ajit P

    2007-08-01

    Point-wise velocity measurements have been traditionally acquired to estimate blood damage potential induced by prosthetic heart valves with emphasis on peak values of velocity magnitude and Reynolds stresses. However, the inherently Lagrangian nature of platelet activation and hemolysis makes such measurements of limited predictive value. This study provides a refined fluid mechanical analysis, including blood element paths and stress exposure times, of the hinge flows of a CarboMedics bileaflet mechanical heart valve placed under both mitral and aortic conditions and a St Jude Medical bileaflet valve placed under aortic conditions. The hinge area was partitioned into characteristic regions based on dominant flow structures and spatio-temporal averaging was performed on the measured velocities and Reynolds shear stresses to estimate the average bulk stresses acting on blood elements transiting through the hinge. A first-order estimate of viscous stress levels and exposure times were computed. Both forward and leakage flow phases were characterized in each partition by dynamic flows dependent on subtle leaflet movements and transvalvular pressure fluctuations. Blood elements trapped in recirculation regions may experience exposure times as long as the entire forward flow phase duration. Most calculated stresses were below the accepted blood damage threshold. Estimates of the stress levels indicate that the flow conditions within the boundary layers near the hinge and leaflet walls may be more detrimental to blood cells than bulk flow conditions, while recirculation regions may promote thrombus buildup.

  14. CisMols Analyzer: identification of compositionally similar cis-element clusters in ortholog conserved regions of coordinately expressed genes

    PubMed Central

    Jegga, Anil G.; Gupta, Ashima; Gowrisankar, Sivakumar; Deshmukh, Mrunal A.; Connolly, Steven; Finley, Kevin; Aronow, Bruce J.

    2005-01-01

    Combinatorial interactions of sequence-specific trans-acting factors with localized genomic cis-element clusters are the principal mechanism for regulating tissue-specific and developmental gene expression. With the emergence of expanding numbers of genome-wide expression analyses, the identification of the cis-elements responsible for specific patterns of transcriptional regulation represents a critical area of investigation. Computational methods for the identification of functional cis-regulatory modules are difficult to devise, principally because of the short length and degenerate nature of individual cis-element binding sites and the inherent complexity that is generated by combinatorial interactions within cis-clusters. Filtering candidate cis-element clusters based on phylogenetic conservation is helpful for an individual ortholog gene pair, but combining data from cis-conservation and coordinate expression across multiple genes is a more difficult problem. To approach this, we have extended an ortholog gene-pair database with additional analytical architecture to allow for the analysis and identification of maximal numbers of compositionally similar and phylogenetically conserved cis-regulatory element clusters from a list of user-selected genes. The system has been successfully tested with a series of functionally related and microarray profile-based co-expressed ortholog pairs of promoters and genes using known regulatory regions as training sets and co-expressed genes in the olfactory and immunohematologic systems as test sets. CisMols Analyzer is accessible via a Web interface at . PMID:15980500

  15. To Join or Not to Join: School Counselors as a Case Study in Professional Membership

    ERIC Educational Resources Information Center

    Bauman, Sheri

    2008-01-01

    School counselors were surveyed regarding their choice to join or not join their professional organization. Members and nonmembers differed on the following: whether participants' graduate program emphasized professional membership, membership status of colleagues, the belief that professional organizations advance the field, and the belief that…

  16. Environmental Controls on River Assemblages at the Regional Scale: An Application of the Elements of Metacommunity Structure Framework

    PubMed Central

    Tonkin, Jonathan D.; Sundermann, Andrea

    2015-01-01

    Understanding factors that structure regional biodiversity is important for linking ecological and biogeographic processes. Our objective was to explore regional patterns in riverine benthic invertebrate assemblages in relation to their broad positioning along the river network and examine differences in composition, biodiversity (alpha and beta diversity), and environmental drivers. We up-scaled methods used to examine patterns in metacommunity structure (Elements of Metacommunity Structure framework) to examine faunal distribution patterns at the regional extent for 168 low-mountain stream invertebrate assemblages in central Germany. We then identified the most influential environmental factors using boosted regression trees. Faunal composition patterns were compartmentalised (Clementsian or quasi-Clementsian), with little difference from headwaters to large rivers, potentially reflecting the regional scale of the study, by crossing major catchment boundaries and incorporating different species pools. While idealised structures did not vary, environmental drivers of composition varied considerably between river sections and with alpha diversity. Prediction was substantially weaker, and the importance of space was greater, in large rivers compared to other sections suggesting a weakening in species sorting downstream. Further, there was a stronger transition in composition than for alpha diversity downstream. The stronger links with regional faunal composition than with richness further emphasises the importance of considering the alternative ways in which anthropogenic stressors are operating to affect biodiversity patterns. Our approach allowed bridging the gap between local (or metacommunity) and regional scales, providing key insights into drivers of regional biodiversity patterns. PMID:26270550

  17. Joining of porous silicon carbide bodies

    DOEpatents

    Bates, Carl H.; Couhig, John T.; Pelletier, Paul J.

    1990-05-01

    A method of joining two porous bodies of silicon carbide is disclosed. It entails utilizing an aqueous slip of a similar silicon carbide as was used to form the porous bodies, including the sintering aids, and a binder to initially join the porous bodies together. Then the composite structure is subjected to cold isostatic pressing to form a joint having good handling strength. Then the composite structure is subjected to pressureless sintering to form the final strong bond. Optionally, after the sintering the structure is subjected to hot isostatic pressing to further improve the joint and densify the structure. The result is a composite structure in which the joint is almost indistinguishable from the silicon carbide pieces which it joins.

  18. Joining Techniques for Ferritic ODS Alloys

    SciTech Connect

    V.G. Krishnardula; V.G. Krishnardula; D.E. Clark; T.C. Totemeier

    2005-06-01

    This report presents results of research on advanced joining techniques for ferritic oxide-dispersion strengthened alloys MA956 and PM2000. The joining techniques studied were resistance pressure welding (also known as pressure forge welding), transient liquid phase bonding, and diffusion bonding. All techniques were shown to produce sound joints in fine-grained, unrecrystallized alloys. Post-bond heat treatment to produce a coarse-grained, recrystallized microstructure resulted in grain growth across the bondline for transient liquid phase and diffusion bonds, giving microstructures essentially identical to that of the parent alloy in the recrystallized condition. The effects of bond orientation, boron interlayer thickness, and bonding parameters are discussed for transient liquid phase and diffusion bonding. The report concludes with a brief discussion of ODS joining techniques and their applicability to GEN IV reactor systems.

  19. Variation in elemental intensities among teeth and between pre- and postnatal regions of enamel.

    PubMed

    Dolphin, Alexis E; Goodman, Alan H; Amarasiriwardena, Dulasiri D

    2005-12-01

    Microspatial analyses of the trace element composition of dental enamel are made possible using laser ablation-inductively coupled plasma-mass spectrometry (LA-ICP-MS). Fine spatial resolution, multielement capabilities, and minimal sample destruction make this technique particularly well-suited for documenting the distribution of elements in sequentially calcifying layers of enamel. Because deciduous enamel forms from week 13 in utero up to 9 months postnatally (thereafter essentially becoming inert), the application of LA-ICP-MS allows for the retrospective measurement of prenatal and early postnatal trace-element uptake during a critical period of child development. In this study, we compared intra- and intertooth intensities of 25Mg, 57Fe, 66Zn, 68Zn, 88Sr, 138Ba, and 208Pb via LA-ICP-MS of 38 exfoliated deciduous incisors and canines donated by 36 participants in the Solís Valley Mexico Nutrition Collaborative Research Support Program (NCRSP). Pre- and postnatal comparisons within teeth showed significant increases (P < 0.001) and greater variation in the abundance of all isotopes in postnatal enamel, with the exception of a decrease in 25Mg (P < 0.001) and constant values for 88Sr (P = 0.681). Conversely, comparisons by tooth type and mouth quadrant revealed few significant differences between teeth of the same individual. We argue that more variation in the trace element composition of teeth occurs across developmental areas within a tooth than among different teeth of the same person. This study further demonstrates that sequentially calcifying areas of enamel have different chemical concentrations. The results support the use of microspatial analyses of enamel for understanding changes in nutrition, pollution, and residence.

  20. The FSHD region on human chromosome 4q35 contains potential coding regions among pseudogenes and a high density of repeat elements.

    PubMed

    van Geel, M; Heather, L J; Lyle, R; Hewitt, J E; Frants, R R; de Jong, P J

    1999-10-01

    The distal end of chromosome 4q contains the locus involved in facioscapulohumeral muscular dystrophy (FSHD1). Specific genomic deletions within a tandem DNA repeat (D4Z4) are associated with the disease status, but no causal genes have yet been discovered. In a systematic search for genes, a 161-kb stretch of genomic DNA proximal to D4Z4 was sequenced, analyzed for homologies, and subjected to gene prediction programs. A major fraction (45%) of the subtelomeric region is composed of repeat sequences attributable mainly to LINE-1 elements. Apart from the previously identified FRG1 and TUB4q sequences, several additional potential coding regions were identified by analyzing the sequence with exon prediction programs. So far, we have been unable to demonstrate transcripts by RT-PCR or cDNA library hybridization. However, several retrotransposed pseudogenes were identified. The high density of pseudogenes and repeat elements is consistent with the subtelomeric location of this region and explains why previous transcript identification studies have been problematic.

  1. Natural trace element enrichment in fishes from a volcanic and tectonically active region (Azores archipelago)

    NASA Astrophysics Data System (ADS)

    Raimundo, Joana; Vale, Carlos; Caetano, Miguel; Giacomello, Eva; Anes, Bárbara; Menezes, Gui M.

    2013-12-01

    Seamounts, in general, are thought to support high biodiversity and special biological communities. They have been targeted by commercial fishing for demersal and pelagic fish species due to the occurrence of large aggregations in mid- and deep-water. Specimens of Phycis phycis, Helicolenus dactylopterus, Pontinus kuhlii, Beryx splendens, Beryx decadactylus, Etmopterus pusillus, Mora moro, Pagellus bogaraveo, Deania profundorum, Scomber colias and Trachurus picturatus were collected at the Condor seamount and on the slopes of Faial and Pico islands of Azores archipelago. Concentrations of V, Cr, Mn, Co, Ni, Cu, Zn, As, Se, Cd and Pb were determined in muscle and liver of each individual. Values of the 11 trace elements in the two tissues of the benthopelagic and benthic specimens, from the two surveyed areas, presented a significant inter-specific variation. In general, levels were lower in muscle than in liver, and negative relations between weight and Co, Mn, Zn, As, Cd and Pb concentrations in muscle and liver of three species were found. Pagellus bogaraveo, S. colias and T. picturatus presented enhanced elemental concentrations in liver, particularly of Cd. The extremely high storage of this potentially toxic element suggests a response to high uptake of Cd and the existence of an additional natural source of Cd to the environment.

  2. Nonlinear Aeroelastic Analysis of Joined-Wing Configurations

    NASA Astrophysics Data System (ADS)

    Cavallaro, Rauno

    Aeroelastic design of joined-wing configurations is yet a relatively unexplored topic which poses several difficulties. Due to the overconstrained nature of the system combined with structural geometric nonlinearities, the behavior of Joined Wings is often counterintuitive and presents challenges not seen in standard layouts. In particular, instability observed on detailed aircraft models but never thoroughly investigated, is here studied with the aid of a theoretical/computational framework. Snap-type of instabilities are shown for both pure structural and aeroelastic cases. The concept of snap-divergence is introduced to clearly identify the true aeroelastic instability, as opposed to the usual aeroelastic divergence evaluated through eigenvalue approach. Multi-stable regions and isola-type of bifurcations are possible characterizations of the nonlinear response of Joined Wings, and may lead to branch-jumping phenomena well below nominal critical load condition. Within this picture, sensitivity to (unavoidable) manufacturing defects could have potential catastrophic effects. The phenomena studied in this work suggest that the design process for Joined Wings needs to be revisited and should focus, when instability is concerned, on nonlinear post-critical analysis since linear methods may provide wrong trend indications and also hide potentially catastrophical situations. Dynamic aeroelastic analyses are also performed. Flutter occurrence is critically analyzed with frequency and time-domain capabilities. Sensitivity to different-fidelity aeroelastic modeling (fluid-structure interface algorithm, aerodynamic solvers) is assessed showing that, for some configurations, wake modeling (rigid versus free) has a strong impact on the results. Post-flutter regimes are also explored. Limit cycle oscillations are observed, followed, in some cases, by flip bifurcations (period doubling) and loss of periodicity of the solution. Aeroelastic analyses are then carried out on a

  3. Fluxing agent for metal cast joining

    DOEpatents

    Gunkel, Ronald W.; Podey, Larry L.; Meyer, Thomas N.

    2002-11-05

    A method of joining an aluminum cast member to an aluminum component. The method includes the steps of coating a surface of an aluminum component with flux comprising cesium fluoride, placing the flux coated component in a mold, filling the mold with molten aluminum alloy, and allowing the molten aluminum alloy to solidify thereby joining a cast member to the aluminum component. The flux preferably includes aluminum fluoride and alumina. A particularly preferred flux includes about 60 wt. % CsF, about 30 wt. % AlF.sub.3, and about 10 wt. % Al.sub.2 O.sub.3.

  4. Endothelin-1 expression is strongly repressed by AU-rich elements in the 3'-untranslated region of the gene.

    PubMed

    Reimunde, Francisco M; Castañares, Cristina; Redondo-Horcajo, Mariano; Lamas, Santiago; Rodríguez-Pascual, Fernando

    2005-05-01

    The regulation of the synthesis of the endothelial-derived vasoconstrictor ET-1 (endothelin-1) is a complex process that occurs mainly at the mRNA level. Transcription of the gene accounts for an important part of the regulation of expression, as already described for different modulators such as the cytokine TGF-beta (transforming growth factor-beta). However, very little is known about mechanisms governing ET-1 expression at the post-transcriptional level. The aim of the present study was to investigate the regulation of the ET-1 expression at this level. Since the 3'-UTR (3'-untranslated region) of mRNAs commonly contains genetic determinants for the post-transcriptional control of gene expression, we focused on the potential role of the 3'-UTR of ET-1 mRNA. Experiments performed with luciferase reporter constructs containing the 3'-UTR showed that this region exerts a potent destabilizing effect. Deletional analyses allowed us to locate this activity within a region at positions 924-1127. Some (but not all) of the AREs (AU-rich elements) present in this region were found to be essential for this mRNA-destabilizing activity. We also present evidence that cytosolic proteins from endothelial cells interact specifically with these RNA elements, and that a close correlation exists between the ability of the AREs to destabilize ET-1 mRNA and the binding of proteins to these elements. Our results are compatible with the existence of a strong repressional control of ET-1 expression mediated by destabilization of the mRNA exerted through the interaction of specific cytosolic proteins with AREs present in the 3'-UTR of the gene.

  5. A Meiotic Drive Element in the Maize Pathogen Fusarium verticillioides Is Located Within a 102 kb Region of Chromosome V

    PubMed Central

    Pyle, Jay; Patel, Tejas; Merrill, Brianna; Nsokoshi, Chabu; McCall, Morgan; Proctor, Robert H.; Brown, Daren W.; Hammond, Thomas M.

    2016-01-01

    Fusarium verticillioides is an agriculturally important fungus because of its association with maize and its propensity to contaminate grain with toxic compounds. Some isolates of the fungus harbor a meiotic drive element known as Spore killer (SkK) that causes nearly all surviving meiotic progeny from an SkK × Spore killer-susceptible (SkS) cross to inherit the SkK allele. SkK has been mapped to chromosome V but the genetic element responsible for meiotic drive has yet to be identified. In this study, we used cleaved amplified polymorphic sequence markers to genotype individual progeny from an SkK × SkS mapping population. We also sequenced the genomes of three progeny from the mapping population to determine their single nucleotide polymorphisms. These techniques allowed us to refine the location of SkK to a contiguous 102 kb interval of chromosome V, herein referred to as the Sk region. Relative to SkS genotypes, SkK genotypes have one extra gene within this region for a total of 42 genes. The additional gene in SkK genotypes, herein named SKC1 for Spore Killer Candidate 1, is the most highly expressed gene from the Sk region during early stages of sexual development. The Sk region also has three hyper-variable regions, the longest of which includes SKC1. The possibility that SKC1, or another gene from the Sk region, is an essential component of meiotic drive and spore killing is discussed. PMID:27317777

  6. Regional PIXE facility at Chandigarh (India) and Trace Element Analysis of Aerosol and Bio-medical Samples

    NASA Astrophysics Data System (ADS)

    Govil, I. M.

    2009-03-01

    A regional Proton induced X-ray Emission (PIXE) facility is newly developed using 3 Mev Proton beam from Variable Energy Cyclotron, Panjab University, Chandigarh (India). A new target chamber has been designed to cater for Proton Induced Gamma Emission (PIGE) and Rutherford Back Scattering (RBS) along with PIXE measurements. The HPGe x-ray detector, the Ge (Li) gamma-ray detector and a silicon surface barrier (SSB) detector can be mounted simultaneously in the chamber for this purpose. A remotely controlled stepper motor is provided to move the target wheel holding 12/24 samples at a time. This facility is now routinely used for the detection of trace elements in the aerosol, medical and forensic science samples. The paper presents the analysis of Aerosol samples collected from highly polluted steel city of Mandi Govindgarh in Punjab state and relatively clean city of Jammu in Jammu & Kashmir region. The results from the analysis of these samples show some basic differences in the trace element profile of the two cities. The paper also describes the trace element analysis of fly ash in the vicinity of Ropar Thermal Power plant in Punjab. The scope of this study was to determine the concentration and composition of atmospheric particulate matter (PM) in the vicinity of coal-fired thermal power plants in India. The data taken for the Bio-medical samples are also discussed.

  7. Trace elements in the Mississippi River Delta outflow region: Behavior at high discharge

    SciTech Connect

    Shiller, A.M. ); Boyle, E.A. )

    1991-11-01

    Samples for dissolved trace element analysis were collected in surface waters of the plume of the Mississippi River during a period of high river discharge. These field data are compared with results of laboratory mixing experiments. The studies show that Cu, Ni, and Mo are largely unreactive in the plume. Surprisingly, Fe also appears to show little reactivity; the pronounced flocculation removal of Fe frequently observed in other estuaries is not seen in this system. This difference may be a consequence of the alkaline nature of the Mississippi which results in low dissolved Fe concentrations in the river (<50 nmol/kg). Zinc, another particle-reactive element, also shows little reactivity. This lack of reactivity for Zn, as well as Cu and Ni, is partly a result of the short residence time of plume waters in shallow areas affected by sedimentary interactions. The chromium distribution shows apparent non-conservative behavior indicative of estuarine removal; however, temporal variations in river concentrations is a more likely explanation for this behavior. For some of the elements, complex distributions occur as a consequence of the interplay of physical-chemical and/or biological processes with the dynamic mixing regime. For Cd, desorption from the suspended load plays a major role in determining the distribution. However, sedimentary input may also play a role in the spatial variability of Cd. For V, biological uptake in the plume exerts a strong influence on its distribution. At the time of this study, uptake was large enough to consume both the river flux of V as well as a substantial amount of vanadium supplied by the ocean.

  8. The REgolith X-Ray Imaging Spectrometer (REXIS) for OSIRIS-REx: identifying regional elemental enrichment on asteroids

    NASA Astrophysics Data System (ADS)

    Allen, Branden; Grindlay, Jonathan; Hong, Jaesub; Binzel, Richard P.; Masterson, Rebecca; Inamdar, Niraj K.; Chodas, Mark; Smith, Matthew W.; Bautz, Marshall W.; Kissel, Steven E.; Villasenor, Joel; Oprescu, Miruna; Induni, Nicholas

    2013-09-01

    The OSIRIS-REx Mission was selected under the NASA New Frontiers program and is scheduled for launch in September of 2016 for a rendezvous with, and collection of a sample from the surface of asteroid Bennu in 2019. 101955 Bennu (previously 1999 RQ36) is an Apollo (near-Earth) asteroid originally discovered by the LINEAR project in 1999 which has since been classified as a potentially hazardous near-Earth object. The REgolith X-Ray Imaging Spectrometer (REXIS) was proposed jointly by MIT and Harvard and was subsequently accepted as a student led instrument for the determination of the elemental composition of the asteroid's surface as well as the surface distribution of select elements through solar induced X-ray fluorescence. REXIS consists of a detector plane that contains 4 X-ray CCDs integrated into a wide field coded aperture telescope with a focal length of 20 em for the detection of regions with enhanced abundance in key elements at 50 m scales. Elemental surface distributions of approximately 50-200 m scales can be detected using the instrument as a simple collimator. An overview of the observation strategy of the REXIS instrument and expected performance are presented here.

  9. [Determination of metal elements in whole Tetraena Mongolia Maxim from West Erdos Region of Inner Mongolia by ICP-AES].

    PubMed

    Liu, Ying; Li, Jing-feng; Feng, Jin-zhao

    2007-10-01

    The sand storm has become a global environmental problem. Since desert woody plants have many special biological characteristics, they play an important role in improving ecological environment and so on. In the present paper, the contents of ordinary and trace metal elements in whole Tetraena Mongolia Maxim, which only exists in West Erdos Region of Inner Mongolia in the world and is protected and endangered national second-class species, were determined by ICP-AES technique and compared with other desert woody plants. The results indicated that the ordinary elements Ca, K, Mg, Na and Al and the trace elements essential to plant vital activities, such as Fe, Mn, Cu and Zn show different content orders in different parts of the plant. For example, the content orders are Ca>Na>Mg>Al>K>Fe>Cu>Mn>Zn for both main root and old root. In twig and leaf, however, the order is Ca>Na>Mg>Al>K>Fe>Mn>Cu>Zn, while in fibrous root the order is K>Ca>Na>Mg>Al>Fe>Cu>Mn>Zn. The element contents of Mn and Zn are lower than the average content of terrestrial plants. The recovery ratio obtained by standard addition method ranged between 94.98% and 120.0%, and its RSD was lower than 3. 5% with a good precision. The results provide theoretical directions for protecting and exploiting vegetable resource of the endangered and wilding plant.

  10. Trace element geochemistry of Jurassic coals from Eastern Black Sea Region, NE-Turkey

    SciTech Connect

    Cebi, F.H.; Korkmaz, S.; Akcay, M.

    2009-07-01

    The majority of coal deposits in the world are of Carboniferous and Tertiary age but Jurassic coals are seldom present. They are also exposed in northern Turkey and occur both at the lower and upper sections of the Liassic-Dogger volcanic- and volcani-clastic series. The coals at the base of the Jurassic units are characterized by higher Ba, Th, Zr, and Cr-Ni and lower S values than those at the top of the units, indicating, in general, laterally consistent trace element contents. The vertical distribution of trace elements in individual coal seams is also rather consistent. The B contents of coals from the Godul and Norsun areas vary from 1.5 to 4.3 ppm whereas those from the Alansa area are in the range of 95 to 138 ppm. This suggests that the coals in the Godul and Norsun areas were deposited in a swamp environment inundated by the sea from time to time, whereas coals of the Alansa were deposited in a saline environment.

  11. A case of small round cell tumor of the thoracopulmonary region with myogenic and neurogenic elements.

    PubMed

    Goji, J; Sano, K; Murakami, R; Nakamura, H; Ninomiya, M; Ito, H

    1992-02-01

    We here report a unique case of a young boy with an intrathoracic tumor which consisted of neurogenic and myogenic elements. The initial pathological diagnosis was alveolar rhabdomyosarcoma. The tumor tissue from surgical resection was composed of three parts, each showing a different histological appearance, i.e. a monotonous small cell area, an alveolar area, and an area consisting of pleomorphic rhabdomyoblasts. The small round cells in the monotonous area were immunoreactive with the antibodies for Leu7, neuron-specific enolase (NSE), neurofilament proteins (NFP), and beta 2 microglobulin, but not with the antibody for desmin. These cells also had dense core granules. The tumor cells in the alveolar area were immunoreactive with the antibodies for Leu7 and desmin, but not with the antibody for NFP. Pleomorphic rhabdomyoblasts were immunoreactive with the antibody for desmin, but not with the antibodies for Leu7 and NFP. These findings imply that this tumor consisted of neurogenic and myogenic elements and is considered to be a special type of rhabdomyosarcoma.

  12. Measurements of L to M shell vacancy transfer probabilities for the elements in the atomic region 70 <= Z <= 92

    NASA Astrophysics Data System (ADS)

    Puri, S.; Mehta, D.; Chand, B.; Singh, Nirmal; Trehan, P. N.

    1993-05-01

    The probabilities for vacancy transfer from L to M shell, ¯gh LM, are deduced for 15 elements in the atomic region 70 ≤ Z ≤ 92 by measuring the M X-ray yields from the targets excited by 5.96 and 22.6 keV incident photons, i.e. below and above the L-edge of the elements and using the theoretical L and M shell photoionisation cross-sections. These results are compared with the theoretical values based on the relativistic Dirac-Hartree-Slater (RDHS) and the nonrelativistic approximate Herman-Skillman (AHS) calculations. From the comparison, it is concluded that the onset of L 1-L 3M 5 Coster-Kronig transition occurs at Z = 75 as predicted by the RDHS model based Coster-Kronig transition energy calculations.

  13. BLG-e1 - a novel regulatory element in the distal region of the beta-lactoglobulin gene promoter.

    PubMed

    Reichenstein, Moshe; German, Tania; Barash, Itamar

    2005-04-11

    beta-Lactoglobulin (BLG) is a major ruminant milk protein. A regulatory element, termed BLG-e1, was defined in the distal region of the ovine BLG gene promoter. This 299-bp element lacks the established cis-regulatory sequences that affect milk-protein gene expression. Nevertheless, it alters the binding of downstream BLG sequences to histone H4 and the sensitivity of the histone-DNA complexes to trichostatin A treatment. In mammary cells cultured under favorable lactogenic conditions, BLG-e1 acts as a potent, position-independent silencer of BLG/luciferase expression, and similarly affects the promoter activity of the mouse whey acidic protein gene. Intragenic sequences upstream of BLG exon 2 reverse the silencing effect of BLG-e1 in vitro and in transgenic mice.

  14. Explosive Joining for Nuclear-Reactor Repair

    NASA Technical Reports Server (NTRS)

    Bement, L. J.; Bailey, J. W.

    1983-01-01

    In explosive joining technique, adapter flange from fuel channel machined to incorporate a V-notch interface. Ribbon explosive, 1/2 inch (1.3 cm) in width, drives V-notched wall of adapter into bellows assembly, producing atomic-level metallurgical bond. Ribbon charge yields joint with double parent metal strength.

  15. Flexible coiled spline securely joins mating cylinders

    NASA Technical Reports Server (NTRS)

    Coppernol, R. W.

    1966-01-01

    Mating cylindrical members are joined by spline to form an integral structure. The spline is made of tightly coiled, high tensile-strength steel spiral wire that fits a groove between the mating members. It provides a continuous bearing surface for axial thrust between the members.

  16. Deformation and Forming of Joined Materials

    SciTech Connect

    Carsley, John; Hovanski, Yuri; Clarke, Kester D.; Krajewski, Paul E.

    2014-09-23

    Introductory article to a set of invited papers from the TMS committee on shaping and forming. This paper introduces a set of papers that were prepared to discussing the deformation and forming of joined materials, and to announce an upcoming symposium at the 2015 MS&T meeting in Columbus Ohio.

  17. Microwave joining of SiC

    SciTech Connect

    Silberglitt, R.; Ahmad, I.; Black, W.M.

    1995-05-01

    The purpose of this work is to optimize the properties of SiC-SiC joints made using microwave energy. The current focus is on optimization of time-temperature profiles, production of SiC from chemical precursors, and design of new applicators for joining of long tubes.

  18. METHOD FOR JOINING ALUMINUM TO STAINLESS STEEL

    DOEpatents

    Lemon, L.C.

    1960-05-24

    Aluminum may be joined to stainless steel without the use of flux by tinning the aluminum with a tin solder containing 1% silver and 1% lead, tinning the stainless steel with a 50% lead 50% tin solder, and then sweating the tinned surfaces together.

  19. Friction Stir & Ultrasonic Solid State Joining Magnesium

    SciTech Connect

    Grant, Glenn J.; Hovanski, Yuri; Santella, M. L.

    2009-12-30

    Solid state joining between automotive sheet steel and magnesium alloys was investigated. Both friction stir welding and ultrasonic welding were utilized to study the potential for creating structural bonds between these dissimilar materials. A detailed investigation into the joint characteristics was undertaken including an evaluation of joint strength, microstructure, chemical structures, and alloy formation.

  20. Joining Forces: Working with Spirituality in Organisations.

    ERIC Educational Resources Information Center

    Snell, Robin; And Others

    1991-01-01

    Includes "Joining Forces" (Lindamood); "Spiritual Dimension of the Learning Organisation" (Hawkins); "Management--A 'Spiritual' Foundation?" (Nevard); "Hermit in Organisations" (Murray); "Towards a Spiritual Perspective on Behavior at Work" (Henson); "On Uncertainty" (Adlam); "Spirituality in Organisations" (Lee); "Ecological Organisation" (Conn);…

  1. New Trio Launches to Join Expedition 33

    NASA Video Gallery

    Three new crew members are on their way to join their Expedition 33 crewmates onboard the International Space Station. They launched aboard the Soyuz TMA-06M spacecraft at 6:51 a.m. EDT (5:51 p.m. ...

  2. Advanced Joining Technology: Simple, Strong, and Secure

    NASA Technical Reports Server (NTRS)

    2005-01-01

    The space-age materials that NASA employs in its spacecraft and satellites have different attributes than the building materials that can work for Earthly uses. These materials do not behave like the typical construction materials, and therefore, require new methods for construction. Work done at NASA s Langley Research Center in the realm of active solder joining has led to a new, self-bonding solder that enables high conductivity, as well as the metallic joining of carbon and ceramic materials to a wide range of metals. The original work involved evaluating high- and low-temperature joining technologies for joining carbon composite structures for use in thermal management and reusable launch vehicles. The initial plan for this innovation was to lower the weight of battery packs in satellites. It was a success. NASA scientists found use for this technology in fabricating a thermal management package for battery compartments in the Earth Observing System (EOS) satellites, but it is also being used by the Agency for space radiator panels. Because it is light, simple to use, and economical, NASA will likely find other uses for this solder, just as outside of the Space Agency, this unique bond is finding many practical applications.

  3. Cap-independent translation of poliovirus mRNA is conferred by sequence elements within the 5' noncoding region

    SciTech Connect

    Pelletier, J.; Kaplan, G.; Racaniello, V.R.; Sonenberg, N.

    1988-03-01

    Poliovirus polysomal RNA is naturally uncapped, and as such, its translation must bypass any 5' cap-dependent ribosome recognition event. To elucidate the manner by which poliovirus mRNA is translated, the authors determined the translational efficiencies of a series of deletion mutants within the 5' noncoding region of the mRNA. They found striking differences in translatability among the altered mRNAs when assayed in mock-infected and poliovirus-infected HeLa cell extracts. The results identify a functional cis-acting element within the 5' noncoding region of the poliovirus mRNA which enables it to translate in a cap-independent fashion. The major determinant of this element maps between nucleotides 320 and 631 of the 5' end of the poliovirus mRNA. They also show that this region (320 to 631), when fused to a heterologous mRNA, can function in cis to render the mRNA cap independent in translation.

  4. Multiple Sclerosis in the Mount Etna Region: Possible Role of Volcanogenic Trace Elements

    PubMed Central

    Nicoletti, Alessandra; Bruno, Elisa; Nania, Martina; Cicero, Edoardo; Messina, Silvia; Chisari, Clara; Torrisi, Josita; Maimone, Davide; Marziolo, Roberto; Lo Fermo, Salvatore; Patti, Francesco; Giammanco, Salvatore; Zappia, Mario

    2013-01-01

    Background Trace elements have been hypothesised to be involved in the pathogenesis of Multiple Sclerosis and volcanic degassing is the major natural sources of trace elements. Both incidence of Multiple Sclerosis in Catania and volcanic activity of Mount Etna have been significantly increased during the last 30 years. Due to prevailing trade winds direction, volcanic gases from Etna summit craters are mostly blown towards the eastern and southern sectors of the volcano. Objective To evaluate the possible association between Multiple Sclerosis and exposure to volcanogenic trace elements. Methods We evaluated prevalence and incidence of Multiple Sclerosis in four communities (47,234 inhabitants) located in the eastern flank and in two communities (52,210 inhabitants) located in the western flank of Mount Etna, respectively the most and least exposed area to crater gas emissions. Results A higher prevalence was found in the population of the eastern flank compared to the population of the western one (137.6/100,000 versus 94.3/100,000; p-value 0.04). We found a borderline significantly higher incidence risk during the incidence study period (1980–2009) in the population of the eastern flank 4.6/100,000 (95% CI 3.1–5.9), compared with the western population 3.2/100,000 (95% CI 2.4–4.2) with a RR of 1.41 (95% CI 0.97–2.05; p-value 0.06). Incidence risks have increased over the time in both populations reaching a peak of 6.4/100,000 in the eastern flank and of 4.4/100.000 in the western flank during 2000–2009. Conclusion We found a higher prevalence and incidence of Multiple Sclerosis among populations living in the eastern flank of Mount Etna. According to our data a possible role of TE cannot be ruled out as possible co-factor in the MS pathogenesis. However larger epidemiological study are needed to confirm this hypothesis. PMID:24348986

  5. Phytobarriers: Plants capture particles containing potentially toxic elements originating from mine tailings in semiarid regions.

    PubMed

    Sánchez-López, Ariadna S; Carrillo-González, Rogelio; González-Chávez, Ma Del Carmen Angeles; Rosas-Saito, Greta Hanako; Vangronsveld, Jaco

    2015-10-01

    Retention of particles containing potentially toxic elements (PTEs) on plants that spontaneously colonize mine tailings was studied through comparison of washed and unwashed shoot samples. Zn, Pb, Cd, Cu, Ni, Co and Mn concentrations were determined in plant samples. Particles retained on leaves were examined by Scanning Electronic Microscopy and energy dispersive X-Ray analysis. Particles containing PTEs were detected on both washed and unwashed leaves. This indicates that the thorough washing procedure did not remove all the particles containing PTEs from the leaf surface, leading to an overestimation of the concentrations of PTEs in plant tissues. Particularly trichomes and fungal mycelium were retaining particles. The quantity and composition of particles varied among plant species and place of collection. It is obvious that plants growing on toxic mine tailings form a physical barrier against particle dispersion and hence limit the spread of PTEs by wind.

  6. Assessment of contamination based on trace element concentrations in Gomphus flavipes (Odonata: Insect) larvae of the Upper Tisza Region.

    PubMed

    Simon, E; Kis, O; Jakab, T; Kolozsvári, I; Málnás, K; Harangi, S; Baranyai, E; Miskolczi, M; Tóthmérész, B; Dévai, Gy

    2017-02-01

    Odonata larvae are frequently used to assess the contamination of aquatic systems, because they tolerate a wide range of chemical and biological conditions in freshwater systems. In early 2000, the sediments of the Hungarian section of the River Tisza and the River Szamos were strongly enriched with heavy metals by an accidental mining spill. Earlier studies demonstrated higher contamination levels in the Szamos than in the Tisza, based on sediment analysis. The aim of our study was to assess the contamination in the Upper Tisza Region, along the upper reach of the Tisza, and the lower reach of the Szamos, based on the trace element concentrations of the Gomphus flavipes larvae. We collected 269 dragonfly specimens for the analyses. The Al, Ba, Cr, Cu, Fe, Mn, Pb, Sr and Zn element contents were analysed in the dragonfly larvae by microwave plasma atomic emission spectrometry (MP-AES). Significantly higher Ba and Cu concentrations were found in the dragonfly larvae of the Tisza than the Szamos. In spite of this, the Cr, Mn, Pb, Sr and Zn concentration was significantly lower in the dragonfly larvae of the Tisza than the Szamos. For all trace elements significant differences were found along the Tisza. Significant differences were also found in all trace element concentrations of dragonfly larvae among studied localities in the Szamos, except in the cases of Al and Ba. Our results demonstrated that the Szamos was more contaminated with Cr, Mn, Pb, Sr and Zn than the Tisza, but that the Tisza was more contaminated with Ba and Cu than the Szamos, based on the trace element concentrations in Gomphus flavipes larvae, which was likely to have been caused by the tributaries of the Tisza. In summary, our results indicated a continuous pollution of the Tisza and the Szamos and their tributaries.

  7. Statistically significant strings are related to regulatory elements in the promoter regions of Saccharomyces cerevisiae

    NASA Astrophysics Data System (ADS)

    Hu, Rui; Wang, Bin

    2001-02-01

    Finding out statistically significant words in DNA and protein sequences forms the basis for many genetic studies. By applying the maximal entropy principle, we give one systematic way to study the nonrandom occurrence of words in DNA or protein sequences. Through comparison with experimental results, it was shown that patterns of regulatory binding sites in Saccharomyces cerevisiae ( yeast) genomes tend to occur significantly in the promoter regions. We studied two correlated gene families of yeast. The method successfully extracts the binding sites verified by experiments in each family. Many putative regulatory sites in the upstream regions are proposed. The study also suggested that some regulatory sites are active in both directions, while others show directional preference.

  8. Finite element modelling of the glenohumeral capsule can help assess the tested region during a clinical exam.

    PubMed

    Ellis, Benjamin J; Drury, Nicholas J; Moore, Susan M; McMahon, Patrick J; Weiss, Jeffrey A; Debski, Richard E

    2010-06-01

    The objective of this research was to examine the efficacy of evaluating the region of the glenohumeral capsule being tested by clinical exams for shoulder instability using finite element (FE) models of the glenohumeral joint. Specifically, the regions of high capsule strain produced by glenohumeral joint positions commonly used during a clinical exam were identified. Kinematics that simulated a simple translation test with an anterior load at three external rotation angles were applied to a validated, subject-specific FE model of the glenohumeral joint at 60° of abduction. Maximum principal strains on the glenoid side of the inferior glenohumeral ligament (IGHL) were significantly higher than the maximum principal strains on the humeral side, for all three regions of the IGHL at 30° and 60° of external rotation. These regions of localised strain indicate that these joint positions might be used to test the glenoid side of the IGHL during this clinical exam, but are not useful for assessing the humeral side of the IGHL. The use of FE models will facilitate the search for additional joint positions that isolate high strains to other IGHL regions, including the humeral side of the IGHL.

  9. Major and minor element geochemistry of deep-sea sediments in the Azores Platform and southern seamount region.

    PubMed

    Palma, Carla; Oliveira, Anabela; Valença, Manuela; Cascalho, João; Pereira, Eduarda; Lillebø, Ana I; Duarte, Armando C; Pinto de Abreu, Manuel

    2013-10-15

    The Azores Platform and the Irving and Great Meteor seamounts south of the archipelago (38°N-29°N) have rarely been studied geochemically, a fact which is surprising given that they represent the south-eastern limit of region V outlined in the Convention for the Protection of the Marine Environment of the North-East Atlantic (OSPAR Convention). The main aim of the present work was therefore to characterise the spatial variability of major and minor elements in deep-sea sediment cores from these two regions. XRD and geochemical analyses revealed that whereas the Azores Platform sediments are composed of a mixture of biogenic and detrital volcanic material, those at the seamounts are characterised by carbonated biogenic remains. The latter sediments were found to contain very low amounts of volcanic or hydrothermal detrital material, being almost entirely comprised of CaCO3 (more than 80%).

  10. A FORTRAN program to implement the method of finite elements to compute regional and residual anomalies from gravity data

    NASA Astrophysics Data System (ADS)

    Agarwal, B. N. P.; Srivastava, Shalivahan

    2010-07-01

    In view of the several publications on the application of the Finite Element Method (FEM) to compute regional gravity anomaly involving only 8 nodes on the periphery of a rectangular map, we present an interactive FORTRAN program, FEAODD.FOR, for wider applicability of the technique. A brief description of the theory of FEM is presented for the sake of completeness. The efficacy of the program has been demonstrated by analyzing the gravity anomaly over Salt dome, South Houston, USA using two differently oriented rectangular blocks and over chromite deposits, Camaguey, Cuba. The analyses over two sets of data reveal that the outline of the ore body/structure matches well with the maxima of the residuals. Further, the data analyses over South Houston, USA, have revealed that though the broad regional trend remains the same for both the blocks, the magnitudes of the residual anomalies differ approximately by 25% of the magnitude as obtained from previous studies.

  11. Key elements of regional seismic velocity models for long period ground motion simulations

    USGS Publications Warehouse

    Brocher, T.M.

    2008-01-01

    Regional 3-D seismic velocity models used for broadband strong motion simulations must include compressional-wave velocity (Vp), shear-wave velocity (Vs), intrinsic attenuation (Qp, Qs), and density. Vs and Qs are the most important of these parameters because the strongest ground motions are generated chiefly by shear- and surface-wave arrivals. Because Vp data are more common than Vs data, many researchers first develop a Vp model and convert it to a Vs model. I describe recent empirical relations between Vs, Vp, Qs, Qp, and density that allow velocity models to be rapidly and accurately calculated. ?? Springer Science+Business Media B.V. 2007.

  12. Spatial distribution and potential sources of trace elements in PM10 monitored in urban and rural sites of Piedmont Region.

    PubMed

    Padoan, Elio; Malandrino, Mery; Giacomino, Agnese; Grosa, Mauro M; Lollobrigida, Francesco; Martini, Sara; Abollino, Ornella

    2016-02-01

    The results on elemental composition of aerosol (PM10) sampled during 2011 in Piedmont region (Italy) are interpreted using meteorological data, Enrichment Factors (EF), chemometric processing by Principal Component Analysis (PCA), Factor Analysis (FA) and Hierarchical Cluster Analysis (HCA). Daily concentrations of about 30 elements were measured using HR-ICP-MS in five monitoring sites. A clear seasonal pattern, with higher concentrations in autumn and winter, was observed, particularly in the urban sites. Levels of As, Cd, Ni and Pb in most of the samples were within the limits imposed by the European legislation. Spatial differences in PM10 and metal concentrations were significant, with rural and urban sites showing different metal patterns, indicating different sources. K and Ca were used, respectively, as marker of biomass burning and industrial marker (cement plant); EFs showed that Ca was enriched just in one area and K was enriched only in the winter period considered and in some stations. Data analysis through PCA, FA and HCA allowed us to identify correlations among the investigated elements and similarities between sampling sites in order to individuate specific emission sources, such as non-exhaust vehicle emission.

  13. Monazite trace-element and isotopic signatures of high-pressure metamorphism: examples from the Western Gneiss region, Norway

    NASA Astrophysics Data System (ADS)

    Holder, R. M.; Hacker, B. R.; Kylander-Clark, A. R.; Cottle, J. M.

    2014-12-01

    Monazite U-Pb and trace-element data were gathered using LASS (laser-ablation split-stream ICP-MS) from the Western Gneiss region, Norway, to investigate how trace-element composition can be used to differentiate (ultra)high-pressure monazite from low-pressure monazite. Monazite from six samples contains up to 3 % common Pb, despite high U and Th concentrations. These high common-Pb monazites are characterized by high Sr, weak Eu anomalies, and low Y+HREE. The high common-Pb and Sr abundances and the weak Eu/Eu* are interpreted to reflect the absence of feldspar at (U)HP, and the low Y+HREE content is attributed to fractionation of those elements into garnet. Sr and common Pb in monazite provide a tool for constraining the timing and duration of (U)HP metamorphism. More generally, Sr in monazite is a potential indicator of feldspar instability and may be applicable in other geologic settings, such as igneous systems in which the abundance of feldspar changes due to melting and crystallization. Sr is expected to be more reliable than Eu and Eu/Eu* as a tracer of feldspar stability, because Sr partitioning is less strongly influenced by oxidation state.

  14. Spatial Distribution of Lead Isotope Ratios and Inorganic Element Concentrations in Epiphytic Lichens from the Athabasca Oil Sands Region

    NASA Astrophysics Data System (ADS)

    Graney, J. R.; Landis, M. S.; Puckett, K.; Edgerton, E.; Krupa, S.; Percy, K.

    2013-12-01

    Coupled studies of inorganic element concentrations and lead (Pb) isotope ratios have been conducted on Hypogymnia physodes samples collected in the Athabasca Oil Sands Region (AOSR) in Alberta, Canada in 2002, 2008, and 2011. To investigate the spatial extent of air emissions, the lichens were collected from sites as far as 160 km from the mining and processing operations. 30 milligram sub-samples of the lichens were microwave digested, and the extracts were analyzed using DRC-ICPMS to determine elemental concentrations, and sector field ICPMS to measure Pb isotope ratios. Concentrations of elements in the lichens were found to reflect proximity to mining and oil processing sites as well as topography, ecosystem differences, and the metabolic biogeochemistry of the lichens. An exponential decrease in concentration of metals associated with fugitive dust (aluminum and others) versus distance from the mining sites, suggests elevated coarse particle emissions associated with mining operations. Near source concentrations of metals with an oil signature (vanadium and others) are less enhanced and more homogeneous than the metals in the fugitive dust, reflecting emission and deposition of smaller diameter particles at greater distances from oil processing sources. The mining and oil processing signatures are superimposed over elemental concentrations that reflect the nutrient needs of the lichens. These findings are being confirmed through ongoing studies using dichot samplers to collect coarse and fine particulate aerosol samples. The lichen samples collected beyond 50 km from the mining and processing sites cluster into a Pb isotope grouping with a 207Pb / 206Pb ratio of 0.8650 and a 208Pb / 206Pb ratio near 2.095. This grouping likely reflects the regional background Pb isotope ratio signature. 207Pb / 206Pb and 208Pb / 206Pb ratios decrease as one nears the mining and processing operations. This indicates that other Pb source(s), (e.g. Pb in the bitumen from the oil

  15. Relationship of magnetic field strength and brightness of fine-structure elements in the solar temperature minimum region

    NASA Technical Reports Server (NTRS)

    Cook, J. W.; Ewing, J. A.

    1990-01-01

    A quantitative relationship was determined between magnetic field strength (or magnetic flux) from photospheric magnetograph observations and the brightness temperature of solar fine-structure elements observed at 1600 A, where the predominant flux source is continuum emission from the solar temperature minimum region. A Kitt Peak magnetogram and spectroheliograph observations at 1600 A taken during a sounding rocket flight of the High Resolution Telescope and Spectrograph from December 11, 1987 were used. The statistical distributions of brightness temperature in the quiet sun at 1600 A, and absolute value of magnetic field strength in the same area were determined from these observations. Using a technique which obtains the best-fit relationship of a given functional form between these two histogram distributions, a quantitative relationship was determined between absolute value of magnetic field strength B and brightness temperature which is essentially linear from 10 to 150 G. An interpretation is suggested, in which a basal heating occurs generally, while brighter elements are produced in magnetic regions with temperature enhancements proportional to B.

  16. Atmospheric background trace elements deposition in Tierra del Fuego region (Patagonia, Argentina), using transplanted Usnea barbata lichens.

    PubMed

    Conti, Marcelo Enrique; Finoia, Maria Grazia; Bocca, Beatrice; Mele, Giustino; Alimonti, Alessandro; Pino, Anna

    2012-01-01

    Lichen, Usnea barbata, transplants taken from Tierra del Fuego (south Patagonia, Argentina) were tested as potential biomonitors of atmospheric airborne deposition in an apparently pristine environment. In 2005, lichens were sampled in a reference site (n = 31) and transplanted in the northern Region of Tierra del Fuego. After, respectively, 1 month and 1 year of exposure, we collected them. The aim of the study was to determine the bioaccumulation of 26 elements in order to evaluate the background levels in the selected area. Samples were analyzed by the sector field inductively coupled plasma mass spectrometry. Discriminant analysis on principal component analysis factors was applied in order to explore the relationship among the different elements as far as time and spatial variation in transplants regards. The analysis was tested by Monte Carlo test based on 999 replicates. The most important contamination source resulted to be the atmospheric soil particle deposition. Furthermore, the results were compared with those obtained from the lichens collected in central and southern Tierra del Fuego. This study confirms the ability of U. barbata to reflect the background levels of the 26 elements in that environment. Compared with other background sites in the world, we did confirm that Tierra del Fuego lichens have a low content of the studied elements. Tierra del Fuego turned out not to be a pristine environment as supposed, but it can be considered as a reference basal ecosystem for useful comparisons among different geographical areas. These findings can be very relevant and useful for environmental conservation programs.

