Sample records for joining region elements

  1. Finite Element Modeling and Optimization of Mechanical Joining Technology

    NASA Astrophysics Data System (ADS)

    Chenot, Jean-Loup; Bouchard, Pierre-Olivier; Massoni, Elisabeth; Mocellin, Katia; Lasne, Patrice


    The main scientific ingredients are recalled for developing a general finite element code and model accurately large plastic deformation of metallic materials during joining processes. Multi material contact is treated using the classical master and slave approach. Rupture may occur in joining processes or even be imposed in self piercing riveting and it must be predicted to evaluate the ultimate strength of joins. Damage is introduced with a generalized uncoupled damage criterion, or by utilizing a coupled formulation with a Lemaître law. Several joining processes are briefly analyzed in term of specific scientific issues: riveting, self piercing riveting, clinching, crimping, hemming and screwing. It is shown that not only the joining process can be successfully simulated and optimized, but also the strength of the assembly can be predicted in tension and in shearing.

  2. Finite element thermal analysis for PMMA/ laser direct joining

    NASA Astrophysics Data System (ADS)

    Hussein, Furat I.; Salloomi, Kareem N.; Akman, E.; Hajim, K. I.; Demir, A.


    This work is concerned with building a three-dimensional (3D) ab-initio models that is capable of predicting the thermal distribution of laser direct joining processes between Polymethylmethacrylate (PMMA) and stainless steel 304( ANSYS® simulation based on finite element analysis (FEA) was implemented for materials joining in two modes; laser transmission joining (LTJ) and conduction joining (CJ). ANSYS® simulator was used to explore the thermal environment of the joints during joining (heating time) and after joining (cooling time). For both modes, the investigation is carried out when the laser spot is at the middle of the joint width, at 15 mm from the commencement point (joint edge) at traveling time of 3.75 s. Process parameters involving peak power (Pp=3 kW), pulse duration (τ=5 ms), pulse repetition rate (PRR=20 Hz) and scanning speed (v=4 mm/s) are applied for both modes.

  3. Finite Element Simulation of Plastic Joining Processes of Steel and Aluminum Alloy Sheets

    SciTech Connect

    Mori, K.; Abe, Y.; Kato, T.


    Various high tensile strength steel sheets and an aluminum alloy sheet were joined with a self-piercing rivet. It is not easy to weld the aluminum alloy sheet and high tensile strength sheets by means of conventional resistance welding because of very different melting points. To obtain optimum joining conditions, joining defects were categorized into separation of the sheets and an inner fracture. The joining range of ultra high tensile strength steel and aluminum alloy sheets was extended by means of dies optimized by finite element simulation. The joint strength is greatly influenced by not only the strength of the sheets and rivets but also the ratio of the thickness of the lower sheet to the total thickness. In addition, mechanical clinching of high strength steel and aluminum alloy sheets was simulated.

  4. Finite Element Simulation of Plastic Joining Processes of Steel and Aluminum Alloy Sheets

    NASA Astrophysics Data System (ADS)

    Mori, K.; Abe, Y.; Kato, T.


    Various high tensile strength steel sheets and an aluminum alloy sheet were joined with a self-piercing rivet. It is not easy to weld the aluminum alloy sheet and high tensile strength sheets by means of conventional resistance welding because of very different melting points. To obtain optimum joining conditions, joining defects were categorized into separation of the sheets and an inner fracture. The joining range of ultra high tensile strength steel and aluminum alloy sheets was extended by means of dies optimized by finite element simulation. The joint strength is greatly influenced by not only the strength of the sheets and rivets but also the ratio of the thickness of the lower sheet to the total thickness. In addition, mechanical clinching of high strength steel and aluminum alloy sheets was simulated.

  5. EPA Regional Administrator Joins Delaware Officials to Honor States Green Ribbon Schools

    EPA Pesticide Factsheets

    PHILADELPHIA (April 29, 2015) Today, EPA Regional Administrator Shawn M. Garvin joined Delaware Senator Harris McDowell, Delaware Department of Education Secretary Mark Murphy, and Delaware Department of Natural Resources and Environmental Control S

  6. Rigorous joining of advanced reduced-dimensional beam models to three-dimensional finite element models

    NASA Astrophysics Data System (ADS)

    Song, Huimin

    In the aerospace and automotive industries, many finite element analyses use lower-dimensional finite elements such as beams, plates and shells, to simplify the modeling. These simplified models can greatly reduce the computation time and cost; however, reduced-dimensional models may introduce inaccuracies, particularly near boundaries and near portions of the structure where reduced-dimensional models may not apply. Another factor in creation of such models is that beam-like structures frequently have complex geometry, boundaries and loading conditions, which may make them unsuitable for modeling with single type of element. The goal of this dissertation is to develop a method that can accurately and efficiently capture the response of a structure by rigorous combination of a reduced-dimensional beam finite element model with a model based on full two-dimensional (2D) or three-dimensional (3D) finite elements. The first chapter of the thesis gives the background of the present work and some related previous work. The second chapter is focused on formulating a system of equations that govern the joining of a 2D model with a beam model for planar deformation. The essential aspect of this formulation is to find the transformation matrices to achieve deflection and load continuity on the interface. Three approaches are provided to obtain the transformation matrices. An example based on joining a beam to a 2D finite element model is examined, and the accuracy of the analysis is studied by comparing joint results with the full 2D analysis. The third chapter is focused on formulating the system of equations for joining a beam to a 3D finite element model for static and free-vibration problems. The transition between the 3D elements and beam elements is achieved by use of the stress recovery technique of the variational-asymptotic method as implemented in VABS (the Variational Asymptotic Beam Section analysis). The formulations for an interface transformation matrix and

  7. Immunoglobulin V/J recombination is accompanied by deletion of joining site and variable region segments.

    PubMed Central

    Seidman, J G; Nau, M M; Norman, B; Kwan, S P; Scharff, M; Leder, P


    A site-specific recombination event is responsible for the somatic activation of immunoglobulin genes and for generating a major share of immunoglobulin gene diversity. Although several possible mechanisms can be proposed to account for this process, recombinatio accompanied by deletion is a particularly attractive mechanism because it might utilize inverted repeat sequences noted on the 3' side of all variable regions and on the 5' side of all joining site segments thus far studied. Testing this model is complicated by the fact that antibody cells are at least diploid and gene segments on the inactive chromosome can obscure deletions occurring within the active gene. Accordingly, we have screened several immunoglobulin-producing plasmacytoma lines to select those in which both chromosomes are rearranged. By using appropriate cell lines and variable and joining region probes in in situ hybridization experiments, we show that recombination is accompanied by the deletion of both variable and joining region genes. These experiments also allow us to map the site of V/J recombination of several active immunoglobulin genes and suggest an order and orientation for variable, joining, and constant region sequences. Images PMID:6777777

  8. Recombination events near the immunoglobulin Cmu gene join variable and constant region genes, switch heavy-chain expression, or inactivate the locus.


    Cory, S; Webb, E; Gough, J; Adams, J M


    Immunoglobulin heavy-chain expression is initiated by recombination between a variable region (VH) gene and one of several joining region (JH) genes located near the mu constant region (Cmu) gene, and the active VH gene can subsequently switch to another CH gene. That the general mechanism for CH switching involves recombination between sites within the JH-Cmu intervening sequence and the 5' flanking region of another CH gene is supported here by Southern blot hybridization analysis of eight IgG- and IgA-secreting plasmacytomas. An alternative model requiring successive VH linkage to similar JH clusters near each CH gene is shown to be very unlikely since the mouse genome appears to contain only one complement of the JH locus and no JH gene was detectable within large cloned sequences flanking germline C gamma 3 and C gamma 1 genes. Thus, VH-JH joining and CH switching are mediated by separate regions of "the joining-switch" or J-S element. In each plasmacytoma examined, the J-S element had undergone recombination within both the JH locus and the switch region and was shown to be linked to the functional CH gene in an IgG3, and IgG1, and three IgA secretors. Both JH joining and CH switching occurred by deletion of DNA. Switch recombination occurred at more than one site within the J-S element in different lines, even for recombination with the same CH gene. Significantly, although heavy-chain expression is restricted to one allele ("allelic exclusion"), all rearranged in each plasmacytoma. Some rearrangements were aberrant, involving, for example, deletion of all JH genes from the allele. Hence, an error-prone recombination machinery may account for allelic exclusion in many plasmacytomas.

  9. Koffka's effect is mediated by figure thickness at the joining region.


    Huang, Abigail E; Hon, Alice J; Li, Xintong; McCormick, Meghan C; Patel, Dina A; Chubb, Charles; Altschuler, Eric L


    Three-quarters of a century ago Gestalt psychologist Kurt Koffka described a remarkable effect: when a contiguous gray ring is placed on a background half one shade of gray, half another, the ring appears homogeneous. However, if the ring is divided, the two halves of the ring appear different shades of gray, the half of the ring on the darker background appearing lighter than the half of the ring on the lighter background. The Gestalt principle of continuity is used to explain this effect. But what microscopic principles might be mediating this effect? Recently we found sufficiently thin rings (annuli) appear heterogeneous even when geometrically continuous. Here, using crescent-shaped figures instead of the circular annuli used for the traditional Koffka effect, we show that this effect of thickness of the ring is mediated by the thickness at the boundary of the region where the halves of the figure are joined.

  10. Nonhomologous-end-joining factors regulate DNA repair fidelity during Sleeping Beauty element transposition in mammalian cells.


    Yant, Stephen R; Kay, Mark A


    Herein, we report that the DNA-dependent protein kinase (DNA-PK) regulates the DNA damage introduced during Sleeping Beauty (SB) element excision and reinsertion in mammalian cells. Using both plasmid- and chromosome-based mobility assays, we analyzed the repair of transposase-induced double-stranded DNA breaks in cells deficient in either the DNA-binding subunit of DNA-PK (Ku) or its catalytic subunit (DNA-PKcs). We found that the free 3' overhangs left after SB element excision were efficiently and accurately processed by the major Ku-dependent nonhomologous-end-joining pathway. Rejoining of broken DNA molecules in the absence of Ku resulted in extensive end degradation at the donor site and greatly increased the frequency of recombination with ectopic templates. Therefore, the major DNA-PK-dependent DNA damage response predominates over more-error-prone repair pathways and thereby facilitates high-fidelity DNA repair during transposon mobilization in mammalian cells. Although transposable elements were not found to be efficiently circularized after transposase-mediated excision, DNA-PK deficiency supported more-frequent transposase-mediated element insertion than was found in wild-type controls. We conclude that, based on its ability to regulate excision site junctional diversity and transposon insertion frequency, DNA-PK serves an important protective role during transpositional recombination in mammals.



    Erwin, J.H.


    A method of fabricating MTR-type fuel elements is described wherein dove- tailed joints are used to fasten fuel plates to supporting side members. The method comprises the steps of dove-tailing the lateral edges of the fuel plates, inserting the dove-tailed edges into corresponding recesses which are provided in a pair of supporting side members, and compressing the supporting side members in a direction so as to close the recesses onto the dove-tailed edges. (AEC)

  12. Genomic structure around joining segments and constant regions of swine T-cell receptor α/δ (TRA/TRD) locus

    PubMed Central

    Uenishi, Hirohide; Hiraiwa, Hideki; Yamamoto, Ryuji; Yasue, Hiroshi; Takagaki, Yohtaroh; Shiina, Takashi; Kikkawa, Eri; Inoko, Hidetoshi; Awata, Takashi


    A complete genomic region of 131·2 kb including the swine T-cell receptor α/δ constant region (TRAC/TRDC) and joining segments (TRAJ/TRDJ) was sequenced. The structure of this region was strikingly conserved in comparison to that of human or mouse. All of the 61 TRAJ segments detected in the human genomic sequence were detected in the swine sequence and the sequence of the protein binding site of T early alpha, the sequence of the α enhancer element and the conserved sequence block between TRAJ3 and TRAJ4 are highly conserved. Insertion of the repetitive sequences that interspersed after the differentiation of the species in mammals such as short interspersed nucleotide elements is markedly suppressed in comparison to other genomic regions, while the composition of the mammalian-wide interspersed sequences is relatively conserved in human and swine. This observation indicates the existence of a highly selective pressure to conserve this genomic region around TRAJ throughout the evolution of mammals. PMID:12871218

  13. Protein displays of the human T cell receptor alpha, beta, gamma and delta variable and joining regions.


    Folch, G; Scaviner, D; Contet, V; Lefranc, M P


    'Protein Displays of the Human T Cell Receptor Alpha, Beta, Gamma and Delta Variable and Joining Regions', the 13th report of the 'IMGT Locus in Focus' section, comprises 8 figures: (1) 'Protein display of the human TRA V-REGIONs'; (2) 'Protein display of the human TRB V-REGIONs'; (3) 'Protein display of the human TRG V-REGIONs'; (4) 'Protein display of the human TRD V-REGIONs'; (5) 'Protein display of the human TRA J-REGIONs'; (6) 'Protein display of the human TRB J- REGIONs'; (7) 'Protein display of the human TRG J-REGIONs'; (8) 'Protein display of the human TRD J-REGIONs', and 4 tables entitled: (1) 'FR-IMGT and CDR-IMGT length of the human TRAV genes'; (2) 'FR-IMGT and CDR-IMGT length of the human TRBV genes'; (3) 'FR-IMGT and CDR-IMGT length of the human TRGV genes'; (4) 'FR-IMGT and CDR-IMGT length of the human TRDV genes'. These figures and tables are available at the IMGT Marie-Paule page from IMGT, the international ImMunoGeneTics database (http:// created by Marie-Paule Lefranc, Université Montpellier II, CNRS, Montpellier, France. Copyright 2000 S. Karger AG, Basel

  14. Explosive Joining

    NASA Technical Reports Server (NTRS)


    Laurence J. Bement of Langley Research Center invented a technique to permit metal joining operations under hazardous or inaccessible conditions. The process, which provides a joint with double the strength of the parent metal, involves the use of very small quantities of ribbon explosive to create hermetically sealed joints. When the metal plates are slammed together by the explosion's force, joining is accomplished. The collision causes a skin deep melt and ejection of oxide films on the surfaces, allowing a linkup of electrons that produce superstrong, uniform joints. The technique can be used to join metals that otherwise would not join and offers advantages over mechanical fasteners and adhesives. With Langley assistance, Demex International Ltd. refined and commercialized the technology. Applications include plugging leaking tubes in feedwater heaters. Demex produces the small plugs, associated sleeves and detonators. The technology allows faster plugging, reduces downtime, cuts plugging costs and increases reliability.

  15. Ceramic joining

    SciTech Connect

    Loehman, R.E.


    This paper describes the relation between reactions at ceramic-metal interfaces and the development of strong interfacial bonds in ceramic joining. Studies on a number of systems are described, including silicon nitrides, aluminium nitrides, mullite, and aluminium oxides. Joints can be weakened by stresses such as thermal expansion mismatch. Ceramic joining is used in a variety of applications such as solid oxide fuel cells.

  16. Generation and reactivation of T-cell receptor A joining region pseudogenes in primates

    SciTech Connect

    Thiel, C.; Lanchbury, J.S.; Otting, N.


    Tandemly duplicated T-cell receptor (Tcr) AJ (J{alpha}) segments contribute significantly to TCRA chain junctional region diversity in mammals. Since only limited data exists on TCRA diversity in nonhuman primates, we examined the TCRAJ regions of 37 chimpanzee and 71 rhesus macaque TCRA cDNA clones derived from inverse polymerase chain reaction on peripheral blood mononuclear cell cDNA of healthy animals. Twenty-five different TCRAJ regions were characterized in the chimpanzee and 36 in the rhesus macaque. Each bears a close structural relationship to an equivalent human TCRAJ region. Conserved amino acid motifs are shared between all three species. There are indications that differences between nonhuman primates and humans exist in the generation of TCRAJ pseudogenes. The nucleotide and amino acid sequences of the various characterized TCRAJ of each species are reported and we compare our results to the available information on human genomic sequences. Although we provide evidence of dynamic processes modifying TCRAJ segments during primate evolution, their repertoire and primary structure appears to be relatively conserved. 21 refs., 2 figs.

  17. Joining up the Episodes of Lifelong Learning: A Regional Transition Project

    ERIC Educational Resources Information Center

    Hartnell-Young, Elizabeth; Smallwood, Angela; Kingston, Sandra; Harley, Philip


    In this paper, we explore the rationale, process and outcomes of the Regional Interoperability Project on Progression for Lifelong Learning, a project that established a model of cross-sector collaboration in personal development planning technology in the UK. With specific reference to the widening participation agenda, and grounded in the…

  18. Joined ceramic product


    Henager, Jr., Charles W [Kennewick, WA; Brimhall, John L [West Richland, WA


    According to the present invention, a joined product is at least two ceramic parts, specifically bi-element carbide parts with a bond joint therebetween, wherein the bond joint has a metal silicon phase. The bi-element carbide refers to compounds of MC, M.sub.2 C, M.sub.4 C and combinations thereof, where M is a first element and C is carbon. The metal silicon phase may be a metal silicon carbide ternary phase, or a metal silicide.

  19. Analysis of the Linker Region Joining the Adenylation and Carrier Protein Domains of the Modular Non-Ribosomal Peptide Synthetases

    PubMed Central

    Miller, Bradley R.; Sundlov, Jesse A.; Drake, Eric J.; Makin, Thomas A.; Gulick, Andrew M.


    Non-Ribosomal Peptide Synthetases (NRPSs) are multi-modular proteins capable of producing important peptide natural products. Using an assembly-line process the amino acid substrate and peptide intermediates are passed between the active sites of different catalytic domains of the NRPS while bound covalently to a peptidyl carrier protein (PCP) domain. Examination of the linker sequences that join the NRPS adenylation and PCP domains identified several conserved proline residues that are not found in standalone adenylation domains. We examined the roles of these proline residues and neighboring conserved sequences through mutagenesis and biochemical analysis of the reaction catalyzed by the adenylation domain and the fully reconstituted NRPS pathway. In particular, we identified a conserved LPxP motif at the start of the adenylation-PCP linker. The LPxP motif interacts with a region on the adenylation domain to stabilize a critical catalytic lysine residue belonging to the A10 motif that immediately precedes the linker. Further, this interaction with the C-terminal sub-domain of the adenylation domain may coordinate movement of the PCP with the conformational change of the adenylation domain. Through this work, we extend the conserved A10 motif of the adenylation domain and identify residues that enable proper adenylation domain function. PMID:24975514

  20. Method of joining ceramics


    Henager, Jr., Charles H.; Brimhall, John L.


    According to the method of the present invention, joining a first bi-element carbide to a second bi-element carbide, has the steps of: (a) forming a bond agent containing a metal carbide and silicon; (b) placing the bond agent between the first and second bi-element carbides to form a pre-assembly; and (c) pressing and heating the pre-assembly in a non-oxidizing atmosphere to a temperature effective to induce a displacement reaction creating a metal silicon phase bonding the first and second bi-element carbides.

  1. MuLV-related endogenous retroviral elements and Flt3 participate in aberrant end-joining events that promote B-cell leukemogenesis.


    Johnson, Radia M; Papp, Eniko; Grandal, Ildiko; Kowalski, Paul E; Nutter, Lauryl; Wong, Raymond C C; Joseph-George, Ann M; Danska, Jayne S; Guidos, Cynthia J


    During V(D)J recombination of immunoglobulin genes, p53 and nonhomologous end-joining (NHEJ) suppress aberrant rejoining of DNA double-strand breaks induced by recombinase-activating genes (Rags)-1/2, thus maintaining genomic stability and limiting malignant transformation during B-cell development. However, Rag deficiency does not prevent B-cell leukemogenesis in p53/NHEJ mutant mice, revealing that p53 and NHEJ also suppress Rag-independent mechanisms of B-cell leukemogenesis. Using several cytogenomic approaches, we identified a novel class of activating mutations in Fms-like tyrosine kinase 3 (Flt3), a receptor tyrosine kinase important for normal hematopoiesis in Rag/p53/NHEJ triple-mutant (TM) B-cell leukemias. These mutant Flt3 alleles were created by complex genomic rearrangements with Moloney leukemia virus (MuLV)-related endogenous retroviral (ERV) elements, generating ERV-Flt3 fusion genes encoding an N-terminally truncated mutant form of Flt3 (trFlt3) that was transcribed from ERV long terminal repeats. trFlt3 protein lacked most of the Flt3 extracellular domain and induced ligand-independent STAT5 phosphorylation and proliferation of hematopoietic progenitor cells. Furthermore, expression of trFlt3 in p53/NHEJ mutant hematopoietic progenitor cells promoted development of clinically aggressive B-cell leukemia. Thus, repetitive MuLV-related ERV sequences can participate in aberrant end-joining events that promote development of aggressive B-cell leukemia. © 2014 Johnson et al.; Published by Cold Spring Harbor Laboratory Press.

  2. Joining of tubes by gas detonation forming

    NASA Astrophysics Data System (ADS)

    Jenkouk, Vahid; Patil, Sandeep; Markert, Bernd


    For many applications, such as in structural components, it is required to join two tubes - sometimes with dissimilar material properties. Only few research studies have investigated the joining of tubular metallic components by means of high-velocity forming processes. In this paper, we present the novel process of joining of two tubes by a gas detonation pressure wave. In particular, the joining of a copper and a steel tube is discussed by means of a finite element study and a conducted experiment.

  3. Joining SI3N4 for Advanced Turbomachinery Applications

    SciTech Connect



    The main objective of this project was to develop reliable, low-cost techniques for joining silicon nitride (Si{sub 3}N{sub 4}) to itself and to metals. For Si{sub 3}N{sub 4} to be widely used in advanced turbomachinery applications, joining techniques must be developed that are reliable, cost-effective, and manufacturable. This project addressed those needs by developing and testing two Si{sub 3}N{sub 4} joining systems; oxynitride glass joining materials and high temperature braze alloys. Extensive measurements were also made of the mechanical properties and oxidation resistance of the braze materials. Finite element models were used to predict the magnitudes and positions of the stresses in the ceramic regions of ceramic-to-metal joints sleeve and butt joints, similar to the geometries used for stator assemblies.

  4. Regional differences in elements of human peroneus longus tendons.


    Matsumoto, Norikazu; Kumai, Tsukasa; Isomoto, Shinji; Shinohara, Yasushi; Tanaka, Yasuhito; Azuma, Cho; Minami, Takeshi; Tohno, Yoshiyuki


    Many studies have been performed on the structure, molecular composition, and biochemical properties of tendons. However, comparatively little research has been conducted on the content of various trace elements within tendons. Six elements were analyzed in four regions of the peroneus longus tendon: the tensional part of the tendon immediately proximal to the lateral malleolus (region A), the compressive region of the tendon in contact with the lateral malleolus (region B), the compressive region of the tendon in contact with the deep surface of the cuboid (region C), and the tensional part of the tendon between the cuboid and first metatarsal, to which the tendon is attached (region D). Regions B and C are wraparound regions. The calcium content was higher in region C (2.10 ± 0.93 mg/g) than in both regions A (1.25 ± 0.51 mg/g) and D (1.43 ± 0.41 mg/g) (p < 0.05), indicating that it is likely related to regional differences in cartilage degeneration. The phosphorus content was also higher in region C, possibly because of low alkaline phosphatase activity in this region. The sulfur content was higher in the wraparound regions (region B: 0.98 ± 0.09 mg/g, region C: 1.24 ± 0.19 mg/g) than in both regions A (0.83 ± 0.11 mg/g) and D (0.83 ± 0.1 mg/g) (p < 0.01); sulfur content is thought to be influenced by tendon-bone compression. Finally, the magnesium content in the wraparound regions was also higher, which is probably related to a higher level of fibrocartilage. No significant relationships were found with regard to zinc or iron. Overall, the findings of the present study indicate that element contents are related to function and anatomical differences in tendons, and that they may even vary within the same tendon.

  5. Cohabitation of insulators and silencing elements in yeast subtelomeric regions.

    PubMed Central

    Fourel, G; Revardel, E; Koering, C E; Gilson, E


    In budding yeast, the telomeric DNA is flanked by a combination of two subtelomeric repetitive sequences, the X and Y' elements. We have investigated the influence of these sequences on telomeric silencing. The telomere-proximal portion of either X or Y' dampened silencing when located between the telomere and the reporter gene. These elements were named STARs, for subtelomeric anti-silencing regions. STARs can also counteract silencer-driven repression at the mating-type HML locus. When two STARs bracket a reporter gene, its expression is no longer influenced by surrounding silencing elements, although these are still active on a second reporter gene. In addition, an intervening STAR uncouples the silencing of neighboring genes. STARs thus display the hallmarks of insulators. Protection from silencing is recapitulated by multimerized oligonucleotides representing Tbf1p- and Reb1p-binding sites, as found in STARs. In contrast, sequences located more centromere proximal in X and Y' elements reinforce silencing. They can promote silencing downstream of an insulated expressed domain. Overall, our results suggest that the silencing emanating from telomeres can be propagated in a discontinuous manner via a series of subtelomeric relay elements. PMID:10228166

  6. Newly developed paleomagnetic map of the Easternmost Mediterranean joined with tectono-structural analysis unmask geodynamic history of this region

    NASA Astrophysics Data System (ADS)

    Eppelbaum, Lev; Katz, Youri


    Comprehensive magnetic-paleomagnetic analysis of physical-geological models developed for the Easternmost Mediterranean (northern part of the Sinai plate) accompanied by gravity and seismic data examination enabled the detection of a zone of inverse magnetization of submeridional strike with a total volume exceeding 120,000 km3. Such a large zone must correspond to the prolonged period of inverse polarity in the Earth's magnetic field history. We suggest that this inversely magnetized thick block of the Earth's crust corresponds to the known Kiama hyperzone. A paleomagnetic map constructed on the basis of abovementioned geophysical data analysis combined with detailed examination of structural, radiometric, petrological, facial, paleogeographical and some other data indicates that to the west of the Kiama zone is situated the Jalal zone, and to the east - Illawarra, Omolon and Gissar zones. Discovery of the Kiama paleomagnetic zone combined with tectonogeodynamical analysis and paleobiographical data examination indicates that the Earth's oceanic crust blocks may have been shifted by transform faults from the eastern part of the Tethys Ocean to their modern position in the Easternmost Mediterranean. Analysis of potential geophysical fields and seismological maps integrated with tectonostructural examination show the isolation of the northern part of Sinai plate from other terranes. For the first time formation-paleogeographical maps of Triassic and Jurassic for the Easternmost Mediterranean have been compiled and their tectono-geodynamical explanation has been given. The obtained data create a basis for reconsidering tectonic zonation, paleogeodynamical reconstructions and searching for economic deposits in this region.

  7. Study on the validity region of Energy Finite Element Analysis

    NASA Astrophysics Data System (ADS)

    Kong, Xiangjie; Chen, Hualing; Zhu, Danhui; Zhang, Wenbo


    The validity domain of Energy Finite Element Analysis (EFEA) is studied in this paper. The validity region and criterion of EFEA are studied theoretically from the formation of reverberant plane wave field, one of the main assumptions of EFEA. The studies are acquired by virtue of the equation of radiative energy transfer method, a similar wave method that can express the direct field and its conversion relationship with reverberant field exactly. The result shows that the SEA criterion of diffuse field derived by Le Bot can be used as a good indicator for the EFEA validity. Numerical simulations on a rectangular plate with different physical parameters are applied to validate the criterion. The validity region and the diagrams of validity of EFEA are assessed and discussed. Some noteworthy conclusions about EFEA are drawn.

  8. Stress concentration around an atelectatic region: a finite element model.


    Makiyama, A M; Gibson, L J; Harris, R S; Venegas, J G


    Lung parenchyma surrounding an atelectatic region is thought to be subjected to increased stress compared with the rest of the lung. Using 37 hexagonal cells made of linear springs, Mead et al. (1970) measured a stress concentration greater than 30% in the springs surrounding a stiffer central cell. We re-examine the problem using a 2D finite element model of 500 cells made of thin filaments with a non-linear stress-strain relationship. We study the consequences of increasing the central stiff region from one to nine contiguous cells in regular hexagonal honeycombs and random Voronoi honeycombs. The honeycomb structures were uniformly expanded with strains of 15%, 30%, 45% and 55% above their resting, non-deformed geometry. The curve of biaxial stress vs. fractional area change has a similar shape to that of the pressure-volume curve of the lung, showing an initial regime with relatively flat slope and a final regime with decreasing slope, tending toward an asymptote. Regular honeycombs had little variability in the maximum stress in radially oriented filaments adjacent to the central stiff region. In contrast, some filaments in random Voronoi honeycombs were subjected to stress concentration approximately 16 times the average stress concentration in the radially oriented filaments adjacent to the stiff region. These results may have implications in selecting the appropriate strategy for mechanical ventilation in ARDS and defining a "safe" level of alveolar pressure for ventilating atelectatic lungs.

  9. An investigation of the weld region on the SAE 1020 joined with metal active gas and determination of the mismatch factor

    SciTech Connect

    Meric, C.; Tokdemir, M.


    In this study, the joining process of SAE 1020 low carbon steel, generally used in the industry, has been completed using the metal active gas (MAG) weld method. The goal of this study was to examine the mismatch between base and weld metal. After the joining process, mechanical properties of the samples of the base metal (BM), the heat affected zone (HAZ), and the weld metal (WM) were investigated, and the crack tip opening displacement (CTOD) test was performed.

  10. Comparative analysis of aerosols elemental distribution in some Romanian regions

    NASA Astrophysics Data System (ADS)

    Amemiya, Susumu; Masuda, Toshio; Popa-Simil, Liviu; Mateescu, Liviu


    The study's main aim is obtaining aerosols particulate elemental distribution and mapping it for some Romanian regions, in order to obtain preliminary information regarding the concentrations of aerosol particles and networking strategy versus local conditions. For this we used the mobile sampling strategy, but taking care on all local specific conditions and weather. In the summer of 1993, in July we took about 8 samples on a rather large territory of SE Romania which were analysed and mapped. The regions which showed an interesting behaviour or doubts such as Bucharest and Dobrogea were zoomed in near the same period of 1994, for comparing the new details with the global aspect previously obtained. An attempt was made to infer the minimum necessary number of stations in a future monitoring network. A mobile sampler was used, having tow polycarbonate filter posts of 8 and 0.4 μm. PIXE elemental analysis was performed on a 2.5 MV Van de Graaff accelerator, by using a proton beam. More than 15 elements were measured. Suggestive 2D and 3D representations were drawn, as well as histogram charts for the concentrations' distribution in the specific regions at the specified times. In spite of the poor samples from the qualitative point of view the experiment surprised us by the good coincidence (good agreement) with realities in terrain known by other means long time ago, and highlighted the power of PIXE methods in terms of money and time. Conclusions over the link between industry, traffic, vegetation, wether, surface waters, soil composition, power plant exhaust and so on, on the one hand, and surface concentration distribution, on the other, were drawn. But the method's weak points were also highlighted; these are weather dependencies (especially air masses movement and precipitation), local relief, microclimate and vegetation, and of course localisation of the sampling point versus the pollution sources and their regime. The paper contains a synthesis of the whole

  11. Precision Joining Center

    NASA Technical Reports Server (NTRS)

    Powell, John W.


    The establishment of a Precision Joining Center (PJC) is proposed. The PJC will be a cooperatively operated center with participation from U.S. private industry, the Colorado School of Mines, and various government agencies, including the Department of Energy's Nuclear Weapons Complex (NWC). The PJC's primary mission will be as a training center for advanced joining technologies. This will accomplish the following objectives: (1) it will provide an effective mechanism to transfer joining technology from the NWC to private industry; (2) it will provide a center for testing new joining processes for the NWC and private industry; and (3) it will provide highly trained personnel to support advance joining processes for the NWC and private industry.

  12. Joining of dissimilar materials


    Tucker, Michael C; Lau, Grace Y; Jacobson, Craig P


    A method of joining dissimilar materials having different ductility, involves two principal steps: Decoration of the more ductile material's surface with particles of a less ductile material to produce a composite; and, sinter-bonding the composite produced to a joining member of a less ductile material. The joining method is suitable for joining dissimilar materials that are chemically inert towards each other (e.g., metal and ceramic), while resulting in a strong bond with a sharp interface between the two materials. The joining materials may differ greatly in form or particle size. The method is applicable to various types of materials including ceramic, metal, glass, glass-ceramic, polymer, cermet, semiconductor, etc., and the materials can be in various geometrical forms, such as powders, fibers, or bulk bodies (foil, wire, plate, etc.). Composites and devices with a decorated/sintered interface are also provided.

  13. Convective Enhancement of Icing Roughness Elements in Stagnation Region Flows

    NASA Technical Reports Server (NTRS)

    Hughes, Michael T.; McClain, Stephen T.; Vargas, Mario; Broeren, Andy


    To improve existing ice accretion simulation codes, more data regarding ice roughness and its effects on convective heat transfer are required. To build on existing research on this topic, this study used the Vertical Icing Studies Tunnel (VIST) at NASA Glenn Research to model realistic ice roughness in the stagnation region of a NACA 0012 airfoil. Using the VIST, a test plate representing the leading 2% chord of the airfoil was subjected to flows of 7.62 m/s (25 ft/s), 12.19 m/s (40 ft/s), and 16.76 m/s (55 ft/s). The test plate was fitted with 3 surfaces, each with a different representation of ice roughness: 1) a control surface with no ice roughness, 2) a surface with ice roughness with element height scaled by 10x and streamwise rough zone width from the stagnation point scaled by 10x, and 3) a surface with ice roughness with element height scaled by 10x and streamwise rough zone width from the stagnation point scaled by 25x. Temperature data from the tests were recorded using an infrared camera and thermocouples imbedded in the test plate. From the temperature data, a convective heat transfer coefficient map was created for each case. Additional testing was also performed to validate the VIST's flow quality. These tests included five-hole probe and hot-wire probe velocity traces to provide flow visualization and to study boundary layer formation on the various test surfaces. The knowledge gained during the experiments will help improve ice accretion codes by providing heat transfer coefficient validation data and by providing flow visualization data helping understand current and future experiments performed in the VIST.

  14. Pulse joining cartridges


    Golovashchenko, Sergey Fedorovich; Bonnen, John Joseph Francis


    A pulsed joining tool includes a tool body that defines a cavity that receives an inner tubular member and an outer tubular member and a pulse joining cartridge. The tubular members are nested together with the cartridge being disposed around the outer tubular member. The cartridge includes a conductor, such as a wire or foil, that extends around the outer tubular member and is insulated to separate a supply segment from a return segment. A source of stored electrical energy is discharged through the conductor to join the tubular members with an electromagnetic force pulse.

  15. Elemental Abundances in Corotating Interaction Regions at High Solar Latitudes

    NASA Astrophysics Data System (ADS)

    Maclennan, C. G.; Lanzerotti, L. J.


    Throughout 1993, as the Ulysses spacecraft traveled from ˜23° to ˜45° south heliolatitude, the HI-SCALE instrument on the spacecraft measured a recurrent series of enhanced particle fluxes with a recurrence period of ˜26.5 days. These particles are accelerated from a background seed population by the corotating interaction regions (CIRs) associated with a southern solar polar coronal hole. Using the Wart detector telescope of the HI-SCALE instrument, we have analyzed the elemental abundances of C, N, O, and Fe relative to He for 0.5 4.0 MeV/nucl ions and Ne, Mg, and Si for 1.0 4.0 MeV/nucl ions in the CIRs. We compare the relative abundances to some previous measurements reported from 1 A.U. as well as with solar photosphere abundances. We note that HI-SCALE measurements of the heliolatitude dependence of the oxygen abundance and spectrum as reported by Lanzerottiet al. (1994) suggest that a substantial fraction of the seed population for the CIR-accelerated oxygen is likely to be the anomalous oxygen component of the cosmic rays.

  16. Joined concentric tubes


    DeJonghe, Lutgard; Jacobson, Craig; Tucker, Michael; Visco, Steven


    Tubular objects having two or more concentric layers that have different properties are joined to one another during their manufacture primarily by compressive and friction forces generated by shrinkage during sintering and possibly mechanical interlocking. It is not necessary for the concentric tubes to display adhesive-, chemical- or sinter-bonding to each other in order to achieve a strong bond. This facilitates joining of dissimilar materials, such as ceramics and metals.

  17. Joined Beryllium Mirror Demonstrator

    NASA Technical Reports Server (NTRS)

    Stahl, H. Philip; Parsonage, Tom; Burdine, Robert (Technical Monitor)


    Fabrications of large Beryllium optical components are fundamentally limited by available facility capabilities. To overcome this limitation, NASA funded Brush Wellman Corp to study a Be joining process. Four 76 mm diameters samples and a 0.5 mm diameter Joined Beryllium Mirror Demonstrator (JBMD) were fabricated. This presentation will review the fabrication of these samples and summarize the results of their cryogenic testing at MSFCs XRCF.

  18. Joining Steel Armor - Intermix

    DTIC Science & Technology


    TARADCOM a d ki Lk A el B~ 0el RWET0 TECHNICAL REPORT NO. 12311 JOINING STEEL ARMOR - INTERMIX March 1979 U U * S* ’ "U .by B. . A.SCEV * U...authorized documents. O "if TECHNICAL REPORT NO. 12311 JOINING STEEL ARMOR - INTERMIX BY B. A. SCHEVO March 1979 AMS: 3197..6D.4329 TARADCOM ARMOR AND...Intermix Process ...... ........ 3 Test Procedures - Intermix Armor ........ ......... 4 Mock Hull ................. ..................... 5 Results

  19. Advanced Joining Technology

    DTIC Science & Technology


    cracking in welding of alloy 713C . Filler-metal thermal expansion characteristics and mechanical properties may influence HAZ soundness. Filler-metal...aluminum-, and titanium-base alloys ; superalloys (both nickel and cobalt base); and ceramics. The detailed review of ceramic-to-ceramic and ceramic...building. The Air Force has funded work on forming and joining of aluminum powder metal alloys , and the Army conducted a metals joining technology

  20. Universal connectors for joining stringers

    NASA Technical Reports Server (NTRS)

    Harrison, Jr., Ernest (Inventor)


    This invention is a lightweight, universal connector that joins stringers at various angles. The connectors 10 are fabricated from fiber-epoxy resin strips that wrap around stringers 30 and have ends, tabs 16 and 18, which extend in one general direction. The inside surface of the first tab 16 lies on a plane defined by the stringers being joined, and the second tab 18 is separated from the first tab 16 by a distance equal to their thickness. Stringers 30 of different shapes and sizes are joined by alternately bonding the first tab 16 of one connector between the first 16 and second 18 tabs of another connector. Tee-joints are formed by using web elements 41 and 42 which each partially wrap around a stringer 3010 and have tabs 411 and 421 which are offset, and are bonded between tabs 16 and 18 of universal connectors 109 and 1010 bonded to another stringer 309. Sharp corners are trimmed from the tabs so that a gusset area remains between the stringers for support. Acute angle through obtuse angle joints are formed by trimming those edges of the tabs which lie against the stringers. A specific application of the invention is a Walker 60, utilized by handicapped individuals, fabricated from composite materials that is 40% lighter than similar metallic structures.

  1. Duct Joining System


    Proctor, John P.


    A duct joining system for providing an air-tight seal and mechanical connection for ducts and fittings is disclosed. The duct joining system includes a flexible gasket affixed to a male end of a duct or fitting. The flexible gasket is affixed at an angle relative to normal of the male end of the duct. The female end of the other duct includes a raised bead in which the flexible gasket is seated when the ducts are properly joined. The angled flexible gasket seated in the raised bead forms an air-tight seal as well as fastens or locks the male end to the female end. Alternatively, when a flexible duct is used, a band clamp with a raised bead is clamped over the female end of the flexible duct and over the male end of a fitting to provide an air tight seal and fastened connection.

  2. Duct joining system


    Proctor, John P.; deKieffer, Robert C.


    A duct joining system for providing an air-tight seal and mechanical connection for ducts and fittings is disclosed. The duct joining system includes a flexible gasket affixed to a male end of a duct or fitting. The flexible gasket is affixed at an angle relative to normal of the male end of the duct. The female end of the other duct includes a raised bead in which the flexible gasket is seated when the ducts are properly joined. The angled flexible gasket seated in the raised bead forms an air-tight seal as well as fastens or locks the male end to the female end. Alternatively, when a flexible duct is used, a band clamp with a raised bead is clamped over the female end of the flexible duct and over the male end of a fitting to provide an air tight seal and fastened connection.

  3. On the problem of embedding picture elements in regions

    NASA Technical Reports Server (NTRS)

    Yakimovsky, Y.; Cunningham, R.


    A few new algorithms for region growing in pictures were developed. These algorithms are a step toward finding a satisfactory solution to the image segmentation problem, and in-depth understanding of the problems of nonsemantic image segmentation. The algorithms utilize a sequential decision approach for region boundaries detection. The sequential decisions are supported by a stochastic algorithm that maintains local statistics of the region near the boundaries as the region grows. A few illustrations of the algorithm's performance are included.

  4. Joining a Gym


    ... Trade Commission Consumer Information español Search form Search Vea esta página en español Joining ... rate ends.  Find Out What Other People Think Search for reviews online Do a search online to ...

  5. Come Join the Band

    ERIC Educational Resources Information Center

    Olson, Cathy Applefeld


    A growing number of students in Blue Springs, Missouri, are joining the band, drawn by a band director who emphasizes caring and inclusiveness. In the four years since Melissia Goff arrived at Blue Springs High School, the school's extensive band program has swelled. The marching band alone has gone from 100 to 185 participants. Also under Goff's…

  6. Come Join the Band

    ERIC Educational Resources Information Center

    Olson, Cathy Applefeld


    A growing number of students in Blue Springs, Missouri, are joining the band, drawn by a band director who emphasizes caring and inclusiveness. In the four years since Melissia Goff arrived at Blue Springs High School, the school's extensive band program has swelled. The marching band alone has gone from 100 to 185 participants. Also under Goff's…

  7. Trace element characteristics of lithospheric and asthenospheric mantle in the Rio Grande rift region

    SciTech Connect

    Perry, F.V.


    Trace element analyses of 10 mafic volcanic rocks from the Colorado Plateau transition zone, Colorado Plateau, Rio Grande rift, and Great Plains were obtained to characterize the trace element characteristics of asthenospheric and lithospheric mantle beneath these regions. Characterization of these mantle reservoirs using the trace element contents of basalts allows one to track the response of the lithosphere to continental rifting and extension.

  8. Quantitative spectral trace element analysis of pathogenic biominerals from residents of the Omsk region

    NASA Astrophysics Data System (ADS)

    Golovanova, O. A.; Bel'Skaya, L. V.; Berezina, N. Yu.


    We have used x-ray fluorescence elemental analysis to analyze a collection of 170 kidney stones, 89 dental calculi (tartar), and 120 gallstones from patients in the Omsk region. According to the experimental results, we observed 36 elements in the kidney stones, 14 elements in the tartar, and 13 elements in the gallstones. We used inductively coupled plasma atomic emission spectroscopy to establish the elemental composition of saliva and bile samples. Comparison of the compositions of the saliva and tartar and also comparison of the compositions of the bile and gallstones showed that biological fluids (saliva and bile) are the likely source of trace elements for pathogenic mineralizations.

  9. Spatial distribution and source identification of trace elements in topsoil from heavily industrialized region, Aliaga, Turkey.


    Kara, Melik; Dumanoğlu, Yetkin; Altıok, Hasan; Elbir, Tolga; Odabası, Mustafa; Bayram, Abdurrahman


    Topsoil samples (n = 40) were collected from a heavily industrialized region in Turkey. The region includes several scrap processing iron-steel plants with electric arc furnaces (EAFs), a petroleum refinery, a petrochemical complex, steel rolling mills, a natural gas-fired power plant, ship-breaking yards and very dense transportation activities. The region has undergone a rapid transition from an agricultural region to a heavily industrialized region in the last three decades. Collected soil samples were analyzed for 48 trace elements using inductively coupled plasma-mass spectrometry (ICP-MS). The elemental distribution pattern in the region indicated that Nemrut area with dense iron-steel production activities was a hotspot for elemental pollution. In addition to crustal elements, concentrations of anthropogenic trace elements (i.e., Fe, Zn, Pb, Mn, Cu, Cd, Cr and Mo) were very high in the area influencing many parts of the region. Elemental compositions of fugitive sources polluting the soil (i.e., paved and unpaved roads, slag piles, EAFs filter dust piles and coal piles) were also determined. The methods (enrichment factors [EFs] and the index of geoaccumulation [Igeo]) used for determination of pollution status of soil showed that Cr, Ag, Zn, As and Pb were the strongly contaminating elements for the region. Principal component analysis (PCA) clearly indicated that anthropogenic sources (steel production, refinery and petrochemical processes and traffic) were important sources in this region.

  10. Method for joining ceramic shapes


    Rabin, Barry H.


    A method for joining shapes of ceramic materials together to form a unitary ceramic structure. In the method of the invention, a mixture of two or more chemical components which will react exothermically is placed between the surfaces to be joined, and the joined shapes heated to a temperature sufficient to initiate the exothermic reaction forming a joining material which acts to bond the shapes together. Reaction materials are chosen which will react exothermically at temperatures below the degradation temperature of the materials to be joined. The process is particularly suited for joining composite materials of the silicon carbide-silicon carbide fiber type.

  11. Multicolor printing plate joining

    NASA Technical Reports Server (NTRS)

    Waters, W. J. (Inventor)


    An upper plate having ink flow channels and a lower plate having a multicolored pattern are joined. The joining is accomplished without clogging any ink flow paths. A pattern having different colored parts and apertures is formed in a lower plate. Ink flow channels each having respective ink input ports are formed in an upper plate. The ink flow channels are coated with solder mask and the bottom of the upper plate is then coated with solder. The upper and lower plates are pressed together at from 2 to 5 psi and heated to a temperature of from 295 F to 750 F or enough to melt the solder. After the plates have cooled and the pressure is released, the solder mask is removed from the interior passageways by means of a liquid solvent.

  12. Silicon Nitride Joining.

    DTIC Science & Technology


    o In Annual Report May 1984 By: Sylvia M. Johnson and David J. Rowclffe Prepared for: AIR FORCE OFFICE OF SCIENTIFIC RESEARCH (AFOSR) Department of...sechan- lcal and high temperature behavior of the Joint system were performed by Sylvia M. Johnson. Mass spectrometry studies were conducted by Robert D...NSJ 9% a Append ix A NBCNANICAL PROPERTIES OF JOINED SILICON NITIIDE By: Sylvia H. Johnson and David J. toucliffe SRI International, 333 Ravenswood

  13. SECIS elements in the coding regions of selenoprotein transcripts are functional in higher eukaryotes

    PubMed Central

    Mix, Heiko; Lobanov, Alexey V.; Gladyshev, Vadim N.


    Expression of selenocysteine (Sec)-containing proteins requires the presence of a cis-acting mRNA structure, called selenocysteine insertion sequence (SECIS) element. In bacteria, this structure is located in the coding region immediately downstream of the Sec-encoding UGA codon, whereas in eukaryotes a completely different SECIS element has evolved in the 3′-untranslated region. Here, we report that SECIS elements in the coding regions of selenoprotein mRNAs support Sec insertion in higher eukaryotes. Comprehensive computational analysis of all available viral genomes revealed a SECIS element within the ORF of a naturally occurring selenoprotein homolog of glutathione peroxidase 4 in fowlpox virus. The fowlpox SECIS element supported Sec insertion when expressed in mammalian cells as part of the coding region of viral or mammalian selenoproteins. In addition, readthrough at UGA was observed when the viral SECIS element was located upstream of the Sec codon. We also demonstrate successful de novo design of a functional SECIS element in the coding region of a mammalian selenoprotein. Our data provide evidence that the location of the SECIS element in the untranslated region is not a functional necessity but rather is an evolutionary adaptation to enable a more efficient synthesis of selenoproteins. PMID:17169995

  14. Welding and joining: A compilation

    NASA Technical Reports Server (NTRS)


    A compilation is presented of NASA-developed technology in welding and joining. Topics discussed include welding equipment, techniques in welding, general bonding, joining techniques, and clamps and holding fixtures.

  15. Trace elements and rare earth elements in wet deposition of Lijiang, Mt. Yulong region, southeastern edge of the Tibetan Plateau.


    Guo, Junming; Kang, Shichang; Huang, Jie; Sillanpää, Mika; Niu, Hewen; Sun, Xuejun; He, Yuanqing; Wang, Shijing; Tripathee, Lekhendra


    In order to investigate the compositions and wet deposition fluxes of trace elements and rare earth elements (REEs) in the precipitation of the southeastern edge of the Tibetan Plateau, 38 precipitation samples were collected from March to August in 2012 in an urban site of Lijiang city in the Mt. Yulong region. The concentrations of most trace elements and REEs were higher during the non-monsoon season than during the monsoon season, indicating that the lower concentrations of trace elements and REEs observed during monsoon had been influenced by the dilution effect of increased precipitation. The concentrations of trace elements in the precipitation of Lijiang city were slightly higher than those observed in remote sites of the Tibetan Plateau but much lower than those observed in the metropolises of China, indicating that the atmospheric environment of Lijiang city was less influenced by anthropogenic emissions, and, as a consequence, the air quality was still relatively good. However, the results of enrichment factor and principal component analysis revealed that some anthropogenic activities (e.g., the increasing traffic emissions from the rapid development of tourism) were most likely important contributors to trace elements, while the regional/local crustal sources rather than anthropogenic activities were the predominant contributors to the REEs in the wet deposition of Lijiang city. Our study was relevant not only for assessing the current status of the atmospheric environment in the Mt. Yulong region, but also for specific management actions to be implemented for the control of atmospheric inputs and the health of the environment for the future.

  16. Elemental characterization of PM1 in a heavy traffic region

    NASA Astrophysics Data System (ADS)

    Ambade, Balram

    Eight hours samples of airborne aerosols PM1 were collected during summer (August-September) and winter (October-November) form one year 2010- 2011 in a intense traffic area of Rajnandgaon city, India. Inductively coupled plasma mass spectroscopy was employed to measure heavy metals (Hg, Cd, Ni, Pb, As). Water-soluble ions (Na+, NH4 +, K+, Ca2+, Cl-, NO3 -, and SO42-) and carbonaceous mass (elemental and organic carbon) were detected using ion chromatograph and CHN analyzer, respectively. The results indicate that the composition of PM10 on intense traffic area is highly affected by automobile emissions. Based on the chemical information, positive matrix factorization (PMF) was used to identify PM sources. A total of five source types were identified, including soil dust, vehicle emissions, sea salt, industrial emissions and secondary aerosols, and their contributions were estimated using PMF. The crustal enrichment factors (EF) were calculated using Al as a reference for the trace metal species to identify the sources

  17. Joining of Beryllium

    SciTech Connect

    Goldberg, A


    A handbook dealing with the many aspects of beryllium that would be important for the users of this metal is currently being prepared. With an introduction on the applications, advantages and limitations in the use of this metal the following topics will be discussed in this handbook: physical, thermal, and nuclear properties; extraction from the ores; purification and casting of ingots; production and types of beryllium powders; consolidation methods, grades, and properties; mechanical properties with emphasis on the various factors affecting these properties; forming and mechanical working; welding, brazing, bonding, and fastening; machining; powder deposition; corrosion; health aspects; and examples of production of components. This report consists of ''Section X--Joining'' from the handbook. The prefix X is maintained here for the figures, tables and references. In this section the different methods used for joining beryllium and the advantages, disadvantages and limitations of each are presented. The methods discussed are fusion welding, brazing, solid state bonding (diffusion bonding and deformation bonding), soldering, and mechanical fastening. Since beryllium has a high affinity for oxygen and nitrogen with the formation of oxides and nitrides, considerable care must be taken on heating the metal, to protect it from the ambient atmosphere. In addition, mating surfaces must be cleaned and joints must be designed to minimize residual stresses as well as locations for stress concentration (notch effects). In joining any two metals the danger exists of having galvanic corrosion if the part is subjected to moisture or to any type of corroding environment. This becomes a problem if the less noble (anodic) metal has a significantly smaller area than the more noble (cathodic) metal since the ions (positive charges) from the anodic (corroding) metal must correspond to the number of electrons (negative charges) involved at the cathode. Beryllium is anodic to almost

  18. Elemental Abundances from Very Low Abundance HII Regions

    NASA Astrophysics Data System (ADS)

    Skillman, Evan D.; Terlevich, Roberto J.; Terlevich, Elena


    In 1987 we initiated a program to mitigate the deficiency of known low metallicity galaxies. Following our discoveries of very low abundance H II regions in nearby dwarf galaxies (Skillman et al. 1988, 1989a,b), we used the IDS on the INT to to collect spectra of dwarf galaxies in the Second Byurakan Survey (SBS) of UV excess galaxies. Our survey of over 40 SBS galaxies was completed in January 1990 and we have identified roughly one dozen very low metallicity H II galaxies. Now, with a significant sample of these galaxies, several observational programs are possible; foremost of these is the measurement of the primordial helium abundance (eg., Pagel et al. 1992). We report here on observations from March 1991 and 1992 using the ISIS spectrograph on the WHT to obtain very high quality spectra of 8 of these newly discovered metal-poor galaxies. The ISIS double spectrograph allows simultaneous observations of the blue (3600 - 5100 Angstroms) and red (6300 - 6800 Angstroms). Thus, He, N, O, Ne and S abundances can be derived with relatively small observational uncertainties. We compare our new observations with those in the literature. Our preliminary analysis indicates a slightly larger scatter in He/H at low O/H than had been seen previously. The small scatter may have been due simply to the paucity of observations at low metallicity. References: Pagel, B.E.J., Simonson, E.A., Terlevich, R.J., & Edmunds, M.G. 1992, MNRAS, 255, 325 Skillman, E.D., Kennicutt, R.C., & Hodge, P.W. 1989a, ApJ, 347, 875 Skillman, E.D., Melnick, J., Terlevich, R., & Moles, M. 1988, A&A, 196, 31 Skillman, E.D., Terlevich, R., & Melnick, J. 1989b, MNRAS, 240, 563

  19. Low temperature joining of ceramic composites


    Barton, Thomas J.; Anderson, Iver E.; Ijadi-Maghsoodi, Sina; Nosrati, Mohammad; Unal, Ozer


    A method of joining similar or dissimilar ceramic and ceramic composite materials, such as SiC continuous fiber ceramic composites, at relatively low joining temperatures uses a solventless, three component bonding agent effective to promote mechanical bond toughness and elevated temperature strength to operating temperatures of approximately 1200 degrees C. The bonding agent comprises a preceramic precursor, an aluminum bearing powder, such as aluminum alloy powder, and mixtures of aluminum metal or alloy powders with another powder, and and boron powder in selected proportions. The bonding agent is disposed as an interlayer between similar or dissimilar ceramic or cermaic composite materials to be joined and is heated in ambient air or inert atmosphere to a temperature not exceeding about 1200 degrees C. to form a strong and tough bond joint between the materials. The bond joint produced is characterized by a composite joint microstructure having relatively soft, compliant aluminum bearing particulate regions dispersed in a ceramic matrix.

  20. Low temperature joining of ceramic composites


    Barton, T.J.; Anderson, I.E.; Ijadi-Maghsoodi, S.; Nosrati, M.; Unal, O.


    A method of joining similar or dissimilar ceramic and ceramic composite materials, such as SiC continuous fiber ceramic composites, at relatively low joining temperatures uses a solventless, three component bonding agent effective to promote mechanical bond toughness and elevated temperature strength to operating temperatures of approximately 1200 degrees C. The bonding agent comprises a preceramic precursor, an aluminum bearing powder, such as aluminum alloy powder, and mixtures of aluminum metal or alloy powders with another powder, and boron powder in selected proportions. The bonding agent is disposed as an interlayer between similar or dissimilar ceramic or ceramic composite materials to be joined and is heated in ambient air or inert atmosphere to a temperature not exceeding about 1200 degrees C. to form a strong and tough bond joint between the materials. The bond joint produced is characterized by a composite joint microstructure having relatively soft, compliant aluminum bearing particulate regions dispersed in a ceramic matrix. 3 figs.

  1. Low temperature joining of ceramic composites


    Barton, Thomas J.; Anderson, Iver E.; Ijadi-Maghsoodi, Sina; Nosrati, Mohammad; Unal, Ozer


    A method of joining similar or dissimilar ceramic and ceramic composite materials, such as SiC continuous fiber ceramic composites, at relatively low joining temperatures uses a solventless, three component bonding agent effective to promote mechanical bond toughness and elevated temperature strength to operating temperatures of approximately 1200 degrees C. The bonding agent comprises a preceramic precursor, an aluminum bearing powder, such as aluminum alloy powder, and mixtures of aluminum metal or alloy powders with another powder, and and boron powder in selected proportions. The bonding agent is disposed as an interlayer between similar or dissimilar ceramic or ceramic composite materials to be joined and is heated in ambient air or inert atmosphere to a temperature not exceeding about 1200 degrees C. to form a strong and tough bond joint between the materials. The bond joint produced is characterized by a composite joint microstructure having relatively soft, compliant aluminum bearing particulate regions dispersed in a ceramic matrix.

  2. Low temperature joining of ceramic composites


    Barton, T.J.; Anderson, I.E.; Ijadi-Maghsoodi, S.; Nosrati, M.; Unal, O.


    A method of joining similar or dissimilar ceramic and ceramic composite materials, such as SiC continuous fiber ceramic composites, at relatively low joining temperatures uses a solventless, three component bonding agent effective to promote mechanical bond toughness and elevated temperature strength to operating temperatures of approximately 1200 C. The bonding agent comprises a preceramic precursor, an aluminum bearing powder, such as aluminum alloy powder, and mixtures of aluminum metal or alloy powders with another powder, and boron powder in selected proportions. The bonding agent is disposed as an interlayer between similar or dissimilar ceramic or ceramic composite materials to be joined and is heated in ambient air or inert atmosphere to a temperature not exceeding about 1200 C to form a strong and tough bond joint between the materials. The bond joint produced is characterized by a composite joint microstructure having relatively soft, compliant aluminum bearing particulate regions dispersed in a ceramic matrix. 3 figs.

  3. Low temperature joining of ceramic composites


    Barton, Thomas J.; Anderson, Iver E.; Ijadi-Maghsoodi, Sina; Nosrati, Mohammad; Unal, Ozer


    A method of joining similar or dissimilar ceramic and ceramic composite materials, such as SiC continuous fiber ceramic composites, at relatively low joining temperatures uses a solventless, three component bonding agent effective to promote mechanical bond toughness and elevated temperature strength to operating temperatures of approximately 1200 degrees C. The bonding agent comprises a preceramic precursor, an aluminum bearing powder, such as aluminum alloy powder, and mixtures of aluminum metal or alloy powders with another powder, and and boron powder in selected proportions. The bonding agent is disposed as an interlayer between similar or dissimilar ceramic or cermaic composite materials to be joined and is heated in ambient air or inert atmosphere to a temperature not exceeding about 1200 degrees C. to form a strong and tough bond joint between the materials. The bond joint produced is characterized by a composite joint microstructure having relatively soft, compliant aluminum bearing particulate regions dispersed in a ceramic matrix.

  4. To Join or Not to Join

    SciTech Connect

    Wiley, H. S.


    At about this time every year, I renew my memberships to several scientific societies, and every year I ask myself the same question: “Should I bother?” In years past, the answer was easy because being a member came with tangible benefits, such as inexpensive journals and the ability to submit abstracts to annual meetings. Nowadays, these perks don’t seem very important. Most society journals are freely available online, and the proliferation of scientific meetings has made it easier to find venues to present my current research. Thus, the volume with which I ask that question—“should I bother?”—has steadily increased. Most scientific societies were established to promote the development and acceptance of a particular field of research. Society journals and annual meetings were the primary way this was accomplished. More recently, the larger societies have expanded their roles to include lobbying for increases in research funding and providing career advice. Although these are worthwhile activities, I don’t need to belong to multiple scientific societies to support them. I almost always renew my society memberships, but I think that it is more out of a sense of tradition than need. Clearly, I am not the only scientist who is ambivalent about societies. Judging from their newsletters, many of the larger societies are struggling with stagnant or declining memberships, especially among young scientists. Although it is the youngest scientists who potentially have the most to gain from a scientific society (from networking, career advice), they are the ones who usually are most poorly served by those societies. This is because scientific societies generally cater to the status quo, not to the new and emerging elements of a field.

  5. Determination of trace elements, including regional tracers, in Rhode Island precipitation

    NASA Astrophysics Data System (ADS)

    Heaton, Roy W.; Rahn, Kenneth A.; Lowenthal, Douglas H.

    Sampling and analytical methods have been developed to determine 20-40 trace elements plus sulfate in precipitation. Samples are collected on an event basis in polyethylene bags, and are then freeze-dried and analyzed by instrumental neutron activation. Concentration data are presented for 3 years' precipitation samples from southern Rhode Island. Elemental solubility data are presented for a smaller set of samples. Elemental concentrations vary seasonally: crustal and pollutant elements have maximum concentrations in summer, and marine elements have maxima in the winter. The data were collected for use in receptor modelling studies, and the four elements most useful as tracers for regional pollution sources (Se, As, Sb, and noncrustal V) are all well determined.

  6. Geochemical baseline distribution of harmful elements in the surface soils of Campania region.

    NASA Astrophysics Data System (ADS)

    Albanese, Stefano; Lima, Annamaria; Qu, Chengkai; Cicchella, Domenico; Buccianti, Antonella; De Vivo, Benedetto


    Environmental geochemical mapping has assumed an increasing relevance and the separation of values to discriminate between anthropogenic pollution and natural (geogenic) sources has become crucial to address environmental problems affecting the quality of life of human beings. In the last decade, a number of geochemical prospecting projects, mostly focused on surface soils (topsoils), were carried out at different scales (from regional to local) across the whole Campania region (Italy) to characterize the distribution of both harmful elements and persistent organic pollutants (POP) in the environment and to generating a valuable database to serve as reference in developing geomedical studies. During the 2014, a database reporting the distribution of 53 chemical elements in 3536 topsoil samples, collected across the whole region, was completed. The geochemical data, after necessary quality controls, were georeferenced and processed in a geochemistry dedicated GIS software named GEODAS. For each considered element a complete set of maps was generated to depict both the discrete and the spatially continuous (interpolated) distribution of elemental concentrations across the region. The interpolated maps were generated using the Multifractal Inverse Distance eighted (MIDW) algorithm. Subsequently, the S-A method, also implemented in GEODAS, was applied to MIDW maps to eliminate spatially limited anomalies from the original grid and to generate the distribution patterns of geochemical baselines for each element. For a selected group of elements geochemical data were also treated by means of a Compositional Data Analysis (CoDA) aiming at investigating the regionalised structure of the data by considering the joint behaviour of several elements constituting for each sample its whole composition. A regional environmental risk assessment was run on the basis of the regional distribution of heavy metals in soil, land use types and population. The risk assessment produced a

  7. Snowpack deposition of trace elements in the Athabasca oil sands region, Canada.


    Guéguen, C; Cuss, C W; Cho, S


    The total recoverable and dissolved concentrations of 29 metals and metalloids were analyzed in snowpack collected at 91 sites in the Athabasca oil sands region, Canada in winter 2011. Based on deposition pattern from geographical centre, three groups were found: Type-1 metals (i.e. dissolved and total recoverable V; Mo) showed a significant exponential decrease with distance, suggesting oil sands development sources; Type-2 elements (e.g. Al, Sb, As, Ba, Fe, Ni, Tl, and Ti and Zn) showed exponentially decline patterns but with some local point sources; Type-3 elements (e.g. Cd, Cl, Cr, Mn, Sr and Th) deposition pattern represented local sources. A self-organizing map showed that sites with the highest elemental concentrations (Cluster I) were mainly located in the vicinity of upgrading facilities and along the north-south transects. The lowest elemental concentration sites (Cluster III) were the most distal sites or located in the western region of the study area.

  8. The RIB element in the goaG-pspF intergenic region of Escherichia coli.


    Jovanovic, G; Model, P


    The sequence (2,700 bp) between the aldH and pspF genes of Escherichia coli was determined. The pspF gene encodes a sigma54 transcriptional activator of the phage shock protein (psp) operon (pspA to pspE). Downstream of the pspF transcribed region are two open reading frames (ORFs), ordL and goaG, convergently oriented with respect to pspF. These two ORFs, together with the adjacent aldH gene, may constitute a novel operon (aldH-ordL-goaG). The goaG-pspF intergenic region contains a complex extragenic mosaic element, RIB. The structure of this RIB element, which belongs to the BIME-1 family, is Y(REP1) > 16 < Z1(REP2), where Y and Z1 are palindromic units and the central 16 bases contain an L motif with an ihf consensus sequence. DNA fragments containing the L motif of the psp RIB element effectively bind integration host factor (IHF), while the Y palindromic unit (REP1) of the same RIB element binds DNA gyrase weakly. Computer prediction of the pspF mRNA secondary structure suggested that the transcribed stem-loop structures formed by the 3'-flanking region of the pspF transcript containing the RIB element can stabilize and protect pspF mRNA. Analysis of pspF steady-state mRNA levels showed that transcripts with an intact RIB element are much more abundant than those truncated at the 3' end by deletion of either the entire RIB element or a single Z1 sequence (REP2). Thus, the pspF 3'-flanking region containing the RIB element has an important role in the stabilization of the pspF transcript.

  9. [Principal component analysis of mineral elements and fatty acids composition in flaxseed from ten different regions].


    Xing, Li; Zhao, Feng-Min; Cao, You-Fu; Wang, Mei; Mei, Shuai; Li, Shao-Ping; Cai, Zhi-Yong


    Flaxseed is a kind of biomass with high edible and medical value. It is rich in many kinds of nutrients and mineral elements. China is one of the important producing places of flaxseed. In order to explore the main characteristic constituents of mineral elements and fatty acids in flaxseed, the study of analyzing the mineral elements and fatty acid composition from 10 different regions was carried out. The contents of seventeen kinds of mineral elements in flaxseed were determined by inductively coupled plasma mass spectrometry (ICP-MS). The contents of fatty acids of the flaxseed oil obtained under the same conditions were determined by gas chromatography-mass spectrometer (GC-MS). The principal component analysis (PCA) method was applied to the study of analyzing the mineral elements and fatty acid compositions in flaxseeds. The difference in mineral elements and fatty acids of flaxseed from different regions were discussed. The main characteristic constituents of mineral elements and fatty acids were analyzed. The results showed that K, Sr, Mg, Ni, Co, Cr, Cd, Se, Zn and Cu were the main characteristic constituents of the mineral elements. At the same time, C16:0, C18:0, C18: 2, C18:3, C20:0 and C20:1 were the main characteristic constituents of the fatty acids. The combination of ICP-MS, GS-MS and PCA can reveal the characteristics and difference of mineral elements and fatty acids from different regions. The results would provide important theoretical basis for the reasonable and effective utilization of flaxseed.

  10. Regional clarkes of chemical elements in soils of southern European Russia

    NASA Astrophysics Data System (ADS)

    D'yachenko, V. V.; Matasova, I. Yu.


    Distribution patterns of 19 elements in soils of the southern part of European Russian were estimated on the basis of the analysis of more than 9000 soil samples; regional clarkes of the elements were compared with their global clarkes, The obtained data attest to the fact that southern Russia is characterized by increased concentrations of most of the microelements with a tendency for their rise in the recent decades. The great role of the aerial migration and deposition of elements results in the enrichment of the soils with technophilic elements, so that the geochemical convergence of the soils is observed. It can be concluded that natural element abundances in soils are subjected to the technogenic transformation reflecting the high rate of contamination of the biosphere.

  11. Finland to Join ESO

    NASA Astrophysics Data System (ADS)


    Finland will become the eleventh member state of the European Southern Observatory (ESO) [1]. Today, during a ceremony at the ESO Headquarters in Garching (Germany), a corresponding Agreement was signed by the Finnish Minister of Education and Science, Ms. Tuula Haatainen and the ESO Director General, Dr. Catherine Cesarsky, in the presence of other high officials from Finland and the ESO member states (see Video Clip 02/04 below). Following subsequent ratification by the Finnish Parliament of the ESO Convention and the associated protocols [2], it is foreseen that Finland will formally join ESO on July 1, 2004. Uniting European Astronomy ESO PR Photo 03/04 ESO PR Photo 03/04 Caption : Signing of the Finland-ESO Agreement on February 9, 2004, at the ESO Headquarters in Garching (Germany). At the table, the ESO Director General, Dr. Catherine Cesarsky, and the Finnish Minister of Education and Science, Ms. Tuula Haatainen . [Preview - JPEG: 400 x 499 pix - 52k] [Normal - JPEG: 800 x 997 pix - 720k] [Full Res - JPEG: 2126 x 2649 pix - 2.9M] The Finnish Minister of Education and Science, Ms. Tuula Haatainen, began her speech with these words: "On behalf of Finland, I am happy and proud that we are now joining the European Southern Observatory, one of the most successful megaprojects of European science. ESO is an excellent example of the potential of European cooperation in science, and along with the ALMA project, more and more of global cooperation as well." She also mentioned that besides science ESO offers many technological challenges and opportunities. And she added: "In Finland we will try to promote also technological and industrial cooperation with ESO, and we hope that the ESO side will help us to create good working relations. I am confident that Finland's membership in ESO will be beneficial to both sides." Dr. Catherine Cesarsky, ESO Director General, warmly welcomed the Finnish intention to join ESO. "With the accession of their country to ESO, Finnish

  12. Identification of the functional elements in the promoter region of human DNA topoisomerase IIIbeta gene.


    Cho, Young Hoon; Park, Jee Young; Han, Sang Youp; Chung, In Kwon


    In this study, we have isolated and characterized the promoter region of the human DNA topoisomerase IIIbeta (hTOP3beta) gene. The 5' RACE assay showed a short exon 1 encoding only the 35-bp untranslated region and suggested the presence of multiple transcription initiation sites. The hTOP3beta gene promoter lacks a canonical TATA box or initiation element and is moderately high in GC content. Transient expression of a luciferase reporter gene under the control of serially deleted 5'-flanking sequence identified an activator element between -141 and -119 upstream of the transcription initiation site and a second regulatory element between -91 and -71. On the basis of scanning mutations of triple nucleotides, we demonstrated that a 5'GGAACC3' element between -117 and -112 plays a critical role in the up-regulation of the basal transcription activity. Changing the 5'GGAACC3' sequence leads to markedly reduced promoter activity. Gel mobility shift assays revealed that the 5'GGAACC3' element is required for DNA binding by the transcription factor complex. These observations lead to the conclusion that the positive regulatory region including the 5'GGAACC3' core element is essential for efficient expression of the hTOP3beta gene as well as for the binding of as yet unidentified regulatory factor(s).

  13. Joining of alumina ceramics and nickel alloy

    SciTech Connect

    Ariga, Tadashi; Nitta, Yuji; Miyazawa, Yasuyuki


    Joining of alumina ceramics to nickel alloy was made using the various types of Ag-Cu-Ti brazing filler metal. Ti-containing brazing filler metal was produced by physical vapor deposition (PVD) method on the joining area of the alumina ceramics. The joinability of the brazing filler metal was estimated by its mechanical properties. And the composition and structure of the ceramic-metal bond zone in the alumina ceramics-nickel alloy joints were analyzed by SEM, EPMA and X-ray diffraction examinations. Some of brazing filler metal achieved the highest shear strength 100 MPa at room temperature. The elemental distributions of the interface between alumina ceramics and Ag-Cu-Ti brazing filler metal was shown to form the reaction layer consisting titanium oxide.

  14. Human polyomavirus JCV late leader peptide region contains important regulatory elements

    SciTech Connect

    Akan, Ilhan; Sariyer, Ilker Kudret; Biffi, Renato; Palermo, Victoria; Woolridge, Stefanie; White, Martyn K.; Amini, Shohreh |; Khalili, Kamel; Safak, Mahmut . E-mail:


    Transcription is a complex process that relies on the cooperative interaction between sequence-specific factors and the basal transcription machinery. The strength of a promoter depends on upstream or downstream cis-acting DNA elements, which bind transcription factors. In this study, we investigated whether DNA elements located downstream of the JCV late promoter, encompassing the late leader peptide region, which encodes agnoprotein, play regulatory roles in the JCV lytic cycle. For this purpose, the entire coding region of the leader peptide was deleted and the functional consequences of this deletion were analyzed. We found that viral gene expression and replication were drastically reduced. Gene expression also decreased from a leader peptide point mutant but to a lesser extent. This suggested that the leader peptide region of JCV might contain critical cis-acting DNA elements to which transcription factors bind and regulate viral gene expression and replication. We analyzed the entire coding region of the late leader peptide by a footprinting assay and identified three major regions (region I, II and III) that were protected by nuclear proteins. Further investigation of the first two protected regions by band shift assays revealed a new band that appeared in new infection cycles, suggesting that viral infection induces new factors that interact with the late leader peptide region of JCV. Analysis of the effect of the leader peptide region on the promoter activity of JCV by transfection assays demonstrated that this region has a positive and negative effect on the large T antigen (LT-Ag)-mediated activation of the viral early and late promoters, respectively. Furthermore, a partial deletion analysis of the leader peptide region encompassing the protected regions I and II demonstrated a significant down-regulation of viral gene expression and replication. More importantly, these results were similar to that obtained from a complete deletion of the late leader

  15. UNC-45/CRO1/She4p (UCS) Protein Forms Elongated Dimer and Joins Two Myosin Heads Near Their Actin Binding Region

    SciTech Connect

    H Shi; G Blobel


    UNC-45/CRO1/She4p (UCS) proteins have variously been proposed to affect the folding, stability, and ATPase activity of myosins. They are the only proteins known to interact directly with the motor domain. To gain more insight into UCS function, we determined the atomic structure of the yeast UCS protein, She4p, at 2.9 {angstrom} resolution. We found that 16 helical repeats are organized into an L-shaped superhelix with an amphipathic N-terminal helix dangling off the short arm of the L-shaped molecule. In the crystal, She4p forms a 193-{angstrom}-long, zigzag-shaped dimer through three distinct and evolutionary conserved interfaces. We have identified She4p's C-terminal region as a ligand for a 27-residue-long epitope on the myosin motor domain. Remarkably, this region consists of two adjacent, but distinct, binding epitopes localized at the nucleotide-responsive cleft between the nucleotide- and actin-filament-binding sites. One epitope is situated inside the cleft, the other outside the cleft. After ATP hydrolysis and Pi ejection, the cleft narrows at its base from 20 to 12 {angstrom} thereby occluding the inside the cleft epitope, while leaving the adjacent, outside the cleft binding epitope accessible to UCS binding. Hence, one cycle of higher and lower binding affinity would accompany one ATP hydrolysis cycle and a single step in the walk on an actin filament rope. We propose that a UCS dimer links two myosins at their motor domains and thereby functions as one of the determinants for step size of myosin on actin filaments.

  16. UNC-45/CRO1/She4p (UCS) protein forms elongated dimer and joins two myosin heads near their actin binding region

    PubMed Central

    Shi, Hang; Blobel, Günter


    UNC-45/CRO1/She4p (UCS) proteins have variously been proposed to affect the folding, stability, and ATPase activity of myosins. They are the only proteins known to interact directly with the motor domain. To gain more insight into UCS function, we determined the atomic structure of the yeast UCS protein, She4p, at 2.9 Å resolution. We found that 16 helical repeats are organized into an L-shaped superhelix with an amphipathic N-terminal helix dangling off the short arm of the L-shaped molecule. In the crystal, She4p forms a 193-Å-long, zigzag-shaped dimer through three distinct and evolutionary conserved interfaces. We have identified She4p’s C-terminal region as a ligand for a 27-residue-long epitope on the myosin motor domain. Remarkably, this region consists of two adjacent, but distinct, binding epitopes localized at the nucleotide-responsive cleft between the nucleotide- and actin-filament-binding sites. One epitope is situated inside the cleft, the other outside the cleft. After ATP hydrolysis and Pi ejection, the cleft narrows at its base from 20 to 12 Å thereby occluding the inside the cleft epitope, while leaving the adjacent, outside the cleft binding epitope accessible to UCS binding. Hence, one cycle of higher and lower binding affinity would accompany one ATP hydrolysis cycle and a single step in the walk on an actin filament rope. We propose that a UCS dimer links two myosins at their motor domains and thereby functions as one of the determinants for step size of myosin on actin filaments. PMID:21115842

  17. External Quality Assessment for KRAS Testing Is Needed: Setup of a European Program and Report of the First Joined Regional Quality Assessment Rounds

    PubMed Central

    Bellon, Ellen; Ligtenberg, Marjolijn J.L.; Tejpar, Sabine; Cox, Karen; de Hertogh, Gert; de Stricker, Karin; Edsjö, Anders; Gorgoulis, Vassilis; Höfler, Gerald; Jung, Andreas; Kotsinas, Athanassios; Laurent-Puig, Pierre; López-Ríos, Fernando; Hansen, Tine Plato; Rouleau, Etienne; Vandenberghe, Peter; van Krieken, Johan J.M.


    The use of epidermal growth factor receptor–targeting antibodies in metastatic colorectal cancer has been restricted to patients with wild-type KRAS tumors by the European Medicines Agency since 2008, based on data showing a lack of efficacy and potential harm in patients with mutant KRAS tumors. In an effort to ensure optimal, uniform, and reliable community-based KRAS testing throughout Europe, a KRAS external quality assessment (EQA) scheme was set up. The first large assessment round included 59 laboratories from eight different European countries. For each country, one regional scheme organizer prepared and distributed the samples for the participants of their own country. The samples included unstained sections of 10 invasive colorectal carcinomas with known KRAS mutation status. The samples were centrally validated by one of two reference laboratories. The laboratories were allowed to use their own preferred method for histological evaluation, DNA isolation, and mutation analysis. In this study, we analyze the setup of the KRAS scheme. We analyzed the advantages and disadvantages of the regional scheme organization by analyzing the outcome of genotyping results, analysis of tumor percentage, and written reports. We conclude that only 70% of laboratories correctly identified the KRAS mutational status in all samples. Both the false-positive and false-negative results observed negatively affect patient care. Reports of the KRAS test results often lacked essential information. We aim to further expand this program to more laboratories to provide a robust estimate of the quality of KRAS testing in Europe, and provide the basis for remedial measures and harmonization. PMID:21441573

  18. Trace Element Contamination in Tissues of Four Bird Species from the Rift Valley Region, Ethiopia.


    Yohannes, Yared Beyene; Ikenaka, Yoshinori; Nakayama, Shouta M M; Mizukawa, Hazuki; Ishizuka, Mayumi


    Concentrations of ten trace elements (Hg, As, Cd, Pb, Co, Cr, Cu, Ni, Se and Zn) were determined in different tissues (liver, kidney, muscle, heart and brain) of African sacred ibis (Threskiornis aethiopicus), Hamerkop (Scopus umbretta), marabou stork (Leptoptilos crumeniferus) and great white pelican (Pelecanus onocrotalus) inhabiting the Ethiopian Rift Valley region. There were differences in trace element patterns among the bird species. Significantly (p < 0.05) higher concentrations of Cd (5.53 µg/g dw ± 2.94) in kidney and Hg (0.75 µg/g ww ± 0.30) in liver were observed in the great white pelican compared to the other species, and liver concentrations of these two elements showed positive correlations with trophic level. Concentrations of toxic elements (As, Cd, Pb and Hg) in liver were below their respective toxicological thresholds, indicating that the data may provide baseline information for future studies.

  19. HIP Joining of Cemented Carbides

    SciTech Connect

    Derby, B.; Miodownik, M.


    Hot Isostatic Pressing (HIP) is investigated as a technique for joining the cermet WC-15% Co to itself. Encapsulation of the specimens prior to HIPing was carried out using steel encapsulation, glass encapsulation and self encapsulation. The bonds were evaluated using a four point bend method. It is shown that the glass and steel encapsulation methods have a number of inherent problems which make them inappropriate for near net shape processing. In contrast the novel self encapsulation method, described for the first time in this communication, is both simple and effective, producing joined material with bulk strength. The concept of self encapsulation is potentially widely applicable for joining composite materials.

  20. Short interspersed transposable elements (SINEs) are excluded from imprinted regions in the human genome.


    Greally, John M


    To test whether regions undergoing genomic imprinting have unique genomic characteristics, imprinted and nonimprinted human loci were compared for nucleotide and retroelement composition. Maternally and paternally expressed subgroups of imprinted genes were found to differ in terms of guanine and cytosine, CpG, and retroelement content, indicating a segregation into distinct genomic compartments. Imprinted regions have been normally permissive to L1 long interspersed transposable element retroposition during mammalian evolution but universally and significantly lack short interspersed transposable elements (SINEs). The primate-specific Alu SINEs, as well as the more ancient mammalian-wide interspersed repeat SINEs, are found at significantly low densities in imprinted regions. The latter paleogenomic signature indicates that the sequence characteristics of currently imprinted regions existed before the mammalian radiation. Transitions from imprinted to nonimprinted genomic regions in cis are characterized by a sharp inflection in SINE content, demonstrating that this genomic characteristic can help predict the presence and extent of regions undergoing imprinting. During primate evolution, SINE accumulation in imprinted regions occurred at a decreased rate compared with control loci. The constraint on SINE accumulation in imprinted regions may be mediated by an active selection process. This selection could be because of SINEs attracting and spreading methylation, as has been found at other loci. Methylation-induced silencing could lead to deleterious consequences at imprinted loci, where inactivation of one allele is already established, and expression is often essential for embryonic growth and survival.

  1. Short interspersed transposable elements (SINEs) are excluded from imprinted regions in the human genome

    PubMed Central

    Greally, John M.


    To test whether regions undergoing genomic imprinting have unique genomic characteristics, imprinted and nonimprinted human loci were compared for nucleotide and retroelement composition. Maternally and paternally expressed subgroups of imprinted genes were found to differ in terms of guanine and cytosine, CpG, and retroelement content, indicating a segregation into distinct genomic compartments. Imprinted regions have been normally permissive to L1 long interspersed transposable element retroposition during mammalian evolution but universally and significantly lack short interspersed transposable elements (SINEs). The primate-specific Alu SINEs, as well as the more ancient mammalian-wide interspersed repeat SINEs, are found at significantly low densities in imprinted regions. The latter paleogenomic signature indicates that the sequence characteristics of currently imprinted regions existed before the mammalian radiation. Transitions from imprinted to nonimprinted genomic regions in cis are characterized by a sharp inflection in SINE content, demonstrating that this genomic characteristic can help predict the presence and extent of regions undergoing imprinting. During primate evolution, SINE accumulation in imprinted regions occurred at a decreased rate compared with control loci. The constraint on SINE accumulation in imprinted regions may be mediated by an active selection process. This selection could be because of SINEs attracting and spreading methylation, as has been found at other loci. Methylation-induced silencing could lead to deleterious consequences at imprinted loci, where inactivation of one allele is already established, and expression is often essential for embryonic growth and survival. PMID:11756672

  2. Environmentally compliant adhesive joining technology

    SciTech Connect

    Tira, J.S.


    Adhesive joining offers one method of assembling products. Advantages of adhesive joining/assembly include distribution of applied forces, lighter weight, appealing appearance, etc. Selecting environmentally safe adhesive materials and accompanying processes is paramount in today`s business climate if a company wants to be environmentally conscious and stay in business. Four areas of adhesive joining (adhesive formulation and selection, surface preparation, adhesive bonding process, waste and pollution generation/cleanup/management) all need to be carefully evaluated before adhesive joining is selected for commercial as well as military products. Designing for six sigma quality must also be addressed in today`s global economy. This requires material suppliers and product manufacturers to work even closer together.

  3. Combustion Joining for Composite Fabrication

    DTIC Science & Technology


    oxidation with every landing A380 -rejected take off test C-C brakes UNCLASSIFIED Joining C-Based Materials • Difficult task – Carbon cannot be welded ...Limiting case: reactive sintering • Materials to be joined also heated to Tig (not just the reactive media) • For most systems, Tig ~ Tmp of least...thin layer of desired reaction composition between two disks of the material to be welded Preheat to the ignition temperature. After initiation, a

  4. Seasonal and spatial variations of atmospheric trace elemental deposition in the Aliaga industrial region, Turkey

    NASA Astrophysics Data System (ADS)

    Kara, Melik; Dumanoglu, Yetkin; Altiok, Hasan; Elbir, Tolga; Odabasi, Mustafa; Bayram, Abdurrahman


    Atmospheric bulk deposition (wet + dry deposition) samples (n = 40) were collected concurrently at ten sites in four seasons between June 2009 and April 2010 in the Aliaga heavily industrialized region, Turkey, containing a number of significant air pollutant sources. Analyses of trace elements were carried out using inductively coupled plasma-mass spectrometry (ICP-MS). While there were significant differences in the particulate matter (PM) deposition fluxes among the sampling sites, seasonal variations were not statistically significant (Kruskal-Wallis test, p < 0.05). Both PM deposition and elemental fluxes were increased at the sampling sites in the vicinity of industrial activities. The crustal elements (i.e., Ca, Mg) and some anthropogenic elements (such as Fe, Zn, Mn, Pb, Cu, and Cr) were high, and the highest fluxes were mostly measured in summer and winter seasons. The enrichment factor (EF) and principal component analysis (PCA) was applied to the data to determine the possible sources in the study area. High EF values were obtained for the anthropogenic elements such as Ag, Cd, Zn, Pb, Cu and Sb. The possible sources were identified as anthropogenic sources (i.e., iron-steel production) (45.4%), crustal and re-suspended dust (27.1%), marine aerosol (7.9%), and coal and wood combustion (8.2%). Thus, the iron-steel production and its related activities were found to be the main pollutant sources for this region.

  5. Spain to Join ESO

    NASA Astrophysics Data System (ADS)


    /infrared astronomical observing site in Europe and site of the Spanish 10m GranTeCan telescope now nearing completion. With the high quality of Spanish astronomical research as well as the technological competence of Spanish industry, it is only fitting that Spain should join ESO, world-leader in ground-based astronomy. Through ESO Spain will enjoy full access both to all of ESO's current facilities and to unrestricted participation in the great projects that ESO is planning for the future. Spain is already an active partner of the Atacama Large Millimeter Array (ALMA), whose construction and operations are led on behalf of Europe by ESO. ESO's Council approved the admission of Spain at its 107th meeting held in Garching on 7 and 8 December 2005. High resolution images and their captions are available on this page.

  6. Double-strand break repair based on short-homology regions is suppressed under terminal deoxynucleotidyltransferase expression, as revealed by a novel vector system for analysing DNA repair by nonhomologous end joining.


    Maezawa, So; Nakano, Saori; Kuniya, Takaaki; Koiwai, Osamu; Koiwai, Kotaro


    We have constructed a novel, nonhomologous end-joining (NHEJ) assay vector (NAV), containing mKate2, Venus and ccdB genes. Cotransfection of NAV with a construct expressing the restriction enzyme I-SceI generated a double-strand break (DSB) in NAV that excised mKate2 and ccdB. Repair of this DSB produced an intact vector that expressed Venus, a green fluorescent protein. Because cells bearing the repaired NAV lacked the ccdB gene which slows cell proliferation, the cultures were enriched in cells containing repaired DSBs. DNA sequence analysis of the DSB junctions indicated that the repair was carried out mainly by using the closest homology sequence. Use of the NAV yielded rapid results within 3 days after transfection. We then used the NAV to analyse NHEJ in cells overexpressing terminal deoxynucleotidyltransferase (TdT). The results indicated that TdT suppresses DNA repair that is based on short (one- or two-base) homology regions, to efficiently add deoxynucleotides during VDJ recombination in lymphoid cells.

  7. The Kuril Islands as a potential region for aquaculture: Trace elements in chum salmon.


    Khristoforova, Nadezhda K; Tsygankov, Vasiliy Yu; Lukyanova, Olga N; Boyarova, Margarita D


    The Kuril Islands region is considered promising for development of salmon aquaculture. There are 41 salmon fish hatcheries in the Sakhalin Island and the Kuril Islands, 34 of them are hatcheries of the chum. Therefore, concentrations of six elements (Zn, Cu, Cd, Pb, As, and Hg) were determined in chum salmon were caught in this region. The contents of toxic elements (Cd, Pb, As, and Hg) don't exceed their maximum permissible concentrations (MPC) according to the Russian sanitary standards, but concentration of Pb are closely to MPC. Increased concentrations of Pb in wild chum have the natural origin. The unusual conditions of the Western Pacific are formed under the influence such factors as volcanism and upwelling.

  8. Toxic and essential elements in butter from the Black Sea region, Turkey.


    Dervisoglu, Muhammet; Gul, Osman; Yazici, Fehmi; Guvenc, Dilek; Atmaca, Enes; Aksoy, Abdurrahman


    In this study, 88 randomly selected samples of butter produced in the Black Sea region of Turkey were purchased from different retail markets during different periods and investigated for toxic and essential elements content. Quantitative analyses of elements in the samples were performed using an inductively coupled plasma-mass spectroscopy (ICP-MS). Mean concentrations of As, Cr, Cu, Fe, Mn, Ni, Pb, Se and Zn in the butter samples were 18.93, 100.32, 384.66, 4199.1, 887.47, 168.64, 56.13, 16.34 and 384.66 µg kg(-1), respectively. Cd and Co were detected in 19 (mean content 0.29 µg kg(-1)) and 81 (mean content 3.81 µg kg(-1)) samples of 88 butter samples, respectively. However, the dietary intake of these elements by the population of the Black Sea region is currently well below the dietary reference intake (DRI) and provisional tolerable weekly intake (PTWI) levels of essential and toxic elements.

  9. Mapping overlapping functional elements embedded within the protein-coding regions of RNA viruses

    PubMed Central

    Firth, Andrew E.


    Identification of the full complement of genes and other functional elements in any virus is crucial to fully understand its molecular biology and guide the development of effective control strategies. RNA viruses have compact multifunctional genomes that frequently contain overlapping genes and non-coding functional elements embedded within protein-coding sequences. Overlapping features often escape detection because it can be difficult to disentangle the multiple roles of the constituent nucleotides via mutational analyses, while high-throughput experimental techniques are often unable to distinguish functional elements from incidental features. However, RNA viruses evolve very rapidly so that, even within a single species, substitutions rapidly accumulate at neutral or near-neutral sites providing great potential for comparative genomics to distinguish the signature of purifying selection. Computationally identified features can then be efficiently targeted for experimental analysis. Here we analyze alignments of protein-coding virus sequences to identify regions where there is a statistically significant reduction in the degree of variability at synonymous sites, a characteristic signature of overlapping functional elements. Having previously tested this technique by experimental verification of discoveries in selected viruses, we now analyze sequence alignments for ∼700 RNA virus species to identify hundreds of such regions, many of which have not been previously described. PMID:25326325

  10. Accumulation of metallic elements by Amanita muscaria from rural lowland and industrial upland regions.


    Lipka, Krzysztof; Falandysz, Jerzy


    This study was carried out on the accumulation and occurrence of Ag, Al, Ba, Ca, Cd, Co, Cu, Fe, Hg, K, Mg, Mn, Na, Rb, Sr and Zn in the mushroom Amanita muscaria and forest topsoil from two lowland sites in the Tuchola Pinewoods in the north-central region and an upland site in the Świetokrzyskie Mountains in the south-central region of Poland. Topsoil from the upland location showed Ag, Al, Ba, Ca, Cd, Co, Cu, Fe, Hg, Na and Zn at significantly higher concentration levels (pseudo-total fraction and often also the labile or extractable fraction) than at both lowland locations, where topsoil was richer in Mg, and similar in Rb. Amanita muscaria from the upland region differed from individuals collected in the lowland sites by higher concentration levels of Cd, Cu, Hg and Mn in caps. This could be related to higher concentration levels of the metallic elements in topsoil in the upland region. On other side, A. muscaria from the upland site was poorer in Co and Fe in caps, and in Ca, Co, Fe and Sr in stipes. In spite of the differences in content of the geogenic metallic elements in topsoil between the lowland and upland locations, A. muscaria from both regions was able to regulate uptake and accumulation of Ag, Al, Ba, Ca, K, Mg, Na, Rb and Zn, which were at similar concentration levels in caps but not necessarily in stipes.

  11. [Concentration distribution of metal elements in atmospheric aerosol under different weather conditions in Qingdao Coastal Region].


    Chen, Xiao-Jing; Qi, Jian-Hua; Liu, Ning; Zhang, Xiang-Yu; Shen, Heng-Qing; Liu, Ming-Xu


    To know the influence of different weather conditions on the concentration of metal elements in aerosols in the coastal region, total suspended particles (TSP) samples were collected from April to May 2012, and August 2012 to March 2013 in the Qingdao coastal region, and common trace metals were analyzed by using Inductively Coupled Plasma-Mass Spectrometry (ICP-MS) and Inductively Coupled Plasma-Atomic Emission Spectrometry (ICP-AES). The results showed that Al, Ca, Fe, Na, K and Mg were the dominant metal elements in TSP, and the sum of the six elements accounted for 94.2% of the sum of all metals. TSP and metal elements had significant monthly variations, Fe, Al, K, Ca, Mg, Zn, Ba, Mn, Ti, Sr and Li had the highest concentration in November and January, while Be, Sc, Co, Ni and Cr showed the highest value in January. Na had the highest concentration in August, November and February, and the lowest in December. Pb had the highest concentration in January and February, and the lowest in August and December. Enrichment factors indicated that Be, Co, Al, Ca, Fe, K, Mg, Mn, Sr and Ti were mainly affected by natural sources; Li, Cr, Ni, Zn, Ba and Na were affected by natural sources and part of anthropogenic sources; Pb was mainly from anthropogenic sources. Different weather conditions had great impact on TSP and metal elements concentrations, all the measured metals had the highest concentrations in smog except Ti. Compared with the sunny day, the concentration of atmospheric particulate Ti decreased, while the other elements increased by 1 to 4 times in smog. Li, Be, Cr, Ni, Al, Fe, Mg and Mn had little variation in concentration in foggy day, and the concentration of Pb and Na increased considerably. The concentration of Co, Ca and Ti reduced obviously in fog. Except for Cr, Co and Ti, the other elements increased by 1 to 3 times in haze. Most of the elements had the minimal enrichment factors in sunny day, while the other had the maximal enrichment factor in

  12. Explosive Spot Joining of Metals

    NASA Technical Reports Server (NTRS)

    Bement, Laurence J. (Inventor); Perry, Ronnie B. (Inventor)


    The invention is an apparatus and method for wire splicing using an explosive joining process. The apparatus consists of a prebend, U-shaped strap of metal that slides over prepositioned wires. A standoff means separates the wires from the strap before joining. An adhesive means holds two ribbon explosives in position centered over the U-shaped strap. A detonating means connects to the ribbon explosives. The process involves spreading strands of each wire to be joined into a flat plane. The process then requires alternating each strand in alignment to form a mesh-like arrangement with an overlapped area. The strap slides over the strands of the wires. and the standoff means is positioned between the two surfaces. The detonating means then initiates the ribbon explosives that drive the strap to accomplish a high velocity. angular collision between the mating surfaces. This collision creates surface melts and collision bonding resulting in electron-sharing linkups.

  13. Bonding and Joining Technology: a Compilation

    NASA Technical Reports Server (NTRS)


    A collection of articles concerning the methods and uses of aerospace bonding and joining techniques in industrial processes is presented. Data include methods to bond and join metal components, joining techniques for adhesive materials, and shop hints for bonding and joining a variety of other items and materials.

  14. Source origin of trace elements in PM from regional background, urban and industrial sites of Spain

    NASA Astrophysics Data System (ADS)

    Querol, X.; Viana, M.; Alastuey, A.; Amato, F.; Moreno, T.; Castillo, S.; Pey, J.; de la Rosa, J.; Sánchez de la Campa, A.; Artíñano, B.; Salvador, P.; García Dos Santos, S.; Fernández-Patier, R.; Moreno-Grau, S.; Negral, L.; Minguillón, M. C.; Monfort, E.; Gil, J. I.; Inza, A.; Ortega, L. A.; Santamaría, J. M.; Zabalza, J.

    Despite their significant role in source apportionment analysis, studies dedicated to the identification of tracer elements of emission sources of atmospheric particulate matter based on air quality data are relatively scarce. The studies describing tracer elements of specific sources currently available in the literature mostly focus on emissions from traffic or large-scale combustion processes (e.g. power plants), but not on specific industrial processes. Furthermore, marker elements are not usually determined at receptor sites, but during emission. In our study, trace element concentrations in PM 10 and PM 2.5 were determined at 33 monitoring stations in Spain throughout the period 1995-2006. Industrial emissions from different forms of metallurgy (steel, stainless steel, copper, zinc), ceramic and petrochemical industries were evaluated. Results obtained at sites with no significant industrial development allowed us to define usual concentration ranges for a number of trace elements in rural and urban background environments. At industrial and traffic hotspots, average trace metal concentrations were highest, exceeding rural background levels by even one order of magnitude in the cases of Cr, Mn, Cu, Zn, As, Sn, W, V, Ni, Cs and Pb. Steel production emissions were linked to high levels of Cr, Mn, Ni, Zn, Mo, Cd, Se and Sn (and probably Pb). Copper metallurgy areas showed high levels of As, Bi, Ga and Cu. Zinc metallurgy was characterised by high levels of Zn and Cd. Glazed ceramic production areas were linked to high levels of Zn, As, Se, Zr, Cs, Tl, Li, Co and Pb. High levels of Ni and V (in association) were tracers of petrochemical plants and/or fuel-oil combustion. At one site under the influence of heavy vessel traffic these elements could be considered tracers (although not exclusively) of shipping emissions. Levels of Zn-Ba and Cu-Sb were relatively high in urban areas when compared with industrialised regions due to tyre and brake abrasion, respectively.

  15. Requirement for both H and L chain V regions, VH and VK joining amino acids, and the unique H chain D region for the high affinity binding of an anti-phosphotyrosine antibody.


    Ruff-Jamison, S; Glenney, J R


    Sequence analysis of a panel of antibodies to phosphotyrosine revealed predominant H and L chain V regions in the immune response and a unique D segment in the Py20 mAb, which exhibits a high affinity for phosphotyrosine. In order to determine the influence of somatic diversity on the high affinity binding of Py20, H and L chain V regions were expressed in Escherichia coli as an Fv dimer. Whereas the H or L chain V regions of Py20 alone were unable to bind phosphotyrosine, the Fv binds phosphotyrosine with an affinity comparable with the intact IgG as determined by fluorescence quenching experiments (1.55 x 10(-7) M vs 1.25 x 10(-7) M, respectively). Substitution of the Py20 V regions with other IgG V regions that differed greatly in sequence abolished binding. A high affinity Py20-combining site was dependent on the presence of the unique D-D segment. Replacement of the Py20 D-D region with a single homologous D region resulted in a decrease in affinity (5.9 x 10(-7) M). Substitution of this D-D region for the D region of another anti-phosphotyrosine antibody that is known to bind phosphotyrosine weakly (1 x 10(-3) M) conferred high affinity binding. Removal of three tyrosines from the first of the two D regions was accompanied by a fivefold reduction in affinity for phosphotyrosine. In addition, changing the VK and VH junctional amino acids resulted in a complete loss of binding. Therefore, the formation of the high affinity Py20 combining site requires both a H and L chain that are similar in sequence to those of Py20 including the unique D region and the junctional amino acids.


    SciTech Connect

    Kahler, S. W.; Tylka, A. J.; Reames, D. V.


    The solar energetic (E > 1 MeV nucleon{sup -1}) particles (SEPs) observed in gradual events at 1 AU are assumed to be accelerated by coronal/interplanetary shocks from ambient thermal or suprathermal seed particles. If so, then the elemental abundances of SEPs produced in different solar wind (SW) stream types (transient, fast, and slow) might be systematically distinguished from each other. We look for these differences in SEP energy spectra and in elemental abundance ratios (including Mg/Ne and Fe/C, which compare low/high first ionization potential elements), in a large number of SEP time intervals over the past solar cycle. The SW regions are characterized by the three-component stream classification of Richardson et al. Our survey shows no significant compositional or energy spectral differences in the 5-10 MeV nucleon{sup -1} range for SEP events of different SW stream types. This result extends the earlier finding that SEP events are observed frequently in fast SW streams, although their higher Alfven and SW flow speeds should constrain SEP production by coronal mass ejection-driven shocks in those regions. We discuss the implications of our results for shock seed populations and cross-field propagation.

  17. Enrichment of short interspersed transposable elements to embryonic stem cell-specific hypomethylated gene regions.


    Muramoto, Hiroki; Yagi, Shintaro; Hirabayashi, Keiji; Sato, Shinya; Ohgane, Jun; Tanaka, Satoshi; Shiota, Kunio


    Embryonic stem cells (ESCs) have a distinctive epigenome, which includes their genome-wide DNA methylation modification status, as represented by the ESC-specific hypomethylation of tissue-dependent and differentially methylated regions (T-DMRs) of Pou5f1 and Nanog. Here, we conducted a genome-wide investigation of sequence characteristics associated with T-DMRs that were differentially methylated between ESCs and somatic cells, by focusing on transposable elements including short interspersed elements (SINEs), long interspersed elements (LINEs) and long terminal repeats (LTRs). We found that hypomethylated T-DMRs were predominantly present in SINE-rich/LINE-poor genomic loci. The enrichment for SINEs spread over 300 kb in cis and there existed SINE-rich genomic domains spreading continuously over 1 Mb, which contained multiple hypomethylated T-DMRs. The characterization of sequence information showed that the enriched SINEs were relatively CpG rich and belonged to specific subfamilies. A subset of the enriched SINEs were hypomethylated T-DMRs in ESCs at Dppa3 gene locus, although SINEs are overall methylated in both ESCs and the liver. In conclusion, we propose that SINE enrichment is the genomic property of regions harboring hypomethylated T-DMRs in ESCs, which is a novel aspect of the ESC-specific epigenomic information.

  18. Convection from Hemispherical and Conical Model Ice Roughness Elements in Stagnation Region Flows

    NASA Technical Reports Server (NTRS)

    Hughes, Michael T.; Shannon, Timothy A.; McClain, Stephen T.; Vargas, Mario; Broeren, Andy


    To improve ice accretion prediction codes, more data regarding ice roughness and its effects on convective heat transfer are required. The Vertical Icing Studies Tunnel (VIST) at NASA Glenn Research was used to model realistic ice roughness in the stagnation region of a NACA 0012 airfoil. In the VIST, a test plate representing the leading 2% chord of the airfoil was subjected to flows of 7.62 m/s (25 ft/s), 12.19 m/s (40 ft/s), and 16.76 m/s (55 ft/s). The test plate was fitted with multiple surfaces or sets of roughness panels, each with a different representation of ice roughness. The sets of roughness panels were constructed using two element distribution patterns that were created based on a laser scan of an iced airfoil acquired in the Icing Research Tunnel at NASA Glenn. For both roughness patterns, surfaces were constructed using plastic hemispherical elements, plastic conical elements, and aluminum conical elements. Infrared surface thermometry data from tests run in the VIST were used to calculate area averaged heat transfer coefficient values. The values from the roughness surfaces were compared to the smooth control surface, showing convective enhancement as high as 400% in some cases. The data gathered during this study will ultimately be used to improve the physical modeling in LEWICE or other ice accretion codes and produce predictions of in-flight ice accretion on aircraft surfaces with greater confidence.

  19. JOIN: Jülich OWS Interface

    NASA Astrophysics Data System (ADS)

    Waychal, Snehal; Schultz, Martin; Decker, Michael; Lührs, Sebastian; Schröder, Sabine; Stein, Olaf


    A large amount of global and regional environmental data is being produced from processing, analysis and model calculations. Building operational services for analysis and interpretation of such datasets is becoming more and more challenging due to different data formats, data protocols, access restrictions, large number of data sources and ever increasing data sizes. We present a key step to build an "interoperable" global data network to effectively analyze and interpret such datasets. The Jülich OWS Interface (JOIN) provides interoperable web services for modeling and emission data sets allowing for easy download and visualization of multi-dimensional atmospheric composition and emission data via the internet. The European project Monitoring of Atmospheric Composition and Climate (MACC) provides daily analyses and forecasts of the global and European atmospheric chemical composition using a comprehensive modeling and data assimilation system. These data are made available in the form of different catalogs either stored locally on the Jülich WCS server or accessed from other WCS servers from European and international partners. JOIN provides a user friendly interface for flexible selection of data sets delivered from WCS servers. The user can select a geographical region, time range and different variables from the selected dataset and then can download or visualize the data in the form of maps, vertical cross sections or time series. A special feature is the comparison of model results with observational data in near real-time (daily updates). Join uses standards like WCS, CF-netCDF and INSPIRE to test in a real-life environment. It is being implemented at present and put to regular use in the MACC project's global boundary condition service at for regional air quality models, or as a front-end to the TFHTAP multi-model experiment database at hosted at IEK-8, Forschungszentrum J

  20. Thin shells joining local cosmic string geometries

    NASA Astrophysics Data System (ADS)

    Eiroa, Ernesto F.; Rubín de Celis, Emilio; Simeone, Claudio


    In this article we present a theoretical construction of spacetimes with a thin shell that joins two different local cosmic string geometries. We study two types of global manifolds, one representing spacetimes with a thin shell surrounding a cosmic string or an empty region with Minkowski metric, and the other corresponding to wormholes which are not symmetric across the throat located at the shell. We analyze the stability of the static configurations under perturbations preserving the cylindrical symmetry. For both types of geometries we find that the static configurations can be stable for suitable values of the parameters.

  1. Joining NZP ceramics. Final report

    SciTech Connect

    Nicklas, K.D.; Richey, M.W.; Holcombe, C.E. Jr.; Santella, M.L.


    Objective was to assess techniques for joining NZP ceramics, a new family of ceramic materials that have low coefficient of thermal expansion, low thermal conductivity, and excellent thermal-shock resistance. Initially, the authors evaluated laser-beam welding over volatile fluxing agents (ferric oxide, copper oxide, boric acid, and boron nitride). They also examined other laser, arc-welding, brazing, and cold joining techniques. The NZP materials were capable of sustaining the thermal stresses associated with these joining processes without substantial cracking. Of the volatile fluxes, only the copper oxide promoted weld fusion. Efforts to accomplish fusion by laser-beam welding over copper, titanium, stainless steel, yttrium barium copper oxide, fused silica glass, and mullite/alumina were unsuccessful. Gas-tungsten arc welding accompanied by porosity, irregularities, and cracking was achieved on copper sheet sandwiched between NZP tiles. Attempts at conventional oxy-acetylene welding and torch brazing were unproductive. Silica-based oxide mixtures and copper oxide-based materials show potential for development into filler materials for furnace brazing, and phosphate-based cements show promise as a means of cold joining.

  2. Automatic connector joins structural columns

    NASA Technical Reports Server (NTRS)

    Jacquemin, G. G.


    Connector snap-locks over toothed bolthead mounted on column end, forming rigid joint that will not bend or twist. Connector is used in conventional construction to install temporary structures or as mechanical coupler. Up to nine receptacles can be clustered in one node to join up to nine converging columns.