  17. Toroid Joining Gun For Fittings And Couplings

    NASA Technical Reports Server (NTRS)

    Fox, Robert L.; Swaim, Robert J.; Johnson, Samuel D.; Buckley, John D.; Copeland, Carl E.; Coultrip, Robert H.; Johnston, David F.; Phillips, William M.

    1992-01-01

    Hand-held gun used to join metal heat-to-shrink couplings. Uses magnetic induction (eddy currents) to produce heat in metal coupling, and thermocouple to measure temperature and signals end of process. Gun, called "toroid joining gun" concentrates high levels of heat in localized areas. Reconfigured for use on metal heat-to-shrink fitting and coupling applications. Provides rapid heating, operates on low power, lightweight and portable. Safe for use around aircraft fuel and has no detrimental effects on surrounding surfaces or objects. Reliable in any environment and under all weather conditions. Gun logical device for taking full advantage of capabilities of new metal heat-to-shrink couplings and fittings.

  18. Rhenium Mechanical Properties and Joining Technology

    NASA Technical Reports Server (NTRS)

    Reed, Brian D.; Biaglow, James A.

    1996-01-01

    Iridium-coated rhenium (Ir/Re) provides thermal margin for high performance and long life radiation cooled rockets. Two issues that have arisen in the development of flight Ir/Re engines are the sparsity of rhenium (Re) mechanical property data (particularly at high temperatures) required for engineering design, and the inability to directly electron beam weld Re chambers to C103 nozzle skirts. To address these issues, a Re mechanical property database is being established and techniques for creating Re/C103 transition joints are being investigated. This paper discusses the tensile testing results of powder metallurgy Re samples at temperatures from 1370 to 2090 C. Also discussed is the evaluation of Re/C103 transition pieces joined by both, explosive and diffusion bonding. Finally, the evaluation of full size Re transition pieces, joined by inertia welding, as well as explosive and diffusion bonding, is detailed.

  19. Novel method for joining CFRP to aluminium

    NASA Astrophysics Data System (ADS)

    Möller, F.; Thomy, C.; Vollertsen, F.; Schiebel, P.; Hoffmeister, C.; Herrmann, A. S.

    The current state of the art in joining of carbon-fibre reinforced composites (CFRP) to metals such as aluminium is - for the case of aircraft structures, e.g.- riveting or bolting. However, to reduce structural weight and improve structural performance, integral, load-bearing aluminium-CFRP-structures are desirable. To produce such structures, a novel joint configuration together with an appropriate thermal, laser-based joining process is suggested by the authors. In this paper, the joint configuration (based on CFRP-Ti-aluminium joints) and the laser beam conduction welding process will be presented, and first specimens obtained will be discussed with respect to their properties. It will be shown that the novel approach is in principle suitable to produce load-bearing CFRP-aluminium structures.

  20. One-step dual purpose joining technique

    NASA Technical Reports Server (NTRS)

    Buckley, J. D.; Swaim, R. J.; Fox, R. L. (Inventor)

    1982-01-01

    This fastener used in induction heating is a wire screen basically of an eddy current carrying material such as carbon steel. Selected wires in the screen are copper, sheathed in an insulating material. The screen is placed between two sheets of thermoplastics. When inductively heated, the composite softens and flows around the apertures of the screen. After this heating and joining, the copper wires may be used to conduct electricity.

  1. Thin layer joining by gas adsorption

    NASA Astrophysics Data System (ADS)

    Taga, Yasunori; Fukumura, Toshio

    2014-10-01

    Attempt has been made to join borosilicate glass and cycloolefin (COP) polymer film by using gas adsorption method. After corona plasma treat, COP was exposed to (3-glycidoxypropyl) trimethoxysilane (GPS) and glass to (3-aminopropyl) triethoxysilane (APS) both in air atmosphere, resulting in co-adsorption of water vapor in the atmosphere and organosilane gases. Surface characterization of plasma treated and gas adsorbed surfaces was carried out by X-ray photoelectron spectroscopy (XPS) using Mg Kα X-ray source. Joining was carried out by a roll laminator after contact of both surfaces at room temperature, followed by annealing at 130 °C for 10 min. Adhesion strength was evaluated by 180 degree peel test based on ASTM D-903 and durability was examined under the conditions of 60 °C and 95% RH. It was found that after plasma treatment, complex functional groups such as Csbnd H, Csbnd O, Cdbnd O, Osbnd Cdbnd O and CO3 were found on COP and Osbnd H on glass. Thickness of GPS gas adsorption layer on COP was evaluated by the XPS to be at least 1.1 nm by taking inelastic mean free path of Si2p photoelectron into consideration. Joining force was found to be more than 5 N/25 mm corresponding to almost equal to COP bulk tensile strength. In addition, durability of this adhesion strength remained unchanged over 2000 h even after exposure to the durability test conditions of 60 °C and 95% RH. The results can be explained in terms of formation of Hsbnd H hydrogen bonding and Sisbnd O covalent bonding via silanols will be made at the interface as a result of lamination and annealing processes. In conclusion, ultrathin joining method by gas adsorption was established by the formation of hydrogen and covalent bonds at the interface by low temperature reaction process.

  2. Joining of materials using laser heating

    DOEpatents

    Cockeram, Brian V.; Hicks, Trevor G.; Schmid, Glenn C.

    2003-07-01

    A method for diffusion bonding ceramic layers such as boron carbide, zirconium carbide, or silicon carbide uses a defocused laser beam to heat and to join ceramics with the use of a thin metal foil insert. The metal foil preferably is rhenium, molybdenum or titanium. The rapid, intense heating of the ceramic/metal/ceramic sandwiches using the defocused laser beam results in diffusive conversion of the refractory metal foil into the ceramic and in turn creates a strong bond therein.

  3. Flexible Hybrid Friction Stir Joining Technology

    SciTech Connect

    2008-12-01

    This factsheet describes a research project whose goal is to advance the friction stir welding (FSW) process as a manufacturing technology that can be deployed for on-site construction of large, complex and typically thick-sectioned structures made of high performance and high-temperature materials. This would transform FSW from a specialty joining process into one with pervasive application potential across a number of industrial sectors where the payoff of energy reduction, environmental and economic benefits would be significant.

  4. The 3' untranslated region of human Cyclin-Dependent Kinase 5 Regulatory subunit 1 contains regulatory elements affecting transcript stability

    PubMed Central

    Moncini, Silvia; Bevilacqua, Annamaria; Venturin, Marco; Fallini, Claudia; Ratti, Antonia; Nicolin, Angelo; Riva, Paola

    2007-01-01

    Background CDK5R1 plays a central role in neuronal migration and differentiation during central nervous system development. CDK5R1 has been implicated in neurodegenerative disorders and proposed as a candidate gene for mental retardation. The remarkable size of CDK5R1 3'-untranslated region (3'-UTR) suggests a role in post-transcriptional regulation of CDK5R1 expression. Results The bioinformatic study shows a high conservation degree in mammals and predicts several AU-Rich Elements (AREs). The insertion of CDK5R1 3'-UTR into luciferase 3'-UTR causes a decreased luciferase activity in four transfected cell lines. We identified 3'-UTR subregions which tend to reduce the reporter gene expression, sometimes in a cell line-dependent manner. In most cases the quantitative analysis of luciferase mRNA suggests that CDK5R1 3'-UTR affects mRNA stability. A region, leading to a very strong mRNA destabilization, showed a significantly low half-life, indicating an accelerated mRNA degradation. The 3' end of the transcript, containing a class I ARE, specifically displays a stabilizing effect in neuroblastoma cell lines. We also observed the interaction of the stabilizing neuronal RNA-binding proteins ELAV with the CDK5R1 transcript in SH-SY5Y cells and identified three 3'-UTR sub-regions showing affinity for ELAV proteins. Conclusion Our findings evince the presence of both destabilizing and stabilizing regulatory elements in CDK5R1 3'-UTR and support the hypothesis that CDK5R1 gene expression is post-transcriptionally controlled in neurons by ELAV-mediated mechanisms. This is the first evidence of the involvement of 3'-UTR in the modulation of CDK5R1 expression. The fine tuning of CDK5R1 expression by 3'-UTR may have a role in central nervous system development and functioning, with potential implications in neurodegenerative and cognitive disorders. PMID:18053171

  5. Using multivariate statistical analysis of groundwater major cation and trace element concentrations to evaluate groundwater flow in a regional aquifer

    NASA Astrophysics Data System (ADS)

    Stetzenbach, Klaus J.; Farnham, Irene M.; Hodge, Vernon F.; Johannesson, Kevin H.

    1999-12-01

    Groundwater samples were collected from 11 springs in Ash Meadows National Wildlife Refuge in southern Nevada and seven springs from Death Valley National Park in eastern California. Concentrations of the major cations (Ca, Mg, Na and K) and 45 trace elements were determined in these groundwater samples. The resultant data were subjected to evaluation via the multivariate statistical technique principal components analysis (PCA), to investigate the chemical relationships between the Ash Meadows and Death Valley spring waters, to evaluate whether the results of the PCA support those of previous hydrogeological and isotopic studies and to determine if PCA can be used to help delineate potential groundwater flow patterns based on the chemical compositions of groundwaters. The results of the PCA indicated that groundwaters from the regional Paleozoic carbonate aquifers (all of the Ash Meadows springs and four springs from the Furnace Creek region of Death Valley) exhibited strong statistical associations, whereas other Death Valley groundwaters were chemically different. The results of the PCA support earlier studies, where potentiometric head levels, 18O and D, geological relationships and rare earth element data were used to evaluate groundwater flow, which suggest groundwater flows from Ash Meadows to the Furnace Creek springs in Death Valley. The PCA suggests that Furnace Creek groundwaters are moderately concentrated Ash Meadows groundwater, reflecting longer aquifer residence times for the Furnace Creek groundwaters. Moreover, PCA indicates that groundwater may flow from springs in the region surrounding Scotty's Castle in Death Valley National Park, to a spring discharging on the valley floor. The study indicates that PCA may provide rapid and relatively cost-effective methods to assess possible groundwater flow regimes in systems that have not been previously investigated.

  6. Joining of beta-SiC by spark plasma sintering

    SciTech Connect

    Grasso, Salvatore; Tatarko, Peter; Rizzo, S.; Porwal, Harshit; Hu, Chunfeng; Katoh, Yutai; Salvo, M; Reece, Michael John; Ferraris, Monica

    2014-01-01

    Spark plasma sintering (SPS) was employed to join monolithic -SiC with or without titanium as intermediate joining material. Both the localizedand rapid heating contributed to the inherent energy saving of electric current assisted joining technique. The effects of uniaxial pressure and surfacepreparation were analyzed independently with respect to the flexural strength and the morphology of the joints. In particular samples polisheddown to 1 m and joined at 1900 C for 5 min achieved the strength of the as received material. The failure occurred outside the joining interface,confirming the optimum quality of the joint. Pressure in combination with surface preparation was necessary to achieve perfect adhesion and porefree direct joining of SiC. The use of Ti foil as a joining material and pressure allowed joining of unpolished SiC.

  7. Astronaut Crippen prepares to join crew in training

    NASA Technical Reports Server (NTRS)

    1984-01-01

    Astronaut Robert L. Crippen, 41-G crew commander, prepares to join his crew for training in the mockup and integration laboratory at JSC. Astronaut David C. Leestma, 41-G mission specialist, left, will join the crew in training.

  8. A regional analysis of elements at risk exposed to mountain hazards in the Eastern European Alps

    NASA Astrophysics Data System (ADS)

    Fuchs, Sven; Zischg, Andreas

    2014-05-01

    We present a method to quantify the number and value of buildings exposed to torrents and snow avalanches in the Austrian Alps, as well as the number of exposed people. Based on a unique population and building register dataset, a relational SQL database was developed that allows in combination with GIS data a rule-based nation-wide automated analysis. Furthermore, possibilities and challenges are discussed with respect to the use of such data in vulnerability assessment and with respect to resilience measures. We comprehensively address the challenge of data accuracy, scale and uncertainties. From the total of approximately 2.4 million buildings with a clearly attributable geographical location, around 120,000 are exposed to torrent processes (5 %) and snow avalanches (0.4 %); exposition was defined here as located within the digitally available hazard maps of the Austrian Torrent and Avalanche Control Service. Around 5 % of the population (360,000 out of 8.5 million inhabitants), based on those people being compulsory listed in the population register, are located in these areas. The analysis according to the building category resulted in 2.05 million residential buildings in Austria (85 %), 93,000 of which (4.5 %) are exposed to these hazards. In contrast, 37,300 buildings (1.6 %) throughout the country belong to the category of accommodation facilities, 5,600 of which are exposed (15 %). Out of the 140,500 commercial buildings, 8,000 (5 %) are exposed. A considerable spatial variation was detectable within the communities and Federal States. In general, an above-average exposition of buildings to torrent process and snow avalanches was detectable in communities located in the Federal State of Salzburg, Styria and Vorarlberg (torrents), and Tyrol and Vorarlberg (snow avalanches). In the alpine part of Austria, the share of exposed accommodation buildings was two times (Salzburg) and three times (Vorarlberg) higher than the regional average of exposed buildings

  9. An adaptive transposable element insertion in the regulatory region of the EO gene in the domesticated silkworm, Bombyx mori.

    PubMed

    Sun, Wei; Shen, Yi-Hong; Han, Min-Jin; Cao, Yun-Feng; Zhang, Ze

    2014-12-01

    Although there are many studies to show a key role of transposable elements (TEs) in adaptive evolution of higher organisms, little is known about the molecular mechanisms. In this study, we found that a partial TE (Taguchi) inserted in the cis-regulatory region of the silkworm ecdysone oxidase (EO) gene, which encodes a crucial enzyme to reduce the titer of molting hormone (20-hydroxyecdysone, 20E). The TE insertion occurred during domestication of silkworm and the frequency of the TE insertion in the domesticated silkworm (Bombyx mori) is high, 54.24%. The linkage disequilibrium in the TE inserted strains of the domesticated silkworm was elevated. Molecular population genetics analyses suggest that this TE insertion is adaptive for the domesticated silkworm. Luminescent reporter assay shows that the TE inserted in the cis-regulatory region of the EO gene functions as a 20E-induced enhancer of the gene expression. Further, phenotypic bioassay indicates that the silkworm with the TE insertion exhibited more stable developmental phenotype than the silkworm without the TE insertion when suffering from food shortage. Thus, the inserted TE in the cis-regulatory region of the EO gene increased developmental uniformity of silkworm individuals through regulating 20E metabolism, partially explaining transformation of a domestication developmental trait in the domesticated silkworm. Our results emphasize the exceptional role of gene expression regulation in developmental transition of domesticated animals.

  10. Evaluating Local and Regional Sources of Trace Element Contamination in a Rural Sub Estuary of the Upper Chesapeake Bay

    NASA Astrophysics Data System (ADS)

    Krahforst, C.; Hartman, S.; Sherman, L.; Kehm, K.

    2014-12-01

    The distribution of trace elements (V, Cr, Co, Ni, Cu, Zn, As, Ag, Cd, Sn, Ba, W, Pb and U) along with Al and Fe and other sediment characteristics in surface sediment and sediment cores from the Chester River - a sub estuary of the Chesapeake Bay located in a predominantly agricultural watershed of Maryland's upper Eastern Shore, USA - have been determined in order to add to the understanding of contaminant transport and fate and inform management strategies designed to maintain or improve the ecological condition of estuaries. These analyses coupled with the comparison of elemental analysis of 210Pb - dated sediment cores, main stem water quality surveys, and a review of recent EPA National Coastal Condition Assessment sediment data from Chesapeake Bay provide added information about the roles of local and region scale processes on ecosystem condition. The high amount of suspended sediment in the Chester River (5-20 mg L-1) is an important factor controlling water quality conditions of the Chester River and a prime focus for environmental management of this system. Sources of suspended matter include local runoff, atmospheric deposition, local resuspension, and exchange with the Chesapeake Bay. In principle, each of these sources could be distinguished on the basis of chemical composition of surface sediment. Preliminary results from multivariate analytic models indicate that many of the elements investigated display significant covariance with Al (and other predominantly crustal signatures) which may indicate limited exogenic sources of contamination for sediments of this watershed. For example total Pb concentrations are mostly below the NOAA's low toxic effects level and lower than the median value of NCCA data for the upper Chesapeake suggesting that sediments have significant sources from within the watershed. Further, significant higher concentrations of Sn and Cu coincide with sediment collected in or near marinas and point to localized anthropogenic

  11. Structural modeling and optimization of a joined-wing configuration of a High-Altitude Long-Endurance (HALE) aircraft

    NASA Astrophysics Data System (ADS)

    Kaloyanova, Valentina B.

    developed. All stringers, skin panels, ribs and spars are represented by appropriate elements in a finite-element model. Also, the model accounts for the fuel weight and sensorcraft antennae housed within the wings. Linear and nonlinear static analyses under the aerodynamic load are performed. The stress distribution in the wing as well as deformation is explored. Starting with a structural model with uniform mass distribution, a design optimization is performed to achieve a fully stressed design. As the joined-wing structure is prone to buckling, after the design optimization is complete linear and nonlinear bucking analyses are performed to study the global joined-wing structural instability, the load magnitude at which it is expected to occur, and the buckling mode. The buckled shape of the aft wing (which is subjected to compression) is found to resemble that of a fixed-pinned column. The linear buckling analysis overestimates the buckling load. However, even the nonlinear buckling analysis results in a load factor higher than 3, i.e. the wing structure is buckling safe under its current loading conditions. As the region of the joint has a very complicated geometry that has adverse effects in the flow and stress behavior an independent, more finely meshed model (submodel) of the joint region is generated and analyzed. A detailed discussion of the stress distribution obtained in the joint region via the submodeling technique is presented in this study as well. It is found out that compared to its structural response, the joint adverse effects are much more pronounced in its aerodynamic response, so it is suggested for future studies the geometry of the joint to be optimized based on its aerodynamic performance. As this design and analysis study is aimed towards developing a realistic structural representation of the innovative joined-wing configuration, in addition to the "global", or upper-level optimization, a local level design optimization is performed as well. At

  12. Innovative and Highly Productive Joining Technologies for Multi-Material Lightweight Car Body Structures

    NASA Astrophysics Data System (ADS)

    Meschut, G.; Janzen, V.; Olfermann, T.

    2014-05-01

    Driven by increasing costs for energy and raw material and especially by the European CO2-emission laws, automotive industry faces the challenge to develop more lightweight and at the same time still rigid and crash-stable car bodies, that are affordable for large-scale production. The implementation of weight-reduced constructions depends not only on the availability of lightweight materials and related forming technologies, but also on cost-efficient and reliable joining technologies suitable for multi-material design. This article discusses the challenges and requirements for these technologies, based on the example of joining aluminium with press-hardened boron steels, what is considered as a very important material combination for affordable future lightweight mobility. Besides a presentation of recent developments for extending the process limits of conventional mechanical joining methods, new promising technologies such as resistance element welding are introduced. In addition, the performance, advantages, and disadvantages of the presented technologies are compared and discussed.

  13. 46 CFR 56.75-30 - Pipe joining details.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ...) Copper-alloy brazing. (1) Copper-alloy brazing may be employed to join pipe, valves, and fittings... APPURTENANCES Brazing § 56.75-30 Pipe joining details. (a) Silver brazing. (1) Circumferential pipe joints may... satisfactory for the brazing alloy to be employed, method of heating, and material to be joined. The...

  14. 46 CFR 56.75-30 - Pipe joining details.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ...) Copper-alloy brazing. (1) Copper-alloy brazing may be employed to join pipe, valves, and fittings... APPURTENANCES Brazing § 56.75-30 Pipe joining details. (a) Silver brazing. (1) Circumferential pipe joints may... satisfactory for the brazing alloy to be employed, method of heating, and material to be joined. The...

  15. 46 CFR 56.75-30 - Pipe joining details.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 2 2014-10-01 2014-10-01 false Pipe joining details. 56.75-30 Section 56.75-30 Shipping... APPURTENANCES Brazing § 56.75-30 Pipe joining details. (a) Silver brazing. (1) Circumferential pipe joints may be either of the socket or butt type. When butt joints are employed the edges to be joined shall...

  16. 24 CFR 17.62 - Subdivision and joining of claims.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Subdivision and joining of claims... General Provisions § 17.62 Subdivision and joining of claims. (a) A debtor's liability arising from a.... (b) Joining of two or more single claims in a demand upon a particular debtor for payment...

  17. 5 CFR 1201.36 - Consolidating and joining appeals.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 5 Administrative Personnel 3 2012-01-01 2012-01-01 false Consolidating and joining appeals. 1201... § 1201.36 Consolidating and joining appeals. (a) Explanation. (1) Consolidation occurs when the appeals... example, a judge might join an appeal challenging a 30-day suspension with a pending appeal challenging...

  18. 24 CFR 17.62 - Subdivision and joining of claims.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 24 Housing and Urban Development 1 2011-04-01 2011-04-01 false Subdivision and joining of claims... General Provisions § 17.62 Subdivision and joining of claims. (a) A debtor's liability arising from a.... (b) Joining of two or more single claims in a demand upon a particular debtor for payment...

  19. 5 CFR 1201.36 - Consolidating and joining appeals.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 5 Administrative Personnel 3 2011-01-01 2011-01-01 false Consolidating and joining appeals. 1201... § 1201.36 Consolidating and joining appeals. (a) Explanation. (1) Consolidation occurs when the appeals... example, a judge might join an appeal challenging a 30-day suspension with a pending appeal challenging...

  20. Little Brother Joins the Large Family

    NASA Astrophysics Data System (ADS)

    2006-12-01

    On the night of 15 December 2006, the fourth and last-to-be-installed VLTI Auxiliary Telescope (AT4) obtained its 'First Light'. The first images demonstrate that AT4 will be able to deliver the excellent image quality already delivered by the first three ATs. It will soon join its siblings to perform routinely interferometric measurements. ESO PR Photo 51a/06 ESO PR Photo 51a/06 VLT Auxiliary Telescope The VLT is composed of four 8.2-m Unit Telescope (Antu, Kueyen, Melipal and Yepun). They have been progressively put into service together with a vast suite of the most advanced astronomical instruments and are operated every night in the year. Contrary to other large astronomical telescopes, the VLT was designed from the beginning with the use of interferometry as a major goal. The VLT Interferometer (VLTI) combines starlight captured by two or three 8.2- VLT Unit Telescopes, dramatically increasing the spatial resolution and showing fine details of a large variety of celestial objects. ESO PR Photo 51b/06 ESO PR Photo 51b/06 One AT Under the Sky However, most of the time the large telescopes are used for other research purposes. They are therefore only available for interferometric observations during a limited number of nights every year. Thus, in order to exploit the VLTI each night and to achieve the full potential of this unique setup, some other (smaller), dedicated telescopes were included into the overall VLT concept. These telescopes, known as the VLTI Auxiliary Telescopes (ATs), are mounted on tracks and can be placed at precisely defined "parking" observing positions on the observatory platform. From these positions, their light beams are fed into the same common focal point via a complex system of reflecting mirrors mounted in an underground system of tunnels. The Auxiliary Telescopes are real technological jewels. They are placed in ultra-compact enclosures, complete with all necessary electronics, an air conditioning system and cooling liquid for

  1. Retroposed elements and their flanking regions resolve the evolutionary history of xenarthran mammals (armadillos, anteaters, and sloths).

    PubMed

    Möller-Krull, Maren; Delsuc, Frédéric; Churakov, Gennady; Marker, Claudia; Superina, Mariella; Brosius, Jürgen; Douzery, Emmanuel J P; Schmitz, Jürgen

    2007-11-01

    Armadillos, anteaters, and sloths (Order Xenarthra) comprise 1 of the 4 major clades of placental mammals. Isolated in South America from the other continental landmasses, xenarthrans diverged over a period of about 65 Myr, leaving more than 200 extinct genera and only 31 living species. The presence of both ancestral and highly derived anatomical features has made morphoanatomical analyses of the xenarthran evolutionary history difficult, and previous molecular analyses failed to resolve the relationships within armadillo subfamilies. We investigated the presence/absence patterns of retroposons from approximately 7,400 genomic loci, identifying 35 phylogenetically informative elements and an additional 39 informative rare genomic changes (RGCs). DAS-short interspersed elements (SINEs), previously described only in the Dasypus novemcinctus genome, were found in all living armadillo genera, including the previously unsampled Chlamyphorus, but were noticeably absent in sloths. The presence/absence patterns of the phylogenetically informative retroposed elements and other RGCs were then compared with data from the DNA sequences of the more than 12-kb flanking regions of these retroposons. Together, these data provide the first fully resolved genus tree of xenarthrans. Interestingly, multiple evidence supports the grouping of Chaetophractus and Zaedyus as a sister group to Euphractus within Euphractinae, an association that was not previously demonstrated. Also, flanking sequence analyses favor a close phylogenetic relationship between Cabassous and Tolypeutes within Tolypeutinae. Finally, the phylogenetic position of the subfamily Chlamyphorinae is resolved by the noncoding sequence data set as the sister group of Tolypeutinae. The data provide a stable phylogenetic framework for further evolutionary investigations of xenarthrans and important information for defining conservation priorities to save the diversity of one of the most curious groups of mammals.

  2. Arsenic in Bangladeshi soils related to physiographic region, paddy management, and mirco- and macro-elemental status.

    PubMed

    Chowdhury, M Tanvir A; Deacon, Claire M; Jones, Gerrad D; Imamul Huq, S M; Williams, Paul N; Manzurul Hoque, A F M; Winkel, Lenny H E; Price, Adam H; Norton, Gareth J; Meharg, Andrew A

    2017-07-15

    While the impact of arsenic in irrigated agriculture has become a major environmental concern in Bangladesh, to date there is still a limited understanding of arsenic in Bangladeshi paddy soils at a landscape level. A soil survey was conducted across ten different physiographic regions of Bangladesh, which encompassed six types of geomorphology (Bil, Brahmaputra floodplain, Ganges floodplain, Meghna floodplain, Karatoya-Bangali floodplain and Pleistocene terrace). A total of 1209 paddy soils and 235 matched non-paddy soils were collected. The source of irrigation water (groundwater and surface water) was also recorded. The concentrations of arsenic and sixteen other elements were determined in the soil samples. The concentration of arsenic was higher in paddy soils compared to non-paddy soils, with soils irrigated with groundwater being higher in arsenic than those irrigated with surface water. There was a clear difference between the Holocene floodplains and the Pleistocene terraces, with Holocene floodplain soils being higher in arsenic and other elements. The results suggest that arsenic is most likely associated with less well weathered/leached soils, suggesting it is either due to the geological newness of Holocene sediments or differences between the sources of sediments, which gives rise to the arsenic problems in Bangladeshi soils.

  3. Joining and Testing Composite Plates to Ti Tubes

    NASA Technical Reports Server (NTRS)

    Morscher, Gregory N.; Singh, Mrityunjay; Shpargei, Tarah; Asthana, Rajiv

    2005-01-01

    The joining of metal tubes to composite plates is required for heat-rejection components in several space applications. Currently a number of different braze compositions are being evaluated as to their effectiveness. Such tube-plate configurations cannot be represented by traditional methods of testing, e.g., lap joints. The joined region is not between two flat surfaces, but rather between a flat surface and a curved surface. Therefore, several tests have been employed to ascertain the effectiveness of the different braze approaches in tension that are both simple and representative of the actual system and relatively straightforward in analysis. The results of these "tube-tests" will be discussed for the three different braze compositions, Cu-ABA, Ti-Cu-Sil, and Ti-Cu-Ni. In addition, fracture analysis of the failed joints was performed and offers insights into the cause of joint failure and the distinctions which need to be made between the "strength" of a joint versus the "load carrying ability" of a joint.

  4. Cadmium and other elements in tissues from four ungulate species from the Mackenzie Mountain region of the Northwest Territories, Canada.

    PubMed

    Larter, N C; Macdonald, C R; Elkin, B T; Wang, X; Harms, N J; Gamberg, M; Muir, D C G

    2016-10-01

    Tissue samples from four ungulate species from the south Mackenzie Mountain region of the Northwest Territories (NT), Canada, were analysed for stable and radioactive elements and (15)N and (13)C stable isotopes. Elevated Cd concentrations in moose (Alces americanus) kidney have been observed in the region and are a health care concern for consumers of traditional foods. This study examined the factors associated with, and potential renal effects from, the accumulation of cadmium, and interactions with other elements in four sympatric ungulate species. Mean renal Cd concentration was highest in moose (48.3mg/kg ww), followed by mountain caribou (Rangifer tarandus caribou) (13.9mg/kg ww) and mountain goat (Oreamnos americanus) (5.78mg/kg ww). No local sources of Cd were evident and the elevated levels in moose are considered to be natural in origin. Conversely, total Hg concentration was significantly higher in mountain caribou kidney (0.21mg/kg ww) than in moose (0.011mg/kg ww). (134)Cs (t½=2.1 y) in mountain goat and Dall's sheep (Ovis dalli) muscle is evidence of deposition from the Fukushima reactor accident in 2011. (137)Cs (t½=30.2 y) in all four ungulates is primarily a remnant of the nuclear weapons tests of the 1960s. The levels of both nuclides are low and the risk to the animals and people consuming them is negligible. Stable isotope δ(15)N and δ(13)C signatures in muscle showed a separation between the mountain caribou, with a lichen-dominated diet, and moose, which browse shrubs and forbs. Isotope signatures for mountain goat and Dall's sheep showed generalist feeding patterns. Differences in elemental and radionuclide levels between species were attributed to relative levels of metal accumulation in the different food items in the diets of the respective species. Kidneys from each species showed minor histological changes in the proximal tubule and glomerulus, although glomerular changes were rare and all changes were rare in mountain goat kidney

  5. METHOD OF JOINING CARBIDES TO BASE METALS

    DOEpatents

    Krikorian, N.H.; Farr, J.D.; Witteman, W.G.

    1962-02-13

    A method is described for joining a refractory metal carbide such as UC or ZrC to a refractory metal base such as Ta or Nb. The method comprises carburizing the surface of the metal base and then sintering the base and carbide at temperatures of about 2000 deg C in a non-oxidizing atmosphere, the base and carbide being held in contact during the sintering step. To reduce the sintering temperature and time, a sintering aid such as iron, nickel, or cobait is added to the carbide, not to exceed 5 wt%. (AEC)

  6. SOLID STATE JOINING OF MAGNESIUM TO STEEL

    SciTech Connect

    Jana, Saumyadeep; Hovanski, Yuri; Pilli, Siva Prasad; Field, David P.; Yu, Hao; Pan, Tsung-Yu; Santella, M. L.

    2012-06-04

    Friction stir welding and ultrasonic welding techniques were applied to join automotive magnesium alloys to steel sheet. The effect of tooling and process parameters on the post-weld microstructure, texture and mechanical properties was investigated. Static and dynamic loading were utilized to investigate the joint strength of both cast and wrought magnesium alloys including their susceptibility and degradation under corrosive media. The conditions required to produce joint strengths in excess of 75% of the base metal strength were determined, and the effects of surface coatings, tooling and weld parameters on weld properties are presented.

  7. Joining of materials with engineered interlayers

    NASA Technical Reports Server (NTRS)

    Challenger, Kenneth D.; Cordea, Tom; Sengupta, Samit; Wampler, Scott

    1991-01-01

    A reliable method to join a variety of different materials is developed which uses engineered coatings to produce strong bonds by solid-state techniques at low temperatures (300-400 C). The strong bonds are capable of accommodating the strains created between Si and most substrates due to differences in thermal expansion coefficients. The approach encompasses two phases: noble metal compliant interlayers and functionally gradient interlayer bonding. Preliminary results are presented and the Ag interlayer bonds are microstructurally characterized confirming that the planar magnetron sputtered coatings/bonds are fully dense and metallurgically sound.

  8. A distal intergenic region controls pancreatic endocrine differentiation by acting as a transcriptional enhancer and as a polycomb response element.

    PubMed

    van Arensbergen, Joris; Dussaud, Sebastien; Pardanaud-Glavieux, Corinne; García-Hurtado, Javier; Sauty, Claire; Guerci, Aline; Ferrer, Jorge; Ravassard, Philippe

    2017-01-01

    Lineage-selective expression of developmental genes is dependent on the interplay between activating and repressive mechanisms. Gene activation is dependent on cell-specific transcription factors that recognize transcriptional enhancer sequences. Gene repression often depends on the recruitment of Polycomb group (PcG) proteins, although the sequences that underlie the recruitment of PcG proteins, also known as Polycomb response elements (PREs), remain poorly understood in vertebrates. While distal PREs have been identified in mammals, a role for positive-acting enhancers in PcG-mediated repression has not been described. Here we have used a highly efficient procedure based on lentiviral-mediated transgenesis to carry out in vivo fine-mapping of, cis-regulatory sequences that control lineage-specific activation of Neurog3, a master regulator of pancreatic endocrine differentiation. Our findings reveal an enhancer region that is sufficient to drive correct spacio-temporal expression of Neurog3 and demonstrate that this same region serves as a PRE in alternative lineages where Neurog3 is inactive.

  9. A distal intergenic region controls pancreatic endocrine differentiation by acting as a transcriptional enhancer and as a polycomb response element

    PubMed Central

    Pardanaud-Glavieux, Corinne; García-Hurtado, Javier; Sauty, Claire; Guerci, Aline; Ferrer, Jorge

    2017-01-01

    Lineage-selective expression of developmental genes is dependent on the interplay between activating and repressive mechanisms. Gene activation is dependent on cell-specific transcription factors that recognize transcriptional enhancer sequences. Gene repression often depends on the recruitment of Polycomb group (PcG) proteins, although the sequences that underlie the recruitment of PcG proteins, also known as Polycomb response elements (PREs), remain poorly understood in vertebrates. While distal PREs have been identified in mammals, a role for positive-acting enhancers in PcG-mediated repression has not been described. Here we have used a highly efficient procedure based on lentiviral-mediated transgenesis to carry out in vivo fine-mapping of, cis-regulatory sequences that control lineage-specific activation of Neurog3, a master regulator of pancreatic endocrine differentiation. Our findings reveal an enhancer region that is sufficient to drive correct spacio-temporal expression of Neurog3 and demonstrate that this same region serves as a PRE in alternative lineages where Neurog3 is inactive. PMID:28225770

  10. Region-dependent dynamics of cAMP response element-binding protein phosphorylation in the basal ganglia

    PubMed Central

    Liu, Fu-Chin; Graybiel, Ann M.

    1998-01-01

    The cAMP response element-binding protein (CREB) is an activity-dependent transcription factor that is involved in neural plasticity. The kinetics of CREB phosphorylation have been suggested to be important for gene activation, with sustained phosphorylation being associated with downstream gene expression. If so, the duration of CREB phosphorylation might serve as an indicator for time-sensitive plastic changes in neurons. To screen for regions potentially involved in dopamine-mediated plasticity in the basal ganglia, we used organotypic slice cultures to study the patterns of dopamine- and calcium-mediated CREB phosphorylation in the major subdivisions of the striatum. Different durations of CREB phosphorylation were evoked in the dorsal and ventral striatum by activation of dopamine D1-class receptors. The same D1 stimulus elicited (i) transient phosphorylation (≤15 min) in the matrix of the dorsal striatum; (ii) sustained phosphorylation (≤2 hr) in limbic-related structures including striosomes, the nucleus accumbens, the fundus striati, and the bed nucleus of the stria terminalis; and (iii) prolonged phosphorylation (up to 4 hr or more) in cellular islands in the olfactory tubercle. Elevation of Ca2+ influx by stimulation of L-type Ca2+ channels, NMDA, or KCl induced strong CREB phosphorylation in the dorsal striatum but not in the olfactory tubercle. These findings differentiate the response of CREB to dopamine and calcium signals in different striatal regions and suggest that dopamine-mediated CREB phosphorylation is persistent in limbic-related regions of the neonatal basal ganglia. The downstream effects activated by persistent CREB phosphorylation may include time-sensitive neuroplasticity modulated by dopamine. PMID:9539803

  11. Joining of thermoplastic substrates by microwaves

    DOEpatents

    Paulauskas, Felix L.; Meek, Thomas T.

    1997-01-01

    A method for joining two or more items having surfaces of thermoplastic material includes the steps of depositing an electrically-conductive material upon the thermoplastic surface of at least one of the items, and then placing the other of the two items adjacent the one item so that the deposited material is in intimate contact with the surfaces of both the one and the other items. The deposited material and the thermoplastic surfaces contacted thereby are then exposed to microwave radiation so that the thermoplastic surfaces in contact with the deposited material melt, and then pressure is applied to the two items so that the melted thermoplastic surfaces fuse to one another. Upon discontinuance of the exposure to the microwave energy, and after permitting the thermoplastic surfaces to cool from the melted condition, the two items are joined together by the fused thermoplastic surfaces. The deposited material has a thickness which is preferably no greater than a skin depth, .delta..sub.s, which is related to the frequency of the microwave radiation and characteristics of the deposited material in accordance with an equation.

  12. Joining Composite Chassis Components on Heavy Trucks

    SciTech Connect

    Herling, Darrell R.; Klett, Lynn

    2003-09-27

    Class 8 trucks offer substantial opportunities for weight reduction with cost incentives resulting from increased payload and improved fuel efficiency. The chassis, suspension, drive train, and wheels contribute to approximately 40% of the truck weight and have components that are excellent candidates, in terms of material performance requirements, for replacement with low-density structural composite materials. However, actual or perceived deficiencies in joint reliability have, up to now, limited the use of polymer composites in this application. Researchers at Oak Ridge National Laboratory (ORNL) and Pacific Northwest National Laboratory (PNNL) have begun a project to overcome the major technical issues associated with joining thick fiber reinforced composite sections. The main objective is to develop both economical and robust attachment techniques for composite members joined to steel members. The research will be coordinated with an industry team led by Delphi Corporation that is developing and commercializing composite chassis members through funding from the Department of Energy's (DOE’s) High Strength Weight Reduction Materials Program, under the Office of FreedomCAR and Vehicle Technologies.

  13. Joining of Tungsten Armor Using Functional Gradients

    SciTech Connect

    John Scott O'Dell

    2006-12-31

    The joining of low thermal expansion armor materials such as tungsten to high thermal expansion heat sink materials has been a major problem in plasma facing component (PFC) development. Conventional planar bonding techniques have been unable to withstand the high thermal induced stresses resulting from fabrication and high heat flux testing. During this investigation, innovative functional gradient joints produced using vacuum plasma spray forming techniques have been developed for joining tungsten armor to copper alloy heat sinks. A model was developed to select the optimum gradient architecture. Based on the modeling effort, a 2mm copper rich gradient was selected. Vacuum plasma pray parameters and procedures were then developed to produce the functional gradient joint. Using these techniques, dual cooling channel, medium scale mockups (32mm wide x 400mm length) were produced with vacuum plasma spray formed tungsten armor. The thickness of the tungsten armor was up to 5mm thick. No evidence of debonding at the interface between the heat sink and the vacuum plasma sprayed material was observed.

  14. Effect of material flow on joint strength in activation spot joining of Al alloy and steel sheets

    NASA Astrophysics Data System (ADS)

    Watanabe, Goro; Yogo, Yasuhiro; Takao, Hisaaki

    2014-08-01

    A new joining method for dissimilar metal sheets was developed where a rotated consumable rod of Al alloy is pressed onto an Al alloy sheet at the part overlapped with a mild steel sheet. The metal flow in the joining region is increased by the through-hole in the Al sheet and consumable Al rod. The rod creates the joint interface and pads out of the thinly joined parts through pressing. This produces a higher joint strength than that of conventional friction stir spot welding. Measurements of the joint interface showed the presence of a 5-10 nm thick amorphous layer consisting of Al and Mg oxides.

  15. A transient FGM interlayer based approach to joining ceramics

    SciTech Connect

    Glaeser, A.M.; Shalz, M.L.; Dalgleish, B.J.; Tomsia, A.P.

    1993-01-01

    In most cases, functionally gradient materials have been designed to produce a desirable property gradient in a material or in a joint region. In this paper, the concept of a transient gradient structure is introduced. The function of the intentional property discontinuities in these multilayer interlayers is to facilitate processing of assemblies and materials combinations that would be difficult to process using conventional bonding approaches. Specifically, the methods make use of a thin or partial layer of a low melting point transient liquid phase to facilitate bonding via brazing, yet produce refractory joints. Several mechanisms for consuming the transient liquid former are outlined, and examples of interlayer designs that exploit these mechanisms are presented. Specific results from experiments joining alumina to alumina via Cu/Pt/Cu, Cu/Ni/Cu, Cu/Nb/Cu and Sn/Nb/Sn interlayers are presented.

  16. Vitamin D Responsive Elements within the HLA-DRB1 Promoter Region in Sardinian Multiple Sclerosis Associated Alleles

    PubMed Central

    Murru, Maria Rita; Corongiu, Daniela; Tranquilli, Stefania; Fadda, Elisabetta; Murru, Raffaele; Schirru, Lucia; Secci, Maria Antonietta; Costa, Gianna; Asunis, Isadora; Cuccu, Stefania; Fenu, Giuseppe; Lorefice, Lorena; Carboni, Nicola; Mura, Gioia; Rosatelli, Maria Cristina; Marrosu, Maria Giovanna

    2012-01-01

    Vitamin D response elements (VDREs) have been found in the promoter region of the MS-associated allele HLA-DRB1*15∶01, suggesting that with low vitamin D availability VDREs are incapable of inducing *15∶01 expression allowing in early life autoreactive T-cells to escape central thymic deletion. The Italian island of Sardinia exhibits a very high frequency of MS and high solar radiation exposure. We test the contribution of VDREs analysing the promoter region of the MS-associated DRB1 *04∶05, *03∶01, *13∶01 and *15∶01 and non-MS-associated *16∶01, *01, *11, *07∶01 alleles in a cohort of Sardinians (44 MS patients and 112 healthy subjects). Sequencing of the DRB1 promoter region revealed a homozygous canonical VDRE in all *15∶01, *16∶01, *11 and in 45/73 *03∶01 and in heterozygous state in 28/73 *03∶01 and all *01 alleles. A new mutated homozygous VDRE was found in all *13∶03, *04∶05 and *07∶01 alleles. Functionality of mutated and canonical VDREs was assessed for its potential to modulate levels of DRB1 gene expression using an in vitro transactivation assay after stimulation with active vitamin D metabolite. Vitamin D failed to increase promoter activity of the *04∶05 and *03∶01 alleles carrying the new mutated VDRE, while the *16∶01 and *03∶01 alleles carrying the canonical VDRE sequence showed significantly increased transcriptional activity. The ability of VDR to bind the mutant VDRE in the DRB1 promoter was evaluated by EMSA. Efficient binding of VDR to the VDRE sequence found in the *16∶01 and in the *15∶01 allele reduced electrophoretic mobility when either an anti-VDR or an anti-RXR monoclonal antibody was added. Conversely, the Sardinian mutated VDRE sample showed very low affinity for the RXR/VDR heterodimer. These data seem to exclude a role of VDREs in the promoter region of the DRB1 gene in susceptibility to MS carried by DRB1* alleles in Sardinian patients. PMID:22848563

  17. Vitamin D responsive elements within the HLA-DRB1 promoter region in Sardinian multiple sclerosis associated alleles.

    PubMed

    Cocco, Eleonora; Meloni, Alessandra; Murru, Maria Rita; Corongiu, Daniela; Tranquilli, Stefania; Fadda, Elisabetta; Murru, Raffaele; Schirru, Lucia; Secci, Maria Antonietta; Costa, Gianna; Asunis, Isadora; Cuccu, Stefania; Fenu, Giuseppe; Lorefice, Lorena; Carboni, Nicola; Mura, Gioia; Rosatelli, Maria Cristina; Marrosu, Maria Giovanna

    2012-01-01

    Vitamin D response elements (VDREs) have been found in the promoter region of the MS-associated allele HLA-DRB1*15:01, suggesting that with low vitamin D availability VDREs are incapable of inducing *15:01 expression allowing in early life autoreactive T-cells to escape central thymic deletion. The Italian island of Sardinia exhibits a very high frequency of MS and high solar radiation exposure. We test the contribution of VDREs analysing the promoter region of the MS-associated DRB1 *04:05, *03:01, *13:01 and *15:01 and non-MS-associated *16:01, *01, *11, *07:01 alleles in a cohort of Sardinians (44 MS patients and 112 healthy subjects). Sequencing of the DRB1 promoter region revealed a homozygous canonical VDRE in all *15:01, *16:01, *11 and in 45/73 *03:01 and in heterozygous state in 28/73 *03:01 and all *01 alleles. A new mutated homozygous VDRE was found in all *13:03, *04:05 and *07:01 alleles. Functionality of mutated and canonical VDREs was assessed for its potential to modulate levels of DRB1 gene expression using an in vitro transactivation assay after stimulation with active vitamin D metabolite. Vitamin D failed to increase promoter activity of the *04:05 and *03:01 alleles carrying the new mutated VDRE, while the *16:01 and *03:01 alleles carrying the canonical VDRE sequence showed significantly increased transcriptional activity. The ability of VDR to bind the mutant VDRE in the DRB1 promoter was evaluated by EMSA. Efficient binding of VDR to the VDRE sequence found in the *16:01 and in the *15:01 allele reduced electrophoretic mobility when either an anti-VDR or an anti-RXR monoclonal antibody was added. Conversely, the Sardinian mutated VDRE sample showed very low affinity for the RXR/VDR heterodimer. These data seem to exclude a role of VDREs in the promoter region of the DRB1 gene in susceptibility to MS carried by DRB1* alleles in Sardinian patients.

  18. Pole-equator difference and the variability of the brightness of the chromospheric CaII-K-network elements in quiet regions over the solar cycle

    NASA Technical Reports Server (NTRS)

    Kariyappa, R.

    1995-01-01

    The dependence of the brightness of chromospheric network elements on latitude was investigated for quiet solar regions. Calibrated photographic CaII K-spectroheliograms were used to compare the variation in brightness at the center of the disk with higher latitude of chromospheric network elements in a quiet region as a function of solar activity. It was found that there was no significant difference in brightness between the center of the solar disk and higher latitude. It is concluded that the brightness of the chromospheric network elements in a quiet region does not depend on the latitude, but that the variation in the intensity enhancement is related to the level of solar activity.

  19. Optimum structural sizing of conventional cantilever and joined wing configurations using equivalent beam models

    NASA Technical Reports Server (NTRS)

    Hajela, P.; Chen, J. L.

    1986-01-01

    The present paper describes an approach for the optimum sizing of single and joined wing structures that is based on representing the built-up finite element model of the structure by an equivalent beam model. The low order beam model is computationally more efficient in an environment that requires repetitive analysis of several trial designs. The design procedure is implemented in a computer program that requires geometry and loading data typically available from an aerodynamic synthesis program, to create the finite element model of the lifting surface and an equivalent beam model. A fully stressed design procedure is used to obtain rapid estimates of the optimum structural weight for the beam model for a given geometry, and a qualitative description of the material distribution over the wing structure. The synthesis procedure is demonstrated for representative single wing and joined wing structures.

  20. Stable isotopic compositions of elemental carbon in PM1.1 in north suburb of Nanjing Region, China

    NASA Astrophysics Data System (ADS)

    Guo, Zhaobing; Jiang, Wenjuan; Chen, Shanli; Sun, Deling; Shi, Lei; Zeng, Gang; Rui, Maoling

    2016-02-01

    Stable isotopic compositions (δ13C) of elemental carbon (EC) in PM1.1 in north suburb of Nanjing region were determined in order to quantitatively evaluate the carbon sources of atmospheric fine particles during different seasons. Besides, δ13C values from potential sources such as coal combustion, vehicle exhaust, biomass burning, and dust were synchronously measured. The results showed that the average δ13C values of EC in PM1.1 in winter and summer were - 23.89 ± 1.6‰ and - 24.76 ± 0.9‰, respectively. Comparing with δ13C values from potential sources, we concluded that the main sources of EC in PM1.1 were from the emission of coal combustion and vehicle exhaust. The higher δ13C values in winter than those in summer were chiefly attributed to the more coal consumption. Combining with the concentrations of SO42 - and K+ in PM1.1, the high δ13C values of EC on 24 December and 27 December 2013 were ascribed to extra input of corn straw burning in addition to coal combustion and vehicle exhaust.