  3. Integrated Conceptual Design of Joined-Wing SensorCraft Using Response Surface Models

    DTIC Science & Technology


    element and wind tunnel analysis of the joined- wing concept. He detailed several distinct advantages of a joined- wing configuration over a more...optimized” joined- wing and geometric perturbations of that model. Following Wolkovich, Smith, Cliff and Stonum performed calculations and wind tunnel ...location at 60 percent of the fore wing semispan. Wind tunnel data confirmed the design predictions for reduced bending moment on the forward wing , and a

  4. A paradigm for human body finite element model integration from a set of regional models.


    Thompson, A B; Gayzik, F S; Moreno, D P; Rhyne, A C; Vavalle, N A; Stitzel, J D


    Computational modeling offers versatility, scalability, and cost advantages to researchers in the trauma and injury biomechanics communities. The Global Human Body Models Consortium (GHBMC) is a group of government, industry, and academic researchers developing human body models (HBMs) that aim to become the standard tool to meet this growing research need. The objective of this study is to present the methods used to develop the average seated male occupant model (M50, weight = 78 kg, height = 175 cm) from five separately validated body region models (BRMs). BRMs include the head, neck, thorax, abdomen, and a combined pelvis and lower extremity model. Modeling domains were split at the atlanto-occipital joint, C7-T1 boundary, diaphragm, abdominal cavity (peritoneum/retroperitoneum), and the acetabulum respectively. BRM meshes are based on a custom CAD model of the seated male built from a multi-modality imaging protocol of a volunteer subject found in literature.[1] Various meshing techniques were used to integrate the full body model (FBM) including 1-D beam and discrete element connections (e.g. ligamentous structures), 2D shell nodal connections (e.g. inferior vena cava to right atrium), 3D hexahedral nodal connections (e.g. soft tissue envelope connections between regions), and contact definitions varying from tied (muscle insertions) to sliding (liver and diaphragm contact). The model was developed in a general-purpose finite element code, LS-Dyna (LTSC, Livermore, CA) R4.2.1., and consists of 1.95 million elements and 1.3 million nodes. The element breakdown by type is 41% hexahedral, 33.7% tetrahedral, 19.5% quad shells and 5% tria shell. The integration methodology presented highlights the viability of using a collaborative development paradigm for the construction of HBMs, and will be used as template for expanding the suite of GHBMC models.

  5. The Join-Up Meeting

    NASA Technical Reports Server (NTRS)

    Cameron, W. Scott


    I recently took on a new assignment and, as is my norm, I scheduled a series of one-hour, 1:1 join-up meetings with the various lead personnel on the team and their hierarchy. During one of these meetings, the person I was meeting with informed me how pleasantly surprised she was that I had scheduled this meeting as very few individuals took the time anymore to have them. I was shocked. I was taught that establishing a 1:1 relationship with the people on your team is critical to the project's success. This was the first time I'd heard anything like this about join-up meetings. I filed this feedback away. Later I was talking to my project manager-mentor, and he indicated he had finished his join-up meetings with every person in his new organization. He also indicated his predecessor had conducted few, if any, join-up meetings. Again, I was shocked. When I reflected on these two experiences, I realized a very negative trend might be emerging in our fast-paced, schedule-driven, 500-e-mail-per-day, cell-phone -ringing, 24/7 -communication, multi-tasking work lives: NO FACE TIME! Face time is what you spend with people to talk about the project you are working on, their expectations of you, your expectations of them, your hierarchy's expectations about each of you, and/or-last but certainly not least-what each of you plans on achieving during the project. A 1:1, face-to-face, join-up meeting is the only way I know to build solid trust between the project manager and the team members and their hierarchy.

  6. Inventory Survey of Geodiversity Elements in a Regional Territory: Applied to the Biga Peninsula, Northwestern Turkey

    NASA Astrophysics Data System (ADS)

    Sedat Çetiner, Ziya; Ertekin, Can; Filiz, Nurdan


    Representative geodiversity elements such as minerals, rocks, fossils, landforms, etc are key components in order to obtain data for the pursuit of geo-research. The scientific worth of geodiversity is not only related to how the geosphere works but also is connected with the conservation of earth materials for present and future geo-knowledge and geoscience milieu. Hence, the nonrenewable nature of geodiversity elements in the human time scale is taken into account for the conservation of natural diversity or simply geo-conservation. Geodiversity as an abiotic element ascribes to in situ or ex situ features both of which maintain scientific value and are used by various societies such as in teaching, tourism, etc. Ex situ elements are known as fossils, minerals and rocks found in museum collections on the other hand in situ features are known as geosites for which there are certain sub-categories such as geomorphological (landform), hydrogeological, paleontological, structural, stratigraphic sequence and lithological. Due to the plethora of geological data dispersed among geodiversity elements, the first crucial step is to execute an inventory solid study. The scope of this study is to survey geodiversity features of potential natural sites distributed the entire sectors of the Biga Peninsula of Northwestern Turkey. In the territory, there are 37 natural sites with their own data set. This data describing their boundaries and administrative features were acquired from Directorate General for Preservation of Natural Heritage. Then, site boundaries, regional published geological maps, surface hydrologic and anthropic attributes were overlaid conceiving as a single unit. Before initiating the inventory survey, the criteria scale were established for geoscience value and geo-tourism potential. In these two frames, geodiversity elements were labeled and tabulated by their representativeness, integrity, rarity, scientific knowledge, scenery, interpretative potential and

  7. Local and regional anthropogenic influence on PM 2.5 elements in Hong Kong

    NASA Astrophysics Data System (ADS)

    Hagler, G. S. W.; Bergin, M. H.; Salmon, L. G.; Yu, J. Z.; Wan, E. C. H.; Zheng, M.; Zeng, L. M.; Kiang, C. S.; Zhang, Y. H.; Schauer, J. J.

    Hong Kong's persistent unhealthy level of fine particulate matter is a current public health challenge, complicated by the city being located in the rapidly industrializing Pearl River Delta Region of China. While the sources of the region's fine particulate matter (PM 2.5) are still not well understood, this study provides new source information through ground measurements and statistical analysis of 24 elements associated with particulate matter collected on filters. Field measurements took place over 4 months (October 2002, December 2002, March 2003, and June 2003) at seven sites throughout the Pearl River Delta, with three sites located in Hong Kong and four sites in the neighboring province, Guangdong. The 4-month average element concentrations show significant variation throughout the region, with higher levels of nearly every species seen among the northern Guangdong sites in comparison to Hong Kong. The high correlation (Pearson r>0.8) and similar magnitudes of 11 species (Al, Si, S, K, Ca, Mn, Fe, Zn, Br, Rb, and Pb) at three contrasting sites in Hong Kong indicate that sources external to Hong Kong dominate the regional levels of these elements. Further correlative analysis compared Hong Kong against potential source areas in Guangdong Province (Shenzhen, Zhongshan, and Guangzhou). Moderate correlation of sulfur for all pairings of Hong Kong sites with three Guangdong sites in developed areas (average Pearson r of 0.52-0.94) supports the importance of long-distance transport impacting the region as a whole, although local sources also clearly impact observed concentrations. Varying correlative characteristics for zinc when Hong Kong sites are paired with Shenzhen (average r=0.86), Guangzhou (average r=-0.65) and Zhongshan (average r=0.45) points to a source area located south of Guangzhou and locally impacting Zhongshan. The concentration distribution and correlative characteristics of bromide point to sources located within the Pearl River Delta, but the

  8. Transposable element fragments in protein-coding regions and their contributions to human functional proteins.


    Wu, Ming; Li, Li; Sun, Zhirong


    Transposable elements (TEs) and their contributions to protein-coding regions are of particular interest. Here we searched for TE fragments in Homo sapiens at both the transcript and protein levels. We found evidence in support of TE exonization and its association with alternative splicing. Despite recent findings that long evolutionary times are required to incorporate TE into proteins, we found many functional proteins with translated TE cassettes derived from young TEs. Analyses of two Bcl-family proteins and Alu-encoded segments suggest the coding and functional potential of TE sequences.

  9. Regional left ventricular myocardial contractility and stress in a finite element model of posterobasal myocardial infarction.


    Wenk, Jonathan F; Sun, Kay; Zhang, Zhihong; Soleimani, Mehrdad; Ge, Liang; Saloner, David; Wallace, Arthur W; Ratcliffe, Mark B; Guccione, Julius M


    Recently, a noninvasive method for determining regional myocardial contractility, using an animal-specific finite element (FE) model-based optimization, was developed to study a sheep with anteroapical infarction (Sun et al., 2009, "A Computationally Efficient Formal Optimization of Regional Myocardial Contractility in a Sheep With Left Ventricular Aneurysm," ASME J. Biomech. Eng., 131(11), p. 111001). Using the methodology developed in the previous study (Sun et al., 2009, "A Computationally Efficient Formal Optimization of Regional Myocardial Contractility in a Sheep With Left Ventricular Aneurysm," ASME J. Biomech. Eng., 131(11), p. 111001), which incorporates tagged magnetic resonance images, three-dimensional myocardial strains, left ventricular (LV) volumes, and LV cardiac catheterization pressures, the regional myocardial contractility and stress distribution of a sheep with posterobasal infarction were investigated. Active material parameters in the noninfarcted border zone (BZ) myocardium adjacent to the infarct (T(max_B)), in the myocardium remote from the infarct (T(max_R)), and in the infarct (T(max_I)) were estimated by minimizing the errors between FE model-predicted and experimentally measured systolic strains and LV volumes using the previously developed optimization scheme. The optimized T(max_B) was found to be significantly depressed relative to T(max_R), while T(max_I) was found to be zero. The myofiber stress in the BZ was found to be elevated, relative to the remote region. This could cause further damage to the contracting myocytes, leading to heart failure.

  10. Geometric Laws in the Periodic Table of Elements

    NASA Astrophysics Data System (ADS)

    Khazan, Albert


    Despite many versions of the Periodic table of Elements were suggested, no one discussed the problem how the elements are connected to each other inside the Groups and Periods of the Table. As is known, the Groups are joined along the vertical (18 Groups in total), while the Periods are joined along the horizontal (7 Periods; we also suggest Period 8). Period 1 consists of 2 elements, Periods 2 and 3 : 8 elements each, Periods 4 and 5 : 18 elements each, Periods 6 and 7 : 32 elements each, and Period 8 : 37 elements. Dependency of the number of elements in each Period on its number is expressed with a broken line, described by equations of the respective linear intervals. It is shown that, according to the dependency of the common number of elements in each Period on its number, all Periods are joined into three sections, for the elements of all 18 Groups: Periods 1-3 (y=8x-6), Periods 3-5 (y=18x-36), Periods 5-7 (y=32x-106), Periods 7-8 (y=37x-141). For the elements of Group 1, we obtain a respective line. The region created by these two lines includes all elements of the Periodic Table (Khazan A. Progress in Physics, v.4, 2010, 64).

  11. [Dynamics of elements distribution in blood, depending on age, by example of Moscow Region residents].


    Yuvs, G G; Ignatova, T N; Anuchin, A M; Lebedeva, V L; Shilov, V V; Khapalyuk, A V


    Elemental status of a person determines the qualitative and quantitative content of chemical elements in the human body. This marker allows us to estimate the level of imbalance of chemical elements and therefore health risks. The method for simultaneous quantitative and qualitative analysis of 67 elements in biomaterials has been proposed. The detailed elemental analysis of whole blood samples of 1711 healthy people (age range 0-100 years) of Moscow Region has been performed. A number of patterns of age-related changes of the element status conditionally healthy people has been estimated. Na content in the samples increased with the age of the person. Presumably, this result reflects the studied populations nutrition disorders associated with immoderate consumption of table salt. The maximum content of Ca was observed in blood samples of people age range 0-20 years (66-69 mg/kg), the Ca content in the blood samples of people age range 26-85 years was significantly lower (59-62 mg/kg). The maximum decrease of Ca was detected in blood samples of people age range of 85-100 years (57-59 mg/kg). Thisreductionin the concentration of Ca, apparently due to age-related changes of Ca balance, correlates with decrease of bone mineral density and bone mass. Iron content decreased in the blood samples of people age range 10-100 years from 480 to 390 mg/kg. Selenium content in blood of people age range 0-25 years linearly increased, remained stable high in the blood of people age range 25-55 years (0,13-0,136 mg/kg) and then gradually decreased. A graph of As content dependence from a person's age is a mirror image of the graph of Se content dependence from a person's age, which is evidence of the antagonistic effects of these elements. Graphic changes in the content of rare earth elements Eu and Ho reflect the unidirectional trend of these elements accumulation. The maximum content of these elements was observed in blood samples of people age range of 25-65 years. Perhaps a

  12. Models of H II regions - Heavy element opacity, variation of temperature

    NASA Technical Reports Server (NTRS)

    Rubin, R. H.


    A detailed set of H II region models that use the same physics and self-consistent input have been computed and are used to examine where in parameter space the effects of heavy element opacity is important. The models are briefly described, and tabular data for the input parameters and resulting properties of the models are presented. It is found that the opacities of C, Ne, O, and to a lesser extent N play a vital role over a large region of parameter space, while S and Ar opacities are negligible. The variation of the average electron temperature T(e) of the models with metal abundance, density, and T(eff) is investigated. It is concluded that by far the most important determinator of T(e) is metal abundance; an almost 7000 K difference is expected over the factor of 10 change from up to down abundances.

  13. Models of H II regions - Heavy element opacity, variation of temperature

    NASA Technical Reports Server (NTRS)

    Rubin, R. H.


    A detailed set of H II region models that use the same physics and self-consistent input have been computed and are used to examine where in parameter space the effects of heavy element opacity is important. The models are briefly described, and tabular data for the input parameters and resulting properties of the models are presented. It is found that the opacities of C, Ne, O, and to a lesser extent N play a vital role over a large region of parameter space, while S and Ar opacities are negligible. The variation of the average electron temperature T(e) of the models with metal abundance, density, and T(eff) is investigated. It is concluded that by far the most important determinator of T(e) is metal abundance; an almost 7000 K difference is expected over the factor of 10 change from up to down abundances.

  14. Joining Dental Ceramic Layers With Glass

    PubMed Central

    Saied, MA; Lloyd, IK; Haller, WK; Lawn, BR


    Objective Test the hypothesis that glass-bonding of free-form veneer and core ceramic layers can produce robust interfaces, chemically durable and aesthetic in appearance and, above all, resistant to delamination. Methods Layers of independently produced porcelains (NobelRondo™ Press porcelain, Nobel BioCare AB and Sagkura Interaction porcelain, Elephant Dental) and matching alumina or zirconia core ceramics (Procera alumina, Nobel BioCare AB, BioZyram yttria stabilized tetragonal zirconia polycrystal, Cyrtina Dental) were joined with designed glasses, tailored to match thermal expansion coefficients of the components and free of toxic elements. Scanning electron microprobe analysis was used to characterize the chemistry of the joined interfaces, specifically to confirm interdiffusion of ions. Vickers indentations were used to drive controlled corner cracks into the glass interlayers to evaluate the toughness of the interfaces. Results The glass-bonded interfaces were found to have robust integrity relative to interfaces fused without glass, or those fused with a resin-based adhesive. Significance The structural integrity of the interfaces between porcelain veneers and alumina or zirconia cores is a critical factor in the longevity of all-ceramic dental crowns and fixed dental prostheses. PMID:21802131

  15. Joining dental ceramic layers with glass.


    Saied, M A; Lloyd, I K; Haller, W K; Lawn, B R


    Test the hypothesis that glass-bonding of free-form veneer and core ceramic layers can produce robust interfaces, chemically durable and esthetic in appearance and, above all, resistant to delamination. Layers of independently produced porcelains (NobelRondo™ Press porcelain, Nobel BioCare AB and Sagkura Interaction porcelain, Elephant Dental) and matching alumina or zirconia core ceramics (Procera alumina, Nobel BioCare AB, BioZyram yttria stabilized tetragonal zirconia polycrystal, Cyrtina Dental) were joined with designed glasses, tailored to match thermal expansion coefficients of the components and free of toxic elements. Scanning electron microprobe analysis was used to characterize the chemistry of the joined interfaces, specifically to confirm interdiffusion of ions. Vickers indentations were used to drive controlled corner cracks into the glass interlayers to evaluate the toughness of the interfaces. The glass-bonded interfaces were found to have robust integrity relative to interfaces fused without glass, or those fused with a resin-based adhesive. The structural integrity of the interfaces between porcelain veneers and alumina or zirconia cores is a critical factor in the longevity of all-ceramic dental crowns and fixed dental prostheses. Copyright © 2011 Academy of Dental Materials. All rights reserved.

  16. The physical structure of Magellanic Cloud H II regions. II. Elemental abundances

    NASA Astrophysics Data System (ADS)

    Vermeij, R.; van der Hulst, J. M.


    Based on a new data set of optical and infrared spectra described in Vermeij et al. (\\cite{Ronald}), we analyse the gas-phase elemental abundances of a sample of H Ii regions in the Large and Small Magellanic Cloud. The combined optical and infrared data set gives us access to all the ionization stages of astrophysically important elements such as sulfur and oxygen. We self-consistently determine the electron temperatures and densities for the \\elem{O}{+}, \\elem{S}{++} and \\elem{O}{++} ionization zones, and use these parameters in the derivation of the ionic fractions. We discuss the uncertainties on these ionic fractions. The different relations between the electron temperatures as proposed by Garnett (\\cite{Garnett}) and Thuan et al. (\\cite{Thuan}) are confronted with our results. We find our electron temperatures to be consistent with these relations, although the relation between Te,[S Iii] and Te, [O Iii] might be slightly steeper than predicted. We investigate the reliability of the Ionization Correction Factors (ICFs) used in the derivation of the full elemental abundances of sulfur and neon. We conclude that the prescription for the ICF used to derive the sulfur abundance as given by Stasińska (\\cite{Stas1}) for alpha = 3 is accurate for \\elem{O}{+}/O > 0.20. No conclusions could be drawn for neon. Avoiding the use of ICFs as much as possible, we then proceed to derive the full elemental abundances. We calculate a grid of general photoionization models to compare our results with the ``bright-line'' abundance diagnostics for oxygen (R23) and sulfur (S23(4)). The reliability of the newly proposed S234 parameter (Oey & Shields \\cite{oey}) which includes emission lines from \\elem{S}{+}, \\elem{S}{++} and \\elem{S}{+3} is checked. We find a very good agreement between the S234 models and our analysis results. Finally, we compare the heavy element-to-oxygen ratios of our sample objects to those of giant H Ii regions in a large sample of low

  17. Trace elements in particulate matter from metropolitan regions of Northern China: Sources, concentrations and size distributions.


    Pan, Yuepeng; Tian, Shili; Li, Xingru; Sun, Ying; Li, Yi; Wentworth, Gregory R; Wang, Yuesi


    Public concerns over airborne trace elements (TEs) in metropolitan areas are increasing, but long-term and multi-site observations of size-resolved aerosol TEs in China are still lacking. Here, we identify highly elevated levels of atmospheric TEs in megacities and industrial sites in a Beijing-Tianjin-Hebei urban agglomeration relative to background areas, with the annual mean values of As, Pb, Ni, Cd and Mn exceeding the acceptable limits of the World Health Organization. Despite the spatial variability in concentrations, the size distribution pattern of each trace element was quite similar across the region. Crustal elements of Al and Fe were mainly found in coarse particles (2.1-9 μm), whereas the main fraction of toxic metals, such as Cu, Zn, As, Se, Cd and Pb, was found in submicron particles (<1.1 μm). These toxic metals were enriched by over 100-fold relative to the Earth's crust. The size distributions of Na, Mg, K, Ca, V, Cr, Mn, Ni, Mo and Ba were bimodal, with two peaks at 0.43-0.65 μm and 4.7-5.8 μm. The combination of the size distribution information, principal component analysis and air mass back trajectory model offered a robust technique for distinguishing the main sources for airborne TEs, e.g., soil dust, fossil fuel combustion and industrial emissions, at different sites. In addition, higher elemental concentrations coincided with westerly flow, indicating that polluted soil and fugitive dust were major sources of TEs on the regional scale. However, the contribution of coal burning, iron industry/oil combustion and non-ferrous smelters to atmospheric metal pollution in Northern China should be given more attention. Considering that the concentrations of heavy metals associated with fine particles in the target region were significantly higher than those in other Asian sites, the implementations of strict environmental standards in China are required to reduce the amounts of these hazardous pollutants released into the atmosphere.

  18. Elemental abundances and temperatures of quiescent solar active region cores from X-ray observations

    NASA Astrophysics Data System (ADS)

    Del Zanna, G.; Mason, H. E.


    A brief review of studies of elemental abundances and emission measures in quiescent solar active region cores is presented. Hinode EUV Imaging Spectrometer (EIS) observations of strong iron spectral lines have shown sharply peaked distributions around 3 MK. EIS observations of lines emitted by a range of elements have allowed good estimates of abundances relative to iron. However, X-ray observations are required to measure the plasma emission above 3 MK and the abundances of oxygen and neon. We revisit, using up-to-date atomic data, older X-ray observations obtained by a sounding rocket and by the Solar Maximum Mission (SMM) Flat Crystal Spectrometer (FCS). We find that the Fe/O and Fe/Ne ratios are normally increased by a factor of 3.2, compared to the photospheric values. Similar results are obtained from FCS observations of six quiescent active region cores. The FCS observations also indicate that the emission measure above 3 MK has a very steep negative slope, with very little plasma observed at 5 MK or above. Appendix A is available in electronic form at

  19. Characterization of elements in the irrigated water in the Changjiang River Delta Region

    NASA Astrophysics Data System (ADS)

    Yuan, X.


    Introduction The river networks are dominated in the Changjiang River Delta Region. Most agricultural areas are irrigated with these small rivers. Rivers also receive the effluence from point and nonpoint sources. It is significative to recognize the distribution and potential hazard of irrigated water in this populated area. Study area and sampling The study area covers about 1.1×106 km2, including 16 cities from the northside of Changjiang River in Jiangsu to the middle Zhejiang. Ninety samples were collected in rural irrigated rivers. And the major cations, anions and trace elements of water were determined. Results We observe that Ca2+ is obviously higher in cations, and Cl-, SO42- higher in anions. The southern Jiangsu and coast of middle Zhejiang show high Na+, the hill area of southern Jiangsu and northern Zhejiang show high Ca2+. HCO3- is relatively uniform distributed in these areas. The high SO42- in a few samples occour in industrial spots of Jiangsu and Zhejiang. Cl- increases in waters along the coast. NO3- fluctuates and disperses in samples. Trace elements in waters are unevenly distributed. The two sides of Changjiang River have high As and Cr. Mercury is higher in southern Jiangsu than in other areas. Iron shows an enrichment in the middle Zhejiang. Compared with the background concentrations of trace elements in the lower Changjiang River, Pb, Cu and Cd are much higher in middle Zhejiang than in other areas. But Zn of most samples are lower than the background value.Cu is associated with organic matter in water. Dicussion The research area consists of hill, plain and coast, where farms, industries and houses distribute. In the hilly area of carbonate-dominated, the waters show high Ca2+ and HCO3-, rivers have high Cl- in vicinity of sea. NO3- and SO42- are strongly influenced by anthopogenic input. NO3- shows a high concentration in areas of fertilizer usage. SO42- increases in areas with a lot of industrial discharge. The distribution of trace

  20. Joining of polymer composite materials

    SciTech Connect

    Magness, F.H.


    Under ideal conditions load bearing structures would be designed without joints, thus eliminating a source of added weight, complexity and weakness. In reality the need for accessibility, repair, and inspectability, added to the size limitations imposed by the manufacturing process and transportation/assembly requirements mean that some minimum number of joints will be required in most structures. The designer generally has two methods for joining fiber composite materials, adhesive bonding and mechanical fastening. As the use of thermoplastic materials increases, a third joining technique -- welding -- will become more common. It is the purpose of this document to provide a review of the available sources pertinent to the design of joints in fiber composites. The primary emphasis is given to adhesive bonding and mechanical fastening with information coming from documentary sources as old as 1961 and as recent as 1989. A third, shorter section on composite welding is included in order to provide a relatively comprehensive treatment of the subject.

  1. A Finite Element Method to Correct Deformable Image Registration Errors in Low-Contrast Regions

    PubMed Central

    Zhong, Hualiang; Kim, Jinkoo; Li, Haisen; Nurushev, Teamour; Movsas, Benjamin; Chetty, Indrin J.


    Image-guided adaptive radiotherapy requires deformable image registration to map radiation dose back and forth between images. The purpose of this study is to develop a novel method to improve the accuracy of an intensity-based image registration algorithm in low-contrast regions. A computational framework has been developed in this study to improve the quality of the “demons” registration. For each voxel in the registration’s target image, the standard deviation of image intensity in a neighborhood of this voxel was calculated. A mask for high-contrast regions was generated based on their standard deviations. In the masked regions, a tetrahedral mesh was refined recursively so that a sufficient number of tetrahedral nodes in these regions can be selected as driving nodes. An elastic system driven by the displacements of the selected nodes was formulated using a finite element method (FEM) and implemented on the refined mesh. The displacements of these driving nodes were generated with the “demons” algorithm. The solution of the system was derived using a conjugated gradient method, and interpolated to generate a displacement vector field for the registered images. The FEM correction method was compared with the “demons” algorithm on the CT images of lung and prostate patients. The performance of the FEM correction relating to the “demons” registration was analyzed based on the physical property of their deformation maps, and quantitatively evaluated through a benchmark model developed specifically for this study. Compared to the benchmark model, the “demons” registration has the maximum error of 1.2 cm, which can be corrected by the FEM method to 0.4 cm, and the average error of the “demons” registration is reduced from 0.17 cm to 0.11 cm. For the CT images of lung and prostate patients, the deformation maps generated by the “demons” algorithm were found unrealistic at several places. In these places, the displacement differences

  2. Modelling elemental carbon at regional, urban and traffic locations in The Netherlands

    NASA Astrophysics Data System (ADS)

    Keuken, M. P.; Zandveld, P.; Jonkers, S.; Moerman, M.; Jedynska, A. D.; Verbeek, R.; Visschedijk, A.; Elshout van den, S.; Panteliadis, P.; Velders, G. J. M.


    The annual concentration of elemental carbon (EC) has been derived for The Netherlands in 2011. National emissions contribute 55% to the average EC concentration in the Netherlands. About 65% of the national contribution comes from emissions from road traffic and about 35% from other mobile sources (15%), households (14%), shipping (4%) and other combustion sources (2%). Conversion factors were established to compare different methods of EC measurement such as Black Smoke, Black Carbon and thermal analysis. The measured regional and urban background concentrations and variability were 0.5 ± 0.1 and 0.9 ± 0.1 μg EC per m3, respectively. The ratios between modelled and measured regional and urban background concentrations were 1.6 ± 0.5 and 1.8 ± 0.4, respectively. The modelled values are likely to be overestimated. The modelled and measured traffic contributions to EC concentrations near motorways and in street canyons were in the range 1.1-1.3 μg m-3 with total EC concentrations of 2.0 and 2.2 μg m-3, respectively. Our study showed that EC concentrations near intense traffic are increased with a factor 2-4 as compared to the urban and regional background, respectively. Consequently there is a similar variation in exposure and potential health effects in the population. More measurements of EC are required to improve modelling of EC concentrations in particular at urban background and near traffic locations.

  3. Joining forces, joining futures: hospice at the crossroads.


    Pietroburgo, Julie


    Faced with health-policy changes, increased competition, and limited funding, hospices must either find more efficient ways to provide end-of-life care or risk organizational demise. Increasingly, hospices are re-evaluating their organizations to stretch resources and remain viable. Prevalent restructuring options for addressing environmental pressures are integration, alliance, and collaboration with other organizations. This study examines the restructuring phenomenon by evaluating trends among nonprofit hospices in six states. The study identifies demographic characteristics predictive of organizational decisions to join forces, and it examines the dominant political and economic reasons that propel or impede restructuring decisions. In addition, the study evaluates the results of restructuring actions.

  4. Geographic patterns of elemental deposition in the Aegean region of Turkey indicated by the lichen, Xanthoria parietina (L.) Th. Fr.


    Yenisoy-Karakaş, S; Tuncel, S G


    Lichen samples from different parts of the world have been known to accumulate elements to a greater degree than higher plants, if they are exposed to these elements from the atmosphere or from water and sediments. It has been hypothesized that lichens can be used to monitor air pollution around point and area emission sources. Local variation (variation in substrate, age and morphology of lichen samples) of element concentrations would not be large enough to affect the concentration patterns in large areas. We tested this hypothesis in the Aegean region of Turkey, which is very urbanized and industrialized. No such study has been conducted before in this part of the country. A total of 234 samples of the lichen Xanthoria parietina were collected from a 51,800-km2 area. Samples were washed and analyzed by INAA and ICP-AES for 35 elements. The range of the concentrations for most of the elements on a local scale was an order of magnitude lower than for the element concentrations on a regional scale. The mean local coefficient of variance (CV) was found to be 15, providing that the local variation did not affect the concentration of elements in the sampling region. According to cluster analysis, 8 (As, Hg, Pb, Sb, Fe, Mn, Na and K) elements are indicative of important local pollution locations and their zone of impact in the region. By mapping the concentrations of eight indicative elements in lichen Xanthoria parietina of the Aegean region, it was possible to relate deposition to the existence of known sources of pollution in certain areas. Location of pollution sources such as iron-steel plants, and coal burning in the cities, industrial activity and two important coal-fired power plants generally corresponded with locations of highest element accumulations in the lichens.

  5. Elements levels in dogs from "triangle of death" and different areas of Campania region (Italy).


    Zaccaroni, Annalisa; Corteggio, Annunziata; Altamura, Gennaro; Silvi, Marina; Di Vaia, Roberto; Formigaro, Costanza; Borzacchiello, Giuseppe


    In the last twenty years, many concerns have raised in Campania region (Southern Italy) about illegal waste dumping and toxic waste and their possible adverse effects on health. Many human activities are considered to be important sources of environmental pollutants, elements among them. In this study, pet dogs were enrolled as environmental sentinels from three different areas of Campania, with a different degree of pollution, evaluating elements in blood and hair. The obtained data indicated that dogs from less polluted area were exposed to a hot spot of pollution, as only animals from one city (Sessa Aurunca) presented elements concentrations very close to toxic levels. When excluding these animals, the area proved to be the less contaminated. The present report confirm the higher degree of pollution of the most industrialized areas, and a certain concern originates from Cr, Ni and As, which are present as levels well above toxic thresholds. These data are indicative of a reduced pollution of the areas considered by Cd and Pb, but arise concern for Hg, As, Cr and Ni, which reach concentrations high enough to impact dogs and humans health, in term of acute (in the city of Sessa Aurunca) and chronic toxicity (i.e. reproduction impairment, endocrine disruption, immunosuppression). Additional studies are necessary to better define not only the precise distribution of hot spots of pollution, but also the real impact of such an exposure on the health of dogs, in term of endocrine balance and/or immune system activity. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Sensitivity-based finite element model updating using constrained optimization with a trust region algorithm

    NASA Astrophysics Data System (ADS)

    Bakir, Pelin Gundes; Reynders, Edwin; De Roeck, Guido


    The use of changes in dynamic system characteristics to detect damage has received considerable attention during the last years. Within this context, FE model updating technique, which belongs to the class of inverse problems in classical mechanics, is used to detect, locate and quantify damage. In this study, a sensitivity-based finite element (FE) model updating scheme using a trust region algorithm is developed and implemented in a complex structure. A damage scenario is applied on the structure in which the stiffness values of the beam elements close to the beam-column joints are decreased by stiffness reduction factors. A worst case and complex damage pattern is assumed such that the stiffnesses of adjacent elements are decreased by substantially different stiffness reduction factors. The objective of the model updating is to minimize the differences between the eigenfrequency and eigenmodes residuals. The updating parameters of the structure are the stiffness reduction factors. The changes of these parameters are determined iteratively by solving a nonlinear constrained optimization problem. The FE model updating algorithm is also tested in the presence of two levels of noise in simulated measurements. In all three cases, the updated MAC values are above 99% and the relative eigenfrequency differences improve substantially after model updating. In cases without noise and with moderate levels of noise; detection, localization and quantification of damage are successfully accomplished. In the case with substantially noisy measurements, detection and localization of damage are successfully realized. Damage quantification is also promising in the presence of high noise as the algorithm can still predict 18 out of 24 damage parameters relatively accurately in that case.

  7. Element concentrations in surface soils of the Coconino Plateau, Grand Canyon region, Coconino County, Arizona

    USGS Publications Warehouse

    Van Gosen, Bradley S.


    This report provides the geochemical analyses of a large set of background soils collected from the surface of the Coconino Plateau in northern Arizona. More than 700 soil samples were collected at 46 widespread areas, sampled from sites that appear unaffected by mineralization and (or) anthropogenic contamination. The soils were analyzed for 47 elements, thereby providing data on metal concentrations in soils representative of the plateau. These background concentrations can be used, for instance, for comparison to metal concentrations found in soils potentially affected by natural and anthropogenic influences on the Coconino Plateau in the Grand Canyon region of Arizona.The soil sampling survey revealed low concentrations for the metals most commonly of environmental concern, such as arsenic, cobalt, chromium, copper, mercury, manganese, molybdenum, lead, uranium, vanadium, and zinc. For example, the median concentrations of the metals in soils of the Coconino Plateau were found to be comparable to the mean values previously reported for soils of the western United States.

  8. On the Measurement of Elemental Abundance Ratios in Inner Galaxy H II Regions

    NASA Astrophysics Data System (ADS)

    Simpson, Janet P.; Rubin, Robert H.; Colgan, Sean W. J.; Erickson, Edwin F.; Haas, Michael R.


    Although variations in elemental abundance ratios in the Milky Way certainly exist, details remain uncertain, particularly in the inner Galaxy, where stars and H II regions in the Galactic plane are obscured optically. In this paper we revisit two previously studied, inner Galaxy H II regions: G333.6-0.2 and W43. We observed three new positions in G333.6-0.2 with the Kuiper Airborne Observatory and reobserved the central position with the Infrared Space Observatory's Long Wavelength Spectrometer in far-infrared lines of S++, N++, N+, and O++. We also added the N+ lines at 122 and 205 μm to the suite of lines measured in W43 by Simpson and coworkers. The measured electron densities range from ~40 to over 4000 cm-3 in a single H II region, indicating that abundance analyses must consider density variations, since the critical densities of the observed lines range from 40 to 9000 cm-3. We propose a method to handle density variations and make new estimates of the S/H and N/H abundance ratios. We find that our sulfur abundance estimates for G333.6-0.2 and W43 agree with the S/H abundance ratios expected for the S/H abundance gradient previously reported by Simpson and coworkers, with the S/H values revised to be smaller as a result of changes in collisional excitation cross sections. The estimated N/H, S/H, and N/S ratios are the most reliable because of their small corrections for unseen ionization states (<~10%). The estimated N/S ratios for the two sources are smaller than what would be calculated from the N/H and S/H ratios in our previous paper. We compute models of the two H II regions to estimate corrections for the other unseen ionization states. We find, with large uncertainties, that oxygen does not have a high abundance, with the result that the N/O ratio is as high (~0.35) as previously reported. The reasons for the uncertainty in the ionization corrections for oxygen are both the nonuniqueness of the H II region models and the sensitivity of these models

  9. Solubility of aerosol trace elements: Sources and deposition fluxes in the Canary Region

    NASA Astrophysics Data System (ADS)

    López-García, Patricia; Gelado-Caballero, María Dolores; Collado-Sánchez, Cayetano; Hernández-Brito, José Joaquín


    African dust inputs have important effects on the climate and marine biogeochemistry of the subtropical North Atlantic Ocean. The impact of dust inputs on oceanic carbon uptake and climate is dependent on total dust deposition fluxes as well as the bioavailability of nutrients and metals in the dust. In this work, the solubility of trace metals (Fe, Al, Mn, Co and Cu) and ions (Ca, sulphate, nitrate and phosphate) has been estimated from the analysis of a long-time series of 109 samples collected over a 3-year period in the Canary Islands. Solubility is primarily a function of aerosol origin, with higher solubility values corresponding to aerosols with more anthropogenic influence. Using soluble fractions of trace elements measured in this work, atmospheric deposition fluxes of soluble metals and nutrients have been calculated. Inputs of dissolved nutrients (P, N and Fe) have been estimated for the mixed layer. Considering that P is the limiting factor when ratios of these elements are compared with phytoplankton requirements, an increase of 0.58 nM of P in the mixed layer (∼150 m depth) and in a year can be estimated, which can support an increase of 0.02 μg Chla L-1 y-1. These atmospheric inputs of trace metals and nutrients appear to be significant relative to the concentrations reported in this region, especially during the summer months when the water column is more stratified and deep-water nutrient inputs are reduced.

  10. Translational repression by a miniature inverted-repeat transposable element in the 3′ untranslated region

    PubMed Central

    Shen, Jianqiang; Liu, Juhong; Xie, Kabin; Xing, Feng; Xiong, Fang; Xiao, Jinghua; Li, Xianghua; Xiong, Lizhong


    Transposable elements constitute a substantial portion of eukaryotic genomes and contribute to genomic variation, function, and evolution. Miniature inverted-repeat transposable elements (MITEs), as DNA transposons, are widely distributed in plant and animal genomes. Previous studies have suggested that retrotransposons act as translational regulators; however, it remains unknown how host mRNAs are influenced by DNA transposons. Here we report a translational repression mechanism mediated by a stowaway-like MITE (sMITE) embedded in the 3′-untranslated region (3′-UTR) of Ghd2, a member of the CCT (CONSTANS [CO], CO-LIKE and TIMING OF CAB1) gene family in rice. Ghd2 regulates important agronomic traits, including grain number, plant height and heading date. Interestingly, the translational repression of Ghd2 by the sMITE mainly relies on Dicer-like 3a (OsDCL3a). Furthermore, other MITEs in the 3′-UTRs of different rice genes exhibit a similar effect on translational repression, thus suggesting that MITEs may exert a general regulatory function at the translational level. PMID:28256530

  11. Element concentrations in cold-water gorgonians and black coral from Azores region

    NASA Astrophysics Data System (ADS)

    Raimundo, Joana; Vale, Carlos; Caetano, Miguel; Anes, Bárbara; Carreiro-Silva, Marina; Martins, Inês; Matos, Valentina de; Porteiro, Filipe M.


    Seamounts are thought to support high biodiversity and special biological communities, including corals. Corals incorporate minor and trace elements and have been suggested as possible bioindicators of their availability in the environment. Forty specimens of five gorgonian species (Alcyonacea) and a black coral (Antipatharia) were collected in 12 sites in the Azores region. Concentrations of Ca, Mg, Cr, Mn, Co, Ni, Cu, Zn, Se, Cd and Pb were determined in skeleton and attached tissue of each individual from each species. Leiopathes sp. had higher Cr, Ni, Se and Pb concentrations than the gorgonians. Enhanced Cu and Cd values were registered in Leiopathes and Acanthogorgia hirsuta. Specimens of A. hirsuta also presented elevated concentrations of Zn and Co. Linear relationships between Cd and Cu, Zn and Se point to response mechanisms in corals, possibly related to the induction of proteins enlarging the capacity to incorporate further quantities of essential elements. Results obtained in this study suggest the existence of an additional source of Cd in waters off Azores Islands associated with natural hydrothermal activities.

  12. Rare earth element components in atmospheric particulates in the Bayan Obo mine region.


    Wang, Lingqing; Liang, Tao; Zhang, Qian; Li, Kexin


    The Bayan Obo mine, located in Inner Mongolia, China, is the largest light rare earth body ever found in the world. The research for rare earth elements (REEs) enrichment in atmospheric particulates caused by mining and ore processing is fairly limited so far. In this paper, atmospheric particulates including total suspended particulate (TSP) matter and particles with an equivalent aerodynamic diameter less than 10 μm (PM10) were collected around the Bayan Obo mine region, in August 2012 and March 2013, to analyze the levels and distributions of REEs in particles. The total concentrations of REEs for TSP were 149.8 and 239.6 ng/m(3), and those for PM10 were 42.8 and 68.9 ng/m(3), in August 2012 and March 2013, respectively. Enrichment factor was calculated for all 14 REEs in the TSP and PM10 and the results indicated that REEs enrichment in atmosphere particulates was caused by anthropogenic sources and influenced by the strong wind in springtime. The spatial distribution of REEs in TSP showed a strong gradient concentration in the prevailing wind direction. REE chondrite normalized patterns of TSP and PM10 were similar and the normalized curves inclined to the right side, showing the conspicuous fractionation between the light REEs and heavy REE, which supported by the chondrite normalized concentration ratios calculated for selected elements (La(N)/Yb(N), La(N)/Sm(N), Gd(N)/Yb(N)).

  13. Multi-Region Boundary Element Analysis for Coupled Thermal-Fracturing Processes in Geomaterials

    NASA Astrophysics Data System (ADS)

    Shen, Baotang; Kim, Hyung-Mok; Park, Eui-Seob; Kim, Taek-Kon; Wuttke, Manfred W.; Rinne, Mikael; Backers, Tobias; Stephansson, Ove


    This paper describes a boundary element code development on coupled thermal-mechanical processes of rock fracture propagation. The code development was based on the fracture mechanics code FRACOD that has previously been developed by Shen and Stephansson (Int J Eng Fracture Mech 47:177-189, 1993) and FRACOM (A fracture propagation code—FRACOD, User's manual. FRACOM Ltd. 2002) and simulates complex fracture propagation in rocks governed by both tensile and shear mechanisms. For the coupled thermal-fracturing analysis, an indirect boundary element method, namely the fictitious heat source method, was implemented in FRACOD to simulate the temperature change and thermal stresses in rocks. This indirect method is particularly suitable for the thermal-fracturing coupling in FRACOD where the displacement discontinuity method is used for mechanical simulation. The coupled code was also extended to simulate multiple region problems in which rock mass, concrete linings and insulation layers with different thermal and mechanical properties were present. Both verification and application cases were presented where a point heat source in a 2D infinite medium and a pilot LNG underground cavern were solved and studied using the coupled code. Good agreement was observed between the simulation results, analytical solutions and in situ measurements which validates an applicability of the developed coupled code.

  14. On the Measurement of Elemental Abundance Ratios in Inner Galaxy H II Regions

    NASA Technical Reports Server (NTRS)

    Simpson, Janet P.; Rubin, Robert H.; Colgan, Sean W. J.; Erickson, Edwin F.; Haas, Michael R.


    Although abundance gradients in the Milky Way Galaxy certainly exist, details remain uncertain, particularly in the inner Galaxy, where stars and H II regions in the Galactic plane are obscured optically. In this paper we revisit two previously studied, inner Galaxy H II regions: G333.6-0.2 and W43. We observed three new positions in G333.6-0.2 with the Kuiper Airborne Observatory and reobserved the central position with the Infrared Space Observatory's Long Wavelength Spectrometer in far-infrared lines of S++, N++, N+, and O++. We also added the N+ lines at 122 and 205 microns to the suite of lines measured in W43 by Simpson et al.. The measured electron densities range from approx. 40 to over 4000 per cu cm in a single HII region, indicating that abundance analyses must consider density variations, since the critical densities of the observed lines range from 40 to 9000 per cu cm. We propose a method to handle density variations and make new estimates of the S/H and N/H abundance ratios. We find that our sulfur abundance estimates for G333.6-0.2 and W43 agree with the S/H abundance ratios expected for the gradient previously reported by Simpson et al., with the S/H values revised to be smaller owing to changes in collisional excitation cross sections. The estimated N/H, S/H, and N/S ratios are the most reliable because of their small corrections for unseen ionization states (< or approx. 10%). The estimated N/S ratios for the two sources are smaller than what would be calculated from the N/H and S/H ratios in our previous paper. If all low excitation H II regions had similar changes to their N/S ratios as a result of adding measurements of N+ to previous measurements of N++, there would be no or only a very small gradient in N/S. This is interesting because nitrogen is considered to be a secondary element and sulfur is a primary element in galactic chemical evolution calculations. We compute models of the two H II regions to estimate corrections for the other

  15. Field Test of a Hybrid Finite-Difference and Analytic Element Regional Model.


    Abrams, D B; Haitjema, H M; Feinstein, D T; Hunt, R J


    Regional finite-difference models often have cell sizes that are too large to sufficiently model well-stream interactions. Here, a steady-state hybrid model is applied whereby the upper layer or layers of a coarse MODFLOW model are replaced by the analytic element model GFLOW, which represents surface waters and wells as line and point sinks. The two models are coupled by transferring cell-by-cell leakage obtained from the original MODFLOW model to the bottom of the GFLOW model. A real-world test of the hybrid model approach is applied on a subdomain of an existing model of the Lake Michigan Basin. The original (coarse) MODFLOW model consists of six layers, the top four of which are aggregated into GFLOW as a single layer, while the bottom two layers remain part of MODFLOW in the hybrid model. The hybrid model and a refined "benchmark" MODFLOW model simulate similar baseflows. The hybrid and benchmark models also simulate similar baseflow reductions due to nearby pumping when the well is located within the layers represented by GFLOW. However, the benchmark model requires refinement of the model grid in the local area of interest, while the hybrid approach uses a gridless top layer and is thus unaffected by grid discretization errors. The hybrid approach is well suited to facilitate cost-effective retrofitting of existing coarse grid MODFLOW models commonly used for regional studies because it leverages the strengths of both finite-difference and analytic element methods for predictions in mildly heterogeneous systems that can be simulated with steady-state conditions.

  16. Analysis of 22 Elements in Milk, Feed, and Water of Dairy Cow, Goat, and Buffalo from Different Regions of China.


    Zhou, Xuewei; Qu, Xueyin; Zhao, Shengguo; Wang, Jiaqi; Li, Songli; Zheng, Nan


    The objectives of this study were to measure the concentrations of elements in raw milk by inductively coupled plasma-mass spectrometry (ICP-MS) and evaluate differences in element concentrations among animal species and regions of China. Furthermore, drinking water and feed samples were analyzed to investigate whether the element concentrations in raw milk are correlated with those in water and feed. All samples were analyzed by ICP-MS following microwave-assisted acid digestion. The mean recovery of the elements was 98.7 % from milk, 103.7 % from water, and 93.3 % from a certified reference material (cabbage). Principal component analysis results revealed that element concentrations differed among animal species and regions. Correlation analysis showed that trace elements Mn, Fe, Ni, Ga, Se, Sr, Cs, U in water and Co, Ni, Cu, Se, U in feed were significantly correlated with those in milk (p < 0.05). Toxic and potential toxic elements Cr, As, Cd, Tl, Pb in water and Al, Cr, As, Hg, Tl in feed were significantly correlated with those in milk (p < 0.05). Results of correlation analysis revealed that elements in water and feed might contribute to the elements in milk.

  17. Computational identification of new structured cis-regulatory elements in the 3'-untranslated region of human protein coding genes.


    Chen, Xiaowei Sylvia; Brown, Chris M


    Messenger ribonucleic acids (RNAs) contain a large number of cis-regulatory RNA elements that function in many types of post-transcriptional regulation. These cis-regulatory elements are often characterized by conserved structures and/or sequences. Although some classes are well known, given the wide range of RNA-interacting proteins in eukaryotes, it is likely that many new classes of cis-regulatory elements are yet to be discovered. An approach to this is to use computational methods that have the advantage of analysing genomic data, particularly comparative data on a large scale. In this study, a set of structural discovery algorithms was applied followed by support vector machine (SVM) classification. We trained a new classification model (CisRNA-SVM) on a set of known structured cis-regulatory elements from 3'-untranslated regions (UTRs) and successfully distinguished these and groups of cis-regulatory elements not been strained on from control genomic and shuffled sequences. The new method outperformed previous methods in classification of cis-regulatory RNA elements. This model was then used to predict new elements from cross-species conserved regions of human 3'-UTRs. Clustering of these elements identified new classes of potential cis-regulatory elements. The model, training and testing sets and novel human predictions are available at:

  18. PREFACE: Light element atom, molecule and radical behaviour in the divertor and edge plasma regions

    NASA Astrophysics Data System (ADS)

    Braams, Bastiaan J.; Chung, Hyun-Kung


    This volume of Journal of Physics: Conference Series contains contributions by participants in an International Atomic Energy Agency (IAEA) Coordinated Research Project (CRP) on "Light element atom, molecule and radical behaviour in the divertor and edge plasma regions" (in magnetic fusion devices). Light elements are the dominant impurity species in fusion experiments and in the near-wall plasma they occur as atoms or ions and also as hydrides and other molecules and molecular ions. Hydrogen (H or D, and T in a reactor) is the dominant species in fusion experiments, but all light elements He - O and Ne are of interest for various reasons. Helium is a product of the D+T fusion reaction and is introduced in experiments for transport studies. Lithium is used for wall coating and also as a beam diagnostic material. Beryllium is foreseen as a wall material for the ITER experiment and is used on the Joint European Torus (JET) experiment. Boron may be used as a coating material for the vessel walls. Carbon (graphite or carbon-fiber composite) is often used as the target material for wall regions subject to high heat load. Nitrogen may be used as a buffer gas for edge plasma cooling. Oxygen is a common impurity in experiments due to residual water vapor. Finally, neon is another choice as a buffer gas. Data for collisional and radiative processes involving these species are important for plasma modelling and for diagnostics. The participants in the CRP met 3 times over the years 2009-2013 for a research coordination meeting. Reports and presentation materials for these meetings are available through the web page on coordinated research projects of the (IAEA) Atomic and Molecular Data Unit [1]. Some of the numerical data generated in the course of the CRP is available through the ALADDIN database [2]. The IAEA takes the opportunity to thank the participants in the CRP for their dedicated efforts in the course of the CRP and for their contributions to this volume. The IAEA

  19. Transcriptional regulatory elements in the noncoding region of human papillomavirus type 6

    SciTech Connect

    Wu, Tzyy-Choou.


    The structure and function of the transcriptional regulatory region of human papillomavirus type 6 (HPV-6) has been investigated. To investigate tissue specific gene expression, a sensitive method to detect and localize HPV-6 viral DNA, mRNA and protein in plastic-embedded tissue sections of genital and respiratory tract papillomata by using in situ hybridization and immunoperoxidase assays has been developed. This method, using ultrathin sections and strand-specific {sup 3}H labeled riboprobes, offers the advantages of superior morphological preservation and detection of viral genomes at low copy number with good resolution, and the modified immunocytochemistry provides better sensitivity. The results suggest that genital tract epithelium is more permissive for HPV-6 replication than respiratory tract epithelium. To study the tissue tropism of HPV-6 at the level of regulation of viral gene expression, the polymerase chain reaction was used to isolate the noncoding region (NCR) of HPV-6 in independent isolates. Nucleotide sequence analysis of molecularly cloned DNA identified base substitutions, deletions/insertions and tandem duplications. Transcriptional regulatory elements in the NCR were assayed in recombinant plasmids containing the bacterial gene for chloramphenicol acetyl transferase.

  20. 53BP1 regulates DNA resection and the choice between classical and alternative end joining during class switch recombination.


    Bothmer, Anne; Robbiani, Davide F; Feldhahn, Niklas; Gazumyan, Anna; Nussenzweig, Andre; Nussenzweig, Michel C


    Class switch recombination (CSR) diversifies antibodies by joining highly repetitive DNA elements, which are separated by 60-200 kbp. CSR is initiated by activation-induced cytidine deaminase, an enzyme that produces multiple DNA double-strand breaks (DSBs) in switch regions. Switch regions are joined by a mechanism that requires an intact DNA damage response and classical or alternative nonhomologous end joining (A-NHEJ). Among the DNA damage response factors, 53BP1 has the most profound effect on CSR. We explore the role of 53BP1 in intrachromosomal DNA repair using I-SceI to introduce paired DSBs in the IgH locus. We find that the absence of 53BP1 results in an ataxia telangiectasia mutated-dependent increase in DNA end resection and that resected DNA is preferentially repaired by microhomology-mediated A-NHEJ. We propose that 53BP1 favors long-range CSR in part by protecting DNA ends against resection, which prevents A-NHEJ-dependent short-range rejoining of intra-switch region DSBs.

  1. Price Chopper Joins EPAs Food Recovery Challenge Program

    EPA Pesticide Factsheets

    (New York, NY - January 14, 2016) Today, U.S. Environmental Protection Agency Regional Administrator Judith A. Enck was joined by Mona Golub, Vice President of Public Relations and Consumer Services for Price Chopper and Market 32; Joseph Berman, Manager o

  2. Flexible Friction Stir Joining Technology

    SciTech Connect

    Feng, Zhili; Lim, Yong Chae; Mahoney, Murray; Sanderson, Samuel; Larsen, Steve; Steel, Russel; Fleck, Dale; Fairchild, Doug P; Wasson, Andrew J; Babb, Jon; Higgins, Paul


    Reported herein is the final report on a U.S. Department of Energy (DOE) Advanced Manufacturing Office (AMO) project with industry cost-share that was jointly carried out by Oak Ridge National Laboratory (ORNL), ExxonMobil Upstream Research Company (ExxonMobil), and MegaStir Technologies (MegaStir). The project was aimed to advance the state of the art of friction stir welding (FSW) technology, a highly energy-efficient solid-state joining process, for field deployable, on-site fabrications of large, complex and thick-sectioned structures of high-performance and high-temperature materials. The technology innovations developed herein attempted to address two fundamental shortcomings of FSW: 1) the inability for on-site welding and 2) the inability to weld thick section steels, both of which have impeded widespread use of FSW in manufacturing. Through this work, major advance has been made toward transforming FSW technology from a “specialty” process to a mainstream materials joining technology to realize its pervasive energy, environmental, and economic benefits across industry.

  3. Bio- and toxic elements in edible wild mushrooms from two regions of potentially different environmental conditions in eastern Poland.


    Brzezicha-Cirocka, Justyna; Mędyk, Małgorzata; Falandysz, Jerzy; Szefer, Piotr


    In the present study, the composition of bio-elements (K, Na, Mg, Ca, Fe, Cu, Zn) and toxic elements (Ag, Cd) in seven edible mushrooms from the rural and woodland region of Morąg (north-eastern Poland) and the rural and industrial region of the Tarnobrzeska Upland (south-eastern Poland) were investigated using a validated method. The species examined were Boletus edulis, Cantharellus cibarius, Leccinum aurantiacum, Leccinum versipelle, Lycoperdon perlatum, Suillus luteus, and Xerocomus subtomentosus. Final determination was carried out by flame atomic absorption spectroscopy (FAAS) after microwave-assisted decomposition of sample matrices with solutions of concentrated nitric acid in the pressurized polytetrafluoroethylene vessels. The contents of the alkali elements and alkali earth elements were determined in the species surveyed. The alkali elements, earth alkali elements, and transition metals (Ag, Cu, Zn, Fe, and Mn) were at typical concentrations as was determined for the same or similar species elsewhere in Poland and Europe. The results may suggest a lack of local and regional emissions of those metallic elements from industrialization of some sites in the Tarnobrzeska Plain. Cadmium was at elevated concentrations in L. versipelle from the Tarnobrzeska Plain but the reason-pollution or geogenic source-was unknown, while it was at typical concentrations in other species.