  1. G. N. Rassam Joins AGU Staff

    NASA Astrophysics Data System (ADS)

    Ghassan N. Rassam joined the AGU staff today, assuming the dual roles of Division Director for Public Information and Marketing and of Special Assistant for Nonprint Publications. He comes to AGU from the American Geological Institute, where he has been chief editor and assistant director of the GeoRef Information System.As Director of Public Information and Marketing, Rassam will head one of AGU's five divisions. He will have under his purview the Public Information Department and the Promotion and Sales Department. The Public Information Department produces Eos and also has the responsibility for press relations, including the preparation of news releases and the operation of press rooms at meetings. These activities are critical to the implementation of AGU's public education and public affairs initiatives, as well as to the central role of AGU in promoting the unity of geophysics.

  2. High time-resolved elemental components in fine and coarse particles in the Pearl River Delta region of Southern China: Dynamic variations and effects of meteorology.

    PubMed

    Zhou, Shengzhen; Davy, Perry K; Wang, Xuemei; Cohen, Jason Blake; Liang, Jiaquan; Huang, Minjuan; Fan, Qi; Chen, Weihua; Chang, Ming; Ancelet, Travis; Trompetter, William J

    2016-12-01

    Hourly-resolved PM2.5 and PM10-2.5 samples were collected in the industrial city Foshan in the Pearl River Delta region, China. The samples were subsequently analyzed for elemental components and black carbon (BC). A key purpose of the study was to understand the composition of particulate matter (PM) at high-time resolution in a polluted urban atmosphere to identify key components contributing to extreme PM concentration events and examine the diurnal chemical concentration patterns for air quality management purposes. It was found that BC and S concentrations dominated in the fine mode, while elements with mostly crustal and oceanic origins such as Si, Ca, Al and Cl were found in the coarse size fraction. Most of the elements showed strong diurnal variations. S did not show clear diurnal variations, suggesting regional rather than local origin. Based on empirical orthogonal functions (EOF) method, 3 forcing factors were identified contributing to the extreme events of PM2.5 and selected elements, i.e., urban direct emissions, wet deposition and a combination of coarse mode sources. Conditional probability functions (CPF) were performed using wind profiles and elemental concentrations. The CPF results showed that BC and elemental Cl, K, Fe, Cu and Zn in the fine mode were mostly from the northwest, indicating that industrial emissions and combustion were the main sources. For elements in the coarse mode, Si, Al, K, Ca, Fe and Ti showed similar patterns, suggesting same sources such as local soil dust/construction activities. Coarse elemental Cl was mostly from the south and southeast, implying the influence of marine aerosol sources. For other trace elements, we found vanadium (V) in fine PM was mainly from the sources located to the southeast of the measuring site. Combined with CPF results of S and V in fine PM, we concluded shipping emissions were likely an important elemental emission source.

  3. Conjoint Forming - Technologies for Simultaneous Forming and Joining

    NASA Astrophysics Data System (ADS)

    Groche, P.; Wohletz, S.; Mann, A.; Krech, M.; Monnerjahn, V.

    2016-03-01

    The market demand for new products optimized for e. g. lightweight applications or smart components leads to new challenges in production engineering. Hybrid structures represent one promising approach. They aim at higher product performance by using a suitable combination of different materials. The developments of hybrid structures stimulate the research on joining of dissimilar materials. Since they allow for joining dissimilar materials without external heating technologies based on joining by plastic deformation seem to be of special attractiveness. The paper at hand discusses the conjoint forming approach. This approach combines forming and joining in one process. Two or more workpieces are joined while at least one workpiece is plastically deformed. After presenting the fundamental joining mechanisms, the conjoint forming approach is discussed comprehensively. Examples of conjoint processes demonstrate the effectiveness and reveal the underlying phenomena.

  4. Research on microwave joining of SiC

    SciTech Connect

    1995-12-31

    The objectives of this research project are to identify optimum time-temperature profiles for the microwave joining of silicon carbide and to develop new microwave joining methods that can be applied to accomplish in situ formation of silicon carbide interlayers and to join larger samples required for industrial applications. Work during this reporting period was focused on investigation of the effect of specimen preparation on joining of SiC using polymer precursors to form SiC in situ at the interface. During this period, LANL also completed the evaluation of joints that were made by FMT using four different joining temperatures, as part of an effort to determine optimum joining temperature.

  5. Regional electric field induced by electroconvulsive therapy in a realistic finite element head model: Influence of white matter anisotropic conductivity

    PubMed Central

    Lee, Won Hee; Deng, Zhi-De; Kim, Tae-Seong; Laine, Andrew F.; Lisanby, Sarah H.; Peterchev, Angel V.

    2012-01-01

    We present the first computational study investigating the electric field (E-field) strength generated by various electroconvulsive therapy (ECT) electrode configurations in specific brain regions of interest (ROIs) that have putative roles in the therapeutic action and/or adverse side effects of ECT. This study also characterizes the impact of the white matter (WM) conductivity anisotropy on the E-field distribution. A finite element head model incorporating tissue heterogeneity and WM anisotropic conductivity was constructed based on structural magnetic resonance imaging (MRI) and diffusion tensor MRI data. We computed the spatial E-field distributions generated by three standard ECT electrode placements including bilateral (BL), bifrontal (BF), and right unilateral (RUL) and an investigational electrode configuration for focal electrically administered seizure therapy (FEAST). The key results are that (1) the median E-field strength over the whole brain is 3.9, 1.5, 2.3, and 2.6 V/cm for the BL, BF, RUL, and FEAST electrode configurations, respectively, which coupled with the broad spread of the BL E-field suggests a biophysical basis for observations of superior efficacy of BL ECT compared to BF and RUL ECT; (2) in the hippocampi, BL ECT produces a median E-field of 4.8 V/cm that is 1.5–2.8 times stronger than that for the other electrode configurations, consistent with the more pronounced amnestic effects of BL ECT; and (3) neglecting the WM conductivity anisotropy results in E-field strength error up to 18% overall and up to 39% in specific ROIs, motivating the inclusion of the WM conductivity anisotropy in accurate head models. This computational study demonstrates how the realistic finite element head model incorporating tissue conductivity anisotropy provides quantitative insight into the biophysics of ECT, which may shed light on the differential clinical outcomes seen with various forms of ECT, and may guide the development of novel stimulation

  6. Holographic optical assembly and photopolymerized joining of planar microspheres.

    PubMed

    Shaw, L A; Chizari, S; Panas, R M; Shusteff, M; Spadaccini, C M; Hopkins, J B

    2016-08-01

    The aim of this research is to demonstrate a holographically driven photopolymerization process for joining colloidal particles to create planar microstructures fixed to a substrate, which can be monitored with real-time measurement. Holographic optical tweezers (HOT) have been used to arrange arrays of microparticles prior to this work; here we introduce a new photopolymerization process for rapidly joining simultaneously handled microspheres in a plane. Additionally, we demonstrate a new process control technique for efficiently identifying when particles have been successfully joined by measuring a sufficient reduction in the particles' Brownian motion. This technique and our demonstrated joining approach enable HOT technology to take critical steps toward automated additive fabrication of microstructures.

  7. A NEW APPROACH TO JOINING SIC/SIC COMPOSITES

    SciTech Connect

    Henager, Charles H.

    2004-06-30

    A new approach to joining SiC-based ceramics is described and evaluated for Fusion Energy systems. The joining method is based on pre-ceramic polymers filled with reactive and inert filler powders and is similar to other approaches that use such materials. This approach differs in the particular polymer system and in the details of the processing. A principal advantage of this approach relative to other, similar approaches is that the polymer system is easily handled in ambient air and can be processed in air. This makes the joining process simple and field repairable. The joining compound is a liquid that can be painted, sprayed, or applied by dip coating.

  8. UK Announces Intention to Join ESO

    NASA Astrophysics Data System (ADS)

    2000-11-01

    Summary The Particle Physics and Astronomy Research Council (PPARC) , the UK's strategic science investment agency, today announced that the government of the United Kingdom is making funds available that provide a baseline for this country to join the European Southern Observatory (ESO) . The ESO Director General, Dr. Catherine Cesarsky , and the ESO Community warmly welcome this move towards fuller integration in European astronomy. "With the UK as a potential member country of ESO, our joint opportunities for front-line research and technology will grow significantly", she said. "This announcement is a clear sign of confidence in ESO's abilities, most recently demonstrated with the construction and operation of the unique Very Large Telescope (VLT) on Paranal. Together we will look forward with confidence towards new, exciting projects in ground-based astronomy." It was decided earlier this year to place the 4-m UK Visible and Infrared Survey Telescope (VISTA) at Paranal, cf. ESO Press Release 03/00. Following negotiations between ESO and PPARC, a detailed proposal for the associated UK/ESO Agreement with the various entry modalities will now be presented to the ESO Council for approval. Before this Agreement can enter into force, the ESO Convention and associated protocols must also be ratified by the UK Parliament. Research and key technologies According to the PPARC press release, increased funding for science, announced by the UK government today, will enable UK astronomers to prepare for the next generation of telescopes and expand their current telescope portfolio through membership of the European Southern Observatory (ESO). The uplift to its baseline budget will enable PPARC to enter into final negotiations for UK membership of the ESO. This will ensure that UK astronomers, together with their colleagues in the ESO member states, are actively involved in global scale preparations for the next generation of astronomy facilities. among these are ALMA

  9. Isotope and trace element data bearing of the sources and evolution of magmas in the Katmai region, Alaska

    SciTech Connect

    Rubenstone, J.L.; Langmuir, C.H.; Hildreth, W.

    1985-01-01

    The Katmai volcanic province, Alaska Peninsula, includes the catastrophic 1912 Valley of Ten Thousand Smokes (VTTS) eruption, and five andesite-dacite stratovolcanoes. The VTTS is markedly uniform in /sup 143/Nd//sup 144/Nd (0.51301) and delta/sup 18/O (6.0 per thousands) but has a small but significant variation in /sup 87/Sr//sup 86/Sr (0.70354 in andesite and dacite, 0.70368 in rhyolite). The rhyolite's low Sr content (63 ppm) makes it particularly susceptible to crustal contamination; assimilation of only 1% of Jurassic country rock (0.70480, 400 ppm Sr) is sufficient. Dacite from the 1959 eruption of nearby Mt. Trident and a basalt boulder from the rim of Mt. Katmai are isotopically similar to the VTTS andesite and dacite. Dacite from Mt. Mageik has higher /sup 87/Sr//sup 86/Sr, whereas the least-silicic in situ lava in the region, an andesite from Mt. Griggs, has the lowest /sup 87/Sr//sup 86/Sr (0.70335). The Katmai Province falls within the narrow range of /sup 143/Nd//sup 144/Nd for Quaternary lavas from the Aleutians and SW Alaska Peninsula (0.51298-0.51310) but at the high end of the /sup 87/Sr//sup 86/Sr range. Along with the greater abundance of evolved lavas, this probably reflects progressively thicker crust northward along the Alaska Peninsula, although simple assimilation of upper crust cannot explain all of the isotopic data. Isotopic systematics, and Aleutian-type trace-element patterns (La/Yb > chondrites, high Ba/La), indicate that the parental magmas at Katmai are likewise derived from a time-integrated depleted mantle, recently modified by a component from the subducted slab.

  10. Spatial and seasonal variations of atmospheric organic carbon and elemental carbon in Pearl River Delta Region, China

    NASA Astrophysics Data System (ADS)

    Cao, J. J.; Lee, S. C.; Ho, K. F.; Zou, S. C.; Fung, Kochy; Li, Y.; Watson, John G.; Chow, Judith C.

    The concentrations of organic carbon (OC) and elemental carbon (EC) in atmospheric particles were investigated at eight sites in four cities (Hong Kong, Guangzhou, Shenzhen and Zhuhai) of the Pearl River Delta Region (PRDR), China, during winter and summer 2002. The comparison of summer and winter results was made in order to investigate spatial and seasonal variations. PM 2.5 and PM 10 samples were collected on pre-fired quartz filters with mini-volume samplers and analyzed by the thermal optical reflectance (TOR) method following the Interagency Monitoring of PROtected Visual Environments (IMPROVE) protocol. During summer, the average OC and EC concentrations in PM 2.5 were 9.2 and 4.1 μg m -3, while those in PM 10 were 12.3 and 5.2 μg m -3. Carbonaceous aerosol accounted for 38.0% of the PM 2.5 and 32.9% of the PM 10. The daily average OC, EC, PM 2.5 and PM 10 concentrations in PRDR were higher in winter than in summer. The average OC/EC ratio was 2.5 for PM 2.5 and PM 10, suggesting the presence of secondary organic aerosols. The estimated secondary organic carbons in PM 2.5 and PM 10 were 4.1 and 5.6 μg m -3, respectively. The OC and EC were found to be correlated in winter (correlation coefficient r=0.82) and summer ( r=0.64), which implied that motor vehicle sources contributed to the ambient carbonaceous particles. The distribution of eight carbon fractions in OC and EC at eight sites was first reported in ambient samples in Asia, which also indicated that motor vehicle exhaust was the dominant contributor to carbonaceous particles.

  11. Identification of polycomb and trithorax group responsive elements in the regulatory region of the Drosophila homeotic gene Sex combs reduced

    SciTech Connect

    Gindhart, J.G. Jr.; Kaufman, T.C.

    1995-02-01

    The Drosophilia homeotic gene Sex combs reduced (Scr) is necessary for the establishment and maintenance of the morphological identity of the labial and prothoracic segments. In the early embryo, its expression pattern is established through the activity of several gap and segmentation gene products, as well as other transcription factors. Once established, the Polycomb group (Pc-G) and trithorax group (trx-G) gene products maintain the spatial pattern of Scr expression for the remainder of development. We report the identification of DNA fragments in the Scr regulatory region that may be important for its regulation by Polycomb and trithorax group gene products. When DNA fragments containing these regulatory sequences are subcloned into P-element vectors containing a white minigene, transformants containing these constructs exhibit mosaic patterns of pigmentation in the adult eye, indicating that white minigene expression is repressed in a clonally heritable manner. The size of pigmented and nonpigmented clones in the adult eye suggests that the event determining whether a cell in the eye anlagen will express white occurs at least as early as the first larval instar. The amount of white minigene repression is reduced in some Polycomb group mutants, whereas repression is enhanced in flies mutant for a subset of trithorax group loci. The repressor activity of one fragment, normally located in Scr Intron 2, is increased when it is able to homologously pair, a property consistent with genetic data suggesting that Scr exhibits transvection. Another Scr regulatory fragment, normally located 40 kb upstream of the Scr promoter, silences ectopic expression of an Scr-lacZ fusion gene in the embryo and does so in a Polycomb-dependent manner. We propose that the regulatory sequences located within these DNA fragments may normally mediate the regulation of Scr by proteins encoded by members of Polycomb and trithorax group loci. 98 refs., 6 figs., 4 tabs.

  12. Elements of regional beetle faunas: faunal variation and compositional breakpoints along climate, land cover and geographical gradients.

    PubMed

    Heino, Jani; Alahuhta, Janne

    2015-03-01

    Regional faunas are structured by historical, spatial and environmental factors. We studied large-scale variation in four ecologically different beetle groups (Coleoptera: Dytiscidae, Carabidae, Hydrophiloidea, Cerambycidae) along climate, land cover and geographical gradients, examined faunal breakpoints in relation to environmental variables, and investigated the best fit pattern of assemblage variation (i.e. randomness, checkerboards, nestedness, evenly spaced, Gleasonian, Clementsian). We applied statistical methods typically used in the analysis of local ecological communities to provide novel insights into faunal compositional patterns at large spatial grain and geographical extent. We found that spatially structured variation in climate and land cover accounted for most variation in each beetle group in partial redundancy analyses, whereas the individual effect of each explanatory variable group was generally much less important in accounting for variation in provincial species composition. We also found that climate variables were most strongly associated with faunal breakpoints, with temperature-related variables alone accounting for about 20% of variation at the first node of multivariate regression tree for each beetle group. The existence of faunal breakpoints was also shown by the 'elements of faunal structure' analyses, which suggested Clementsian gradients across the provinces, that is, that there were two or more clear groups of species responding similarly to the underlying ecological gradients. The four beetle groups showed highly similar biogeographical patterns across our study area. The fact that temperature was related to faunal breakpoints in the species composition of each beetle group suggests that climate sets a strong filter to the distributions of species at this combination of spatial grain and spatial extent. This finding held true despite the ecological differences among the four beetle groups, ranging from fully aquatic to fully

  13. Investigation of spatial and historical variations of air pollution around an industrial region using trace and macro elements in tree components.

    PubMed

    Odabasi, Mustafa; Tolunay, Doganay; Kara, Melik; Ozgunerge Falay, Ezgi; Tuna, Gizem; Altiok, Hasan; Dumanoglu, Yetkin; Bayram, Abdurrahman; Elbir, Tolga

    2016-04-15

    Several trace and macro elements (n=48) were measured in pine needle, branch, bark, tree ring, litter, and soil samples collected at 27 sites (21 industrial, 6 background) to investigate their spatial and historical variation in Aliaga industrial region in Turkey. Concentrations generally decreased with distance from the sources and the lowest ones were measured at background sites far from major sources. Spatial distribution of anthropogenic trace elements indicated that their major sources in the region are the iron-steel plants, ship-breaking activities and the petroleum refinery. Patterns of 40 elements that were detected in most of the samples were also evaluated to assess their suitability for investigation of historical variations. Observed increasing trends of several trace and macro elements (As, Cr, Fe, Mo, Ni, V, Cu, Pb, Sb, Sn, and Hg) in the tree-ring samples were representative for the variations in anthropogenic emissions and resulting atmospheric concentrations in Aliaga region. It was shown that lanthanides (La, Ce, Pr, Nd, Sm, Gd, Dy, Er, Yb) could also be used for the investigation of historical variations due to specific industrial emissions (i.e., petroleum refining). Results of the present study showed that tree components, litter, and soil could be used to determine the spatial variations of atmospheric pollution in a region while tree rings could be used to assess the historical variations.

  14. Coupling lead isotopes and element concentrations in epiphytic lichens to track sources of air emissions in the Alberta Oil Sands Region

    EPA Science Inventory

    A study was conducted that coupled use of element concentrations and lead (Pb) isotope ratios in the lichen Hypogymnia physodes collected during 2002 and 2008, to assess the impacts of air emissions from the Alberta Oil Sands Region (AOSR, Canada) mining and processing operations...

  15. Whole process modeling of joining of flareless AA 6061-T4 tube by extrusion-bulging forming using a polyurethane elastomer medium

    NASA Astrophysics Data System (ADS)

    Yang, J. C.; Li, H.; Yang, H.; Li, G. J.

    2016-08-01

    The tube joining by plastic deformation proves to be a more efficient and environmentally friendly way to achieve the tube-tube joining compared with other traditional types, such as metallurgical joining and mechanical joining. In this study, to reveal the effects of the processing parameters on the filling quality and residual contact stress, an axisymmetric finite element (FE) model of the whole joining process, including extrusion-bulging forming and unloading, was established and validated. The aluminum alloy (AA) 6061-T4 tubes, the stainless steel (ST) 15-5PH sleeve and polyurethane (PU) elastomer medium were characterized and modeled. And the implicit algorithm was adopted by comparing the prediction results between explicit and implicit FE models. The characteristics of stress distribution and plastic strain for the tube, PU elastomer and sleeve were discussed.

  16. Systematic analysis of enhancer and critical cis-acting RNA elements in the protein-encoding region of the hepatitis C virus genome.

    PubMed

    Chu, Derrick; Ren, Songyang; Hu, Stacy; Wang, Wei Gang; Subramanian, Aparna; Contreras, Deisy; Kanagavel, Vidhya; Chung, Eric; Ko, Justine; Amirtham Jacob Appadorai, Ranjit Singh; Sinha, Sanjeev; Jalali, Ziba; Hardy, David W; French, Samuel W; Arumugaswami, Vaithilingaraja

    2013-05-01

    Hepatitis C virus (HCV) causes chronic hepatitis, cirrhosis, and liver cancer. cis-acting RNA elements of the HCV genome are critical for translation initiation and replication of the viral genome. We hypothesized that the coding regions of nonstructural proteins harbor enhancer and essential cis-acting replication elements (CRE). In order to experimentally identify new cis RNA elements, we utilized an unbiased approach to introduce synonymous substitutions. The HCV genome coding for nonstructural proteins (nucleotide positions 3872 to 9097) was divided into 17 contiguous segments. The wobble nucleotide positions of each codon were replaced, resulting in 33% to 41% nucleotide changes. The HCV genome containing one of each of 17 mutant segments (S1 to S17) was tested for genome replication and infectivity. We observed that silent mutations in segment 13 (S13) (nucleotides [nt] 7457 to 7786), S14 (nt 7787 to 8113), S15 (nt 8114 to 8440), S16 (nt 8441 to 8767), and S17 (nt 8768 to 9097) resulted in impaired genome replication, suggesting CRE structures are enriched in the NS5B region. Subsequent high-resolution mutational analysis of NS5B (nt 7787 to 9289) using approximately 51-nucleotide contiguous subsegment mutant viruses having synonymous mutations revealed that subsegments SS8195-8245, SS8654-8704, and SS9011-9061 were required for efficient viral growth, suggesting that these regions act as enhancer elements. Covariant nucleotide substitution analysis of a stem-loop, JFH-SL9098, revealed the formation of an extended stem structure, which we designated JFH-SL9074. We have identified new enhancer RNA elements and an extended stem-loop in the NS5B coding region. Genetic modification of enhancer RNA elements can be utilized for designing attenuated HCV vaccine candidates.

  17. Identification of negative-acting and protein-binding elements in the mouse alpha A-crystallin -1556/-1165 region.

    PubMed

    Sax, C M; Cvekl, A; Kantorow, M; Sommer, B; Chepelinsky, A B; Piatigorsky, J

    1994-07-08

    The mouse alpha A-crystallin-encoding gene (alpha A-cry) is expressed in a highly lens-preferred manner. To date, it has been shown that this lens-preferred expression is controlled by four proximal positive-acting transcriptional regulatory elements: DE1 (-111/-97), alpha A-CRYBP1 (-66/-57), PE1/TATA (-35/-19) and PE2 (+24/+43). The present study extends our knowledge of mouse alpha A-cry transcriptional regulatory elements to the far upstream region of that gene by demonstrating that the -1556 to -1165 region contains negative-acting sequence elements which function in transfected lens cells derived from mouse, rabbit and chicken. This is the first negative-acting regulatory region identified in mouse alpha A-cry. The -1556 to -1165 region contains sequences similar to repressor/silencer elements identified in other genes, including those highly expressed in the lens, such as the delta 1-crystallin (delta 1-cry) and vimentin (vim) genes. The -1480 to -1401 region specifically interacts with nuclear proteins isolated from the alpha TN4-1 mouse lens cell line. Contained within this protein-binding region and positioned at -1453 to -1444 is a sequence (RS1) similar to the chicken delta 1-cry intron 3 repressor, and which competes for the formation of -1480 to -1401 DNA-protein complexes. Our findings suggest that lens nuclear proteins bind to the mouse alpha A-cry RS1 region. We demonstrate that the chicken delta 1-cry intron repressor binds similar nuclear proteins in chicken embryonic lens cells and mouse alpha TN4-1 lens cells.(ABSTRACT TRUNCATED AT 250 WORDS)

  18. End Joining at Caenorhabditis elegans Telomeres

    PubMed Central

    Lowden, Mia Rochelle; Meier, Bettina; Lee, Teresa Wei-sy; Hall, Julie; Ahmed, Shawn

    2008-01-01

    Critically shortened telomeres can be subjected to DNA repair events that generate end-to-end chromosome fusions. The resulting dicentric chromosomes can enter breakage–fusion–bridge cycles, thereby impeding elucidation of the structures of the initial fusion events and a mechanistic understanding of their genesis. Current models for the molecular basis of fusion of critically shortened, uncapped telomeres rely on PCR assays that typically capture fusion breakpoints created by direct ligation of chromosome ends. Here we use independent approaches that rely on distinctive features of Caenorhabditis elegans to study the frequency of direct end-to-end chromosome fusion in telomerase mutants: (1) holocentric chromosomes that allow for genetic isolation of stable end-to-end fusions and (2) unique subtelomeric sequences that allow for thorough PCR analysis of samples of genomic DNA harboring multiple end-to-end fusions. Surprisingly, only a minority of end-to-end fusion events resulted from direct end joining with no additional genome rearrangements. We also demonstrate that deficiency for the C. elegans Ku DNA repair heterodimer does not affect telomere length or cause synthetic effects in the absence of telomerase. PMID:18780750

  19. Method of joining metals of significantly different expansion rates

    NASA Technical Reports Server (NTRS)

    Caler, W.; La Salle, F.; Traylor, J.

    1971-01-01

    To join a refractory metal to a dissimilar high-temperature metal, braze a section of high elasticity, high ductility metal /such as columbium or columbium alloy/ between the metals to be joined, using a fork-type joint to hold the braze and transition member in place during expansion.

  20. 49 CFR 192.283 - Plastic pipe: Qualifying joining procedures.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 3 2012-10-01 2012-10-01 false Plastic pipe: Qualifying joining procedures. 192... Materials Other Than by Welding § 192.283 Plastic pipe: Qualifying joining procedures. (a) Heat fusion... for making plastic pipe joints by a heat fusion, solvent cement, or adhesive method, the...

  1. 49 CFR 192.283 - Plastic pipe: Qualifying joining procedures.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 3 2013-10-01 2013-10-01 false Plastic pipe: Qualifying joining procedures. 192... Materials Other Than by Welding § 192.283 Plastic pipe: Qualifying joining procedures. (a) Heat fusion... for making plastic pipe joints by a heat fusion, solvent cement, or adhesive method, the...

  2. 49 CFR 192.283 - Plastic pipe: Qualifying joining procedures.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 3 2010-10-01 2010-10-01 false Plastic pipe: Qualifying joining procedures. 192... Materials Other Than by Welding § 192.283 Plastic pipe: Qualifying joining procedures. (a) Heat fusion... for making plastic pipe joints by a heat fusion, solvent cement, or adhesive method, the...

  3. 49 CFR 192.283 - Plastic pipe: Qualifying joining procedures.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 3 2011-10-01 2011-10-01 false Plastic pipe: Qualifying joining procedures. 192... Materials Other Than by Welding § 192.283 Plastic pipe: Qualifying joining procedures. (a) Heat fusion... for making plastic pipe joints by a heat fusion, solvent cement, or adhesive method, the...

  4. 49 CFR 192.283 - Plastic pipe: Qualifying joining procedures.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 3 2014-10-01 2014-10-01 false Plastic pipe: Qualifying joining procedures. 192... Materials Other Than by Welding § 192.283 Plastic pipe: Qualifying joining procedures. (a) Heat fusion... for making plastic pipe joints by a heat fusion, solvent cement, or adhesive method, the...

  5. 46 CFR 56.75-30 - Pipe joining details.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ...) Copper-alloy brazing. (1) Copper-alloy brazing may be employed to join pipe, valves, and fittings... satisfactory for the brazing alloy to be employed, method of heating, and material to be joined. The annular... in place until the brazing alloy has set so as to prevent any strain on the joint until the...

  6. 46 CFR 56.75-30 - Pipe joining details.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ...) Copper-alloy brazing. (1) Copper-alloy brazing may be employed to join pipe, valves, and fittings... satisfactory for the brazing alloy to be employed, method of heating, and material to be joined. The annular... in place until the brazing alloy has set so as to prevent any strain on the joint until the...

  7. Structure-Property Correlations in Microwave Joining of Inconel 718

    NASA Astrophysics Data System (ADS)

    Bansal, Amit; Sharma, Apurbba Kumar; Kumar, Pradeep; Das, Shantanu

    2015-09-01

    The butt joining of Inconel 718 plates at 981°C solution treated and aged (981STA) condition was carried out using the microwave hybrid heating technique with Inconel 718 powder as a filler material. The developed joints were free from any microfissures (cracks) and were metallurgically bonded through complete melting of the powder particles. The as-welded joints were subjected to postweld heat treatments, including direct-aged, 981STA and 1080STA. The microstructural features of the welded joints were investigated using a field emission-scanning electron microscope equipped with x-ray elemental analysis. Microhardness and room-temperature tensile properties of the welded joints were evaluated. The postweld heat-treated specimens exhibited higher microhardness and tensile strength than the as-welded specimens due to the formation of strengthening precipitates in the microstructure after postweld heat treatments. The microhardness of the fusion zone of the joint in 1080STA condition was higher than all welded conditions due to the complete dissolution of Laves phase after 1080STA treatment. However, the tensile strength of the welded specimen in 981STA condition was higher than all welded conditions. The tensile strength in 1080STA condition was lower than that in 981STA condition because of the grain coarsening that took place after 1080STA condition. The fractography of the fractured surfaces was carried out to determine the structure-property-fracture correlation.

  8. Thermal-stress-free fasteners for joining orthotropic materials

    NASA Technical Reports Server (NTRS)

    Blosser, M. L.

    1987-01-01

    Hot structures fabricated from orthotropic materials are an attractive design option for future high speed vehicles. Joining subassemblies of these materials with standard cylindrical fasteners can lead to loose joints or highly stressed joints due to thermal stress. A method has been developed to eliminate thermal stresses and maintain a tight joint by shaping the fastener and mating hole. This method allows both materials (fastener and structure), with different coefficients of thermal expansion (CTEs) in each of the three material directions, to expand freely with temperature yet remain in contact. For the assumptions made in the analysis, the joint will remain snug, yet free of thermal stress at any temperature. Finite element analysis was used to verify several thermal-stress-free fasteners and to show that conical fasteners, which are thermal-stress-free for isotropic materials, can reduce thermal stresses for transversely isotropic materials compared to a cylindrical fastener. Equations for thermal-stress-free shapes are presented and typical fastener shapes are shown.

  9. Toroid Joining Gun. [thermoplastic welding system using induction heating

    NASA Technical Reports Server (NTRS)

    Buckley, J. D.; Fox, R. L.; Swaim, R J.

    1985-01-01

    The Toroid Joining Gun is a low cost, self-contained, portable low powered (100-400 watts) thermoplastic welding system developed at Langley Research Center for joining plastic and composite parts using an induction heating technique. The device developed for use in the fabrication of large space sructures (LSST Program) can be used in any atmosphere or in a vacuum. Components can be joined in situ, whether on earth or on a space platform. The expanded application of this welding gun is in the joining of thermoplastic composites, thermosetting composites, metals, and combinations of these materials. Its low-power requirements, light weight, rapid response, low cost, portability, and effective joining make it a candidate for solving many varied and unique bonding tasks.

  10. Rapid infrared joining takes on the advanced materials

    NASA Astrophysics Data System (ADS)

    Blue, C. A.; Warrier, S. G.; Robson, M. T.; Lin, R. Y.

    1993-06-01

    In this work, 4340 steel was joined with a nickel-based brazing alloy AMS 4777, using rapid infrared joining technique (Blue et al., 1991), and the microstructure of the joint was examined using SEM. The effects of the bond thickness and the joint lap area on the bond shear strength were investigated following the ASTM D1002-72 standard joint testing procedure. Results of SEM examination indicated that the microstructure of the material was preserved throughout the joining process. Bond shear tests showed that, as the bond thickness increases, the shear strength also increases, reaching a constant bond strength plateau at about 2 mils. It is concluded that, compared with traditional joining methods, the rapid infrared joining technique has the advantages of fast heating, little energy consumption, easy operation, no need for vacuum, little metallurgical modification to the base metal, and low cost.

  11. Affordable, Robust Ceramic Joining Technology (ARCJoinT)

    NASA Technical Reports Server (NTRS)

    Singh, M.

    1998-01-01

    Joining is recognized as one of the enabling technologies for the application of silicon carbide-based ceramic and composite components in a number of demanding and high temperature applications in aerospace and ground-based systems. An affordable, robust ceramic joining technology (ARCJoinT) for joining of silicon carbide-based ceramics and fiber reinforced composites has been developed. This technique is capable of producing joints with tailorable thickness and composition. A wide variety of silicon carbide-based ceramics and composites, in different shapes and sizes, have been joined using this technique. These joints maintain their mechanical strength up to 1350 C in air. This technology is suitable for the joining of large and complex shaped ceramic and composite components and with certain modifications, can be applied to repair ceramic components damaged in service.

  12. Transcriptional regulation by activation and repression elements located at the 5'-noncoding region of the human alpha9 nicotinic receptor subunit gene.

    PubMed

    Valor, Luis M; Castillo, Mar; Ortiz, José A; Criado, Manuel

    2003-09-26

    The alpha9 subunit is a component of the neuronal nicotinic acetylcholine receptor gene superfamily that is expressed in very restricted locations. The promoter of the human gene has been analyzed in the human neuroblastoma SH-SY5Y, where alpha9 subunit expression was detected, and in C2C12 cells that do not express alpha9. A proximal promoter region (from -322 to +113) showed maximal transcriptional activity in SH-SY5Y cells, whereas its activity in C1C12 cells was much lower. Two elements unusually located at the 5'-noncoding region exhibited opposite roles. A negative element located between +15 and +48 appears to be cell-specific because it was effective in C2C12 but not in SH-SY5Y cells, where it was counterbalanced by the presence of the promoter region 5' to the initiation site. An activating element located between +66 and +79 and formed by two adjacent Sox boxes increased the activity of the alpha9 promoter about 4-fold and was even able to activate other promoters. This element interacts with Sox proteins, probably through a cooperative mechanism in which the two Sox boxes are necessary. We propose that the Sox complex provides an initial scaffold that facilitates the recruiting of the transcriptional machinery responsible for alpha9 subunit expression.

  13. Construction and uses of a new transposable element whose insertion is able to produce gene fusions with the neomycin-phosphotransferase-coding region of Tn903.

    PubMed

    Ratet, P; Richaud, F

    1986-01-01

    We describe the construction of a transposable element derived from the Mu phage that upon insertion is able to create a gene fusion between the region of Tn903 coding for neomycin phosphotransferase (NPT I), which confers resistance to aminoglycosides including kanamycin (KmR), neomycin and G418, and the control elements of the gene where the insertion occurs. A chloramphenicol (Cm) transacetylase gene (cat) that confers resistance to Cm is present in the transposon so that transposition events can be monitored even when no active fusions with the nptI coding region occur. The transposase gene is deleted and, therefore, this transposon is perfectly stable upon insertion. The properties of this new transposable element were studied by obtaining gene fusions between the Escherichia coli L-arabinose operon and 'nptI gene. In some of them the KmR phenotype is induced by arabinose. Insertions of this element in cloned fragments of the T-DNA region of Agrobacterium rhizogenes were also isolated. Some of them confer a KmR phenotype upon its E. coli carriers, which indicates that portions of the T-DNA are expressed in these cells.

  14. Brazil to Join the European Southern Observatory

    NASA Astrophysics Data System (ADS)

    2010-12-01

    The Federative Republic of Brazil has yesterday signed the formal accession agreement paving the way for it to become a Member State of the European Southern Observatory (ESO). Following government ratification Brazil will become the fifteenth Member State and the first from outside Europe. On 29 December 2010, at a ceremony in Brasilia, the Brazilian Minister of Science and Technology, Sergio Machado Rezende and the ESO Director General, Tim de Zeeuw signed the formal accession agreement aiming to make Brazil a Member State of the European Southern Observatory. Brazil will become the fifteen Member State and the first from outside Europe. Since the agreement means accession to an international convention, the agreement must now be submitted to the Brazilian Parliament for ratification [1]. The signing of the agreement followed the unanimous approval by the ESO Council during an extraordinary meeting on 21 December 2010. "Joining ESO will give new impetus to the development of science, technology and innovation in Brazil as part of the considerable efforts our government is making to keep the country advancing in these strategic areas," says Rezende. The European Southern Observatory has a long history of successful involvement with South America, ever since Chile was selected as the best site for its observatories in 1963. Until now, however, no non-European country has joined ESO as a Member State. "The membership of Brazil will give the vibrant Brazilian astronomical community full access to the most productive observatory in the world and open up opportunities for Brazilian high-tech industry to contribute to the European Extremely Large Telescope project. It will also bring new resources and skills to the organisation at the right time for them to make a major contribution to this exciting project," adds ESO Director General, Tim de Zeeuw. The European Extremely Large Telescope (E-ELT) telescope design phase was recently completed and a major review was

  15. A role for palindromic structures in the cis-region of maize Sirevirus LTRs in transposable element evolution and host epigenetic response

    PubMed Central

    Bousios, Alexandros; Diez, Concepcion M.; Takuno, Shohei; Bystry, Vojtech; Darzentas, Nikos; Gaut, Brandon S.

    2016-01-01

    Transposable elements (TEs) proliferate within the genome of their host, which responds by silencing them epigenetically. Much is known about the mechanisms of silencing in plants, particularly the role of siRNAs in guiding DNA methylation. In contrast, little is known about siRNA targeting patterns along the length of TEs, yet this information may provide crucial insights into the dynamics between hosts and TEs. By focusing on 6456 carefully annotated, full-length Sirevirus LTR retrotransposons in maize, we show that their silencing associates with underlying characteristics of the TE sequence and also uncover three features of the host–TE interaction. First, siRNA mapping varies among families and among elements, but particularly along the length of elements. Within the cis-regulatory portion of the LTRs, a complex palindrome-rich region acts as a hotspot of both siRNA matching and sequence evolution. These patterns are consistent across leaf, tassel, and immature ear libraries, but particularly emphasized for floral tissues and 21- to 22-nt siRNAs. Second, this region has the ability to form hairpins, making it a potential template for the production of miRNA-like, hairpin-derived small RNAs. Third, Sireviruses are targeted by siRNAs as a decreasing function of their age, but the oldest elements remain highly targeted, partially by siRNAs that cross-map to the youngest elements. We show that the targeting of older Sireviruses reflects their conserved palindromes. Altogether, we hypothesize that the palindromes aid the silencing of active elements and influence transposition potential, siRNA targeting levels, and ultimately the fate of an element within the genome. PMID:26631490

  16. A correlation between diet and longevity characterization by means of element profiles in healthy people over 80 years from a Chinese longevous region.

    PubMed

    Cai, Da; Li, Danlei; Zhao, Shancang; Dou, Xiaowei; Wang, Fang; Huang, Guohong; Zhao, Mouming; Li, Quanyang

    2015-05-01

    Monitoring the element concentrations in the human body is of critical importance for health and longevity. In order to explore the formation mechanism of longevity from the perspective of the body's element loads, this study investigated the prominent feature of element profiles in healthy people over 80 years from Bama County (China), a famous longevous region (LR). The element profiles in nails of elderly people from the LR and a non-longevous region were determined by inductively coupled plasma mass spectrometry, using orthogonal projections to latent structures discriminant analysis (OPLS-DA) for pattern recognition. As a result, four characteristic elements closely related to the healthy elderly people from LR, including Cr, Fe, Mn, and Co, were identified. The concentrations of Cr, Fe, Mn, and Co were significantly increased in the LR group (p < 0.05). The values of fold change of Cr, Fe, Mn, and Co were 3.00, 2.46, 2.24, and 2.21, respectively. These characteristic elements could provide an important material guarantee for health and longevity of elderly people in the LR. The further correlation analysis revealed significant positive correlations between the Sr (r = 0.886), Mn (r = 0.873), Ni (r = 0.786), and Co (r = 0.738) concentrations in nails of elderly people and those in drinking water. Furthermore, significant positive correlations were found between the Se (r = 0.940), Mn (r = 0.833), and Fe (r = 0.733) concentrations in nails and their dietary intake. Consequently, the observations suggested that diet could provide extraordinary reference information in terms of reflecting the feature of element profiles in healthy elderly people over 80 years from the LR.

  17. Modeling Non-homologous End Joining

    NASA Technical Reports Server (NTRS)

    Li, Yongfeng

    2013-01-01

    Non-homologous end joining (NHEJ) is the dominant DNA double strand break (DSB) repair pathway and involves several NHEJ proteins such as Ku, DNA-PKcs, XRCC4, Ligase IV and so on. Once DSBs are generated, Ku is first recruited to the DNA end, followed by other NHEJ proteins for DNA end processing and ligation. Because of the direct ligation of break ends without the need for a homologous template, NHEJ turns out to be an error-prone but efficient repair pathway. Some mechanisms have been proposed of how the efficiency of NHEJ repair is affected. The type of DNA damage is an important factor of NHEJ repair. For instance, the length of DNA fragment may determine the recruitment efficiency of NHEJ protein such as Ku [1], or the complexity of the DNA breaks [2] is accounted for the choice of NHEJ proteins and subpathway of NHEJ repair. On the other hand, the chromatin structure also plays a role of the accessibility of NHEJ protein to the DNA damage site. In this talk, some mathematical models of NHEJ, that consist of series of biochemical reactions complying with the laws of chemical reaction (e.g. mass action, etc.), will be introduced. By mathematical and numerical analysis and parameter estimation, the models are able to capture the qualitative biological features and show good agreement with experimental data. As conclusions, from the viewpoint of modeling, how the NHEJ proteins are recruited will be first discussed for connection between the classical sequential model [4] and recently proposed two-phase model [5]. Then how the NHEJ repair pathway is affected, by the length of DNA fragment [6], the complexity of DNA damage [7] and the chromatin structure [8], will be addressed

  18. Identification of cis-acting regulatory elements in the promoter region of the rat brain creatine kinase gene.

    PubMed Central

    Hobson, G M; Molloy, G R; Benfield, P A

    1990-01-01

    The functional organization of the rat brain creatine kinase (ckb) promoter was analyzed by deletion, linker scanning, and substitution mutagenesis. Mutations were introduced into the ckb promoter of hybrid ckb/neo (neomycin resistance gene) genes, and the mutant genes were expressed transiently in HeLa cells. Expression was assayed by primer extension analysis of neo RNA, which allowed the transcription start sites and the amount of transcription to be determined. Transfections and primer extension reactions were internally controlled by simultaneous analysis of transcription from the adenovirus VA gene located on the same plasmid as the hybrid ckb/neo gene. We demonstrate that 195 bp of the ckb promoter is sufficient for efficient in vivo expression in HeLa cells. A nonconsensus TTAA element at -28 bp appears to provide the TATA box function for the ckb promoter in vivo. Two CCAAT elements, one at -84 bp and the other at -54 bp, and a TATAAA TA element (a consensus TATA box sequence) at -66 bp are required for efficient transcription from the TTAA element. In addition, we present evidence that the consensus beta-globin TATA box responds to the TATAAATA element in the same way as the ckb nonconsensus TTAA element. Images PMID:2247071

  19. Space construction requirements for joining, inspection, development testing, and flight checkout

    NASA Technical Reports Server (NTRS)

    Morgenthaler, George W.; Nii, Kendall M.

    1990-01-01

    Space construction poses new challenges not yet met in the space program to date. New materials: High strength to weight ratio metal matrix composites and other kinds of composites have been developed. They have not been fully characterized as regards rolling, drilling, cutting, forming, joining, etc. New joining methods: Many types of joining methods are proposed for use in space construction. It is important to understand the key discriminators in choosing one method over another. Once the discriminators are known, one can rank the various methods of joining or connecting things in space. New constructors: Astronauts frequently mention that EVA effort is very exhausting because of the suit inflexibility. For these reasons, as well as the inherent risk, hazards due to radiation, and other concerns mentioned in the literature, it is likely that robot workers of various sorts will play a key role. Now one must consider the question of qualifying space joining methods that will be applied by robots as well as those being applied by humans. New NDE methods/space qualification of detectors: For every joining method that is used here on earth, there are various non-destructive inspection techniques, such as ultrasonic inspection and x-ray inspection. It will be necessary to develop inspection techniques for all joining methods that will be approved for use in space. The detector must also be space qualified. Development testing: As a new concept for space habitat goes through its conceptual phases, various development tests are anticipated for the first time. Some elements cannot be adequately tested except in space itself. Flight check-out: Assuming that one is assembling the Mars spacecraft in earth orbit and that all of the preceding questions have been resolved, the day finally arrives when the fully assembled vehicle is ready for occupancy and journeying to Mars. It will be necessary to conduct a final flight readiness review, countdown procedure, and certification

  20. The Role of Structural Elements of the 5'-Terminal Region of p53 mRNA in Translation under Stress Conditions Assayed by the Antisense Oligonucleotide Approach.

    PubMed

    Swiatkowska, Agata; Zydowicz, Paulina; Gorska, Agnieszka; Suchacka, Julia; Dutkiewicz, Mariola; Ciesiołka, Jerzy

    2015-01-01

    The p53 protein is one of the major factors responsible for cell cycle regulation and stress response. In the 5'-terminal region of p53 mRNA, an IRES element has been found which takes part in the translational regulation of p53 expression. Two characteristic hairpin motifs are present in this mRNA region: G56-C169, with the first AUG codon, and U180-A218, which interacts with the Hdm2 protein (human homolog of mouse double minute 2 protein). 2'-OMe modified antisense oligomers hybridizing to the 5'-terminal region of p53 mRNA were applied to assess the role of these structural elements in translation initiation under conditions of cellular stress. Structural changes in the RNA target occurring upon oligomers' binding were monitored by the Pb2+-induced cleavage method. The impact of antisense oligomers on the synthesis of two proteins, the full-length p53 and its isoform Δ40p53, was analysed in HT-29, MCF-7 and HepG2 cells, under normal conditions and under stress, as well as in vitro conditions. The results revealed that the hairpin U180-A218 and adjacent single-stranded region A219-A228 were predominantly responsible for high efficacy of IRES-mediated translation in the presence of stress factors. These motifs play a role of cis-acting elements which are able to modulate IRES activity, likely via interactions with protein factors.

  1. Germline deletion of Igh 3′ regulatory region elements hs5-7 affects B cell specific regulation, rearrangement and insulation of the Igh locus1

    PubMed Central

    Volpi, Sabrina A.; Verma-Gaur, Jiyoti; Hassan, Rabih; Ju, Zhongliang; Roa, Sergio; Chatterjee, Sanjukta; Werling, Uwe; Hou, Harry; Will, Britta; Steidl, Ulrich; Scharff, Matthew; Edelman, Winfried; Feeney, Ann J.; Birshtein, Barbara K.

    2012-01-01

    Regulatory elements located within a ~28 kb region 3′ of the Igh gene cluster (3′ regulatory region, 3′ RR) are required for class switch recombination and for high levels of IgH expression in plasma cells. We previously defined novel DNase I hypersensitive (hs) sites, i.e. hs5-7, immediately downstream of this region. Hs5-7 contains a high density of binding sites for CTCF, a zinc finger protein associated with mammalian insulator activity and is an anchor for interactions with CTCF sites flanking the DH region. To test the function of hs5-7, we have generated mice with an 8 kb deletion encompassing all three hs elements. B cells from hs5-7 KO mice showed a modest increase in expression of the nearest downstream gene. In addition, Igh alleles in hs5-7 KO mice were in a less contracted configuration compared to WT Igh alleles and showed a two-fold increase in the usage of proximal VH7183 gene families. Hs5-7 KO mice were essentially indistinguishable from wild type mice in B cell development, allelic regulation, class switch recombination, and chromosomal looping. We conclude that hs5-7--a high-density CTCF binding region at the 3′ end of the Igh locus--impacts usage of VH regions as far as 500 kb away. PMID:22345664

  2. Comparative analysis of the Hrp pathogenicity island of Rubus- and Spiraeoideae-infecting Erwinia amylovora strains identifies the IT region as a remnant of an integrative conjugative element.

    PubMed

    Mann, Rachel A; Blom, Jochen; Bühlmann, Andreas; Plummer, Kim M; Beer, Steven V; Luck, Joanne E; Goesmann, Alexander; Frey, Jürg E; Rodoni, Brendan C; Duffy, Brion; Smits, Theo H M

    2012-08-01

    The Hrp pathogenicity island (hrpPAI) of Erwinia amylovora not only encodes a type III secretion system (T3SS) and other genes required for pathogenesis on host plants, but also includes the so-called island transfer (IT) region, a region that originates from an integrative conjugative element (ICE). Comparative genomic analysis of the IT regions of two Spiraeoideae- and three Rubus-infecting strains revealed that the regions in Spiraeoideae-infecting strains were syntenic and highly conserved in length and genetic information, but that the IT regions of the Rubus-infecting strains varied in gene content and length, showing a mosaic structure. None of the ICEs in E. amylovora strains were complete, as conserved ICE genes and the left border were missing, probably due to reductive genome evolution. Comparison of the hrpPAI region of E. amylovora strains to syntenic regions from other Erwinia spp. indicates that the hrpPAI and the IT regions are the result of several insertion and deletion events that have occurred within the ICE. It also suggests that the T3SS was present in a common ancestor of the pathoadapted Erwinia spp. and that insertion and deletion events in the IT region occurred during speciation.

  3. The spatial organization of non-homologous end joining: from bridging to end joining.

    PubMed

    Ochi, Takashi; Wu, Qian; Blundell, Tom L

    2014-05-01

    Non-homologous end joining (NHEJ) repairs DNA double-strand breaks generated by DNA damage and also those occurring in V(D)J recombination in immunoglobulin and T cell receptor production in the immune system. In NHEJ DNA-PKcs assembles with Ku heterodimer on the DNA ends at double-strand breaks, in order to bring the broken ends together and to assemble other proteins, including DNA ligase IV (LigIV), required for DNA repair. Here we focus on structural aspects of the interactions of LigIV with XRCC4, XLF, Artemis and DNA involved in the bridging and end-joining steps of NHEJ. We begin with a discussion of the role of XLF, which interacts with Ku and forms a hetero-filament with XRCC4; this likely forms a scaffold bridging the DNA ends. We then review the well-defined interaction of XRCC4 with LigIV, and discuss the possibility of this complex interrupting the filament formation, so positioning the ligase at the correct positions close to the broken ends. We also describe the interactions of LigIV with Artemis, the nuclease that prepares the ends for ligation and also interacts with DNA-PK. Lastly we review the likely affects of Mendelian mutations on these multiprotein assemblies and their impacts on the form of inherited disease.

  4. The spatial organization of non-homologous end joining: From bridging to end joining

    PubMed Central

    Ochi, Takashi; Wu, Qian; Blundell, Tom L.

    2014-01-01

    Non-homologous end joining (NHEJ) repairs DNA double-strand breaks generated by DNA damage and also those occurring in V(D)J recombination in immunoglobulin and T cell receptor production in the immune system. In NHEJ DNA-PKcs assembles with Ku heterodimer on the DNA ends at double-strand breaks, in order to bring the broken ends together and to assemble other proteins, including DNA ligase IV (LigIV), required for DNA repair. Here we focus on structural aspects of the interactions of LigIV with XRCC4, XLF, Artemis and DNA involved in the bridging and end-joining steps of NHEJ. We begin with a discussion of the role of XLF, which interacts with Ku and forms a hetero-filament with XRCC4; this likely forms a scaffold bridging the DNA ends. We then review the well-defined interaction of XRCC4 with LigIV, and discuss the possibility of this complex interrupting the filament formation, so positioning the ligase at the correct positions close to the broken ends. We also describe the interactions of LigIV with Artemis, the nuclease that prepares the ends for ligation and also interacts with DNA-PK. Lastly we review the likely affects of Mendelian mutations on these multiprotein assemblies and their impacts on the form of inherited disease. PMID:24636752

  5. Efficient compression scheme by use of the region division of elemental images on MALT in three-dimensional integral imaging

    NASA Astrophysics Data System (ADS)

    Kang, Ho-Hyun; Lee, Jung-Woo; Shin, Dong-Hak; Kim, Eun-Soo

    2010-02-01

    This paper addresses the efficient compression scheme of elemental image array (EIA) generated from the moving array lenslet technique (MALT) based on MPEG-4. The EIAs are picked-up by MALT controlling the spatial ray sampling of ray and which produces few EIAs that the positions of the lenslet arrays are rapidly vibrated in the lateral directions within the retention time of the afterimage of human eye. To enhance the similarity in each EIA picked-up by MALT, several EIAs obtained from MALT are regenerated by the collection of an elemental image occupied at the same position in each EIA. The newly generated each EIA has high similarity among adjacent elemental images. To illustrate the feasibility of the proposed scheme, some experiments are carried out to show the increased compression efficiency and we obtained the improved compression ratio of 12% compared to the unhandled compression scheme.

  6. Solid State Joining of Dissimilar Titanium Alloys

    NASA Astrophysics Data System (ADS)

    Morton, Todd W.

    Solid state joining of titanium via friction stir welding and diffusion bonding have emerged as enablers of efficient monolithic structural designs by the eliminations fasteners for the aerospace industry. As design complexity and service demands increase, the need for joints of dissimilar alloys has emerged. Complex thermomechanical conditions in friction stir weld joints and high temperature deformation behavior differences between alloys used in dissimilar joints gives rise to a highly variable flow pattern within a stir zone. Experiments performed welding Ti-6Al-4V to beta21S show that mechanical intermixing of the two alloys is the primary mechanism for the generation of the localized chemistry and microstructure, the magnitude of which can be directly related to pin rotation and travel speed weld parameters. Mechanical mixing of the two alloys is heavily influenced by strain rate softening phenomena, and can be used to manipulate weld nugget structure by switching which alloy is subjected to the advancing side of the pin. Turbulent mixing of a weld nugget and a significant reduction in defects and weld forces are observed when the beta21S is put on the advancing side of the weld where higher strain rates are present. Chemical diffusion driven by the heat of weld parameters is characterized using energy dispersive x-ray spectroscopy (EDS) and is shown to be a secondary process responsible for generating short-range chemical gradients that lead to a gradient of alpha particle structures. Diffusion calculations are inconsistent with an assumption of steady-state diffusion and show that material interfaces in the weld nugget evolve through the break-down of turbulent interface features generated by material flows. A high degree of recrystallization is seen throughout the welds, with unique, hybrid chemistry grains that are generated at material interfaces in the weld nugget that help to unify the crystal structure of dissimilar alloys. The degree of

  7. Joining of parts via magnetic heating of metal aluminum powders

    SciTech Connect

    Baker, Ian

    2013-05-21

    A method of joining at least two parts includes steps of dispersing a joining material comprising a multi-phase magnetic metal-aluminum powder at an interface between the at least two parts to be joined and applying an alternating magnetic field (AMF). The AMF has a magnetic field strength and frequency suitable for inducing magnetic hysteresis losses in the metal-aluminum powder and is applied for a period that raises temperature of the metal-aluminum powder to an exothermic transformation temperature. At the exothermic transformation temperature, the metal-aluminum powder melts and resolidifies as a metal aluminide solid having a non-magnetic configuration.

  8. Trace elements and common ions in southeastern Idaho snow: Regional air pollutant tracers for source area emissions

    USGS Publications Warehouse

    Abbott, M.; Einerson, J.; Schuster, P.; Susong, D.; Taylor, H.E.; ,

    2004-01-01

    Snow sampling and analysis methods which produce accurate and ultra-low measurements of trace elements and common ion concentration in southeastern Idaho snow, were developed. Snow samples were collected over two winters to assess trace elements and common ion concentrations in air pollutant fallout across the southeastern Idaho. The area apportionment of apportionment of fallout concentrations measured at downwind location were investigated using pattern recognition and multivariate statistical technical techniques. Results show a high level of contribution from phosphates processing facilities located outside Pocatello in the southern portion of the Eastern Snake River Plain, and no obvious source area profiles other than at Pocatello.

  9. [MONITORING OF THE CONTENT OF HEAVY METALS AND ELEMENTS IN THE SNOW COVER IN AGRICULTURAL SOILS AT THE TERRITORY OF THE MOSCOW REGION].

    PubMed

    Ermakov, A A; Karpova, E A; Malysheva, A G; Mikhaylova, R I; Ryzhova, I N

    2015-01-01

    The monitoring of snow cover pollution by heavy metals and elements (zinc, copper, lead, cadmium, arsenic, nickel, chromium, strontium, manganese, fluorine, lithium) was performed in 20 districts of the Moscow region in 2009, 2012 and 2013. The assessment of the levels of contamination by heavy metals and elements was given by means of comparison of them with the average values in the snow cover near Moscow in the end of the last century and in some areas of the world, that no exposed to technological environmental impact. 7 districts of Moscow region were characterized by a high content of lead and cadmium in the snow water. It requires the control of water, soil and agricultural products pollution.

  10. A new case of an Holarctic element in the Colombian Andes: first record of Cordyla Meigen (Diptera, Mycetophilidae) from the Neotropical region

    PubMed Central

    Kurina, Olavi; Oliveira, Sarah Siqueira

    2015-01-01

    Abstract Three new species of Mycetophilidae – Cordyla monticola sp. n., Cordyla pseudopusilla sp. n. and Cordyla reducta sp. n. – are described from the Colombian Andes, representing the first described species of Cordyla Meigen from the Neotropical region. Colour photos of their habitus, wing and terminalia are provided. The morphological affinities of male terminalia are discussed in a worldwide context. The distributional pattern of the genus clearly indicates a case of northern elements reaching the north-western region of the Neotropics that corresponds to a secondary extension of a Holarctic clade to the south. PMID:26445929

  11. Screening of Trace Elements in Hair of the Female Population with Different Types of Cancers in Wielkopolska Region of Poland

    PubMed Central

    Czerny, Bogusław; Krupka, Krzysztof; Ożarowski, Marcin; Seremak-Mrozikiewicz, Agnieszka

    2014-01-01

    Background. Cancer constitutes a major health problem worldwide. Thus, search for reliable and practical markers of the disease process remains the key issue of the diagnostic process. Objectives. The study aims at linking the trace element status of an organism, assessed by hair analysis, with the occurrence of cancer diseases. Material and Methods. Hair samples were collected from 299 patients with cancer diseases confirmed by a histopathological test and from 100 controls. Cancer patients were divided into three groups, depending on cancer type: hormone-dependent cancer, cancer of the alimentary tract, and cancer with high glycolytic activity. Mineral element analysis of hair was performed using an atomic emission spectrophotometer with inductively coupled plasma (ICP-OES) and inductively coupled plasma mass spectrometry (ICP-MS). Results. Statistically significantly lower concentrations of selenium, zinc, copper, germanium and boron, iron, and magnesium were observed in the three groups of cancer patients. Disturbance in the axis glucose-insulin and changes in concentrations of heavy metals and toxic elements were also noted. Conclusions. It seems safe to conclude that our results confirmed usefulness of hair element analysis in screening tests for the assessment of the biomarker of various cancer diseases in a female population. PMID:25580464

  12. The effect of alloy elements on the density variation of steel melt at the interdendritic region during solidification

    NASA Astrophysics Data System (ADS)

    Cao, Y. F.; Chen, Y.; Ma, X. P.; Fu, P. X.; Kang, X. H.; Liu, H. W.; Li, D. Z.

    2016-03-01

    Alloying elements in steels have essential effects on the formation of macrosegregation by inducing a density difference between the mushy zone and the bulk melt, and even by the alteration of the solidified microstructure. Hence, in terms of the thermodynamic laws for solidification of an idealized dilute solution, a systematic theoretical analysis on the effect of elements on the density variation of the interdendritic melt is presented for common Fe-based binary alloys. It shows that density variation closely associates with three crucial parameters: the microsegregation parameter λ, the temp-comp-expansion parameter β and the initial composition CL o . With these derived parameters, a simple analytical model is proposed to assess the influence of alloy elements on density change. The theoretical analysis indicates that compared to silicon, the effect of carbon on the density variation cannot be ignored, which is remarkably different from the previous recognition of these two elements. The macrosegregation induced by carbon only is experimentally validated by two dissected 500 kg ingots with different carbon contents. Furthermore, to directly validate the results of theoretical analysis a macrosegregation model with two different microsegregation laws (lever rule and Scheil equation) is established. Then simulations of the convection during solidification in the experimental 500 kg reference ingot are performed for Fe-C and Fe-Si alloys, respectively. It demonstrates that numerically simulated effects of carbon and silicon on the interdendritic convection induced by density inversion are fairly consistent with the analytical predictions.

  13. Putative regulatory elements within the non-coding regions of Chrysomelidae Diapause Associated Transcript-1 (DAT-1) orthologs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To develop a more comprehensive understanding of diapause within Chrysomelidae, we are employing phylogenetic foot-printing to isolate and characterize the regulatory elements associated with the diapause-associated gene, DAT-1. Leptinotarsa decemlineata (Colorado potato beetle, CPB) DAT-1 has been ...

  14. A meiotic drive element in the maize pathogen Fusarium verticillioides is located within a 102-kb region of chromosome V

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fusarium verticillioides is an agriculturally important fungus because of its association with maize and its propensity to contaminate grain with toxic compounds. Some isolates of the fungus harbor a meiotic drive element known as Spore killer (SkK) that causes nearly all surviving meiotic progeny f...

  15. Determination of mineral, trace element, and pesticide levels in honey samples originating from different regions of Malaysia compared to manuka honey.

    PubMed

    Moniruzzaman, Mohammed; Chowdhury, Muhammed Alamgir Zaman; Rahman, Mohammad Abdur; Sulaiman, Siti Amrah; Gan, Siew Hua

    2014-01-01

    The present study was undertaken to determine the content of six minerals, five trace elements, and ten pesticide residues in honeys originating from different regions of Malaysia. Calcium (Ca), magnesium (Mg), iron (Fe), and zinc (Zn) were analyzed by flame atomic absorption spectrometry (FAAS), while sodium (Na) and potassium (K) were analyzed by flame emission spectrometry (FAES). Trace elements such as arsenic (As), lead (Pb), cadmium (Cd), copper (Cu), and cobalt (Co) were analyzed by graphite furnace atomic absorption spectrometry (GFAAS) following the microwave digestion of honey. High mineral contents were observed in the investigated honeys with K, Na, Ca, and Fe being the most abundant elements (mean concentrations of 1349.34, 236.80, 183.67, and 162.31 mg/kg, resp.). The concentrations of the trace elements were within the recommended limits, indicating that the honeys were of good quality. Principal component analysis reveals good discrimination between the different honey samples. The pesticide analysis for the presence of organophosphorus and carbamates was performed by high performance liquid chromatography (HPLC). No pesticide residues were detected in any of the investigated honey samples, indicating that the honeys were pure. Our study reveals that Malaysian honeys are rich sources of minerals with trace elements present within permissible limits and that they are free from pesticide contamination.

  16. Determination of Mineral, Trace Element, and Pesticide Levels in Honey Samples Originating from Different Regions of Malaysia Compared to Manuka Honey

    PubMed Central

    Moniruzzaman, Mohammed; Chowdhury, Muhammed Alamgir Zaman; Rahman, Mohammad Abdur; Sulaiman, Siti Amrah; Gan, Siew Hua

    2014-01-01

    The present study was undertaken to determine the content of six minerals, five trace elements, and ten pesticide residues in honeys originating from different regions of Malaysia. Calcium (Ca), magnesium (Mg), iron (Fe), and zinc (Zn) were analyzed by flame atomic absorption spectrometry (FAAS), while sodium (Na) and potassium (K) were analyzed by flame emission spectrometry (FAES). Trace elements such as arsenic (As), lead (Pb), cadmium (Cd), copper (Cu), and cobalt (Co) were analyzed by graphite furnace atomic absorption spectrometry (GFAAS) following the microwave digestion of honey. High mineral contents were observed in the investigated honeys with K, Na, Ca, and Fe being the most abundant elements (mean concentrations of 1349.34, 236.80, 183.67, and 162.31 mg/kg, resp.). The concentrations of the trace elements were within the recommended limits, indicating that the honeys were of good quality. Principal component analysis reveals good discrimination between the different honey samples. The pesticide analysis for the presence of organophosphorus and carbamates was performed by high performance liquid chromatography (HPLC). No pesticide residues were detected in any of the investigated honey samples, indicating that the honeys were pure. Our study reveals that Malaysian honeys are rich sources of minerals with trace elements present within permissible limits and that they are free from pesticide contamination. PMID:24982869

  17. Microwave joining of SiC ceramics and composites

    SciTech Connect

    Ahmad, I.; Silberglitt, R.; Tian, Y.L.; Katz, J.D.

    1997-04-01

    Potential applications of SiC include components for advanced turbine engines, tube assemblies for radiant burners and petrochemical processing and heat exchangers for high efficiency electric power generation systems. Reliable methods for joining SiC are required in order to cost-effectively fabricate components for these applications from commercially available shapes and sizes. This manuscript reports the results of microwave joining experiments performed using two different types of SiC materials. The first were on reaction bonded SiC, and produced joints with fracture toughness equal to or greater than that of the base material over an extended range of joining temperatures. The second were on continuous fiber-reinforced SiC/SiC composite materials, which were successfully joined with a commercial active brazing alloy, as well as by using a polymer precursor.

  18. 10. EYEBAR PIN CONNECTION JOINING VERTICAL SUSPENSION STRINGER WITH LATERAL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. EYEBAR PIN CONNECTION JOINING VERTICAL SUSPENSION STRINGER WITH LATERAL BRACING MEMBERS - Spruce Street Bridge, East Spruce Street, 500 Block, spanning Power Canal, Sault Ste. Marie, Chippewa County, MI

  19. Holographic optical assembly and photopolymerized joining of planar microspheres

    SciTech Connect

    Shaw, L. A.; Chizari, S.; Panas, R. M.; Shusteff, M.; Spadaccini, C. M.; Hopkins, J. B.

    2016-07-27

    The aim of this research is to demonstrate a holographically driven photopolymerization process for joining colloidal particles to create planar microstructures fixed to a substrate, which can be monitored with real-time measurement. Holographic optical tweezers (HOT) have been used to arrange arrays of microparticles prior to this work; here we introduce a new photopolymerization process for rapidly joining simultaneously handled microspheres in a plane. Additionally, we demonstrate a new process control technique for efficiently identifying when particles have been successfully joined by measuring a sufficient reduction in the particles’ Brownian motion. Furthermore, this technique and our demonstrated joining approach enable HOT technology to take critical steps toward automated additive fabrication of microstructures.

  20. Join NASA: The Sky is NOT the Limit

    NASA Video Gallery

    We're going to send humans farther into space than ever before ... and eventually to Mars. We need YOU to help plan for this future of exploration. Join NASA: Get your application in now for the 20...

  1. Conventional and Microwave Joining of Silicon Carbide Using Displacement Reactions

    NASA Technical Reports Server (NTRS)

    Kingsley, J.; Yiin, T.; Barmatz, M.

    1995-01-01

    Microwave heating was used to join Silicon Carbide rods using a thin TiC /Si tape interlayer . Microwaves quickly heated the rods and tape to temperatures where solid-state displacement reactions between TiC and Si occurred.

  2. Holographic optical assembly and photopolymerized joining of planar microspheres

    DOE PAGES

    Shaw, L. A.; Chizari, S.; Panas, R. M.; ...

    2016-07-27

    The aim of this research is to demonstrate a holographically driven photopolymerization process for joining colloidal particles to create planar microstructures fixed to a substrate, which can be monitored with real-time measurement. Holographic optical tweezers (HOT) have been used to arrange arrays of microparticles prior to this work; here we introduce a new photopolymerization process for rapidly joining simultaneously handled microspheres in a plane. Additionally, we demonstrate a new process control technique for efficiently identifying when particles have been successfully joined by measuring a sufficient reduction in the particles’ Brownian motion. Furthermore, this technique and our demonstrated joining approach enablemore » HOT technology to take critical steps toward automated additive fabrication of microstructures.« less

  3. Explosive Joining for the Mars Sample Return Mission

    NASA Technical Reports Server (NTRS)

    Bement, Laurence J.; Sanok, Joseph T.

    2000-01-01

    A unique, small-scale, ribbon explosive joining process is being developed as an option for closing and sealing a metal canister to allow the return of a pristine sample of the Martian surface and atmosphere to Earth. This joining process is accomplished by an explosively driven, high-velocity, angular collision of the metal, which melts and effaces the oxide films from the surfaces to allow valence electron sharing to bond the interface. Significant progress has been made through more than 100 experimental tests to meet the goals of this ongoing developmental effort. The metal of choice, aluminum alloy 6061, has been joined in multiple interface configurations and in complete cylinders. This process can accommodate dust and debris on the surfaces to be joined. It can both create and sever a joint at its midpoint with one explosive input. Finally, an approach has been demonstrated that can capture the back blast from the explosive.

  4. Who Should Join the Environmental Response Laboratory Network

    EPA Pesticide Factsheets

    Laboratories that analyze biological samples, chemical warfare agents, radiological, or toxic industrial chemical samples can join the ERLN. Members make up a critical infrastructure that delivers data necessary for responses to large scale emergencies.

  5. Chord Splicing & Joining Detail; Chord & CrossBracing Joint Details; ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Chord Splicing & Joining Detail; Chord & Cross-Bracing Joint Details; Cross Bracing Center Joint Detail; Chord & Diagonal Joint Detail - Vermont Covered Bridge, Highland Park, spanning Kokomo Creek at West end of Deffenbaugh Street (moved to), Kokomo, Howard County, IN

  6. TRANSFORMER FOR JOINING UNBALANCED TO BALANCED TRANSMISSION MEANS

    DOEpatents

    Bittner, B.J.; Opperman, R.H.

    1960-06-28

    An improved transformer is invented for joining an unbalanced transmission means to a balanced transmission means and is useful, for example, in transmitting an electromagnetic signal from a coaxial cable to a balanced dipole antenna.

  7. South Pole Telescope joins black-hole project

    NASA Astrophysics Data System (ADS)

    Allen, Michael

    2015-06-01

    Astronomers are one step closer to observing the event horizon of a black hole after Antarctica's largest telescope joined a worldwide collection of millimetre/submillimetre facilities pursuing this goal.

  8. Fastening, coupling and joining technique between diaspora and irredenta

    NASA Astrophysics Data System (ADS)

    Bauer, C.-O.

    1980-06-01

    The problem of eliminating the present divergence and shattering (diaspora) in the treatment of problems of the fastening, coupling, and joining technique on different technical branches is examined. It is shown that by an appropriate independence the fastening, coupling and joining techniques can recognize and consequently utilize the numerous performance reserves which are concealed by the present organization and action due to the lack of systematically tended works.

  9. Joining of SiC parts by polishing and hipping

    DOEpatents

    Rossi, Guilio A.; Pelletier, Paul J.

    1990-05-15

    A method of joining two pre-sintered pieces of silicon carbide is disclosed. It entails polishing the surfaces to be joined to a mirror-finish, fitting the polished surfaces together to form a composite structure, and then subjecting the composite structure to hot isostatic pressing under conditions which are sufficient to form a joint which is essentially indistinguishable from the original silicon carbide pieces.

  10. Parametric weight evaluation of joined wings by structural optimization

    NASA Technical Reports Server (NTRS)

    Miura, Hirokazu; Shyu, Albert T.; Wolkovitch, Julian

    1988-01-01

    Joined-wing aircraft employ tandem wings having positive and negative sweep and dihedral, arranged to form diamond shapes in both plan and front views. An optimization method was applied to study the effects of joined-wing geometry parameters on structural weight. The lightest wings were obtained by increasing dihedral and taper ratio, decreasing sweep and span, increasing fraction of airfoil chord occupied by structural box, and locating the joint inboard of the front wing tip.

  11. Top scientists join Stephen Hawking at Perimeter Institute

    NASA Astrophysics Data System (ADS)

    Banks, Michael

    2009-03-01

    Nine leading researchers are to join Stephen Hawking as visiting fellows at the Perimeter Institute for Theoretical Physics in Ontario, Canada. The researchers, who include string theorists Leonard Susskind from Stanford University and Asoka Sen from the Harisch-Chandra Research Institute in India, will each spend a few months of the year at the institute as "distinguished research chairs". They will be joined by another 30 scientists to be announced at a later date.

  12. Orientation-specific joining of AID-initiated DNA breaks promotes antibody class switching.

    PubMed

    Dong, Junchao; Panchakshari, Rohit A; Zhang, Tingting; Zhang, Yu; Hu, Jiazhi; Volpi, Sabrina A; Meyers, Robin M; Ho, Yu-Jui; Du, Zhou; Robbiani, Davide F; Meng, Feilong; Gostissa, Monica; Nussenzweig, Michel C; Manis, John P; Alt, Frederick W

    2015-09-03

    During B-cell development, RAG endonuclease cleaves immunoglobulin heavy chain (IgH) V, D, and J gene segments and orchestrates their fusion as deletional events that assemble a V(D)J exon in the same transcriptional orientation as adjacent Cμ constant region exons. In mice, six additional sets of constant region exons (CHs) lie 100-200 kilobases downstream in the same transcriptional orientation as V(D)J and Cμ exons. Long repetitive switch (S) regions precede Cμ and downstream CHs. In mature B cells, class switch recombination (CSR) generates different antibody classes by replacing Cμ with a downstream CH (ref. 2). Activation-induced cytidine deaminase (AID) initiates CSR by promoting deamination lesions within Sμ and a downstream acceptor S region; these lesions are converted into DNA double-strand breaks (DSBs) by general DNA repair factors. Productive CSR must occur in a deletional orientation by joining the upstream end of an Sμ DSB to the downstream end of an acceptor S-region DSB. However, the relative frequency of deletional to inversional CSR junctions has not been measured. Thus, whether orientation-specific joining is a programmed mechanistic feature of CSR as it is for V(D)J recombination and, if so, how this is achieved is unknown. To address this question, we adapt high-throughput genome-wide translocation sequencing into a highly sensitive DSB end-joining assay and apply it to endogenous AID-initiated S-region DSBs in mouse B cells. We show that CSR is programmed to occur in a productive deletional orientation and does so via an unprecedented mechanism that involves in cis Igh organizational features in combination with frequent S-region DSBs initiated by AID. We further implicate ATM-dependent DSB-response factors in enforcing this mechanism and provide an explanation of why CSR is so reliant on the 53BP1 DSB-response factor.

  13. Plasma Joining of Metal Matrix Composites.

    DTIC Science & Technology

    1985-12-01

    coefficient (a<l) P = vapor pressure of Al in dynes/cm2 at T K o = density of Al (2.7 g/cm 3 r = radius of Al droplets in cm. R = gas constant (8.31 x...atom of the alloying element, and k = Boltzmann constant For dilute solutions: n x (4) n Al and 4 N 3 o nAl 7r C Al (5) 3Al!% W. . . 1 where: n...atomic weight of Al (27 g/mole) N = Avogadros Number (6.1 x 10 2 3/mole) o Substituting Equations (4) and (5) into Equation (3), we obtain: "- ’dn

  14. Geochemical background/baseline values in top soils of Campania region: assessment of the toxic elements threat to ecosystem and human health

    NASA Astrophysics Data System (ADS)

    de Vivo, B.; Lima, A.; Albanese, S.; Bove, M.; Cicchella, D.; Civitillo, D.; Cosenza, A.; Grezzi, G.

    2009-04-01

    In the late years an intense geochemical prospecting activity on the whole territory of Campania region (Southern Italy) has been carried aiming at the definition of the geochemical backgrounds/baselines at both regional and local scale. At the end of 2003 the first edition of an atlas containing 200 maps showing the distribution patterns of 40 chemical elements on the whole regional territory was published (De Vivo et al., 2003, 2006a; Albanese et al., 2007a). The atlas provided a base knowledge of environmental status of the region and allowed to individuate some critical areas to be further investigated by topsoils sampling follow up activity; the topsoils are considered as the best media in order to examine closely the sources and the distribution patterns of harmful elements at a local scale. The topsoils sampling was mainly focused on anthropized areas (at urban and metropolitan scale), industrial settlments, brownfields and intensely cultivated zones, aimed at: • showing the distribution of concentration values and to determine baseline values (or backgrounds, depending on local conditions) of each analyzed element (38) in the top soils; • assessing harmful elements pollution levels and their geographic distribution; • providing reliable analytical data for assessment of toxic element pollution threat to ecosystem and human health; • creating a sound basis for policy makers and legislators who need to address the public concerns regarding environmental pollution. Five atlases (De Vivo et al., 2006b; Albanese et al., 2007b; Lima et al., 2007; Fedele et al., 2007 Cicchella et al., 2009) were produced reporting soil geochemical maps compiled using 1620 samples collected both in the metropolitan and provincial area of Napoli and in the cities of Avellino, Benevento, Caserta and Salerno. Further studies were also carried out taking into account Pb isotopes (Cicchella et al., 2008a), PGE's (Cicchella et al., 2003; 2008b) and bioavailability of harmful

  15. JOINING DISSIMILAR MATERIALS USING FRICTION STIR SCRIBE TECHNIQUE

    SciTech Connect

    Upadhyay, Piyush; Hovanski, Yuri; Jana, Saumyadeep; Fifield, Leonard S.

    2016-09-01

    Development of robust and cost effective method of joining dissimilar materials can provide a critical pathway to enable widespread use of multi-material design and components in mainstream industrial applications. The use of multi-material components such as Steel-Aluminum, Aluminum-Polymer allows design engineers to optimize material utilization based on service requirements and often lead weight and cost reductions. However producing an effective joint between materials with vastly different thermal, microstructural and deformation response is highly problematic using conventional joining and /or fastening methods. This is especially challenging in cost sensitive high volume markets that largely rely on low–cost joining solutions. Friction Stir Scribe technology was developed to meet the demands of joining materials with drastically different properties and melting regimes. The process enables joining of light metals like Magnesium and Aluminum to high temperature materials like Steels and Titanium. Additionally viable joints between polymer composites and metal can also be made using this method. This paper will present state of the art, progress made and challenges associated with this innovative derivative of Friction Stir welding in reference to joining dissimilar metals and polymer/metal combinations.

  16. Joining Dissimilar Materials Using Friction Stir Scribe Technique

    SciTech Connect

    Upadhyay, Piyush; Hovanski, Yuri; Jana, Saumyadeep; Fifield, Leonard S.

    2016-10-03

    Development of a robust and cost-effective method of joining dissimilar materials could provide a critical pathway to enable widespread use of multi-material designs and components in mainstream industrial applications. The use of multi-material components such as steel-aluminum and aluminum-polymer would allow design engineers to optimize material utilization based on service requirements and could often lead to weight and cost reductions. However, producing an effective joint between materials with vastly different thermal, microstructural, and deformation responses is highly problematic using conventional joining and/or fastening methods. This is especially challenging in cost sensitive, high volume markets that largely rely on low cost joining solutions. Friction stir scribe technology was developed to meet the demands of joining materials with drastically different properties and melting regimes. The process enables joining of light metals like magnesium and aluminum to high temperature materials like steel and titanium. Viable joints between polymer composites and metal can also be made using this method. This paper will present the state of the art, progress made, and challenges associated with this innovative derivative of friction stir welding in reference to joining dissimilar metals and polymer/metal combinations.

  17. Regional Missile Defense: DOD’s 2014 Report Generally Addressed Required Reporting Elements, but Excluded Additional Key Details

    DTIC Science & Technology

    2014-12-01

    PAGES 29 19a. NAME OF RESPONSIBLE PERSON a. REPORT unclassified b. ABSTRACT unclassified c . THIS PAGE unclassified Standard Form 298 (Rev. 8-98...Page ii GAO-15-32 Regional Ballistic Missile Defense Abbreviations AN/ TPY -2 Army Navy...matters related to allied contributions to U.S. regional BMD activities . DOD responded to this mandate with a report submitted to congressional

  18. Modeling and Testing Miniature Torsion Specimens for SiC Joining Development Studies for Fusion

    SciTech Connect

    Henager, Charles H.; Nguyen, Ba Nghiep; Kurtz, Richard J.; Roosendaal, Timothy J.; Borlaug, Brennan A.; Ferraris, Monica; Ventrella, Andrea; Katoh, Yutai

    2015-08-19

    The international fusion community has designed a miniature torsion specimen for neutron irradiation studies of joined SiC and SiC/SiC composite materials. Miniature torsion joints based on this specimen design were fabricated using displacement reactions between Si and TiC to produce Ti3SiC2 + SiC joints with CVD-SiC and tested in torsion-shear prior to and after neutron irradiation. However, many of these miniature torsion specimens fail out-of-plane within the CVD-SiC specimen body, which makes it problematic to assign a shear strength value to the joints and makes it difficult to compare unirradiated and irradiated joint strengths to determine the effects of the irradiation. Finite element elastic damage and elastic-plastic damage models of miniature torsion joints are developed that indicate shear fracture is likely to occur within the body of the joined sample and cause out-of-plane failures for miniature torsion specimens when a certain modulus and strength ratio between the joint material and the joined material exists. The model results are compared and discussed with regard to unirradiated and irradiated joint test data for a variety of joint materials. The unirradiated data includes Ti3SiC2 + SiC/CVD-SiC joints with tailored joint moduli, and includes steel/epoxy and CVD-SiC/epoxy joints. The implications for joint data based on this sample design are discussed.

  19. Modeling and testing miniature torsion specimens for SiC joining development studies for fusion

    NASA Astrophysics Data System (ADS)

    Henager, C. H.; Nguyen, B. N.; Kurtz, R. J.; Roosendaal, T. J.; Borlaug, B. A.; Ferraris, M.; Ventrella, A.; Katoh, Y.

    2015-11-01

    The international fusion community has designed a miniature torsion specimen for neutron irradiation studies of joined SiC and SiC/SiC composite materials. Miniature torsion joints based on this specimen design were fabricated using displacement reactions between Si and TiC to produce Ti3SiC2 + SiC joints with SiC and tested in torsion-shear prior to and after neutron irradiation. However, many miniature torsion specimens fail out-of-plane within the SiC specimen body, which makes it problematic to assign a shear strength value to the joints and makes it difficult to compare unirradiated and irradiated strengths to determine irradiation effects. Finite element elastic damage and elastic-plastic damage models of miniature torsion joints are developed that indicate shear fracture is more likely to occur within the body of the joined sample and cause out-of-plane failures for miniature torsion specimens when a certain modulus and strength ratio between the joint material and the joined material exists. The model results are compared and discussed with regard to unirradiated and irradiated test data for a variety of joint materials. The unirradiated data includes Ti3SiC2 + SiC/CVD-SiC joints with tailored joint moduli, and includes steel/epoxy and CVD-SiC/epoxy joints. The implications for joint data based on this sample design are discussed.

  20. Laser-generated Macroscopic and Microscopic Surface Structures for the Joining of Aluminum and Thermoplastics using Friction Press Joining

    NASA Astrophysics Data System (ADS)

    Fuchs, Alexander N.; Wirth, Franz X.; Rinck, Philipp; Zaeh, Michael F.

    Structural lightweight construction is increasingly utilized in the aerospace and automotive industry. Hybrid structures have great potential, especially with regard to load-specific component layouts. Usually, a surface pre-treatment is applied prior to joining dissimilar materials to improve bonding mechanisms such as form closure. In previous studies pulsed wave (pw) lasers were used for structuring metals. This paper presents the results of aluminum pre-treatment via a continuous wave (cw) single-mode fiber laser: macroscopic and microscopic structures were generated on the aluminum surface; the samples were joined with glass fiber reinforced polyamide using Friction Press Joining (FPJ), a method for joining metals and thermoplastic polymers in lap joint configuration. Using these new methods for surface structuring, shear strength was increased by 40% compared to previous studies with pw lasers.

  1. Comparison of joining processes for Haynes 230 nickel based super alloy

    NASA Astrophysics Data System (ADS)

    Williston, David Hugh

    Haynes 230 is a nickel based, solid-solution strengthened alloy that is used for high-temperature applications in the aero-engine and power generation industries. The alloy composition is balanced to avoid precipitation of undesirable topologically closed-packed (TCP) intermetallic phases, such as Sigma, Mu, or Laves-type, that are detrimental to mechanical and corrosion properties. This material is currently being used for the NASA's J2X upper stage rocket nozzle extension. Current fabrication procedures use fusion welding processes to join blanks that are subsequently formed. Cracks have been noted to occur in the fusion welded region during the forming operations. Use of solid state joining processes, such as friction stir welding are being proposed to eliminate the fusion weld cracks. Of interest is a modified friction stir welding process called thermal stir welding. Three welding process: Gas Metal Arc Welding (GMAW), Electron Beam Welding (EBW), and Thermal Stir Welding (TSWing) are compared in this study.

  2. Endothelin-1 expression is strongly repressed by AU-rich elements in the 3′-untranslated region of the gene

    PubMed Central

    2004-01-01

    The regulation of the synthesis of the endothelial-derived vasoconstrictor ET-1 (endothelin-1) is a complex process that occurs mainly at the mRNA level. Transcription of the gene accounts for an important part of the regulation of expression, as already described for different modulators such as the cytokine TGF-β (transforming growth factor-β). However, very little is known about mechanisms governing ET-1 expression at the post-transcriptional level. The aim of the present study was to investigate the regulation of the ET-1 expression at this level. Since the 3′-UTR (3′-untranslated region) of mRNAs commonly contains genetic determinants for the post-transcriptional control of gene expression, we focused on the potential role of the 3′-UTR of ET-1 mRNA. Experiments performed with luciferase reporter constructs containing the 3′-UTR showed that this region exerts a potent destabilizing effect. Deletional analyses allowed us to locate this activity within a region at positions 924–1127. Some (but not all) of the AREs (AU-rich elements) present in this region were found to be essential for this mRNA-destabilizing activity. We also present evidence that cytosolic proteins from endothelial cells interact specifically with these RNA elements, and that a close correlation exists between the ability of the AREs to destabilize ET-1 mRNA and the binding of proteins to these elements. Our results are compatible with the existence of a strong repressional control of ET-1 expression mediated by destabilization of the mRNA exerted through the interaction of specific cytosolic proteins with AREs present in the 3′-UTR of the gene. PMID:15595926

  3. The Schizosaccharomyces pombe inv1+ regulatory region is unusually large and contains redundant cis-acting elements that function in a SAGA- and Swi/Snf-dependent fashion.

    PubMed

    Ahn, Sejin; Spatt, Dan; Winston, Fred

    2012-08-01

    The Schizosaccharomyces pombe inv1(+) gene encodes invertase, the enzyme required for hydrolysis of sucrose and raffinose. Transcription of inv1(+) is regulated by glucose levels, with transcription tightly repressed in high glucose and strongly induced in low glucose. To understand this regulation, we have analyzed the inv1(+) cis-regulatory region and the requirement for the trans-acting coactivators SAGA and Swi/Snf. Surprisingly, deletion of the entire 1-kilobase intergenic region between the inv1(+) TATA element and the upstream open reading frame SPCC191.10 does not significantly alter regulation of inv1(+) transcription. However, a longer deletion that extends through SPCC191.10 abolishes inv1(+) induction in low glucose. Additional analysis demonstrates that there are multiple, redundant regulatory regions spread over 1.5 kb 5' of inv1(+), including within SPCC191.10, that can confer glucose-mediated transcriptional regulation to inv1(+). Furthermore, SPCC191.10 can regulate inv1(+) transcription in an orientation-independent fashion and from a distance as great as 3 kb. With respect to trans-acting factors, both SAGA and Swi/Snf are recruited to SPCC191.10 and to other locations in the large inv1(+) regulatory region in a glucose-dependent fashion, and both are required for inv1(+) derepression. Taken together, these results demonstrate that inv1(+) regulation in S. pombe occurs via the use of multiple regulatory elements and that activation can occur over a great distance, even from elements within other open reading frames.

  4. Boeing technicians join Node 1 for ISS to PMA-1 in the SSPF

    NASA Technical Reports Server (NTRS)

    1997-01-01

    Boeing technicians join Node 1 for the International Space Station (ISS) with the Pressurized Mating Adapter (PMA)-1 in KSC's Space Station Processing Facility. This PMA, identifiable by its bright red ring, is a cone-shaped connector for the space station's structural building block, known as Node 1. Seen here surrounded by scaffolding, Node 1 will have two PMAs attached, the second of which is scheduled for mating to the node in January 1998. The node and PMAs, which will be the first element of the ISS, are scheduled to be launched aboard the Space Shuttle Endeavour on STS-88 in July 1998.

  5. Identification of region-specific yeast artificial chromosomes using pools of Alu element-mediated polymerase chain reaction probes labeled via linear amplification.

    PubMed

    Cole, C G; Patel, K; Shipley, J; Sheer, D; Bobrow, M; Bentley, D R; Dunham, I

    1992-12-01

    The ability to identify large numbers of yeast artificial chromosomes (YACs) specific to any given genomic region rapidly and efficiently enhances both the construction of clone maps and the isolation of region-specific landmarks (e.g., polymorphic markers). We describe a method of preparing region-specific single-stranded hybridization probes from Alu element-mediated polymerase chain reaction (Alu-PCR) products of somatic cell hybrids for YAC library screening. Pools of up to 50 cloned Alu-PCR products from an irradiation-reduced hybrid containing 22q11.2-q13.1 were labeled to high specific activity by linear amplification using a single vector primer. The resulting single-stranded probes were extensively competed to remove repetitive sequences, while retaining the full complexity of the probe. Extensive coverage of the region by YACs using multiple probe pools was demonstrated as many YACs were detected more than once. In situ analysis using chosen YACs confirmed that the clones were specific for the region. Thus, this pooled probe approach constitutes a rapid method to identify large numbers of YACs relevant to a large chromosomal region.

  6. Trace elements in free-range hen eggs in the Campania region (Italy) analyzed by inductively coupled plasma mass spectrometry (ICP-MS).

    PubMed

    Esposito, Mauro; Cavallo, Stefania; Chiaravalle, Eugenio; Miedico, Oto; Pellicanò, Roberta; Rosato, Guido; Sarnelli, Paolo; Baldi, Loredana

    2016-06-01

    Eggs from hens raised on rural or domestic farms are a good indicator of environmental contamination, as the hens are in close contact with the ground and the air and can therefore accumulate heavy metals and other toxic contaminants from the environment as well as from the diet. In this paper, we report the results of the determination of 19 trace elements (As, Be, Cd, Co, Cr, Cu, Hg, Mo, Mn, Ni, Pb, Sb, Se, Sn, Sr, Tl, U, V, Zn) in 39 hen egg samples collected from domestic poultry farms in the territory dubbed the "Land of fires" in the Campania region (Italy). This area is characterized by environmental problems caused by the illegal dumping of industrial or domestic waste in fields or by roadsides. In some cases, these wastes have been burned, thereby spreading persistent contaminants into the atmosphere. The content of trace elements in whole egg samples was determined by mass spectrometer after a microwave-assisted digestion procedure. Because European legislation does not indicate maximum values of these elements in this foodstuff, the results were compared with the content of trace elements reported in literature for eggs, in particular home-produced eggs, in various countries. In some cases (Cd, Cu, Ni, Mn), the content determined in this study was in line with those reported elsewhere, in other cases (Pb, Cr), lower values were found.

  7. A compilation of mineral occurrences and the relationship of occurrences to structural elements of the Kentucky and Tennessee region

    NASA Technical Reports Server (NTRS)

    Mayhew, M. A.; Myers, D. M.

    1984-01-01

    A very prominent magnetic anomaly measured by MAGSAT over the eastern mid-continent of the United States was inferred to have a source region beneath Kentucky and Tennessee. Prominent aeromagnetic and gravity anomalies are also associated with the inferred source region. A crustal model constructed to fit these anomalies interpreted the complex as a large mafic plutonic intrusion of Precambrian age. The complex was named the Kentucky body. It was noticed that the Jessamine Dome, which is a locus of intense faulting and mineralization, occurs near the northern end of the Kentucky body, and that more generally there seemed to be a spatial relationship between mineral occurrence and the body. The relationship between mineral deposits in Kentucky and Tennessee and the Kentucky body was investigated. A compilation of mineral occurrences in the region, classified according to type and age, is presented.

  8. Definition of a lipopolysaccharide-responsive element in the 5'-flanking regions of MuRantes and crg-2.

    PubMed Central

    Shin, H S; Drysdale, B E; Shin, M L; Noble, P W; Fisher, S N; Paznekas, W A

    1994-01-01

    Macrophages are stimulated by lipopolysaccharide (LPS) of gram-negative organisms. The changes in LPS-stimulated macrophages include transcriptional activation of multiple immediate-early genes, which may contribute to the natural immunity to microorganisms. We have defined by deletion and mutational analysis LPS-responsive elements (LREs) in two chemokine genes, MuRantes and crg-2, which are activated in an immediate-early manner. LRE consists of two motifs, TCAYR, which is an AP-1 half site with two flanking bases, and (A/T) (G/C)NTTYC(A/T)NTTY, which resembles in part the interferon-stimulated responsive element (ISRE). The orientation of these two motifs relative to each other in MuRantes differed from that in crg-2. These two motifs are separated by 10 and 6 nonconsensus nucleotides in the MuRantes and crg-2 LREs, respectively. Stimulation of macrophage-like RAW 264.7 cells with alpha/beta interferon did not activate MuRantes, indicating that the ISRE-like motif in MuRantes does not have ISRE activity. Upon stimulation of RAW 264.7 cells with LPS, proteins capable of binding to LRE accumulate in the nuclei as measured by electrophoretic mobility shift assay. These LRE-binding proteins include c-Jun and CREB. Images PMID:7513046

  9. Retrotransposons in the flanking regions of normal plant genes: a role for copia-like elements in the evolution of gene structure and expression.

    PubMed Central

    White, S E; Habera, L F; Wessler, S R

    1994-01-01

    The wx-K mutation results from the insertion of a copia-like retrotransposon into exon 12 of the maize waxy gene. This retrotransposon, named Hopscotch, has one long open reading frame encoding all of the domains required for transposition. Computer-assisted database searches using Hopscotch and other plant copia-like retroelements as query sequences have revealed that ancient, degenerate retrotransposon insertions are found in close proximity to 21 previously sequenced plant genes. The data suggest that these elements may be involved in gene duplication and the regulation of gene expression. Similar searches using the Drosophila retrotransposon copia did not reveal any retrotransposon-like sequences in the flanking regions of animal genes. These results, together with the recent finding that reverse-transcriptase sequences characteristic of copia-like elements are ubiquitous and diverse in plants, suggest that copia-like retrotransposons are an ancient component of plant genomes. Images PMID:7991537

  10. Genomic matrix attachment region and chromosome conformation capture quantitative real time PCR assays identify novel putative regulatory elements at the imprinted Dlk1/Gtl2 locus.

    PubMed

    Braem, Caroline; Recolin, Bénédicte; Rancourt, Rebecca C; Angiolini, Christopher; Barthès, Pauline; Branchu, Priscillia; Court, Franck; Cathala, Guy; Ferguson-Smith, Anne C; Forné, Thierry

    2008-07-04

    We previously showed that genomic imprinting regulates matrix attachment region activities at the mouse Igf2 (insulin-like growth factor 2) locus and that these activities are functionally linked to neighboring differentially methylated regions (DMRs). Here, we investigate the similarly structured Dlk1/Gtl2 imprinted domain and show that in the mouse liver, the G/C-rich intergenic germ line-derived DMR, a sequence involved in domain-wide imprinting, is highly retained within the nuclear matrix fraction exclusively on the methylated paternal copy, reflecting its differential function on that chromosome. Therefore, not only "classical" A/T-rich matrix attachment region (MAR) sequences but also other important regulatory DNA elements (such as DMRs) can be recovered from genomic MAR assays following a high salt treatment. Interestingly, the recovery of one A/T-rich sequence (MAR4) from the "nuclear matrix" fraction is strongly correlated with gene expression. We show that this element possesses an intrinsic activity that favors transcription, and using chromosome conformation capture quantitative real time PCR assays, we demonstrate that the MAR4 interacts with the intergenic germ line-derived DMR specifically on the paternal allele but not with the Dlk1/Gtl2 promoters. Altogether, our findings shed a new light on gene regulation at this locus.

  11. A hemicentric inversion in the maize line knobless Tama flint created two sites of centromeric elements and moved the kinetochore-forming region.

    PubMed

    Lamb, Jonathan C; Meyer, Julie M; Birchler, James A

    2007-06-01

    A maize line, knobless Tama flint (KTF), was found to contain a version of chromosome 8 with two spatially distinct regions of centromeric elements, one at the original genetic position and the other at a novel location on the long arm. The new site of centromeric elements functions as the kinetochore-forming region resulting in a change of arm length ratio. Examination of fluorescence in situ hybridization markers on chromosome 8 revealed an inversion between the two centromere sites relative to standard maize lines, indicating that this chromosome 8 resulted from a hemicentric inversion with one breakpoint approximately 20 centi-McClintocks (cMc) on the long arm (20% of the total arm length from the centromere) and the other in the original cluster of centromere repeats. This inversion moved the kinetochore-forming region but left the remainder of the centromere repeats. In a hybrid between a standard line (Mo17) and KTF, both chromosome 8 homologues were completely synapsed at pachytene despite the inversion. Although the homologous centromeres were not paired, they were always correctly oriented at anaphase and migrated to opposite poles. Additionally, recombination on 8L was severely repressed in the hybrid.