  4. Spatial variation in total element concentration in soil within the Northern Great Plains coal region, and regional soil chemistry in Bighorn and Wind River basins, Wyoming and Montana

    USGS Publications Warehouse

    Severson, R.C.; Tidball, R.R.


    PART A: To objectively determine the changes in chemical character of an area subjected to mining and reclamation, prior information is needed. This study represents a broadscale inventory of total chemical composition of the surficial materials of the Northern Great Plains coal region (western North and South Dakota, eastern Montana, and northeastern Wyoming); data are given for 41 elements in A and C soil horizons. An unbalanced, nested, analysis-of-variance design was used to quantify variation in total content of elements between glaciated and unglaciated terrains, for four increasingly smaller geographic scales, and to quantify variation due to sample preparation and analysis. From this statistical study, reliable maps on a regional basis (>100 km) were prepared for C, K, and Rb in A and C soil horizons; for N a, Si, Th, D, and Zn in A-horizon soil; and for As, Ca, Ge, and Mg in C-horizon soil. The distribution of variance components for the remaining 29 elements did not permit the construction of reliable maps. Therefore, a baseline value for each of these elements is given as a measure of the total element concentration in the soils of the Northern Great Plains coal region. The baseline is expressed as the 95-percent range in concentration to be expected in samples of natural soils. PART B: A reconnaissance study of total concentrations of 38 elements in samples of soils (0-40 cm deep, composite) from the Bighorn and Wind River Basins of Montana and Wyoming indicates that the geographic variation for most elements occurs locally (5 km or less). However, in the Bighorn Basin, Zn exhibits significant regional variation (between geologic units); and in the Wind River Basin, AI, Cr, K, Mn, Mo, Ni, U, and V exhibit similar variation. For the remaining elements, the lack of regional variation suggests that a single summary statistic can be used to estimate a baseline value that reflects the range in concentration to be expected in samples of soils in each basin

  5. The nonlinear finite element analysis and plantar pressure measurement for various shoe soles in heel region.


    Shiang, T Y


    The most influential factor contributing to foot and shoe comfort is underfoot cushioning. The shock absorbing ability of footwear in the heel area is of particular importance in reducing the impact load during athletic activities and in therapeutic footwear prescribed for heel pain. Furthermore, foot care for foot problem patients is an important part of treatment and educational programs. Therefore, a well-designed sport shoe which can provide comfort and protection is essential. In order to design a functional shoe, biomechanics and other new technologies should be considered, and the design process should be examined in the biomechanics laboratory over and over. The design process requires too much time and effort since the entire experimental and test work can only be done after the prototype is manufactured. Therefore, this study tried to introduce the Finite Element Method (FEM) into the shoe design process by building a three-dimensional FE model with various shoe soles and loading conditions. The material properties of shoe materials were tested using an Instron Testing Machine. An in-shoe pressure insole was used to measure the plantar pressure in different ambulation conditions with various shoe constructions. The subject for this study was a healthy young male without any foot problem. The average plantar pressures obtained from approximately 50 steps in the heel region for each of the various conditions were collected. The results showed that the mean peak plantar pressure of the running situation was significantly higher than that of the walking situation as predicted, and that the insole could provide better cushioning compared to the other shoe constructions. The stress strain relationship for shoe materials was approximated better by a second-order nonlinear curve according to the Instron test. The results of the finite element method suggested that only the second-order nonlinear stress strain curve could correctly describe the shoe material

  6. [Potential Ecological Suitability Regionalization Analysis of Angelica sinensis Based on GIS and Fuzzy Matter Element Model].


    Shang, Zhong-hui; Wei, Hai-yan; Gu, Wei; Mao, Ya-juan; Zhu, Li-nan; Sang, Man-jie


    To study the potential ecological suitability regionalization of Angelica sinensis, for protecting wild resources and selecting cultivation location and designing rational production layout. Based on fuzzy matter element model, the relationship of fuzzy membership function between ferulic acid content and 14 ecological factors, including climate, topography and soil,were established. Then information entropy theory was used to determine the relative importance of each environmental factor, and thus to determine the most limiting habitat criteria. Finally, the probable spatial distribution of Angelica sinensis across ten provinces in Western China was determined based on GIS spatial analysis of habitat conditions. Meanwhile, the optimal index range of ecological factors was quantified. It was showed that the percentage of moderately and highly suitable habitats for Angelica sinensis in the study area was 9. 64%, its area was 306,768. 01 km2. The moderately and highly suitable habitats were mainly located in the southeast of Gansu ind Tibet,the north of Sichuan and the northwest of Yunnan. The results also showed that six dominant ecological factors controlling the distribution of Angelica sinensis. These six dominant features were as follows: (1) mean temperature of wettest quarter, (2) altitude, (3) precipitation of growth, (4) annual relative humidity, (5) average temperature of growth period, and (6) annual )recipitation. The habitat suitability assessment model based on GIS and fuzzy matter element model theory can accurately valuate the habitat suitability of Angelica sinensis, quantify the area of suitable habitat and analyze the spatial distribution. This informaion is of value to provide insight for choosing the most suitable cultivation sites,as well as the habitat protection zones.

  7. Rare earth element components in atmospheric particulates in the Bayan Obo mine region

    SciTech Connect

    Wang, Lingqing Liang, Tao Zhang, Qian; Li, Kexin


    The Bayan Obo mine, located in Inner Mongolia, China, is the largest light rare earth body ever found in the world. The research for rare earth elements (REEs) enrichment in atmospheric particulates caused by mining and ore processing is fairly limited so far. In this paper, atmospheric particulates including total suspended particulate (TSP) matter and particles with an equivalent aerodynamic diameter less than 10 μm (PM{sub 10}) were collected around the Bayan Obo mine region, in August 2012 and March 2013, to analyze the levels and distributions of REEs in particles. The total concentrations of REEs for TSP were 149.8 and 239.6 ng/m{sup 3}, and those for PM{sub 10} were 42.8 and 68.9 ng/m{sup 3}, in August 2012 and March 2013, respectively. Enrichment factor was calculated for all 14 REEs in the TSP and PM{sub 10} and the results indicated that REEs enrichment in atmosphere particulates was caused by anthropogenic sources and influenced by the strong wind in springtime. The spatial distribution of REEs in TSP showed a strong gradient concentration in the prevailing wind direction. REE chondrite normalized patterns of TSP and PM{sub 10} were similar and the normalized curves inclined to the right side, showing the conspicuous fractionation between the light REEs and heavy REE, which supported by the chondrite normalized concentration ratios calculated for selected elements (La{sub N}/Yb{sub N}, La{sub N}/Sm{sub N}, Gd{sub N}/Yb{sub N}). - Highlights: • TSP and PM{sub 10} samples were collected to analyze the levels and distributions of REE. • Enrichment factors indicated that REE enrichment was caused by anthropogenic sources. • The distribution of REEs showed a strong gradient in the prevailing wind direction. • Obvious fractionation between LREEs and HREEs is observed in atmospheric particulates.

  8. The presence of vanadium in groundwater of southeastern extreme the pampean region Argentina Relationship with other chemical elements.


    Fiorentino, Carmen E; Paoloni, Juan D; Sequeira, Mario E; Arosteguy, Pedro


    Changes in the quality of groundwater resources are related to the presence and concentration of contaminants, especially trace elements such as arsenic, boron, fluoride and vanadium. Vanadium is a rare element naturally abundant, generally found in combination with other elements. Vanadium pentoxide is known to have aneugenic effects. Thus, a study was carried out to assess the presence of vanadium in the groundwater of the southeastern pampean region of Argentina, which constitutes the main water supply for the local population. Statistical and correlational analyses were applied to identify possible interrelationships between vanadium and another chemical elements. Vanadium was found in all groundwater samples. The minimum and maximum vanadium concentrations found were 0.05 mg/l and 2.47 mg/l, respectively. Vanadium is significantly correlated with other trace elements such as arsenic, fluoride and boron. The interrelationship between vanadium and the presence of volcanic glass in sediments is not significant as expected.

  9. A methodology for elemental and organic carbon emission inventory and results for Lombardy region, Italy.


    Caserini, Stefano; Galante, Silvia; Ozgen, Senem; Cucco, Sara; de Gregorio, Katia; Moretti, Marco


    This paper presents a methodology and its application for the compilation of elemental carbon (EC) and organic carbon (OC) emission inventories. The methodology consists of the estimation of EC and OC emissions from available total suspended particulate matter (TSP) emission inventory data using EC and OC abundances in TSP derived from an extensive literature review, by taking into account the local technological context. In particular, the method is applied to the 2008 emissions of Lombardy region, Italy, considering 148 different activities and 30 types of fuels, typical of Western Europe. The abundances estimated in this study may provide a useful basis to assess the emissions also in other emission contexts with similar prevailing sources and technologies. The dominant sources of EC and OC in Lombardy are diesel vehicles for EC and the residential wood combustion (RWC) for OC which together account for about 83% of the total emissions of both pollutants. The EC and OC emissions from industrial processes and other fuel (e.g., gasoline, kerosene and LPG) combustion are significantly lower, while non-combustion sources give an almost negligible contribution. Total EC+OC contribution to regional greenhouse gas emissions is positive for every sector assuming whichever GWP100 value within the range proposed in literature. An uncertainty assessment is performed through a Monte Carlo simulation for RWC, showing a large uncertainty range (280% of the mean value for EC and 70% for OC), whereas for road transport a qualitative analysis identified a narrower range of uncertainty. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Join-Graph Propagation Algorithms

    PubMed Central

    Mateescu, Robert; Kask, Kalev; Gogate, Vibhav; Dechter, Rina


    The paper investigates parameterized approximate message-passing schemes that are based on bounded inference and are inspired by Pearl's belief propagation algorithm (BP). We start with the bounded inference mini-clustering algorithm and then move to the iterative scheme called Iterative Join-Graph Propagation (IJGP), that combines both iteration and bounded inference. Algorithm IJGP belongs to the class of Generalized Belief Propagation algorithms, a framework that allowed connections with approximate algorithms from statistical physics and is shown empirically to surpass the performance of mini-clustering and belief propagation, as well as a number of other state-of-the-art algorithms on several classes of networks. We also provide insight into the accuracy of iterative BP and IJGP by relating these algorithms to well known classes of constraint propagation schemes. PMID:20740057

  11. Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element.

    PubMed Central

    Frayne, E G; Kellems, R E


    Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element. Images PMID:3714472

  12. Eco-environmental implications of elemental and carbon isotope distributions in ornithogenic sediments from the Ross Sea region, Antarctica

    NASA Astrophysics Data System (ADS)

    Liu, Xiaodong; Nie, Yaguang; Sun, Liguang; Emslie, Steven D.


    Seabirds have substantial influence on geochemical circulation of elements, serving as a link for substance exchange between their foraging area and colonies. In this study, we investigated the elemental and carbon isotopic composition of five penguin-affected sediment profiles excavated from Ross Island and Beaufort Island in the Ross Sea region, Antarctica. Among the three main constituents of the sediments (including weathered bedrock, guano and algae), guano was the main source of organic matter and nutrients, causing selective enrichment of several elements in each of the sediment profiles. In the 22 measured elements, As, Cd, Cu, P, S, Se and Zn were identified as penguin bio-elements in the Ross Sea region through statistical analysis and comparison with local end-member environmental media such as weathered bedrock, fresh guano and fresh algae. Carbon isotopic composition in the ornithogenic sediments showed a mixing feature of guano and algae. Using a two-member isotope mixing equation, we were able to reconstruct the historical change of guano input and algal bio-mass. Compared with research in other parts of Antarctic, Arctic, and South China Sea, we found apparent overlap of avian bio-elements including As, Cd, Cu, P, Se, and Zn. Information on the composition and behavior of bio-elements in seabird guano on a global scale, and the role that bio-vectors play in the geochemical circulation between land and sea, will facilitate future research on avian ecology and paleoclimatic reconstruction.

  13. Application of the finite element groundwater model FEWA to three regional aquifers

    SciTech Connect

    Wong, K.F.V.; Yeh, G.T.


    This report documents the calibration with field data and predictive application of a finite element model of water through aquifers (FEWA). FEWA was described in a report written by G.T. Yeh and D.D. Huff in 1983. The model was first compared with the United States Geological Survey (USGS) two-dimensional model and found superior in treating anisotropic media when the coordinates cannot be made to coincide with the principal directions of hydraulic conductivities. In addition, there was no necessity to define nodal points outside the region, as required by the USGS model. FEWA was next calibrated with measured potentiometric surfaces from the Love Canal area in New York and the Conesville area in Ohio. There were satisfactory matches between computed results and available field data. The calibration and predictive runs of FEWA were then accomplished with the Hialeah-Preston well field data over the Biscayne aquifer in south Florida. The calibration run yielded two values of hydraulic conductivity in the area, and the predictive run gave results that matched well with available data. 18 refs., 28 figs.

  14. Fine-scale map of encyclopedia of DNA elements regions in the Korean population.


    Yoo, Yeon-Kyeong; Ke, Xiayi; Hong, Sungwoo; Jang, Hye-Yoon; Park, Kyunghee; Kim, Sook; Ahn, TaeJin; Lee, Yeun-Du; Song, Okryeol; Rho, Na-Young; Lee, Moon Sue; Lee, Yeon-Su; Kim, Jaeheup; Kim, Young J; Yang, Jun-Mo; Song, Kyuyoung; Kimm, Kyuchan; Weir, Bruce; Cardon, Lon R; Lee, Jong-Eun; Hwang, Jung-Joo


    The International HapMap Project aims to generate detailed human genome variation maps by densely genotyping single-nucleotide polymorphisms (SNPs) in CEPH, Chinese, Japanese, and Yoruba samples. This will undoubtedly become an important facility for genetic studies of diseases and complex traits in the four populations. To address how the genetic information contained in such variation maps is transferable to other populations, the Korean government, industries, and academics have launched the Korean HapMap project to genotype high-density Encyclopedia of DNA Elements (ENCODE) regions in 90 Korean individuals. Here we show that the LD pattern, block structure, haplotype diversity, and recombination rate are highly concordant between Korean and the two HapMap Asian samples, particularly Japanese. The availability of information from both Chinese and Japanese samples helps to predict more accurately the possible performance of HapMap markers in Korean disease-gene studies. Tagging SNPs selected from the two HapMap Asian maps, especially the Japanese map, were shown to be very effective for Korean samples. These results demonstrate that the HapMap variation maps are robust in related populations and will serve as an important resource for the studies of the Korean population in particular.

  15. Discrete elements within the SV40 enhancer region display different cell-specific enhancer activities.

    PubMed Central

    Ondek, B; Shepard, A; Herr, W


    The SV40 enhancer contains three genetically defined elements, called A, B and C, that can functionally compensate for one another. By using short, synthetic DNA oligonucleotides, we show that each of these elements can act autonomously as an enhancer when present as multiple tandem copies. Analysis of a progressive series of B element oligomers shows a single element is ineffective as an enhancer and that the activity of two or more elements increases with copy number. Assay in five different cell lines of two separate enhancers containing six tandem copies of either the B or C element shows that these elements possess different cell-specific activities. Parallel oligomer enhancer constructs containing closely spaced double point mutations display no enhancer activity in any of the cell lines tested, indicating that these elements represent single units of enhancer function. These elements contain either a 'core' or 'octamer' consensus sequence but these consensus sequences alone are not sufficient for enhancer activity. The different cell-specific activities of the B and C elements are consistent with functional interactions with different trans-acting factors. We discuss how tandem duplication of such dissimilar elements, as in the wild-type SV40 72-bp repeats, can serve to expand the conditions under which an enhancer can function. Images Fig. 2. Fig. 3. Fig. 4. PMID:3036487

  16. Melting temperature highlights functionally important RNA structure and sequence elements in yeast mRNA coding regions.


    Qi, Fei; Frishman, Dmitrij


    Secondary structure elements in the coding regions of mRNAs play an important role in gene expression and regulation, but distinguishing functional from non-functional structures remains challenging. Here we investigate the dependence of sequence-structure relationships in the coding regions on temperature based on the recent PARTE data by Wan et al. Our main finding is that the regions with high and low thermostability (high Tm and low Tm regions) are under evolutionary pressure to preserve RNA secondary structure and primary sequence, respectively. Sequences of low Tm regions display a higher degree of evolutionary conservation compared to high Tm regions. Low Tm regions are under strong synonymous constraint, while high Tm regions are not. These findings imply that high Tm regions contain thermo-stable functionally important RNA structures, which impose relaxed evolutionary constraint on sequence as long as the base-pairing patterns remain intact. By contrast, low thermostability regions contain single-stranded functionally important conserved RNA sequence elements accessible for binding by other molecules. We also find that theoretically predicted structures of paralogous mRNA pairs become more similar with growing temperature, while experimentally measured structures tend to diverge, which implies that the melting pathways of RNA structures cannot be fully captured by current computational approaches.

  17. Finite element analysis of drop deformation in the entrance region of a cylindrical tube

    NASA Astrophysics Data System (ADS)

    Xing, Yingsheng

    The finite element method was employed to investigate the large deformation of a viscoelastic drop, which was suspended in a viscoelastic medium, moving along the central axis of a cylindrical tube in the entrance region. For the investigation, finite element equations were developed, with the aid of the penalty function method, based on the system equations consisting of the continuity and momentum equations for both the drop and suspending medium, and auto-remeshing technique was employed to describe the moving interface between the drop and suspending medium. The system equations were formulated using the integral-type KBKZ constitutive equation to deal with a moving boundary problem. The effects of (1) the ratio of the relaxation times of the drop and the suspending medium, (2) the viscosity ratio of the drop and suspending medium, (3) the initial drop size, and (4) an apparent shear rate on the extent of the drop deformation were investigated by considering five combinations of viscoelastic drop and viscoelastic suspending medium. The computed shapes of a viscoelastic drop, suspended in another viscoelastic medium, moving along the central axis of a cylindrical tube in the entrance region elongated continuously as it moved towards the tube entrance and recoiled slightly after it passed the tube inlet. Further, the extent of drop deformation became greater as the ratio of the relaxation times of the drop and the suspending medium decreased, as the initial drop radius was increased, and as the apparent shear rate was increased. For comparison, also computed were the shapes of a Newtonian drop, suspended in another Newtonian medium, moving along the central axis of a cylindrical tube in the entrance region. A maximum deformation of a Newtonian drop occurred at an axial position very close to the end of the converging section of the straight section of the cylindrical tube, while a maximum deformation of a viscoelastic drop occurred at an axial position slightly

  18. Affordable, Robust Ceramic Joining Technology (ARCJoint) Developed

    NASA Technical Reports Server (NTRS)

    Steele, Gynelle C.


    Affordable, Robust Ceramic Joining Technology (ARCJoint) is a method for joining high temperature- resistant ceramic pieces together, establishing joints that are strong, and allowing joining to be done in the field. This new way of joining allows complex shapes to be formed by joining together geometrically simple shapes. The joining technology at NASA is one of the enabling technologies for the application of silicon-carbide-based ceramic and composite components in demanding and high-temperature applications. The technology is being developed and tested for high-temperature propulsion parts for aerospace use. Commercially, it can be used for joining ceramic pieces used for high temperature applications in the power-generating and chemical industries, as well as in the microelectronics industry. This innovation could yield big payoffs for not only the power-generating industry but also the Silicon Valley chipmakers. This technology, which was developed at the NASA Glenn Research Center by Dr. Mrityunjay Singh, is a two-step process involving first using a paste to join together ceramic pieces and bonding them by heating the joint to 110 to 120 C for between 10 and 20 min. This makes the joint strong enough to be handled for the final joining. Then, a silicon-based substance is applied to the joint and heated to 1400 C for 10 to 15 min. The resulting joint is as strong as the original ceramic material and can withstand the same high temperatures.

  19. Affordable, Robust Ceramic Joining Technology (ARCJoint) Developed

    NASA Technical Reports Server (NTRS)

    Steele, Gynelle C.


    Affordable, Robust Ceramic Joining Technology (ARCJoint) is a method for joining high temperature- resistant ceramic pieces together, establishing joints that are strong, and allowing joining to be done in the field. This new way of joining allows complex shapes to be formed by joining together geometrically simple shapes. The joining technology at NASA is one of the enabling technologies for the application of silicon-carbide-based ceramic and composite components in demanding and high-temperature applications. The technology is being developed and tested for high-temperature propulsion parts for aerospace use. Commercially, it can be used for joining ceramic pieces used for high temperature applications in the power-generating and chemical industries, as well as in the microelectronics industry. This innovation could yield big payoffs for not only the power-generating industry but also the Silicon Valley chipmakers. This technology, which was developed at the NASA Glenn Research Center by Dr. Mrityunjay Singh, is a two-step process involving first using a paste to join together ceramic pieces and bonding them by heating the joint to 110 to 120 C for between 10 and 20 min. This makes the joint strong enough to be handled for the final joining. Then, a silicon-based substance is applied to the joint and heated to 1400 C for 10 to 15 min. The resulting joint is as strong as the original ceramic material and can withstand the same high temperatures.

  20. Simplified Explosive Joining of Tubes to Fittings

    NASA Technical Reports Server (NTRS)

    Bement, L. J.; Bailey, J. W.; Perry, R.; Finch, M. S.


    Technique simplifies tube-to-fitting joining, as compared to fusion welding, and provides improvement on standard procedures used to join tubes explosively to tube fittings. Special tool inserted into tube to be joined. Tool allows strip of ribbon explosive to be placed right at joint. Ribbon explosive and mild detonating fuse allows use of smaller charge. Assembled tool storable, and process amenable to automation. Assembly of components, insertion of tool into weld site, and joining operation mechanized without human contact. Used to assemble components in nuclear reactors or in other environments hostile to humans.

  1. Whorl-specific expression of the SUPERMAN gene of Arabidopsis is mediated by cis elements in the transcribed region.


    Ito, Toshiro; Sakai, Hajime; Meyerowitz, Elliot M


    The SUPERMAN (SUP) gene of Arabidopsis is involved in controlling cell proliferation in stamen and carpel primordia and in ovules during flower development. The SUP gene encodes a transcription factor with a C2H2-type zinc finger motif, a serine/proline-rich domain, a basic domain, and a leucine-zipper-like domain and is expressed in a very limited region in stamen primordia and in the developing ovary during flower development. The SUP gene is susceptible to methylation, resulting in epigenetic gene silencing. To understand how the SUP gene is expressed spatially and temporally in its restricted domain, and why methylation of the transcribed region affects early-stage SUP expression, we have identified the SUP cis regulatory elements by characterizing SUP gene fusions. These studies show that the SUP gene has discrete upstream promoter elements required for expression in stamen primordia in early stages and in the ovary in later stages. The promoter activity for stamen primordia is modulated by several positive and negative elements located in the transcribed and translated regions. Several regulatory elements in the transcribed region correlate with the areas of the gene that are heavily methylated in epigenetic alleles; these data provide a possible explanation of how methylation of the transcribed region represses transcription.

  2. Trace Elements and Common Ions in Southeastern Idaho Snow: Regional Air Pollutant Tracers for Source Area Emissions

    SciTech Connect

    Abbott, Michael Lehman; Einerson, Jeffrey James; Schuster, Paul; Susong, David D.


    Snow samples were collected in southeastern Idaho over two winters to assess trace elements and common ions concentrations in air pollutant fallout across the region. The objectives were to: 1) develop sampling and analysis techniques that would produce accurate measurements of a broad suite of elements and ions in snow, 2) identify the major elements in regional fallout and their spatial and temporal trends, 3) determine if there are unique combinations of elements that are characteristic to the major source areas in the region (source profiles), and 4) use pattern recognition and multivariate statistical techniques (principal component analysis and classical least squares regression) to investigate source apportionment of the fallout to the major source areas. In the winter of 2000-2001, 250 snow samples were collected across the region over a 4-month period and analyzed in triplicate using inductively-coupled plasma mass spectrometry (ICP-MS) and ion chromatography (IC). Thirty-nine (39) trace elements and 9 common ions were positively identified in most samples. The data were analyzed using pattern recognition tools in the software, Pirouette® (Infometrix, Inc.). These results showed a large crustal component (Al, Zn, Mn, Ba, and rare earth elements), an overwhelming contribution from phosphate processing facilities located outside Pocatello in the southern portion of the ESRP, some changes in concentrations over time, and no obvious source area profiles (unique chemical signatures) other than at Pocatello. Concentrations near a major U.S. Department of Energy industrial complex on the Idaho National Engineering and Environmental Laboratory (INEEL) were lower than those observed at major downwind communities. In the winter of 2001-2002, we tried a new sampling design (and collected 135 additional samples) in an attempt to estimate pure emission profiles from the major source areas in the region and used classical least squares regression (CLS) to source

  3. Concentrations and solubility of trace elements in fine particles at a mountain site, southern China: regional sources and cloud processing

    NASA Astrophysics Data System (ADS)

    Li, T.; Wang, Y.; Li, W. J.; Chen, J. M.; Wang, T.; Wang, W. X.


    The concentrations and solubility of twelve trace elements in PM2.5 at Mt. Lushan, southern China, were investigated during the summer of 2011 and the spring of 2012. The average PM2.5 mass was 55.2 ± 20.1 μg m-3 during the observation period. Temporal variations of all trace elements including total and water-soluble fractions with several dust storm spikes for total fraction Al and Fe were observed. The enrichment factor (EF) values were one order of magnitude higher for the water-soluble fractions vs. the total fractions of trace elements. Four major emission sources were classified by principal component analysis (PCA), namely nonferrous metal mining and smelting (for Cr, As, Ba and parts of Zn), coal combustion (for Pb, Zn, Se, Cu and Mn), crustal materials (for Al and Fe) and municipal solid waste incineration (for Cd and Mo). Trajectory cluster analysis and the potential source contribution function (PSCF) consistently identified the Yangtze River Delta (YRD), the Pearl River Delta (PRD) and parts of Hunan and Jiangxi as the major source regions and pathways for anthropogenic elements, while northern China was identified for crustal elements. In contrast, the local Jiangxi area has become the most significant contributor to the solubility of most trace elements, apart from the YRD with severe air pollution. In addition, the solubility alteration of trace elements in cloud events was investigated and transmission electron microscopy (TEM) analysis indicated that the irreversible alteration of particle morphology by cloud processing was highly responsible for the enhancement of element solubility. Our work implies an important role of regional anthropogenic pollution and cloud processing in the evolution of trace element solubility during transport.

  4. Atmospheric deposition of trace elements recorded in snow from the Mt. Nyainqêntanglha region, southern Tibetan Plateau.


    Huang, Jie; Kang, Shichang; Zhang, Qianggong; Guo, Junming; Chen, Pengfei; Zhang, Guoshuai; Tripathee, Lekhendra


    In May 2009, snowpit samples were collected from a high-elevation glacier in the Mt. Nyainqêntanglha region on the southern Tibetan Plateau. A set of elements (Al, V, Cr, Mn, Co, Ni, Cu, Zn, Cd, Hg and Pb) was analyzed to investigate the concentrations, deposition fluxes of trace elements, and the relative contributions from anthropogenic and natural sources deposited on the southern Tibetan Plateau. Concentrations of most of the trace elements in snowpit samples from the Zhadang glacier are significantly lower than those examined from central Asia (e.g., eastern Tien Shan), with higher concentrations during the non-monsoon season than during the monsoon season. The elements of Al, V, Cr, Mn, Co, and Ni display low crustal enrichment factors (EFs), while Cu, Zn, Cd, Hg, and Pb show high EF values in the snow samples, suggesting anthropogenic inputs are potentially important for these elements in the remote, high-elevation atmosphere on the southern Tibetan Plateau. Together with the fact that the concentration levels of such elements in the Mt. Nyainqêntanglha region are significantly higher than those observed on the south edge of the Tibetan Plateau, our results suggest that the high-elevation atmosphere on the southern Tibetan Plateau may be more sensitive to variations in the anthropogenic emissions of atmospheric trace elements than that in the central Himalayas. Moreover, the major difference between deposition fluxes estimated in our snow samples and those recently measured at Nam Co Station for elements such as Cr and Cu may suggest that atmospheric deposition of some of trace elements reconstructed from snowpits and ice cores could be grossly underestimated on the Tibetan Plateau.

  5. Concentrations and solubility of trace elements in fine particles at a mountain site, southern China: regional sources and cloud processing

    NASA Astrophysics Data System (ADS)

    Li, T.; Wang, Y.; Li, W. J.; Chen, J. M.; Wang, T.; Wang, W. X.


    The concentrations and solubility of twelve trace elements in PM2.5 at Mt. Lushan, southern China, were investigated during the summer of 2011 and the spring of 2012. The average PM2.5 mass was 55.2 ± 20.1 μg m-3 during the observation period. Temporal variations of all trace elements including total and water-soluble fractions with several dust storm spikes in total fractions of Al and Fe were observed. The enrichment factor (EF) values were 1 order of magnitude higher for the water-soluble fractions versus the total fractions of trace elements. Four major emission sources, namely nonferrous metal mining and smelting (for Cr, As, Ba and parts of Zn), coal combustion (for Pb, Zn, Se, Cu and Mn), crustal materials (for Al and Fe) and municipal solid waste incineration (for Cd and Mo), were classified by principal component analysis (PCA). Trajectory cluster analysis and the potential source contribution function (PSCF) consistently identified the Yangtze River delta (YRD), the Pearl River delta (PRD), and the neighbouring provinces of Mt. Lushan as the major source regions and transport pathways for anthropogenic elements. Northern China was identified as a major source region for crustal elements. It should be noted that apart from the YRD, the area around Mt. Lushan has become the most significant contributor to the solubility of most trace elements. Element solubility can be partially determined by emission sources. However, enhanced solubility of trace elements corresponding to increased concentrations of sulfate after the occurrence of cloud events indicated significant effects of cloud processing on aerosol element dissolution. Metal particles mixed with sulfate in cloud droplet residues were further investigated through transmission electron microscopy (TEM) analysis. Irreversible alteration of particle morphology by cloud processing was confirmed to be highly responsible for the enhancement of trace element solubility. The findings from this study imply an

  6. Investigation of trace elements in ancient pottery from Jenini, Brong Ahafo region, Ghana by INAA and Compton suppression spectrometry

    NASA Astrophysics Data System (ADS)

    Nyarko, B. J. B.; Bredwa-Mensah, Y.; Serfor-Armah, Y.; Dampare, S. B.; Akaho, E. H. K.; Osae, S.; Perbi, A.; Chatt, A.


    Concentrations of trace elements in ancient pottery excavated from Jenini in the Brong Ahafo region of Ghana were determined using instrumental neutron activation analysis (INAA) in conjunction with both conventional and Compton suppression counting. Jenini was a slave Camp of Samory Toure during the indigenous slavery and the Trans-Atlantic slave trade. Pottery fragments found during the excavation of the grave tombs of the slaves who died in the slave camps were analysed. In all, 26 trace elements were determined in 40 pottery fragments. These elemental concentrations were processed using multivariate statistical methods, cluster, factor and discriminant analyses in order to determine similarities and correlation between the various samples. The suitability of the two counting systems for determination of trace elements in pottery objects has been evaluated.

  7. Spectra in the 60 )angstrom) to 345 )angstrom) wavelength region of elements injected into the PLT tokamak

    SciTech Connect

    Wouters, A.; Schwob, J.L.; Suckewer, S.; Seely, J.F.; Feldman, U.; Dave, J.H.


    High resolution spectra of the elements Fe, Ni, Zn, Ge, Se, and Mo injected into the PLT tokamak were recorded by the 2-meter Schwob-Fraenkel soft X-ray multichannel spectrometer (SOXMOS). Spectra were recorded every 50 ms during the time before and after injection. The spectral lines of the injected element were very strong in the spectrum recorded immedately after injection, and the transition in the injected element were easily distinguished from the transitions in te intrinsic elements (C, O, Ti, Cr, Fe, and Ni). An accurate wavelength scale was established using well-known reference transitions in the intrinsic elements. The spectra recorded just prior to injection were substracted from the spectra recorded after injection, and the resulting spectrum was composed almost entirely of transitions from the injected element. A large number of + 0 transitions between the ground and the first excited configurations in the Li I through K I isoelectronic sequences of the injected elements were identified in the wavelength region 60 )angstrom) to 345 )angstrom). 33 refs., 5 figs., 1 tab.

  8. Joining of advanced materials by superplastic deformation


    Goretta, Kenneth C.; Routbort, Jules L.; Gutierrez-Mora, Felipe


    A method for utilizing superplastic deformation with or without a novel joint compound that leads to the joining of advanced ceramic materials, intermetallics, and cermets. A joint formed by this approach is as strong as or stronger than the materials joined. The method does not require elaborate surface preparation or application techniques.

  9. Joining of advanced materials by superplastic deformation


    Goretta, Kenneth C.; Routbort, Jules L.; Gutierrez-Mora, Felipe


    A method for utilizing superplastic deformation with or without a novel joint compound that leads to the joining of advanced ceramic materials, intermetallics, and cermets. A joint formed by this approach is as strong as or stronger than the materials joined. The method does not require elaborate surface preparation or application techniques.

  10. Efficient Joins with Compressed Bitmap Indexes

    SciTech Connect

    Computational Research Division; Madduri, Kamesh; Wu, Kesheng


    We present a new class of adaptive algorithms that use compressed bitmap indexes to speed up evaluation of the range join query in relational databases. We determine the best strategy to process a join query based on a fast sub-linear time computation of the join selectivity (the ratio of the number of tuples in the result to the total number of possible tuples). In addition, we use compressed bitmaps to represent the join output compactly: the space requirement for storing the tuples representing the join of two relations is asymptotically bounded by min(h; n . cb), where h is the number of tuple pairs in the result relation, n is the number of tuples in the smaller of the two relations, and cb is the cardinality of the larger column being joined. We present a theoretical analysis of our algorithms, as well as experimental results on large-scale synthetic and real data sets. Our implementations are efficient, and consistently outperform well-known approaches for a range of join selectivity factors. For instance, our count-only algorithm is up to three orders of magnitude faster than the sort-merge approach, and our best bitmap index-based algorithm is 1.2x-80x faster than the sort-merge algorithm, for various query instances. We achieve these speedups by exploiting several inherent performance advantages of compressed bitmap indexes for join processing: an implicit partitioning of the attributes, space-efficiency, and tolerance of high-cardinality relations.

  11. Initial quality of advanced joining concepts

    NASA Astrophysics Data System (ADS)

    Garver, W. R.; Lee, D. Y.; Koepsel, K. M.


    This initial fatigue quality of three types of aircraft construction were studied. The three types included conventional mechanically-fastened joints, adhesively-bonded joints, and monolithic aluminum castings. The objectives are to obtain data for setting initial flaw assumptions for U.S. Air Force damage tolerance specifications, and to develop a method for comparing the relative merit of competing structural concepts. Two hundred test elements representing these joining concepts were prepared and tested under realistic spectrum load histories. Nondestructive inspections were performed on all specimens, but no correlation to crack growth performance was found. Crack growth data were obtained by fractographic examination and analyzed using the equivalent initial flaw size (EIFS) concept. Statistical distributions, representing the variation in EIFS and in crack growth rate, were obtained. Adhesively-bonded structure was found to give the best overall combination of benefits. The scatter in crack growth was highest in castings, which limits reliability at high stresses. An improved methodology was developed for comparing structural performance and efficiency. The methods include consideration of initial material and manufacturing quality, and can be used to quantify reliability at any confidence level and service time.

  12. Welding and Joining of Titanium Aluminides

    PubMed Central

    Cao, Jian; Qi, Junlei; Song, Xiaoguo; Feng, Jicai


    Welding and joining of titanium aluminides is the key to making them more attractive in industrial fields. The purpose of this review is to provide a comprehensive overview of recent progress in welding and joining of titanium aluminides, as well as to introduce current research and application. The possible methods available for titanium aluminides involve brazing, diffusion bonding, fusion welding, friction welding and reactive joining. Of the numerous methods, solid-state diffusion bonding and vacuum brazing have been most heavily investigated for producing reliable joints. The current state of understanding and development of every welding and joining method for titanium aluminides is addressed respectively. The focus is on the fundamental understanding of microstructure characteristics and processing–microstructure–property relationships in the welding and joining of titanium aluminides to themselves and to other materials. PMID:28788113

  13. LAMP Joining between Ceramic and Plastic

    NASA Astrophysics Data System (ADS)

    Kawahito, Yousuke; Nishimoto, Kouji; Katayama, Seiji

    Joining of dissimilar materials is necessary and important from a manufacturing viewpoint. Therefore, the authors have developed a new laser direct joining method between a metal and a plastic which is named Laser Assisted Metal and Plastic (LAMP) joining method. In this research, LAMP joining was applied to join silicon nitride Si3N4 ceramic and polyethylene terephthalate (PET) engineering plastic, although metal was replaced by ceramic. The tensile shear strength of obtained joints was 3100 N at the maximum, which was strong enough to elongate a PET base plate of 2 mm in thickness and 30 mm in width. Moreover, transmission electron microscopes (TEM) observation demonstrates that the ceramic and the plastic are tightly bonded on atomic or molecular sized level.

  14. Welding and Joining of Titanium Aluminides.


    Cao, Jian; Qi, Junlei; Song, Xiaoguo; Feng, Jicai


    Welding and joining of titanium aluminides is the key to making them more attractive in industrial fields. The purpose of this review is to provide a comprehensive overview of recent progress in welding and joining of titanium aluminides, as well as to introduce current research and application. The possible methods available for titanium aluminides involve brazing, diffusion bonding, fusion welding, friction welding and reactive joining. Of the numerous methods, solid-state diffusion bonding and vacuum brazing have been most heavily investigated for producing reliable joints. The current state of understanding and development of every welding and joining method for titanium aluminides is addressed respectively. The focus is on the fundamental understanding of microstructure characteristics and processing-microstructure-property relationships in the welding and joining of titanium aluminides to themselves and to other materials.

  15. The c-myc insulator element and matrix attachment regions define the c-myc chromosomal domain.


    Gombert, Wendy M; Farris, Stephen D; Rubio, Eric D; Morey-Rosler, Kristin M; Schubach, William H; Krumm, Anton


    Insulator elements and matrix attachment regions are essential for the organization of genetic information within the nucleus. By comparing the pattern of histone modifications at the mouse and human c-myc alleles, we identified an evolutionarily conserved boundary at which the c-myc transcription unit is separated from the flanking condensed chromatin enriched in lysine 9-methylated histone H3. This region harbors the c-myc insulator element (MINE), which contains at least two physically separable, functional activities: enhancer-blocking activity and barrier activity. The enhancer-blocking activity is mediated by CTCF. Chromatin immunoprecipitation assays demonstrate that CTCF is constitutively bound at the insulator and at the promoter region independent of the transcriptional status of c-myc. This result supports an architectural role of CTCF rather than a regulatory role in transcription. An additional higher-order nuclear organization of the c-myc locus is provided by matrix attachment regions (MARs) that define a domain larger than 160 kb. The MARs of the c-myc domain do not act to prevent the association of flanking regions with lysine 9-methylated histones, suggesting that they do not function as barrier elements.

  16. Finite Element Modelling of the Glenohumeral Capsule Can Help Assess the Tested Region during a Clinical Exam

    PubMed Central

    Ellis, Benjamin J; Drury, Nicholas J.; Moore, Susan M.; McMahon, Patrick J.; Weiss, Jeffrey A.; Debski, Richard E.


    The objective of this research was to examine the efficacy of evaluating the region of the glenohumeral capsule being tested by clinical exams for shoulder instability using finite element models of the glenohumeral joint. Specifically, the regions of high capsule strain produced by glenohumeral joint positions commonly used during a clinical exam were identified. Kinematics that simulated a simple translation test with an anterior load at three external rotation angles were applied to a validated, subject-specific finite element model of the glenohumeral joint at 60° of abduction. Maximum principal strains on the glenoid side of the IGHL were significantly higher than the maximum principal strains on the humeral side, for all three regions of the IGHL at 30° and 60° of external rotation. These regions of localized strain indicate that these joint positions might be used to test the glenoid side of the IGHL during this clinical exam, but are not useful for assessing the humeral side of the IGHL. The use of finite element models will facilitate the search for additional joint positions that isolate high strains to other IGHL regions, including the humeral side of the IGHL. PMID:20013435

  17. An optical region elemental abundance analysis of the chemically peculiar HgMn star chi Lupi

    NASA Technical Reports Server (NTRS)

    Wahlgren, Glenn M.; Adelman, Saul J.; Robinson, Richard D.


    The optical spectrum of the chemically peculiar HgMn type binary star chi Lupi has been analyzed to determine atmospheric parameters and elemental abundances. Echelle spectra were obtained with the 3.9 m Anglo-Australian telescope to exploit the extreme shape-lined nature of the spectrum. This study was undertaken in support of ultraviolet analyses currently underway that utilize echell spectra obtained with the Hubble Space Telescope. For the B9.5 V primary star we obtain T(sub eff) = 10650 K, log g = 3.9, and xi = 0 km/s, while for the A2 V secondary, T(sub eff) = 9200 K, log g = 4.0, and xi = 2 km/s. Most of the elemental abundances are typical of HgMn stars with similar T(sub eff) showing an overall iron-peak elemental abundance distribution that is basically solar in nature with enhancement of the light elements Si, P, and S, as well as all detected elements heavier than the iron group. Abundances for several elements have been determined for the first time in this star, including several of the rare-earths. The secondary star spectrum shows Am star characteristics. We also discuss the relative merits of the equivalent width and synthetic spectrum techniques in determining the elemental abundences, concluding that the synthetic spectrum technique is necessary for obtaining abundances with the utmost accuracy.

  18. An optical region elemental abundance analysis of the chemically peculiar HgMn star chi Lupi

    NASA Technical Reports Server (NTRS)

    Wahlgren, Glenn M.; Adelman, Saul J.; Robinson, Richard D.


    The optical spectrum of the chemically peculiar HgMn type binary star chi Lupi has been analyzed to determine atmospheric parameters and elemental abundances. Echelle spectra were obtained with the 3.9 m Anglo-Australian telescope to exploit the extreme shape-lined nature of the spectrum. This study was undertaken in support of ultraviolet analyses currently underway that utilize echell spectra obtained with the Hubble Space Telescope. For the B9.5 V primary star we obtain T(sub eff) = 10650 K, log g = 3.9, and xi = 0 km/s, while for the A2 V secondary, T(sub eff) = 9200 K, log g = 4.0, and xi = 2 km/s. Most of the elemental abundances are typical of HgMn stars with similar T(sub eff) showing an overall iron-peak elemental abundance distribution that is basically solar in nature with enhancement of the light elements Si, P, and S, as well as all detected elements heavier than the iron group. Abundances for several elements have been determined for the first time in this star, including several of the rare-earths. The secondary star spectrum shows Am star characteristics. We also discuss the relative merits of the equivalent width and synthetic spectrum techniques in determining the elemental abundences, concluding that the synthetic spectrum technique is necessary for obtaining abundances with the utmost accuracy.

  19. Leap to explore the region of neutron-rich heavy element isotopes

    SciTech Connect

    Hoffman, D.C.


    The research aims of the Large Einsteinium Activation Program (LEAP) are described. This program is a major initiative to exploit currently existing expertise in heavy element research and the potential for producing very heavy actinide target materials such as 285-day /sup 254/Es at the High Flux Isotope Reactor at Oak Ridge National Laboratory. The stated aims of the program are to produce heavy element isotopes, to conduct chemical studies of these isotopes, to study the nuclear properties of such isotopes, and to produce a superheavy element (183 neutrons) by the using a /sup 254/Es target and /sup 48/Ca projectiles. 13 refs., 2 figs., 2 tabs. (DWL)

  20. Austria Declares Intent To Join ESO

    NASA Astrophysics Data System (ADS)


    At a press conference today at the University of Vienna's Observatory, the Austrian Science Minister Johannes Hahn announced the decision by the Austrian Government to seek membership of ESO from 1 July this year. ESO PR Photo 11/08 ESO PR Photo 11/08 Announcing Austria's Intent to Join ESO Said Minister Hahn: "With membership of ESO, Austria's scientists will receive direct access to the world's leading infrastructure in astronomy. This strengthens Austria as a place for research and provides an opportunity for young researchers to continue their work from here. With this move, Austria takes an important step in the reinforcement of Europe's science and research infrastructure." The decision constitutes a major breakthrough for Austrian scientists who have argued for membership of ESO for many years. Seeking membership in ESO also marks a step towards the further development of the European Research and Innovation Area, an important element of Europe's so-called Lisbon Strategy. "ESO welcomes the Austrian bid to join our organisation. I salute the Austrian Government for taking this important step and look forward to working closely with our Austrian friends and colleagues in the years to come," commented the ESO Director General, Tim de Zeeuw. For Austrian astronomers, ESO membership means not only unrestricted access to ESO's world-leading observational facilities including the world's most advanced optical telescope, the Very Large Telescope, and full participation in the quasi-global ALMA project, but also the possibility to participate on a par with their European colleagues in the future projects of ESO, including the realisation of ESO's Extremely Large Telescope project (E-ELT), which is currently in the design phase. All these projects require some of the most advanced technologies in key areas such as optics, detectors, lightweight structures, etc. Austrian participation in ESO opens the door for Austrian industry and major research institutes of the

  1. Inventory of available data elements for the San Bernardino, California region

    NASA Technical Reports Server (NTRS)

    Christenson, J.; Michel, R.


    Elements of data sets that are available to be integrated for the San Bernardino vertical data integration project are given. Each of the data sets has specified for it the ownership, validity, accuracy and technical requirements for integration.

  2. A Comparison of Elemental Abundance Ratios in SEP Events in Fast and Slow Solar Wind Regions

    DTIC Science & Technology


    that the elemental abundances of gradual SEP events reflect the composition of the solar corona , implying that the ambient coronal thermal ions...point at the top of the corona , although the plasma near Earth emerged ~4 days prior to its arrival at 1 AU. Thus energetic-particle and solar -wind...TYPE REPRINT 3. DATES COVERED (From - To) 4. TITLE AND SUBTITLE A Comparison of Elemental Abundance Ratios in SEP Events in Fast and Slow Solar

  3. Selected translocation of plasmid genes: frequency and regional specificity of translocation of the Tn3 element.


    Kretschmer, P J; Cohen, S N


    A procedure is described that selects for the insertion of transposable antibiotic resistance elements in a variety of recipient replicons. The selected translocation procedure, which employs a plasmid having a temperature-sensitive defect in replication as a donor of transposable genetic elements, was used to investigate certain characteristics of the translocation process. Our results indicate that translocation of the Tn3 element from plasmid to plasmid occurs at a 10(3)- to 10(4)-times-higher frequency than from plasmid to chromosome. In both cases, continued accumulation of Tn3 on recipient genomes is prevented by development of an apparent equilibrium when only a small fraction of molecules in the recipient population contain Tn3. An alternative method for estimation of translocation frequency has shown that the translocation process is temperature sensitive and that its frequency is unaffected by the presence of host recA mutation. Insertions of Tn3 onto the 65 X 10(6)-dalton R6-5 plasmid in Escherichia coli are clustered on EcoRI fragments 3 (8 of 23 insertions) and 9 (7 of 23 insertions), which contain 12 and 5%, respectively, of the R6-5 genome. The occurrence of multiple insertions of Tn3 within EcoRI fragment 9, which contains the IS1 element and a terminus of the Tn4 element, is consistent with earlier evidence indicating that terminal deoxyribonucleic acid sequences of already present transposable elements may provide recognition sequences for subsequent illegitimate recombinational events.

  4. Four reference soil and rock samples for measuring element availability in the Western Energy Regions

    USGS Publications Warehouse

    Crock, J.G.; Severson, R.C.


    Attaining acceptable precision in extractable element determinations is more difficult than in total element determinations. In total element determinations, dissolution of the sample is qualitatively checked by the clarity of the solution and the absence of residues. These criteria cannot be used for extracts. Possibilities for error are introduced in virtually every step in soil extractions. Therefore, the use of reference materials whose homogeneity and element content are reasonably well known is essential for determination of extractable elements. In this report, estimates of homogeneity and element content are presented for four reference samples. Bulk samples of about 100 kilograms of each sample were ground to pass an 80-mesh sieve. The samples were homogenized and split using a Jones-type splitter. Fourteen splits of each reference sample were analyzed for total content of Ca, Co, Cu, Fe, K, Mg, Mn, Na, and Zn; DTPA-extractable Cd, Co, Cu, Fe, Mn, Ni, Pb, and Zn; exchangeable Ca, Mg, K, and Na; cation exchange capacity water-saturation-extractable Ca, Mg, K, Na, C1, and SO4; soil pH; and hot-water-extractable boron. Error measured between splits was small, indicating that the samples were homogenized adequately and that the laboratory procedure provided reproducible results.

  5. Cardiomyopathy mutations reveal variable region of myosin converter as major element of cross-bridge compliance.


    Seebohm, B; Matinmehr, F; Köhler, J; Francino, A; Navarro-Lopéz, F; Perrot, A; Ozcelik, C; McKenna, W J; Brenner, B; Kraft, T


    The ability of myosin to generate motile forces is based on elastic distortion of a structural element of the actomyosin complex (cross-bridge) that allows strain to develop before filament sliding. Addressing the question, which part of the actomyosin complex experiences main elastic distortion, we suggested previously that the converter domain might be the most compliant region of the myosin head domain. Here we test this proposal by studying functional effects of naturally occurring missense mutations in the beta-myosin heavy chain, 723Arg --> Gly (R723G) and 736Ile --> Thr (I736T), in comparison to 719Arg --> Trp (R719W). All three mutations are associated with hypertrophic cardiomyopathy and are located in the converter region of the myosin head domain. We determined several mechanical parameters of single skinned slow fibers isolated from Musculus soleus biopsies of hypertrophic cardiomyopathy patients and healthy controls. Major findings of this study for mutation R723G were i), a >40% increase in fiber stiffness in rigor with a 2.9-fold increase in stiffness per myosin head (S( *)(rigor R723G) = 0.84 pN/nm S( *)(rigor WT) = 0.29 pN/nm); and ii), a significant increase in force per head (F( *)(10 degrees C), 1.99 pN vs. 1.49 pN = 1.3-fold increase; F( *)(20 degrees C), 2.56 pN vs. 1.92 pN = 1.3-fold increase) as well as stiffness per head during isometric steady-state contraction (S( *)(active10 degrees C), 0.52 pN/nm vs. 0.28 pN/nm = 1.9-fold increase). Similar changes were found for mutation R719W (2.6-fold increase in S( *)(rigor); 1.8-fold increase in F( *)(10 degrees C), 1.6-fold in F( *)(20 degrees C); twofold increase in S( *)(active10 degrees C)). Changes in active cross-bridge cycling kinetics could not account for the increase in force and active stiffness. For the above estimates the previously determined fraction of mutated myosin in the biopsies was taken into account. Data for wild-type myosin of slow soleus muscle fibers support previous

  6. Effects of Linker Length and Transient Secondary Structure Elements in the Intrinsically Disordered Notch RAM Region on Notch Signaling.


    Sherry, Kathryn P; Johnson, Scott E; Hatem, Christine L; Majumdar, Ananya; Barrick, Doug


    Formation of the bivalent interaction between the Notch intracellular domain (NICD) and the transcription factor CBF-1/RBP-j, Su(H), Lag-1 (CSL) is a key event in Notch signaling because it switches Notch-responsive genes from a repressed state to an activated state. Interaction of the intrinsically disordered RBP-j-associated molecule (RAM) region of NICD with CSL is thought to both disrupt binding of corepressor proteins to CSL and anchor NICD to CSL, promoting interaction of the ankyrin domain of NICD with CSL through an effective concentration mechanism. To quantify the role of disorder in the RAM linker region on the effective concentration enhancement of Notch transcriptional activation, we measured the effects of linker length variation on activation. The resulting activation profile has general features of a worm-like chain model for effective concentration. However, deviations from the model for short sequence deletions suggest that RAM contains sequence-specific structural elements that may be important for activation. Structural characterization of the RAM linker with sedimentation velocity analytical ultracentrifugation and NMR spectroscopy reveals that the linker is compact and contains three transient helices and two extended and dynamic regions. To test if these secondary structure elements are important for activation, we made sequence substitutions to change the secondary structure propensities of these elements and measured transcriptional activation of the resulting variants. Substitutions to two of these nonrandom elements (helix 2, extended region 1) have effects on activation, but these effects do not depend on the nature of the substituting residues. Thus, the primary sequences of these elements, but not their secondary structures, are influencing signaling. Copyright © 2015. Published by Elsevier Ltd.

  7. Rare earth elements upon assessment of reasons of the geophagy in Sikhote-Alin region (Russian Federation), Africa and other world regions.


    Panichev, Alexander M; Popov, Vladimir K; Chekryzhov, Igor Yu; Seryodkin, Ivan V; Stolyarova, Tatiana A; Zakusin, Sergey V; Sergievich, Alexandr A; Khoroshikh, Pavel P


    Rocks eaten by wild animals on the Bolshoy Shanduyskiy kudur in the Sikhote-Alin region (Russian Federation) are zeolite-clay mineral complexes-products of weathering of zeolitized vitric tuffs of rhyolite composition, deposited in aqueous medium within the volcanic caldera of about 55 million years ago. By composition of rock-forming oxides, the tuffs refer to high-potassium calc-alkaline series. In trace elements of most favorite kudurites of the Bolshoy Shanduyskiy kudur, there are significantly increased contents of most of rare earth elements (2-5 times in comparison with surrounding rocks). The results of our analysis of geological and geochemical data on kudurs and kudurites in another part of the Sikhote-Alin, as well as on other regions of the world (particularly, in Africa and Indonesia), taking into account new data on the prevalence of rare earth elements in living matter and their medical and biological properties, enable us to consider the version of causal connection of the geophagy with rare earth elements.

  8. [Determination and principal component analysis of mineral elements based on ICP-OES in Nitraria roborowskii fruits from different regions].


    Yuan, Yuan-Yuan; Zhou, Yu-Bi; Sun, Jing; Deng, Juan; Bai, Ying; Wang, Jie; Lu, Xue-Feng


    The content of elements in fifteen different regions of Nitraria roborowskii samples were determined by inductively coupled plasma-atomic emission spectrometry(ICP-OES), and its elemental characteristics were analyzed by principal component analysis. The results indicated that 18 mineral elements were detected in N. roborowskii of which V cannot be detected. In addition, contents of Na, K and Ca showed high concentration. Ti showed maximum content variance, while K is minimum. Four principal components were gained from the original data. The cumulative variance contribution rate is 81.542% and the variance contribution of the first principal component was 44.997%, indicating that Cr, Fe, P and Ca were the characteristic elements of N. roborowskii.Thus, the established method was simple, precise and can be used for determination of mineral elements in N.roborowskii Kom. fruits. The elemental distribution characteristics among N.roborowskii fruits are related to geographical origins which were clearly revealed by PCA. All the results will provide good basis for comprehensive utilization of N.roborowskii. Copyright© by the Chinese Pharmaceutical Association.

  9. New cis-regulatory elements in the Rht-D1b locus region of wheat

    USDA-ARS?s Scientific Manuscript database

    Fifteen gene-containing BACs with accumulated length of 1.82-Mb from the Rht-D1b locus region weresequenced and compared in detail with the orthologous regions of rice, sorghum, and maize. Our results show that Rht-D1b represents a conserved genomic region as implied by high gene sequence identity...

  10. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.


    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  11. Identification of a Positive Transcription Regulatory Element within the Coding Region of the nifLA Operon in Azotobacter vinelandii

    PubMed Central

    Mitra, Ranjana; Das, Hirendra K.; Dixit, Aparna


    Nitrogen fixation in Azotobacter vinelandii is regulated by the nifLA operon. NifA activates the transcription of nif genes, while NifL antagonizes the transcriptional activator NifA in response to fixed nitrogen and molecular oxygen levels. However, transcriptional regulation of the nifLA operon of A. vinelandii itself is not fully understood. Using the S1 nuclease assay, we mapped the transcription start site of the nifLA operon, showing it to be similar to the σ54-dependent promoters. We also identified a positive cis-acting regulatory element (+134 to +790) of the nifLA operon within the coding region of the nifL gene of A. vinelandii. Deletion of this element results in complete loss of promoter activity. Several protein factors bind to this region, and the specific binding sites have been mapped by DNase I foot printing. Two of these sites, namely dR1 (+134 to +204) and dR2 (+745 to +765), are involved in regulating the nifLA promoter activity. The absence of NtrC-like binding sites in the upstream region of the nifLA operon in A. vinelandii makes the identification of these downstream elements a highly significant finding. The interaction of the promoter with the proteins binding to the dR2 region spanning +745 to +765 appears to be dependent on the face of the helix as introduction of 4 bases just before this region completely disrupts promoter activity. Thus, the positive regulatory element present within the BglII-BglII fragment may play, in part; an important role in nifLA regulation in A. vinelandii. PMID:16000781

  12. In which regions is breast-feeding safer from the impact of toxic elements from the environment?


    Cinar, Nursan; Ozdemir, Sami; Yucel, Oya; Ucar, Fatma


    Owing to its unique nutritional and immunological characteristics, breast milk is the most important food source for infants. But, children are at greater risk for exposure to environmental toxicants from breast milk. The aim of this study was to evaluate the influence of environmental pollution on essential and toxic element contents of breast milk and determine the risky locations in our population. This study was conducted on women who were breastfeeding (n=90). Milk samples were collected at three locations in Marmara region, Turkey: highly industrialized region highly affected by pollution, urbanized region moderately and rural area that is affected little. Breast milk samples (5 mL) were collected at approximately one month postpartum (mature milk). The concentrations of cadmium (Cd), cobalt (Co), chromium (Cr), copper (Cu), iron (Fe), manganese (Mn), nickel (Ni), lead (Pb) and zinc (Zn) in milk samples were compared to the milk samples coming from different locations.Lead, cadmium, nickel, chromium, iron and manganese levels in the breast milk are highest and engrossing especially in rural areas compared to the other regions but cobalt, copper, zinc levels are highest in highly industrial areas. The levels of essential and toxic elements in breast milk can vary in different regions. The levels presented in our study are above some countries' data albeit not at toxic levels. Because of global effects, environmental pollution is not the problem for industrializing regions only. Rural area also may not be safe for breastfeed babies.

  13. Discriminative study of a potato (Solanum tuberosum L.) cultivation region by measuring the stable isotope ratios of bio-elements.


    Chung, Ill-Min; Kim, Jae-Kwang; Jin, Yong-Ik; Oh, Yong-Taek; Prabakaran, Mayakrishnan; Youn, Kyoung-Jin; Kim, Seung-Hyun


    Compared to other foods, the use of common bio-elements to identify the geographical origin of potato remains limited. Thus, this study aimed to verify whether the cultivation regions of raw potato tubers could be determined by the stable isotope composition analysis of bio-elements. δ(13)CVPDB and δ(15)NAIR in potato were influenced by region and cultivar, whereas δ(18)OVSMOW and δ(34)SVCDT were only influenced by region (p<0.0001). A two-dimensional plot of δ(18)OVSMOW and δ(34)SVCDT effectively distinguished between high and low altitude regions, and also reliably discriminated Wanju, Haenam, and Boseong cultivars in low altitude regions. δ(34)SVCDT was the main component that was responsible for the separation of samples in the principal component analysis (eigenvector of -0.6209) and orthogonal projection to latent structure-discriminant analysis (VIP value of 1.0566). In conclusion, this study improves our understanding of how the isotope composition of potato tubers varies with respect to cultivation regions and cultivars. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Microwave joining of SiC

    SciTech Connect

    Silberglitt, R.; Ahmad, I.; Tian, Y.L.


    The purpose of this work is to optimize the properties of SiC-SiC joints made using microwave energy. The current focus is on identification of the most effective joining methods for scale-up to large tube assemblies, including joining using SiC produced in situ from chemical precursors. During FY 1996, a new microwave applicator was designed, fabricated and tested that provides the capability for vacuum baking of the specimens and insulation and for processing under inert environment. This applicator was used to join continuous fiber-reinforced (CFCC) SiC/SiC composites using a polymer precursor to form a SiC interlayer in situ.

  15. Method of joining metallic and composite components

    NASA Technical Reports Server (NTRS)

    Semmes, Edmund B. (Inventor)


    A method is provided for joining a metallic member to a structure made of a composite matrix material. One or more surfaces of a portion of the metallic member that is to be joined to the composite matrix structure is provided with a plurality of outwardly projecting studs. The surface including the studs is brought into engagement with a portion of an uncured composite matrix material so that fibers of the composite matrix material intertwine with the studs, and the metallic member and composite structure form an assembly. The assembly is then companion cured so as to join the metallic member to the composite matrix material structure.

  16. Advanced concepts in joining by conventional processes

    SciTech Connect

    Edwards, G.R.; Fasching-James, A.A.; Onsoien, M.I.; Allen, J.W.


    Innovations which can be made to conventional arc welding processes so that advanced materials can be more efficiently joined are considered. Three examples are discussed: (1) GTA welding of iron aluminides, (2) GMA welding of advanced steels, and (3) SMA welding of structural steels. Advanced materials present new challenges for the materials joining specialist. The three examples discussed in this paper demonstrate, however, that modest but creative alterations of conventional GTAW, GMAW, or SMAW processes can provide new and better controls for solving advanced materials joining problems.

  17. Joining of ceramics for high temperature applications

    NASA Technical Reports Server (NTRS)

    Vilpas, Martti


    Summarized is a literature survey of the methods for joining ceramics to ceramics or ceramics to metals for high temperature applications. Also mechanical properties and potential applications of the joints are considered. The joining of ceramics is usually carried out by brazing or diffusion bonding. Especially the latter has been found useful, increasing the application of bonded ceramics. The possibility of using electron beam and laser beam welding for joining ceramics has also recently been investigated. The bonding of ceramics has found numerous applications typical for high operating temperatures, i.e., sensors and thermocouples.

  18. Surface and interface analysis of a Roman lead pipe ``fistula'': microchemistry of the soldering at the join, as seen by scanning Auger microscopy and X-ray photoelectron spectroscopy

    NASA Astrophysics Data System (ADS)

    Paparazzo, Ernesto


    Scanning Auger microscopy (SAM) and X-ray photoelectron spectroscopy (XPS) are used to study the surface and interface chemical composition of a Roman lead pipe (fistula). Experimental evidence is provided that the Romans used tin for soldering the join, and the chemical nature of the single elements, e.g. whether in metallic or combined form, is identified. SAM discloses the segregation of the chemical elements with a sub-micron spatial resolution, and large deviations in the quantitative results are found relative to the large-area averaged XPS results. Elemental depth profiles are obtained from all over the body of the pipe: we find that the lead is less oxidized at the join, and this region contains many more hydrocarbon species, which we interpret as deriving from the use of oil for anti-oxidizing purposes. Our experimental findings are consistent with Plinius' report on the lead-tin soldering techniques used in the Roman world.

  19. Comparative genomics reveals a functional thyroid-specific element in the far upstream region of the PAX8 gene

    PubMed Central


    Background The molecular mechanisms leading to a fully differentiated thyrocite are still object of intense study even if it is well known that thyroglobulin, thyroperoxidase, NIS and TSHr are the marker genes of thyroid differentiation. It is also well known that Pax8, TTF-1, Foxe1 and Hhex are the thyroid-enriched transcription factors responsible for the expression of the above genes, thus are responsible for the differentiated thyroid phenotype. In particular, the role of Pax8 in the fully developed thyroid gland was studied in depth and it was established that it plays a key role in thyroid development and differentiation. However, to date the bases for the thyroid-enriched expression of this transcription factor have not been unraveled yet. Here, we report the identification and characterization of a functional thyroid-specific enhancer element located far upstream of the Pax8 gene. Results We hypothesized that regulatory cis-acting elements are conserved among mammalian genes. Comparison of a genomic region extending for about 100 kb at the 5'-flanking region of the mouse and human Pax8 gene revealed several conserved regions that were tested for enhancer activity in thyroid and non-thyroid cells. Using this approach we identified one putative thyroid-specific regulatory element located 84.6 kb upstream of the Pax8 transcription start site. The in silico data were verified by promoter-reporter assays in thyroid and non-thyroid cells. Interestingly, the identified far upstream element manifested a very high transcriptional activity in the thyroid cell line PC Cl3, but showed no activity in HeLa cells. In addition, the data here reported indicate that the thyroid-enriched transcription factor TTF-1 is able to bind in vitro and in vivo the Pax8 far upstream element, and is capable to activate transcription from it. Conclusions Results of this study reveal the presence of a thyroid-specific regulatory element in the 5' upstream region of the Pax8 gene. The

  20. Elemental and organic carbon in aerosols over urbanized coastal region (southern Baltic Sea, Gdynia).


    Lewandowska, Anita; Falkowska, Lucyna; Murawiec, Dominika; Pryputniewicz, Dorota; Burska, Dorota; Bełdowska, Magdalena


    Studies on PM 10, total particulate matter (TSP), elemental carbon (EC) and organic carbon (OC) concentrations were carried out in the Polish coastal zone of the Baltic Sea, in urbanized Gdynia. The interaction between the land, the air and the sea was clearly observed. The highest concentrations of PM 10, TSP and both carbon fractions were noted in the air masses moving from southern and western Poland and Europe. The EC was generally of primary origin and its contribution to TSP and PM 10 mass was on average 2.3% and 3.7% respectively. Under low wind speed conditions local sources (traffic and industry) influenced increases in elemental carbon and PM 10 concentrations in Gdynia. Elemental carbon demonstrated a pronounced weekly cycle, yielding minimum values at the weekend and maximum values on Thursdays. The role of harbors and ship yards in creating high EC concentrations was clearly observed. Concentration of organic carbon was ten times higher than that of elemental carbon, and the average OC contribution to PM 10 mass was very high (31.6%). An inverse situation was observed when air masses were transported from over the Atlantic Ocean, the North Sea and the Baltic Sea. These clean air masses were characterized by the lowest concentrations of all analysed compounds. Obtained results for organic and elemental carbon fluxes showed that atmospheric aerosols can be treated, along with water run-off, as a carbon source for the coastal waters of the Baltic Sea. The enrichment of surface water was more effective in the case of organic carbon (0.27+/-0.19 mmol m(-2) d(-1)). Elemental carbon fluxes were one order of magnitude smaller, on average 0.03+/-0.04 mmol m(-2) d(-1). We suggest that in some situations atmospheric carbon input can explain up to 18% of total carbon fluxes into the Baltic coastal waters. Copyright 2010 Elsevier B.V. All rights reserved.

  1. CpG methylation at GATA elements in the regulatory region of CCR3 positively correlates with CCR3 transcription.


    Uhm, Tae Gi; Lee, Seol Kyung; Kim, Byung Soo; Kang, Jin Hyun; Park, Choon Sik; Rhim, Tai Youn; Chang, Hun Soo; Kim, Do Jin; Chung, Il Yup


    DNA methylation may regulate gene expression by restricting the access of transcription factors. We have previously demonstrated that GATA-1 regulates the transcription of the CCR3 gene by dynamically interacting with both positively and negatively acting GATA elements of high affinity binding in the proximal promoter region including exon 1. Exon 1 has three CpG sites, two of which are positioned at the negatively acting GATA elements. We hypothesized that the methylation of these two CpGs sites might preclude GATA-1 binding to the negatively acting GATA elements and, as a result, increase the availability of GATA-1 to the positively acting GATA element, thereby contributing to an increase in GATA-1-mediated transcription of the gene. To this end, we determined the methylation of the three CpG sites by bisulfate pyrosequencing in peripheral blood eosinophils, cord blood (CB)-derived eosinophils, PBMCs, and cell lines that vary in CCR3 mRNA expression. Our results demonstrated that methylation of CpG sites at the negatively acting GATA elements severely reduced GATA-1 binding and augmented transcription activity in vitro. In agreement, methylation of these CpG sites positively correlated with CCR3 mRNA expression in the primary cells and cell lines examined. Interestingly, methylation patterns of these three CpG sites in CB-derived eosinophils mostly resembled those in peripheral blood eosinophils. These results suggest that methylation of CpG sites at the GATA elements in the regulatory regions fine-tunes CCR3 transcription.

  2. First description of food-borne Salmonella enterica resistance regions R1 and R3 associated with IS26 elements.


    Gomes-Neves, Eduarda; Manageiro, Vera; Ferreira, Eugénia; Correia da Costa, José M; Caniça, Manuela


    In this study, we assessed the presence of IS26 in food-borne ASSuT-type Salmonella enterica isolates. A new genetic region (R3) was described, that included a C14 caspase gene between IS26 elements. R3 was present in two Salmonella Rissen isolates from a swine carcass and a meat handler, collected at the same abattoir. Furthermore, a new rearrangement of resistance region R1, harboring the blaTEM-1 gene flanked by IS26 elements, was identified in Salmonella Typhimurium and Salmonella 4,[5],12:i:-, from different samples. This study highlights the zoonotic potential of Salmonella spp. isolates and the possible role of IS26 in the mobilization of resistance genes. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  3. Regional annulus fibre orientations used as a tool for the calibration of lumbar intervertebral disc finite element models.


    Malandrino, Andrea; Noailly, Jérôme; Lacroix, Damien


    The collagen network of the annulus fibrosus largely controls the functional biomechanics of the lumbar intervertebral discs (IVDs). Quantitative anatomical examinations have shown bundle orientation patterns, possibly coming from regional adaptations of the annulus mechanics. This study aimed to show that the regional differences in annulus mechanical behaviour could be reproduced by considering only fibre orientation changes. Using the finite element method, a lumbar annulus was modelled as a poro-hyperelastic material in which fibres were represented by a direction-dependent strain energy density term. Fibre orientations were calibrated to reproduce the annulus tensile behaviours measured for four different regions: posterior outer, anterior outer, posterior inner and anterior inner. The back-calculated fibre angles and regional patterns as well as the global disc behaviour were comparable with anatomical descriptions reported in the literature. It was concluded that annulus fibre variations might be an effective tool to calibrate lumbar spine IVD and segment models.

  4. Distinct 3'-untranslated region elements regulate stage-specific mRNA accumulation and translation in Leishmania.


    McNicoll, François; Müller, Michaela; Cloutier, Serge; Boilard, Nathalie; Rochette, Annie; Dubé, Marthe; Papadopoulou, Barbara


    We recently characterized a large developmentally regulated gene family in Leishmania encoding the amastin surface proteins. While studying the regulation of these genes, we identified a region of 770 nucleotides (nt) within the 2055-nt 3'-untranslated region (3'-UTR) that regulates stage-specific gene expression at the level of translation. An intriguing feature of this 3'-UTR regulatory region is the presence of a approximately 450-nt element that is highly conserved among several Leishmania mRNAs. Here we show, using a luciferase reporter system and polysome profiling experiments, that the 450-nt element stimulates translation initiation of the amastin mRNA in response to heat shock, which is the main environmental change that the parasite encounters upon its entry into the mammalian host. Deletional analyses depicted a second region of approximately 100 nucleotides located at the 3'-end of several amastin transcripts, which also activates translation in response to elevated temperature. Both 3'-UTR regulatory elements act in an additive manner to stimulate amastin mRNA translation. In addition, we show that acidic pH encountered in the phagolysosomes of macrophages, the location of parasitic differentiation, triggers the accumulation of amastin transcripts by a distinct mechanism that is independent of the 450-nt and 100-nt elements. Overall, these important findings support the notion that stage-specific post-transcriptional regulation of the amastin mRNAs in Leishmania is complex and involves the coordination of distinct mechanisms controlling mRNA stability and translation that are independently triggered by key environmental signals inducing differentiation of the parasite within macrophages.

  5. Hotspots for Vitamin-Steroid-Thyroid Hormone Response Elements Within Switch Regions of Immunoglobulin Heavy Chain Loci Predict a Direct Influence of Vitamins and Hormones on B Cell Class Switch Recombination.


    Hurwitz, Julia L; Penkert, Rhiannon R; Xu, Beisi; Fan, Yiping; Partridge, Janet F; Maul, Robert W; Gearhart, Patricia J


    Vitamin A deficiencies are common throughout the world and have a significant negative influence on immune protection against viral infections. Mouse models demonstrate that the production of IgA, a first line of defense against viruses at mucosal sites, is inhibited in the context of vitamin A deficiency. In vitro, the addition of vitamin A to activated B cells can enhance IgA expression, but downregulate IgE. Previous reports have demonstrated that vitamin A modifies cytokine patterns, and in so doing may influence antibody isotype expression by an indirect mechanism. However, we have now discovered hundreds of potential response elements among Sμ, Sɛ, and Sα switch sites within immunoglobulin heavy chain loci. These hotspots appear in both mouse and human loci and include targets for vitamin receptors and related proteins (e.g., estrogen receptors) in the nuclear receptor superfamily. Full response elements with direct repeats are relatively infrequent or absent in Sγ regions although half-sites are present. Based on these results, we pose a hypothesis that nuclear receptors have a direct effect on the immunoglobulin heavy chain class switch recombination event. We propose that vitamin A may alter S site accessibility to activation-induced deaminase and nonhomologous end-joining machinery, thereby influencing the isotype switch, antibody production, and protection against viral infections at mucosal sites.

  6. Steps to Join Green Power Partnership

    EPA Pesticide Factsheets

    The U.S. EPA's Green Power Partnership is a voluntary partnership program designed to reduce the environmental impact of electricity generation by promoting renewable energy. This page details steps organizations should take to join the Partnership.

  7. Joining of dissimilar materials. A review

    NASA Astrophysics Data System (ADS)

    Sun, Zheng; Karppi, Risto


    Multimaterial technology is set to become one of the most promising solutions for the design and fabrication of many high performance products and engineering structures. Joining dissimilar materials is a key process in the manufacture of multimaterial products and has hence become a very important and vital field of research and development. This report contains a literature survey on the joining of dissimilar materials. The characteristics of dissimilar material joints are discussed. Theoretical and practical problems encountered in joining dissimilar materials are reviewed with special reference to the joinability of various materials and how they can be combined. Applications of dissimilar material joints are highlighted with reference to industrial requirements. Furthermore, examples are given in order to illustrate the principles of solving specific problems. The survey aims at providing the industrial and research and development (R&D) sectors with identification of the major needs for future development in the joining of dissimilar materials.

  8. Microwave joining of high-purity alumina

    SciTech Connect

    Cozzi, A.D.; Clark, D.E.; Ferber, M.K.


    Microwave hybrid heating (MHH) was used to join 99.5% pure alumina pieces 25 mm diameter and 25 mm long using 94% pure alumina as the interlayer material. The interlayer material was cut from a rod into discs approximately 2 mm thick. Joining was performed in a home model microwave oven. Temperatures for joining ranged from 1450{degrees}C to 1550{degrees}C and pressures from 1-3 MPa. For comparison, similar joints were made in a conventional furnace. Joined specimens were tested using four-point bend at room temperature. Statistical analysis was utilized to determine the relative effect of the different processing parameters on the strength of the joint.

  9. Occurrence and mobility of toxic elements in coals from endemic fluorosis areas in the Three Gorges Region, SW China.


    Xiong, Yan; Xiao, Tangfu; Liu, Yizhang; Zhu, Jianming; Ning, Zengping; Xiao, Qingxiang


    Fluorine (F) is a topic of great interest in coal-combustion related endemic fluorosis areas. However, little extent research exists regarding the environmental geochemistry of toxic elements that are enriched in coals and coal wastes in traditional endemic fluorosis areas, particularly focusing on their occurrences and mobilities during the weathering-leaching processes of coals and coal wastes in the surface environment. This paper addressed the issue of toxic elements in coals and coal wastes in the Three Gorges Region, Southwest (SW) China, where endemic fluorosis has historically prevailed, and investigated the distribution, occurrence, mobility features, and associated potential health risks. For this purpose, a modified experiment combined with long-term humidity cell test and column leaching trial was applied to elucidate the mobility of toxic elements in coals and coal wastes. In addition, sequential chemical extraction (SCE) was used to ascertain the modes of occurrence of toxic elements. The results demonstrated that the contents of toxic elements in the study area followed the order: stone coals > gangues > coal balls > coals. Furthermore, modes of occurrence of toxic elements were obviously different in coals and coal wastes. For example, cadmium (Cd) was mainly associated with monosulfide fraction in coals, molybdenum (Mo) and arsenic (As) were mainly associated with carbonate and silicate in coal gangues and stone coals, chromium (Cr) mainly existed in silicate and insoluble matter in coal gangues and coal balls, thallium (Tl) mainly occurred in organic matter in stone coals and sulfide in coals, and the occurrence of antimony (Sb) varied with different kinds of samples. Moreover, a large amount of toxic elements released to the leachates during the weathering and leaching process, which might pollute the environment and threaten human health. Based on the geo-accumulation index (Igeo), single factor index (Pi) and Nemerow index (PN), soils in the

  10. Influence of Regional Difference in Bone Mineral Density on Hip Fracture Site in Elderly Females by Finite Element Analysis.


    Lin, Z L; Li, P F; Pang, Z H; Zheng, X H; Huang, F; Xu, H H; Li, Q L


    Hip fracture is a kind of osteoporotic fractures in elderly patients. Its important monitoring indicator is to measure bone mineral density (BMD) using DXA. The stress characteristics and material distribution in different parts of the bones can be well simulated by three-dimensional finite element analysis. Our previous studies have demonstrated a linear positive correlation between clinical BMD and the density of three-dimensional finite element model of the femur. However, the correlation between the density variation between intertrochanteric region and collum femoris region of the model and the fracture site has not been studied yet. The present study intends to investigate whether the regional difference in the density of three-dimensional finite element model of the femur can be used to predict hip fracture site in elderly females. The CT data of both hip joints were collected from 16 cases of elderly female patients with hip fractures. Mimics 15.01 software was used to reconstruct the model of proximal femur on the healthy side. Ten kinds of material properties were assigned. In Abaqus 6.12 software, the collum femoris region and intertrochanteric region were, respectively, drawn for calculating the corresponding regional density of the model, followed by prediction of hip fracture site and final comparison with factual fracture site. The intertrochanteric region/collum femoris region density was [(1.20 ± 0.02) × 10(6)] on the fracture site and [(1.22 ± 0.03) × 10(6)] on the non-fracture site, and the difference was statistically significant (P = 0.03). Among 16 established models of proximal femur on the healthy side, 14 models were consistent with the actual fracture sites, one model was inconsistent, and one model was unpredictable, with the coincidence rate of 87.5 %. The intertrochanteric region or collum femoris region with lower BMD is more prone to hip fracture of the type on the corresponding site.

  11. Spatio-temporal flow analysis in bileaflet heart valve hinge regions: potential analysis for blood element damage.


    Simon, Hélène A; Dasi, Lakshmi P; Leo, Hwa-Liang; Yoganathan, Ajit P


    Point-wise velocity measurements have been traditionally acquired to estimate blood damage potential induced by prosthetic heart valves with emphasis on peak values of velocity magnitude and Reynolds stresses. However, the inherently Lagrangian nature of platelet activation and hemolysis makes such measurements of limited predictive value. This study provides a refined fluid mechanical analysis, including blood element paths and stress exposure times, of the hinge flows of a CarboMedics bileaflet mechanical heart valve placed under both mitral and aortic conditions and a St Jude Medical bileaflet valve placed under aortic conditions. The hinge area was partitioned into characteristic regions based on dominant flow structures and spatio-temporal averaging was performed on the measured velocities and Reynolds shear stresses to estimate the average bulk stresses acting on blood elements transiting through the hinge. A first-order estimate of viscous stress levels and exposure times were computed. Both forward and leakage flow phases were characterized in each partition by dynamic flows dependent on subtle leaflet movements and transvalvular pressure fluctuations. Blood elements trapped in recirculation regions may experience exposure times as long as the entire forward flow phase duration. Most calculated stresses were below the accepted blood damage threshold. Estimates of the stress levels indicate that the flow conditions within the boundary layers near the hinge and leaflet walls may be more detrimental to blood cells than bulk flow conditions, while recirculation regions may promote thrombus buildup.

  12. Laser -Based Joining of Metallic and Non-metallic Materials

    NASA Astrophysics Data System (ADS)

    Padmanabham, G.; Shanmugarajan, B.

    Laser as a high intensity heat source can be effectively used for joining of materials by fusion welding and brazing in autogenous or in hybrid modes. In autogenous mode, welding is done in conduction , deep penetration , and keyhole mode. However, due to inherently high energy density available from a laser source, autogenous keyhole welding is the most popular laser welding mode. But, it has certain limitations like need for extremely good joint fit-up, formation of very hard welds in steel , keyhole instability, loss of alloying elements, etc. To overcome these limitations, innovative variants such as laser-arc hybrid welding , induction-assisted welding , dual beam welding , etc., have been developed. Using laser heat, brazing can be performed by melting a filler to fill the joints, without melting the base materials. Accomplishing laser-based joining as mentioned above requires appropriate choice of laser source, beam delivery system, processing head with appropriate optics and accessories. Basic principles of various laser-based joining processes, laser system technology, process parameters, metallurgical effects on different base materials, joint performance, and applications are explained in this chapter.

  13. Elemental Composition Variations for Large Dusty and Rocky Regions on Mars Using Gamma-Ray Data from the Mars Odyssey Gamma-Ray Spectrometer

    NASA Technical Reports Server (NTRS)

    Evans, L. G.; Starr, R. D.; Reedy, R. C.; Boynton, W. V.


    The Gamma-Ray Spectrometer (GRS) on the Mars Odyssey spacecraft has been mapping the elemental composition of the surface materials since June 2002. To study elemental composition variations on the martian surface, seven large regions of Mars were selected: three very dusty ones and four mainly rocky ones. Large regions were used to get good counting statistics on as many gamma-ray peaks as possible from spectrum accumulated by the GRS experiment on Mars Odyssey, including elements with poor counting statistics. Data from TES were used to help select these regions. Gamma-ray peaks for several elements were analyzed. Some results and trends are reported.

  14. Robust Joining Technology for Solid Oxide Fuel Cells Applications

    NASA Technical Reports Server (NTRS)

    Shpargel, Tarah P.; Needham, Robert J.; Singh, M.; Kung, S. C.


    Recently there has been a great deal of interest in research development and commercialization of solid oxide fuel cells (SOFCs). Joining and sealing are critical issues that will need to be addressed before SOFCs can truly perform as expected. Ceramics and metals can be difficult to join together, especially when the joint must withstand up to 900 C operating temperature of the SOFCs. The goal of the present study is to find the most suitable braze material for joining of yttria stabilized zirconia (YSZ) to stainless steel. A number of commercially available braze materials TiCuSil, TiCuNi, Copper-ABA, Gold-ABA and Gold-ABA-V have been evaluated. The oxidation behavior of the braze materials and steel substrates in air was also examined through thermogravimetric analysis. The microstructure and composition of the brazed regions have been examined by optical and scanning electron microscopy and eDS analysis. Effect of braze composition and processing conditions on the interfacial microstructure and composition of the joint regions will be presented.

  15. Atmospheric trace elements over source regions for Chinese dust: concentrations, sources and atmospheric deposition on the Loess plateau

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaoye; Arimoto, Richard; An, Zhisheng; Chen, Tuo; Zhang, Guangyu; Zhu, Guanghua; Wang, Xinfu

    The mass-particle size distributions of up to 17 trace elements in aerosol particle samples from dust storm and non-dust storm periods were determined for three sites in or near the source regions of Chinese dust. The mass of particulate material in the atmosphere at the sites is dominated by mineral aerosol particles. An absolute principal component analysis of the non-dust storm elemental data for the loess region allows the estimation of the mass contributions from two coarse-particle classes (soil dust and dust associated with pollutants), and two fine-particle classes (soil dust and anomalously enriched). For most elements (Al, Si, Ca, Fe, Ti, K, S and As), the mass-particle size distributions (MSDs) were approximately log-normal. The mass-median diameters (MMDs) of the soil-derived elements tended to decrease with distance from the desert region and when the dust storms subsided. Total dry deposition velocities were calculated by fitting a log-normal distribution to the aerosol data and calculating deposition rates for 100 particle-size intervals using a two-layer deposition model. The mean dry-deposition rates and fluxes were highest during dust storms over desert regions. In thloess region, the calculated dry deposition velocities of soil derived elements (Al, Si, Ca, Fe and Ti) during non-dust storm periods were from 3.1 to 3.7 cm s -1. From the estimated mass-particles size distributions, the coarser and finer mineral particles were found to benriched with Ca, Fe, Ti and K relative to Al or Si. On a yearly basis, the dry atmospheric input to the Loess Plateau was mainly attributable to normal transport processes, i.e. non-dust storm conditions. Wet deposition fluxes estimated from scavenging ratios indicate that dry deposition dominated the total atmospheric deposition of mineral aerosol. The deposition of aerosol particles associated with coal burning or other anthropogenic sources also was considerable on the Loess Plateau.

  16. Variation in elemental intensities among teeth and between pre- and postnatal regions of enamel.


    Dolphin, Alexis E; Goodman, Alan H; Amarasiriwardena, Dulasiri D


    Microspatial analyses of the trace element composition of dental enamel are made possible using laser ablation-inductively coupled plasma-mass spectrometry (LA-ICP-MS). Fine spatial resolution, multielement capabilities, and minimal sample destruction make this technique particularly well-suited for documenting the distribution of elements in sequentially calcifying layers of enamel. Because deciduous enamel forms from week 13 in utero up to 9 months postnatally (thereafter essentially becoming inert), the application of LA-ICP-MS allows for the retrospective measurement of prenatal and early postnatal trace-element uptake during a critical period of child development. In this study, we compared intra- and intertooth intensities of 25Mg, 57Fe, 66Zn, 68Zn, 88Sr, 138Ba, and 208Pb via LA-ICP-MS of 38 exfoliated deciduous incisors and canines donated by 36 participants in the Solís Valley Mexico Nutrition Collaborative Research Support Program (NCRSP). Pre- and postnatal comparisons within teeth showed significant increases (P < 0.001) and greater variation in the abundance of all isotopes in postnatal enamel, with the exception of a decrease in 25Mg (P < 0.001) and constant values for 88Sr (P = 0.681). Conversely, comparisons by tooth type and mouth quadrant revealed few significant differences between teeth of the same individual. We argue that more variation in the trace element composition of teeth occurs across developmental areas within a tooth than among different teeth of the same person. This study further demonstrates that sequentially calcifying areas of enamel have different chemical concentrations. The results support the use of microspatial analyses of enamel for understanding changes in nutrition, pollution, and residence.

  17. Environmental Controls on River Assemblages at the Regional Scale: An Application of the Elements of Metacommunity Structure Framework

    PubMed Central

    Tonkin, Jonathan D.; Sundermann, Andrea


    Understanding factors that structure regional biodiversity is important for linking ecological and biogeographic processes. Our objective was to explore regional patterns in riverine benthic invertebrate assemblages in relation to their broad positioning along the river network and examine differences in composition, biodiversity (alpha and beta diversity), and environmental drivers. We up-scaled methods used to examine patterns in metacommunity structure (Elements of Metacommunity Structure framework) to examine faunal distribution patterns at the regional extent for 168 low-mountain stream invertebrate assemblages in central Germany. We then identified the most influential environmental factors using boosted regression trees. Faunal composition patterns were compartmentalised (Clementsian or quasi-Clementsian), with little difference from headwaters to large rivers, potentially reflecting the regional scale of the study, by crossing major catchment boundaries and incorporating different species pools. While idealised structures did not vary, environmental drivers of composition varied considerably between river sections and with alpha diversity. Prediction was substantially weaker, and the importance of space was greater, in large rivers compared to other sections suggesting a weakening in species sorting downstream. Further, there was a stronger transition in composition than for alpha diversity downstream. The stronger links with regional faunal composition than with richness further emphasises the importance of considering the alternative ways in which anthropogenic stressors are operating to affect biodiversity patterns. Our approach allowed bridging the gap between local (or metacommunity) and regional scales, providing key insights into drivers of regional biodiversity patterns. PMID:26270550

  18. Natural trace element enrichment in fishes from a volcanic and tectonically active region (Azores archipelago)

    NASA Astrophysics Data System (ADS)

    Raimundo, Joana; Vale, Carlos; Caetano, Miguel; Giacomello, Eva; Anes, Bárbara; Menezes, Gui M.


    Seamounts, in general, are thought to support high biodiversity and special biological communities. They have been targeted by commercial fishing for demersal and pelagic fish species due to the occurrence of large aggregations in mid- and deep-water. Specimens of Phycis phycis, Helicolenus dactylopterus, Pontinus kuhlii, Beryx splendens, Beryx decadactylus, Etmopterus pusillus, Mora moro, Pagellus bogaraveo, Deania profundorum, Scomber colias and Trachurus picturatus were collected at the Condor seamount and on the slopes of Faial and Pico islands of Azores archipelago. Concentrations of V, Cr, Mn, Co, Ni, Cu, Zn, As, Se, Cd and Pb were determined in muscle and liver of each individual. Values of the 11 trace elements in the two tissues of the benthopelagic and benthic specimens, from the two surveyed areas, presented a significant inter-specific variation. In general, levels were lower in muscle than in liver, and negative relations between weight and Co, Mn, Zn, As, Cd and Pb concentrations in muscle and liver of three species were found. Pagellus bogaraveo, S. colias and T. picturatus presented enhanced elemental concentrations in liver, particularly of Cd. The extremely high storage of this potentially toxic element suggests a response to high uptake of Cd and the existence of an additional natural source of Cd to the environment.

  19. A novel tracer technique to quantify the atmospheric flux of trace elements to remote ocean regions

    NASA Astrophysics Data System (ADS)

    Kadko, David; Landing, William M.; Shelley, Rachel U.


    Atmospheric input into the global ocean constitutes an important budgetary component of numerous chemical species and plays a key role in controlling biogeochemical processes in the ocean. Assessment of this input is difficult, however, because measurements of deposition rates to the ocean, particularly in remote areas, are rare and susceptible to problems of temporal and spatial variability. While the collection and analysis of aerosol samples is somewhat routine, the chemical concentration data collected from ship board or land-based aerosol samplers in and of themselves cannot yield the deposition flux of trace elements; a method is required to transform concentration measurements into flux. The ability to derive the atmospheric flux of 7Be from its ocean inventory provides a key linkage between the atmospheric concentration of chemical species and their deposition to the ocean. We have demonstrated that estimates of the atmospheric flux of trace elements (TEs) can be made by multiplying the ocean inventory of 7Be x [TE/7Be] ratio in bulk aerosols. Flux estimates for trace elements made by the 7Be ocean inventory method were comparable to fluxes derived from rain samples collected on the island of Bermuda. The situation at Bermuda allows such testing to be made, where ocean-based methods can be calibrated by convenient land locations. Our results suggest that this method would be useful for remote areas where fixed sampling stations do not exist; that is, the majority of the global ocean.

  20. Sources of particulate matter components in the Athabasca oil sands region: investigation through a comparison of trace element measurement methodologies

    NASA Astrophysics Data System (ADS)

    Phillips-Smith, Catherine; Jeong, Cheol-Heon; Healy, Robert M.; Dabek-Zlotorzynska, Ewa; Celo, Valbona; Brook, Jeffrey R.; Evans, Greg


    The province of Alberta, Canada, is home to three oil sands regions which, combined, contain the third largest deposit of oil in the world. Of these, the Athabasca oil sands region is the largest. As part of Environment and Climate Change Canada's program in support of the Joint Canada-Alberta Implementation Plan for Oil Sands Monitoring program, concentrations of trace elements in PM2. 5 (particulate matter smaller than 2.5 µm in diameter) were measured through two campaigns that involved different methodologies: a long-term filter campaign and a short-term intensive campaign. In the long-term campaign, 24 h filter samples were collected once every 6 days over a 2-year period (December 2010-November 2012) at three air monitoring stations in the regional municipality of Wood Buffalo. For the intensive campaign (August 2013), hourly measurements were made with an online instrument at one air monitoring station; daily filter samples were also collected. The hourly and 24 h filter data were analyzed individually using positive matrix factorization. Seven emission sources of PM2. 5 trace elements were thereby identified: two types of upgrader emissions, soil, haul road dust, biomass burning, and two sources of mixed origin. The upgrader emissions, soil, and haul road dust sources were identified through both the methodologies and both methodologies identified a mixed source, but these exhibited more differences than similarities. The second upgrader emissions and biomass burning sources were only resolved by the hourly and filter methodologies, respectively. The similarity of the receptor modeling results from the two methodologies provided reassurance as to the identity of the sources. Overall, much of the PM2. 5-related trace elements were found to be anthropogenic, or at least to be aerosolized through anthropogenic activities. These emissions may in part explain the previously reported higher levels of trace elements in snow, water, and biota samples collected

  1. Ethanol activates cAMP response element-mediated gene expression in select regions of the mouse brain.


    Asyyed, Asma; Storm, Daniel; Diamond, Ivan


    The specific brain regions that contribute to behavioral changes produced by ethanol are not clearly understood. We know that cAMP-PKA signaling has been strongly implicated in the CNS effects of ethanol. Ethanol promotes activation and translocation of the PKA catalytic subunit (Calpha) into the nucleus in cell lines and primary neuronal cultures. PKA Calpha translocation to the nucleus is followed by cAMP Response Element protein phosphorylation (pCREB) and cAMP Response Element (CRE)-mediated gene expression. Here, we use X-gal histochemistry to map CRE-mediated gene transcription in the brain of CRE-lacZ transgenic mice following ethanol injection. 3 h after i.p. ethanol injection (3.2 g/kg, 16% wt/vol.), the number of X-gal positive cells was increased in the nucleus accumbens (202 +/- 63 cells/field compared to 71 +/- 47 cells/field in saline injected controls, P < 0.05 by paired t-test, n = 10). Similar increases were found in other mesolimbic areas and brain regions associated with rewarding and addictive responses. These include: prefrontal cortex, lateral and medial septum, basolateral amygdala, paraventricular and anterior hypothalamus, centromedial thalamus, CA1 region of hippocampus and dentate gyrus, substantia nigra pars compacta, ventral tegmental area, geniculate nucleus and the superior colliculus. these results confirm and extend current concepts that ethanol stimulates cAMP-PKA signaling in brain regions involved in CNS responses to ethanol.

  2. The FSHD region on human chromosome 4q35 contains potential coding regions among pseudogenes and a high density of repeat elements.


    van Geel, M; Heather, L J; Lyle, R; Hewitt, J E; Frants, R R; de Jong, P J


    The distal end of chromosome 4q contains the locus involved in facioscapulohumeral muscular dystrophy (FSHD1). Specific genomic deletions within a tandem DNA repeat (D4Z4) are associated with the disease status, but no causal genes have yet been discovered. In a systematic search for genes, a 161-kb stretch of genomic DNA proximal to D4Z4 was sequenced, analyzed for homologies, and subjected to gene prediction programs. A major fraction (45%) of the subtelomeric region is composed of repeat sequences attributable mainly to LINE-1 elements. Apart from the previously identified FRG1 and TUB4q sequences, several additional potential coding regions were identified by analyzing the sequence with exon prediction programs. So far, we have been unable to demonstrate transcripts by RT-PCR or cDNA library hybridization. However, several retrotransposed pseudogenes were identified. The high density of pseudogenes and repeat elements is consistent with the subtelomeric location of this region and explains why previous transcript identification studies have been problematic.

  3. Reconfiguration of nucleosome-depleted regions at distal regulatory elements accompanies DNA methylation of enhancers and insulators in cancer

    PubMed Central

    Taberlay, Phillippa C.; Statham, Aaron L.; Kelly, Theresa K.


    It is well established that cancer-associated epigenetic repression occurs concomitant with CpG island hypermethylation and loss of nucleosomes at promoters, but the role of nucleosome occupancy and epigenetic reprogramming at distal regulatory elements in cancer is still poorly understood. Here, we evaluate the scope of global epigenetic alterations at enhancers and insulator elements in prostate and breast cancer cells using simultaneous genome-wide mapping of DNA methylation and nucleosome occupancy (NOMe-seq). We find that the genomic location of nucleosome-depleted regions (NDRs) is mostly cell type specific and preferentially found at enhancers in normal cells. In cancer cells, however, we observe a global reconfiguration of NDRs at distal regulatory elements coupled with a substantial reorganization of the cancer methylome. Aberrant acquisition of nucleosomes at enhancer-associated NDRs is associated with hypermethylation and epigenetic silencing marks, and conversely, loss of nucleosomes with demethylation and epigenetic activation. Remarkably, we show that nucleosomes remain strongly organized and phased at many facultative distal regulatory elements, even in the absence of a NDR as an anchor. Finally, we find that key transcription factor (TF) binding sites also show extensive peripheral nucleosome phasing, suggesting the potential for TFs to organize NDRs genome-wide and contribute to deregulation of cancer epigenomes. Together, our findings suggest that “decommissioning” of NDRs and TFs at distal regulatory elements in cancer cells is accompanied by DNA hypermethylation susceptibility of enhancers and insulator elements, which in turn may contribute to an altered genome-wide architecture and epigenetic deregulation in malignancy. PMID:24916973

  4. Endothelin-1 expression is strongly repressed by AU-rich elements in the 3'-untranslated region of the gene.


    Reimunde, Francisco M; Castañares, Cristina; Redondo-Horcajo, Mariano; Lamas, Santiago; Rodríguez-Pascual, Fernando


    The regulation of the synthesis of the endothelial-derived vasoconstrictor ET-1 (endothelin-1) is a complex process that occurs mainly at the mRNA level. Transcription of the gene accounts for an important part of the regulation of expression, as already described for different modulators such as the cytokine TGF-beta (transforming growth factor-beta). However, very little is known about mechanisms governing ET-1 expression at the post-transcriptional level. The aim of the present study was to investigate the regulation of the ET-1 expression at this level. Since the 3'-UTR (3'-untranslated region) of mRNAs commonly contains genetic determinants for the post-transcriptional control of gene expression, we focused on the potential role of the 3'-UTR of ET-1 mRNA. Experiments performed with luciferase reporter constructs containing the 3'-UTR showed that this region exerts a potent destabilizing effect. Deletional analyses allowed us to locate this activity within a region at positions 924-1127. Some (but not all) of the AREs (AU-rich elements) present in this region were found to be essential for this mRNA-destabilizing activity. We also present evidence that cytosolic proteins from endothelial cells interact specifically with these RNA elements, and that a close correlation exists between the ability of the AREs to destabilize ET-1 mRNA and the binding of proteins to these elements. Our results are compatible with the existence of a strong repressional control of ET-1 expression mediated by destabilization of the mRNA exerted through the interaction of specific cytosolic proteins with AREs present in the 3'-UTR of the gene.

  5. Regional PIXE facility at Chandigarh (India) and Trace Element Analysis of Aerosol and Bio-medical Samples

    NASA Astrophysics Data System (ADS)

    Govil, I. M.


    A regional Proton induced X-ray Emission (PIXE) facility is newly developed using 3 Mev Proton beam from Variable Energy Cyclotron, Panjab University, Chandigarh (India). A new target chamber has been designed to cater for Proton Induced Gamma Emission (PIGE) and Rutherford Back Scattering (RBS) along with PIXE measurements. The HPGe x-ray detector, the Ge (Li) gamma-ray detector and a silicon surface barrier (SSB) detector can be mounted simultaneously in the chamber for this purpose. A remotely controlled stepper motor is provided to move the target wheel holding 12/24 samples at a time. This facility is now routinely used for the detection of trace elements in the aerosol, medical and forensic science samples. The paper presents the analysis of Aerosol samples collected from highly polluted steel city of Mandi Govindgarh in Punjab state and relatively clean city of Jammu in Jammu & Kashmir region. The results from the analysis of these samples show some basic differences in the trace element profile of the two cities. The paper also describes the trace element analysis of fly ash in the vicinity of Ropar Thermal Power plant in Punjab. The scope of this study was to determine the concentration and composition of atmospheric particulate matter (PM) in the vicinity of coal-fired thermal power plants in India. The data taken for the Bio-medical samples are also discussed.

  6. [The peculiarities of deposition of foreign particles in the skin region experimentally damaged by the electrical saw cutting element].


    Nazarov, Yu V


    The objective of the present study was to detect the deposition of foreign particles and other introduced objects in the human skin region damaged by the electrical saw cutting elements and to use the data thus obtained for the estimation of the speed and the type of the instrument, the main characteristics of the cutter covering and/or composition of its surface. The experiments included the sawing of the skin fragments using the small steel saws differing in the type of the surface cover, such as the uncoated (steel), stained, nickel- or chromium-plated, blue-finished saws with the movement speed of the cutting element 500, 1000, 2500, 2,000, and 3,000 revolutions per minute. The study provided information about the peculiarities of deposition of foreign particles and other introduced objects in the damaged regions of the human skin that allow not only to establish the fact of using the electrical saw with a high-speed back-and-forth movements of the cutting element but also the type of the instrument and the main characteristics of its cover and/or the composition of its surface.

  7. A Meiotic Drive Element in the Maize Pathogen Fusarium verticillioides Is Located Within a 102 kb Region of Chromosome V

    PubMed Central

    Pyle, Jay; Patel, Tejas; Merrill, Brianna; Nsokoshi, Chabu; McCall, Morgan; Proctor, Robert H.; Brown, Daren W.; Hammond, Thomas M.


    Fusarium verticillioides is an agriculturally important fungus because of its association with maize and its propensity to contaminate grain with toxic compounds. Some isolates of the fungus harbor a meiotic drive element known as Spore killer (SkK) that causes nearly all surviving meiotic progeny from an SkK × Spore killer-susceptible (SkS) cross to inherit the SkK allele. SkK has been mapped to chromosome V but the genetic element responsible for meiotic drive has yet to be identified. In this study, we used cleaved amplified polymorphic sequence markers to genotype individual progeny from an SkK × SkS mapping population. We also sequenced the genomes of three progeny from the mapping population to determine their single nucleotide polymorphisms. These techniques allowed us to refine the location of SkK to a contiguous 102 kb interval of chromosome V, herein referred to as the Sk region. Relative to SkS genotypes, SkK genotypes have one extra gene within this region for a total of 42 genes. The additional gene in SkK genotypes, herein named SKC1 for Spore Killer Candidate 1, is the most highly expressed gene from the Sk region during early stages of sexual development. The Sk region also has three hyper-variable regions, the longest of which includes SKC1. The possibility that SKC1, or another gene from the Sk region, is an essential component of meiotic drive and spore killing is discussed. PMID:27317777

  8. [Additional skeletal elements in the nasal skull structure of Phocoena phocoena and the development of the nasal region in toothed whales].


    Klima, M; van Bree, P J


    Small nasal ossicles, occasionally occurring on the caudal border of the premaxillary bones in Phocoena and some other toothed whales (Odontoceti) up to now, were considered the remnants of maxilloturbinalia. The latter, however, originate from the cartilaginous lateral wall of the embryonal nasal capsule, whereas the ossicles mentioned are remnants of the nasal floor cartilages. These additional nasal structures are homologous with the lamina transversalis anterior, and also contain the material of the cartilago paraseptalis. In comparison with the quadrupedal terrestrial mammals, the skull of odontocetes shows some important differences in development. In the nasal region, the nasal tract is shifted backward from the top of the snout to the vertex of the head, while the bony rostrum projects far forward. These changes can already be observed during the early morphogenesis of skull. We have examined embryos of Phocoena, Lagenorhynchus, and Monodon, 16 different developmental stages altogether, representing the most complete material ever examined for this purpose. There is a marked developmental trend from a complicated nasal capsule, consisting of many isolated cartilages, to a simple reduced structure, being composed of some fused cartilages only. Whereas Monodon, Lagenorhynchus, and Globicephala still possess some of the original ancestral features, common to all mammals, Phocoena in this respect is the most advanced odontocete which has been investigated so far. In Phocoena, the tectum nasi and the lateral wall of the nasal capsule are widely reconstructed in embryonal life, turned upright and displaced caudally; thus it lies immediately in front of neurocranium. The floor of the original nasal capsule persists in 2 elements only, the lamina transversalis anterior and the paraseptal cartilage, both largely fusing with each other and losing their connection with the lateral nasal wall. During early morphogenesis they move to the top of the head, expanding along

  9. Trace elements in the Mississippi River Delta outflow region: Behavior at high discharge

    SciTech Connect

    Shiller, A.M. ); Boyle, E.A. )


    Samples for dissolved trace element analysis were collected in surface waters of the plume of the Mississippi River during a period of high river discharge. These field data are compared with results of laboratory mixing experiments. The studies show that Cu, Ni, and Mo are largely unreactive in the plume. Surprisingly, Fe also appears to show little reactivity; the pronounced flocculation removal of Fe frequently observed in other estuaries is not seen in this system. This difference may be a consequence of the alkaline nature of the Mississippi which results in low dissolved Fe concentrations in the river (<50 nmol/kg). Zinc, another particle-reactive element, also shows little reactivity. This lack of reactivity for Zn, as well as Cu and Ni, is partly a result of the short residence time of plume waters in shallow areas affected by sedimentary interactions. The chromium distribution shows apparent non-conservative behavior indicative of estuarine removal; however, temporal variations in river concentrations is a more likely explanation for this behavior. For some of the elements, complex distributions occur as a consequence of the interplay of physical-chemical and/or biological processes with the dynamic mixing regime. For Cd, desorption from the suspended load plays a major role in determining the distribution. However, sedimentary input may also play a role in the spatial variability of Cd. For V, biological uptake in the plume exerts a strong influence on its distribution. At the time of this study, uptake was large enough to consume both the river flux of V as well as a substantial amount of vanadium supplied by the ocean.

  10. The REgolith X-Ray Imaging Spectrometer (REXIS) for OSIRIS-REx: identifying regional elemental enrichment on asteroids

    NASA Astrophysics Data System (ADS)

    Allen, Branden; Grindlay, Jonathan; Hong, Jaesub; Binzel, Richard P.; Masterson, Rebecca; Inamdar, Niraj K.; Chodas, Mark; Smith, Matthew W.; Bautz, Marshall W.; Kissel, Steven E.; Villasenor, Joel; Oprescu, Miruna; Induni, Nicholas


    The OSIRIS-REx Mission was selected under the NASA New Frontiers program and is scheduled for launch in September of 2016 for a rendezvous with, and collection of a sample from the surface of asteroid Bennu in 2019. 101955 Bennu (previously 1999 RQ36) is an Apollo (near-Earth) asteroid originally discovered by the LINEAR project in 1999 which has since been classified as a potentially hazardous near-Earth object. The REgolith X-Ray Imaging Spectrometer (REXIS) was proposed jointly by MIT and Harvard and was subsequently accepted as a student led instrument for the determination of the elemental composition of the asteroid's surface as well as the surface distribution of select elements through solar induced X-ray fluorescence. REXIS consists of a detector plane that contains 4 X-ray CCDs integrated into a wide field coded aperture telescope with a focal length of 20 em for the detection of regions with enhanced abundance in key elements at 50 m scales. Elemental surface distributions of approximately 50-200 m scales can be detected using the instrument as a simple collimator. An overview of the observation strategy of the REXIS instrument and expected performance are presented here.