  12. Joining RDC data from flexible protein domains

    NASA Astrophysics Data System (ADS)

    Sgheri, Luca

    2010-11-01

    We study the inverse problem of determining the conformational freedom of two protein domains from residual dipolar coupling (RDC) measurements. For each paramagnetic ion attached to one of the domains we obtain a magnetic susceptibility tensor χ from the RDC of couples of atoms of that domain, and a mean paramagnetic susceptibility tensor {\\bar{\\chi }} from the RDC of couples of atoms of the other domain. The latter is an integral average of rotations of χ which depends on the conformational freedom of the two domains. In this paper we consider the case when we have data from paramagnetic ions attached separately to each of the domains. We prove that in this case not all the elements of χ and {\\bar{\\chi }} are independent. We derive the mathematical equations for the compatibility of the measurements and show how these relations can be used in the presence of noisy data to determine a compatible set of χ and {\\bar{\\chi }} with an unconstrained minimization. If available, information about the shape of the noise can be included in the target function. We show that in this case the compatible set obtained has a reduced error with respect to the noisy data.

  13. Identification and characterization of hepatocyte-specific regulatory regions of the rat pyruvate kinase L gene. The synergistic effect of multiple elements.

    PubMed

    Yamada, K; Noguchi, T; Matsuda, T; Takenaka, M; Monaci, P; Nicosia, A; Tanaka, T

    1990-11-15

    The rat pyruvate kinase L (PKL) gene produces the L- and R-type isozymes by alternative transcription that is regulated in a tissue-specific manner. To investigate which DNA elements are involved in hepatocyte-specific expression of the L-type isozyme, we performed transient DNA transfer experiments with PKL/chloramphenicol acetyltransferase fusion genes. We found three positive regulatory regions required for expression of the L-type isozyme in adult rat hepatocytes by functional analyses of a series of 5' and internal deletion constructs of the fusion genes. These regions, designated as PKL-I, PKL-II, and PKL-III, were located between nucleotides -76 and -94, -126 and -149, and -150 and -170, respectively. PKL-I showed enhancer-like activity alone, whereas PKL-II and PKL-III did not have any independent effect. Combinations of L-I + L-II and L-II + L-III, but not of L-I + L-III, showed synergistic enhancer activities when oriented in the same direction. The inclusion of all three elements oriented in the same direction had the maximum synergistic effect, indicating that these elements function as a unit. This unit enhanced expression from heterologous as well as homologous promoters in a manner that was independent of its orientation and position relative to the cap site. The activity of the unit was not detected in HeLa cells or K562 erythroleukemia cells, suggesting that this unit possessed cell-type specificity. PKL-I consists of a palindrome sequence 5'-CTGGTTATACTTTAACCAG-3', which contain a sequence homologous to the LF-B1-binding site. PKL-II contains the sequence 5'-TTCCTGGACTCTGGCCCCCAGTGT-3', which is similar to that of the LF-A1-binding site. PKL-III contains a palindrome sequence 5'-CCACGGGGCACTCCCGTGG-3', which include a sequence homologous to the binding site of the adenovirus major late transcription factor. Gel retardation assay indicated that the different trans-acting factors interacted with three elements and that the transacting protein bound

  14. Novel apparatus for joining of carbon-carbon composites

    NASA Astrophysics Data System (ADS)

    White, Jeremiah D. E.; Mukasyan, Alexander S.; La Forest, Mark L.; Simpson, Allen H.

    2007-01-01

    A novel apparatus for joining carbon-carbon (C-C) composites is presented. This device was designed and built based on the concept of self-sustained oxygen-free high-temperature reactions. A layer of reactive mixture is contained between two disks of C-C composite that are to be joined. The stack is held in place between two electrodes, which are connected to a dc power supply. dc current is used to uniformly initiate the reaction in the reactive layer. The electrodes are also part of the pneumatic system, which applies a load to the stack. The designed hydraulic system is effective, lending to low cost and simplified, rapid, accurate operation. It provides a very short response time (˜10ms), which is important for the considered applications. All operational parameters such as initial and final loads, applied current, delay time between ignition and final load application, duration of Joule heating, and safety interlocks are controlled by a programable logic controller system. These features make it an efficient, user-friendly and safe machine to join refractory materials. The entire joining process takes place on the order of seconds, rather than hours as required for solid-state joining methods. The mechanical properties of the obtained joints are higher than those for the C-C composites.

  15. Research on microwave joining of SiC

    SciTech Connect

    Silberglitt, R.

    1995-07-31

    Results: identification of optimum joining temperature range for reaction bonded Si carbide at 1420-1500 C; demonstration that specimens joined within this range have fracture roughness greater than as-received material; and demonstration of ability to use SiC formed in situ from the decomposition of polycarbosilane as a joining aid for sintered Si carbide. In the latter case, the interlayer material was also shown to fill any pores in the joining specimens near the interlayer. Together with the demonstration of leaktight joints between tube sections of reaction bonded and sintered SiC under the previous contract, these results provide the foundation for scaleup to joining of the larger and longer tubes needed for radiant burner and heat exchanger tube assemblies. The formation of SiC in situ is important because maintaining roundness of these large tubes is a technical challenge for the tube manufacturer, so that formation of a leaktight joint may require some degree of gap filling.

  16. Mitochondrial protein phylogeny joins myriapods with chelicerates.

    PubMed

    Hwang, U W; Friedrich, M; Tautz, D; Park, C J; Kim, W

    2001-09-13

    The animal phylum Arthropoda is very useful for the study of body plan evolution given its abundance of morphologically diverse species and our profound understanding of Drosophila development. However, there is a lack of consistently resolved phylogenetic relationships between the four extant arthropod subphyla, Hexapoda, Myriapoda, Chelicerata and Crustacea. Recent molecular studies have strongly supported a sister group relationship between Hexapoda and Crustacea, but have not resolved the phylogenetic position of Chelicerata and Myriapoda. Here we sequence the mitochondrial genome of the centipede species Lithobius forficatus and investigate its phylogenetic information content. Molecular phylogenetic analysis of conserved regions from the arthropod mitochondrial proteome yields highly resolved and congruent trees. We also find that a sister group relationship between Myriapoda and Chelicerata is strongly supported. We propose a model to explain the apparently parallel evolution of similar head morphologies in insects and myriapods.

  17. Nanostructure evolution in joining of Al and Fe nanoparticles with femtosecond laser irradiation

    SciTech Connect

    Jiao, Z.; Huang, H.; Zhou, Y. E-mail: nzhou@uwaterloo.ca; Liu, L.; Hu, A.; Duley, W.; He, P. E-mail: nzhou@uwaterloo.ca

    2014-04-07

    The joining of Al-Fe nanoparticles (NPs) by femtosecond (fs) laser irradiation is reported in this paper. Fe and Al NPs were deposited on a carbon film in vacuum via fs laser ablation. Particles were then exposed to multiple fs laser pulses at fluences between 0.5 and 1.3 mJ/cm{sup 2}. Transmission Electron Microscopy (TEM) and Electron Diffraction X-ray observations indicate that Al and Fe NPs bond to each other under these conditions. For comparison, bonding of Al to Al and Fe to Fe NPs was also investigated. The nanostructure, as observed using TEM, showed that individual Al NPs were monocrystalline while individual Fe NPs were polycrystalline prior to joining and that these structures are retained after the formation of Al-Al and Fe-Fe NPs. Al-Fe NPs produced by fs laser joining exhibited a mixed amorphous and crystalline phase at the interface. Bonding is suggested to originate from intermixing within a region of high field intensity between particles.

  18. Permanent wire splicing by an explosive joining process

    NASA Technical Reports Server (NTRS)

    Bement, Laurence J. (Inventor); Kushnick, Anne C. (Inventor)

    1991-01-01

    The invention is an apparatus and method for wire splicing using an explosive joining process. The apparatus consists of a prebent, U-shaped strap of metal that slides over prepositioned wires. A standoff means separates the wires from the strap before joining. An adhesive means holds two ribbon explosives in position centered over the U-shaped strap. A detonating means connects to the ribbon explosives. The process involves spreading strands of each wire to be joined into a flat plane. The process then requires alternating each strand in alignment to form a mesh-like arrangement with an overlapped area. The strap slides over the strands of the wires, and the standoff means is positioned between the two surfaces. The detonating means then initiates the ribbon explosives that drive the strap to accomplish a high velocity, angular collision between the mating surfaces. This collision creates surface melts and collision bonding results in electron sharing linkups.

  19. Advances in Solid State Joining of High Temperature Alloys

    NASA Technical Reports Server (NTRS)

    Ding, Jeff; Schneider, Judy

    2011-01-01

    Many of the metals used in the oil and gas industry are difficult to fusion weld including Titanium and its alloys. Solid state joining processes are being pursued as an alternative process to produce robust structures more amenable to high pressure applications. Various solid state joining processes include friction stir welding (FSW) and a patented modification termed thermal stir welding (TSW). The configuration of TSWing utilizes an induction coil to preheat the material minimizing the burden on the weld tool extending its life. This provides the ability to precisely select and control the temperature to avoid detrimental changes to the microstructure. The work presented in this presentation investigates the feasibility of joining various titanium alloys using the solid state welding processes of FSW and TSW. Process descriptions and attributes of each weld process will be presented. Weld process set ]up and welding techniques will be discussed leading to the challenges experienced. Mechanical property data will also be presented.

  20. Physical Conditions of the Small Magellanic Cloud HII Region NGC 456 and the Underestimated Heavy Element Abundances of the Universe

    NASA Astrophysics Data System (ADS)

    Pena-Guerrero, Maria Angeles; Peimbert, A.

    2011-01-01

    We study the O/H abundance determinations in HII regions in the presence of temperature inhomogeneities (as proposed by Peimbert in 1967), t2. The first object of our study is NGC 456, which the second brightest HII region of the Small Magellanic Clouds (SMC); we find it has an abundance 1.75 times higher than previously determined. Traditionally it is assumed that these objects have the same temperature throughout the whole volume; this temperature is then used to calculate abundances. Our determination was done using Collisionally Excited Lines (CEL) and the t2 obtained from HeI lines; it is consistent with abundances determined with Recombination Lines (RL). The most well known strong-line ratio or metallicity indicator used to determine the O/H ratio is O23= ([OII]3727Å + [OIII]4959,5007Å) / Hβ introduced by Pagel et al. (1979). The log(O23) vs. 12+log(O/H) diagram constitutes an important tool in the study of objects with low intrinsecal brightness or high redshift. To account for the presence of thermal inhomogeneities, the upper branch of the O23-O/H diagram can be recalibrated using RLs whereas in the lower branch of the diagram RLs cannot be used due to their faintness. For low metallicity objects the formalism of t2 is applied to CELs to determine abundances and recalibrate the O23-O/H diagram. We find that the point corresponding to NGC 456 in the diagram shifts up by 0.24 dex in the 12+log(O/H) axis. This is consistent with preliminary results for the next 3 objects of our sample and with the behavior of other HII regions from the literature were t2 has been measured. The systematic shift in the curve of the O23-O/H diagram implies that abundances in the Universe need to be corrected by a factor of approximately 2.

  1. A regional inventory of the landslide processes and the elements at risk on the Rift flanks west of Lake Kivu (DRC)

    NASA Astrophysics Data System (ADS)

    Maki Mateso, Jean-Claude; Monsieurs, Elise; Jacobs, Liesbet; Bagalwa Mateso, Luc; Fiama Bondo, Silvanos; Delvaux, Damien; Albino, Fabien; Kervyn, François; Dewitte, Olivier

    2016-04-01

    The Rift flanks west of Lake Kivu (DRC) are one of the Congolese regions most affected by fatal landslides. However, information on the distribution of these processes and their impact on society is still lacking. Here we present a first regional landslide inventory and the associated elements at risk. The inventory was conducted in an area of 5,700 km² in three administrative territories between the cities of Bukavu and Goma. The region is one of the most densely populated area of DRC with a density of up to 200 persons/km². The approach for the inventory relies on visual analysis of Google Earth imagery and a 5 m resolution DEM that we produced from TanDEM-X interferometry. Field validation was performed in target places accounting for 5% of the study area. More than 2,000 landslides were mapped and distinction was made between deep and shallow, and slide and flow processes. Average landslide area is 6 ha (max. = 430 ha). Geomorphological analysis of landslide distribution shows topographic, lithologic, climatic and seismic controls. For 600 randomly-selected landslides, elements at risk (house, road, cultivated land, river) were inventoried in the areas affected and potentially affected by the instabilities; 10% of the landslides are inhabited and 25% do not present any risk. Numerous landslides have caused direct and indirect damage in recent years. In some places, the impact of mining activities on slope stability can be important. Google Earth was the only way to locate the recent shallow failures triggered by known extreme rainfall events. This inventory is a first step towards the understanding of the landslide processes in the region. Further studies are needed to complete and validate the information, to better infer about the triggers, and to compute susceptibility and risk maps.

  2. Transport of elemental mercury in the unsaturated zone from a waste disposal site in an arid region

    USGS Publications Warehouse

    Walvoord, M.A.; Andraski, B.J.; Krabbenhoft, D.P.; Striegl, R.G.

    2008-01-01

    Mercury contained in buried landfill waste may be released via upward emission to the atmosphere or downward leaching to groundwater. Data from the US Geological Survey's Amargosa Desert Research Site (ADRS) in arid southwestern Nevada reveal another potential pathway of Hg release: long-distance (102 m) lateral migration of elemental Hg (Hg0) through the unsaturated zone. Gas collected from multiple depths from two instrumented boreholes that sample the entire 110-m unsaturated zone thickness and are located 100 and 160 m away from the closest waste burial trench exhibit gaseous Hg concentrations of up to 33 and 11 ng m-3, respectively. The vertical distribution of gaseous Hg in the borehole closest to the disposal site shows distinct subsurface peaks in concentration at depths of 1.5 and 24 m that cannot be explained by radial diffusive transport through a heterogeneous layered unsaturated zone. The inability of current models to explain gaseous Hg distribution at the ADRS highlights the need to advance the understanding of gas-phase contaminant transport in unsaturated zones to attain a comprehensive model of landfill Hg release.

  3. Isotope and trace element geochemistry of sediments from the Barbados Ridge-Demerara Plain region, Atlantic Ocean

    NASA Astrophysics Data System (ADS)

    White, William M.; Dupré, Bernard; Vidal, Philippe

    1985-09-01

    Twenty-four piston core sediment samples and 13 sediments and 3 basalts from DSDP Leg 78 Site 543 were analyzed for Sr, Nd and Pb isotopic compositions. The results show sediment with highly radiogenic Pb 206Pb /204Pb up to 19.8) and rather radiogenic Sr and unradiogenic Nd has been deposited in the region since the Cretaceous. The source of this sediment is probably the Archean Guiana Highland, which is drained by the Orinoco River. Pb and Sr isotopic compositions and sediment thickness decrease and 143Nd /144Nd increases northward due to a decrease in turbiditic component. This decrease is partly due to the damming action of basement ridges. Rare earth concentrations in the sediments are somewhat low, due to the abundance of detrital and biogenic components in the sediment and rapid sedimentation rates. Both positive and negative Ce anomalies occur in the surface sediments, but only positive Ce anomalies occur in the Site 543 sediments. It is unlikely that sediment subducted to the source region of Lesser Antilles arc magmas could be the cause of negative Ce anomalies in those magmas. Isotopic compositions of Site 543 basalts show some effect of contamination by seawater-basalt reaction products and sediments. Beyond this, however, they are typical of "normal" depleted MORB.

  4. Soil properties, strontium isotopic signatures and multi-element profiles to authenticate the origin of vegetables from small-scale regions: illustration with early potatoes from southern Italy.

    PubMed

    Zampella, Mariavittoria; Quétel, Christophe R; Paredes, Eduardo; Goitom Asfaha, Daniel; Vingiani, Simona; Adamo, Paola

    2011-10-15

    We propose a method for the authentication of the origin of vegetables grown under similar weather conditions, in sites less than 10 km distance from the sea and distributed over a rather small scale area (58651 km(2)). We studied how the strontium (Sr) isotopic signature and selected elemental concentrations ([Mn], [Cu], [Zn], [Rb], [Sr] and [Cd]) in early potatoes from three neighbouring administrative regions in the south of Italy were related to the geological substrate (alluvial sediments, volcanic substrates and carbonate rocks) and to selected soil chemical properties influencing the bioavailability of elements in soils (pH, cation exchange capacity and total carbonate content). Through multiple-step multivariate statistics (PLS-DA) we could assign 26 potatoes (including two already commercialised samples) to their respective eight sites of production, corresponding to the first two types of geological substrates. The other 12 potatoes from four sites of production had similar characteristics in terms of the geological substrate (third type) and these soil properties could be grouped together. In this case, more discriminative parameters would be required to allow the differentiation between sites. The validation of our models included external prediction tests with data of potatoes harvested the year before and a study on the robustness of the uncertainties of the measurement results. Annual variations between multi-elemental and Sr isotopic fingerprints were observed in potatoes harvested from soils overlying carbonate rocks, stressing the importance of testing long term variations in authentication studies.

  5. Tool and process for miniature explosive joining of tubes

    NASA Technical Reports Server (NTRS)

    Bement, Laurence J. (Inventor); Bailey, James W. (Inventor)

    1987-01-01

    A tool and process to be used in the explosive joining of tubes is disclosed. The tool consists of an initiator, a tool form, and a ribbon explosive. The assembled tool is a compact, storable, and safe device suitable for explosive joining of small, lightweight tubes down to 0.20 inch in diameter. The invention is inserted into either another tube or a tube plate. A shim or standoff between the two surfaces to be welded is necessary. Initiation of the explosive inside the tube results in a high velocity, angular collision between the mating surfaces. This collision creates surface melts and collision bonding wherein electron-sharing linkups are formed.

  6. Superplasticity and joining of zirconia-based ceramics

    SciTech Connect

    Gutierrez-Mora, F.; Dominguez-Rodriguez, A.; Jimenez-Melendo, M.; Chaim, R.; Ravi, G.B.; Routbort, J.L.

    2000-07-01

    Steady-state creep and joining of alumina/zirconia composites containing alumina volume fractions of 20, 60 and 85% have been investigated between 1,250 and 1,350 C. Superplasticity of these compounds is controlled by grain-boundary sliding and the creep rate is a function of alumina volume fraction, not grain size. Using the principles of superplasticity, pieces of the composite have been joined by applying the stress required to achieve 5 to 10% strain to form a strong interface at temperatures as low as 1,200 C.

  7. Liquid-solid joining of bulk metallic glasses

    PubMed Central

    Huang, Yongjiang; Xue, Peng; Guo, Shu; Wu, Yang; Cheng, Xiang; Fan, Hongbo; Ning, Zhiliang; Cao, Fuyang; Xing, Dawei; Sun, Jianfei; Liaw, Peter K.

    2016-01-01

    Here, we successfully welded two bulk metallic glass (BMG) materials, Zr51Ti5Ni10Cu25Al9 and Zr50.7Cu28Ni9Al12.3 (at. %), using a liquid-solid joining process. An atomic-scale metallurgical bonding between two BMGs can be achieved. The interface has a transition layer of ~50 μm thick. The liquid-solid joining of BMGs can shed more insights on overcoming their size limitation resulting from their limited glass-forming ability and then promoting their applications in structural components. PMID:27471073

  8. Liquid-solid joining of bulk metallic glasses

    NASA Astrophysics Data System (ADS)

    Huang, Yongjiang; Xue, Peng; Guo, Shu; Wu, Yang; Cheng, Xiang; Fan, Hongbo; Ning, Zhiliang; Cao, Fuyang; Xing, Dawei; Sun, Jianfei; Liaw, Peter K.

    2016-07-01

    Here, we successfully welded two bulk metallic glass (BMG) materials, Zr51Ti5Ni10Cu25Al9 and Zr50.7Cu28Ni9Al12.3 (at. %), using a liquid-solid joining process. An atomic-scale metallurgical bonding between two BMGs can be achieved. The interface has a transition layer of ~50 μm thick. The liquid-solid joining of BMGs can shed more insights on overcoming their size limitation resulting from their limited glass-forming ability and then promoting their applications in structural components.

  9. Liquid-solid joining of bulk metallic glasses.

    PubMed

    Huang, Yongjiang; Xue, Peng; Guo, Shu; Wu, Yang; Cheng, Xiang; Fan, Hongbo; Ning, Zhiliang; Cao, Fuyang; Xing, Dawei; Sun, Jianfei; Liaw, Peter K

    2016-07-29

    Here, we successfully welded two bulk metallic glass (BMG) materials, Zr51Ti5Ni10Cu25Al9 and Zr50.7Cu28Ni9Al12.3 (at. %), using a liquid-solid joining process. An atomic-scale metallurgical bonding between two BMGs can be achieved. The interface has a transition layer of ~50 μm thick. The liquid-solid joining of BMGs can shed more insights on overcoming their size limitation resulting from their limited glass-forming ability and then promoting their applications in structural components.

  10. Joining three car body steel sheets by clinching method

    NASA Astrophysics Data System (ADS)

    Kaščák, Ľuboš; Spišák, Emil; Majerníková, Jana

    2016-12-01

    The optimization of a car body in terms of cost can be achieved by using different materials in various positions of the car in order to utilize specific properties of each different material. Resistance spot welding is the most used method of joining in car body production, but it is not always easy or even possible to join some combination of materials by this method. Clinching is an alternative method to spot welding, as a combination of drawing and forming. The research is focused on the evaluation of clinched joints' properties using shearing test and metallographic observation of material structure.

  11. Investigating Thermal Interactions in the Case of Laser Assisted Joining of PMMA Plastic and Steel

    NASA Astrophysics Data System (ADS)

    Bauernhuber, Andor; Markovits, Tamás

    Laser transmission joining of dissimilar materials is a novel and promising area of researches on joining technology. However, processes during laser assisted metal plastic (LAMP) joining are not completely explained yet. In the course of this study, the authors investigated the joining process of PMMA plastic and steel by means of laser, as a part of their research on dissimilar material joining. The characteristic process temperature was measured during the joining by different heating conditions, to describe thermal interactions between the polymer and the metal part, and to better understand the mechanism of joining.

  12. Full-length L1 elements have arisen recently in the same 1-kb region of the gorilla and human genomes.

    PubMed

    DeBerardinis, R J; Kazazian, H H

    1998-09-01

    New copies of the mammalian retrotransposon L1 arise in the germline at an undetermined rate. Each new L1 copy appears at a specific evolutionary time point that can be estimated by phylogenetic analysis. In humans, the active L1 sequence L1.2 resides at the genomic locus LRE1. Here we analyzed the region surrounding the LRE1 locus in humans and gorillas to determine the evolutionary history of the region and to estimate the age of L1.2. We found that the region was composed of an ancient L1, L1Hs-Lrg, which was significantly divergent from all other L1 sequences available in the databases. We also determined that L1.2 was absent from the gorilla genome and arose in humans after the divergence of gorilla and human lineages. In the gorilla LRE1 region, we discovered a different full-length L1 element, L1Gg-1, which was allelic and present at a high gene frequency in gorillas but absent from other primates. We determined the nucleotide sequence of L1Gg-1 and found that it was 98% identical to L1.2, suggesting a close relationship between active L1s in gorillas and humans.

  13. Using the P[wHy] hybrid transposable element to disrupt genes in region 54D-55B in Drosophila melanogaster.

    PubMed Central

    Mohr, Stephanie E; Gelbart, William M

    2002-01-01

    Understanding the function of each gene in the genome of a model organism such as Drosophila melanogaster is an important goal. The development of improved methods for uncovering the mutant phenotypes of specific genes can accelerate achievement of this goal. The P[wHy] hybrid transposable element can be used to generate nested sets of precisely mapped deletions in a given region of the Drosophila genome. Here we use the P[wHy] method to generate overlapping, molecularly defined deletions from a set of three P[wHy] insertions in the 54E-F region of chromosome 2. Deletions that span a total of 0.5 Mb were identified and molecularly mapped precisely. Using overlapping deletions, the mutant phenotypes of nine previously uncharacterized genes in a 101-kb region were determined, including identification of new loci required for viability and female fertility. In addition, the deletions were used to molecularly map previously isolated lethal mutations. Thus, the P[wHy] method provides an efficient method for systematically determining the phenotypes of genes in a given region of the fly genome. PMID:12242231

  14. Torsional Shear Strength Tests for Glass-Ceramic Joined Silicon Carbide

    DOE PAGES

    Ferraris, Monica; Ventrella, Andrea; Salvo, Milena; ...

    2014-03-17

    A torsion test on hour-glass-shaped samples with a full joined or a ring-shaped joined area was chosen in this study to measure shear strength of glass-ceramic joined silicon carbide. Shear strength of about 100 MPa was measured for full joined SiC with fracture completely inside their joined area. Attempts to obtain this shear strength with a ring-shaped joined area failed due to mixed mode fractures. However, full joined and ring-shaped steel hour-glasses joined by a glass-ceramic gave the same shear strength, thus suggesting that this test measures shear strength of joined components only when their fracture is completely inside theirmore » joined area.« less

  15. Torsional Shear Strength Tests for Glass-Ceramic Joined Silicon Carbide

    SciTech Connect

    Ferraris, Monica; Ventrella, Andrea; Salvo, Milena; Katoh, Yutai; Gross, Dietmar

    2014-03-17

    A torsion test on hour-glass-shaped samples with a full joined or a ring-shaped joined area was chosen in this study to measure shear strength of glass-ceramic joined silicon carbide. Shear strength of about 100 MPa was measured for full joined SiC with fracture completely inside their joined area. Attempts to obtain this shear strength with a ring-shaped joined area failed due to mixed mode fractures. However, full joined and ring-shaped steel hour-glasses joined by a glass-ceramic gave the same shear strength, thus suggesting that this test measures shear strength of joined components only when their fracture is completely inside their joined area.

  16. Biomechanics of cervical tooth region and noncarious cervical lesions of different morphology; three-dimensional finite element analysis

    PubMed Central

    Jakupović, Selma; Anić, Ivica; Ajanović, Muhamed; Korać, Samra; Konjhodžić, Alma; Džanković, Aida; Vuković, Amra

    2016-01-01

    Objective: The present study aims to investigate the influence of presence and shape of cervical lesions on biomechanical behavior of mandibular first premolar, subjected to two types of occlusal loading using three-dimensional (3D) finite element method (FEM). Materials and Methods: 3D models of the mandibular premolar are created from a micro computed tomography X-ray image: model of sound mandibular premolar, model with the wedge-shaped cervical lesion (V lesion), and model with saucer-shaped cervical lesion (U lesion). By FEM, straining of the tooth tissues under functional and nonfunctional occlusal loading of 200 (N) is analyzed. For the analysis, the following software was used: CTAn program 1.10 and ANSYS Workbench (version 14.0). The results are presented in von Mises stress. Results: Values of calculated stress in all tooth structures are higher under nonfunctional occlusal loading, while the functional loading is resulted in homogeneous stress distribution. Nonfunctional load in the cervical area of sound tooth model as well as in the sub-superficial layer of the enamel resulted with a significant stress (over 50 [MPa]). The highest stress concentration on models with lesions is noticed on the apex of the V-shaped lesion, while stress in saucer U lesion is significantly lower and distributed over wider area. Conclusion: The type of the occlusal teeth loading has the biggest influence on cervical stress intensity. Geometric shape of the existing lesion is very important in the distribution of internal stress. Compared to the U-shaped lesions, V-shaped lesions show significantly higher stress concentrations under load. Exposure to stress would lead to its progression. PMID:27403064

  17. Population-based dietary intakes and tap water concentrations for selected elements in the EPA region V National Human Exposure Assessment Survey (NHEXAS).

    PubMed

    Thomas, K W; Pellizzari, E D; Berry, M R

    1999-01-01

    A National Human Exposure Assessment Survey (NHEXAS) field study was performed in U.S. Environmental Protection Agency (EPA) Region V, providing population-based exposure distribution data for selected elements in several personal, environmental, and biological media. Population distributions are reported for the 11 elements that were measured in water and dietary samples. Dietary intakes and home tap water concentrations of lead, arsenic, and cadmium were further examined for intermedia associations, for differences between dietary exposure for adults and children, and to estimate the proportion of the population above health-based reference values (dietary) or regulatory action levels or maximum contaminant levels (water). Water lead and arsenic concentrations were significantly associated with dietary intake. Intake of all elements was higher from solid foods than from liquid foods (including drinking water). Dietary intakes of Pb, As, and Cd were greater than those calculated for intake from home tap water or inhalation on a microg/day basis. Median dietary intakes for the Region V population for Pb, As, and Cd were 0.10, 0.13, and 0.19 microg/kg bw/day, respectively. While Pb, As, and Cd concentrations in the foods consumed by 0 to 6-year-old children were similar to or lower than those for adults, dietary intakes calculated on a body weight basis were 1.5 to 2.5 times higher for young children. Intrapersonal intake differences accounted for most of the variance in short-term (daily) dietary intakes for Pb and As, while interpersonal differences accounted for more of the intake variance for Cd. Only small percentages of the population exceeded health-based intake reference values or concentrations equal to regulatory levels in water for Pb, As, and Cd.

  18. The circadian clock-related gene pex regulates a negative cis element in the kaiA promoter region.

    PubMed

    Kutsuna, Shinsuke; Kondo, Takao; Ikegami, Haruki; Uzumaki, Tatsuya; Katayama, Mitsunori; Ishiura, Masahiro

    2007-11-01

    In the cyanobacterium Synechococcus sp. strain PCC 7942, a circadian clock-related gene, pex, was identified as the gene prolonging the period of the clock. A PadR domain, which is a newly classified transcription factor domain, and the X-ray crystal structure of the Pex protein suggest a role for Pex in transcriptional regulation in the circadian system. However, the regulatory target of the Pex protein is unknown. To determine the role of Pex, we monitored bioluminescence rhythms that reported the expression activity of the kaiA gene or the kaiBC operon in pex deficiency, pex constitutive expression, and the wild-type genotype. The expression of kaiA in the pex-deficient or constitutive expression genotype was 7 or 1/7 times that of the wild type, respectively, suggesting that kaiA is the target of negative regulation by Pex. In contrast, the expression of the kaiBC gene in the two pex-related genotypes was the same as that in the wild type, suggesting that Pex specifically regulates kaiA expression. We used primer extension analysis to map the transcription start site for the kaiA gene 66 bp upstream of the translation start codon. Mapping with deletion and base pair substitution of the kaiA upstream region revealed that a 5-bp sequence in this region was essential for the regulation of kaiA. The repression or constitutive expression of the kaiA transgene caused the prolongation or shortening of the circadian period, respectively, suggesting that the Pex protein changes the period via the negative regulation of kaiA.

  19. Delayed secondary glucocorticoid response elements. Unusual nucleotide motifs specify glucocorticoid receptor binding to transcribed regions of alpha 2u-globulin DNA.

    PubMed

    Chan, G C; Hess, P; Meenakshi, T; Carlstedt-Duke, J; Gustafsson, J A; Payvar, F

    1991-11-25

    Glucocorticoids stimulate the transcription of rat alpha 2u-globulin (RUG) genes. Because this induction occurs after a time lag of several hours and is blocked by inhibitors of protein synthesis, it exemplifies a delayed secondary response to steroid hormones. In this report, we show that a region of RUG-transcribed DNA (approximately +1800 to +2174) contains multiple footprint sites for glucocorticoid receptor that are, apparently, organized into at least three independent binding clusters. The DNA sequences bound by the receptor and the location of binding sites were determined. A family of sequences related to half-sites of the consensus primary glucocorticoid response element (GRE) is discernible at each cluster of sites. Compared to the consensus GRE, which contains two pseudo-palindromic hexanucleotides arranged in a tail-to-tail fashion and separated by three bases, the arrangements of hexanucleotides within this segment of RUG DNA are unusual and heterogeneous. Methylation interference of a binding cluster containing three receptor footprints demonstrates that certain guanines of the GRE-like hexanucleotides are essential for efficient receptor binding. A synthetic 29-base pair (bp) RUG element, containing one receptor footprint from this cluster, selectively binds the receptor. Within this 29-bp element, six nucleotides separate two directly repeated copies of GRE-like hexanucleotides. RUG DNA fragments containing all or part of the three binding clusters, including the 29-bp element, confer a delayed secondary hormone responsiveness upon a linked heterologous promoter and reporter gene in stably transfected cell lines. We speculate that the unusual DNA sequence motifs of the receptor-binding sites are crucial for the generation of certain delayed secondary responses.

  20. Alkali metal and rare earth element evolution of rock-forming minerals from the Gatumba area pegmatites (Rwanda): Quantitative assessment of crystal-melt fractionation in the regional zonation of pegmatite groups

    NASA Astrophysics Data System (ADS)

    Hulsbosch, Niels; Hertogen, Jan; Dewaele, Stijn; André, Luc; Muchez, Philippe

    2014-05-01

    This study presents a general model for the evaluation of Rayleigh fractional crystallisation as the principal differentiation mechanism in the formation of regionally zoned common and rare-element pegmatites. The magmatic evolution of these systems from a granitic source is reconstructed by means of alkali element and rare earth element (REE) analyses of rock-forming minerals (feldspars, micas and tourmaline), which represent a whole sequence of regional pegmatite zonation. The Gatumba pegmatite field (Rwanda, Central Africa) is chosen as case study area because of its well-developed regional zonation sequence. The pegmatites are spatially and temporally related to peraluminous G4-granites (986 ± 10 Ma). The regional zonation is developed around a G4-granite and the proximal pegmatites grade outwardly into biotite, two-mica and muscovite pegmatites. Rare-element (Nb-Ta-Sn) pegmatites occur most distal from the granite.

  1. Joining of Cf/SiC Ceramics to Nimonic Alloys

    NASA Astrophysics Data System (ADS)

    Jiménez, C.; Mergia, K.; Moutis, N. V.; Azpiroz, X. A.; Wilhelmi, Ch.; Speliotis, Th.; Messoloras, S.

    2012-05-01

    Cf/SiC ceramic composites have been brazed to Nimonic alloys using TiCuAg filler metal. In order to improve wettability and to provide compatibility between ceramic and metal, the Cf/SiC surface was metallized through the deposition of a chromium layer. Subsequent heat treatments were carried out to develop intermediate layers of chromium carbides. Excellent wetting of both the composite ceramic and the metal from the filler metal is observed in the fabricated joints. Shear tests show that failure occurs always within the ceramic material and not at the joint. In the filler region depletion of Ti and formation of Ag and Cu rich regions are observed. At the Cf/SiC-filler interface a layered structure of the filler metallic elements is observed. Titanium interacts with the SiC matrix to form carbides and silicides.

  2. Women's Heart Disease: Join the Heart Truth Community

    MedlinePlus

    ... this page please turn JavaScript on. Feature: Women's Heart Disease Join The Heart Truth Community Past Issues / Winter 2014 Table of Contents National Symbol The centerpiece of The Heart Truth ® is The Red Dress ® which was introduced ...

  3. Joining Forces: The Case of Alliant International University

    ERIC Educational Resources Information Center

    Leslie, Heather

    2013-01-01

    Mergers and acquisitions are a prevalent force in higher education as more colleges and universities are joining forces to expand resources, enhance missions, or prevent closures. This study examines the merger of Alliant University (formerly California School of Professional Psychology) with United States International University to create what…

  4. Efficient and scalable graph similarity joins in MapReduce.

    PubMed

    Chen, Yifan; Zhao, Xiang; Xiao, Chuan; Zhang, Weiming; Tang, Jiuyang

    2014-01-01

    Along with the emergence of massive graph-modeled data, it is of great importance to investigate graph similarity joins due to their wide applications for multiple purposes, including data cleaning, and near duplicate detection. This paper considers graph similarity joins with edit distance constraints, which return pairs of graphs such that their edit distances are no larger than a given threshold. Leveraging the MapReduce programming model, we propose MGSJoin, a scalable algorithm following the filtering-verification framework for efficient graph similarity joins. It relies on counting overlapping graph signatures for filtering out nonpromising candidates. With the potential issue of too many key-value pairs in the filtering phase, spectral Bloom filters are introduced to reduce the number of key-value pairs. Furthermore, we integrate the multiway join strategy to boost the verification, where a MapReduce-based method is proposed for GED calculation. The superior efficiency and scalability of the proposed algorithms are demonstrated by extensive experimental results.

  5. Novel Metal-Ceramic Joining for Planar SOFCs

    SciTech Connect

    Kim, Jin Yong Y.; Hardy, John S.; Weil, K. Scott

    2005-05-01

    We are investigating a new method of ceramic-to-metal joining, referred to as reactive air brazing (RAB), as a potential method of sealing planar solid oxide fuel cells (SOFCs). In the present study, yttria stabilized zirconia (YSZ) and FeCrAlY were selected as subject materials in order to simulate the cell-to-frame seal in planar SOFC. YSZ plates were joined with FeCrAlY foils, using various CuO-Ag and CuO-Ag-TiO2 braze compositions. Metallographic analysis revealed that a majority of the CuO in the braze preferentially migrates to the braze/FeCrAlY interface, indicating a stronger affinity and interaction between the CuO and the alumina scale that had formed on the FeCrAlY than with the YSZ substrate. The addition of TiO2 to the braze appeared to have no significant effect on the microstructure or mechanical properties of the YSZ/FeCrAlY joints, unlike what had been observed previously in YSZ/YSZ joining. Four-point bend tests indicated that joint strength improves with increasing CuO content up to 8 mol% CuO, the maximum concentration of copper oxide tetsed, likely due to the concomitant improvement in braze wettability. A maximum bend strength of 101 MPa was achieved using the 8 mol% CuO braze composition, demonstrating the feasibility of this joining technique for sealing planar SOFCs.

  6. Join-A-School Survey: District Summary Report.

    ERIC Educational Resources Information Center

    Albuquerque Public Schools, NM.

    This report summarizes responses to a questionnaire sent to both school and business participants in the Join-A-School Program in Albuquerque, New Mexico. The program, which pairs schools and businesses within a community, was originated in 1985; this survey is the first evaluation of the program. Responses were received from 47% of the business…

  7. 5 CFR 1201.36 - Consolidating and joining appeals.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    .... For example, individual appeals rising from a single reduction in force might be consolidated. (2... join cases on his or her own motion or on the motion of a party if doing so would: (1) Expedite... motion for consolidation or joinder must be filed within 10 days of the date of service of the motion....

  8. 5 CFR 1201.36 - Consolidating and joining appeals.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    .... For example, individual appeals rising from a single reduction in force might be consolidated. (2... join cases on his or her own motion or on the motion of a party if doing so would: (1) Expedite... motion for consolidation or joinder must be filed within 10 days of the date of service of the motion....

  9. 5 CFR 1201.36 - Consolidating and joining appeals.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    .... For example, individual appeals rising from a single reduction in force might be consolidated. (2... or join cases on his or her own motion or on the motion of a party if doing so would: (1) Expedite... motion for consolidation or joinder must be filed within 10 days of the date of service of the motion....

  10. 91. VIEW OF THE SOUTHWEST CORNER WHERE THE TOWER JOINS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    91. VIEW OF THE SOUTHWEST CORNER WHERE THE TOWER JOINS THE WEST GABLE & THE BRICK STEPS LEAD UP TO A SMALL VERANDAH (DUPLICATE OF HABS No. AL-765-34) - Kenworthy Hall, State Highway 14 (Greensboro Road), Marion, Perry County, AL

  11. Incoming Students' Alcohol Use and Intent to Join Greek Organizations

    ERIC Educational Resources Information Center

    Oswalt, Sara B.; Shutt, Michael D.; Cooper, Diane L.

    2006-01-01

    Incoming first-time, first-year students attending summer orientation (N = 1,710) at a large public university in the Southeast completed an instrument that assessed their use of alcohol and other drugs during the previous year, their perceptions of use by current students on campus, their intended alcohol use, and their intent to join a Greek…

  12. Embedded Heaters for Joining or Separating Plastic Parts

    NASA Technical Reports Server (NTRS)

    Bryant, Melvin A., III

    2004-01-01

    A proposed thermal-bonding technique would make it possible to join or separate thermoplastic parts quickly and efficiently. The technique would eliminate the need for conventional welding or for such conventional fastening components as bolted flanges or interlocking hooks. The technique could be particularly useful in the sign industry (in which large quantities of thermoplastics are used) or could be used to join plastic pipes. A thin sheet of a suitable electrically conductive material would be formed to fit between two thermoplastic parts to be joined (see figure). The electrically conductive sheet and the two parts would be put together tightly, then an electrical current would be sent through the conductor to heat the thermoplastic locally. The magnitude of the current and the heating time would be chosen to generate just enough heat to cause the thermoplastic to adhere to both sides of the electrically conductive sheet. Optionally, the electrically conductive sheet could contain many small holes to provide purchase or to increase electrical resistance to facilitate the generation of heat. After thermal bonding, the electrically conductive sheet remains as an integral part of the structure. If necessary, the electrically conductive sheet can be reheated later to separate the joined thermoplastic parts.

  13. Joining and fabrication of metal-matrix composite materials

    NASA Technical Reports Server (NTRS)

    Royster, D. M.; Wiant, H. R.; Bales, T. T.

    1975-01-01

    Manufacturing technology associated with developing fabrication processes to incorporate metal-matrix composites into flight hardware is studied. The joining of composite to itself and to titanium by innovative brazing, diffusion bonding, and adhesive bonding is examined. The effects of the fabrication processes on the material properties and their influence on the design of YF-12 wing panels are discussed.

  14. Improved Joining of Metal Components to Composite Structures

    NASA Technical Reports Server (NTRS)

    Semmes, Edmund

    2009-01-01

    Systems requirements for complex spacecraft drive design requirements that lead to structures, components, and/or enclosures of a multi-material and multifunctional design. The varying physical properties of aluminum, tungsten, Invar, or other high-grade aerospace metals when utilized in conjunction with lightweight composites multiply system level solutions. These multi-material designs are largely dependent upon effective joining techAn improved method of joining metal components to matrix/fiber composite material structures has been invented. The method is particularly applicable to equipping such thin-wall polymer-matrix composite (PMC) structures as tanks with flanges, ceramic matrix composite (CMC) liners for high heat engine nozzles, and other metallic-to-composite attachments. The method is oriented toward new architectures and distributing mechanical loads as widely as possible in the vicinities of attachment locations to prevent excessive concentrations of stresses that could give rise to delaminations, debonds, leaks, and other failures. The method in its most basic form can be summarized as follows: A metal component is to be joined to a designated attachment area on a composite-material structure. In preparation for joining, the metal component is fabricated to include multiple studs projecting from the aforementioned face. Also in preparation for joining, holes just wide enough to accept the studs are molded into, drilled, or otherwise formed in the corresponding locations in the designated attachment area of the uncured ("wet') composite structure. The metal component is brought together with the uncured composite structure so that the studs become firmly seated in the holes, thereby causing the composite material to become intertwined with the metal component in the joining area. Alternately, it is proposed to utilize other mechanical attachment schemes whereby the uncured composite and metallic parts are joined with "z-direction" fasteners. The

  15. Initial Development in Joining of ODS Alloys Using Friction Stir Welding

    SciTech Connect

    Ren, Weiju; Feng, Zhili

    2007-08-01

    Solid-state welding of oxide-dispersion-strengthened (ODS) alloy MA956 sheets using friction stir welding (FSW) was investigated. Butt weld was successfully produced. The weld and base metals were characterized using optical microscopy, scanning electronic microscopy, transmission electronic microscopy, and energy dispersion x-ray spectrum. Microhardness mapping was also conducted over the weld region. Analyses indicate that the distribution of the strengthening oxides was preserved in the weld. Decrease in microhardness of the weld was observed but was insignificant. The preliminary results seem to confirm the envisioned feasibility of FSW application to ODS alloy joining. For application to Gen IV nuclear reactor heat exchanger, further investigation is suggested.

  16. Source Regions of the Interplanetary Magnetic Field and Variability in Heavy-Ion Elemental Composition in Gradual Solar Energetic Particle Events

    NASA Technical Reports Server (NTRS)

    Ko, Yuan-Kuen; Tylka, Allan J.; Ng, Chee K.; Wang, Yi-Ming; Dietrich, William F.

    2013-01-01

    Gradual solar energetic particle (SEP) events are those in which ions are accelerated to their observed energies by interactions with a shock driven by a fast coronal mass-ejection (CME). Previous studies have shown that much of the observed event-to-event variability can be understood in terms of shock speed and evolution in the shock-normal angle. But an equally important factor, particularly for the elemental composition, is the origin of the suprathermal seed particles upon which the shock acts. To tackle this issue, we (1) use observed solar-wind speed, magnetograms, and the PFSS model to map the Sun-L1 interplanetary magnetic field (IMF) line back to its source region on the Sun at the time of the SEP observations; and (2) then look for correlation between SEP composition (as measured by Wind and ACE at approx. 2-30 MeV/nucleon) and characteristics of the identified IMF-source regions. The study is based on 24 SEP events, identified as a statistically-significant increase in approx. 20 MeV protons and occurring in 1998 and 2003-2006, when the rate of newly-emergent solar magnetic flux and CMEs was lower than in solar-maximum years and the field-line tracing is therefore more likely to be successful. We find that the gradual SEP Fe/O is correlated with the field strength at the IMF-source, with the largest enhancements occurring when the footpoint field is strong, due to the nearby presence of an active region. In these cases, other elemental ratios show a strong charge-to-mass (q/M) ordering, at least on average, similar to that found in impulsive events. These results lead us to suggest that magnetic reconnection in footpoint regions near active regions bias the heavy-ion composition of suprathermal seed ions by processes qualitatively similar to those that produce larger heavy-ion enhancements in impulsive SEP events. To address potential technical concerns about our analysis, we also discuss efforts to exclude impulsive SEP events from our event sample.

  17. Advances in Solid State Joining of Haynes 230 High Temperature Alloy

    NASA Technical Reports Server (NTRS)

    Ding, Jeff; Schneider, Judy; Walker, Bryant

    2010-01-01

    The J-2X engine is being designed for NASA s new class of crew and launch vehicles, the Ares I and Ares V. The J-2X is a LOX/Hydrogen upper stage engine with 294,000 lbs of thrust and a minimum Isp of 448 seconds. As part of the design criteria to meet the performance requirements a large film-cooled nozzle extension is being designed to further expand the hot gases and increases the specific impulse. The nozzle extension is designed using Haynes 230, a nickel-chromium-tungsten-molybdenum superalloy. The alloy was selected for its high strength at elevated temperatures and resistance to hydrogen embrittlement. The nozzle extension is manufactured from Haynes 230 plate spun-forged to form the contour and chemically-milled pockets for weight reduction. Currently fusion welding is being evaluated for joining the panels which are then mechanically etched and thinned to required dimensions for the nozzle extension blank. This blank is then spun formed into the parabolic geometry required for the nozzle. After forming the nozzle extension, weight reduction pockets are chemically milled into the nozzle. Fusion welding of Haynes results in columnar grains which are prone to hot cracking during forming processes. This restricts the ability to use spin forging to produce the nozzle contour. Solid state joining processes are being pursued as an alternative process to produce a structure more amenable to spin forming. Solid state processes have been shown to produce a refined grain structure within the joint regions as illustrated in Figure 1. Solid state joining processes include friction stir welding (FSW) and a patented modification termed thermal stir welding (TSW). The configuration of TSWing utilizes an induction coil to preheat the material minimizing the burden on the weld tool extending its life. This provides the ability to precisely select and control the temperature. The work presented in this presentation investigates the feasibility of joining the Haynes 230

  18. Lacustrine Records of Forest Fire Indicators and Trace Elements Deposition in an Land Use Change Region in the Brazilian Amazonia (Alta Floresta, MT)

    NASA Astrophysics Data System (ADS)

    Rodrigues, R. R.; Conceicão, M. G.; Cordeiro, R. C.; Turcq, B. J.; Seoane, J. S.; Sifeddine, A.