  11. [Determination of metal elements in whole Tetraena Mongolia Maxim from West Erdos Region of Inner Mongolia by ICP-AES].


    Liu, Ying; Li, Jing-feng; Feng, Jin-zhao


    The sand storm has become a global environmental problem. Since desert woody plants have many special biological characteristics, they play an important role in improving ecological environment and so on. In the present paper, the contents of ordinary and trace metal elements in whole Tetraena Mongolia Maxim, which only exists in West Erdos Region of Inner Mongolia in the world and is protected and endangered national second-class species, were determined by ICP-AES technique and compared with other desert woody plants. The results indicated that the ordinary elements Ca, K, Mg, Na and Al and the trace elements essential to plant vital activities, such as Fe, Mn, Cu and Zn show different content orders in different parts of the plant. For example, the content orders are Ca>Na>Mg>Al>K>Fe>Cu>Mn>Zn for both main root and old root. In twig and leaf, however, the order is Ca>Na>Mg>Al>K>Fe>Mn>Cu>Zn, while in fibrous root the order is K>Ca>Na>Mg>Al>Fe>Cu>Mn>Zn. The element contents of Mn and Zn are lower than the average content of terrestrial plants. The recovery ratio obtained by standard addition method ranged between 94.98% and 120.0%, and its RSD was lower than 3. 5% with a good precision. The results provide theoretical directions for protecting and exploiting vegetable resource of the endangered and wilding plant.

  12. Element tracers of source regions of contaminants in precipitation. Fourth quarterly report

    SciTech Connect

    Rahn, K.A.


    Activity was continued on the following projects: each rain at Narragansett was collected and analyzed with its corresponding aerosol samples. The rain-sampling procedure was improved. Analytical blanks associated with the plastic bags were reduced by large factors. The precipitation and aerosol data are being examined for systematic features. In addition: we have begun an informal cooperative effort to apply our analytical technique to measuring elemental abundances in several waterways of Rhode Island, in conjunction with Rhode island College. We are laying more concrete plans to expand our study of precipitation and aerosol in China. Each of these topics is discussed in more detail.

  13. Trace element geochemistry of Jurassic coals from Eastern Black Sea Region, NE-Turkey

    SciTech Connect

    Cebi, F.H.; Korkmaz, S.; Akcay, M.


    The majority of coal deposits in the world are of Carboniferous and Tertiary age but Jurassic coals are seldom present. They are also exposed in northern Turkey and occur both at the lower and upper sections of the Liassic-Dogger volcanic- and volcani-clastic series. The coals at the base of the Jurassic units are characterized by higher Ba, Th, Zr, and Cr-Ni and lower S values than those at the top of the units, indicating, in general, laterally consistent trace element contents. The vertical distribution of trace elements in individual coal seams is also rather consistent. The B contents of coals from the Godul and Norsun areas vary from 1.5 to 4.3 ppm whereas those from the Alansa area are in the range of 95 to 138 ppm. This suggests that the coals in the Godul and Norsun areas were deposited in a swamp environment inundated by the sea from time to time, whereas coals of the Alansa were deposited in a saline environment.

  14. A case of small round cell tumor of the thoracopulmonary region with myogenic and neurogenic elements.


    Goji, J; Sano, K; Murakami, R; Nakamura, H; Ninomiya, M; Ito, H


    We here report a unique case of a young boy with an intrathoracic tumor which consisted of neurogenic and myogenic elements. The initial pathological diagnosis was alveolar rhabdomyosarcoma. The tumor tissue from surgical resection was composed of three parts, each showing a different histological appearance, i.e. a monotonous small cell area, an alveolar area, and an area consisting of pleomorphic rhabdomyoblasts. The small round cells in the monotonous area were immunoreactive with the antibodies for Leu7, neuron-specific enolase (NSE), neurofilament proteins (NFP), and beta 2 microglobulin, but not with the antibody for desmin. These cells also had dense core granules. The tumor cells in the alveolar area were immunoreactive with the antibodies for Leu7 and desmin, but not with the antibody for NFP. Pleomorphic rhabdomyoblasts were immunoreactive with the antibody for desmin, but not with the antibodies for Leu7 and NFP. These findings imply that this tumor consisted of neurogenic and myogenic elements and is considered to be a special type of rhabdomyosarcoma.

  15. [The correlation of allergic rhinitis and trace elements in Ningxia region].


    Ma, Ruixia; Shen, Yueling; Hou, Li; Yang, Zhichao; Feng, Ningyu; Yan, Xiaohui; Shao, Hui; Gao, Xiaoping; Di, Lingling


    To investigate the correlation of allergic rhinitis and trace elements and to provide a reference for clinical diagnosis, treatment and prevention of allergic rhinitis. One hundred and six patients were diagnosed as allergic rhinitis in General Hospital of Ningxia Medical University between January and December in 2010, including 48 cases of perennial allergic rhinitis and 58 cases of seasonal allergic rhinitis. In the same time, one hundred and three healthy volunteers were selected as control. Intravenous blood 3-5 ml were obtained from all subjects both in experimental group and in control group. The content of Ca, Ni, Fe, Mg, Zn, Sr, Mn, Cu, Se in serum and hair was determined by inductively coupled plasma atomic emission spectrometry (ICP-AES). The t-test (SPSS 16.0) was used to compare the results of trace elements in serum between allergic rhinitis and control group. The testing results of trace elements in AR patients serum and normal controls serum were as follows: Cu, Ni (1 002.18 ± 104.62) µg/L, (21.58 ± 5.54) mg/L were super than control group, (832.78 ± 50.45) µg/L, (17.04 ± 4.93) mg/L (t value was 15.545, 5.154, both P < 0.05). But the content of Zn, Se (793.48 ± 46.88) µg/L, (84.25 ± 12.77) µg/L lower than control group (908.53 ± 31.26) µg/L, (98.35 ± 15.21) µg/L (t value was -24.175 and -7.797, both P < 0.05) . The testing results of trace elements in AR patients hair and normal controls hair were as follows: Cu, Ni (42.43 ± 5.03) µg/g, (31.72 ± 5.49) µg/g were super than control group, (23.00 ± 4.45) µg/g, (8.94 ± 7.53) µg/g (t value was -8.633 and 4.236, both P < 0.05). But the content of Zn, Se (92.16 ± 4.54) µg/g , (0.28 ± 0.04) µg/g lower than control group (189.09 ± 8.45) µg/g, (0.39 ± 0.06) µg/g (t value was -28.71 and -8.633, both P < 0.05). The content of Zn, Se in AR patients serum are lower than that in control group. But the content of Cu, Ni in AR patients serum are super than that in control group. There

  16. Measurements of L to M shell vacancy transfer probabilities for the elements in the atomic region 70 <= Z <= 92

    NASA Astrophysics Data System (ADS)

    Puri, S.; Mehta, D.; Chand, B.; Singh, Nirmal; Trehan, P. N.


    The probabilities for vacancy transfer from L to M shell, ¯gh LM, are deduced for 15 elements in the atomic region 70 ≤ Z ≤ 92 by measuring the M X-ray yields from the targets excited by 5.96 and 22.6 keV incident photons, i.e. below and above the L-edge of the elements and using the theoretical L and M shell photoionisation cross-sections. These results are compared with the theoretical values based on the relativistic Dirac-Hartree-Slater (RDHS) and the nonrelativistic approximate Herman-Skillman (AHS) calculations. From the comparison, it is concluded that the onset of L 1-L 3M 5 Coster-Kronig transition occurs at Z = 75 as predicted by the RDHS model based Coster-Kronig transition energy calculations.

  17. BLG-e1 - a novel regulatory element in the distal region of the beta-lactoglobulin gene promoter.


    Reichenstein, Moshe; German, Tania; Barash, Itamar


    beta-Lactoglobulin (BLG) is a major ruminant milk protein. A regulatory element, termed BLG-e1, was defined in the distal region of the ovine BLG gene promoter. This 299-bp element lacks the established cis-regulatory sequences that affect milk-protein gene expression. Nevertheless, it alters the binding of downstream BLG sequences to histone H4 and the sensitivity of the histone-DNA complexes to trichostatin A treatment. In mammary cells cultured under favorable lactogenic conditions, BLG-e1 acts as a potent, position-independent silencer of BLG/luciferase expression, and similarly affects the promoter activity of the mouse whey acidic protein gene. Intragenic sequences upstream of BLG exon 2 reverse the silencing effect of BLG-e1 in vitro and in transgenic mice.

  18. Cap-independent translation of poliovirus mRNA is conferred by sequence elements within the 5' noncoding region.

    PubMed Central

    Pelletier, J; Kaplan, G; Racaniello, V R; Sonenberg, N


    Poliovirus polysomal RNA is naturally uncapped, and as such, its translation must bypass any 5' cap-dependent ribosome recognition event. To elucidate the manner by which poliovirus mRNA is translated, we have determined the translational efficiencies of a series of deletion mutants within the 5' noncoding region of the mRNA. We found striking differences in translatability among the altered mRNAs when assayed in mock-infected and poliovirus-infected HeLa cell extracts. The results identify a functional cis-acting element within the 5' noncoding region of the poliovirus mRNA which enables it to translate in a cap-independent fashion. The major determinant of this element maps between nucleotides 320 and 631 of the 5' end of the poliovirus mRNA. We also show that this region (320 to 631), when fused to a heterologous mRNA, can function in cis to render the mRNA cap independent in translation. Images PMID:2835660

  19. Translational efficiency of poliovirus mRNA: mapping inhibitory cis-acting elements within the 5' noncoding region.

    PubMed Central

    Pelletier, J; Kaplan, G; Racaniello, V R; Sonenberg, N


    Poliovirus mRNA contains a long 5' noncoding region of about 750 nucleotides (the exact number varies among the three virus serotypes), which contains several AUG codons upstream of the major initiator AUG. Unlike most eucaryotic mRNAs, poliovirus does not contain a m7GpppX (where X is any nucleotide) cap structure at its 5' end and is translated by a cap-independent mechanism. To study the manner by which poliovirus mRNA is expressed, we examined the translational efficiencies of a series of deletion mutants within the 5' noncoding region of the mRNA. In this paper we report striking translation system-specific differences in the ability of the altered mRNAs to be translated. The results suggest the existence of an inhibitory cis-acting element(s) within the 5' noncoding region of poliovirus (between nucleotides 70 and 381) which restricts mRNA translation in reticulocyte lysate, wheat germ extract, and Xenopus oocytes, but not in HeLa cell extracts. In addition, we show that HeLa cell extracts contain a trans-acting factor(s) that overcomes this restriction. Images PMID:2836606

  20. Cap-independent translation of poliovirus mRNA is conferred by sequence elements within the 5' noncoding region

    SciTech Connect

    Pelletier, J.; Kaplan, G.; Racaniello, V.R.; Sonenberg, N.


    Poliovirus polysomal RNA is naturally uncapped, and as such, its translation must bypass any 5' cap-dependent ribosome recognition event. To elucidate the manner by which poliovirus mRNA is translated, the authors determined the translational efficiencies of a series of deletion mutants within the 5' noncoding region of the mRNA. They found striking differences in translatability among the altered mRNAs when assayed in mock-infected and poliovirus-infected HeLa cell extracts. The results identify a functional cis-acting element within the 5' noncoding region of the poliovirus mRNA which enables it to translate in a cap-independent fashion. The major determinant of this element maps between nucleotides 320 and 631 of the 5' end of the poliovirus mRNA. They also show that this region (320 to 631), when fused to a heterologous mRNA, can function in cis to render the mRNA cap independent in translation.

  1. Biomarker responses of rice plants growing in a potentially toxic element polluted region: A case study in the Le'An Region.


    Ji, Yong; Zhang, Jie; Li, Xiaoli; Peng, Yongwen; Cai, Gaotang; Gao, Guiqing; Wu, Jianqiang; Liu, Jiali


    Rice plants, planted and grown in the field, were chosen in this study to evaluate the potentially toxic element pollution by combining pollutant analysis and a molecular biomarker response evaluation together in the Le'An Region, a highly polluted area due to anthropogenic activities. Soils and crops at 18 sites classified into four areas based on hydrological, geological and pollutant survey results were collected during the whole growth cycle for chemical and biological analysis. Sediment quality values and pollution indexes were combined with statistical analyses to assess the hazard of potentially toxic elements and evaluate ecological risks. As effective stress-related signals, chlorophyll (Chl), superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), glutathione content (GSH) and lipoperoxidation (as TBARS) were also determined during the rice plant growth period. The results revealed that heavy metal concentrations were significantly higher than corresponding background values and significantly related to those of the soils. The maximum concentration of potentially toxic elements was observed at the tillering stage, followed by the grain filling stage and heading stage. As biomarkers in field monitoring, a significant increase or decrease in Chl, SOD, POD, CAT, GSH and TBARS in crops means a potential relationship between the indexes and pollutants. This study also demonstrates that the integrated biomarker response (IBR) calculated by combining different biomarkers could be used effectively to evaluate the pollutant-induced stress levels in different areas. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Multiple Sclerosis in the Mount Etna Region: Possible Role of Volcanogenic Trace Elements

    PubMed Central

    Nicoletti, Alessandra; Bruno, Elisa; Nania, Martina; Cicero, Edoardo; Messina, Silvia; Chisari, Clara; Torrisi, Josita; Maimone, Davide; Marziolo, Roberto; Lo Fermo, Salvatore; Patti, Francesco; Giammanco, Salvatore; Zappia, Mario


    Background Trace elements have been hypothesised to be involved in the pathogenesis of Multiple Sclerosis and volcanic degassing is the major natural sources of trace elements. Both incidence of Multiple Sclerosis in Catania and volcanic activity of Mount Etna have been significantly increased during the last 30 years. Due to prevailing trade winds direction, volcanic gases from Etna summit craters are mostly blown towards the eastern and southern sectors of the volcano. Objective To evaluate the possible association between Multiple Sclerosis and exposure to volcanogenic trace elements. Methods We evaluated prevalence and incidence of Multiple Sclerosis in four communities (47,234 inhabitants) located in the eastern flank and in two communities (52,210 inhabitants) located in the western flank of Mount Etna, respectively the most and least exposed area to crater gas emissions. Results A higher prevalence was found in the population of the eastern flank compared to the population of the western one (137.6/100,000 versus 94.3/100,000; p-value 0.04). We found a borderline significantly higher incidence risk during the incidence study period (1980–2009) in the population of the eastern flank 4.6/100,000 (95% CI 3.1–5.9), compared with the western population 3.2/100,000 (95% CI 2.4–4.2) with a RR of 1.41 (95% CI 0.97–2.05; p-value 0.06). Incidence risks have increased over the time in both populations reaching a peak of 6.4/100,000 in the eastern flank and of 4.4/100.000 in the western flank during 2000–2009. Conclusion We found a higher prevalence and incidence of Multiple Sclerosis among populations living in the eastern flank of Mount Etna. According to our data a possible role of TE cannot be ruled out as possible co-factor in the MS pathogenesis. However larger epidemiological study are needed to confirm this hypothesis. PMID:24348986

  3. To Join or Not to Join: School Counselors as a Case Study in Professional Membership

    ERIC Educational Resources Information Center

    Bauman, Sheri


    School counselors were surveyed regarding their choice to join or not join their professional organization. Members and nonmembers differed on the following: whether participants' graduate program emphasized professional membership, membership status of colleagues, the belief that professional organizations advance the field, and the belief that…

  4. To Join or Not to Join: School Counselors as a Case Study in Professional Membership

    ERIC Educational Resources Information Center

    Bauman, Sheri


    School counselors were surveyed regarding their choice to join or not join their professional organization. Members and nonmembers differed on the following: whether participants' graduate program emphasized professional membership, membership status of colleagues, the belief that professional organizations advance the field, and the belief that…

  5. Assessment of contamination based on trace element concentrations in Gomphus flavipes (Odonata: Insect) larvae of the Upper Tisza Region.


    Simon, E; Kis, O; Jakab, T; Kolozsvári, I; Málnás, K; Harangi, S; Baranyai, E; Miskolczi, M; Tóthmérész, B; Dévai, Gy


    Odonata larvae are frequently used to assess the contamination of aquatic systems, because they tolerate a wide range of chemical and biological conditions in freshwater systems. In early 2000, the sediments of the Hungarian section of the River Tisza and the River Szamos were strongly enriched with heavy metals by an accidental mining spill. Earlier studies demonstrated higher contamination levels in the Szamos than in the Tisza, based on sediment analysis. The aim of our study was to assess the contamination in the Upper Tisza Region, along the upper reach of the Tisza, and the lower reach of the Szamos, based on the trace element concentrations of the Gomphus flavipes larvae. We collected 269 dragonfly specimens for the analyses. The Al, Ba, Cr, Cu, Fe, Mn, Pb, Sr and Zn element contents were analysed in the dragonfly larvae by microwave plasma atomic emission spectrometry (MP-AES). Significantly higher Ba and Cu concentrations were found in the dragonfly larvae of the Tisza than the Szamos. In spite of this, the Cr, Mn, Pb, Sr and Zn concentration was significantly lower in the dragonfly larvae of the Tisza than the Szamos. For all trace elements significant differences were found along the Tisza. Significant differences were also found in all trace element concentrations of dragonfly larvae among studied localities in the Szamos, except in the cases of Al and Ba. Our results demonstrated that the Szamos was more contaminated with Cr, Mn, Pb, Sr and Zn than the Tisza, but that the Tisza was more contaminated with Ba and Cu than the Szamos, based on the trace element concentrations in Gomphus flavipes larvae, which was likely to have been caused by the tributaries of the Tisza. In summary, our results indicated a continuous pollution of the Tisza and the Szamos and their tributaries.

  6. Identification of evolutionarily conserved, functional noncoding elements in the promoter region of the sodium channel gene SCN8A.


    Drews, Valerie L; Shi, Kehui; de Haan, Georgius; Meisler, Miriam H


    SCN8A is a major neuronal sodium channel gene expressed throughout the central and peripheral nervous systems. Mutations of SCN8A result in movement disorders and impaired cognition. To investigate the basis for the tissue-specific expression of SCN8A, we located conserved, potentially regulatory sequences in the human, mouse, chicken, and fish genes by 5' RACE of brain RNA and genomic sequence comparison. A highly conserved 5' noncoding exon, exon 1c, is present in vertebrates from fish to mammals and appears to define the ancestral promoter region. The distance from exon 1c to the first coding exon increased tenfold during vertebrate evolution, largely by insertion of repetitive elements. The mammalian gene acquired three novel, mutually exclusive noncoding exons that are not represented in the lower vertebrates. Within the shared exon 1c, we identified four short sequence elements of 10-20 bp with an unusually high level of evolutionary conservation. The conserved elements are most similar to consensus sites for the transcription factors Pou6f1/Brn5, YY1, and REST/NRSF. Introduction of mutations into the predicted Pou6f1 and REST sites reduced promoter activity in transfected neuronal cells. A 470-bp promoter fragment containing all of the conserved elements directed brain-specific expression of the LacZ reporter in transgenic mice. Transgene expression was highest in hippocampal neurons and cerebellar Purkinje cells, consistent with the expression of the endogenous gene. The compact cluster of conserved regulatory elements in SCN8A provides a useful target for molecular analysis of neuronal gene expression.

  7. Phytobarriers: Plants capture particles containing potentially toxic elements originating from mine tailings in semiarid regions.


    Sánchez-López, Ariadna S; Carrillo-González, Rogelio; González-Chávez, Ma Del Carmen Angeles; Rosas-Saito, Greta Hanako; Vangronsveld, Jaco


    Retention of particles containing potentially toxic elements (PTEs) on plants that spontaneously colonize mine tailings was studied through comparison of washed and unwashed shoot samples. Zn, Pb, Cd, Cu, Ni, Co and Mn concentrations were determined in plant samples. Particles retained on leaves were examined by Scanning Electronic Microscopy and energy dispersive X-Ray analysis. Particles containing PTEs were detected on both washed and unwashed leaves. This indicates that the thorough washing procedure did not remove all the particles containing PTEs from the leaf surface, leading to an overestimation of the concentrations of PTEs in plant tissues. Particularly trichomes and fungal mycelium were retaining particles. The quantity and composition of particles varied among plant species and place of collection. It is obvious that plants growing on toxic mine tailings form a physical barrier against particle dispersion and hence limit the spread of PTEs by wind.

  8. Regional Dissemination of a Trimethoprim-Resistance Gene Cassette via a Successful Transposable Element

    PubMed Central

    Opintan, Japheth A.; Bishar, Rima A.; Aboderin, A. Oladipo; Newman, Mercy J.; Lamikanra, Adebayo; Okeke, Iruka N.


    Background Antimicrobial resistance is a growing international problem. We observed a 50% increase in the prevalence of trimethoprim resistance among fecal Escherichia coli from healthy Nigerian students between 1998 and 2005, a trend to increase that continued in 2009. Methods and Findings A PCR-based screen revealed that 131 (43.1%) of isolates obtained in Nigeria in 2005 and 2009 carried integron-borne dfrA cassettes. In the case of 67 (51.1%) of these isolates, the cassette was a class 1-integron-borne dfrA7 gene, which has been reported at high prevalence from E. coli isolates from other parts of Africa. Complete sequencing of a 27 Kb dfrA7-bearing plasmid from one isolate located the dfrA7 gene within a Tn21-type transposon. The transposon also contained an IS26-derived bla/sul/str element, encoding resistance to β-lactams, sulphonamides and streptomycin, and mercury resistance genes. Although the plasmid backbone was only found in 12 (5.8%) of trimethoprim-resistant isolates, dfrA7 and other transposon-borne genes were detected in 14 (16.3%) and 32 (26.3%) of trimethoprim resistant isolates collected in Nigeria in 2005 and 2009, respectively. Additionally, 37 (19.3%) of trimethoprim-resistant E. coli isolates collected between 2006 and 2008 from Ghana were positive for the dfrA7 and a transposon marker, but only 4 (2.1%) harbored the plasmid backbone. Conclusions Our data point to transposition as a principal mechanism for disseminating dfrA7 among E. coli from Nigeria and Ghana. On-going intensive use of the affordable broad-spectrum antibacterials is likely to promote selective success of a highly prevalent transposable element in West Africa. PMID:22666464

  9. Trace element concentrations along a gradient of urban pressure in forest and lawn soils of the Paris region (France).


    Foti, Ludovic; Dubs, Florence; Gignoux, Jacques; Lata, Jean-Christophe; Lerch, Thomas Z; Mathieu, Jérôme; Nold, François; Nunan, Naoise; Raynaud, Xavier; Abbadie, Luc; Barot, Sébastien


    The concentration, degree of contamination and pollution of 7 trace elements (TEs) along an urban pressure gradient were measured in 180 lawn and wood soils of the Paris region (France). Iron (Fe), a major element, was used as reference element. Copper (Cu), cadmium (Cd), lead (Pb) and zinc (Zn) were of anthropogenic origin, while arsenic (As), chromium (Cr) and nickel (Ni) were of natural origin. Road traffic was identified as the main source of anthropogenic TEs. In addition, the industrial activity of the Paris region, especially cement plants, was identified as secondary source of Cd. Soil characteristics (such as texture, organic carbon (OC) and total nitrogen (tot N) contents) tell the story of the soil origins and legacies along the urban pressure gradient and often can explain TE concentrations. The history of the land-use types was identified as a factor that allowed understanding the contamination and pollution by TEs. Urban wood soils were found to be more contaminated and polluted than urban lawns, probably because woods are much older than lawns and because of the legacy of the historical management of soils in the Paris region (Haussmann period). Lawn soils are similar to the fertile agricultural soils and relatively recently (mostly from the 1950s onwards) imported from the surrounding of Paris, so that they may be less influenced by urban conditions in terms of TE concentrations. Urban wood soils are heavily polluted by Cd, posing a high risk to the biological communities. The concentration of anthropogenic TEs increased from the rural to the urban areas, and the concentrations of most anthropogenic TEs in urban areas were equivalent to or above the regulatory reference values, raising the question of longer-term monitoring. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Statistically significant strings are related to regulatory elements in the promoter regions of Saccharomyces cerevisiae

    NASA Astrophysics Data System (ADS)

    Hu, Rui; Wang, Bin


    Finding out statistically significant words in DNA and protein sequences forms the basis for many genetic studies. By applying the maximal entropy principle, we give one systematic way to study the nonrandom occurrence of words in DNA or protein sequences. Through comparison with experimental results, it was shown that patterns of regulatory binding sites in Saccharomyces cerevisiae ( yeast) genomes tend to occur significantly in the promoter regions. We studied two correlated gene families of yeast. The method successfully extracts the binding sites verified by experiments in each family. Many putative regulatory sites in the upstream regions are proposed. The study also suggested that some regulatory sites are active in both directions, while others show directional preference.

  11. Joining of porous silicon carbide bodies


    Bates, Carl H.; Couhig, John T.; Pelletier, Paul J.


    A method of joining two porous bodies of silicon carbide is disclosed. It entails utilizing an aqueous slip of a similar silicon carbide as was used to form the porous bodies, including the sintering aids, and a binder to initially join the porous bodies together. Then the composite structure is subjected to cold isostatic pressing to form a joint having good handling strength. Then the composite structure is subjected to pressureless sintering to form the final strong bond. Optionally, after the sintering the structure is subjected to hot isostatic pressing to further improve the joint and densify the structure. The result is a composite structure in which the joint is almost indistinguishable from the silicon carbide pieces which it joins.

  12. The joining of plastics and their composites

    NASA Astrophysics Data System (ADS)

    Menges, G.

    A review of joining techniques is conducted with specific attention given to the special characteristics of the materials in question and the effectiveness plastic-composite joining techniques. The materials discussed include polymeric and thermoplastic substances as well elastomers and thermosets. Molding processes and fastening procedures are described for these categories of materials, and specific treatment is given to thermoplastic and thermoset moldings and aerospace fasteners for fiber composites. The mechanism of gluing is described emphasizing surface preparation and the properties of various glue types. The welding of plastics is considered, and gluing and welding approaches are outlined for crafts/trades vs industrial applications. The review is of use in the selection of suitable joining technologies for plastic aerospace components.

  13. Joining Techniques for Ferritic ODS Alloys

    SciTech Connect

    V.G. Krishnardula; V.G. Krishnardula; D.E. Clark; T.C. Totemeier


    This report presents results of research on advanced joining techniques for ferritic oxide-dispersion strengthened alloys MA956 and PM2000. The joining techniques studied were resistance pressure welding (also known as pressure forge welding), transient liquid phase bonding, and diffusion bonding. All techniques were shown to produce sound joints in fine-grained, unrecrystallized alloys. Post-bond heat treatment to produce a coarse-grained, recrystallized microstructure resulted in grain growth across the bondline for transient liquid phase and diffusion bonds, giving microstructures essentially identical to that of the parent alloy in the recrystallized condition. The effects of bond orientation, boron interlayer thickness, and bonding parameters are discussed for transient liquid phase and diffusion bonding. The report concludes with a brief discussion of ODS joining techniques and their applicability to GEN IV reactor systems.

  14. The Missing Element: How to Integrate Existing Regional and Cultural Understanding at the GCC Level Effectively

    DTIC Science & Technology


    12 Bahaudin Mujtaba and Bina Patel, “McDonald’s Success Strategy and Global Expansion through Customer and Brand Loyalty ”, Journal of...McDonald’s Success Strategy and Global Expansion through Customer and Brand Loyalty ”, Journal of Business Case Studies, Vol 3 Number 3 (2007): 55-66...scalable concept of Regionally Aligned Forces. Recently, General David Rodriguez, the U.S. Army Forces Command (FORSCOM) Commander, stated the plan is

  15. Finite element modelling of the glenohumeral capsule can help assess the tested region during a clinical exam.


    Ellis, Benjamin J; Drury, Nicholas J; Moore, Susan M; McMahon, Patrick J; Weiss, Jeffrey A; Debski, Richard E


    The objective of this research was to examine the efficacy of evaluating the region of the glenohumeral capsule being tested by clinical exams for shoulder instability using finite element (FE) models of the glenohumeral joint. Specifically, the regions of high capsule strain produced by glenohumeral joint positions commonly used during a clinical exam were identified. Kinematics that simulated a simple translation test with an anterior load at three external rotation angles were applied to a validated, subject-specific FE model of the glenohumeral joint at 60° of abduction. Maximum principal strains on the glenoid side of the inferior glenohumeral ligament (IGHL) were significantly higher than the maximum principal strains on the humeral side, for all three regions of the IGHL at 30° and 60° of external rotation. These regions of localised strain indicate that these joint positions might be used to test the glenoid side of the IGHL during this clinical exam, but are not useful for assessing the humeral side of the IGHL. The use of FE models will facilitate the search for additional joint positions that isolate high strains to other IGHL regions, including the humeral side of the IGHL.

  16. Nonlinear Aeroelastic Analysis of Joined-Wing Configurations

    NASA Astrophysics Data System (ADS)

    Cavallaro, Rauno

    Aeroelastic design of joined-wing configurations is yet a relatively unexplored topic which poses several difficulties. Due to the overconstrained nature of the system combined with structural geometric nonlinearities, the behavior of Joined Wings is often counterintuitive and presents challenges not seen in standard layouts. In particular, instability observed on detailed aircraft models but never thoroughly investigated, is here studied with the aid of a theoretical/computational framework. Snap-type of instabilities are shown for both pure structural and aeroelastic cases. The concept of snap-divergence is introduced to clearly identify the true aeroelastic instability, as opposed to the usual aeroelastic divergence evaluated through eigenvalue approach. Multi-stable regions and isola-type of bifurcations are possible characterizations of the nonlinear response of Joined Wings, and may lead to branch-jumping phenomena well below nominal critical load condition. Within this picture, sensitivity to (unavoidable) manufacturing defects could have potential catastrophic effects. The phenomena studied in this work suggest that the design process for Joined Wings needs to be revisited and should focus, when instability is concerned, on nonlinear post-critical analysis since linear methods may provide wrong trend indications and also hide potentially catastrophical situations. Dynamic aeroelastic analyses are also performed. Flutter occurrence is critically analyzed with frequency and time-domain capabilities. Sensitivity to different-fidelity aeroelastic modeling (fluid-structure interface algorithm, aerodynamic solvers) is assessed showing that, for some configurations, wake modeling (rigid versus free) has a strong impact on the results. Post-flutter regimes are also explored. Limit cycle oscillations are observed, followed, in some cases, by flip bifurcations (period doubling) and loss of periodicity of the solution. Aeroelastic analyses are then carried out on a

  17. Fluxing agent for metal cast joining


    Gunkel, Ronald W.; Podey, Larry L.; Meyer, Thomas N.


    A method of joining an aluminum cast member to an aluminum component. The method includes the steps of coating a surface of an aluminum component with flux comprising cesium fluoride, placing the flux coated component in a mold, filling the mold with molten aluminum alloy, and allowing the molten aluminum alloy to solidify thereby joining a cast member to the aluminum component. The flux preferably includes aluminum fluoride and alumina. A particularly preferred flux includes about 60 wt. % CsF, about 30 wt. % AlF.sub.3, and about 10 wt. % Al.sub.2 O.sub.3.

  18. Major and minor element geochemistry of deep-sea sediments in the Azores Platform and southern seamount region.


    Palma, Carla; Oliveira, Anabela; Valença, Manuela; Cascalho, João; Pereira, Eduarda; Lillebø, Ana I; Duarte, Armando C; Pinto de Abreu, Manuel


    The Azores Platform and the Irving and Great Meteor seamounts south of the archipelago (38°N-29°N) have rarely been studied geochemically, a fact which is surprising given that they represent the south-eastern limit of region V outlined in the Convention for the Protection of the Marine Environment of the North-East Atlantic (OSPAR Convention). The main aim of the present work was therefore to characterise the spatial variability of major and minor elements in deep-sea sediment cores from these two regions. XRD and geochemical analyses revealed that whereas the Azores Platform sediments are composed of a mixture of biogenic and detrital volcanic material, those at the seamounts are characterised by carbonated biogenic remains. The latter sediments were found to contain very low amounts of volcanic or hydrothermal detrital material, being almost entirely comprised of CaCO3 (more than 80%). Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. A FORTRAN program to implement the method of finite elements to compute regional and residual anomalies from gravity data

    NASA Astrophysics Data System (ADS)

    Agarwal, B. N. P.; Srivastava, Shalivahan


    In view of the several publications on the application of the Finite Element Method (FEM) to compute regional gravity anomaly involving only 8 nodes on the periphery of a rectangular map, we present an interactive FORTRAN program, FEAODD.FOR, for wider applicability of the technique. A brief description of the theory of FEM is presented for the sake of completeness. The efficacy of the program has been demonstrated by analyzing the gravity anomaly over Salt dome, South Houston, USA using two differently oriented rectangular blocks and over chromite deposits, Camaguey, Cuba. The analyses over two sets of data reveal that the outline of the ore body/structure matches well with the maxima of the residuals. Further, the data analyses over South Houston, USA, have revealed that though the broad regional trend remains the same for both the blocks, the magnitudes of the residual anomalies differ approximately by 25% of the magnitude as obtained from previous studies.

  20. Genetic polymorphisms in the promoter region of catalase gene, creates new potential PAX-6 and STAT4 response elements.


    Saify, Khyber


    Catalase (CAT, OMIM: 115500) is an endogenous antioxidant enzyme and genetic variations in the regulatory regions of the CAT gene may alter the CAT enzyme activity and subsequently may alter the risk of oxidative stress related disease. In this study, potential influence(s) of the A-21T (rs7943316) and C-262T (rs1001179) genetic polymorphisms in the CAT promoter region, using the ALGGEN-PROMO.v8.3 online software were analyzed. Our findings show that the A allele at the -21 position creates a new potential binding site for PAX-6 and the T allele at the -262 position changes the TFII-I binding site into STAT4 response element. The PAX-6 and STAT4 are the multifunctional and enhancing transcription factors.

  1. Key elements of regional seismic velocity models for long period ground motion simulations

    USGS Publications Warehouse

    Brocher, T.M.


    Regional 3-D seismic velocity models used for broadband strong motion simulations must include compressional-wave velocity (Vp), shear-wave velocity (Vs), intrinsic attenuation (Qp, Qs), and density. Vs and Qs are the most important of these parameters because the strongest ground motions are generated chiefly by shear- and surface-wave arrivals. Because Vp data are more common than Vs data, many researchers first develop a Vp model and convert it to a Vs model. I describe recent empirical relations between Vs, Vp, Qs, Qp, and density that allow velocity models to be rapidly and accurately calculated. ?? Springer Science+Business Media B.V. 2007.

  2. Elements of morphology: standard terminology for the lips, mouth, and oral region.


    Carey, John C; Cohen, M Michael; Curry, Cynthia J R; Devriendt, Koenraad; Holmes, Lewis B; Verloes, Alain


    An international group of clinicians and scientists working in the field of dysmorphology has initiated the standardization of terms used to describe human morphology. The goals are to standardize these terms and reach consensus regarding their definitions. In this way, we will increase the utility of descriptions of the human phenotype and facilitate reliable comparisons of findings among patients. Discussions with other workers in dysmorphology and related fields, such as developmental biology and molecular genetics, will become more precise. Here we summarize the anatomy of the oral region and define and illustrate the terms that describe the major characteristics of the lips and mouth.

  3. Magnetic instability regions in patterned structures: influence of element shape on magnetization reversal dynamics.


    Han, X F; Grimsditch, M; Meersschaut, J; Hoffmann, A; Ji, Y; Sort, J; Nogués, J; Divan, R; Pearson, J E; Keavney, D J


    We report a time-resolved imaging study of the influence of shape on magnetic instabilities in patterned magnetic structures. We find that in rectangular structures magnetization reversal initiates at the ends and interior simultaneously, while in structures with tapered ends the reversal begins in the middle of the structures and spreads out to the ends. The degree of tapering is important for both the switching field and the time required for full reversal. A model based on the concept of local instability regions yields good agreement with the observed location of the reversal onsets.

  4. Magnetic instability regions in patterned structures : influence of element shape on magnetization reversal dynamics.

    SciTech Connect

    Keavney, D. J.; Han, X. F.; Grimsditch, M.; Meersschaut, J.; Hoffmann, A.; Ji, Y.; Sort, J.; Notues, J.; Divan, R.; Pearson, J. E.; Guslienko, K. Y.; Bader, S. D.; Inst. voor Kern-en Stralingsfysica and INPAC; Univ. Autonoma de Barcelona


    We report a time-resolved imaging study of the influence of shape on magnetic instabilities in patterned magnetic structures. We find that in rectangular structures magnetization reversal initiates at the ends and interior simultaneously, while in structures with tapered ends the reversal begins in the middle of the structures and spreads out to the ends. The degree of tapering is important for both the switching field and the time required for full reversal. A model based on the concept of local instability regions yields good agreement with the observed location of the reversal onsets.

  5. Monazite trace-element and isotopic signatures of high-pressure metamorphism: examples from the Western Gneiss region, Norway

    NASA Astrophysics Data System (ADS)

    Holder, R. M.; Hacker, B. R.; Kylander-Clark, A. R.; Cottle, J. M.


    Monazite U-Pb and trace-element data were gathered using LASS (laser-ablation split-stream ICP-MS) from the Western Gneiss region, Norway, to investigate how trace-element composition can be used to differentiate (ultra)high-pressure monazite from low-pressure monazite. Monazite from six samples contains up to 3 % common Pb, despite high U and Th concentrations. These high common-Pb monazites are characterized by high Sr, weak Eu anomalies, and low Y+HREE. The high common-Pb and Sr abundances and the weak Eu/Eu* are interpreted to reflect the absence of feldspar at (U)HP, and the low Y+HREE content is attributed to fractionation of those elements into garnet. Sr and common Pb in monazite provide a tool for constraining the timing and duration of (U)HP metamorphism. More generally, Sr in monazite is a potential indicator of feldspar instability and may be applicable in other geologic settings, such as igneous systems in which the abundance of feldspar changes due to melting and crystallization. Sr is expected to be more reliable than Eu and Eu/Eu* as a tracer of feldspar stability, because Sr partitioning is less strongly influenced by oxidation state.

  6. Spatial distribution and potential sources of trace elements in PM10 monitored in urban and rural sites of Piedmont Region.


    Padoan, Elio; Malandrino, Mery; Giacomino, Agnese; Grosa, Mauro M; Lollobrigida, Francesco; Martini, Sara; Abollino, Ornella


    The results on elemental composition of aerosol (PM10) sampled during 2011 in Piedmont region (Italy) are interpreted using meteorological data, Enrichment Factors (EF), chemometric processing by Principal Component Analysis (PCA), Factor Analysis (FA) and Hierarchical Cluster Analysis (HCA). Daily concentrations of about 30 elements were measured using HR-ICP-MS in five monitoring sites. A clear seasonal pattern, with higher concentrations in autumn and winter, was observed, particularly in the urban sites. Levels of As, Cd, Ni and Pb in most of the samples were within the limits imposed by the European legislation. Spatial differences in PM10 and metal concentrations were significant, with rural and urban sites showing different metal patterns, indicating different sources. K and Ca were used, respectively, as marker of biomass burning and industrial marker (cement plant); EFs showed that Ca was enriched just in one area and K was enriched only in the winter period considered and in some stations. Data analysis through PCA, FA and HCA allowed us to identify correlations among the investigated elements and similarities between sampling sites in order to individuate specific emission sources, such as non-exhaust vehicle emission.

  7. Spatial Distribution of Lead Isotope Ratios and Inorganic Element Concentrations in Epiphytic Lichens from the Athabasca Oil Sands Region

    NASA Astrophysics Data System (ADS)

    Graney, J. R.; Landis, M. S.; Puckett, K.; Edgerton, E.; Krupa, S.; Percy, K.


    Coupled studies of inorganic element concentrations and lead (Pb) isotope ratios have been conducted on Hypogymnia physodes samples collected in the Athabasca Oil Sands Region (AOSR) in Alberta, Canada in 2002, 2008, and 2011. To investigate the spatial extent of air emissions, the lichens were collected from sites as far as 160 km from the mining and processing operations. 30 milligram sub-samples of the lichens were microwave digested, and the extracts were analyzed using DRC-ICPMS to determine elemental concentrations, and sector field ICPMS to measure Pb isotope ratios. Concentrations of elements in the lichens were found to reflect proximity to mining and oil processing sites as well as topography, ecosystem differences, and the metabolic biogeochemistry of the lichens. An exponential decrease in concentration of metals associated with fugitive dust (aluminum and others) versus distance from the mining sites, suggests elevated coarse particle emissions associated with mining operations. Near source concentrations of metals with an oil signature (vanadium and others) are less enhanced and more homogeneous than the metals in the fugitive dust, reflecting emission and deposition of smaller diameter particles at greater distances from oil processing sources. The mining and oil processing signatures are superimposed over elemental concentrations that reflect the nutrient needs of the lichens. These findings are being confirmed through ongoing studies using dichot samplers to collect coarse and fine particulate aerosol samples. The lichen samples collected beyond 50 km from the mining and processing sites cluster into a Pb isotope grouping with a 207Pb / 206Pb ratio of 0.8650 and a 208Pb / 206Pb ratio near 2.095. This grouping likely reflects the regional background Pb isotope ratio signature. 207Pb / 206Pb and 208Pb / 206Pb ratios decrease as one nears the mining and processing operations. This indicates that other Pb source(s), (e.g. Pb in the bitumen from the oil

  8. Relationship of magnetic field strength and brightness of fine-structure elements in the solar temperature minimum region

    NASA Technical Reports Server (NTRS)

    Cook, J. W.; Ewing, J. A.


    A quantitative relationship was determined between magnetic field strength (or magnetic flux) from photospheric magnetograph observations and the brightness temperature of solar fine-structure elements observed at 1600 A, where the predominant flux source is continuum emission from the solar temperature minimum region. A Kitt Peak magnetogram and spectroheliograph observations at 1600 A taken during a sounding rocket flight of the High Resolution Telescope and Spectrograph from December 11, 1987 were used. The statistical distributions of brightness temperature in the quiet sun at 1600 A, and absolute value of magnetic field strength in the same area were determined from these observations. Using a technique which obtains the best-fit relationship of a given functional form between these two histogram distributions, a quantitative relationship was determined between absolute value of magnetic field strength B and brightness temperature which is essentially linear from 10 to 150 G. An interpretation is suggested, in which a basal heating occurs generally, while brighter elements are produced in magnetic regions with temperature enhancements proportional to B.

  9. Joining silicon nitride to FA-129 iron aluminide

    NASA Astrophysics Data System (ADS)

    Brochu, Mathieu

    Joints between dissimilar materials are characterized particularly by compositional gradients and microstructural changes, which yield large variations in chemical, physical and mechanical properties across the joint. The joining of dissimilar materials is therefore more complex than the joining of similar materials. In this project, the joining procedure, from the interaction between the different components in a joint to the determination of the mechanical properties was applied to the Si3N4/FA-129 system. This iron aluminide intermetallic alloy (FA-129), was developed by Oak Ridge National Laboratories (ORNL) to have high temperature properties with good room temperature ductility. This intermetallic is replacing high strength ferritic stainless steel (SS) in moderate strength applications due to cost and property reasons. Joints between SS and Si3N4 are already used industrially and this project was to evaluate the potential to replace these Si3N 4/SS joints by those of Si3N4/FA-129. Broadly stated, the results obtained during this project are as follows: (I) The E2 energy for Si3N4 ceramic was calculated to be 3.01 keV. (II) The wetting of iron aluminide alloy by copper has been achieved and the spreading and reaction kinetics are influenced by the presence of Cr as alloying element. (III) The penetration and decohesion of the FA-129 microstructure is significantly reduced by the utilization of a Cu alloy containing a high titanium concentration. (IV) An active brazing alloy containing a high active element content can be fabricated by an electroless deposition technique. (V) The melting behavior of the powder was characterized and complete melting occurs in a multi-step process at different temperatures, which are a function of the heating rate. (VI) The strength of joint produced by brazing Si3N4 to itself using the composite powder reached 400 MPa. (VII) Direct brazing of Si 3N4 to FA-129 was shown to be unsuccessful and therefore a soft Cu interlayer was

  10. Atmospheric background trace elements deposition in Tierra del Fuego region (Patagonia, Argentina), using transplanted Usnea barbata lichens.


    Conti, Marcelo Enrique; Finoia, Maria Grazia; Bocca, Beatrice; Mele, Giustino; Alimonti, Alessandro; Pino, Anna


    Lichen, Usnea barbata, transplants taken from Tierra del Fuego (south Patagonia, Argentina) were tested as potential biomonitors of atmospheric airborne deposition in an apparently pristine environment. In 2005, lichens were sampled in a reference site (n = 31) and transplanted in the northern Region of Tierra del Fuego. After, respectively, 1 month and 1 year of exposure, we collected them. The aim of the study was to determine the bioaccumulation of 26 elements in order to evaluate the background levels in the selected area. Samples were analyzed by the sector field inductively coupled plasma mass spectrometry. Discriminant analysis on principal component analysis factors was applied in order to explore the relationship among the different elements as far as time and spatial variation in transplants regards. The analysis was tested by Monte Carlo test based on 999 replicates. The most important contamination source resulted to be the atmospheric soil particle deposition. Furthermore, the results were compared with those obtained from the lichens collected in central and southern Tierra del Fuego. This study confirms the ability of U. barbata to reflect the background levels of the 26 elements in that environment. Compared with other background sites in the world, we did confirm that Tierra del Fuego lichens have a low content of the studied elements. Tierra del Fuego turned out not to be a pristine environment as supposed, but it can be considered as a reference basal ecosystem for useful comparisons among different geographical areas. These findings can be very relevant and useful for environmental conservation programs.

  11. Use of regional mechanical properties of abdominal aortic aneurysms to advance finite element modeling of rupture risk.


    Tierney, Áine P; Callanan, Anthony; McGloughlin, Timothy M


    To investigate the use of regional variations in the mechanical properties of abdominal aortic aneurysms (AAA) in finite element (FE) modeling of AAA rupture risk, which has heretofore assumed homogeneous mechanical tissue properties. Electrocardiogram-gated computed tomography scans from 3 male patients with known infrarenal AAA were used to characterize the behavior of the aneurysm in 4 different segments (posterior, anterior, and left and right lateral) at maximum diameter and above the infrarenal aorta. The elasticity of the aneurysm (circumferential cyclic strain, compliance, and the Hudetz incremental modulus) was calculated for each segment and the aneurysm as a whole. The FE analysis inclusive of prestress (pre-existing tensile stress) produced a detailed stress pattern on each of the aneurysm models under pressure loading. The 4 largest areas of stress in each region were considered in conjunction with the local regional properties of the segment to define a specific regional prestress rupture index (RPRI). In terms of elasticity, there were average reductions of 68% in circumferential cyclic strain and 63% in compliance, with a >5-fold increase in incremental modulus, between the healthy and the aneurysmal aorta for each patient. There were also regional variations in all elastic properties in each individual patient. The average difference in total stress inclusive of prestress was 59%, 67%, and 15%, respectively, for the 3 patients. Comparing the strain from FE models with the CT scans revealed an average difference in strain of 1.55% for the segmented models and 3.61% for the homogeneous models, which suggests that the segmented models more accurately reflect in vivo behavior. RPRI values were calculated for each segment for all patients. A greater understanding of the local material properties and their use in FE models is essential for greater accuracy in rupture prediction. Quantifying the regional behavior will yield insight into the changes in



    Lemon, L.C.


    Aluminum may be joined to stainless steel without the use of flux by tinning the aluminum with a tin solder containing 1% silver and 1% lead, tinning the stainless steel with a 50% lead 50% tin solder, and then sweating the tinned surfaces together.

  13. Joining Forces: Working with Spirituality in Organisations.

    ERIC Educational Resources Information Center

    Snell, Robin; And Others


    Includes "Joining Forces" (Lindamood); "Spiritual Dimension of the Learning Organisation" (Hawkins); "Management--A 'Spiritual' Foundation?" (Nevard); "Hermit in Organisations" (Murray); "Towards a Spiritual Perspective on Behavior at Work" (Henson); "On Uncertainty" (Adlam); "Spirituality in Organisations" (Lee); "Ecological Organisation" (Conn);…

  14. Deformation and Forming of Joined Materials

    SciTech Connect

    Carsley, John; Hovanski, Yuri; Clarke, Kester D.; Krajewski, Paul E.


    Introductory article to a set of invited papers from the TMS committee on shaping and forming. This paper introduces a set of papers that were prepared to discussing the deformation and forming of joined materials, and to announce an upcoming symposium at the 2015 MS&T meeting in Columbus Ohio.

  15. New Trio Launches to Join Expedition 33

    NASA Image and Video Library

    Three new crew members are on their way to join their Expedition 33 crewmates onboard the International Space Station. They launched aboard the Soyuz TMA-06M spacecraft at 6:51 a.m. EDT (5:51 p.m. ...

  16. Flexible coiled spline securely joins mating cylinders

    NASA Technical Reports Server (NTRS)

    Coppernol, R. W.


    Mating cylindrical members are joined by spline to form an integral structure. The spline is made of tightly coiled, high tensile-strength steel spiral wire that fits a groove between the mating members. It provides a continuous bearing surface for axial thrust between the members.

  17. Initial Quality of Advanced Joining Concepts

    DTIC Science & Technology


    Equivalent Initial Flaw Size , A357 Aluminum 20. ABSTRACT (Continue on...including conventionally-fastened baseline specimens. iix Adopting the equivalent initial flaw size concept, data obtained from crack growth observations... equivalent initial flaw size concept. Loading spectrum, spectrum stress level, and init- ial manufactured quality, as well as joining concept type,

  18. Explosive Joining for Nuclear-Reactor Repair

    NASA Technical Reports Server (NTRS)

    Bement, L. J.; Bailey, J. W.


    In explosive joining technique, adapter flange from fuel channel machined to incorporate a V-notch interface. Ribbon explosive, 1/2 inch (1.3 cm) in width, drives V-notched wall of adapter into bellows assembly, producing atomic-level metallurgical bond. Ribbon charge yields joint with double parent metal strength.

  19. Explosive Joining for Nuclear-Reactor Repair

    NASA Technical Reports Server (NTRS)

    Bement, L. J.; Bailey, J. W.


    In explosive joining technique, adapter flange from fuel channel machined to incorporate a V-notch interface. Ribbon explosive, 1/2 inch (1.3 cm) in width, drives V-notched wall of adapter into bellows assembly, producing atomic-level metallurgical bond. Ribbon charge yields joint with double parent metal strength.

  20. Friction Stir & Ultrasonic Solid State Joining Magnesium

    SciTech Connect

    Grant, Glenn J.; Hovanski, Yuri; Santella, M. L.


    Solid state joining between automotive sheet steel and magnesium alloys was investigated. Both friction stir welding and ultrasonic welding were utilized to study the potential for creating structural bonds between these dissimilar materials. A detailed investigation into the joint characteristics was undertaken including an evaluation of joint strength, microstructure, chemical structures, and alloy formation.

  1. Microwave joining of SiC

    SciTech Connect

    Silberglitt, R.; Ahmad, I.; Black, W.M.


    The purpose of this work is to optimize the properties of SiC-SiC joints made using microwave energy. The current focus is on optimization of time-temperature profiles, production of SiC from chemical precursors, and design of new applicators for joining of long tubes.

  2. States Rushing to Join Assessment Consortia

    ERIC Educational Resources Information Center

    Sawchuk, Stephen


    Spurred by the promise of $350 million in Race to the Top money for improved tests--as well as an opportunity to strengthen bids for part of the federal fund's larger $4 billion pot--states are scrambling to join consortia to develop common assessments. Six state consortia are now engaged in discussions about common tests, and the multiple…

  3. Joining Forces: Working with Spirituality in Organisations.

    ERIC Educational Resources Information Center

    Snell, Robin; And Others


    Includes "Joining Forces" (Lindamood); "Spiritual Dimension of the Learning Organisation" (Hawkins); "Management--A 'Spiritual' Foundation?" (Nevard); "Hermit in Organisations" (Murray); "Towards a Spiritual Perspective on Behavior at Work" (Henson); "On Uncertainty" (Adlam); "Spirituality in Organisations" (Lee); "Ecological Organisation" (Conn);…

  4. Advanced Joining Technology: Simple, Strong, and Secure

    NASA Technical Reports Server (NTRS)


    The space-age materials that NASA employs in its spacecraft and satellites have different attributes than the building materials that can work for Earthly uses. These materials do not behave like the typical construction materials, and therefore, require new methods for construction. Work done at NASA s Langley Research Center in the realm of active solder joining has led to a new, self-bonding solder that enables high conductivity, as well as the metallic joining of carbon and ceramic materials to a wide range of metals. The original work involved evaluating high- and low-temperature joining technologies for joining carbon composite structures for use in thermal management and reusable launch vehicles. The initial plan for this innovation was to lower the weight of battery packs in satellites. It was a success. NASA scientists found use for this technology in fabricating a thermal management package for battery compartments in the Earth Observing System (EOS) satellites, but it is also being used by the Agency for space radiator panels. Because it is light, simple to use, and economical, NASA will likely find other uses for this solder, just as outside of the Space Agency, this unique bond is finding many practical applications.

  5. Using multivariate statistical analysis of groundwater major cation and trace element concentrations to evaluate groundwater flow in a regional aquifer

    NASA Astrophysics Data System (ADS)

    Stetzenbach, Klaus J.; Farnham, Irene M.; Hodge, Vernon F.; Johannesson, Kevin H.