    2009-05-01

    The dynamics of terrestrial ecosystems depend on interactions between the carbon cycle, nutrient cycles, and the hydrological cycle, all of which may be modified by climate and human actions. Terrestrial ecological systems, in which carbon is retained in live biomass, decomposing organic matter, and soil, play an important role in the global carbon cycle. Human activities change carbon stocks in these pools and exchanges between them and the atmosphere through land-use change and other activities. From 1850 to 1998 about 136 (+55) Gt C has been emitted as a result of land-use change, predominantly from forest ecosystems. Amazonia's carbon storage potential gives great importance to land-use changes in this region because disturbances of the natural landscape can increase atmospheric carbon and affect global biogeochemical cycles. Mercury release from gold mining activities and deforestation are the two most important environmental issues in the Amazon Basin. Gold mining activities in Amazonia have been responsible for the release of about 2000-3000 t of Hg over the last 20 y. In Alta Floresta region (southern Amazonia), concurrent with the deforestation, an intense gold rush occurred with the exploration of riverbed sediments. This region was a significant gold mining site from 1980 to 1996. This study aims to understand the atmospheric deposition rates of charcoal particles, mercury and other trace elements and discuss the environmental changes caused by man activities in an area of an intense land use change. Accordingly to the fact that in Brazilian Amazonia the colonization process generally takes place after the building of a road, an 82 cm core (AF SSW 150) was collected in a lake formed by the barrier effect of a road embankment and distant 150 km of the center of Alta Floresta city. The ages of the sedimentary sections in the core were calculated by the activity of 210Pb. The grain size profile showed a huge change from 1985, with the dominance of fine

  19. Modeling and testing miniature torsion specimens for SiC joining development studies for fusion

    SciTech Connect

    Henager, Jr., C. H.; Nguyen, Ba N.; Kurtz, Richard J.; Roosendaal, T. J.; Borlaug, B. A.; Ferraris, Monica; Ventrella, A.; Katoh, Yutai

    2015-08-05

    The international fusion community has designed a miniature torsion specimen for neutron irradiation studies of joined SiC and SiC/SiC composite materials. For this research, miniature torsion joints based on this specimen design were fabricated using displacement reactions between Si and TiC to produce Ti3SiC2 + SiC joints with SiC and tested in torsion-shear prior to and after neutron irradiation. However, many miniature torsion specimens fail out-of-plane within the SiC specimen body, which makes it problematic to assign a shear strength value to the joints and makes it difficult to compare unirradiated and irradiated strengths to determine irradiation effects. Finite element elastic damage and elastic–plastic damage models of miniature torsion joints are developed that indicate shear fracture is more likely to occur within the body of the joined sample and cause out-of-plane failures for miniature torsion specimens when a certain modulus and strength ratio between the joint material and the joined material exists. The model results are compared and discussed with regard to unirradiated and irradiated test data for a variety of joint materials. The unirradiated data includes Ti3SiC2 + SiC/CVD-SiC joints with tailored joint moduli, and includes steel/epoxy and CVD-SiC/epoxy joints. Finally, the implications for joint data based on this sample design are discussed.

  20. Characterization of the cis elements in the proximal promoter regions of the anthocyanin pathway genes reveals a common regulatory logic that governs pathway regulation

    PubMed Central

    Zhu, Zhixin; Wang, Hailong; Wang, Yiting; Guan, Shan; Wang, Fang; Tang, Jingyu; Zhang, Ruijuan; Xie, Lulu; Lu, Yingqing

    2015-01-01

    Cellular activities such as compound synthesis often require the transcriptional activation of an entire pathway; however, the molecular mechanisms underlying pathway activation have rarely been explained. Here, the cis regulatory architecture of the anthocyanin pathway genes targeted by the transcription factor (TF) complex including MYB, bHLH, and WDR was systematically analysed in one species and the findings extended to others. In Ipomoea purpurea, the IpMYB1-IpbHLH2-IpWDR1 (IpMBW) complex was found to be orthologous to the PAP1-GL3-TTG1 (AtPGT) complex of Arabidopsis thaliana, and interacted with a 7-bp MYB-recognizing element (MRE) and a 6-bp bHLH-recognizing element (BRE) at the proximal promoter region of the pathway genes. There was little transcription of the gene in the absence of the MRE or BRE. The cis elements identified experimentally converged on two syntaxes, ANCNNCC for MREs and CACN(A/C/T)(G/T) for BREs, and our bioinformatic analysis showed that these were present within anthocyanin gene promoters in at least 35 species, including both gymnosperms and angiosperms. For the anthocyanin pathway, IpMBW and AtPGT recognized the interspecific promoters of both early and later genes. In A. thaliana, the seed-specific TF complex (TT2, TT8, and TTG1) may regulate all the anthocyanin pathway genes, in addition to the proanthocyanidin-specific BAN. When multiple TF complexes in the anthocyanin pathway were compared, the cis architecture played a role larger than the TF complex in determining the variation in promoter activity. Collectively, a cis logic common to the pathway gene promoters was found, and this logic is essential for the trans factors to regulate the pathway. PMID:25911741

  1. Limited Flow of Continental Crust at UHP Depths: Coupled Age and Trace-Element Analyses of Titanite in the Western Gneiss Region, Norway

    NASA Astrophysics Data System (ADS)

    Garber, J. M.; Hacker, B. R.; Kylander-Clark, A. R.

    2015-12-01

    Coupled age and trace-element data from titanites in the Western Gneiss Region (WGR) of Norway suggest that continental crust underwent limited recrystallization and ductile flow through ~40 My of deep subduction and subsequent exhumation. Precambrian igneous titanites in granitic to tonalitic orthogneisses from the WGR were metastably preserved though Caledonian ultrahigh-pressure (UHP) metamorphism and variably recrystallized through subsequent amphibolite-facies metamorphism from ~420-385 Ma. The inherited Precambrian titanites are not present everywhere but rather cluster primarily in a cooler "southern domain" (peak T ~650oC) and a hotter "northern domain" (peak T ~750-800oC).Titanite data were collected using LASS (laser-ablation split stream inductively-coupled plasma mass spectrometry) at UCSB, and a principal component analysis (PCA) was used to define age and trace-element populations. These data indicate that inherited titanites are LREE-enriched, HFSE-enriched, and have higher Th/U, consistent with Precambrian neocrystallization from a granitic melt. In contrast, the recrystallized titanites have generally lower Th/U and flat, LREE-depleted, or hump-shaped trace-element patterns. These data suggest that (1) Caledonian titanite recrystallization occurred in the presence of LREE-depleted melts or fluids, or that (2) recrystallization was accompanied by a "typical" granitic melt, but that titanite/bulk-rock distribution coefficients are different for neo- and recrystallization; on-going whole-rock analyses will clarify these hypotheses. Critically, the geochemical signature of recrystallized titanite in felsic orthogneisses is comparable across the entire WGR - emphasizing that the petrologic process of titanite recrystallization was similar orogen-wide, but was less extensive in the domains where inherited titanite was preserved. In this case, large volumes of crust outside of the "old domains" may also have retained metastable titanite during subduction

  2. Comparison of abundances of chemical elements in mineralized and unmineralized sandstone of the Brushy Basin Member of the Morrison Formation, Smith Lake District, Grants uranium region, New Mexico

    USGS Publications Warehouse

    Pierson, C.T.; Spirakis, C.S.; Robertson, J.F.

    1983-01-01

    Statistical treatment of analytical data from the Mariano Lake and Ruby uranium deposits in the Smith Lake district, New Mexico, indicates that organic carbon, arsenic, barium, calcium, cobalt, copper, gallium, iron, lead, manganese, molybdenum, nickel, selenium, strontium, sulfur, vanadium, yttrium, and zirconium are concentrated along with uranium in primary ore. Comparison of the Smith Lake data with information from other primary deposits in the Grants uranium region and elsewhere in the Morrison Formation of the Colorado Plateau suggests that these elements, with the possible exceptions of zirconium and gallium and with the probable addition of aluminum and magnesium, are typically associated with primary, tabular uranium deposits. Chemical differences between the Ruby and Mariano Lake deposits are consistent with the interpretation that the Ruby deposit has been more affected by post-mineralization oxidizing solutions than has the Mariano Lake deposit.

  3. Experimental detailed power distribution in a fast spectrum thermionic reactor fuel element at the core/BeO reflector interface region

    NASA Technical Reports Server (NTRS)

    Klann, P. G.; Lantz, E.

    1973-01-01

    A zero-power critical assembly was designed, constructed, and operated for the prupose of conducting a series of benchmark experiments dealing with the physics characteristics of a UN-fueled, Li-7-cooled, Mo-reflected, drum-controlled compact fast reactor for use with a space-power conversion system. The critical assembly was modified to simulate a fast spectrum advanced thermionics reactor by: (1) using BeO as a reflector in place of some of the existing molybdenum, (2) substituting Nb-1Zr tubing for some of the existing Ta tubing, and (3) inserting four full-scale mockups of thermionic type fuel elements near the core and BeO reflector boundary. These mockups were surrounded with a buffer zone having the equivalent thermionic core composition. In addition to measuring the critical mass of this thermionic configuration, a detailed power distribution in one of the thermionic element stages in the mixed spectrum region was measured. A power peak to average ratio of two was observed for this fuel stage at the midplane of the core and adjacent to the reflector. Also, the power on the outer surface adjacent to the BeO was slightly more than a factor of two larger than the power on the inside surface of a 5.08 cm (2.0 in.) high annular fuel segment with a 2.52 cm (0.993 in. ) o.d. and a 1.86 cm (0.731 in.) i.d.

  4. Meiotic cohesin subunits RAD21L and REC8 are positioned at distinct regions between lateral elements and transverse filaments in the synaptonemal complex of mouse spermatocytes

    PubMed Central

    RONG, Mei; MATSUDA, Atsushi; HIRAOKA, Yasushi; LEE, Jibak

    2016-01-01

    Cohesins containing a meiosis-specific α-kleisin subunit, RAD21L or REC8, play roles in diverse aspects of meiotic chromosome dynamics including formation of axial elements (AEs), assembly of the synaptonemal complex (SC), recombination of homologous chromosomes (homologs), and cohesion of sister chromatids. However, the exact functions of individual α-kleisins remain to be elucidated. Here, we examined the localization of RAD21L and REC8 within the SC by super-resolution microscopy, 3D-SIM. We found that both RAD21L and REC8 were localized at the connection sites between lateral elements (LEs) and transverse filaments (TFs) of pachynema with RAD21L locating interior to REC8 sites. RAD21L and REC8 were not symmetrical in terms of synaptic homologs, suggesting that the arrangement of different cohesins is not strictly fixed along all chromosome axes. Intriguingly, some RAD21L signals, but not REC8 signals, were observed between unsynapsed regions of AEs of zygonema as if they formed a bridge between homologs. Furthermore, the signals of recombination intermediates overlapped with those of RAD21L to a greater degree than with those of REC8. These results highlight the different properties of two meiotic α-kleisins, and strongly support the previous proposition that RAD21L is an atypical cohesin that establishes the association between homologs rather than sister chromatids. PMID:27665783

  5. Finite element modelling of stress field perturbations and interseismic crustal deformation in the Val d'Agri region, southern Apennines, Italy

    NASA Astrophysics Data System (ADS)

    Candela, Stefania; Mazzoli, Stefano; Megna, Antonella; Santini, Stefano

    2015-08-01

    The Val d'Agri area provides the opportunity to analyse active structures in a seismic region for which a large amount of subsurface data is available. This area, which was struck in 1857 by one of the most destructive earthquakes in Italy (MW = 7.03), represents a unique natural laboratory to gain new insights into geometry, modes and rates of faulting controlling crustal deformation in an actively extending orogen. In this study, a crustal geological section through the southern Apennines is discretized into a finite element model (FEM). We present a 2D elastoplastic FEM that reproduces stress perturbations and strain field around the Val d'Agri active fault system. The influence of fault strand activity on interseismic crustal deformation is tested by a series of computer models, whose predictions are compared with the horizontal velocity components of continuous GPS sites in the region and with stress directions and geological data. The best fit with available geological and geophysical constraints is obtained with a 300 km long, 29 km deep model formed by a multilayer including three components having different rheological characteristics and including several shallow, locked fault segments, which branch into a freely slipping major basement fault at depth. Finite element modelling provides new insights into the controversial and widely debated active tectonic setting of the study area, pointing out the fundamental role played by a structural reactivation process involving inherited, long-lived, mature fault systems at depth. Our FEM, reconciling apparently contrasting geological and geophysical constraints from the study area, points to maximum stress build up and strain accumulation at a depth of 15 ± 5 km. Such a depth range is suggested as the most likely one for the nucleation of large events such as the 1857 Val d'Agri earthquake.

  6. Thyroid hormones directly activate the expression of the human and mouse uncoupling protein-3 genes through a thyroid response element in the proximal promoter region

    PubMed Central

    2004-01-01

    The transcription of the human UCP3 (uncoupling protein-3) gene in skeletal muscle is tightly regulated by metabolic signals related to fatty acid availability. However, changes in thyroid status also modulate UCP3 gene expression, albeit by unknown mechanisms. We created transgenic mice bearing the entire human UCP3 gene to investigate the effect of thyroid hormones on human UCP3 gene expression. Treatment of human UCP3 transgenic mice with thyroid hormones induced the expression of the human gene in skeletal muscle. In addition, transient transfection experiments demonstrate that thyroid hormones activate the transcription of the human UCP3 gene promoter when MyoD and the TR (thyroid hormone receptor) were co-transfected. The action of thyroid hormones on UCP3 gene transcription is mediated by the binding of the TR to a proximal region in the UCP3 gene promoter that contains a direct repeat structure. An intact DNA sequence of this site is required for thyroid hormone responsiveness and TR binding. Chromatin immunoprecipitation assays revealed that the TR binds this element in vivo. The murine Ucp3 gene promoter was also dependent on MyoD and responsive to thyroid hormone in transient transfection assays. However, it was much less sensitive to thyroid hormone than the human UCP3 promoter. In summary, UCP3 gene transcription is activated by thyroid hormone treatment in vivo, and this activation is mediated by a TRE (thyroid hormone response element) in the proximal promoter region. Such regulation suggests a link between UCP3 gene expression and the effects of thyroid hormone on mitochondrial function in skeletal muscle. PMID:15496137

  7. Constitutive androstane receptor transcriptionally activates human CYP1A1 and CYP1A2 genes through a common regulatory element in the 5'-flanking region.

    PubMed

    Yoshinari, Kouichi; Yoda, Noriaki; Toriyabe, Takayoshi; Yamazoe, Yasushi

    2010-01-15

    Phenobarbital has long been known to increase cellular levels of CYP1A1 and CYP1A2 possibly through a pathway(s) independent of aryl hydrocarbon receptor. We have investigated the role of constitutive androstane receptor (CAR), a xenobiotic-responsive nuclear receptor, in the transactivation of human CYP1A1 and CYP1A2. These genes are located in a head-to-head orientation, sharing a 5'-flanking region. Reporter assays were thus performed with dual-reporter constructs, containing the whole or partially deleted human CYP1A promoter between two different reporter genes. In this system, human CAR (hCAR) enhanced the transcription of both genes through common promoter regions from -461 to -554 and from -18089 to -21975 of CYP1A1. With reporter assays using additional deleted and mutated constructs, electrophoresis mobility shift assays and chromatin immunoprecipitation assays, an ER8 motif (everted repeat separated by eight nucleotides), located at around -520 of CYP1A1, was identified as an hCAR-responsive element and a binding motif of hCAR/human retinoid X receptor alpha heterodimer. hCAR enhanced the transcription of both genes also in the presence of an aryl hydrocarbon receptor ligand. Finally, hCAR activation increased CYP1A1 and CYP1A2 mRNA levels in cultured human hepatocytes. Our results indicate that CAR transactivates human CYP1A1 and CYP1A2 in human hepatocytes through the common cis-element ER8. Interestingly, the ER8 motif is highly conserved in the CYP1A1 proximal promoter sequences of various species, suggesting a fundamental role of CAR in the xenobiotic-induced expression of CYP1A1 and CYP1A2 independent of aryl hydrocarbon receptor.

  8. Identification of a non-canonical E-box motif as a regulatory element in the proximal promoter region of the apolipoprotein E gene.

    PubMed Central

    Salero, Enrique; Giménez, Cecilio; Zafra, Francisco

    2003-01-01

    We have used the yeast one-hybrid system to identify transcription factors with binding capability to specific sequences in proximal regions of the apolipoprotein E gene ( APOE ) promoter. The sequence between -113 and -80 nt, which contains regulatory elements in various cell types, was used as a bait to screen a human brain cDNA library. Four cDNA clones that encoded portions of the human upstream-stimulatory-factor (USF) transcription factor were isolated. Electrophoretic-mobility-shift assays ('EMSAs') using nuclear extracts from various human cell lines as well as from rat brain and liver revealed the formation of two DNA-protein complexes within the sequence CACCTCGTGAC (region -101/-91 of the APOE promoter) that show similarity to the E-box element. The retarded complexes contained USF1, as deduced from competition and supershift assays. Functional experiments using different APOE promoter-luciferase reporter constructs transiently transfected into U87, HepG2 or HeLa cell lines showed that mutations that precluded the formation of complexes decreased the basal activity of the promoter by about 50%. Overexpression of USF1 in U87 glioblastoma cells led to an increased activity of the promoter that was partially mediated by the atypical E-box. The stimulatory effect of USF1 was cell-type specific, as it was not observed in hepatoma HepG2 cells. Similarly, overexpression of a USF1 dominant-negative mutant decreased the basal activity of the promoter in glioblastoma, but not in hepatoma, cells. These data indicated that USF, and probably other related transcription factors, might be involved in the basal transcriptional machinery of APOE by binding to a non-canonical E-box motif within the proximal promoter. PMID:12444925

  9. Orientation-Specific Joining of AID-initiated DNA Breaks Promotes Antibody Class Switching

    PubMed Central

    Zhang, Yu; Hu, Jiazhi; Volpi, Sabrina A.; Meyers, Robin M.; Ho, Yu-Jui; Du, Zhou; Robbiani, Davide F.; Meng, Feilong; Gostissa, Monica; Nussenzweig, Michel C.; Manis, John P.; Alt, Frederick W.

    2015-01-01

    During B cell development, RAG endonuclease cleaves immunoglobulin heavy chain (IgH) V, D, and J gene segments and orchestrates their fusion as deletional events that assemble a V(D)J exon in the same transcriptional orientation as adjacent Cμ constant region exons1,2. In mice, six additional sets of constant region exons (CHs) lie 100-200 kb downstream in the same transcriptional orientation as V(D)J and Cμ exons2. Long repetitive switch (S) regions precede Cμ and downstream CHs. In mature B cells, class switch recombination (CSR) generates different antibody classes by replacing Cμ with a downstream CH2. Activation-Induced Cytidine Deaminase (AID) initiates CSR by promoting deamination lesions within Sμ and a downstream acceptor S region2,3; these lesions are converted into DNA double-strand breaks (DSBs) by general DNA repair factors3. Productive CSR must occur in a deletional orientation by joining the upstream end of an Sμ DSB to the downstream end of an acceptor S region DSB (Fig. 1a). However, the relative frequency of deletional to inversional CSR junctions had not been measured. Thus, whether orientation-specific joining is a programmed mechanistic feature of CSR as it is for V(D)J recombination and, if so, how this is achieved was unknown. To address this question, we adapted high-throughput genome-wide translocation sequencing (HTGTS)4 into a highly sensitive DSB end-joining assay and applied it to endogenous AID-initiated S region DSBs. We find that CSR indeed is programmed to occur in a productive deletional orientation and does so via an unprecedented mechanism that involves in cis IgH organizational features in combination with frequent S region DSBs initiated by AID. We further implicate ATM-dependent DSB response (DSBR) factors in enforcing this mechanism and provide a solution to the enigma of why CSR is so reliant on the 53BP1 DSBR factor. PMID:26308889

  10. Pigments, elemental composition (C, N, P, Si) and stoichiometry of particulate matter, in the naturally iron fertilized region of Kerguelen in the Southern Ocean

    NASA Astrophysics Data System (ADS)

    Lasbleiz, M.; Leblanc, K.; Blain, S.; Ras, J.; Cornet-Barthaux, V.; Hélias Nunige, S.; Quéguiner, B.

    2014-06-01

    The particulate matter distribution and phytoplankton community structure of the iron-fertilized Kerguelen region were investigated in early austral spring (October-November 2011) during the KEOPS2 cruise. The iron-fertilized region was characterized by a complex mesoscale circulation resulting in a patchy distribution of particulate matter. Integrated concentrations over 200 m ranged from 72.2 to 317.7 mg m-2 for chlorophyll a, 314 to 744 mmol m-2 for biogenic silica (BSi), 1106 to 2268 mmol m-2 for particulate organic carbon, 215 to 436 mmol m-2 for particulate organic nitrogen, and 29.3 to 39.0 mmol m-2 for particulate organic phosphorus. Three distinct high biomass areas were identified: the coastal waters of Kerguelen Islands, the easternmost part of the study area in the Polar Front Zone, and the southeastern Kerguelen Plateau. As expected from previous artificial and natural iron-fertilization experiments, the iron-fertilized areas were characterized by the development of large diatoms revealed by BSi size-fractionation and HPLC pigment signatures, whereas the iron-limited reference area was associated to a low biomass dominated by a mixed (nanoflagellates and diatoms) phytoplankton assemblage. A major difference from previous artificial iron fertilization studies was the observation of much higher Si : C, Si : N, and Si : P ratios (respectively 0.31 ± 0.16, 1.6 ± 0.7 and 20.5 ± 7.9) in the iron-fertilized areas compared to the iron-limited reference station (respectively 0.13, 1.1, 5.8). A second difference is the patchy response of the elemental composition of phytoplankton communities to large scale natural iron fertilization. Comparison to the previous KEOPS1 cruise also allowed to address the seasonal dynamics of phytoplankton bloom over the southeastern plateau. From POC, PON, and BSi evolutions, we showed that the elemental composition of the particulate matter also varies at the seasonal scale. This temporal evolution followed changes of the

  11. Pigments, elemental composition (C, N, P, and Si), and stoichiometry of particulate matter in the naturally iron fertilized region of Kerguelen in the Southern Ocean

    NASA Astrophysics Data System (ADS)

    Lasbleiz, M.; Leblanc, K.; Blain, S.; Ras, J.; Cornet-Barthaux, V.; Hélias Nunige, S.; Quéguiner, B.

    2014-10-01

    The particulate matter distribution and phytoplankton community structure of the iron-fertilized Kerguelen region were investigated in early austral spring (October-November 2011) during the KEOPS2 cruise. The iron-fertilized region was characterized by a complex mesoscale circulation resulting in a patchy distribution of particulate matter. Integrated concentrations over 200 m ranged from 72.2 to 317.7 mg m-2 for chlorophyll a 314 to 744 mmol m-2 for biogenic silica (BSi), 1106 to 2268 mmol m-2 for particulate organic carbon, 215 to 436 mmol m-2 for particulate organic nitrogen, and 29.3 to 39.0 mmol m-2 for particulate organic phosphorus. Three distinct high biomass areas were identified: the coastal waters of Kerguelen Islands, the easternmost part of the study area in the polar front zone, and the southeastern Kerguelen Plateau. As expected from previous artificial and natural iron-fertilization experiments, the iron-fertilized areas were characterized by the development of large diatoms revealed by BSi size-fractionation and high performance liquid chromatography (HPLC) pigment signatures, whereas the iron-limited reference area was associated with a low biomass dominated by a mixed (nanoflagellates and diatoms) phytoplankton assemblage. A major difference from most previous artificial iron fertilization studies was the observation of much higher Si : C, Si : N, and Si : P ratios (0.31 ± 0.16, 1.6 ± 0.7 and 20.5 ± 7.9, respectively) in the iron-fertilized areas compared to the iron-limited reference station (0.13, 1.1, and 5.8, respectively). A second difference is the patchy response of the elemental composition of phytoplankton communities to large scale natural iron fertilization. Comparison to the previous KEOPS1 cruise also allowed to address the seasonal dynamics of phytoplankton bloom over the southeastern plateau. From particulate organic carbon (POC), particulate organic nitrogen (PON), and BSi evolutions, we showed that the elemental composition

  12. Element concentrations in the flesh and osteoderms of estuarine crocodiles (Crocodylus porosus) from the Alligator Rivers Region, Northern Australia: biotic and geographic effects.

    PubMed

    Jeffree, R A; Markich, S J; Twining, J R

    2001-02-01

    The concentrations of Na, K, Ca, Mg, Ba, Sr, Fe, Al, Mn, Zn, Pb, Cu, Ni, Cr, Co, Se, U, and Ti were determined in the flesh and osteoderms of estuarine crocodiles (Crocodylus porosus) captured in three adjacent catchments of Kakadu National Park, within the Alligator Rivers Region of northern Australia. This study provides, for the first-time, baseline concentrations of elements in both flesh and osteoderms of wild crocodiles. Multiple linear regression analyses were used to determine the effects of total crocodile length, estimated age, gender, inferred reproductive status, physical condition, and catchment of capture on element concentrations in both tissues. The Mg concentration (log10) in the flesh and osteoderms of C. porosus significantly (p < or = 0.001) decreased with increasing length (1.7-5.0 m) and estimated age (5-40 years). Similarly, the Ti concentration (log10) in flesh significantly (p < or = 0.01) decreased with increasing length. In contrast, Zn and Se concentration (log10) in flesh significantly (p < or = 0.001) increased with increasing length and/or age, suggesting that these relationships are mediated by biological rather than environmental chemical factors. In flesh, Fe and Na concentrations (log10) significantly (p < or = 0.05) increased as the physical condition of C. porosus deteriorated. No significant (p > 0.05) effects of gender or inferred reproductive status on element concentrations in the flesh and osteoderms were found. The mean concentrations (log10) of Al, Ba, Cr, Ni, and Pb in flesh and Co, Fe, Mg, Mn, and U in the osteoderms were significantly (p < or = 0.01) different between catchments. The significant (p < or = 0.05) effects of catchment on the concentrations of various elements indicate that C. porosus reflects the chemistry of its environmental milieu and therefore has a certain degree of catchment fidelity, even though the catchments are adjacent to one another. Such catchment-specific signals may be useful in the

  13. Joining and Integration of Advanced Carbon-Carbon Composites to Metallic Systems for Thermal Management Applications

    NASA Technical Reports Server (NTRS)

    Singh, M.; Asthana, R.

    2008-01-01

    Recent research and development activities in joining and integration of carbon-carbon (C/C) composites to metals such as Ti and Cu-clad-Mo for thermal management applications are presented with focus on advanced brazing techniques. A wide variety of carbon-carbon composites with CVI and resin-derived matrices were joined to Ti and Cu-clad Mo using a number of active braze alloys. The brazed joints revealed good interfacial bonding, preferential precipitation of active elements (e.g., Ti) at the composite/braze interface. Extensive braze penetration of the inter-fiber channels in the CVI C/C composites was observed. The chemical and thermomechanical compatibility between C/C and metals at elevated temperatures is assessed. The role of residual stresses and thermal conduction in brazed C/C joints is discussed. Theoretical predictions of the effective thermal resistance suggest that composite-to-metal brazed joints may be promising for lightweight thermal management applications.

  14. Advances in Solid State Joining of High Temperature Alloys

    NASA Technical Reports Server (NTRS)

    Ding, R. Jeff; Schneider, Judy; Walker, Bryant

    2011-01-01

    Many of the metals used in the oil and gas industry are difficult to fusion weld including titanium and its alloys. Thus solid state joining processes, such as friction stir welding (FSWing) and a patented modification termed thermal stir welding (TSWing), are being pursued as alternatives to produce robust structures more amenable to high pressure applications. Unlike the FSWing process where the tool is used to heat the workpiece, TSWing utilizes an induction coil to preheat the material prior to stirring thus minimizing the burden on the weld tool and thereby extending its life. This study reports on the initial results of using a hybrid (H)-TSW process to join commercially pure, 1.3cm thick panels of titanium (CP Ti) Grade 2.

  15. Thermal and electrical comparison of different joining techniques

    NASA Astrophysics Data System (ADS)

    Szałapak, J.; Kiełbasiński, K.; Krzemiński, J.; Pawłowski, R.; Jakubowska, M.

    2016-09-01

    After the enforcement of Restriction of Hazardous Substances Directive, one of the biggest problems in electronics is finding a substitution for led solders. Meanwhile, working conditions for the electronics are tougher and tougher - the temperatures the joints have to withstand can be much higher than working temperatures of the soft solders. In current article, the authors present the Low Temperature Joining Technique (LTJT) with the use of pastes based on the mixture of silver nanoparticles and silver microflakes. The authors also show the technology of joining, justify their sintering parameters selection and compare their silver joints with Pb solder and adhesive. The joints prepared with pastes containing silver nanoparticles have much better electrical and thermal properties than the ones made with other techniques.

  16. Breast cancer survivors' decisions to join a dragon boating team.

    PubMed

    Weisenbach, Beth B; McDonough, Meghan H

    2014-12-01

    Physical activity is associated with psychosocial and physical health benefits for breast cancer survivors. Little is known, however, about survivors' decision-making processes when considering joining group physical activity programs designed for survivors. Guided by interpretive description methodology (Thorne, 2008), N = 15 breast cancer survivors who were considering or had made the decision to join a dragon boating team were interviewed about their decisions to participate. Four patterns of decision making were identified: searching for a way to care for physical and social needs, taking advantage of opportunities created by breast cancer, dove in with little contemplation, and hesitant to connect with other survivors. Results have implications for understanding decisions to participate in physical activity groups in this population and overcoming challenges to participation.

  17. Becoming stranger: When future selves join the out-group.

    PubMed

    Burum, Bethany A; Gilbert, Daniel T; Wilson, Timothy D

    2016-09-01

    One of the most powerful rules of interpersonal behavior is that people are kinder to members of their in-groups than to members of their out-groups. Are people also kinder to their future selves when they expect them to remain members of their current in-groups rather than become members of their current out-groups? In 2 studies, participants in an emotionally charged debate expected either to remain on the same team or to join the opposing team when they returned the following week. Those who expected to join the opposing team were less willing to sacrifice for their future selves, leaving more of an unpleasant task for their future selves to finish and treating their future selves as unkindly as they treated a stranger. These results suggest that the rules that govern interpersonal behavior may also govern intertemporal behavior, and suggest new strategies to encourage prudent decisions. (PsycINFO Database Record

  18. Joining and Integration of Silicon Carbide for Turbine Engine Applications

    NASA Technical Reports Server (NTRS)

    Halbig, Michael C.; Singh, Mrityunjay; Coddington, Bryan; Asthana, Rajiv

    2010-01-01

    The critical need for ceramic joining and integration technologies is becoming better appreciated as the maturity level increases for turbine engine components fabricated from ceramic and ceramic matrix composite materials. Ceramic components offer higher operating temperatures and reduced cooling requirements. This translates into higher efficiencies and lower emissions. For fabricating complex shapes, diffusion bonding of silicon carbide (SiC) to SiC is being developed. For the integration of ceramic parts to the surrounding metallic engine system, brazing of SiC to metals is being developed. Overcoming the chemical, thermal, and mechanical incompatibilities between dissimilar materials is very challenging. This presentation will discuss the types of ceramic components being developed by researchers and industry and the benefits of using ceramic components. Also, the development of strong, crack-free, stable bonds will be discussed. The challenges and progress in developing joining and integration approaches for a specific application, i.e. a SiC injector, will be presented.

  19. Joining dissimilar materials using Friction Stir scribe technique

    SciTech Connect

    Upadhyay, Piyush; Hovanski, Yuri; Jana, Saumyadeep; Fifield, Leonard S.

    2016-10-03

    The ability to effectively join materials with vastly different melting points like Aluminum-Steel, Polymer composites - metals has been one of the road blocks in realizing multi-material components for light weighting efforts. Friction stir scribe (FSS) technique is a promising method that produces continuous overlap joint between materials with vastly different melting regimes and high temperature flow characteristics. FSS uses an offset cutting tool at the tip of the FSW pin to create an insitu mechanical interlock between material interfaces. With investments from Vehicle Technology office, US DOE and several automotive manufacturers and suppliers PNNL is developing the FSS process and has demonstrated viability of joining several material combinations. Details of welding trails, unique challenges and mitigation strategies in different material combinations will be discussed. Joint characterization including mechanical tests and joint performances will also be presented.

  20. Joining of Silicon Carbide: Diffusion Bond Optimization and Characterization

    NASA Technical Reports Server (NTRS)

    Halbig, Michael C.; Singh, Mrityunjay

    2008-01-01

    Joining and integration methods are critically needed as enabling technologies for the full utilization of advanced ceramic components in aerospace and aeronautics applications. One such application is a lean direct injector for a turbine engine to achieve low NOx emissions. In the application, several SiC substrates with different hole patterns to form fuel and combustion air channels are bonded to form the injector. Diffusion bonding is a joining approach that offers uniform bonds with high temperature capability, chemical stability, and high strength. Diffusion bonding was investigated with the aid of titanium foils and coatings as the interlayer between SiC substrates to aid bonding. The influence of such variables as interlayer type, interlayer thickness, substrate finish, and processing time were investigated. Optical microscopy, scanning electron microscopy, and electron microprobe analysis were used to characterize the bonds and to identify the reaction formed phases.

  1. Joining of ceramics of different biofunction by hot isostatic pressing

    SciTech Connect

    Li, Jianguo . Center for Dental Technology and Biomaterials); Harmansson, L. ); Soeremark, R. . Dept. of Prosthodontics)

    1993-10-01

    Monolithic zirconia (Z) and zirconia-hydroxyapatite (Z/HA) composites were joined by cold isostatic pressing (CIP at 300 MPa) and subsequently by glass-encapsulated hot isostatic pressing (HIP at 1225 C, 1 h and 200 MPa). The physical and mechanical properties of the materials were measured. The fracture surface was studied using a light microscope. The results indicate a strength level of the joint similar to that of the corresponding composite material (Z/HA), 845 and 860 MPa, respectively. Similar experiments with monolithic alumina (A) and alumina-hydroxyapatite (A/HA) were carried out without success. Cracking occurred in the joint area during the cold isostatic pressing process. It seems that ceramics with high green strength and similar green density are essential when joining ceramics by combined CIP and HIP processes.

  2. The iab-7 Polycomb Response Element Maps to a Nucleosome-Free Region of Chromatin and Requires Both GAGA and Pleiohomeotic for Silencing Activity

    PubMed Central

    Mishra, Rakesh K.; Mihaly, Jozsef; Barges, Stéphane; Spierer, Annick; Karch, François; Hagstrom, Kirsten; Schweinsberg, Susan E.; Schedl, Paul

    2001-01-01

    In the work reported here we have undertaken a functional dissection of a Polycomb response element (PRE) from the iab-7 cis-regulatory domain of the Drosophila melanogaster bithorax complex (BX-C). Previous studies mapped the iab-7 PRE to an 860-bp fragment located just distal to the Fab-7 boundary. Located within this fragment is an ∼230-bp chromatin-specific nuclease-hypersensitive region called HS3. We have shown that HS3 is capable of functioning as a Polycomb-dependent silencer in vivo, inducing pairing-dependent silencing of a mini-white reporter. The HS3 sequence contains consensus binding sites for the GAGA factor, a protein implicated in the formation of nucleosome-free regions of chromatin, and Pleiohomeotic (Pho), a Polycomb group protein that is related to the mammalian transcription factor YY1. We show that GAGA and Pho interact with these sequences in vitro and that the consensus binding sites for the two proteins are critical for the silencing activity of the iab-7 PRE in vivo. PMID:11158316

  3. Identification of Cis-regulatory elements in the mouse Pax9/Nkx2-9 genomic region: implication for evolutionary conserved synteny.

    PubMed Central

    Santagati, Fabio; Abe, Kuniya; Schmidt, Volker; Schmitt-John, Thomas; Suzuki, Misao; Yamamura, Ken-Ichi; Imai, Kenji

    2003-01-01

    We previously reported close physical linkage between Pax9 and Nkx2-9 in the human, mouse, and pufferfish (Fugu rubripes) genomes. In this study, we analyzed cis-regulatory elements of the two genes by comparative sequencing in the three species and by transgenesis in the mouse. We identified two regions including conserved noncoding sequences that possessed specific enhancer activities for expression of Pax9 in the medial nasal process and of Nkx2-9 in the ventral neural tube. Remarkably, the latter contained the consensus Gli-binding motif. Interestingly, the identified Pax9 cis-regulatory sequences were located in an intron of the neighboring gene Slc25a21. Close examination of an extended genomic interval around Pax9 revealed the presence of strong synteny conservation in the human, mouse, and Fugu genomes. We propose such an intersecting organization of cis-regulatory sequences in multigenic regions as a possible mechanism that maintains evolutionary conserved synteny. PMID:14504231

  4. Molecular screening for P-element insertions in a large genomic region of Drosophila melanogaster using polymerase chain reaction mediated by the vectorette.

    PubMed Central

    Eggert, H; Bergemann, K; Saumweber, H

    1998-01-01

    As an alternative to existing methods for the detection of new insertions during a transposon mutagenesis, we adapted the method of vectorette ligation to genomic restriction fragments followed by PCR to obtain genomic sequences flanking the transposon. By combining flies containing a defined genomic transposon with an excess of flies containing unrelated insertion sites, we demonstrate the specificity and sensitivity of the procedure in the detection of integration events. This method was applied in a transposon-tagging screen for BJ1, the Drosophila homolog of the vertebrate gene Regulator of Chromosome Condensation (RCCI). Genetic mobilization of a single genomic P element was used to generate preferentially new local insertions from which integrations into a genomic region surrounding the BJ1 gene were screened. Flies harboring new insertions were phenotypically selected on the basis of the zeste1-dependent transvection of white. We detected a single transposition to a 13-kb region close to the BJ1 gene among 6650 progeny that were analyzed. Southern analysis of the homozygous line confirmed the integration 3 kb downstream of BJ1. PMID:9649531

  5. Joining aluminum to titanium alloy by friction stir lap welding with cutting pin

    SciTech Connect

    Wei, Yanni; Li, Jinglong; Xiong, Jiangtao; Huang, Fu; Zhang, Fusheng; Raza, Syed Hamid

    2012-09-15

    Aluminum 1060 and titanium alloy Ti-6Al-4V plates were lap joined by friction stir welding. A cutting pin of rotary burr made of tungsten carbide was employed. The microstructures of the joining interface were observed by scanning electron microscopy. Joint strength was evaluated by a tensile shear test. During the welding process, the surface layer of the titanium plate was cut off by the pin, and intensively mixed with aluminum situated on the titanium plate. The microstructures analysis showed that a visible swirl-like mixed region existed at the interface. In this region, the Al metal, Ti metal and the mixed layer of them were all presented. The ultimate tensile shear strength of joint reached 100% of 1060Al that underwent thermal cycle provided by the shoulder. - Highlights: Black-Right-Pointing-Pointer FSW with cutting pin was successfully employed to form Al/Ti lap joint. Black-Right-Pointing-Pointer Swirl-like structures formed due to mechanical mixing were found at the interface. Black-Right-Pointing-Pointer High-strength joints fractured at Al suffered thermal cycle were produced.

  6. Joining characteristics of beta-titanium wires with electrical resistance welding.

    PubMed

    Iijima, Masahiro; Brantley, William A; Yuasa, Toshihiro; Kawashima, Isao; Mizoguchi, Itaru

    2008-05-01

    The goal of this research was to investigate the effects of different conditions for electrical resistance welding of beta-titanium orthodontic wires. Three electrode types were used with a range of power settings on an electrical resistance welding machine to join beta-titanium wires (Resolve, GAC International). Forces that caused bond failures for joined specimens were obtained with tensile loading, and the values were compared using one-way ANOVA and the Tukey test (alpha = 0.05). Metallurgical phases in the joint region were determined by micro-X-ray diffraction. Mean tensile forces for bond failure ranged from 5 to 20 kgf for the eight specimen groups and were dependent on electrode type and power setting. All X-ray diffraction peaks in the joint region were indexed to beta-titanium. Superior bond strength was achieved with the use of wide electrodes. The absence of phases other than beta-titanium in the joint area suggests that the electrical resistance welding may not adversely affect clinically important mechanical properties. Scanning microscope observations indicated that the localized permanent deformation and the formation of an undesirable equiaxed grain structure occurred with the use of narrow electrodes.

  7. Europlanet - Joining the European Planetary Research Information Service

    NASA Astrophysics Data System (ADS)

    Capria, M. T.; Chanteur, G.; Schmidt, W.

    2009-04-01

    The "Europlanet Research Infrastructure - Europlanet RI", supported by the European Commission's Framework Program 7, aims at integrating major parts of the distributed European Planetary Research infrastructure with as diverse components as space exploration, ground-based observations, laboratory experiments and numerical model-ling teams. A central part of Europlanet RI is the "Integrated and Distributed Information Service" or Europlanet-IDIS which intends to provide easy Web-based access to information about scientists and teams working in related fields, observatories or laboratories with capabilities possibly beneficial to planetary research, modelling expertise useful for planetary science and observations from space-based, ground-based or laboratory measurements. As far as the type of data and their access methods allow, IDIS will provide Virtual Observatory (VO) like access to a variety of data from distributed sources and tools to compare and integrate this information to further data analysis and re-search. IDIS itself is providing a platform for information and data sharing and for data mining. It is structured as a network of thematic nodes each concentrating on a sub-set of research areas in planetary sciences. But the most important elements of IDIS and the whole Europlanet RI are the single scientists, institutes, laboratories, observatories and mission project teams. Without them the whole effort would remain an empty shell. How can an interested individual or team join this activity and what are the benefits to be expected from the related effort? The poster gives detailed answers to these questions. Here some highlights: 1. Locate from the Europlanet web pages (addresses see below) the thematic node best related to the own field of expertise. This might be more than one. 2. Define which services you want to offer to the community: just the contact address, field of competence, off-line access to data on request or even on-line searchable access

  8. Phase topography-based characterization of thermal effects on materials and joining techniques.

    PubMed

    Lorenz, Hagen; Beckert, Erik; Schödel, René

    2015-03-10

    There are growing demands to characterize the stability of assemblies of optical components for ultrahigh-precision instruments. In this paper we demonstrate how absolute length measurements by interferometry can be applied to measure the thermal and dimensional stability of connections. In order to enable investigation of common joining techniques, including wringing, screwing, and gluing, as well as specialized, inorganic joining techniques such as silicatic bonding, thin-film soldering, and solderjet bumping, representative connections were fabricated. By using gage blocks or prismatic bodies as joining parts, parallelism and flatness were provided which are needed for precision interferometric length measurements. The stability of connection elements used in ultrahigh-precision instruments was investigated longitudinally and laterally to the connection interface, and also mutual tilting of the parts was detected by analysis of the phase topographies. The measurements have an accuracy level of about 1 nm, and the traditional wringing method was also considered as a reference joining technique. The long-term behavior was studied within a period of about 1 year under constant temperature. Further, the thermal dilatation and the reaction of connections to thermal stress were measured. Results show that screwed connections do not exhibit a significant drift of length or orientation. They also did not show response to temperature variations of ±10°C. This is different for adhesive connections, where dimensional changes of up to 100 nm were observed. The specimens produced by using thin-film soldering as well as silicatic bonding revealed stability of length better than 5 nm per year and angular stability within ±0.1   arcsec. Furthermore, these specimens were shown to be insensitive to a temporary temperature variation in a range from 10°C to 40°C. This situation is slightly different for the sample connections produced by solderjet bumping, which show a

  9. Low Temperature Active Joining of Structural and Electronic Composites

    DTIC Science & Technology

    2007-11-02

    vacuum pre-treating of stainless steel and t Materials Resources International 27 Aluminumg has and s g met Alloy n for also s trengt...solid aluminum Bond method was required. If Ti alloy or thi only joining methods can be used. The exa thermal vacuum pre-treatments, grit-blasting were...Rod/Rod tensile test results with Alloy 220 Figure 12. Joints shear strength for single lap shear Figure 13. Effect of doubling the joint

  10. Apparatus for the joining of ceramics using microwave hybrid heating

    SciTech Connect

    Cozzi, A.D.; Ferber, M.K.; Tennery, V.J.

    1995-12-31

    An apparatus was designed and constructed to facilitate the joining of ceramics in a microwave field. The microwave unit used is a modified Goldstar MA-1172M household microwave oven. The maximum load that can be applied is 2.24 kN. Temperature can be monitored with either a shielded type R thermocouple or an optical pyrometer. Measurements of the temperature and applied load are collected remotely.

  11. Biosynthesis of amidated joining peptide from pro-adrenocorticotropin-endorphin

    SciTech Connect

    Cullen, E.I.; Mains, R.E. )

    1987-09-01

    Joining peptide is the major alpha-amidated product of pro-ACTH/endorphin (PAE) in AtT-20 corticotropic tumor cells. To study intracellular joining peptide synthesis, affinity purified antibodies directed against gamma-MSH, joining peptide, and ACTH were used to immunoprecipitate extracts from biosynthetically labeled AtT-20 cells. Immunoprecipitates were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and by tryptic peptide mapping on HPLC. In steady labeling experiments, radioactivity in amidated joining peptide (JP) increased roughly linearly with time, in the manner of a final product, whereas radioactivity associated with PAE (1-94)NH2 reached a constant value after 2-4 h, indicating that PAE(1-94)NH2 is an intermediate in the biosynthesis of JP. Radioactivity appeared in ACTH(1-39) well before JP, consistent with a cleavage order in which ACTH is cleaved from PAE(1-95) before JP sequences are cleaved from PAE(1-74). This conclusion was supported by tryptic peptide analyses of immunoprecipitates, which indicated that less than 5% of JP-related material is cleaved from PAE(1-74) before being cleaved from ACTH-related sequences. After a pulse label, radioactivity in PAE(1-94)NH2 reached a peak value after 1 h of chase and declined with a half-life of less than 1 h. Amidated JP increased to a constant level after 2 h of chase. Enough radiolabeled PAE(1-94)NH2 was detected to account for about half of the radioactivity found in amidated JP, indicating that about half of JP-related material is first cleaved from PAE(1-95) before being amidated. This result was corroborated using HPLC purification to determine both amidated and glycine-extended forms of JP.

  12. Fellow astronauts join Gemini 7 crew for preflight breakfast

    NASA Technical Reports Server (NTRS)

    1965-01-01

    Fellow astronauts join the Gemini 7 prime crew for breakfeast in the Manned Spacecraft Operations Building, Merritt Island, on the day of the Gemini 7 launch. Clockwise around table, starting lower left, are Astronauts James A. Lovell Jr., Gemini 7 prime crew pilot; Walter M. Schirra Jr., Donald K. Slayton, MSC Assistant Director for Flight Crew Operations; Richard F. Gordon Jr., Gemini 8 backup crew pilot; Virgil I. Grissom, Charles Conrad Jr., and Frank Borman, Gemini 7 prime crew command pilot.

  13. Electron Beam Welding to Join Gamma Titanium Aluminide Articles

    NASA Technical Reports Server (NTRS)

    Kelly, Thomas Joseph (Inventor)

    2008-01-01

    A method is provided for welding two gamma titanium aluminide articles together. The method includes preheating the two articles to a welding temperature of from about 1700 F to about 2100 F, thereafter electron beam welding the two articles together at the welding temperature and in a welding vacuum to form a welded structure, and thereafter annealing the welded structure at an annealing temperature of from about 1800 F to about 2200 F, to form a joined structure.

  14. International Symposium on Interfacial Joining and Surface Technology (IJST2013)

    NASA Astrophysics Data System (ADS)

    Takahashi, Yasuo

    2014-08-01

    Interfacial joining (bonding) is a widely accepted welding process and one of the environmentally benign technologies used in industrial production. As the bonding temperature is lower than the melting point of the parent materials, melting of the latter is kept to a minimum. The process can be based on diffusion bonding, pressure welding, friction welding, ultrasonic bonding, or brazing-soldering, all of which offer many advantages over fusion welding. In addition, surface technologies such as surface modification, spraying, coating, plating, and thin-film formation are necessary for advanced manufacturing, fabrication, and electronics packaging. Together, interfacial joining and surface technology (IJST) will continue to be used in various industrial fields because IJST is a very significant form of environmentally conscious materials processing. The international symposium of IJST 2013 was held at Icho Kaikan, Osaka University, Japan from 27-29 November, 2013. A total of 138 participants came from around the world to attend 56 oral presentations and 36 posters presented at the symposium, and to discuss the latest research and developments on interfacial joining and surface technologies. This symposium was also held to commemorate the 30th anniversary of the Technical Commission on Interfacial Joining of the Japan Welding Society. On behalf of the chair of the symposium, it is my great pleasure to present this volume of IOP Conference Series: Materials Science and Engineering (MSE). Among the presentations, 43 papers are published here, and I believe all of the papers have provided the welding community with much useful information. I would like to thank the authors for their enthusiastic and excellent contributions. Finally, I would like to thank all members of the committees, secretariats, participants, and everyone who contributed to this symposium through their support and invaluable effort for the success of IJST 2013. Yasuo Takahashi Chair of IJST 2013

  15. Consider the workhorse: Nonhomologous end joining in budding yeast

    PubMed Central

    Emerson, Charlene H.; Bertuch, Alison A.