    Groundwater samples were collected from 11 springs in Ash Meadows National Wildlife Refuge in southern Nevada and seven springs from Death Valley National Park in eastern California. Concentrations of the major cations (Ca, Mg, Na and K) and 45 trace elements were determined in these groundwater samples. The resultant data were subjected to evaluation via the multivariate statistical technique principal components analysis (PCA), to investigate the chemical relationships between the Ash Meadows and Death Valley spring waters, to evaluate whether the results of the PCA support those of previous hydrogeological and isotopic studies and to determine if PCA can be used to help delineate potential groundwater flow patterns based on the chemical compositions of groundwaters. The results of the PCA indicated that groundwaters from the regional Paleozoic carbonate aquifers (all of the Ash Meadows springs and four springs from the Furnace Creek region of Death Valley) exhibited strong statistical associations, whereas other Death Valley groundwaters were chemically different. The results of the PCA support earlier studies, where potentiometric head levels, 18O and D, geological relationships and rare earth element data were used to evaluate groundwater flow, which suggest groundwater flows from Ash Meadows to the Furnace Creek springs in Death Valley. The PCA suggests that Furnace Creek groundwaters are moderately concentrated Ash Meadows groundwater, reflecting longer aquifer residence times for the Furnace Creek groundwaters. Moreover, PCA indicates that groundwater may flow from springs in the region surrounding Scotty's Castle in Death Valley National Park, to a spring discharging on the valley floor. The study indicates that PCA may provide rapid and relatively cost-effective methods to assess possible groundwater flow regimes in systems that have not been previously investigated.

  6. The 3' untranslated region of human Cyclin-Dependent Kinase 5 Regulatory subunit 1 contains regulatory elements affecting transcript stability

    PubMed Central

    Moncini, Silvia; Bevilacqua, Annamaria; Venturin, Marco; Fallini, Claudia; Ratti, Antonia; Nicolin, Angelo; Riva, Paola


    Background CDK5R1 plays a central role in neuronal migration and differentiation during central nervous system development. CDK5R1 has been implicated in neurodegenerative disorders and proposed as a candidate gene for mental retardation. The remarkable size of CDK5R1 3'-untranslated region (3'-UTR) suggests a role in post-transcriptional regulation of CDK5R1 expression. Results The bioinformatic study shows a high conservation degree in mammals and predicts several AU-Rich Elements (AREs). The insertion of CDK5R1 3'-UTR into luciferase 3'-UTR causes a decreased luciferase activity in four transfected cell lines. We identified 3'-UTR subregions which tend to reduce the reporter gene expression, sometimes in a cell line-dependent manner. In most cases the quantitative analysis of luciferase mRNA suggests that CDK5R1 3'-UTR affects mRNA stability. A region, leading to a very strong mRNA destabilization, showed a significantly low half-life, indicating an accelerated mRNA degradation. The 3' end of the transcript, containing a class I ARE, specifically displays a stabilizing effect in neuroblastoma cell lines. We also observed the interaction of the stabilizing neuronal RNA-binding proteins ELAV with the CDK5R1 transcript in SH-SY5Y cells and identified three 3'-UTR sub-regions showing affinity for ELAV proteins. Conclusion Our findings evince the presence of both destabilizing and stabilizing regulatory elements in CDK5R1 3'-UTR and support the hypothesis that CDK5R1 gene expression is post-transcriptionally controlled in neurons by ELAV-mediated mechanisms. This is the first evidence of the involvement of 3'-UTR in the modulation of CDK5R1 expression. The fine tuning of CDK5R1 expression by 3'-UTR may have a role in central nervous system development and functioning, with potential implications in neurodegenerative and cognitive disorders. PMID:18053171

  7. Characterization and distribution of metal and nonmetal elements in the Alberta oil sands region of Canada.


    Huang, Rongfu; McPhedran, Kerry N; Yang, Lingling; El-Din, Mohamed Gamal


    This review covers the characterization and distribution of metals and nonmetals in the Alberta oil sands region (AOSR) of Canada. The development of the oil sands industry has resulted in the release of organic, metal and nonmetal contaminants via air and water to the AOSR. For air, studies have found that atmospheric deposition of metals in the AOSR decreased exponentially with distance from the industrial emission sources. For water, toxic metal concentrations often exceeded safe levels leading to the potential for negative impacts to the receiving aquatic environments. Interestingly, although atmospheric deposition, surface waters, fish tissues, and aquatic bird eggs exhibited increasing level of metals in the AOSR, reported results from river sediments showed no increases over time. This could be attributed to physical and/or chemical dynamics of the river system to transport metals to downstream. The monitoring of the airborne emissions of relevant nonmetals (nitrogen and sulphur species) was also considered over the AOSR. These species were found to be increasing along with the oil sands developments with the resultant depositions contributing to nitrogen and sulphur accumulations resulting in ecosystem acidification and eutrophication impacts. In addition to direct monitoring of metals/nonmetals, tracing of air emissions using isotopes was also discussed. Further investigation and characterization of metals/nonmetals emissions in the AOSR are needed to determine their impacts to the ecosystem and to assess the need for further treatment measures to limit their continued output into the receiving environments. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Evaluating Local and Regional Sources of Trace Element Contamination in a Rural Sub Estuary of the Upper Chesapeake Bay

    NASA Astrophysics Data System (ADS)

    Krahforst, C.; Hartman, S.; Sherman, L.; Kehm, K.


    The distribution of trace elements (V, Cr, Co, Ni, Cu, Zn, As, Ag, Cd, Sn, Ba, W, Pb and U) along with Al and Fe and other sediment characteristics in surface sediment and sediment cores from the Chester River - a sub estuary of the Chesapeake Bay located in a predominantly agricultural watershed of Maryland's upper Eastern Shore, USA - have been determined in order to add to the understanding of contaminant transport and fate and inform management strategies designed to maintain or improve the ecological condition of estuaries. These analyses coupled with the comparison of elemental analysis of 210Pb - dated sediment cores, main stem water quality surveys, and a review of recent EPA National Coastal Condition Assessment sediment data from Chesapeake Bay provide added information about the roles of local and region scale processes on ecosystem condition. The high amount of suspended sediment in the Chester River (5-20 mg L-1) is an important factor controlling water quality conditions of the Chester River and a prime focus for environmental management of this system. Sources of suspended matter include local runoff, atmospheric deposition, local resuspension, and exchange with the Chesapeake Bay. In principle, each of these sources could be distinguished on the basis of chemical composition of surface sediment. Preliminary results from multivariate analytic models indicate that many of the elements investigated display significant covariance with Al (and other predominantly crustal signatures) which may indicate limited exogenic sources of contamination for sediments of this watershed. For example total Pb concentrations are mostly below the NOAA's low toxic effects level and lower than the median value of NCCA data for the upper Chesapeake suggesting that sediments have significant sources from within the watershed. Further, significant higher concentrations of Sn and Cu coincide with sediment collected in or near marinas and point to localized anthropogenic

  9. A regional analysis of elements at risk exposed to mountain hazards in the Eastern European Alps

    NASA Astrophysics Data System (ADS)

    Fuchs, Sven; Zischg, Andreas


    We present a method to quantify the number and value of buildings exposed to torrents and snow avalanches in the Austrian Alps, as well as the number of exposed people. Based on a unique population and building register dataset, a relational SQL database was developed that allows in combination with GIS data a rule-based nation-wide automated analysis. Furthermore, possibilities and challenges are discussed with respect to the use of such data in vulnerability assessment and with respect to resilience measures. We comprehensively address the challenge of data accuracy, scale and uncertainties. From the total of approximately 2.4 million buildings with a clearly attributable geographical location, around 120,000 are exposed to torrent processes (5 %) and snow avalanches (0.4 %); exposition was defined here as located within the digitally available hazard maps of the Austrian Torrent and Avalanche Control Service. Around 5 % of the population (360,000 out of 8.5 million inhabitants), based on those people being compulsory listed in the population register, are located in these areas. The analysis according to the building category resulted in 2.05 million residential buildings in Austria (85 %), 93,000 of which (4.5 %) are exposed to these hazards. In contrast, 37,300 buildings (1.6 %) throughout the country belong to the category of accommodation facilities, 5,600 of which are exposed (15 %). Out of the 140,500 commercial buildings, 8,000 (5 %) are exposed. A considerable spatial variation was detectable within the communities and Federal States. In general, an above-average exposition of buildings to torrent process and snow avalanches was detectable in communities located in the Federal State of Salzburg, Styria and Vorarlberg (torrents), and Tyrol and Vorarlberg (snow avalanches). In the alpine part of Austria, the share of exposed accommodation buildings was two times (Salzburg) and three times (Vorarlberg) higher than the regional average of exposed buildings

  10. Heidal revisited: new light on critical elements in the allochthon of the classical Otta region (Oppland)

    NASA Astrophysics Data System (ADS)

    Heim, Michael; Corfu, Fernando


    lenses of serpentinite and augengneiss are also present. The unit possibly reflects high strain between middle and upper allochthon, resulting in repeated imbrication of different tectonic slices. Both Rudihø and Heidal units were, at a late stage of the medium-grade shear, intruded by numerous granitic to trondhjemitic dykes ranging from dm to hundreds of meters in size. Dating of these intrusives is made extremely difficult because of the pervasiveness of xenocrystic zircon, but the present available data suggest that they are Early Silurian (435-420 Ma), just like those in the Jotun nappe and the Trondheim region. Gjelsvik, T. 1947: Anorthosittkomplekset i Heidal. NGT 26. 58 pp. Siedlecka, A. et al. 1987: Berggrunnskart Lillehammer, 1:250 000. NGU. Strand, T. 1951: The Sel and Vågå map areas. Geology and petrology of a part of the Caledonides of Central Southern Norway. NGU 178, 117 pp.

  11. Retroposed elements and their flanking regions resolve the evolutionary history of xenarthran mammals (armadillos, anteaters, and sloths).


    Möller-Krull, Maren; Delsuc, Frédéric; Churakov, Gennady; Marker, Claudia; Superina, Mariella; Brosius, Jürgen; Douzery, Emmanuel J P; Schmitz, Jürgen


    Armadillos, anteaters, and sloths (Order Xenarthra) comprise 1 of the 4 major clades of placental mammals. Isolated in South America from the other continental landmasses, xenarthrans diverged over a period of about 65 Myr, leaving more than 200 extinct genera and only 31 living species. The presence of both ancestral and highly derived anatomical features has made morphoanatomical analyses of the xenarthran evolutionary history difficult, and previous molecular analyses failed to resolve the relationships within armadillo subfamilies. We investigated the presence/absence patterns of retroposons from approximately 7,400 genomic loci, identifying 35 phylogenetically informative elements and an additional 39 informative rare genomic changes (RGCs). DAS-short interspersed elements (SINEs), previously described only in the Dasypus novemcinctus genome, were found in all living armadillo genera, including the previously unsampled Chlamyphorus, but were noticeably absent in sloths. The presence/absence patterns of the phylogenetically informative retroposed elements and other RGCs were then compared with data from the DNA sequences of the more than 12-kb flanking regions of these retroposons. Together, these data provide the first fully resolved genus tree of xenarthrans. Interestingly, multiple evidence supports the grouping of Chaetophractus and Zaedyus as a sister group to Euphractus within Euphractinae, an association that was not previously demonstrated. Also, flanking sequence analyses favor a close phylogenetic relationship between Cabassous and Tolypeutes within Tolypeutinae. Finally, the phylogenetic position of the subfamily Chlamyphorinae is resolved by the noncoding sequence data set as the sister group of Tolypeutinae. The data provide a stable phylogenetic framework for further evolutionary investigations of xenarthrans and important information for defining conservation priorities to save the diversity of one of the most curious groups of mammals.

  12. Early demethylation of non-CpG, CpC-rich, elements in the myogenin 5′-flanking region

    PubMed Central

    Fuso, Andrea; Ferraguti, Giampiero; Grandoni, Francesco; Ruggeri, Raffaella; Scarpa, Sigfrido; Strom, Roberto


    The dynamic changes and structural patterns of DNA methylation of genes without CpG islands are poorly characterized. The relevance of CpG to the non-CpG methylation equilibrium in transcriptional repression is unknown. In this work, we analyzed the DNA methylation pattern of the 5′-flanking of the myogenin gene, a positive regulator of muscle differentiation with no CpG island and low CpG density, in both C2C12 muscle satellite cells and embryonic muscle. Embryonic brain was studied as a non-expressing tissue. High levels of both CpG and non-CpG methylation were observed in non-expressing experimental conditions. Both CpG and non-CpG methylation rapidly dropped during muscle differentiation and myogenin transcriptional activation with active demethylation dynamics. Non-CpG demethylation occurred more rapidly than CpG demethylation. Demethylation spread from initially highly methylated short CpC-rich elements to a virtually unmethylated status. These short elements have a high CpC content and density, share some motifs and largely coincide with putative recognition sequences of some differentiation-related transcription factors. Our findings point to a dynamically controlled equilibrium between CpG and non-CpG active demethylation in the transcriptional control of tissue-specific genes. The short CpC-rich elements are new structural features of the methylation machinery, whose functions may include priming the complete demethylation of a transcriptionally crucial DNA region. PMID:20935518

  13. Brain Region-Specific Expression of MeCP2 Isoforms Correlates with DNA Methylation within Mecp2 Regulatory Elements

    PubMed Central

    Liyanage, Vichithra R. B.; Rastegar, Mojgan


    MeCP2 is a critical epigenetic regulator in brain and its abnormal expression or compromised function leads to a spectrum of neurological disorders including Rett Syndrome and autism. Altered expression of the two MeCP2 isoforms, MeCP2E1 and MeCP2E2 has been implicated in neurological complications. However, expression, regulation and functions of the two isoforms are largely uncharacterized. Previously, we showed the role of MeCP2E1 in neuronal maturation and reported MeCP2E1 as the major protein isoform in the adult mouse brain, embryonic neurons and astrocytes. Recently, we showed that DNA methylation at the regulatory elements (REs) within the Mecp2 promoter and intron 1 impact the expression of Mecp2 isoforms in differentiating neural stem cells. This current study is aimed for a comparative analysis of temporal, regional and cell type-specific expression of MeCP2 isoforms in the developing and adult mouse brain. MeCP2E2 displayed a later expression onset than MeCP2E1 during mouse brain development. In the adult female and male brain hippocampus, both MeCP2 isoforms were detected in neurons, astrocytes and oligodendrocytes. Furthermore, MeCP2E1 expression was relatively uniform in different brain regions (olfactory bulb, striatum, cortex, hippocampus, thalamus, brainstem and cerebellum), whereas MeCP2E2 showed differential enrichment in these brain regions. Both MeCP2 isoforms showed relatively similar distribution in these brain regions, except for cerebellum. Lastly, a preferential correlation was observed between DNA methylation at specific CpG dinucleotides within the REs and Mecp2 isoform-specific expression in these brain regions. Taken together, we show that MeCP2 isoforms display differential expression patterns during brain development and in adult mouse brain regions. DNA methylation patterns at the Mecp2 REs may impact this differential expression of Mecp2/MeCP2 isoforms in brain regions. Our results significantly contribute towards characterizing

  14. Convergent transcription initiates from oppositely oriented promoters within the 5 prime end regions of Drosophila melanogaster F elements

    SciTech Connect

    Minchiotti, G. ); Di Nocera, P.P. )


    Drosophila melanogaster F elements are mobile, oligo(A)-terminated DNA sequences that likely propagate by the retrotranscription of RNA intermediates. Plasmids bearing DNA segments from the left-hand region of a full-length F element fused to the CAT gene were used as templates for transient expression assays in Drosophila Schneider II cultured cells. Protein and RNA analyses led to the identification of two promoters, F{sub in} and F{sub out}, that transcribe in opposite orientations. Analysis of the template activity of 3{prime} deletion derivatives indicates that the level of accumulation of F{sub in}RNA is also dependent upon the presence of sequences located within the +175 to +218 interval. The F{sub out} promoter drives transcription in the opposite orientation with respect to F{sub in}, F{sub out} transcripts initiate at nearby sites within the +92 to +102 interval. Sequences downstream of these multiple RNA start sites are not required for the activity of the F{sub out} promoter. Deletions knocking out the F{sub in} promoter do not impair F{sub out} transcription; conversely, initiation at the F{sub in} promoter still takes place in templates that lack the F{sub out} promoter. At a low level, both promoters are active in cultured cells.

  15. Arsenic in Bangladeshi soils related to physiographic region, paddy management, and mirco- and macro-elemental status.


    Chowdhury, M Tanvir A; Deacon, Claire M; Jones, Gerrad D; Imamul Huq, S M; Williams, Paul N; Manzurul Hoque, A F M; Winkel, Lenny H E; Price, Adam H; Norton, Gareth J; Meharg, Andrew A


    While the impact of arsenic in irrigated agriculture has become a major environmental concern in Bangladesh, to date there is still a limited understanding of arsenic in Bangladeshi paddy soils at a landscape level. A soil survey was conducted across ten different physiographic regions of Bangladesh, which encompassed six types of geomorphology (Bil, Brahmaputra floodplain, Ganges floodplain, Meghna floodplain, Karatoya-Bangali floodplain and Pleistocene terrace). A total of 1209 paddy soils and 235 matched non-paddy soils were collected. The source of irrigation water (groundwater and surface water) was also recorded. The concentrations of arsenic and sixteen other elements were determined in the soil samples. The concentration of arsenic was higher in paddy soils compared to non-paddy soils, with soils irrigated with groundwater being higher in arsenic than those irrigated with surface water. There was a clear difference between the Holocene floodplains and the Pleistocene terraces, with Holocene floodplain soils being higher in arsenic and other elements. The results suggest that arsenic is most likely associated with less well weathered/leached soils, suggesting it is either due to the geological newness of Holocene sediments or differences between the sources of sediments, which gives rise to the arsenic problems in Bangladeshi soils.

  16. Changes in climatic elements in the Pan-Hexi region during 1960-2014 and responses to global climatic changes

    NASA Astrophysics Data System (ADS)

    Wei, Liu; Feng, Qi; Deo, Ravinesh C.


    In this paper, robust statistical methods (including the climatic tendency ratio, inverse distance weight (IDW), and Mann-Kendall's non-parametric statistical tests) were applied to analyze the annual sequences of meteorological data for the period 1960-2014. The results indicated that the mean annual air temperature in the Pan-Hexi and the surrounding regions has increased by 0.9 °C. Over the 55-year period of study, this represented a warming rate that was significantly higher than the contemporaneous warming rate in China and the rest of the world. The warming trend in northeastern Tibet was the most pronounced. Here, the mean warming rate exhibited an increasing trend from the mid-late 1980s, and the cold season-dominated warming changed to year-round warming. The rise in the amplitude of the mean minimum temperature was significant, and the variation in the amplitude of the extreme minimum temperature was greater than that of the extreme maximum temperature, exhibiting a variation period of approximately 10 years. Since 1960, the mean precipitation in the study region and the surrounding areas first increased, and then decreased, and then increased again rapidly from 2007. Precipitation and relative humidity trend showed a 13- and a 10-year variation period, respectively. Crop evapotranspiration exhibited a decreasing trend, but from 1993 onwards, there was an increasing trend and a 9-year variation period was also notable based on observed datasets. In the most recent 55 years (1960-2014), the sunshine duration and mean wind velocity in the study area first showed a decreasing trend followed by an increasing trend, and then it exhibited a decreasing trend from east to west of the study region. The temporal variations in the climatic elements were similar to those of China, suggesting that the climate change signal in the study region over the last 55 years appeared to be well correlated with the global climate change signal.

  17. Modelling near field regional uplift patterns in West Greenland/Disko Bay with plane-Earth finite element models.

    NASA Astrophysics Data System (ADS)

    Meldgaard, Asger; Nielsen, Lars; Iaffaldano, Giampiero


    Relative sea level data, primarily obtained through isolation basin analysis in western Greenland and on Disko Island, indicates asynchronous rates of uplift during the Early Holocene with larger rates of uplift in southern Disko Bay compared to the northern part of the bay. Similar short-wavelength variations can be inferred from the Holocene marine limit as observations on the north and south side of Disko Island differ by as much as 60 m. While global isostatic adjustment models are needed to account for far field contributions to the relative sea level and for the calculation of accurate ocean functions, they are generally not suited for a detailed analysis of the short-wavelength uplift patterns observed close to present ice margins. This is in part due to the excessive computational cost required for sufficient resolution, and because these models generally ignore regional lateral heterogeneities in mantle and lithosphere rheology. To mitigate this problem, we perform sensitivity tests to investigate the effects of near field loading on a regional plane-Earth finite element model of the lithosphere and mantle of the Disko Bay area, where the global isostatic uplift chronology is well documented. By loading the model area through detailed regional ocean function and ice models, and by including a high resolution topography model of the area, we seek to assess the isostatic rebound generated by surface processes with wavelengths similar to those of the observed rebound signal. We also investigate possible effects of varying lithosphere and mantle rheology, which may play an important role in explaining the rebound signal. We use the abundance of relative sea level curves obtained in the region primarily through isolation basin analysis on Disko Island to constrain the parameters of the Earth model.

  18. Joining titanium materials with tungsten inert gas welding, laser welding, and infrared brazing.


    Wang, R R; Welsch, G E


    Titanium has a number of desirable properties for dental applications that include low density, excellent biocompatibility, and corrosion resistance. However, joining titanium is one of the practical problems with the use of titanium prostheses. Dissolved oxygen and hydrogen may cause severe embrittlement in titanium materials. Therefore the conventional dental soldering methods that use oxygen flame or air torch are not indicated for joining titanium materials. This study compared laser, tungsten inert gas, and infrared radiation heating methods for joining both pure titanium and Ti-6Al-4V alloy. Original rods that were not subjected to joining procedures were used as a control method. Mechanical tests and microstructure analysis were used to evaluate joined samples. Mechanical tests included Vickers microhardness and uniaxial tensile testing of the strength of the joints and percentage elongation. Two-way analysis of variance and Duncan's multiple range test were used to compare mean values of tensile strength and elongation for significant differences (p < or = 0.05). Tensile rupture occurred in the joint region of all specimens by cohesive failure. Ti-6Al-4V samples exhibited significantly greater tensile strength than pure titanium samples. Samples prepared by the three joining methods had markedly lower tensile elongation than the control titanium and Ti-6Al-4V rods. The changes in microstructure and microhardness were studied in the heat-affected and unaffected zones. Microhardness values increased in the heat-affected zone for all the specimens tested.

  19. Rhenium Mechanical Properties and Joining Technology

    NASA Technical Reports Server (NTRS)

    Reed, Brian D.; Biaglow, James A.


    Iridium-coated rhenium (Ir/Re) provides thermal margin for high performance and long life radiation cooled rockets. Two issues that have arisen in the development of flight Ir/Re engines are the sparsity of rhenium (Re) mechanical property data (particularly at high temperatures) required for engineering design, and the inability to directly electron beam weld Re chambers to C103 nozzle skirts. To address these issues, a Re mechanical property database is being established and techniques for creating Re/C103 transition joints are being investigated. This paper discusses the tensile testing results of powder metallurgy Re samples at temperatures from 1370 to 2090 C. Also discussed is the evaluation of Re/C103 transition pieces joined by both, explosive and diffusion bonding. Finally, the evaluation of full size Re transition pieces, joined by inertia welding, as well as explosive and diffusion bonding, is detailed.

  20. Novel method for joining CFRP to aluminium

    NASA Astrophysics Data System (ADS)

    Möller, F.; Thomy, C.; Vollertsen, F.; Schiebel, P.; Hoffmeister, C.; Herrmann, A. S.

    The current state of the art in joining of carbon-fibre reinforced composites (CFRP) to metals such as aluminium is - for the case of aircraft structures, e.g.- riveting or bolting. However, to reduce structural weight and improve structural performance, integral, load-bearing aluminium-CFRP-structures are desirable. To produce such structures, a novel joint configuration together with an appropriate thermal, laser-based joining process is suggested by the authors. In this paper, the joint configuration (based on CFRP-Ti-aluminium joints) and the laser beam conduction welding process will be presented, and first specimens obtained will be discussed with respect to their properties. It will be shown that the novel approach is in principle suitable to produce load-bearing CFRP-aluminium structures.

  1. Toroid Joining Gun For Fittings And Couplings

    NASA Technical Reports Server (NTRS)

    Fox, Robert L.; Swaim, Robert J.; Johnson, Samuel D.; Buckley, John D.; Copeland, Carl E.; Coultrip, Robert H.; Johnston, David F.; Phillips, William M.


    Hand-held gun used to join metal heat-to-shrink couplings. Uses magnetic induction (eddy currents) to produce heat in metal coupling, and thermocouple to measure temperature and signals end of process. Gun, called "toroid joining gun" concentrates high levels of heat in localized areas. Reconfigured for use on metal heat-to-shrink fitting and coupling applications. Provides rapid heating, operates on low power, lightweight and portable. Safe for use around aircraft fuel and has no detrimental effects on surrounding surfaces or objects. Reliable in any environment and under all weather conditions. Gun logical device for taking full advantage of capabilities of new metal heat-to-shrink couplings and fittings.

  2. Toroid Joining Gun For Fittings And Couplings

    NASA Technical Reports Server (NTRS)

    Fox, Robert L.; Swaim, Robert J.; Johnson, Samuel D.; Buckley, John D.; Copeland, Carl E.; Coultrip, Robert H.; Johnston, David F.; Phillips, William M.


    Hand-held gun used to join metal heat-to-shrink couplings. Uses magnetic induction (eddy currents) to produce heat in metal coupling, and thermocouple to measure temperature and signals end of process. Gun, called "toroid joining gun" concentrates high levels of heat in localized areas. Reconfigured for use on metal heat-to-shrink fitting and coupling applications. Provides rapid heating, operates on low power, lightweight and portable. Safe for use around aircraft fuel and has no detrimental effects on surrounding surfaces or objects. Reliable in any environment and under all weather conditions. Gun logical device for taking full advantage of capabilities of new metal heat-to-shrink couplings and fittings.

  3. Cadmium and other elements in tissues from four ungulate species from the Mackenzie Mountain region of the Northwest Territories, Canada.


    Larter, N C; Macdonald, C R; Elkin, B T; Wang, X; Harms, N J; Gamberg, M; Muir, D C G


    Tissue samples from four ungulate species from the south Mackenzie Mountain region of the Northwest Territories (NT), Canada, were analysed for stable and radioactive elements and (15)N and (13)C stable isotopes. Elevated Cd concentrations in moose (Alces americanus) kidney have been observed in the region and are a health care concern for consumers of traditional foods. This study examined the factors associated with, and potential renal effects from, the accumulation of cadmium, and interactions with other elements in four sympatric ungulate species. Mean renal Cd concentration was highest in moose (48.3mg/kg ww), followed by mountain caribou (Rangifer tarandus caribou) (13.9mg/kg ww) and mountain goat (Oreamnos americanus) (5.78mg/kg ww). No local sources of Cd were evident and the elevated levels in moose are considered to be natural in origin. Conversely, total Hg concentration was significantly higher in mountain caribou kidney (0.21mg/kg ww) than in moose (0.011mg/kg ww). (134)Cs (t½=2.1 y) in mountain goat and Dall's sheep (Ovis dalli) muscle is evidence of deposition from the Fukushima reactor accident in 2011. (137)Cs (t½=30.2 y) in all four ungulates is primarily a remnant of the nuclear weapons tests of the 1960s. The levels of both nuclides are low and the risk to the animals and people consuming them is negligible. Stable isotope δ(15)N and δ(13)C signatures in muscle showed a separation between the mountain caribou, with a lichen-dominated diet, and moose, which browse shrubs and forbs. Isotope signatures for mountain goat and Dall's sheep showed generalist feeding patterns. Differences in elemental and radionuclide levels between species were attributed to relative levels of metal accumulation in the different food items in the diets of the respective species. Kidneys from each species showed minor histological changes in the proximal tubule and glomerulus, although glomerular changes were rare and all changes were rare in mountain goat kidney

  4. Bacterial nonhomologous end joining requires teamwork.


    Matthews, Lindsay A; Simmons, Lyle A


    All living organisms must repair DNA double-stranded breaks (DSBs) in order to survive. Many bacteria rely on nonhomologous end joining (NHEJ) when only a single copy of the genome is available and maintain NHEJ pathways with a minimum of two proteins. In this issue, Bhattarai and colleagues identify additional factors that can work together to aid in survival of stationary-phase cells with chromosomal breaks. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  5. Joining of materials using laser heating


    Cockeram, Brian V.; Hicks, Trevor G.; Schmid, Glenn C.


    A method for diffusion bonding ceramic layers such as boron carbide, zirconium carbide, or silicon carbide uses a defocused laser beam to heat and to join ceramics with the use of a thin metal foil insert. The metal foil preferably is rhenium, molybdenum or titanium. The rapid, intense heating of the ceramic/metal/ceramic sandwiches using the defocused laser beam results in diffusive conversion of the refractory metal foil into the ceramic and in turn creates a strong bond therein.

  6. One-step dual purpose joining technique

    NASA Technical Reports Server (NTRS)

    Buckley, J. D.; Swaim, R. J.; Fox, R. L. (Inventor)


    This fastener used in induction heating is a wire screen basically of an eddy current carrying material such as carbon steel. Selected wires in the screen are copper, sheathed in an insulating material. The screen is placed between two sheets of thermoplastics. When inductively heated, the composite softens and flows around the apertures of the screen. After this heating and joining, the copper wires may be used to conduct electricity.

  7. Fundamentals of metals joining with lasers

    SciTech Connect

    Jellison, J.L.


    The intrinsic characteristic of a laser as a metals joining heat source is high intensity (high irradiance). Other advantages stem from the ability to optically manipulate the beam and the inertness of light. Optimal application of laser technology to metals joining is supported by a fundamental understanding of the physics of the process. The interaction of the laser beam with metals is highly materials and process dependent. Metals joining with lasers in a absence of an understanding of beam-materials interactions would appear to be a highly unpredictable process. This is because of the complexity of beam-material interactions. For example, absorptivity varies by more than an order of magnitude as a function of alloy, temperature, oxide thickness, and laser wavelength. Also, in most laser welding and brazing processing, evaporation of metal creates a significant plume, and beam-plume interactions can markedly alter the spatial distribution of energy at the plume-metal interface. The probability of the beam being absorbed by the plume increases with the square of the wavelength, whereas the propensity for scattering of the beam by particles in the beam is inversely proportional to wavelength. Also, the beam can be refracted due to thermal and compositional gradients in the plume. In selecting a laser process for a given application, understanding each of these physical effects and others is helpful. In many ways, the physics of metals joining with lasers is only qualitatively understood at the present time. This paper overviews the present understanding of the process and identifies areas where research is required to clarify our process understanding.

  8. Thin layer joining by gas adsorption

    NASA Astrophysics Data System (ADS)

    Taga, Yasunori; Fukumura, Toshio


    Attempt has been made to join borosilicate glass and cycloolefin (COP) polymer film by using gas adsorption method. After corona plasma treat, COP was exposed to (3-glycidoxypropyl) trimethoxysilane (GPS) and glass to (3-aminopropyl) triethoxysilane (APS) both in air atmosphere, resulting in co-adsorption of water vapor in the atmosphere and organosilane gases. Surface characterization of plasma treated and gas adsorbed surfaces was carried out by X-ray photoelectron spectroscopy (XPS) using Mg Kα X-ray source. Joining was carried out by a roll laminator after contact of both surfaces at room temperature, followed by annealing at 130 °C for 10 min. Adhesion strength was evaluated by 180 degree peel test based on ASTM D-903 and durability was examined under the conditions of 60 °C and 95% RH. It was found that after plasma treatment, complex functional groups such as Csbnd H, Csbnd O, Cdbnd O, Osbnd Cdbnd O and CO3 were found on COP and Osbnd H on glass. Thickness of GPS gas adsorption layer on COP was evaluated by the XPS to be at least 1.1 nm by taking inelastic mean free path of Si2p photoelectron into consideration. Joining force was found to be more than 5 N/25 mm corresponding to almost equal to COP bulk tensile strength. In addition, durability of this adhesion strength remained unchanged over 2000 h even after exposure to the durability test conditions of 60 °C and 95% RH. The results can be explained in terms of formation of Hsbnd H hydrogen bonding and Sisbnd O covalent bonding via silanols will be made at the interface as a result of lamination and annealing processes. In conclusion, ultrathin joining method by gas adsorption was established by the formation of hydrogen and covalent bonds at the interface by low temperature reaction process.

  9. Flexible Hybrid Friction Stir Joining Technology

    SciTech Connect


    This factsheet describes a research project whose goal is to advance the friction stir welding (FSW) process as a manufacturing technology that can be deployed for on-site construction of large, complex and typically thick-sectioned structures made of high performance and high-temperature materials. This would transform FSW from a specialty joining process into one with pervasive application potential across a number of industrial sectors where the payoff of energy reduction, environmental and economic benefits would be significant.

  10. ASKAP Joins the Hunt for Mysterious Bursts

    NASA Astrophysics Data System (ADS)

    Kohler, Susanna


    A new telescope, the Australian Square Kilometre Array Pathfinder (ASKAP), has joined the search for energetic and elusive fast radio bursts. And in just a few days of looking, its already had success!Elusive TransientsThe Parkes radio telescope, which has detected all but five of the fast radio bursts published to date, has a very narrow field of view. [CSIRO]Fast radio bursts are mysterious millisecond-duration radio pulses that were first discovered around a decade ago. Since that time particularly in recent years weve made some progress toward the goal of localizing them. Were now fairly convinced that fast radio bursts come from outside of the galaxy, and yet theyre enormously bright orders of magnitude more luminous than any pulse seen from the Milky Way.Better identification of where these mysterious bursts come from would help us to determine what they are. But so far, weve discovered only around 30 such bursts, despite the fact that theyre estimated to occur at a rate of 3,000 events per day across the whole sky.Why are they so hard to find? Due to their short duration, effective detection would require instantaneous coverage of a very large fraction of the sky. The Parkes radio telescope which has detected all but five of the fast radio bursts published to date has a field of view spanning less than a square degree,significantly limiting our ability to rapidly survey for these transients.FRB 170107s band-averaged pulse (top) and dynamic spectrum (bottom). [Bannister et al. 2017]A New Array in TownA new player is now on the scene, however, and its already had huge success. ASKAP is a wide-field radio telescope made up of an array of 12-meter antennas. Using phased-array-feed technology, ASKAP is able to instantaneously observe an effective area of 160 square degrees an enormous field compared to Parkes 0.6 square degrees! This capability significantly increases our chances of being able to detect fast radio bursts.In a new study led by Keith Bannister

  11. Classification of wines according to their production regions with the contained trace elements using laser-induced breakdown spectroscopy

    NASA Astrophysics Data System (ADS)

    Tian, Ye; Yan, Chunhua; Zhang, Tianlong; Tang, Hongsheng; Li, Hua; Yu, Jialu; Bernard, Jérôme; Chen, Li; Martin, Serge; Delepine-Gilon, Nicole; Bocková, Jana; Veis, Pavel; Chen, Yanping; Yu, Jin


    Laser-induced breakdown spectroscopy (LIBS) has been applied to classify French wines according to their production regions. The use of the surface-assisted (or surface-enhanced) sample preparation method enabled a sub-ppm limit of detection (LOD), which led to the detection and identification of at least 22 metal and nonmetal elements in a typical wine sample including majors, minors and traces. An ensemble of 29 bottles of French wines, either red or white wines, from five production regions, Alsace, Bourgogne, Beaujolais, Bordeaux and Languedoc, was analyzed together with a wine from California, considered as an outlier. A non-supervised classification model based on principal component analysis (PCA) was first developed for the classification. The results showed a limited separation power of the model, which however allowed, in a step by step approach, to understand the physical reasons behind each step of sample separation and especially to observe the influence of the matrix effect in the sample classification. A supervised classification model was then developed based on random forest (RF), which is in addition a nonlinear algorithm. The obtained classification results were satisfactory with, when the parameters of the model were optimized, a classification accuracy of 100% for the tested samples. We especially discuss in the paper, the effect of spectrum normalization with an internal reference, the choice of input variables for the classification models and the optimization of parameters for the developed classification models.

  12. A distal intergenic region controls pancreatic endocrine differentiation by acting as a transcriptional enhancer and as a polycomb response element.


    van Arensbergen, Joris; Dussaud, Sebastien; Pardanaud-Glavieux, Corinne; García-Hurtado, Javier; Sauty, Claire; Guerci, Aline; Ferrer, Jorge; Ravassard, Philippe


    Lineage-selective expression of developmental genes is dependent on the interplay between activating and repressive mechanisms. Gene activation is dependent on cell-specific transcription factors that recognize transcriptional enhancer sequences. Gene repression often depends on the recruitment of Polycomb group (PcG) proteins, although the sequences that underlie the recruitment of PcG proteins, also known as Polycomb response elements (PREs), remain poorly understood in vertebrates. While distal PREs have been identified in mammals, a role for positive-acting enhancers in PcG-mediated repression has not been described. Here we have used a highly efficient procedure based on lentiviral-mediated transgenesis to carry out in vivo fine-mapping of, cis-regulatory sequences that control lineage-specific activation of Neurog3, a master regulator of pancreatic endocrine differentiation. Our findings reveal an enhancer region that is sufficient to drive correct spacio-temporal expression of Neurog3 and demonstrate that this same region serves as a PRE in alternative lineages where Neurog3 is inactive.

  13. A distal intergenic region controls pancreatic endocrine differentiation by acting as a transcriptional enhancer and as a polycomb response element

    PubMed Central

    Pardanaud-Glavieux, Corinne; García-Hurtado, Javier; Sauty, Claire; Guerci, Aline; Ferrer, Jorge


    Lineage-selective expression of developmental genes is dependent on the interplay between activating and repressive mechanisms. Gene activation is dependent on cell-specific transcription factors that recognize transcriptional enhancer sequences. Gene repression often depends on the recruitment of Polycomb group (PcG) proteins, although the sequences that underlie the recruitment of PcG proteins, also known as Polycomb response elements (PREs), remain poorly understood in vertebrates. While distal PREs have been identified in mammals, a role for positive-acting enhancers in PcG-mediated repression has not been described. Here we have used a highly efficient procedure based on lentiviral-mediated transgenesis to carry out in vivo fine-mapping of, cis-regulatory sequences that control lineage-specific activation of Neurog3, a master regulator of pancreatic endocrine differentiation. Our findings reveal an enhancer region that is sufficient to drive correct spacio-temporal expression of Neurog3 and demonstrate that this same region serves as a PRE in alternative lineages where Neurog3 is inactive. PMID:28225770

  14. Structural modeling and optimization of a joined-wing configuration of a High-Altitude Long-Endurance (HALE) aircraft

    NASA Astrophysics Data System (ADS)

    Kaloyanova, Valentina B.

    developed. All stringers, skin panels, ribs and spars are represented by appropriate elements in a finite-element model. Also, the model accounts for the fuel weight and sensorcraft antennae housed within the wings. Linear and nonlinear static analyses under the aerodynamic load are performed. The stress distribution in the wing as well as deformation is explored. Starting with a structural model with uniform mass distribution, a design optimization is performed to achieve a fully stressed design. As the joined-wing structure is prone to buckling, after the design optimization is complete linear and nonlinear bucking analyses are performed to study the global joined-wing structural instability, the load magnitude at which it is expected to occur, and the buckling mode. The buckled shape of the aft wing (which is subjected to compression) is found to resemble that of a fixed-pinned column. The linear buckling analysis overestimates the buckling load. However, even the nonlinear buckling analysis results in a load factor higher than 3, i.e. the wing structure is buckling safe under its current loading conditions. As the region of the joint has a very complicated geometry that has adverse effects in the flow and stress behavior an independent, more finely meshed model (submodel) of the joint region is generated and analyzed. A detailed discussion of the stress distribution obtained in the joint region via the submodeling technique is presented in this study as well. It is found out that compared to its structural response, the joint adverse effects are much more pronounced in its aerodynamic response, so it is suggested for future studies the geometry of the joint to be optimized based on its aerodynamic performance. As this design and analysis study is aimed towards developing a realistic structural representation of the innovative joined-wing configuration, in addition to the "global", or upper-level optimization, a local level design optimization is performed as well. At

  15. Joining of carbon-carbon composites for thermonuclear fusion applications

    SciTech Connect

    Salvo, M.; Lemoine, P.; Ferraris, M.; Montorsi, M.; Merola, M.


    Carbon-fiber-reinforced carbon (CfC) composites have been joined by using different joining agents: metals (silicon, aluminum, and titanium), an intermetallic compound (magnesium silicide, Mg{sub 2}Si), and glasses (borosilicates and zinc borates). These joining agents have been chosen by considering their possible use in a thermonuclear fusion reactor, as suggested by their low-activation properties, reasonably high working temperature, industrial feasibility, and potential scale-up of the joined carbon-carbon structures using pressureless-processing techniques. Each joined structure (CfC composite-joining material-CfC composite) has been first morphologically characterized by scanning electron microscopy, energy-dispersive X-ray spectroscopy, and X-ray diffractometry. Then, single-lap shear tests have been performed on the most-promising joined structures, i.e., silicon- and aluminum-joined CfC-composite samples, which have shown an average shear strength of 22 and 10 MPa, respectively.

  16. Astronaut Crippen prepares to join crew in training

    NASA Technical Reports Server (NTRS)


    Astronaut Robert L. Crippen, 41-G crew commander, prepares to join his crew for training in the mockup and integration laboratory at JSC. Astronaut David C. Leestma, 41-G mission specialist, left, will join the crew in training.

  17. Joining of beta-SiC by spark plasma sintering

    SciTech Connect

    Grasso, Salvatore; Tatarko, Peter; Rizzo, S.; Porwal, Harshit; Hu, Chunfeng; Katoh, Yutai; Salvo, M; Reece, Michael John; Ferraris, Monica


    Spark plasma sintering (SPS) was employed to join monolithic -SiC with or without titanium as intermediate joining material. Both the localizedand rapid heating contributed to the inherent energy saving of electric current assisted joining technique. The effects of uniaxial pressure and surfacepreparation were analyzed independently with respect to the flexural strength and the morphology of the joints. In particular samples polisheddown to 1 m and joined at 1900 C for 5 min achieved the strength of the as received material. The failure occurred outside the joining interface,confirming the optimum quality of the joint. Pressure in combination with surface preparation was necessary to achieve perfect adhesion and porefree direct joining of SiC. The use of Ti foil as a joining material and pressure allowed joining of unpolished SiC.

  18. Innovative and Highly Productive Joining Technologies for Multi-Material Lightweight Car Body Structures

    NASA Astrophysics Data System (ADS)

    Meschut, G.; Janzen, V.; Olfermann, T.


    Driven by increasing costs for energy and raw material and especially by the European CO2-emission laws, automotive industry faces the challenge to develop more lightweight and at the same time still rigid and crash-stable car bodies, that are affordable for large-scale production. The implementation of weight-reduced constructions depends not only on the availability of lightweight materials and related forming technologies, but also on cost-efficient and reliable joining technologies suitable for multi-material design. This article discusses the challenges and requirements for these technologies, based on the example of joining aluminium with press-hardened boron steels, what is considered as a very important material combination for affordable future lightweight mobility. Besides a presentation of recent developments for extending the process limits of conventional mechanical joining methods, new promising technologies such as resistance element welding are introduced. In addition, the performance, advantages, and disadvantages of the presented technologies are compared and discussed.

  19. The role of electroplated coatings in metal joining

    SciTech Connect

    Dini, J.W.


    Electroplated and electroless coatings often play an important role in soldering, brazing, and welding operations. Thin deposits applied to critical surfaces before the joining operations can provide the difference between success and failure. Diffusion welding applications sometimes require coatings to help promote joining. For some applications, electroplating by itself can be used to join metals that cannot be welded or brazed because of metallurgical incompatibility. The use of electroplated coatings for these various joining applications is reviewed here.

  20. An adaptive transposable element insertion in the regulatory region of the EO gene in the domesticated silkworm, Bombyx mori.


    Sun, Wei; Shen, Yi-Hong; Han, Min-Jin; Cao, Yun-Feng; Zhang, Ze


    Although there are many studies to show a key role of transposable elements (TEs) in adaptive evolution of higher organisms, little is known about the molecular mechanisms. In this study, we found that a partial TE (Taguchi) inserted in the cis-regulatory region of the silkworm ecdysone oxidase (EO) gene, which encodes a crucial enzyme to reduce the titer of molting hormone (20-hydroxyecdysone, 20E). The TE insertion occurred during domestication of silkworm and the frequency of the TE insertion in the domesticated silkworm (Bombyx mori) is high, 54.24%. The linkage disequilibrium in the TE inserted strains of the domesticated silkworm was elevated. Molecular population genetics analyses suggest that this TE insertion is adaptive for the domesticated silkworm. Luminescent reporter assay shows that the TE inserted in the cis-regulatory region of the EO gene functions as a 20E-induced enhancer of the gene expression. Further, phenotypic bioassay indicates that the silkworm with the TE insertion exhibited more stable developmental phenotype than the silkworm without the TE insertion when suffering from food shortage. Thus, the inserted TE in the cis-regulatory region of the EO gene increased developmental uniformity of silkworm individuals through regulating 20E metabolism, partially explaining transformation of a domestication developmental trait in the domesticated silkworm. Our results emphasize the exceptional role of gene expression regulation in developmental transition of domesticated animals. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail:

  1. Region-dependent dynamics of cAMP response element-binding protein phosphorylation in the basal ganglia

    PubMed Central

    Liu, Fu-Chin; Graybiel, Ann M.


    The cAMP response element-binding protein (CREB) is an activity-dependent transcription factor that is involved in neural plasticity. The kinetics of CREB phosphorylation have been suggested to be important for gene activation, with sustained phosphorylation being associated with downstream gene expression. If so, the duration of CREB phosphorylation might serve as an indicator for time-sensitive plastic changes in neurons. To screen for regions potentially involved in dopamine-mediated plasticity in the basal ganglia, we used organotypic slice cultures to study the patterns of dopamine- and calcium-mediated CREB phosphorylation in the major subdivisions of the striatum. Different durations of CREB phosphorylation were evoked in the dorsal and ventral striatum by activation of dopamine D1-class receptors. The same D1 stimulus elicited (i) transient phosphorylation (≤15 min) in the matrix of the dorsal striatum; (ii) sustained phosphorylation (≤2 hr) in limbic-related structures including striosomes, the nucleus accumbens, the fundus striati, and the bed nucleus of the stria terminalis; and (iii) prolonged phosphorylation (up to 4 hr or more) in cellular islands in the olfactory tubercle. Elevation of Ca2+ influx by stimulation of L-type Ca2+ channels, NMDA, or KCl induced strong CREB phosphorylation in the dorsal striatum but not in the olfactory tubercle. These findings differentiate the response of CREB to dopamine and calcium signals in different striatal regions and suggest that dopamine-mediated CREB phosphorylation is persistent in limbic-related regions of the neonatal basal ganglia. The downstream effects activated by persistent CREB phosphorylation may include time-sensitive neuroplasticity modulated by dopamine. PMID:9539803

  2. Elements of environmental concern in the 1990 Clean Air Act Amendments: A perspective of Fort Union coals in northern Rocky Mountains and Great Plains region

    SciTech Connect

    Stricker, G.D.; Ellis, M.E.; Flores, R.M.; Bader, L.R.


    The elements of environmental concern (EECs) named in the 1990 Clean Air Act Amendments include 12 trace elements consisting of antimony, arsenic, beryllium, cadmium, chromium, cobalt, lead, manganese, mercury, nickel, selenium, and uranium. Although all these trace elements are potentially hazardous, arsenic, mercury, lead, and selenium may be targeted in forthcoming Environmental Protection Agency regulations. Fort Union coals contain all the trace elements named in the Clean Air Act Amendments; however, the presence and amounts of individual trace elements vary from basin to basin. In the Powder River Basin, the major producing Fort Union coals (Wyodak-Anderson and equivalent coal beds, and Rosebud coal bed) contain the lowest (or statistically as low) amounts of EECs of any of the coal producing basins (i.e., Williston, Hanna, and Green River) in the region. In addition, when the arithmetic means of these trace elements in Powder River Basin coals are compared to other regions in the conterminous US, they are lower than those of Cretaceous coals in Colorado Plateau, Tertiary lignites in the Gulf Coast, and Pennsylvanian coals in the Illinois and Appalachian Basins. Thus, elements of environmental concern are generally low in Fort Union coals in the Northern Rocky Mountains and Great Plains region, and particularly low in the Powder River Basin. Projected increase in production of Powder River Basin coals will, therefore, be of greater benefit to the nation than an increase in development and production of coals in other basins.

  3. 46 CFR 56.75-30 - Pipe joining details.

    Code of Federal Regulations, 2014 CFR


    ... 46 Shipping 2 2014-10-01 2014-10-01 false Pipe joining details. 56.75-30 Section 56.75-30 Shipping... APPURTENANCES Brazing § 56.75-30 Pipe joining details. (a) Silver brazing. (1) Circumferential pipe joints may be either of the socket or butt type. When butt joints are employed the edges to be joined shall...

  4. 24 CFR 17.62 - Subdivision and joining of claims.

    Code of Federal Regulations, 2010 CFR


    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Subdivision and joining of claims... General Provisions § 17.62 Subdivision and joining of claims. (a) A debtor's liability arising from a.... (b) Joining of two or more single claims in a demand upon a particular debtor for payment...

  5. 5 CFR 1201.36 - Consolidating and joining appeals.

    Code of Federal Regulations, 2012 CFR


    ... 5 Administrative Personnel 3 2012-01-01 2012-01-01 false Consolidating and joining appeals. 1201... § 1201.36 Consolidating and joining appeals. (a) Explanation. (1) Consolidation occurs when the appeals... example, a judge might join an appeal challenging a 30-day suspension with a pending appeal challenging...

  6. 24 CFR 17.62 - Subdivision and joining of claims.

    Code of Federal Regulations, 2011 CFR


    ... 24 Housing and Urban Development 1 2011-04-01 2011-04-01 false Subdivision and joining of claims... General Provisions § 17.62 Subdivision and joining of claims. (a) A debtor's liability arising from a.... (b) Joining of two or more single claims in a demand upon a particular debtor for payment...

  7. 5 CFR 1201.36 - Consolidating and joining appeals.

    Code of Federal Regulations, 2011 CFR


    ... 5 Administrative Personnel 3 2011-01-01 2011-01-01 false Consolidating and joining appeals. 1201... § 1201.36 Consolidating and joining appeals. (a) Explanation. (1) Consolidation occurs when the appeals... example, a judge might join an appeal challenging a 30-day suspension with a pending appeal challenging...

  8. Little Brother Joins the Large Family

    NASA Astrophysics Data System (ADS)


    On the night of 15 December 2006, the fourth and last-to-be-installed VLTI Auxiliary Telescope (AT4) obtained its 'First Light'. The first images demonstrate that AT4 will be able to deliver the excellent image quality already delivered by the first three ATs. It will soon join its siblings to perform routinely interferometric measurements. ESO PR Photo 51a/06 ESO PR Photo 51a/06 VLT Auxiliary Telescope The VLT is composed of four 8.2-m Unit Telescope (Antu, Kueyen, Melipal and Yepun). They have been progressively put into service together with a vast suite of the most advanced astronomical instruments and are operated every night in the year. Contrary to other large astronomical telescopes, the VLT was designed from the beginning with the use of interferometry as a major goal. The VLT Interferometer (VLTI) combines starlight captured by two or three 8.2- VLT Unit Telescopes, dramatically increasing the spatial resolution and showing fine details of a large variety of celestial objects. ESO PR Photo 51b/06 ESO PR Photo 51b/06 One AT Under the Sky However, most of the time the large telescopes are used for other research purposes. They are therefore only available for interferometric observations during a limited number of nights every year. Thus, in order to exploit the VLTI each night and to achieve the full potential of this unique setup, some other (smaller), dedicated telescopes were included into the overall VLT concept. These telescopes, known as the VLTI Auxiliary Telescopes (ATs), are mounted on tracks and can be placed at precisely defined "parking" observing positions on the observatory platform. From these positions, their light beams are fed into the same common focal point via a complex system of reflecting mirrors mounted in an underground system of tunnels. The Auxiliary Telescopes are real technological jewels. They are placed in ultra-compact enclosures, complete with all necessary electronics, an air conditioning system and cooling liquid for

  9. Joining and Testing Composite Plates to Ti Tubes

    NASA Technical Reports Server (NTRS)

    Morscher, Gregory N.; Singh, Mrityunjay; Shpargei, Tarah; Asthana, Rajiv


    The joining of metal tubes to composite plates is required for heat-rejection components in several space applications. Currently a number of different braze compositions are being evaluated as to their effectiveness. Such tube-plate configurations cannot be represented by traditional methods of testing, e.g., lap joints. The joined region is not between two flat surfaces, but rather between a flat surface and a curved surface. Therefore, several tests have been employed to ascertain the effectiveness of the different braze approaches in tension that are both simple and representative of the actual system and relatively straightforward in analysis. The results of these "tube-tests" will be discussed for the three different braze compositions, Cu-ABA, Ti-Cu-Sil, and Ti-Cu-Ni. In addition, fracture analysis of the failed joints was performed and offers insights into the cause of joint failure and the distinctions which need to be made between the "strength" of a joint versus the "load carrying ability" of a joint.

  10. Vitamin D responsive elements within the HLA-DRB1 promoter region in Sardinian multiple sclerosis associated alleles.