    2017-01-01

    DNA double strand breaks (DSBs) are dangerous sources of genome instability and must be repaired by the cell. Nonhomologous end joining (NHEJ) is an evolutionarily conserved pathway to repair DSBs by direct ligation of the ends, with no requirement for a homologous template. While NHEJ is the primary DSB repair pathway in mammalian cells, conservation of the core NHEJ factors throughout eukaryotes make the pathway attractive for study in model organisms. The budding yeast, Saccharomyces cerevisiae, has been used extensively to develop a functional picture of NHEJ. In this review, we will discuss the current understanding of NHEJ in S. cerevisiae. Topics include canonical end-joining, alternative end-joining, and pathway regulation. Particular attention will be paid to the NHEJ mechanism involving core factors, including Yku70/80, Dnl4, Lif1, and Nej1, as well as the various factors implicated in the processing of the broken ends. The relevance of chromatin dynamics to NHEJ will also be discussed. This review illustrates the use of S. cerevisiae as a powerful system to understand the principles of NHEJ, as well as in pioneering the direction of the field. PMID:27240172

  16. DNA Polymerase θ: A Unique Multifunctional End-Joining Machine

    PubMed Central

    Black, Samuel J.; Kashkina, Ekaterina; Kent, Tatiana; Pomerantz, Richard T.

    2016-01-01

    The gene encoding DNA polymerase θ (Polθ) was discovered over ten years ago as having a role in suppressing genome instability in mammalian cells. Studies have now clearly documented an essential function for this unique A-family polymerase in the double-strand break (DSB) repair pathway alternative end-joining (alt-EJ), also known as microhomology-mediated end-joining (MMEJ), in metazoans. Biochemical and cellular studies show that Polθ exhibits a unique ability to perform alt-EJ and during this process the polymerase generates insertion mutations due to its robust terminal transferase activity which involves template-dependent and independent modes of DNA synthesis. Intriguingly, the POLQ gene also encodes for a conserved superfamily 2 Hel308-type ATP-dependent helicase domain which likely assists in alt-EJ and was reported to suppress homologous recombination (HR) via its anti-recombinase activity. Here, we review our current knowledge of Polθ-mediated end-joining, the specific activities of the polymerase and helicase domains, and put into perspective how this multifunctional enzyme promotes alt-EJ repair of DSBs formed during S and G2 cell cycle phases. PMID:27657134

  17. Analysis and optimization of recombinant DNA joining reactions.

    PubMed

    Legerski, R J; Robberson, D L

    1985-01-20

    The statistical segment length of duplex DNA was determined in phage T4 ligase (poly(deoxyribonucleotide): poly(deoxyribonucleotide) ligase (AMP forming), EC 6.5.1.1) buffer (50 mM-Tris . HCl (pH 7.8), 20 mM-dithiothreitol, 10 mM-MgCl2, 1 mM-ATP) at 12 degrees C to be 1030(+/- 116) A. This result was obtained by electron microscopic examination of the molecular distributions generated by T4 ligase-mediated joining of EcoRI-cleaved pBR322 DNA. This value of the statistical segment length was utilized in an extension of the Jacobson-Stockmayer theory on the probability of intramolecular cyclization in order to optimize DNA joining reactions that are of great utility in recombinant DNA experiments. Five cloning systems were analyzed: circular plasmid vectors that had been linearized with one or two restriction endonucleases, circular plasmids that had been tailed with deoxyhomopolymers before joining, lambda-type cloning vectors and cosmids. The results are tabulated for convenient use in molecular cloning experiments.

  18. Consider the workhorse: Nonhomologous end-joining in budding yeast.

    PubMed

    Emerson, Charlene H; Bertuch, Alison A

    2016-10-01

    DNA double strand breaks (DSBs) are dangerous sources of genome instability and must be repaired by the cell. Nonhomologous end-joining (NHEJ) is an evolutionarily conserved pathway to repair DSBs by direct ligation of the ends, with no requirement for a homologous template. While NHEJ is the primary DSB repair pathway in mammalian cells, conservation of the core NHEJ factors throughout eukaryotes makes the pathway attractive for study in model organisms. The budding yeast, Saccharomyces cerevisiae, has been used extensively to develop a functional picture of NHEJ. In this review, we will discuss the current understanding of NHEJ in S. cerevisiae. Topics include canonical end-joining, alternative end-joining, and pathway regulation. Particular attention will be paid to the NHEJ mechanism involving core factors, including Yku70/80, Dnl4, Lif1, and Nej1, as well as the various factors implicated in the processing of the broken ends. The relevance of chromatin dynamics to NHEJ will also be discussed. This review illustrates the use of S. cerevisiae as a powerful system to understand the principles of NHEJ, as well as in pioneering the direction of the field.

  19. The role of mecA and blaZ regulatory elements in mecA expression by regional clones of methicillin-resistant Staphylococcus pseudintermedius.

    PubMed

    Black, C C; Eberlein, L C; Solyman, S M; Wilkes, R P; Hartmann, F A; Rohrbach, B W; Bemis, D A; Kania, S A

    2011-08-05

    Two major regional clones of methicillin-resistant Staphylococcus pseudintermedius (MRSP) have been identified in Europe and North America. They are designated multilocus sequence types (ST) 71 and 68 and contain staphylococcal chromosome cassette (SCCmec) types II-III and V(T), respectively. One notable difference between the two clones is a deletion in the mecI/mecR1 regulatory apparatus of ST 68 SCCmec V(T). This deletion in analogous methicillin-resistant Staphylococcus aureus (MRSA) results in more responsive and greater expression of the mecA encoded penicillin-binding protein 2a, and is associated with SCCmec types occurring in community-acquired MRSA lineages. The aim of this study was to characterize mec and bla regulatory apparatuses in MRSP and determine their effects on expression of mecA. Seventeen S. pseudintermedius isolates representing nine methicillin-resistant ST lineages were screened for the presence of the repressors blaI and mecI and sensors blaR1 and mecR1. The bla and mec operons for each isolate were sequenced and compared for homology between the repressor open-reading frames (ORF), sensor ORFs, and mecA promoter regions. A real-time reverse transcriptase PCR expression assay was developed, validated and applied to nine isolates determining the effect of oxacillin induction on mecA transcription. Significant differences were found in mecA expression between isolates with a full regulatory complement (mecI/mecR1 and blaI/blaR1) and those with truncated and/or absent regulatory elements. Isolates representative of European and North American MRSP ST regional clones have dissimilar mecA responses to oxacillin.

  20. Advanced fusion welding processes, solid state joining and a successful marriage. [production of aerospace structures

    NASA Technical Reports Server (NTRS)

    Miller, F. R.

    1972-01-01

    Joining processes for aerospace systems combine fusion welding and solid state joining during production of metal structures. Detailed characteristics of electron beam welding, plasma arc welding, diffusion welding, inertia welding and weldbond processes are discussed.

  1. Multi-Element Airfoil System

    NASA Technical Reports Server (NTRS)

    Turner, Travis L. (Inventor); Khorrami, Mehdi R. (Inventor); Lockard, David P. (Inventor); McKenney, Martin J. (Inventor); Atherley, Raymond D. (Inventor); Kidd, Reggie T. (Inventor)

    2014-01-01

    A multi-element airfoil system includes an airfoil element having a leading edge region and a skin element coupled to the airfoil element. A slat deployment system is coupled to the slat and the skin element, and is capable of deploying and retracting the slat and the skin element. The skin element substantially fills the lateral gap formed between the slat and the airfoil element when the slat is deployed. The system further includes an uncoupling device and a sensor to remove the skin element from the gap based on a critical angle-of-attack of the airfoil element. The system can alternatively comprise a trailing edge flap, where a skin element substantially fills the lateral gap between the flap and the trailing edge region of the airfoil element. In each case, the skin element fills a gap between the airfoil element and the deployed flap or slat to reduce airframe noise.

  2. Apatite trace element and halogen compositions as petrogenetic-metallogenic indicators: Examples from four granite plutons in the Sanjiang region, SW China

    NASA Astrophysics Data System (ADS)

    Pan, Li-Chuan; Hu, Rui-Zhong; Wang, Xin-Song; Bi, Xian-Wu; Zhu, Jing-Jing; Li, Chusi

    2016-06-01

    The abundances of trace elements including Sr, Ga and rare earth elements (REE) and halogens in apatite crystals from four intermediate-felsic plutons in the Zhongdian terrane in the Sanjiang region have been determined using electron microprobe and laser ablation inductively coupled plasma mass spectrometry to evaluate the potential of apatite as a petrogenic-metallogenic indicator. The selected plutons include one that is not mineralized (the Triassic Xiuwacu pluton, or the TXWC pluton), one that hosts a porphyry-type Cu deposit (the Pulang pluton, or the PL pluton), one that hosts a porphyry-type Mo deposit (the Tongchanggou pluton, or the TCG pluton), and one that hosts a vein-type Mo deposit (the Cretaceous Xiuwacu pluton, or the CXWC pluton). Except for the CXWC pluton, the other three plutons have adakite-like trace element signatures in whole rocks. The results from this study show that REE, Sr and halogens in apatite can be used to track magma compositions, oxidation states and crystallization history. Apatite crystals from the adakite-like plutons are characterized by much higher Sr/Y and δEu than the non-adakite-type pluton. This means that apatite, which is not susceptible to alteration, is a useful tool for identifying the adakite-like plutons that no longer preserve the initial Sr/Y ratios in whole rocks due to weathering and hydrothermal alteration. Based on apatite Ga contents and δEu values, it is inferred that the parental magmas for the two adakite-like plutons containing porphyry-type Cu and Mo mineralization are more oxidized than that for the non-adakite-type pluton containing vein-type Mo mineralization. Apatite crystals from the vein-type Mo deposit have much lower Cl/F ratios than those from the porphyry-type Cu and Mo deposits. Apatite crystals from the adakite-like pluton without Cu or Mo mineralization is characterized by much lower Cl/F ratios than those from the adakite-like plutons that host the porphyry-type Cu and Mo deposits. The

  3. Toxic element mobility assessment and modeling for regional geo-scientific survey to support Risk Assessment in a European Union context

    NASA Astrophysics Data System (ADS)

    Abdaal, Ahmed; Jordan, Gyozo; Bartha, Andras; Fugedi, Ubul

    2013-04-01

    The Mine Waste Directive 2006/21/EC requires the risk-based inventory of all mine waste sites in Europe. The geochemical documentation concerning inert classification and ranking of the mine wastes requires detailed field study and laboratory testing and analyses of waste material to assess the Acid Mine Drainage potential and toxic element mobility. The procedure applied in this study used a multi-level decision support scheme including: 1) expert judgment, 2) data review, 3) representative field sampling and laboratory analysis of formations listed in the Inert Mining Waste List, and 4) requesting available laboratory analysis data from selected operating mines. Based on expert judgment, the listed formations were classified into three categories. A: inert B: probably inert, but has to be checked, C: probably not inert, has to be examined. This paper discusses the heavy metal contamination risk assessment (RA) in leached quarry-mine waste sites in Hungary. In total 34 mine waste sites (including tailing lagoons and heaps of both abandoned mines and active quarries) have been selected for scientific testing using the EU Pre-selection Protocol. Over 93 field samples have been collected from the mine sites including Ore (Andesite and Ryolite), Coal (Lignite, black and brown coals), Peat, Alginite, Bauxite, Clay and Limestone. Laboratory analyses of the total toxic element content (aqua regia extraction), the mobile toxic element content (deionized water leaching) and the analysis of different forms of sulfur (sulfuric acid potential) ) on the base of Hungarian GKM Decree No. 14/2008. (IV. 3) concerning mining waste management. A detailed geochemical study together with spatial analysis and GIS has been performed to derive a geochemically sound contamination RA of the mine waste sites. Key parameters such as heavy metal and sulphur content, in addition to the distance to the nearest surface and ground water bodies, or to sensitive receptors such as settlements and

  4. Low Activation Joining of SiC/SiC Composites for Fusion Applications: Modeling Miniature Torsion Tests with Elastic and Elastic-Plastic Models

    SciTech Connect

    Henager, Charles H.; Nguyen, Ba Nghiep; Kurtz, Richard J.; Roosendaal, Timothy J.; Borlaug, Brennan A.; Ferraris, Monica; Ventrella, Andrea; Katoh, Yutai

    2015-03-01

    The use of SiC and SiC-composites in fission or fusion environments requires joining methods for assembling systems. The international fusion community designed miniature torsion specimens for joint testing and irradiation in test reactors with limited irradiation volumes. These torsion specimens fail out-of-plane when joints are strong and when elastic moduli are within a certain range compared to SiC, which causes difficulties in determining shear strengths for joints or for comparing unirradiated and irradiated joints. A finite element damage model was developed that indicates fracture is likely to occur within the joined pieces to cause out-of-plane failures for miniature torsion specimens when a certain modulus and strength ratio between the joint material and the joined material exists. The model was extended to treat elastic-plastic joints such as SiC/epoxy and steel/epoxy joints tested as validation of the specimen design.

  5. 12 CFR Appendix G to Part 360 - Deposit-Customer Join File Structure

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 12 Banks and Banking 4 2011-01-01 2011-01-01 false Deposit-Customer Join File Structure G Appendix... Join File Structure This is the structure of the data file to provide to the FDIC information necessary..., an indication that it is a join file type and the date of the extract. The files will be...

  6. 12 CFR Appendix G to Part 360 - Deposit-Customer Join File Structure

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 12 Banks and Banking 5 2012-01-01 2012-01-01 false Deposit-Customer Join File Structure G Appendix... Join File Structure This is the structure of the data file to provide to the FDIC information necessary..., an indication that it is a join file type and the date of the extract. The files will be...

  7. 12 CFR Appendix G to Part 360 - Deposit-Customer Join File Structure

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 12 Banks and Banking 5 2013-01-01 2013-01-01 false Deposit-Customer Join File Structure G Appendix... Join File Structure This is the structure of the data file to provide to the FDIC information necessary..., an indication that it is a join file type and the date of the extract. The files will be...

  8. 12 CFR Appendix G to Part 360 - Deposit-Customer Join File Structure

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 12 Banks and Banking 5 2014-01-01 2014-01-01 false Deposit-Customer Join File Structure G Appendix... Join File Structure This is the structure of the data file to provide to the FDIC information necessary..., an indication that it is a join file type and the date of the extract. The files will be...

  9. Thermoplastic Joining and Assembly of Bulk Metallic Glass Composites Through Capacitive Discharge

    NASA Technical Reports Server (NTRS)

    Hofmann, Douglas C. (Inventor); Roberts, Scott N. (Inventor); Kozachkov, Henry (Inventor); Demetriou, Marios D. (Inventor); Schramm, Joseph P. (Inventor); Johnson, William L. (Inventor)

    2015-01-01

    Systems and methods for joining BMG Composites are disclosed. Specifically, the joining of BMG Composites is implemented so as to preserve the amorphicity of their matrix phase and the microstructure of their particulate phase. Implementation of the joining method with respect to the construction of modular cellular structures that comprise BMG Composites is also discussed.

  10. Identification of two glucocorticoid response elements in the promoter region of the ubiquitous isoform of glutamine synthetase in gulf toadfish, Opsanus beta.

    PubMed

    Esbaugh, Andrew J; Walsh, Patrick J

    2009-10-01

    Unlike most teleosts, gulf toadfish have the capacity to switch from ammoniotely to ureotely as the predominate means of nitrogen excretion during periods of stress. The switch to ureotely is a result of increased glutamine synthetase (GS) mRNA expression/enzyme activity in the liver and muscle, which is initiated by cortisol. Cortisol typically affects gene expression through the action of cortisol-activated transcription factors, such as glucocorticoid receptors, which bind to glucocorticoid response elements (GRE) in the upstream regulatory region of genes. The purpose of the present study was to identify the GRE responsible for increased GS gene expression during crowding/confinement in gulf toadfish using an in vivo luciferase reporter assay. Upstream promoter regions for both the ubiquitous and gill GS isoforms were amplified by PCR. Additionally, an intron was amplified from the ubiquitous GS isoform that suggested the possibility of two discreet transcripts for the mitochondrial and cytoplasmic proteins. When tested via in vivo reporter assays, both the cytoplasmic and mitochondrial ubiquitous GS promoters showed increased luciferase activity during crowding vs. noncrowded controls; the gill GS promoter showed no effects in response to crowding. In silico analysis of the mitochondrial and cytoplasmic ubiquitous GS promoter constructs showed an overlapping section of 565 bp containing two potential GREs. Mutation of either site alone had no effect on luciferase activity vs. wild-type controls. However, when both sites were mutated a significant decrease in luciferase activity was observed. We conclude that two functional GREs combine to confer cortisol-inducible GS expression in the liver of gulf toadfish.

  11. Geochemical processes controlling mobilization of arsenic and trace elements in shallow aquifers and surface waters in the Antequera and Poopó mining regions, Bolivian Altiplano

    NASA Astrophysics Data System (ADS)

    Ramos Ramos, Oswaldo Eduardo; Rötting, Tobias S.; French, Megan; Sracek, Ondra; Bundschuh, Jochen; Quintanilla, Jorge; Bhattacharya, Prosun

    2014-10-01

    A geochemical approach was applied to understand the factors controlling the mobilization of As and trace elements (TEs) in mining areas of the Poopó and Antequera River sub-basins on the Bolivian Altiplano. A total of 52 samples (surface, groundwater and geothermal water) were collected during the rainy season (2009). Arsenic, Cd and Mn concentrations exceed World Health Organization (WHO) drinking water guidelines and Bolivian regulations for drinking water in 28 groundwater samples, but Cu, Ni, Pb and Zn do not. Arsenic, Cd, Mn, Pb and Zn concentrations exceed World Health Organization guidelines for drinking water and Bolivian regulations Class A standard for discharge to water bodies in 20 surface water samples, whereas levels of Cu do not, and Ni and Fe rarely exceed regulation and guideline values. Factor analysis was applied to 18 hydrochemical parameters of 52 samples. Five factors for groundwater (plagioclase weathering, dissolution of gypsum and halite, TEs mobilization at acidic pH, sulfide oxidation, and release of As) account for 86.5% of the total variance for Antequera and 83.9% for Poopó sub-basins. Four factors for surface water data (weathering and mobilization of TEs influenced by pH, dissolution of evaporate salts, neutralization of acid mine drainage, and As release due to dissolution of Mn and Fe oxides) account for 91% of the total variance in Antequera and 96% in Poopó sub-basins. The As and TEs mobilized in these regions could affect the local water sources, which is a prevalent concern with respect to water resource management in this semi-arid Altiplano region. Presence of both natural and anthropogenic sources of contamination requires careful monitoring of water quality.

  12. Solid State Joining of High Temperature Alloy Tubes for USC and Heat-Exchanger Systems

    SciTech Connect

    Bimal Kad

    2011-12-31

    The principal objective of this project was to develop materials enabling joining technologies for use in forward looking heat-exchanger fabrication in Brayton cycle HIPPS, IGCC, FutureGen concepts capable of operating at temperatures in excess of 1000{degree}C as well as conventional technology upgrades via Ultra Super-Critical (USC) Rankine-cycle boilers capable of operating at 760{degree}C (1400F)/38.5MPa (5500psi) steam, while still using coal as the principal fossil fuel. The underlying mission in Rankine, Brayton or Brayton-Rankine, or IGCC combined cycle heat engine is a steady quest to improving operating efficiency while mitigating global environmental concerns. There has been a progressive move to higher overall cycle efficiencies, and in the case of fossil fuels this has accelerated recently in part because of concerns about greenhouse gas emissions, notably CO{sub 2}. For a heat engine, the overall efficiency is closely related to the difference between the highest temperature in the cycle and the lowest temperature. In most cases, efficiency gains are prompted by an increase in the high temperature, and this in turn has led to increasing demands on the materials of construction used in the high temperature end of the systems. Our migration to new advanced Ni-base and Oxide Dispersion Strengthened (ODS) alloys poses significant fabrication challenges, as these materials are not readily weldable or the weld performs poorly in the high temperature creep regime. Thus the joining challenge is two-fold to a) devise appropriate joining methodologies for similar/dissimilar Ni-base and ODS alloys while b) preserving the near baseline creep performance in the welded region. Our program focus is on solid state joining of similar and dissimilar metals/alloys for heat exchanger components currently under consideration for the USC, HIPPS and IGCC power systems. The emphasis is to manipulate the joining methods and variables available to optimize joint creep

  13. IgH class switching exploits a general property of two DNA breaks to be joined in cis over long chromosomal distances.

    PubMed

    Gostissa, Monica; Schwer, Bjoern; Chang, Amelia; Dong, Junchao; Meyers, Robin M; Marecki, Gregory T; Choi, Vivian W; Chiarle, Roberto; Zarrin, Ali A; Alt, Frederick W

    2014-02-18

    Antibody class switch recombination (CSR) in B lymphocytes joins two DNA double-strand breaks (DSBs) lying 100-200 kb apart within switch (S) regions in the immunoglobulin heavy-chain locus (IgH). CSR-activated B lymphocytes generate multiple S-region DSBs in the donor Sμ and in a downstream acceptor S region, with a DSB in Sμ being joined to a DSB in the acceptor S region at sufficient frequency to drive CSR in a large fraction of activated B cells. Such frequent joining of widely separated CSR DSBs could be promoted by IgH-specific or B-cell-specific processes or by general aspects of chromosome architecture and DSB repair. Previously, we found that B cells with two yeast I-SceI endonuclease targets in place of Sγ1 undergo I-SceI-dependent class switching from IgM to IgG1 at 5-10% of normal levels. Now, we report that B cells in which Sγ1 is replaced with a 28 I-SceI target array, designed to increase I-SceI DSB frequency, undergo I-SceI-dependent class switching at almost normal levels. High-throughput genome-wide translocation sequencing revealed that I-SceI-generated DSBs introduced in cis at Sμ and Sγ1 sites are joined together in T cells at levels similar to those of B cells. Such high joining levels also occurred between I-SceI-generated DSBs within c-myc and I-SceI- or CRISPR/Cas9-generated DSBs 100 kb downstream within Pvt1 in B cells or fibroblasts, respectively. We suggest that CSR exploits a general propensity of intrachromosomal DSBs separated by several hundred kilobases to be frequently joined together and discuss the relevance of this finding for recurrent interstitial deletions in cancer.

  14. Wild flora of mine tailings: perspectives for use in phytoremediation of potentially toxic elements in a semi-arid region in Mexico.

    PubMed

    Sánchez-López, Ariadna S; Del Carmen A González-Chávez, Ma; Carrillo-González, Rogelio; Vangronsveld, Jaco; Díaz-Garduño, Margarita

    2015-01-01

    The aim of this research was to identify wild plant species applicable for remediation of mine tailings in arid soils. Plants growing on two mine tailings were identified and evaluated for their potential use in phytoremediation based on the concentration of potentially toxic elements (PTEs) in roots and shoots, bioconcentration (BCF) and translocation factors (TF). Total, water-soluble and DTPA-extractable concentrations of Pb, Cd, Zn, Cu, Co and Ni in rhizospheric and bulk soil were determined. Twelve species can grow on mine tailings, accumulate PTEs concentrations above the commonly accepted phytotoxicity levels, and are suitable for establishing a vegetation cover on barren mine tailings in the Zimapan region. Pteridium sp. is suitable for Zn and Cd phytostabilization. Aster gymnocephalus is a potential phytoextractor for Zn, Cd, Pb and Cu; Gnaphalium sp. for Cu and Crotalaria pumila for Zn. The species play different roles according to the specific conditions where they are growing at one site behaving as a PTEs accumulator and at another as a stabilizer. For this reason and due to the lack of a unified approach for calculation and interpretation of bioaccumulation factors, only considering BCF and TF may be not practical in all cases.

  15. Characterization of various promoter regions of the human DNA helicase-encoding genes and identification of duplicated ets (GGAA) motifs as an essential transcription regulatory element.

    PubMed

    Uchiumi, Fumiaki; Watanabe, Takeshi; Tanuma, Sei-ichi

    2010-05-15

    DNA helicases are important in the regulation of DNA transaction and thereby various cellular functions. In this study, we developed a cost-effective multiple DNA transfection assay with DEAE-dextran reagent and analyzed the promoter activities of the human DNA helicases. The 5'-flanking regions of the human DNA helicase-encoding genes were isolated and subcloned into luciferase (Luc) expression plasmids. They were coated onto 96-well plate and used for co-transfection with a renilla-Luc expression vector into various cells, and dual-Luc assays were performed. The profiles of promoter activities were dependent on cell lines used. Among these human DNA helicase genes, XPB, RecQL5, and RTEL promoters were activated during TPA-induced HL-60 cell differentiation. Interestingly, duplicated ets (GGAA) elements are commonly located around the transcription start sites of these genes. The duplicated GGAA motifs are also found in the promoters of DNA replication/repair synthesis factor genes including PARG, ATR, TERC, and Rb1. Mutation analyses suggested that the duplicated GGAA-motifs are necessary for the basal promoter activity in various cells and some of them positively respond to TPA in HL-60 cells. TPA-induced response of 44-bp in the RTEL promoter was attenuated by co-transfection of the PU.1 expression vector. These findings suggest that the duplicated ets motifs regulate DNA-repair associated gene expressions during macrophage-like differentiation of HL-60 cells.

  16. A role for human homologous recombination factors in suppressing microhomology-mediated end joining

    PubMed Central

    Ahrabi, Sara; Sarkar, Sovan; Pfister, Sophia X.; Pirovano, Giacomo; Higgins, Geoff S.; Porter, Andrew C.G.; Humphrey, Timothy C.

    2016-01-01

    DNA double-strand breaks (DSBs) are toxic lesions, which if improperly repaired can result in cell death or genomic instability. DSB repair is usually facilitated by the classical non-homologous end joining (C-NHEJ), or homologous recombination (HR) pathways. However, a mutagenic alternative NHEJ pathway, microhomology-mediated end joining (MMEJ), can also be deployed. While MMEJ is suppressed by C-NHEJ, the relationship between HR and MMEJ is less clear. Here, we describe a role for HR genes in suppressing MMEJ in human cells. By monitoring DSB mis-repair using a sensitive HPRT assay, we found that depletion of HR proteins, including BRCA2, BRCA1 or RPA, resulted in a distinct mutational signature associated with significant increases in break-induced mutation frequencies, deletion lengths and the annealing of short regions of microhomology (2–6 bp) across the break-site. This signature was dependent on CtIP, MRE11, POLQ and PARP, and thus indicative of MMEJ. In contrast to CtIP or MRE11, depletion of BRCA1 resulted in increased partial resection and MMEJ, thus revealing a functional distinction between these early acting HR factors. Together these findings indicate that HR factors suppress mutagenic MMEJ following DSB resection. PMID:27131361

  17. Ultrapulse welding: A new joining technique. [for automotive industry

    NASA Technical Reports Server (NTRS)

    Anderson, D. G.

    1972-01-01

    The ultrapulse process is a resistance welding process that utilizes unidirectional current of high magnitude for a very short time with a precisely controlled dynamic force pulse. Peak currents of up to 220,000 amperes for two to ten milliseconds are used with synchronized force pulses of up to nine thousand pounds. The welding current passing through the relatively high resistance of the interface between the parts that are being joined results in highly localized heating. Described is the UPW process as it applies to the automotive industry.

  18. Method for joining metal by solid-state bonding

    DOEpatents

    Burkhart, L. Elkin; Fultz, Chester R.; Maulden, Kerry A.

    1979-01-01

    The present development is directed to a method for joining metal at relatively low temperatures by solid-state bonding. Planar surfaces of the metal workpieces are placed in a parallel abutting relationship with one another. A load is applied to at least one of the workpieces for forcing the workpieces together while one of the workpieces is relatively slowly oscillated in a rotary motion over a distance of about 1.degree.. After a preselected number of oscillations, the rotary motion is terminated and the bond between the abutting surfaces is effected. An additional load may be applied to facilitate the bond after terminating the rotary motion.

  19. Approaches for mechanical joining of 7xxx series aluminum alloys

    NASA Astrophysics Data System (ADS)

    Jäckel, M.; Grimm, T.; Landgrebe, D.

    2016-10-01

    This paper shows a numerical and experimental analysis of the different problems occurring during or after the conventional self-pierce riveting with semi-tubular and solid rivets of the high strength aluminum alloy EN AW-7021 T4. Furthermore this paper describes different pre-process methods by which the fracture in the high strength aluminum, caused by the self-pierce riveting processes, can be prevented and proper joining results are achieved. On this basis, the different approaches are compared regarding joint strength.

  20. Laser based metal and plastics joining for lightweight design

    NASA Astrophysics Data System (ADS)

    Kahmann, Max; Quentin, Ulf; Kirchhoff, Marc; Brockmann, Rüdiger; Löffler, Klaus

    2015-03-01

    One of the most important issues in automotive industry is lightweight design, especially since the CO2 emission of new cars has to be reduced by 2020. Plastic and fiber reinforced plastics (e.g. CFRP and GFRP) receive besides new manufacturing methods and the employment of high-strength steels or non-ferrous metals increasing interest. Especially the combination of different materials such as metals and plastics to single components exhausts the entire potential on weight reduction. This article presents an approach based on short laser pulses to join such dissimilar materials in industrial applications.

  1. Metal-ceramic junctions - Mechanical and physicochemical interactive joining techniques

    NASA Astrophysics Data System (ADS)

    Lascar, Guy

    Reactive brazing and thermocompression are discussed in terms of their use as joining techniques for metal-ceramic structures. Theoretical consideration is given to brazing under vacuum conditions to examine the relationships between contact surface and volume, interfacial energy, surface energy, and adhesion energy. Brazing is shown to permit metal-ceramic junctions without metallization of the ceramic substrate, although several reactions and metallic materials can affect joint strength. Thermocompression is distinguished from brazing and shown to limit the alteration of the ceramic material. The protection of the mechanical properties of the ceramic and metal components of the materials is a critical aspect of industrial applications of brazing and thermocompression.

  2. 8. Several of the rental rooms are joined by doors, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8. Several of the rental rooms are joined by doors, and each room is accessed from the corridor. Originally, the transoms were glazed. When a central heating/cooling system was installed, the transoms were modified to accommodate air grilles that are supplied by a duct located in the corridor. The five-panel door and wood wainscot are original features. However, the wainscot does not occur in every room. The lath and plaster partitions and the wood flooring are typical of the original construction. Credit GADA/MRM. - Stroud Building, 31-33 North Central Avenue, Phoenix, Maricopa County, AZ

  3. Method for joining carbon-carbon composites to metals

    DOEpatents

    Lauf, R.J.; McMillan, A.D.; Moorhead, A.J.

    1997-07-15

    A method for joining carbon-carbon composites to metals by brazing. Conventional brazing of recently developed carbon-bonded carbon fiber (CBCF) material to a metal substrate is limited by the tendency of the braze alloy to ``wick`` into the CBCF composite rather than to form a strong bond. The surface of the CBCF composite that is to be bonded is first sealed with a fairly dense carbonaceous layer achieved by any of several methods. The sealed surface is then brazed to the metal substrate by vacuum brazing with a Ti-Cu-Be alloy. 1 fig.

  4. Method for joining carbon-carbon composites to metals

    DOEpatents

    Lauf, Robert J.; McMillan, April D.; Moorhead, Arthur J.

    1997-01-01

    A method for joining carbon-carbon composites to metals by brazing. Conventional brazing of recently developed carbon-bonded carbon fiber (CBCF) material to a metal substrate is limited by the tendency of the braze alloy to "wick" into the CBCF composite rather than to form a strong bond. The surface of the CBCF composite that is to be bonded is first sealed with a fairly dense carbonaceous layer achieved by any of several methods. The sealed surface is then brazed to the metal substrate by vacuum brazing with a Ti-Cu-Be alloy.

  5. A new active solder for joining electronic components

    SciTech Connect

    SMITH,RONALD W.; VIANCO,PAUL T.; HERNANDEZ,CYNTHIA L.; LUGSCHEIDER,E.; RASS,I.; HILLEN,F.

    2000-05-11

    Electronic components and micro-sensors utilize ceramic substrates, copper and aluminum interconnect and silicon. The joining of these combinations require pre-metallization such that solders with fluxes can wet such combinations of metals and ceramics. The paper will present a new solder alloy that can bond metals, ceramics and composites. The alloy directly wets and bonds in air without the use flux or premetallized layers. The paper will present typical processing steps and joint microstructures in copper, aluminum, aluminum oxide, aluminum nitride, and silicon joints.

  6. Low Activation Joining of SiC/SiC Composites for Fusion Applications: Modeling Miniature Torsion Tests

    SciTech Connect

    Henager, Charles H.; Nguyen, Ba Nghiep; Kurtz, Richard J.; Roosendaal, Timothy J.; Borlaug, Brennan A.; Ferraris, Monica; Ventrella, Andrea; Katoh, Yutai

    2014-06-30

    The use of SiC and SiC-composites in fission or fusion environments appears to require joining methods for assembling systems. The international fusion community has designed miniature torsion specimens for joint testing and for irradiation in HFIR. Therefore, miniature torsion joints were fabricated using displacement reactions between Si and TiC to produce Ti3SiC2 + SiC joints with CVD-SiC that were tested in shear prior to and after HFIR irradiation. However, these torsion specimens fail out-of-plane, which causes difficulties in determining a shear strength for the joints or for comparing unirradiated and irradiated joints. A finite element damage model has been developed that indicates fracture is likely to occur within the joined pieces to cause out-of-plane failures for miniature torsion specimens when a certain modulus and strength ratio between the joint material and the joined material exists. The implications for torsion shear joint data based on this sample design are discussed.

  7. Biomimetic-inspired joining of composite with metal structures: A survey of natural joints and application to single lap joints

    NASA Astrophysics Data System (ADS)

    Avgoulas, Evangelos Ioannis; Sutcliffe, Michael P. F.

    2014-03-01

    Joining composites with metal parts leads, inevitably, to high stress concentrations because of the material property mismatch. Since joining composite to metal is required in many high performance structures, there is a need to develop a new multifunctional approach to meet this challenge. This paper uses the biomimetics approach to help develop solutions to this problem. Nature has found many ingenious ways of joining dissimilar materials and making robust attachments, alleviating potential stress concentrations. A literature survey of natural joint systems has been carried out, identifying and analysing different natural joint methods from a mechanical perspective. A taxonomy table was developed based on the different methods/functions that nature successfully uses to attach dissimilar tissues (materials). This table is used to understand common themes or approaches used in nature for different joint configurations and functionalities. One of the key characteristics that nature uses to joint dissimilar materials is a transitional zone of stiffness in the insertion site. Several biomimetic-inspired metal-to-composite (steel-to-CFRP), adhesively bonded, Single Lap Joints (SLJs) were numerically investigated using a finite element analysis. The proposed solutions offer a transitional zone of stiffness of one joint part to reduce the material stiffness mismatch at the joint. An optimisation procedure was used to identify the variation in material stiffness which minimises potential failure of the joint. It was found that the proposed biomimetic SLJs reduce the asymmetry of the stress distribution along the adhesive area.

  8. Non-homologous DNA end joining in plant cells is associated with deletions and filler DNA insertions.

    PubMed Central

    Gorbunova, V; Levy, A A

    1997-01-01

    Double strand DNA breaks in plants are primarily repaired via non-homologous end joining. However, little is known about the molecular events underlying this process. We have studied non-homologous end joining of linearized plasmid DNA with different termini configurations following transformation into tobacco cells. A variety of sequences were found at novel end junctions. Joining with no sequence alterations was rare. In most cases, deletions were found at both ends, and rejoining usually occurred at short repeats. A distinct feature of plant junctions was the presence of relatively large, up to 1.2 kb long, insertions (filler DNA), in approximately 30% of the analyzed clones. The filler DNA originated either from internal regions of the plasmid or from tobacco genomic DNA. Some insertions had a complex structure consisting of several reshuffled plasmid-related regions. These data suggest that double strand break repair in plants involves extensive end degradation, DNA synthesis following invasion of ectopic templates and multiple template switches. Such a mechanism is reminiscent of the synthesis-dependent recombination in bacteriophage T4. It can also explain the frequent 'DNA scrambling' associated with illegitimate recombination in plants. PMID:9358178

  9. Normal human oral keratinocytes demonstrate abnormal DNA end joining activity during replicative senescence.

    PubMed

    Kang, Mo K; Shin, Ki-Hyuk; Yip, Felix K; Park, No-Hee

    2005-04-01

    Repair of DNA double-strand breaks (DSBs) is critical for the maintenance of cellular genetic integrity. DSBs are repaired by cellular end joining activity, which could proceed with varying degrees of accuracy. Abnormal end joining may lead to an accumulation of mutations and contribute to genetic instability and cellular aging. In the present study, we compared the efficiency and accuracy of end joining activities in exponentially replicating and senescing normal human oral keratinocytes (NHOK). We developed an in vitro end joining assay utilizing a plasmid linearized with a unique EcoR I or EcoR V restriction site. The efficiency of end joining was determined by PCR with primers that could amplify the fragment containing the end joining site. The accuracy of end joining was assessed by determining whether the original EcoR I site was restored after end joining. Both replicating and senescing cultures of NHOK yielded a similar level of end joining efficiency, which was noted by the similar intensity of PCR amplification. However, the frequency of end joining errors was significantly elevated in NHOK during replicative senescence. Senescing NHOK could thus accumulate abnormal end joining products, which might contribute to cellular aging and cancer.

  10. High Temperature Joining and Characterization of Joint Properties in Silicon Carbide-Based Composite Materials

    NASA Technical Reports Server (NTRS)

    Halbig, Michael C.; Singh, Mrityunjay

    2015-01-01

    Advanced silicon carbide-based ceramics and composites are being developed for a wide variety of high temperature extreme environment applications. Robust high temperature joining and integration technologies are enabling for the fabrication and manufacturing of large and complex shaped components. The development of a new joining approach called SET (Single-step Elevated Temperature) joining will be described along with the overview of previously developed joining approaches including high temperature brazing, ARCJoinT (Affordable, Robust Ceramic Joining Technology), diffusion bonding, and REABOND (Refractory Eutectic Assisted Bonding). Unlike other approaches, SET joining does not have any lower temperature phases and will therefore have a use temperature above 1315C. Optimization of the composition for full conversion to silicon carbide will be discussed. The goal is to find a composition with no remaining carbon or free silicon. Green tape interlayers were developed for joining. Microstructural analysis and preliminary mechanical tests of the joints will be presented.

  11. Comparing Adhesive Bonding and LAMP Joining Technology in Case of Hybrid Material Combination

    NASA Astrophysics Data System (ADS)

    Markovits, T.; Bauernhuber, A.

    As plastics are utilized more and more frequently in our devices, it becomes necessary that they can be adequately joined to other materials, like metals. Bonding different materials was carried so far out primarily by adhesives, however, novel technologies, like laser assisted metal-plastic joining are showing benefits against current technologies. In the course of this study, the authors joined PMMA plastic to structural steel by adhesives and by laser assisted metal-plastic joining. Mechanical tests were carried out to compare the two different technologies, and to be able to position the LAMP joining within the field of joining technologies. Results show clearly the advantages of laser transmission joining as compared to adhesives.

  12. A HuD-ZBP1 ribonucleoprotein complex localizes GAP-43 mRNA into axons through its 3' untranslated region AU-rich regulatory element.

    PubMed

    Yoo, Soonmoon; Kim, Hak H; Kim, Paul; Donnelly, Christopher J; Kalinski, Ashley L; Vuppalanchi, Deepika; Park, Michael; Lee, Seung J; Merianda, Tanuja T; Perrone-Bizzozero, Nora I; Twiss, Jeffery L

    2013-09-01

    Localized translation of axonal mRNAs contributes to developmental and regenerative axon growth. Although untranslated regions (UTRs) of many different axonal mRNAs appear to drive their localization, there has been no consensus RNA structure responsible for this localization. We recently showed that limited expression of ZBP1 protein restricts axonal localization of both β-actin and GAP-43 mRNAs. β-actin 3'UTR has a defined element for interaction with ZBP1, but GAP-43 mRNA shows no homology to this RNA sequence. Here, we show that an AU-rich regulatory element (ARE) in GAP-43's 3'UTR is necessary and sufficient for its axonal localization. Axonal GAP-43 mRNA levels increase after in vivo injury, and GAP-43 mRNA shows an increased half-life in regenerating axons. GAP-43 mRNA interacts with both HuD and ZBP1, and HuD and ZBP1 co-immunoprecipitate in an RNA-dependent fashion. Reporter mRNA with the GAP-43 ARE competes with endogenous β-actin mRNA for axonal localization and decreases axon length and branching similar to the β-actin 3'UTR competing with endogenous GAP-43 mRNA. Conversely, over-expressing GAP-43 coding sequence with its 3'UTR ARE increases axonal elongation and this effect is lost when just the ARE is deleted from GAP-43's 3'UTR. We have recently found that over-expression of GAP-43 using an axonally targeted construct with the 3'UTRs of GAP-43 promoted elongating growth of axons, while restricting the mRNA to the cell body with the 3'UTR of γ-actin had minimal effect on axon length. In this study, we show that the ARE in GAP-43's 3'UTR is responsible for localization of GAP-43 mRNA into axons and is sufficient for GAP-43 protein's role in elongating axonal growth.

  13. Surface plasmon resonance assisted rapid laser joining of glass

    SciTech Connect

    Zolotovskaya, Svetlana A.; Tang, Guang; Abdolvand, Amin; Wang, Zengbo

    2014-08-25

    Rapid and strong joining of clear glass to glass containing randomly distributed embedded spherical silver nanoparticles upon nanosecond pulsed laser irradiation (∼40 ns and repetition rate of 100 kHz) at 532 nm is demonstrated. The embedded silver nanoparticles were ∼30–40 nm in diameter, contained in a thin surface layer of ∼10 μm. A joint strength of 12.5 MPa was achieved for a laser fluence of only ∼0.13 J/cm{sup 2} and scanning speed of 10 mm/s. The bonding mechanism is discussed in terms of absorption of the laser energy by nanoparticles and the transfer of the accumulated localised heat to the surrounding glass leading to the local melting and formation of a strong bond. The presented technique is scalable and overcomes a number of serious challenges for a widespread adoption of laser-assisted rapid joining of glass substrates, enabling applications in the manufacture of microelectronic devices, sensors, micro-fluidic, and medical devices.

  14. Development of the weld-braze joining process

    NASA Technical Reports Server (NTRS)

    Bales, T. T.; Royster, D. M.; Arnold, W. E., Jr.

    1973-01-01

    A joining process, designated weld-brazing, was developed which combines resistance spot welding and brazing. Resistance spot welding is used to position and aline the parts, as well as to establish a suitable faying-surface gap for brazing. Fabrication is then completed at elevated temperature by capillary flow of the braze alloy into the joint. The process was used successfully to fabricate Ti-6Al-4V alloy joints by using 3003 aluminum braze alloy and should be applicable to other metal-braze systems. Test results obtained on single-overlap and hat-stiffened panel specimens show that weld-brazed joints were superior in tensile shear, stress rupture, fatigue, and buckling compared with joints fabricated by conventional means. Another attractive feature of the process is that the brazed joint is hermetically sealed by the braze material, which may eliminate many of the sealing problems encountered with riveted or spot welded structures. The relative ease of fabrication associated with the weld-brazing process may make it cost effective over conventional joining techniques.

  15. Temperature Controlled Laser Joining of Aluminum to Galvanized Steel

    NASA Astrophysics Data System (ADS)

    Weller, Daniel; Simon, Jörg; Stritt, Peter; Weber, Rudolf; Graf, Thomas; Bezençon, Cyrille; Bassi, Corrado

    Reliable joining of 6000 series aluminum alloy to galvanized steel is a challenge for current manufacturing technologies. To control and limit the formation of brittle intermetallic phases, mixing of both metals in liquid state has to be avoided. It has been shown that laser weld-brazing is a possible process. Thereby the aluminum and zinc layer of the galvanized steel are molten and the steel remains solid during the process. In addition, to avoid zinc degassing, the aluminum melt bath temperature has to be below zinc boiling temperature of 907°C. To meet these requirements a temperature controlled laser process was developed, allowing to join the two materials without flux and filler material. The thickness of the intermetallic layer shows a dependency on the set temperature used to control the process. At optimum set temperature the thickness of intermetallic phases can be limited to about 5 μm. Tensile strengths of the joints of up to 75% of the aluminum base material were achieved.

  16. Welding of gold nanowires with different joining procedures

    NASA Astrophysics Data System (ADS)

    Guo, J. Y.; Xu, C. X.; Hu, A. M.; Shi, Z. L.; Sheng, F. Y.; Dai, J.; Li, Z. H.

    2012-02-01

    Welding of single-crystal metallic nanowires is likely to have an important role in the bottom-up fabrication of nanodevices. The welding effects of free ends of two single-crystal gold nanowires (Au-Au) were demonstrated by Monte Carlo simulations in this paper. The quantum corrected Sutton-Chen type many-body potential was used to model the metal-metal interactions. Metallic nanowires were first placed closely with head-to-head, head-to-side and side-to-side joining procedures. Two ends were successfully welded together to form a continuous nanowire by annealing at different temperatures. The welding effects of the different joining procedure with different temperatures were compared. Structures of the welded specimens were characterized by the common neighbor analysis technique. Variable atomic mobility, freedom and contacting angles may result in different bonding strengths in the three different configurations. The results showed that the joint structure welded at low temperature were similar to the cold welding without fusion meanwhile the molten phase was presented in the joint when processing at the high temperatures.

  17. Glass-ceramic joint and method of joining

    DOEpatents

    Meinhardt, Kerry D [Richland, WA; Vienna, John D [West Richland, WA; Armstrong, Timothy R [Clinton, TN; Pederson, Larry R [Kennewick, WA

    2003-03-18

    The present invention is a glass-ceramic material and method of making useful for joining a solid ceramic component and at least one other solid component. The material is a blend of M1-M2-M3, wherein M1 is BaO, SrO, CaO, MgO, or combinations thereof, M2 is Al.sub.2 O.sub.3, present in the blend in an amount from 2 to 15 mol %, M3 is SiO.sub.2 with up to 50 mol % B.sub.2 O.sub.3 that substantially matches a coefficient of thermal expansion of the solid electrolyte. According to the present invention, a series of glass ceramics in the M1-Al.sub.2 O.sub.3 -M3 system can be used to join or seal both tubular and planar solid oxide fuel cells, oxygen electrolyzers, and membrane reactors for the production of syngas, commodity chemicals and other products.

  18. Positioning and joining of organic single-crystalline wires.

    PubMed

    Wu, Yuchen; Feng, Jiangang; Jiang, Xiangyu; Zhang, Zhen; Wang, Xuedong; Su, Bin; Jiang, Lei

    2015-03-27

    Organic single-crystal, one-dimensional materials can effectively carry charges and/or excitons due to their highly ordered molecule packing, minimized defects and eliminated grain boundaries. Controlling the alignment/position of organic single-crystal one-dimensional architectures would allow on-demand photon/electron transport, which is a prerequisite in waveguides and other optoelectronic applications. Here we report a guided physical vapour transport technique to control the growth, alignment and positioning of organic single-crystal wires with the guidance of pillar-structured substrates. Submicrometre-wide, hundreds of micrometres long, highly aligned, organic single-crystal wire arrays are generated. Furthermore, these organic single-crystal wires can be joined within controlled angles by varying the pillar geometries. Owing to the controllable growth of organic single-crystal one-dimensional architectures, we can present proof-of-principle demonstrations utilizing joined wires to allow optical waveguide through small radii of curvature (internal angles of ~90-120°). Our methodology may open a route to control the growth of organic single-crystal one-dimensional materials with potential applications in optoelectronics.

  19. Positioning and joining of organic single-crystalline wires

    PubMed Central

    Wu, Yuchen; Feng, Jiangang; Jiang, Xiangyu; Zhang, Zhen; Wang, Xuedong; Su, Bin; Jiang, Lei

    2015-01-01

    Organic single-crystal, one-dimensional materials can effectively carry charges and/or excitons due to their highly ordered molecule packing, minimized defects and eliminated grain boundaries. Controlling the alignment/position of organic single-crystal one-dimensional architectures would allow on-demand photon/electron transport, which is a prerequisite in waveguides and other optoelectronic applications. Here we report a guided physical vapour transport technique to control the growth, alignment and positioning of organic single-crystal wires with the guidance of pillar-structured substrates. Submicrometre-wide, hundreds of micrometres long, highly aligned, organic single-crystal wire arrays are generated. Furthermore, these organic single-crystal wires can be joined within controlled angles by varying the pillar geometries. Owing to the controllable growth of organic single-crystal one-dimensional architectures, we can present proof-of-principle demonstrations utilizing joined wires to allow optical waveguide through small radii of curvature (internal angles of ~90–120°). Our methodology may open a route to control the growth of organic single-crystal one-dimensional materials with potential applications in optoelectronics. PMID:25814032

  20. Homologous Elements hs3a and hs3b in the 3′ Regulatory Region of the Murine Immunoglobulin Heavy Chain (Igh) Locus Are Both Dispensable for Class-switch Recombination*

    PubMed Central

    Yan, Yi; Pieretti, Joyce; Ju, Zhongliang; Wei, Shiniu; Christin, John R.; Bah, Fatmata; Birshtein, Barbara K.; Eckhardt, Laurel A.

    2011-01-01

    Immunoglobulin heavy chain (IgH) genes are formed, tested, and modified to yield diverse, specific, and high affinity antibody responses to antigen. The processes involved must be regulated, however, to avoid unintended damage to chromosomes. The 3′ regulatory region of the Igh locus plays a major role in regulating class-switch recombination (CSR), the process by which antibody effector functions are modified during an immune response. Loss of all known enhancer-like elements in this region dramatically impairs CSR, but individual element deletions have no effect on this process. In the present study, we explored the hypothesis that an underlying functional redundancy in the homologous elements hs3a and hs3b was masking the importance of either element to CSR. Several transgenic mouse lines were generated, each carrying a bacterial artificial chromosome transgene that mimicked Igh locus structure but in which hs3a was missing and hs3b was flanked by loxP sites. Matings to Cyclization Recombination Enzyme-expressing mice established “pairs” of lines that differed only in the presence or absence of hs3b. Remarkably, CSR remained robust in the absence of both hs3a and hs3b, suggesting that the remaining two elements of the 3′ regulatory region, hs1.2 and hs4, although individually dispensable for CSR, are, together, sufficient to support CSR. PMID:21673112

  1. Post-transcriptional regulation of cytokine genes in fish: A role for conserved AU-rich elements located in the 3'-untranslated region of their mRNAs.

    PubMed

    Roca, Francisco J; Cayuela, María L; Secombes, Chris J; Meseguer, José; Mulero, Victoriano

    2007-01-01

    The overproduction of cytokines, such us interleukin-1beta (IL-1beta) and tumor necrosis factor alpha (TNFalpha), contributes to the pathological complications observed in many inflammatory diseases caused by bacterial endotoxins. The synthesis of these cytokines is tightly regulated at both transcriptional and post-transcriptional levels. Post-transcriptional regulation of gene expression depends on specific cis-acting sequences and trans-acting factors. Thus, the presence of adenylate- and uridylate-rich (AU-rich) elements (AREs) has been described in the 3'-untranslated regions (UTRs) of many unstable mammalian mRNAs. Although, it represents the most widespread, phylogenetically conserved and efficient determinant of mRNA stability among those so far characterized in mammalian cells, no studies are available on the functional relevance of this sequence in non-mammalian vertebrates. In this contribution, we study the enzymatic activity of various luciferase reporter constructs, containing or lacking the 3'UTR of IL-1beta and TNFalpha from different fish species, and report the finding that bony fish AREs are able to decrease luciferase activity but are less potent than their mammalian counterparts. Surprisingly, the 3'UTR of the IL-1beta from the cartilaginous fish small spotted catshark had the greatest ability to decrease luciferase activity. Lastly, the functional significance of the above was confirmed by measuring the half-life of IL-1beta and TNFalpha mRNAs in gilthead seabream leukocytes by blocking transcription with actinomycin D. Both cytokine mRNAs were unstable with an estimated half-life of about 45 min in control and activated cells.

  2. Intermittent hypoxic exposure during light phase induces changes in cAMP response element binding protein activity in the rat CA1 hippocampal region: water maze performance correlates.

    PubMed

    Goldbart, A; Row, B W; Kheirandish, L; Schurr, A; Gozal, E; Guo, S Z; Payne, R S; Cheng, Z; Brittian, K R; Gozal, D

    2003-01-01

    Intermittent hypoxia (IH) during sleep, a characteristic feature of sleep-disordered breathing (SDB) is associated with time-dependent apoptosis and spatial learning deficits in the adult rat. The mechanisms underlying such neurocognitive deficits remain unclear. Activation of the cAMP-response element binding protein (CREB) transcription factor mediates critical components of neuronal survival and memory consolidation in mammals. CREB phosphorylation and DNA binding, as well as the presence of apoptosis in the CA1 region of the hippocampus were examined in Sprague-Dawley male rats exposed to IH. Spatial reference task learning was assessed with the Morris water maze. IH induced significant decreases in Ser-133 phosphorylated CREB (pCREB) without changes in total CREB, starting as early as 1 h IH, peaking at 6 h-3 days, and returning toward normoxic levels by 14-30 days. Double-labeling immunohistochemistry for pCREB and Neu-N (a neuronal marker) confirmed these findings. The expression of cleaved caspase 3 (cC3) in the CA1, a marker of apoptosis, peaked at 3 days and returned to normoxic values at 14 days. Initial IH-induced impairments in spatial learning were followed by partial functional recovery starting at 14 days of IH exposure. We postulate that IH elicits time-dependent changes in CREB phosphorylation and nuclear binding that may account for decreased neuronal survival and spatial learning deficits in the adult rat. We suggest that CREB changes play an important role in the neurocognitive morbidity of SDB patients.

  3. Functional analysis of a metal response element in the regulatory region of flounder cytochrome P450 1A and implications for environmental monitoring of pollutants.

    PubMed

    Lewis, Nick A; Williams, Tim D; Chipman, James K

    2006-08-01

    Cytochrome P450 1A (CYP 1A) is a member of a multigene family of xenobiotic metabolizing enzymes. CYP 1A is highly inducible by numerous environmental contaminants including polycyclic aromatic hydrocarbons (PAHs) and is widely used in biomonitoring studies. Therefore, understanding the regulation of this gene is important for accurate interpretation of biomarker data. We describe here the functional role of a metal response element (MRE) in the European flounder CYP 1A promoter region. To help elucidate the potential role of this MRE, reporter gene constructs, with or without site-directed mutagenesis, were used in conjunction with a dual-luciferase assay. The electrophoretic mobility shift assay (EMSA) was also used to investigate potential protein binding at this MRE site. Treatment with the prototypical PAH 3-methylcholanthrene (3MC) (1.0 microM) produced a dose-dependent response at the CYP 1A promoter, whereas treatment with cadmium (0-1.0 microM) produced little transcriptional activity at either the wild-type or mutated promoter. Cotreatment with cadmium (1.0 microM) and 3MC (1.0 microM) reduced induction at this promoter to 1.83-fold compared to 3MC treatment alone (4.0-fold induction). Mutation of the MRE site resulted in abolishment of this cadmium-related loss of 3MC-dependent activity. Furthermore, a retarded band was observed in the EMSA when the MRE was used as a probe and incubated with liver nuclear protein from flounder treated with cadmium. The results not only add to knowledge of the diversity in vertebrate CYP 1A regulation but also raise the complexity of interpretation of CYP 1A induction in monitoring studies that involve mixtures of PAHs and metals.

  4. The crucial role of GATA-1 in CCR3 gene transcription: modulated balance by multiple GATA elements in the CCR3 regulatory region.

    PubMed

    Kim, Byung Soo; Uhm, Tae Gi; Lee, Seol Kyoung; Lee, Sin-Hwa; Kang, Jin Hyun; Park, Choon-Sik; Chung, Il Yup

    2010-12-01

    GATA-1, a zinc finger-containing transcription factor, regulates not only the differentiation of eosinophils but also the expression of many eosinophil-specific genes. In the current study, we dissected CCR3 gene expression at the molecular level using several cell types that express varying levels of GATA-1 and CCR3. Chromatin immunoprecipitation analysis revealed that GATA-1 preferentially bound to sequences in both exon 1 and its proximal intron 1. A reporter plasmid assay showed that constructs harboring exon 1 and/or intron 1 sequences retained transactivation activity, which was essentially proportional to cellular levels of endogenous GATA-1. Introduction of a dominant-negative GATA-1 or small interfering RNA of GATA-1 resulted in a decrease in transcription activity of the CCR3 reporter. Both point mutation and EMSA analyses demonstrated that although GATA-1 bound to virtually all seven putative GATA elements present in exon 1-intron 1, the first GATA site in exon 1 exhibited the highest binding affinity for GATA-1 and was solely responsible for GATA-1-mediated transactivation. The fourth and fifth GATA sites in exon 1, which were postulated previously to be a canonical double-GATA site for GATA-1-mediated transcription of eosinophil-specific genes, appeared to play an inhibitory role in transactivation, albeit with a high affinity for GATA-1. Furthermore, mutation of the seventh GATA site (present in intron 1) increased transcription, suggesting an inhibitory role. These data suggest that GATA-1 controls CCR3 transcription by interacting dynamically with the multiple GATA sites in the regulatory region of the CCR3 gene.

  5. A transient FGM interlayer based approach to joining ceramics. [Functionally gradient materials

    SciTech Connect

    Glaeser, A.M.; Shalz, M.L.; Dalgleish, B.J.; Tomsia, A.P.

    1993-01-01

    In most cases, functionally gradient materials have been designed to produce a desirable property gradient in a material or in a joint region. In this paper, the concept of a transient gradient structure is introduced. The function of the intentional property discontinuities in these multilayer interlayers is to facilitate processing of assemblies and materials combinations that would be difficult to process using conventional bonding approaches. Specifically, the methods make use of a thin or partial layer of a low melting point transient liquid phase to facilitate bonding via brazing, yet produce refractory joints. Several mechanisms for consuming the transient liquid former are outlined, and examples of interlayer designs that exploit these mechanisms are presented. Specific results from experiments joining alumina to alumina via Cu/Pt/Cu, Cu/Ni/Cu, Cu/Nb/Cu and Sn/Nb/Sn interlayers are presented.

  6. Effects of prefabricated hole structure on cold-pressing joining reliability between dissimilar sheets

    NASA Astrophysics Data System (ADS)

    Jin, Cheng Chuang; Li, Feng; Wang, Mo Nan; Bao, Ze Ping

    2016-12-01

    The structural form of prefabricated holes is one of the important factors to determine the quality and reliability of cold-pressing joining between dissimilar sheets. Different numbers of holes with the same area will lead to different wall thickness distributions and joining strengths. This paper takes the cold-pressing joining between AA1100 pure aluminum sheet and SS304 stainless steel sheet as an example, the further study results show that the end of aluminum sheet has an increasing tendency along the directions of length and width in the process of cold-pressing joining. The wall thickness of joints shows a symmetrical distribution on both sides and the joining thickness decreases from the center to both sides sequentially. With the continuous increase of the punch loading pressure, the average thinning ratio of the joints becomes larger. By contrast, when the other parameters are all the same, the joining strength is the most ideal when the punch loading pressure is 250 kN. The loading pressure which is too small or large is easy to cause an insufficient joining strength or defects. This paper provides a scientific basis in this aspect for optimizing the cold-pressing joining plan and designing a reasonable joint structure. It can also promote the existing cold-pressing joining technologies to be mature, and enrich the existing solid-state joining technology.

  7. Volume thermal expansion along the jadeite-diopside join

    NASA Astrophysics Data System (ADS)

    Pandolfo, Francesco; Cámara, Fernando; Domeneghetti, M. Chiara; Alvaro, Matteo; Nestola, Fabrizio; Karato, Shun-Ichiro; Amulele, George

    2015-01-01

    An in situ single-crystal high-temperature X-ray diffraction study was performed on clinopyroxene crystals along the jadeite, (NaAlSi2O6 Jd)-diopside (CaMgSi2O6 Di) join. In particular, natural samples of jadeite, diopside, P2/ n omphacite and three C2/ c synthetic samples with intermediate composition (i.e., Jd80, Jd60, Jd40) were investigated. In order to determine the unit-cell volume thermal expansion coefficient ( α V), the unit-cell parameters for all these compositions have been measured up to c.a. 1,073 K. The evolution of the unit-cell volume thermal expansion coefficient ( α V) along the Jd-Di join at different temperatures has been calculated by using a modified version of the equation proposed by Holland and Powell (J Metamorph Geol 16(3):309-343, 1998). The equation obtained from the α V at room- T (i.e., α V303K,1bar) allows us to predict the room- T volume thermal expansion for Fe-free C2/ c clinopyroxenes with intermediate composition along the binary join Jd-Di. The observed α V value for P2/ n omphacite α V(303K,1bar) = 2.58(5) × 10-5 K-1 was compared with that recalculated for disordered C2/ c omphacite published by Pandolfo et al. (Phys Chem Miner 1-10, 2012) [ α V(303K,1bar) = 2.4(5) × 10-5 K-1]. Despite the large e.s.d.'s for the latter, the difference of both values at room- T is small, indicating that convergent ordering has practically no influence on the room- T thermal expansion. However, at high- T, the smaller thermal expansion coefficient for the C2/c sample with respect to the P2/n one with identical composition could provide further evidence for its reduced stability relative to the ordered one.

  8. A negative element in the downstream region of the Rice tungro bacilliform virus promoter is orientation- and position-independent and is active with heterologous promoters.

    PubMed

    Purkayastha, Arunima; Sharma, Shweta; Dasgupta, Indranil

    2010-10-01

    The promoter of an Indian isolate of the pararetrovirus Rice tungro bacilliform virus (RTBV-WB) contains a negative element downstream of the transcription start site (TSS), between nucleotide residues +58 and +195 (Mathur and Dasgupta, 2007). To further characterize the element, we show, by using transient gus reporter gene assays in the cells of onion peel, rice calli and Arabidopsis leaves, that it down-regulates heterologous promoters CaMV35S and Maize ubiquitin. Quantitative measurements of transient GUS activity indicated more than 90% inhibition of reporter gene expression by the negative element. We also show, by reversing the orientation of the element downstream and by placing it in a position upstream to a constitutively expressing RTBV promoter, that the negative element is orientation- and position-independent, pointing towards its activity at the transcriptional and not post-transcriptional level.

  9. Joining the nursing profession in Qatar: motives and perceptions.

    PubMed

    Okasha, M S; Ziady, H H

    2001-11-01

    We aimed to identify why female students in Qatar decide to become nurses and how the students perceived the community attitude towards nursing. A self-administered anonymous questionnaire was distributed to all (57) female students of the four academic classes of the Nursing Unit, University of Qatar for the academic year 1999-2000. The two commonest reasons for joining the nursing profession were an interest in medical services and the humanitarian nature of nursing. There were 33 (57.89%) students who considered there was a negative community attitude towards nursing mainly due to the presence of male patients and colleagues and the working hours. A mass media campaign and govemmental support were two strategies suggested to change this.

  10. Joining lead wires to thin platinum alloy films

    NASA Technical Reports Server (NTRS)

    Przybyszewski, J. S.; Claing, R. G. (Inventor)

    1983-01-01

    A two step process of joining a lead wire to .000002 m thick platinum alloy film which rests upon an equally thin alumina insulating layer which is adhered to a metal substrate is described. Typically the platinum alloy film forms part of a thermocouple for measuring the surface temperature of a gas turbine airfoil. In the first step the lead wire is deformed 30 to 60% at room temperature while the characteristic one million ohm resistance of the alumina insulating layer is monitored for degradation. In the second step the cold pressed assembly is heated at 865 to 1025 C for 4 to 75 hr in air. During the heating step any degradation of insulating layer resistance may be reversed, provided the resistance was not decreased below 100 ohm in the cold pressing.

  11. The endless tale of non-homologous end-joining.

    PubMed

    Weterings, Eric; Chen, David J

    2008-01-01

    DNA double-strand breaks (DSBs) are introduced in cells by ionizing radiation and reactive oxygen species. In addition, they are commonly generated during V(D)J recombination, an essential aspect of the developing immune system. Failure to effectively repair these DSBs can result in chromosome breakage, cell death, onset of cancer, and defects in the immune system of higher vertebrates. Fortunately, all mammalian cells possess two enzymatic pathways that mediate the repair of DSBs: homologous recombination and non-homologous end-joining (NHEJ). The NHEJ process utilizes enzymes that capture both ends of the broken DNA molecule, bring them together in a synaptic DNA-protein complex, and finally repair the DNA break. In this review, all the known enzymes that play a role in the NHEJ process are discussed and a working model for the co-operation of these enzymes during DSB repair is presented.

  12. Resistance Distances and Kirchhoff Index in Generalised Join Graphs

    NASA Astrophysics Data System (ADS)

    Chen, Haiyan

    2017-03-01

    The resistance distance between any two vertices of a connected graph is defined as the effective resistance between them in the electrical network constructed from the graph by replacing each edge with a unit resistor. The Kirchhoff index of a graph is defined as the sum of all the resistance distances between any pair of vertices of the graph. Let G=H[G1, G2, …, Gk ] be the generalised join graph of G1, G2, …, Gk determined by H. In this paper, we first give formulae for resistance distances and Kirchhoff index of G in terms of parameters of {G'_i}s and H. Then, we show that computing resistance distances and Kirchhoff index of G can be decomposed into simpler ones. Finally, we obtain explicit formulae for resistance distances and Kirchhoff index of G when {G'_i}s and H take some special graphs, such as the complete graph, the path, and the cycle.

  13. Joining of Silicon Carbide Through the Diffusion Bonding Approach

    NASA Technical Reports Server (NTRS)

    Halbig, Michael .; Singh, Mrityunjay

    2009-01-01

    In order for ceramics to be fully utilized as components for high-temperature and structural applications, joining and integration methods are needed. Such methods will allow for the fabrication the complex shapes and also allow for insertion of the ceramic component into a system that may have different adjacent materials. Monolithic silicon carbide (SiC) is a ceramic material of focus due to its high temperature strength and stability. Titanium foils were used as an interlayer to form diffusion bonds between chemical vapor deposited (CVD) SiC ceramics with the aid of hot pressing. The influence of such variables as interlayer thickness and processing time were investigated to see which conditions contributed to bonds that were well adhered and crack free. Optical microscopy, scanning electron microscopy, and electron microprobe analysis were used to characterize the bonds and to identify the reaction formed phases.

  14. Bridging the gaps : joining information sources with Splunk.

    SciTech Connect

    Lord, Kenneth Malcolm; Corwell, Sophia E.; Stearley, Jon R.

    2010-07-01

    Supercomputers are composed of many diverse components, operated at a variety of scales, and function as a coherent whole. The resulting logs are thus diverse in format, interrelated at multiple scales, and provide evidence of faults across subsystems. When combined with system configuration information, insights on both the downstream effects and upstream causes of events can be determined. However, difficulties in joining the data and expressing complex queries slow the speed at which actionable insights can be obtained. Effectively connecting data experts and data miners faces similar hurdles. This paper describes our experience with applying the Splunk log analysis tool as a vehicle to combine both data, and people. Splunk's search language, lookups, macros, and subsearches reduce hours of tedium to seconds of simplicity, and its tags, saved searches, and dashboards offer both operational insights and collaborative vehicles.

  15. Bridging the gaps : joining information sources with Splunk.

    SciTech Connect

    Lord, Kenneth Malcolm; Corwell, Sophia E.; Stearley, Jon R.

    2010-10-01

    Supercomputers are composed of many diverse components, operated at a variety of scales, and function as a coherent whole. The resulting logs are thus diverse in format, interrelated at multiple scales, and provide evidence of faults across subsystems. When combined with system configuration information, insights on both the downstream effects and upstream causes of events can be determined. However, difficulties in joining the data and expressing complex queries slow the speed at which actionable insights can be obtained. Effectively connecting data experts and data miners faces similar hurdles. This paper describes our experience with applying the Splunk log analysis tool as a vehicle to combine both data, and people. Splunk's search language, lookups, macros, and subsearches reduce hours of tedium to seconds of simplicity, and its tags, saved searches, and dashboards offer both operational insights and collaborative vehicles.

  16. Analysis of Gene Targeting & Nonhomologous End-joining. Final Report

    SciTech Connect

    Haber, J. E.

    2002-11-30

    Overall, we identified a number of new proteins that participate in nonhomologous end-joining and also in telomere addition to the ends of broken chromosomes. We showed that NHEJ is severely reduced in cells expressing both yeast mating-type genes and then went on to identify the NEJ1 gene that was under this control. We showed the epistasis relations among a set of mutations that impair telomere addition and we showed that there are in fact two pathways to repair broken chromosomes in the absence of telomerase. We characterized the DNA damage checkpoint pathway in response to a single broken chromosome and characterized especially the adaptation of cells arrested by an unrepaired DSB. We demonstrated that the DNA damage response is nuclear-limited. We showed adaptation defects for Tid1and Srs2 proteins and showed that Srs2 was also recovery-defective, even when DNA was repaired.

  17. Joining veneers to ceramic cores and dentition with adhesive interlayers.

    PubMed

    Lee, J J-W; Wang, Y; Lloyd, I K; Lawn, B R

    2007-08-01

    Adhesive joining of veneers to cores offers potential simplicity and economy in the fabrication of all-ceramic crowns. We tested the hypothesis that resin-based adhesives can be used for such fabrication without compromising mechanical integrity of the crown structure. A simple test procedure for quantifying this hypothesis was proposed. A model glass veneer layer 1 mm thick (representative of porcelain), adhesively bonded onto a glass-like core substrate (ceramic or dental enamel), was loaded at its top surface with a hard sphere (occlusal force) until a radial crack initiated at the veneer undersurface. The critical loads for fracture, visually observable in the transparent glass, afforded a measure of the predisposition for the adhesive to cause veneer failure in an occlusal overload. Two adhesives were tested, one a commercial epoxy resin and the other a relatively stiff in-house-developed composite. The results confirmed that stiffer adhesives provide higher resistance to failure.

  18. Joining problems posed by the development of materials

    NASA Astrophysics Data System (ADS)

    Colombie, M.

    A review of new materials is conducted to examine joining difficulties caused by the properties of the advanced materials. Attention is given to recent developments in the areas of polymers, ceramics, composite materials, and metal alloys. Fabrication procedures are outlined for traditional metals including continuous methods, and associated levels of purity are described that can be achieved with traditional materials such as steel. Recently developed materials discussed include 'multimaterials' such as Al alloys and polymer composites as well as the metallurgical techniques developed for their fabrication. The production of metal/ceramic combinations by means of diffusion bonding and welding is shown to require development, and fabrication methods are required that insure the production of reproducible and consistent materials.

  19. Joining mechanism with stem tension and interlocked compression ring

    DOEpatents

    James, Allister W.; Morrison, Jay A.

    2012-09-04

    A stem (34) extends from a second part (30) through a hole (28) in a first part (22). A groove (38) around the stem provides a non-threaded contact surface (42) for a ring element (44) around the stem. The ring element exerts an inward force against the non-threaded contact surface at an angle that creates axial tension (T) in the stem, pulling the second part against the first part. The ring element is formed of a material that shrinks relative to the stem by sintering. The ring element may include a split collet (44C) that fits partly into the groove, and a compression ring (44E) around the collet. The non-threaded contact surface and a mating distal surface (48) of the ring element may have conic geometries (64). After shrinkage, the ring element is locked onto the stem.

  20. Pulsed Joining Of Body-In-White Components

    SciTech Connect

    Bonnen, John

    2014-09-30

    The objective of this project was to develop cost efficient high quality pulsed welding (PW) technology for joining 6xxx Aluminum and High Strength Steel (with tensile strength above 580MPa) components enabling broad usage of hydroformed parts and leading to substantial weight reduction of cars and trucks to reduce US demand on petroleum, lower carbon emissions and energy expenditures. In general, pulsed welding is a form of impact welding where two dissimilar metal pieces are joined by accelerating one to velocities exceeding 300m/s at which point the first piece strikes the second and forms a weld. In this work, two methods were used to accelerate the flyer material: Electro-Magnetic (EM) pulse and Electro-Hydraulic (EH) pulse launching. The advantage of pulsed welding techniques is that welds can be formed between two materials that cannot otherwise be welded: high strength aluminum and high strength steel. The technical objectives of the project included: 1) developing cost affordable production feasible tooling design for PW of 6xxx aluminum to High Strength steel with strengths above 580MPa; 2) demonstrating that fabricated joints can exceed the required service load strength initially at the coupon level and then at the component level; 3) developing fundamental understanding of the mechanisms of joint formation and conditions leading to formation of high quality PW joint; and 4) creating a numerical model predicting the tooling and electric discharge parameters necessary for the joint formation and that satisfy the targeted strength parameters. The project successfully developed: 1) EM and EH pulsed welds between high strength aluminum with tensile strengths exceeding 240MPa and steels exceeding 580MPa; 2) pulsed welds of extrusions with strengths exceeding project requirements; 3) EM and EH flyer launch models and 4) weld interface formation models. However, the grant holder, Ford Motor Company, could see no path to commercialization and the work was

  1. End Closure Joining of Ferritic-Martensitic and Oxide-Dispersion Strengthened Steel Cladding Tubes by Magnetic Pulse Welding

    NASA Astrophysics Data System (ADS)

    Lee, Jung-Gu; Park, Jin-Ju; Lee, Min-Ku; Rhee, Chang-Kyu; Kim, Tae-Kyu; Spirin, Alexey; Krutikov, Vasiliy; Paranin, Sergey

    2015-07-01

    The magnetic pulse welding (MPW) technique was employed for the end closure joining of fuel pin cladding tubes made of ferritic-martensitic (FM) steel and oxide-dispersion strengthened (ODS) steel. The technique is a solid-state impact joining process based on the electromagnetic force, similar to explosive welding. For a given set of optimal process parameters, e.g., the end-plug geometry, the rigid metallurgical bonding between the tube and end plug was obtained by high-velocity impact collision accompanied with surface jetting. The joint region showed a typical wavy morphology with a narrow grain boundary-like bonding interface. There was no evidence of even local melting, and only the limited grain refinement was observed in the vicinity of the bonding interface without destructing the original reinforcement microstructure of the FM-ODS steel, i.e., a fine grain structure with oxide dispersion. No leaks were detected during helium leakage test, and moreover, the rupture occurred in the cladding tube section without leaving any joint damage during internal pressure burst test. All of the results proved the integrity and durability of the MPWed joints and signified the great potential of this method of end closure joining for advanced fast reactor fuel pin fabrication.

  2. Alterations of Hair and Nail Content of Selected Trace Elements in Nonoccupationally Exposed Patients with Chronic Depression from Different Geographical Regions

    PubMed Central

    Liao, Kuan-Yung; Liao, Heng-Hsin; Niziński, Przemysław; Momčilović, Berislav; Jabłońska-Czapla, Magdalena; Prystupa, Andrzej; Sak, Jarosław J.; Kocjan, Ryszard

    2017-01-01

    The aim of this study was to determine if altered levels of selected trace elements manifest themselves during chronic depression. To identify elements strongly associated with chronic depression, relationships between the elemental contents of hair and nails and the interelement correlations were checked. Inductively coupled plasma mass spectrometry and ion chromatography were used to evaluate the contents of Zn, Cu, Co, Pb, Mn, and Fe in hair and nail samples from a total of 415 subjects (295 patients and 120 healthy volunteers). The study included logistic regression models to predict the probability of chronic depression. To investigate possible intercorrelations among the studied elements, the scaled principal component analysis was used. The research has revealed differences in TE levels in the group of depressed men and women in comparison to the healthy subjects. Statistically significant differences in both hair and nails contents of several elements were observed. Our study also provides strong evidence that the intermediary metabolism of certain elements is age- and gender-dependent. Zn, Mn, Pb, and Fe contents in hair/nails seem to be strongly associated with chronic depression. We found no statistically significant residence-related differences in the contents of studied elements in nonoccupationally exposed patients and healthy subjects. PMID:28386550

  3. Joining of ceramics and ceramic matrix composites via reactive metal penetration

    NASA Astrophysics Data System (ADS)

    Locatelli, Mark Rico

    The processing and properties of ceramic and ceramic matrix composite components have improved to the point that they are now candidates for use in a variety of structural applications at high temperature. However, the lack of effective joining techniques limits further application of these materials. In an effort to remove this limitation a joining process based on the reactive metal penetration process used to make bulk metal/ceramic composites has been developed to join ceramics. This joining technique offers the potential to bond refractory components at reduced temperature, thus alleviating some of the limitations of traditional ceramic joining processes. Several experiments joining alumina and SiCf/SiC composite have been carried out at temperatures of 1100--1200°C. The results of these experiments show that processing ceramic joints with composite interlayers at these temperatures is possible, and may be technologically significant if a number of interesting processing and microstructural difficulties can be successfully overcome.

  4. Efficient string similarity join in multi-core and distributed systems

    PubMed Central

    Yan, Cairong; Zhao, Xue; Zhang, Qinglong; Huang, Yongfeng

    2017-01-01

    In big data area a significant challenge about string similarity join is to find all similar pairs more efficiently. In this paper, we propose a parallel processing framework for efficient string similarity join. First, the input is split into some disjoint small subsets according to the joint frequency distribution and the interval distribution of strings. Then the filter-verification strategy is adopted in the computation of string similarity for each subset so that the number of candidate pairs is reduced before an effective pruning strategy is used to improve the performance. Finally, the operation of string join is executed in parallel. Para-Join algorithm based on the multi-threading technique is proposed to implement the framework in a multi-core system while Pada-Join algorithm based on Spark platform is proposed to implement the framework in a cluster system. We prove that Para-Join and Pada-Join cannot only avoid reduplicate computation but also ensure the completeness of the result. Experimental results show that Para-Join can achieve high efficiency and significantly outperform than state-of-the-art approaches, meanwhile, Pada-Join can work on large datasets. PMID:28278177

  5. Transient-Liquid-Phase and Liquid-Film-Assisted Joining ofCeramics

    SciTech Connect

    Sugar, Joshua D.; McKeown, Joseph T.; Akashi, Takaya; Hong, SungM.; Nakashima, Kunihiko; Glaeser, Andreas M.

    2005-02-09

    Two joining methods, transient-liquid-phase (TLP) joining and liquid-film-assisted joining (LFAJ), have been used to bond alumina ceramics. Both methods rely on multilayer metallic interlayers designed to form thin liquid films at reduced temperatures. The liquid films either disappear by interdiffusion (TLP) or promote ceramic/metal interface formation and concurrent dewetting of the liquid film (LFAJ). Progress on extending the TLP method to lower temperatures by combining low-melting-point (<450 C) liquids and commercial reactive-metal brazes is described. Recent LFAJ work on joining alumina to niobium using copper films is presented.

  6. Joining of Ion Transport Membranes Using a Novel Transient Liquid Phase Process

    SciTech Connect

    Darryl P. Butt

    2006-08-30

    The feasibility of a novel transient liquid phase (TLP) joining method has been demonstrated in joining La{sub 0.9}Ca{sub 0.1}FeO{sub 3} materials. Metal oxide powders were processed to form the TLP compositions which were used in the joining process. The method has been successful in producing joint interfaces that effectively disappear, as they are the same material and have the same properties as the joined parts. The feasibility of the method has been demonstrated for a single system, but many systems where the method can potentially be applied have been identified.

  7. Efficient string similarity join in multi-core and distributed systems.

    PubMed

    Yan, Cairong; Zhao, Xue; Zhang, Qinglong; Huang, Yongfeng

    2017-01-01

    In big data area a significant challenge about string similarity join is to find all similar pairs more efficiently. In this paper, we propose a parallel processing framework for efficient string similarity join. First, the input is split into some disjoint small subsets according to the joint frequency distribution and the interval distribution of strings. Then the filter-verification strategy is adopted in the computation of string similarity for each subset so that the number of candidate pairs is reduced before an effective pruning strategy is used to improve the performance. Finally, the operation of string join is executed in parallel. Para-Join algorithm based on the multi-threading technique is proposed to implement the framework in a multi-core system while Pada-Join algorithm based on Spark platform is proposed to implement the framework in a cluster system. We prove that Para-Join and Pada-Join cannot only avoid reduplicate computation but also ensure the completeness of the result. Experimental results show that Para-Join can achieve high efficiency and significantly outperform than state-of-the-art approaches, meanwhile, Pada-Join can work on large datasets.

  8. Joining of Zirconium Diboride-Based Ceramic Composites to Metallic Systems for High-Temperature Applications

    NASA Technical Reports Server (NTRS)

    Asthana, R.; Singh, M.

    2008-01-01

    Three types of hot-pressed zirconium diboride (ZrB2)-based ultra-high-temperature ceramic composites (UHTCC), ZrB2-SiC (ZS), ZrB2-SiC-C (ZSC), and ZrB2-SCS9-SiC (ZSS), were joined to Cu-clad-Mo using two Ag-Cu brazes (Cusil-ABA and Ticusil, T(sub L) approx.1073-1173 K) and two Pd-base brazes (Palco and Palni, T(sub L) approx.1493-1513 K). Scanning Electron Microscopy (SEM) coupled with energy-dispersive spectroscopy (EDS) revealed greater chemical interaction in joints made using Pd-base brazes than in joints made using Ag-Cu based active brazes. The degree of densification achieved in hot pressed composites influenced the Knoop hardness of the UHTCC and the hardness distribution across the braze interlayer. The braze region in Pd-base system displayed higher hardness in joints made using fully-dense ZS composites than in joints made using partially-dense ZSS composites and the carbon-containing ZSC composites. Calculations indicate a small negative elastic strain energy and an increase in the UHTCC's fracture stress up to a critical clad layer thickness . Above this critical thickness, strain energy in the UHTCC is positive, and it increases with increasing clad layer thickness. Empirical projections show a reduction in the effective thermal resistance of the joints and highlight the potential benefits of joining the UHTCC to Cu-clad-Mo.

  9. Assembly and transfer of tripartite integrative and conjugative genetic elements

    PubMed Central

    Haskett, Timothy L.; Terpolilli, Jason J.; Bekuma, Amanuel; O’Hara, Graham W.; Sullivan, John T.; Wang, Penghao; Ronson, Clive W.

    2016-01-01

    Integrative and conjugative elements (ICEs) are ubiquitous mobile genetic elements present as “genomic islands” within bacterial chromosomes. Symbiosis islands are ICEs that convert nonsymbiotic mesorhizobia into symbionts of legumes. Here we report the discovery of symbiosis ICEs that exist as three separate chromosomal regions when integrated in their hosts, but through recombination assemble as a single circular ICE for conjugative transfer. Whole-genome comparisons revealed exconjugants derived from nonsymbiotic mesorhizobia received three separate chromosomal regions from the donor Mesorhizobium ciceri WSM1271. The three regions were each bordered by two nonhomologous integrase attachment (att) sites, which together comprised three homologous pairs of attL and attR sites. Sequential recombination between each attL and attR pair produced corresponding attP and attB sites and joined the three fragments to produce a single circular ICE, ICEMcSym1271. A plasmid carrying the three attP sites was used to recreate the process of tripartite ICE integration and to confirm the role of integrase genes intS, intM, and intG in this process. Nine additional tripartite ICEs were identified in diverse mesorhizobia and transfer was demonstrated for three of them. The transfer of tripartite ICEs to nonsymbiotic mesorhizobia explains the evolution of competitive but suboptimal N2-fixing strains found in Western Australian soils. The unheralded existence of tripartite ICEs raises the possibility that multipartite elements reside in other organisms, but have been overlooked because of their unusual biology. These discoveries reveal mechanisms by which integrases dramatically manipulate bacterial genomes to allow cotransfer of disparate chromosomal regions. PMID:27733511

  10. p190RhoGEF Binds to a destabilizing element in the 3' untranslated region of light neurofilament subunit mRNA and alters the stability of the transcript.

    PubMed

    Cañete-Soler, R; Wu, J; Zhai, J; Shamim, M; Schlaepfer, W W

    2001-08-24

    Stabilization of neurofilament (NF) mRNAs plays a major role in regulating levels of NF expression and in establishing axonal size and rate of axonal conduction. Previous studies have identified a 68-nucleotide destabilizing element at the junction of the coding region and 3' untranslated region of the light NF subunit (NF-L) mRNA. The present study has used the destabilizing element (probe A) to screen a rat brain cDNA library for interactive proteins. A cDNA clone encoding 1068 nucleotides in the C-terminal domain of p190RhoGEF (clone 39) was found to bind strongly and specifically to the RNA probe. The interaction was confirmed using a glutathione S-transferase/clone 39 fusion protein in Northwestern, gel-shift, and cross-linkage studies. The glutathione S-transferase/clone 39 fusion protein also enhanced the cross-linkage of a major 43-kDa protein in brain extract to the destabilizing element. Functional studies on stably transfected neuronal cells showed that p190RhoGEF expression increased the half-life of a wild-type NF-L mRNA but did not alter the half-life of a mutant NF-L mRNA lacking the destabilizing element. The findings reveal a novel interactive feature of p190RhoGEF that links the exchange factor with NF mRNA stability and regulation of the axonal cytoskeleton.

  11. Ceramic-metal composite article and joining method

    DOEpatents

    Kang, S.; Selverian, J.H.; Kim, H.J.; Dunn, E.M.; Kim, K.S.

    1992-04-28

    A ceramic-metal article including a ceramic rod, a metal rod, and a braze joining the ceramic and metal rods at a braze area of a coaxial bore in the metal rod is described. The bore gradually decreases in diameter, having an inward seat area sized for close sliding fit about the ceramic, a larger brazing area near the joint end, and a void area intermediate the braze and seat areas. The ceramic is seated without brazing in the bore seat area. The side wall between the brazing area and the metal outer surface is about 0.030-0.080 inch. The braze includes an inner braze layer, an outer braze layer, and an interlayer about 0.030-0.090 inch thick. A shoulder between the brazing and void areas supports the interlayer during bonding while preventing bonding between the void area and the ceramic member, leaving a void space between the void area and the ceramic member. A venting orifice extends generally radially through the metal member from the outer surface to the void space. The braze layers are palladium, platinum, gold, silver, copper, nickel, indium, chromium, molybdenum, niobium, iron, aluminum, or alloys thereof. Preferred is a gold-palladium-nickel brazing alloy. The interlayer is nickel, molybdenum, copper, tantalum, tungsten, niobium, aluminum, cobalt, iron, or an alloy thereof. 4 figs.

  12. Ceramic-metal composite article and joining method

    DOEpatents

    Kang, Shinhoo; Selverian, John H.; Kim, Hans J.; Dunn, Edmund M.; Kim, Kyung S.

    1992-01-01

    A ceramic-metal article including a ceramic rod, a metal rod, and a braze joining the ceramic and metal rods at a braze area of a coaxial bore in the metal rod. The bore gradually decreases in diameter, having an inward seat area sized for close sliding fit about the ceramic, a larger brazing area near the joint end, and a void area intermediate the braze and seat areas. The ceramic is seated without brazing in the bore seat area. The side wall between the brazing area and the metal outer surface is about 0.030-0.080 inch. The braze includes an inner braze layer, an outer braze layer, and an interlayer about 0.030-0.090 inch thick. A shoulder between the brazing and void areas supports the interlayer during bonding while preventing bonding between the void area and the ceramic member, leaving a void space between the void area and the ceramic member. A venting orifice extends generally radially through the metal member from the outer surface to the void space. The braze layers are palladium, platinum, gold, silver, copper, nickel, indium, chromium, molybdenum, niobium, iron, aluminum, or alloys thereof. Preferred is a gold-palladium-nickel brazing alloy. The interlayer is nickel, molybdenum, copper, tantalum, tungsten, niobium, aluminum, cobalt, iron, or an alloy thereof.

  13. Indian oil company joins efforts to reduce methane emissions

    NASA Astrophysics Data System (ADS)

    Kumar, Mohi

    The Oil and Natural Gas Corp, Ltd. (ONGC), headquartered in Dehradun, India, has joined seven U.S. and Canadian oil and natural gas companies as a partner in a U.S. Environmental Protection Agency program to reduce greenhouse gas emissions. EPA's Natural Gas STAR International Program aims to reduce methane emissions from the oil and natural gas sector while delivering more gas to markets around the world. With this partnership, ONGC agrees to implement emissions reduction practices and to submit annual reports on progress achieved; EPA agrees to assist ONGC with training technicians in new cost-effective technologies that will help achieve target emissions. The Natural Gas STAR International Program is administered under the Methane to Markets Partnership, a group of 20 countries and 600 companies across the globe that since 2004 has volunteered to cut methane emissions. More information on EPA's agreement with ONGC can be found at http://www.epa.gov/gasstar/index.htm; information about the Methane to Markets Partnership can be found at http://www.methanetomarkets.org.

  14. Moments of genome evolution by Double Cut-and-Join.

    PubMed

    Biller, Priscila; Guéguen, Laurent; Tannier, Eric

    2015-01-01

    We study statistical estimators of the number of genomic events separating two genomes under a Double Cut-and Join (DCJ) rearrangement model, by a method of moment estimation. We first propose an exact, closed, analytically invertible formula for the expected number of breakpoints after a given number of DCJs. This improves over the heuristic, recursive and computationally slower previously proposed one. Then we explore the analogies of genome evolution by DCJ with evolution of binary sequences under substitutions, permutations under transpositions, and random graphs. Each of these are presented in the literature with intuitive justifications, and are used to import results from better known fields. We formalize the relations by proving a correspondence between moments in sequence and genome evolution, provided substitutions appear four by four in the corresponding model. Eventually we prove a bounded error on two estimators of the number of cycles in the breakpoint graph after a given number of rearrangements, by an analogy with cycles in permutations and components in random graphs.

  15. Predictive modeling of reactive wetting and metal joining.

    SciTech Connect

    van Swol, Frank B.

    2013-09-01

    The performance, reproducibility and reliability of metal joints are complex functions of the detailed history of physical processes involved in their creation. Prediction and control of these processes constitutes an intrinsically challenging multi-physics problem involving heating and melting a metal alloy and reactive wetting. Understanding this process requires coupling strong molecularscale chemistry at the interface with microscopic (diffusion) and macroscopic mass transport (flow) inside the liquid followed by subsequent cooling and solidification of the new metal mixture. The final joint displays compositional heterogeneity and its resulting microstructure largely determines the success or failure of the entire component. At present there exists no computational tool at Sandia that can predict the formation and success of a braze joint, as current capabilities lack the ability to capture surface/interface reactions and their effect on interface properties. This situation precludes us from implementing a proactive strategy to deal with joining problems. Here, we describe what is needed to arrive at a predictive modeling and simulation capability for multicomponent metals with complicated phase diagrams for melting and solidification, incorporating dissolutive and composition-dependent wetting.

  16. Joining of Dissimilar Metals By Friction Stir Welding

    NASA Astrophysics Data System (ADS)

    Firouzdor, Vahid

    The use of friction stir welding (FSW) as a new process for joining dissimilar metals has been studied frequently recently. The present study investigated dissimilar-metal FSW between Al and Mg alloys using the widely used alloys 6061 Al and AZ31B Mg. It focused on the issue of how the joint strength is affected by the welding conditions, including the positions of Al and Mg with respect to the welding tool, the tool travel speed and the tool rotation speed. In spite of studies conducted by many other investigators, understanding of this fundamental issue is still rather limited. Unlike those studies, the present study: (1) determined the heat input by torque and temperature measurements during welding and used it to explain the effect of the welding conditions on the joint strength, (2) used color metallography with Al, Mg, Al3Mg2 and Al12Mg17 shown in different colors to clearly revealed the effect of the welding conditions on the formation of intermetallic compounds and material flow, which are affected by the heat input and which in turn affect the joint strength, and (3) determined the windows for selecting the travel and rotation speeds to optimize the joint strength for various material positions. Furthermore, conventional lap FSW was modified and the joint strength and ductility of the resultant welds were both increased significantly. The modified lap FSW was applied subsequently to Al-to-Cu FSW. The intermetallic compounds in Al-Mg and Al-Cu welds were identified.

  17. Join the "Club of the Sterilized" Hanoi urges.

    PubMed

    1996-01-01

    In Viet Nam, the government has mounted a program of encouraging sterilization to control population growth. Peasants who have been sterilized are being urged to form and join special motivational clubs to give momentum to the initiative, and financial incentives are provided to those who accept sterilization after having two children. The government action follows concerns that rapid population growth will strain the country's newly achieved economic gains and ability to produce enough food. Until recently, large families were eligible for greater amounts of land being allocated, and the government's new initiative faces challenges in districts that are prosperous or are predominantly Roman Catholic. With domestic funds in short supply, Viet Nam has depended upon the UN Population Fund for training, equipment supply, and development of an assembly line at a condom factory. The government plans to screen pregnant women for fetal anomalies to insure that only healthy fetuses are carried to term. For several decades, Viet Nam will be suffering from the effects of the spraying of herbicides undertaken by the US during the war. Miscarriages, stillbirths, and fetal deformities are among those effects.

  18. Asian international students' barriers to joining group counseling.

    PubMed

    Lee, Ji-Yeon

    2014-10-01

    This cross-sectional study examined anticipated reactions to group participation among Asian international students (ISs). Structural equation modeling confirmed that Asian ISs' (n = 180) level of acculturation was associated with their attitude toward joining group counseling, which is partially mediated by their stigma toward help-seeking. The results of multiple regression analyses indicated that ISs who reported higher place dependence, stigma toward help-seeking, and fear of negative evaluation reported more fear about disclosing emotional parts of themselves to other group members in the presence of a group member from the same country of origin. The results showed that ISs' perceived difficulties in providing feedback to a group member in the presence of an IS from the same country of origin were predicted by low place identity, high place dependence, and more stigma. International students' willingness to disclose and provide feedback in a group counseling setting was compared in three different hypothetical situations based on other group members' demographics, and the results showed that ISs are more afraid of self-disclosure in the presence of an international student from the same country.

  19. Laser Assisted Joining of Hybrid Polyamide-aluminum Structures

    NASA Astrophysics Data System (ADS)

    Lamberti, Christian; Solchenbach, Tobias; Plapper, Peter; Possart, Wulff

    The demand for hybrid polymer-metal structures is continuously growing due to their great potential in automotive, aerospace and packaging applications. The expected capabilities are highly diverse and include functional, chemical and mechanical as well as economical and ecological aspects. A novel laser beam joining process for hybrid polyamide-aluminum structures is reported. The spatial and temporal heat input is optimized for optimal bonding quality. At the interface it was proven that the polyamide was not decomposed as a result of excessive thermal stress. It was shown that laser or electro-chemical surface pre-treatment of the aluminum substrate has a distinctive effect on the shear strength of the joint. However, the bond quality does not correspond to a change of surface roughness. Therefore, mechanical interlocking in direct relation to surface topology of the pre-treated substrate is not the principal cause for the bonding phenomenon. Chemical analysis in terms of IR-spectroscopy has shown a physicochemical interaction based on hydrogen bonds.

  20. Controlled joining of Ag nanoparticles with femtosecond laser radiation

    NASA Astrophysics Data System (ADS)

    Huang, H.; Liu, L.; Peng, P.; Hu, A.; Duley, W. W.; Zhou, Y.

    2012-12-01

    We show that it is possible to tailor the gap separation and interface geometry between adjacent Ag nanoparticles (NPs) by controlling fluence when irradiating with pulses from a fs laser. Unirradiated samples extracted from aqueous solution consist of networks of Ag NPs coated with polyvinylpyrrolidone (PVP). At low laser fluence, bonding between NPs occurs via the formation of an intervening hydrogenated amorphous carbon (α-C:H) layer resulting from the laser-induced decomposition of PVP. This occurs when electrons are emitted at hot-spots created by the trapping of plasmons. The thickness of the α-C:H layer determines the minimum separation between NPs. Ag NPs with different contact geometries can be produced by irradiation of the networks in solution at fluences exceeding the threshold for the formation of α-C:H. At fluences between 200 and 380 μJ/cm2, the α-C:H interface layer is replaced with a metallic neck. Surface enhanced Raman scattering (SERS) has been used to quantify the electromagnetic field enhancement in joined NP samples. We find that Ag NPs bonded by α-C:H and exhibiting a narrow gap possess the highest SERS enhancement.