    Cocco, Eleonora; Meloni, Alessandra; Murru, Maria Rita; Corongiu, Daniela; Tranquilli, Stefania; Fadda, Elisabetta; Murru, Raffaele; Schirru, Lucia; Secci, Maria Antonietta; Costa, Gianna; Asunis, Isadora; Cuccu, Stefania; Fenu, Giuseppe; Lorefice, Lorena; Carboni, Nicola; Mura, Gioia; Rosatelli, Maria Cristina; Marrosu, Maria Giovanna


    Vitamin D response elements (VDREs) have been found in the promoter region of the MS-associated allele HLA-DRB1*15:01, suggesting that with low vitamin D availability VDREs are incapable of inducing *15:01 expression allowing in early life autoreactive T-cells to escape central thymic deletion. The Italian island of Sardinia exhibits a very high frequency of MS and high solar radiation exposure. We test the contribution of VDREs analysing the promoter region of the MS-associated DRB1 *04:05, *03:01, *13:01 and *15:01 and non-MS-associated *16:01, *01, *11, *07:01 alleles in a cohort of Sardinians (44 MS patients and 112 healthy subjects). Sequencing of the DRB1 promoter region revealed a homozygous canonical VDRE in all *15:01, *16:01, *11 and in 45/73 *03:01 and in heterozygous state in 28/73 *03:01 and all *01 alleles. A new mutated homozygous VDRE was found in all *13:03, *04:05 and *07:01 alleles. Functionality of mutated and canonical VDREs was assessed for its potential to modulate levels of DRB1 gene expression using an in vitro transactivation assay after stimulation with active vitamin D metabolite. Vitamin D failed to increase promoter activity of the *04:05 and *03:01 alleles carrying the new mutated VDRE, while the *16:01 and *03:01 alleles carrying the canonical VDRE sequence showed significantly increased transcriptional activity. The ability of VDR to bind the mutant VDRE in the DRB1 promoter was evaluated by EMSA. Efficient binding of VDR to the VDRE sequence found in the *16:01 and in the *15:01 allele reduced electrophoretic mobility when either an anti-VDR or an anti-RXR monoclonal antibody was added. Conversely, the Sardinian mutated VDRE sample showed very low affinity for the RXR/VDR heterodimer. These data seem to exclude a role of VDREs in the promoter region of the DRB1 gene in susceptibility to MS carried by DRB1* alleles in Sardinian patients.

  11. Vitamin D Responsive Elements within the HLA-DRB1 Promoter Region in Sardinian Multiple Sclerosis Associated Alleles

    PubMed Central

    Murru, Maria Rita; Corongiu, Daniela; Tranquilli, Stefania; Fadda, Elisabetta; Murru, Raffaele; Schirru, Lucia; Secci, Maria Antonietta; Costa, Gianna; Asunis, Isadora; Cuccu, Stefania; Fenu, Giuseppe; Lorefice, Lorena; Carboni, Nicola; Mura, Gioia; Rosatelli, Maria Cristina; Marrosu, Maria Giovanna


    Vitamin D response elements (VDREs) have been found in the promoter region of the MS-associated allele HLA-DRB1*15∶01, suggesting that with low vitamin D availability VDREs are incapable of inducing *15∶01 expression allowing in early life autoreactive T-cells to escape central thymic deletion. The Italian island of Sardinia exhibits a very high frequency of MS and high solar radiation exposure. We test the contribution of VDREs analysing the promoter region of the MS-associated DRB1 *04∶05, *03∶01, *13∶01 and *15∶01 and non-MS-associated *16∶01, *01, *11, *07∶01 alleles in a cohort of Sardinians (44 MS patients and 112 healthy subjects). Sequencing of the DRB1 promoter region revealed a homozygous canonical VDRE in all *15∶01, *16∶01, *11 and in 45/73 *03∶01 and in heterozygous state in 28/73 *03∶01 and all *01 alleles. A new mutated homozygous VDRE was found in all *13∶03, *04∶05 and *07∶01 alleles. Functionality of mutated and canonical VDREs was assessed for its potential to modulate levels of DRB1 gene expression using an in vitro transactivation assay after stimulation with active vitamin D metabolite. Vitamin D failed to increase promoter activity of the *04∶05 and *03∶01 alleles carrying the new mutated VDRE, while the *16∶01 and *03∶01 alleles carrying the canonical VDRE sequence showed significantly increased transcriptional activity. The ability of VDR to bind the mutant VDRE in the DRB1 promoter was evaluated by EMSA. Efficient binding of VDR to the VDRE sequence found in the *16∶01 and in the *15∶01 allele reduced electrophoretic mobility when either an anti-VDR or an anti-RXR monoclonal antibody was added. Conversely, the Sardinian mutated VDRE sample showed very low affinity for the RXR/VDR heterodimer. These data seem to exclude a role of VDREs in the promoter region of the DRB1 gene in susceptibility to MS carried by DRB1* alleles in Sardinian patients. PMID:22848563

  12. Evaluating the Upset Protrusion Joining (UPJ) Method to Join magnesium Castings to Dissimilar Metals

    SciTech Connect

    Logan, Stephen D.


    This presentation discusses advantages and best practices for incorporating magnesium in automotive component applications to achieve substantial mass reduction, as well as some of the key challenges with respect to joining, coating, and galvanic corrosion, before providing an introduction and status update of the U.S. Department of Energy and Department of Defense jointly sponsored Upset Protrusion Joining (UPJ) process development and evaluation project. This update includes sharing performance results of a benchmark evaluation of the self-pierce riveting (SPR) process for joining dissimilar magnesium (Mg) to aluminum (Al) materials in four unique coating configurations before introducing the UPJ concept and comparing performance results of the joints made with the UPJ process to those made with the SPR process.


    SciTech Connect

    Jana, Saumyadeep; Hovanski, Yuri; Pilli, Siva Prasad; Field, David P.; Yu, Hao; Pan, Tsung-Yu; Santella, M. L.


    Friction stir welding and ultrasonic welding techniques were applied to join automotive magnesium alloys to steel sheet. The effect of tooling and process parameters on the post-weld microstructure, texture and mechanical properties was investigated. Static and dynamic loading were utilized to investigate the joint strength of both cast and wrought magnesium alloys including their susceptibility and degradation under corrosive media. The conditions required to produce joint strengths in excess of 75% of the base metal strength were determined, and the effects of surface coatings, tooling and weld parameters on weld properties are presented.

  14. Joining of materials with engineered interlayers

    NASA Technical Reports Server (NTRS)

    Challenger, Kenneth D.; Cordea, Tom; Sengupta, Samit; Wampler, Scott


    A reliable method to join a variety of different materials is developed which uses engineered coatings to produce strong bonds by solid-state techniques at low temperatures (300-400 C). The strong bonds are capable of accommodating the strains created between Si and most substrates due to differences in thermal expansion coefficients. The approach encompasses two phases: noble metal compliant interlayers and functionally gradient interlayer bonding. Preliminary results are presented and the Ag interlayer bonds are microstructurally characterized confirming that the planar magnetron sputtered coatings/bonds are fully dense and metallurgically sound.

  15. Solid State Joining of Magnesium to Steel

    NASA Astrophysics Data System (ADS)

    Jana, Saumyadeep; Hovanski, Yuri; Pilli, Siva P.; Field, David P.; Yu, Hao; Pan, Tsung-Yu; Santella, M. L.

    Friction stir welding and ultrasonic welding techniques were applied to join automotive magnesium alloys to steel sheet. The effect of tooling and process parameters on the post-weld microstructure, texture and mechanical properties was investigated. Static and dynamic loading were utilized to investigate the joint strength of both cast and wrought magnesium alloys including their susceptibility and degradation under corrosive media. The conditions required to produce joint strengths in excess of 75% of the base metal strength were determined, and the effects of surface coatings, tooling and weld parameters on weld properties are presented.



    Krikorian, N.H.; Farr, J.D.; Witteman, W.G.


    A method is described for joining a refractory metal carbide such as UC or ZrC to a refractory metal base such as Ta or Nb. The method comprises carburizing the surface of the metal base and then sintering the base and carbide at temperatures of about 2000 deg C in a non-oxidizing atmosphere, the base and carbide being held in contact during the sintering step. To reduce the sintering temperature and time, a sintering aid such as iron, nickel, or cobait is added to the carbide, not to exceed 5 wt%. (AEC)

  17. Pole-equator difference and the variability of the brightness of the chromospheric CaII-K-network elements in quiet regions over the solar cycle

    NASA Technical Reports Server (NTRS)

    Kariyappa, R.


    The dependence of the brightness of chromospheric network elements on latitude was investigated for quiet solar regions. Calibrated photographic CaII K-spectroheliograms were used to compare the variation in brightness at the center of the disk with higher latitude of chromospheric network elements in a quiet region as a function of solar activity. It was found that there was no significant difference in brightness between the center of the solar disk and higher latitude. It is concluded that the brightness of the chromospheric network elements in a quiet region does not depend on the latitude, but that the variation in the intensity enhancement is related to the level of solar activity.

  18. Genetic and biochemical analysis of cis regulatory elements within the keratinocyte enhancer region of the human papillomavirus type 31 upstream regulatory region during different stages of the viral life cycle.


    Sen, Ellora; Alam, Samina; Meyers, Craig


    Using linker scanning mutational analysis, we recently identified potential cis regulatory elements contained within the 5' upstream regulatory region (URR) domain and auxiliary enhancer (AE) region of the human papillomavirus type 31 (HPV31) URR involved in the regulation of E6/E7 promoter activity at different stages of the viral life cycle. For the present study, we extended the linker scanning mutational analysis to identify potential cis elements located in the keratinocyte enhancer (KE) region (nucleotides 7511 to 7762) of the HPV31 URR and to characterize cellular factors that bind to these elements under conditions representing different stages of the viral life cycle. The linker scanning mutational analysis identified viral cis elements located in the KE region that regulate transcription in the presence and absence of any viral gene products or viral DNA replication and determine the role of host tissue differentiation on viral transcriptional regulation. Using electrophoretic mobility shift assays, we illustrated defined reorganization in the composition of cellular transcription factors binding to the same cis regulatory elements at different stages of the HPV differentiation-dependent life cycle. Our studies provide an extensive map of functional elements in the KE region of the HPV31 URR, identify cis regulatory elements that exhibit significant transcription regulatory potential, and illustrate changes in specific protein-DNA interactions at different stages of the viral life cycle. The variable recruitment of transcription factors to the same cis element under different cellular conditions may represent a mechanism underlying the tight link between keratinocyte differentiation and E6/E7 expression.

  19. Geochemical distribution of major and trace elements in agricultural soils of Castilla-La Mancha (central Spain): finding criteria for baselines and delimiting regional anomalies.


    Bravo, Sandra; García-Ordiales, Efrén; García-Navarro, Francisco Jesús; Amorós, José Ángel; Pérez-de-Los-Reyes, Caridad; Jiménez-Ballesta, Raimundo; Esbrí, José María; García-Noguero, Eva María; Higueras, Pablo


    Castilla-La Mancha (central Spain) is a region characterized by significant agricultural production aimed at high-quality food products such as wine and olive oil. The quality of agricultural products depends directly on the soil quality. Soil geochemistry, including dispersion maps and the recognition of baselines and anomalies of various origins, is the most important tool to assess soil quality. With this objective, 200 soil samples were taken from agricultural areas distributed among the different geological domains present in the region. Analysis of these samples included evaluation of edaphological parameters (reactivity, electrical conductivity, organic matter content) and the geochemistry of major and trace elements by X-ray fluorescence. The dataset obtained was statistically analyzed for major elements and, in the case of trace elements, was normalized with respect to Al and analyzed using the relative cumulative frequency (RCF) distribution method. Furthermore, the geographic distribution of analytical data was characterized and analyzed using the kriging technique, with a correspondence found between major and trace elements in the different geologic domains of the region as well as with the most important mining areas. The results show an influence of the clay fraction present in the soil, which acts as a repository for trace elements. On the basis of the results, of the possible elements related with clay that could be used for normalization, Al was selected as the most suitable, followed by Fe, Mn, and Ti. Reference values estimated using this methodology were lower than those estimated in previous studies.

  20. High time-resolved elemental components in fine and coarse particles in the Pearl River Delta region of Southern China: Dynamic variations and effects of meteorology.


    Zhou, Shengzhen; Davy, Perry K; Wang, Xuemei; Cohen, Jason Blake; Liang, Jiaquan; Huang, Minjuan; Fan, Qi; Chen, Weihua; Chang, Ming; Ancelet, Travis; Trompetter, William J


    Hourly-resolved PM2.5 and PM10-2.5 samples were collected in the industrial city Foshan in the Pearl River Delta region, China. The samples were subsequently analyzed for elemental components and black carbon (BC). A key purpose of the study was to understand the composition of particulate matter (PM) at high-time resolution in a polluted urban atmosphere to identify key components contributing to extreme PM concentration events and examine the diurnal chemical concentration patterns for air quality management purposes. It was found that BC and S concentrations dominated in the fine mode, while elements with mostly crustal and oceanic origins such as Si, Ca, Al and Cl were found in the coarse size fraction. Most of the elements showed strong diurnal variations. S did not show clear diurnal variations, suggesting regional rather than local origin. Based on empirical orthogonal functions (EOF) method, 3 forcing factors were identified contributing to the extreme events of PM2.5 and selected elements, i.e., urban direct emissions, wet deposition and a combination of coarse mode sources. Conditional probability functions (CPF) were performed using wind profiles and elemental concentrations. The CPF results showed that BC and elemental Cl, K, Fe, Cu and Zn in the fine mode were mostly from the northwest, indicating that industrial emissions and combustion were the main sources. For elements in the coarse mode, Si, Al, K, Ca, Fe and Ti showed similar patterns, suggesting same sources such as local soil dust/construction activities. Coarse elemental Cl was mostly from the south and southeast, implying the influence of marine aerosol sources. For other trace elements, we found vanadium (V) in fine PM was mainly from the sources located to the southeast of the measuring site. Combined with CPF results of S and V in fine PM, we concluded shipping emissions were likely an important elemental emission source. Copyright © 2016. Published by Elsevier B.V.

  1. Stable isotopic compositions of elemental carbon in PM1.1 in north suburb of Nanjing Region, China

    NASA Astrophysics Data System (ADS)

    Guo, Zhaobing; Jiang, Wenjuan; Chen, Shanli; Sun, Deling; Shi, Lei; Zeng, Gang; Rui, Maoling


    Stable isotopic compositions (δ13C) of elemental carbon (EC) in PM1.1 in north suburb of Nanjing region were determined in order to quantitatively evaluate the carbon sources of atmospheric fine particles during different seasons. Besides, δ13C values from potential sources such as coal combustion, vehicle exhaust, biomass burning, and dust were synchronously measured. The results showed that the average δ13C values of EC in PM1.1 in winter and summer were - 23.89 ± 1.6‰ and - 24.76 ± 0.9‰, respectively. Comparing with δ13C values from potential sources, we concluded that the main sources of EC in PM1.1 were from the emission of coal combustion and vehicle exhaust. The higher δ13C values in winter than those in summer were chiefly attributed to the more coal consumption. Combining with the concentrations of SO42 - and K+ in PM1.1, the high δ13C values of EC on 24 December and 27 December 2013 were ascribed to extra input of corn straw burning in addition to coal combustion and vehicle exhaust.

  2. In-Network Processing of Joins in Wireless Sensor Networks

    PubMed Central

    Kang, Hyunchul


    The join or correlated filtering of sensor readings is one of the fundamental query operations in wireless sensor networks (WSNs). Although the join in centralized or distributed databases is a well-researched problem, join processing in WSNs has quite different characteristics and is much more difficult to perform due to the lack of statistics on sensor readings and the resource constraints of sensor nodes. Since data transmission is orders of magnitude more costly than processing at a sensor node, in-network processing of joins is essential. In this paper, the state-of-the-art techniques for join implementation in WSNs are surveyed. The requirements and challenges, join types, and components of join implementation are described. The open issues for further research are identified. PMID:23478603

  3. Effect of material flow on joint strength in activation spot joining of Al alloy and steel sheets

    NASA Astrophysics Data System (ADS)

    Watanabe, Goro; Yogo, Yasuhiro; Takao, Hisaaki


    A new joining method for dissimilar metal sheets was developed where a rotated consumable rod of Al alloy is pressed onto an Al alloy sheet at the part overlapped with a mild steel sheet. The metal flow in the joining region is increased by the through-hole in the Al sheet and consumable Al rod. The rod creates the joint interface and pads out of the thinly joined parts through pressing. This produces a higher joint strength than that of conventional friction stir spot welding. Measurements of the joint interface showed the presence of a 5-10 nm thick amorphous layer consisting of Al and Mg oxides.

  4. Ceramic joining in the United States

    SciTech Connect

    Loehman, R.E.


    Most US government-funded ceramic joining research and development is sponsored by the US Department of Energy (DOE). Historically, this work has not been funded as a stand-alone effort, but rather as a component of the ceramic engine program sponsored by DOE. That program had its genesis with the Advanced Gas Turbine or AGT Project, which was conducted by two teams, each consisting of a turbine manufacturer and an automobile company. Those two teams, Garrett/Ford and GM/Allison, eventually produced gas turbine demonstration engines in two designs that ran for 100 hours at 1150 /degree/C. An important point for this audience is that the program included no separate materials development or joining R and D. The project objective was engineering design and demonstration and new materials and processes to meet the systems requirements were to be developed as needed in the program. Consequently, there was very little support for advanced materials development and progress on that front was somewhat limited. 6 refs.

  5. Joining Composite Chassis Components on Heavy Trucks

    SciTech Connect

    Herling, Darrell R.; Klett, Lynn


    Class 8 trucks offer substantial opportunities for weight reduction with cost incentives resulting from increased payload and improved fuel efficiency. The chassis, suspension, drive train, and wheels contribute to approximately 40% of the truck weight and have components that are excellent candidates, in terms of material performance requirements, for replacement with low-density structural composite materials. However, actual or perceived deficiencies in joint reliability have, up to now, limited the use of polymer composites in this application. Researchers at Oak Ridge National Laboratory (ORNL) and Pacific Northwest National Laboratory (PNNL) have begun a project to overcome the major technical issues associated with joining thick fiber reinforced composite sections. The main objective is to develop both economical and robust attachment techniques for composite members joined to steel members. The research will be coordinated with an industry team led by Delphi Corporation that is developing and commercializing composite chassis members through funding from the Department of Energy's (DOE’s) High Strength Weight Reduction Materials Program, under the Office of FreedomCAR and Vehicle Technologies.

  6. Joining of thermoplastic substrates by microwaves


    Paulauskas, Felix L.; Meek, Thomas T.


    A method for joining two or more items having surfaces of thermoplastic material includes the steps of depositing an electrically-conductive material upon the thermoplastic surface of at least one of the items, and then placing the other of the two items adjacent the one item so that the deposited material is in intimate contact with the surfaces of both the one and the other items. The deposited material and the thermoplastic surfaces contacted thereby are then exposed to microwave radiation so that the thermoplastic surfaces in contact with the deposited material melt, and then pressure is applied to the two items so that the melted thermoplastic surfaces fuse to one another. Upon discontinuance of the exposure to the microwave energy, and after permitting the thermoplastic surfaces to cool from the melted condition, the two items are joined together by the fused thermoplastic surfaces. The deposited material has a thickness which is preferably no greater than a skin depth, .delta..sub.s, which is related to the frequency of the microwave radiation and characteristics of the deposited material in accordance with an equation.

  7. Joining of Tungsten Armor Using Functional Gradients

    SciTech Connect

    John Scott O'Dell


    The joining of low thermal expansion armor materials such as tungsten to high thermal expansion heat sink materials has been a major problem in plasma facing component (PFC) development. Conventional planar bonding techniques have been unable to withstand the high thermal induced stresses resulting from fabrication and high heat flux testing. During this investigation, innovative functional gradient joints produced using vacuum plasma spray forming techniques have been developed for joining tungsten armor to copper alloy heat sinks. A model was developed to select the optimum gradient architecture. Based on the modeling effort, a 2mm copper rich gradient was selected. Vacuum plasma pray parameters and procedures were then developed to produce the functional gradient joint. Using these techniques, dual cooling channel, medium scale mockups (32mm wide x 400mm length) were produced with vacuum plasma spray formed tungsten armor. The thickness of the tungsten armor was up to 5mm thick. No evidence of debonding at the interface between the heat sink and the vacuum plasma sprayed material was observed.

  8. Identification of both copy number variation-type and constant-type core elements in a large segmental duplication region of the mouse genome

    PubMed Central


    Background Copy number variation (CNV), an important source of diversity in genomic structure, is frequently found in clusters called CNV regions (CNVRs). CNVRs are strongly associated with segmental duplications (SDs), but the composition of these complex repetitive structures remains unclear. Results We conducted self-comparative-plot analysis of all mouse chromosomes using the high-speed and large-scale-homology search algorithm SHEAP. For eight chromosomes, we identified various types of large SD as tartan-checked patterns within the self-comparative plots. A complex arrangement of diagonal split lines in the self-comparative-plots indicated the presence of large homologous repetitive sequences. We focused on one SD on chromosome 13 (SD13M), and developed SHEPHERD, a stepwise ab initio method, to extract longer repetitive elements and to characterize repetitive structures in this region. Analysis using SHEPHERD showed the existence of 60 core elements, which were expected to be the basic units that form SDs within the repetitive structure of SD13M. The demonstration that sequences homologous to the core elements (>70% homology) covered approximately 90% of the SD13M region indicated that our method can characterize the repetitive structure of SD13M effectively. Core elements were composed largely of fragmented repeats of a previously identified type, such as long interspersed nuclear elements (LINEs), together with partial genic regions. Comparative genome hybridization array analysis showed that whereas 42 core elements were components of CNVR that varied among mouse strains, 8 did not vary among strains (constant type), and the status of the others could not be determined. The CNV-type core elements contained significantly larger proportions of long terminal repeat (LTR) types of retrotransposon than the constant-type core elements, which had no CNV. The higher divergence rates observed in the CNV-type core elements than in the constant type indicate that the

  9. Regional electric field induced by electroconvulsive therapy in a realistic finite element head model: Influence of white matter anisotropic conductivity

    PubMed Central

    Lee, Won Hee; Deng, Zhi-De; Kim, Tae-Seong; Laine, Andrew F.; Lisanby, Sarah H.; Peterchev, Angel V.


    We present the first computational study investigating the electric field (E-field) strength generated by various electroconvulsive therapy (ECT) electrode configurations in specific brain regions of interest (ROIs) that have putative roles in the therapeutic action and/or adverse side effects of ECT. This study also characterizes the impact of the white matter (WM) conductivity anisotropy on the E-field distribution. A finite element head model incorporating tissue heterogeneity and WM anisotropic conductivity was constructed based on structural magnetic resonance imaging (MRI) and diffusion tensor MRI data. We computed the spatial E-field distributions generated by three standard ECT electrode placements including bilateral (BL), bifrontal (BF), and right unilateral (RUL) and an investigational electrode configuration for focal electrically administered seizure therapy (FEAST). The key results are that (1) the median E-field strength over the whole brain is 3.9, 1.5, 2.3, and 2.6 V/cm for the BL, BF, RUL, and FEAST electrode configurations, respectively, which coupled with the broad spread of the BL E-field suggests a biophysical basis for observations of superior efficacy of BL ECT compared to BF and RUL ECT; (2) in the hippocampi, BL ECT produces a median E-field of 4.8 V/cm that is 1.5–2.8 times stronger than that for the other electrode configurations, consistent with the more pronounced amnestic effects of BL ECT; and (3) neglecting the WM conductivity anisotropy results in E-field strength error up to 18% overall and up to 39% in specific ROIs, motivating the inclusion of the WM conductivity anisotropy in accurate head models. This computational study demonstrates how the realistic finite element head model incorporating tissue conductivity anisotropy provides quantitative insight into the biophysics of ECT, which may shed light on the differential clinical outcomes seen with various forms of ECT, and may guide the development of novel stimulation

  10. FE-simulation of the Presta joining process for assembled camshafts - modelling of the joining process

    NASA Astrophysics Data System (ADS)

    Scherzer, R.; Silbermann, C. B.; Landgraf, R.; Ihlemann, J.


    The Presta joining process is based on the separate manufacturing of internal profiled cams and shafts with previously widened diameters at the intended cam seat through rolling. With regard to further optimization and enhancement, the two substeps are modelled and simulated using FEM. The results of the rolling process simulation are employed as the starting point for the simulation of the joining step, which is presented in this contribution. First, the shaft is widened with a profile oriented orthogonal to the shaft axis at the intended cam seat. Subsequently, the shaft is joined with a cam that has an internal profile oriented parallel to the shaft axis. Due to plastic deformations these perpendicular profiles form a tight fit. Because of these complex plastic deformations, that are related to large local forming degrees, the use of precise material models is essential. Moreover, it is necessary to maintain the deformation history of the rolling simulation in the joining step with regard to effects like kinematic or isotropic hardening. For that purpose, the applied material model’s invariance under change of the reference configuration is used by transferring its internal state variables from one simulation step to another. Finally, the results of the simulation are compared to measurements of series production.

  11. A transient FGM interlayer based approach to joining ceramics

    SciTech Connect

    Glaeser, A.M.; Shalz, M.L.; Dalgleish, B.J.; Tomsia, A.P.


    In most cases, functionally gradient materials have been designed to produce a desirable property gradient in a material or in a joint region. In this paper, the concept of a transient gradient structure is introduced. The function of the intentional property discontinuities in these multilayer interlayers is to facilitate processing of assemblies and materials combinations that would be difficult to process using conventional bonding approaches. Specifically, the methods make use of a thin or partial layer of a low melting point transient liquid phase to facilitate bonding via brazing, yet produce refractory joints. Several mechanisms for consuming the transient liquid former are outlined, and examples of interlayer designs that exploit these mechanisms are presented. Specific results from experiments joining alumina to alumina via Cu/Pt/Cu, Cu/Ni/Cu, Cu/Nb/Cu and Sn/Nb/Sn interlayers are presented.

  12. Optimum structural sizing of conventional cantilever and joined wing configurations using equivalent beam models

    NASA Technical Reports Server (NTRS)

    Hajela, P.; Chen, J. L.


    The present paper describes an approach for the optimum sizing of single and joined wing structures that is based on representing the built-up finite element model of the structure by an equivalent beam model. The low order beam model is computationally more efficient in an environment that requires repetitive analysis of several trial designs. The design procedure is implemented in a computer program that requires geometry and loading data typically available from an aerodynamic synthesis program, to create the finite element model of the lifting surface and an equivalent beam model. A fully stressed design procedure is used to obtain rapid estimates of the optimum structural weight for the beam model for a given geometry, and a qualitative description of the material distribution over the wing structure. The synthesis procedure is demonstrated for representative single wing and joined wing structures.

  13. Multi-element otolith chemistry of juvenile sole ( Solea solea), whiting ( Merlangius merlangus) and European seabass ( Dicentrarchus labrax) in the Thames Estuary and adjacent coastal regions

    NASA Astrophysics Data System (ADS)

    Leakey, Chris D. B.; Attrill, Martin J.; Fitzsimons, Mark F.


    Estuaries are regarded as valuable nursery habitats for many commercially important marine fishes, potentially providing a thermal resource, refuge from predators and a source of abundant prey. To assess the extent of estuarine use by juvenile (0+) common sole ( Solea solea), whiting ( Merlangius merlangus) and European seabass ( Dicentrarchus labrax) we: (1) developed techniques to distinguish between estuarine and coastally-caught juveniles using otolith chemistry; and (2) examined the accuracy with which multi-elemental signatures could re-classify juveniles to their region of collection. High-resolution solution-based inductively coupled plasma mass spectrometry (HB-SB-ICPMS) was used to quantify 32 elements within the juvenile otoliths; 14 elements occurred above detection limits for all samples. Some elemental distributions demonstrated clear differences between estuarine and coastally-caught fish. Multivariate analysis of the otolith chemistry data resulted in 95-100% re-classification accuracy to the region of collection. Estuarine and coastal signatures were most clearly defined for sole which, compared to bass and whiting, have low mobility and are less likely to move from estuarine to coastal habitats between larval settlement and later migration to adult stocks. Sole were the only species to reveal an energetic benefit associated with an estuarine juvenile phase. The physiological ability of bass to access upper estuarine regions was consistent with some elemental data, while the high mobility and restricted range of whiting resulted in less distinct otolith chemistries.

  14. Spatial and seasonal variations of atmospheric organic carbon and elemental carbon in Pearl River Delta Region, China

    NASA Astrophysics Data System (ADS)

    Cao, J. J.; Lee, S. C.; Ho, K. F.; Zou, S. C.; Fung, Kochy; Li, Y.; Watson, John G.; Chow, Judith C.

    The concentrations of organic carbon (OC) and elemental carbon (EC) in atmospheric particles were investigated at eight sites in four cities (Hong Kong, Guangzhou, Shenzhen and Zhuhai) of the Pearl River Delta Region (PRDR), China, during winter and summer 2002. The comparison of summer and winter results was made in order to investigate spatial and seasonal variations. PM 2.5 and PM 10 samples were collected on pre-fired quartz filters with mini-volume samplers and analyzed by the thermal optical reflectance (TOR) method following the Interagency Monitoring of PROtected Visual Environments (IMPROVE) protocol. During summer, the average OC and EC concentrations in PM 2.5 were 9.2 and 4.1 μg m -3, while those in PM 10 were 12.3 and 5.2 μg m -3. Carbonaceous aerosol accounted for 38.0% of the PM 2.5 and 32.9% of the PM 10. The daily average OC, EC, PM 2.5 and PM 10 concentrations in PRDR were higher in winter than in summer. The average OC/EC ratio was 2.5 for PM 2.5 and PM 10, suggesting the presence of secondary organic aerosols. The estimated secondary organic carbons in PM 2.5 and PM 10 were 4.1 and 5.6 μg m -3, respectively. The OC and EC were found to be correlated in winter (correlation coefficient r=0.82) and summer ( r=0.64), which implied that motor vehicle sources contributed to the ambient carbonaceous particles. The distribution of eight carbon fractions in OC and EC at eight sites was first reported in ambient samples in Asia, which also indicated that motor vehicle exhaust was the dominant contributor to carbonaceous particles.

  15. Isotope and trace element data bearing of the sources and evolution of magmas in the Katmai region, Alaska

    SciTech Connect

    Rubenstone, J.L.; Langmuir, C.H.; Hildreth, W.


    The Katmai volcanic province, Alaska Peninsula, includes the catastrophic 1912 Valley of Ten Thousand Smokes (VTTS) eruption, and five andesite-dacite stratovolcanoes. The VTTS is markedly uniform in /sup 143/Nd//sup 144/Nd (0.51301) and delta/sup 18/O (6.0 per thousands) but has a small but significant variation in /sup 87/Sr//sup 86/Sr (0.70354 in andesite and dacite, 0.70368 in rhyolite). The rhyolite's low Sr content (63 ppm) makes it particularly susceptible to crustal contamination; assimilation of only 1% of Jurassic country rock (0.70480, 400 ppm Sr) is sufficient. Dacite from the 1959 eruption of nearby Mt. Trident and a basalt boulder from the rim of Mt. Katmai are isotopically similar to the VTTS andesite and dacite. Dacite from Mt. Mageik has higher /sup 87/Sr//sup 86/Sr, whereas the least-silicic in situ lava in the region, an andesite from Mt. Griggs, has the lowest /sup 87/Sr//sup 86/Sr (0.70335). The Katmai Province falls within the narrow range of /sup 143/Nd//sup 144/Nd for Quaternary lavas from the Aleutians and SW Alaska Peninsula (0.51298-0.51310) but at the high end of the /sup 87/Sr//sup 86/Sr range. Along with the greater abundance of evolved lavas, this probably reflects progressively thicker crust northward along the Alaska Peninsula, although simple assimilation of upper crust cannot explain all of the isotopic data. Isotopic systematics, and Aleutian-type trace-element patterns (La/Yb > chondrites, high Ba/La), indicate that the parental magmas at Katmai are likewise derived from a time-integrated depleted mantle, recently modified by a component from the subducted slab.

  16. Far Upstream Element-Binding Protein 1 Binds the 3' Untranslated Region of PKD2 and Suppresses Its Translation.


    Zheng, Wang; Shen, Fan; Hu, Ruikun; Roy, Birbickram; Yang, JungWoo; Wang, Qian; Zhang, Fan; King, Jennifer C; Sergi, Consolato; Liu, Song-Mei; Cordat, Emmanuelle; Tang, Jingfeng; Cao, Ying; Ali, Declan; Chen, Xing-Zhen


    Autosomal dominant polycystic kidney disease pathogenesis can be recapitulated in animal models by gene mutations in or dosage alterations of polycystic kidney disease 1 (PKD1) or PKD2, demonstrating that too much and too little PKD1/PKD2 are both pathogenic. Gene dosage manipulation has become an appealing approach by which to compensate for loss or gain of gene function, but the mechanisms controlling PKD2 expression remain incompletely characterized. In this study, using cultured mammalian cells and dual-luciferase assays, we found that the 3' untranslated region (3'UTR) of PKD2 mRNA inhibits luciferase protein expression. We then identified nucleotides 691-1044, which we called 3FI, as the 3'UTR fragment necessary for repressing the expression of luciferase or PKD2 in this system. Using a pull-down assay and mass spectrometry we identified far upstream element-binding protein 1 (FUBP1) as a 3FI-binding protein. In vitro overexpression of FUBP1 inhibited the expression of PKD2 protein but not mRNA. In embryonic zebrafish, FUBP1 knockdown (KD) by morpholino injection increased PKD2 expression and alleviated fish tail curling caused by morpholino-mediated KD of PKD2. Conversely, FUBP1 overexpression by mRNA injection significantly increased pronephric cyst occurrence and tail curling in zebrafish embryos. Furthermore, FUBP1 binds directly to eukaryotic translation initiation factor 4E-binding protein 1, indicating a link to the translation initiation complex. These results show that FUBP1 binds 3FI in the PKD2 3'UTR to inhibit PKD2 translation, regulating zebrafish disease phenotypes associated with PKD2 KD. Copyright © 2016 by the American Society of Nephrology.

  17. Natural contamination with arsenic and other trace elements in groundwater of the Central-West region of Chaco, Argentina.


    Blanes, Patricia S; Buchhamer, Edgar E; Giménez, María C


    This study covered the central agricultural region of the Chaco province, which lacks a permanent river networks. However, during the rainy period there is localized groundwater recharge. About 84 groundwater samples were taken during the period April-December 2007. These groundwater samples were collected from two different depths: 62 samples from shallow wells (4 to 20 m) and 24 samples from deep wells (20 to 100 m). Chemical variables were determined: pH, specific conductance, total dissolved solid, hardness, alkalinity, HCO(3)-, CO(3)(2-), SO(4)(2-), Cl-, NO(3)-, NO(2) -, NH(4)+, F-, As((tot)), Na+, K+, Ca2+, Mg2+, Fe, Cu, Ni, Pb and Zn. The chemical composition of groundwater in the study area is dominantly sodium bicarbonate and sodium chloride bicarbonate, comprising more than 60% (52/86) of shallow and deep groundwater samples. Of the 86 analyzed groundwater samples, 88% exceeded the WHO (World Health Organization) and CAA (Código Alimentario Argentino) standards (10 μg/L) for As (arsenic) and 9% exceeded the WHO standard (1.5 mg/L) for F(-).Groundwater highly contaminated with As (max. 1,073 μg/L) and F- (max. 4.2 mg/L) was found in shallow aquifer. The contaminated groundwater is characterized by high pH (max. 8.9), alkalinity (max. HCO(3)- 1,932 mg/L), SO(4)(2-) (max. 11,862 mg/L), Na(+) (max. 3,158 mg/L), Cl(-) (max. 10,493 mg/L) and electric conductivity greater than 33.3 μS/cm. Other associated elements (Ni, Pb, Cu and Zn) are present in low concentrations, except for Fe that in 32% of samples exceeded the guideline value of 0.3 mg/L suggested by the CAA.

  18. Trace elements in native and improved paddy rice from different climatic regions of Sri Lanka: implications for public health.


    Diyabalanage, Saranga; Navarathna, Thamara; Abeysundara, Hemalika T K; Rajapakse, Sanath; Chandrajith, Rohana


    Samples of 226 new improved and 21 indigenous rice (Oryza sativa L.) varieties were collected from the rice fields in three climatic zones of Sri Lanka and concentrations of 18 trace elements (Li, B, Al, Cr, Mn, Fe, Co, Ni, Cu, Zn, As, Se, Sr, Mo, Cd, Ba, Pb and Bi) were measured giving particular emphasis on Se, Cd and As using ICP-MS. The two way multivariate analysis of variance (MANOVA) method was employed to identify the differences in composition among rice from different climatic zones. The mean values obtained for both white and red rice were Se (36; 25 µg/kg), As (42; 45 µg/kg) and Cd (70; 123 µg/kg) on dry weight basis. However mean content of Se, As and Cd of native rice varieties were 69, 74 and 33 µg/kg, respectively. Statistical interpretations showed that in the majority of cases, there was a significant difference in Cd content among climatic zones whereas Se and Pb show differences between white and red rice varieties. Arsenic did not indicate any significant difference either between rice types or among climatic regions. Notably Se and As contents in indigenous rice were higher than that of improved rice types. To assess the safety of dietary of intake, daily intake of Se, Cd and As by rice were calculated. Non-gender specific Estimated Daily Intake (EDI) of Se, Cd and As consuming improved rice are 9.31, 24.1 and 12.2 µg day(-1), respectively. Since over 50 % of daily meals of people contain rice or rice based products, Se intake is expected to be deficient among the Sri Lankan population.

  19. Elements of regional beetle faunas: faunal variation and compositional breakpoints along climate, land cover and geographical gradients.


    Heino, Jani; Alahuhta, Janne


    Regional faunas are structured by historical, spatial and environmental factors. We studied large-scale variation in four ecologically different beetle groups (Coleoptera: Dytiscidae, Carabidae, Hydrophiloidea, Cerambycidae) along climate, land cover and geographical gradients, examined faunal breakpoints in relation to environmental variables, and investigated the best fit pattern of assemblage variation (i.e. randomness, checkerboards, nestedness, evenly spaced, Gleasonian, Clementsian). We applied statistical methods typically used in the analysis of local ecological communities to provide novel insights into faunal compositional patterns at large spatial grain and geographical extent. We found that spatially structured variation in climate and land cover accounted for most variation in each beetle group in partial redundancy analyses, whereas the individual effect of each explanatory variable group was generally much less important in accounting for variation in provincial species composition. We also found that climate variables were most strongly associated with faunal breakpoints, with temperature-related variables alone accounting for about 20% of variation at the first node of multivariate regression tree for each beetle group. The existence of faunal breakpoints was also shown by the 'elements of faunal structure' analyses, which suggested Clementsian gradients across the provinces, that is, that there were two or more clear groups of species responding similarly to the underlying ecological gradients. The four beetle groups showed highly similar biogeographical patterns across our study area. The fact that temperature was related to faunal breakpoints in the species composition of each beetle group suggests that climate sets a strong filter to the distributions of species at this combination of spatial grain and spatial extent. This finding held true despite the ecological differences among the four beetle groups, ranging from fully aquatic to fully

  20. Identification of polycomb and trithorax group responsive elements in the regulatory region of the Drosophila homeotic gene Sex combs reduced

    SciTech Connect

    Gindhart, J.G. Jr.; Kaufman, T.C.


    The Drosophilia homeotic gene Sex combs reduced (Scr) is necessary for the establishment and maintenance of the morphological identity of the labial and prothoracic segments. In the early embryo, its expression pattern is established through the activity of several gap and segmentation gene products, as well as other transcription factors. Once established, the Polycomb group (Pc-G) and trithorax group (trx-G) gene products maintain the spatial pattern of Scr expression for the remainder of development. We report the identification of DNA fragments in the Scr regulatory region that may be important for its regulation by Polycomb and trithorax group gene products. When DNA fragments containing these regulatory sequences are subcloned into P-element vectors containing a white minigene, transformants containing these constructs exhibit mosaic patterns of pigmentation in the adult eye, indicating that white minigene expression is repressed in a clonally heritable manner. The size of pigmented and nonpigmented clones in the adult eye suggests that the event determining whether a cell in the eye anlagen will express white occurs at least as early as the first larval instar. The amount of white minigene repression is reduced in some Polycomb group mutants, whereas repression is enhanced in flies mutant for a subset of trithorax group loci. The repressor activity of one fragment, normally located in Scr Intron 2, is increased when it is able to homologously pair, a property consistent with genetic data suggesting that Scr exhibits transvection. Another Scr regulatory fragment, normally located 40 kb upstream of the Scr promoter, silences ectopic expression of an Scr-lacZ fusion gene in the embryo and does so in a Polycomb-dependent manner. We propose that the regulatory sequences located within these DNA fragments may normally mediate the regulation of Scr by proteins encoded by members of Polycomb and trithorax group loci. 98 refs., 6 figs., 4 tabs.

  1. RNA Replication from the Simian Virus 5 Antigenomic Promoter Requires Three Sequence-Dependent Elements Separated by Sequence-Independent Spacer Regions

    PubMed Central

    Keller, Michael A.; Murphy, Susan K.; Parks, Griffith D.


    We have previously shown for the paramyxovirus simian virus 5 (SV5) that a functional promoter for RNA replication requires proper spacing between two discontinuous elements: a 19-base segment at the 3′ terminus (conserved region I [CRI]) and an 18-base internal region (CRII) that is contained within the coding region of the L protein gene. In the work described here, we have used a reverse-genetics system to determine if the 53-base segment between CRI and CRII contains additional sequence-specific signals required for optimal replication or if this segment functions solely as a sequence-independent spacer region. A series of copyback defective interfering minigenome analogs were constructed to contain substitutions of nonviral sequences in place of bases 21 to 72 of the antigenomic promoter, and the relative level of RNA replication was measured by Northern blot analysis. The results from our mutational analysis indicate that in addition to CRI and CRII, optimal replication from the SV5 antigenomic promoter requires a third sequence-dependent element located 51 to 66 bases from the 3′ end of the RNA. Minigenome RNA replication was not affected by changes in the either the position of this element in relation to CRI and CRII or the predicted hexamer phase of NP encapsidation. Thus, optimal RNA replication from the SV5 antigenomic promoter requires three sequence-dependent elements, CRI, CRII and bases 51 to 66. PMID:11264390

  2. Investigation of spatial and historical variations of air pollution around an industrial region using trace and macro elements in tree components.


    Odabasi, Mustafa; Tolunay, Doganay; Kara, Melik; Ozgunerge Falay, Ezgi; Tuna, Gizem; Altiok, Hasan; Dumanoglu, Yetkin; Bayram, Abdurrahman; Elbir, Tolga


    Several trace and macro elements (n=48) were measured in pine needle, branch, bark, tree ring, litter, and soil samples collected at 27 sites (21 industrial, 6 background) to investigate their spatial and historical variation in Aliaga industrial region in Turkey. Concentrations generally decreased with distance from the sources and the lowest ones were measured at background sites far from major sources. Spatial distribution of anthropogenic trace elements indicated that their major sources in the region are the iron-steel plants, ship-breaking activities and the petroleum refinery. Patterns of 40 elements that were detected in most of the samples were also evaluated to assess their suitability for investigation of historical variations. Observed increasing trends of several trace and macro elements (As, Cr, Fe, Mo, Ni, V, Cu, Pb, Sb, Sn, and Hg) in the tree-ring samples were representative for the variations in anthropogenic emissions and resulting atmospheric concentrations in Aliaga region. It was shown that lanthanides (La, Ce, Pr, Nd, Sm, Gd, Dy, Er, Yb) could also be used for the investigation of historical variations due to specific industrial emissions (i.e., petroleum refining). Results of the present study showed that tree components, litter, and soil could be used to determine the spatial variations of atmospheric pollution in a region while tree rings could be used to assess the historical variations.

  3. Coupling lead isotopes and element concentrations in epiphytic lichens to track sources of air emissions in the Alberta Oil Sands Region

    EPA Science Inventory

    A study was conducted that coupled use of element concentrations and lead (Pb) isotope ratios in the lichen Hypogymnia physodes collected during 2002 and 2008, to assess the impacts of air emissions from the Alberta Oil Sands Region (AOSR, Canada) mining and processing operations...

  4. Coupling lead isotopes and element concentrations in epiphytic lichens to track sources of air emissions in the Alberta Oil Sands Region

    EPA Science Inventory

    A study was conducted that coupled use of element concentrations and lead (Pb) isotope ratios in the lichen Hypogymnia physodes collected during 2002 and 2008, to assess the impacts of air emissions from the Alberta Oil Sands Region (AOSR, Canada) mining and processing operations...

  5. Cross-organizational workflow in radiology: an empirical study of the quality of shared metadata elements in Region Västra Götaland, Sweden.


    Lindsköld, Lars; Wintell, Mikael; Edgren, Lars; Aspelin, Peter; Lundberg, Nina


    Challenges related to the cross-organizational access of accurate and timely information about a patient's condition has become a critical issue in healthcare. Interoperability of different local sources is necessary. To identify and present missing and semantically incorrect data elements of metadata in the radiology enterprise service that supports cross-organizational sharing of dynamic information about patients' visits, in the Region Västra Götaland, Sweden. Quantitative data elements of metadata were collected yearly from the first Wednesday in March from 2006 to 2011 from the 24 in-house radiology departments in Region Västra Götaland. These radiology departments were organized into four hospital groups and three stand-alone hospitals. Included data elements of metadata were the patient name, patient ID, institutional department name, referring physician's name, and examination description. The majority of missing data elements of metadata was related to the institutional department name for Hospital 2, from 87% in 2007 to 25% in 2011. All data elements of metadata except the patient ID contained semantic errors. For example, for the data element "patient name", only three names out of 3537 were semantically correct. This study shows that the semantics of metadata elements are poorly structured and inconsistently used. Although a cross-organizational solution may technically be fully functional, semantic errors may prevent it from serving as an information infrastructure for collaboration between all departments and hospitals in the region. For interoperability, it is important that the agreed semantic models are implemented in vendor systems using the information infrastructure.

  6. Advanced ceramic-to-metal joining process

    SciTech Connect

    Deluca, M.A.; Swain, J.W. Jr.; Swank, L.R.


    One of the major problems in the use of ceramics as components of turbochargers, gas turbines, diesel engines, and other heat engine applications is the joining of ceramics to metals. A new advanced process for achieving strong bonds which utilizes ceramic surface modification and a high-strength direct bonding of metal coating to ceramic is discussed in this paper. Also discussed are the requirements of braze materials for a successful bond and the engineering design of a successful attachment. The tensile and fatigue tests conducted to verify the bonds are discussed. Tests conducted on a simulated turbocharger rotor-to-shaft attachment show good results at temperatures as high as 650 C. 8 references.

  7. G. N. Rassam Joins AGU Staff

    NASA Astrophysics Data System (ADS)

    Ghassan N. Rassam joined the AGU staff today, assuming the dual roles of Division Director for Public Information and Marketing and of Special Assistant for Nonprint Publications. He comes to AGU from the American Geological Institute, where he has been chief editor and assistant director of the GeoRef Information System.As Director of Public Information and Marketing, Rassam will head one of AGU's five divisions. He will have under his purview the Public Information Department and the Promotion and Sales Department. The Public Information Department produces Eos and also has the responsibility for press relations, including the preparation of news releases and the operation of press rooms at meetings. These activities are critical to the implementation of AGU's public education and public affairs initiatives, as well as to the central role of AGU in promoting the unity of geophysics.


    SciTech Connect

    Kim, Jin Yong Y.; Hardy, John S.; Weil, K. Scott


    Aluminum foils were used to braze ceramic plates directly in air. Since aluminum forms an inert oxide layer, aluminum air brazing can provide significant benefits in ceramic joining such as chemical tolerance in dual atmospheres. In using aluminum to air braze, the key factor is optimizing the brazing conditions in order to obtain good interface between braze and substrates by controling the kinetics of melting and oxidation of aluminum and sintering of oxide scale. In this study, joint strength was found to be largely dependent on brazing conditions such as temperature and hold time. Effects of these conditions on the mechanical properties and the microstructure of the Al-brazed ceramic joints will be discussed in this paper.

  9. Systematic analysis of enhancer and critical cis-acting RNA elements in the protein-encoding region of the hepatitis C virus genome.


    Chu, Derrick; Ren, Songyang; Hu, Stacy; Wang, Wei Gang; Subramanian, Aparna; Contreras, Deisy; Kanagavel, Vidhya; Chung, Eric; Ko, Justine; Amirtham Jacob Appadorai, Ranjit Singh; Sinha, Sanjeev; Jalali, Ziba; Hardy, David W; French, Samuel W; Arumugaswami, Vaithilingaraja


    Hepatitis C virus (HCV) causes chronic hepatitis, cirrhosis, and liver cancer. cis-acting RNA elements of the HCV genome are critical for translation initiation and replication of the viral genome. We hypothesized that the coding regions of nonstructural proteins harbor enhancer and essential cis-acting replication elements (CRE). In order to experimentally identify new cis RNA elements, we utilized an unbiased approach to introduce synonymous substitutions. The HCV genome coding for nonstructural proteins (nucleotide positions 3872 to 9097) was divided into 17 contiguous segments. The wobble nucleotide positions of each codon were replaced, resulting in 33% to 41% nucleotide changes. The HCV genome containing one of each of 17 mutant segments (S1 to S17) was tested for genome replication and infectivity. We observed that silent mutations in segment 13 (S13) (nucleotides [nt] 7457 to 7786), S14 (nt 7787 to 8113), S15 (nt 8114 to 8440), S16 (nt 8441 to 8767), and S17 (nt 8768 to 9097) resulted in impaired genome replication, suggesting CRE structures are enriched in the NS5B region. Subsequent high-resolution mutational analysis of NS5B (nt 7787 to 9289) using approximately 51-nucleotide contiguous subsegment mutant viruses having synonymous mutations revealed that subsegments SS8195-8245, SS8654-8704, and SS9011-9061 were required for efficient viral growth, suggesting that these regions act as enhancer elements. Covariant nucleotide substitution analysis of a stem-loop, JFH-SL9098, revealed the formation of an extended stem structure, which we designated JFH-SL9074. We have identified new enhancer RNA elements and an extended stem-loop in the NS5B coding region. Genetic modification of enhancer RNA elements can be utilized for designing attenuated HCV vaccine candidates.

  10. Identification of negative-acting and protein-binding elements in the mouse alpha A-crystallin -1556/-1165 region.


    Sax, C M; Cvekl, A; Kantorow, M; Sommer, B; Chepelinsky, A B; Piatigorsky, J


    The mouse alpha A-crystallin-encoding gene (alpha A-cry) is expressed in a highly lens-preferred manner. To date, it has been shown that this lens-preferred expression is controlled by four proximal positive-acting transcriptional regulatory elements: DE1 (-111/-97), alpha A-CRYBP1 (-66/-57), PE1/TATA (-35/-19) and PE2 (+24/+43). The present study extends our knowledge of mouse alpha A-cry transcriptional regulatory elements to the far upstream region of that gene by demonstrating that the -1556 to -1165 region contains negative-acting sequence elements which function in transfected lens cells derived from mouse, rabbit and chicken. This is the first negative-acting regulatory region identified in mouse alpha A-cry. The -1556 to -1165 region contains sequences similar to repressor/silencer elements identified in other genes, including those highly expressed in the lens, such as the delta 1-crystallin (delta 1-cry) and vimentin (vim) genes. The -1480 to -1401 region specifically interacts with nuclear proteins isolated from the alpha TN4-1 mouse lens cell line. Contained within this protein-binding region and positioned at -1453 to -1444 is a sequence (RS1) similar to the chicken delta 1-cry intron 3 repressor, and which competes for the formation of -1480 to -1401 DNA-protein complexes. Our findings suggest that lens nuclear proteins bind to the mouse alpha A-cry RS1 region. We demonstrate that the chicken delta 1-cry intron repressor binds similar nuclear proteins in chicken embryonic lens cells and mouse alpha TN4-1 lens cells.(ABSTRACT TRUNCATED AT 250 WORDS)

  11. Research on microwave joining of SiC

    SciTech Connect


    The objectives of this research project are to identify optimum time-temperature profiles for the microwave joining of silicon carbide and to develop new microwave joining methods that can be applied to accomplish in situ formation of silicon carbide interlayers and to join larger samples required for industrial applications. Work during this reporting period was focused on investigation of the effect of specimen preparation on joining of SiC using polymer precursors to form SiC in situ at the interface. During this period, LANL also completed the evaluation of joints that were made by FMT using four different joining temperatures, as part of an effort to determine optimum joining temperature.

  12. Conjoint Forming - Technologies for Simultaneous Forming and Joining

    NASA Astrophysics Data System (ADS)

    Groche, P.; Wohletz, S.; Mann, A.; Krech, M.; Monnerjahn, V.


    The market demand for new products optimized for e. g. lightweight applications or smart components leads to new challenges in production engineering. Hybrid structures represent one promising approach. They aim at higher product performance by using a suitable combination of different materials. The developments of hybrid structures stimulate the research on joining of dissimilar materials. Since they allow for joining dissimilar materials without external heating technologies based on joining by plastic deformation seem to be of special attractiveness. The paper at hand discusses the conjoint forming approach. This approach combines forming and joining in one process. Two or more workpieces are joined while at least one workpiece is plastically deformed. After presenting the fundamental joining mechanisms, the conjoint forming approach is discussed comprehensively. Examples of conjoint processes demonstrate the effectiveness and reveal the underlying phenomena.

  13. Combustion based technique for synthesis and joining of refractory materials

    NASA Astrophysics Data System (ADS)

    White, Jeremiah David Edward

    Gasless combustion systems offer features that make them attractive tools for a variety of potential applications. Among them are rapid heating rates, high exothermicity, and high maximum temperatures. These characteristics were exploited to accomplish three separate concepts including the joining of refractory materials, synthesis of a pore-free composite, and the study of thermal explosion in mechanically activated powders. Honeywell Aerospace is a leading producer of carbon brakes for commercial aircraft. The manufacturing process involves chemical vapor infiltration (CVI) to form a carbon matrix around a carbon fiber preform. A major disadvantage of this approach is the time required to form a fully dense preform, which is on the order of 140 days. In addition, after the brakes are in service, they have to be discarded while there is a relatively thick amount of friction material still available. There is a profit motive for reusing these discs which are out of spec. One such example would be to perform a refurbishment by bonding a new thin C/C element onto a used "core" to produce a brake that meets performance specifications. Unfortunately, joining C/C composites is not a simple task, as carbon does not lend itself to welding, and other means (e.g. mechanical or adhesives) would not hold up to the harsh operational conditions. A novel apparatus was designed, built, and proven to join C/C using so-called reactive resistance welding (RRW). It is shown that a joint stronger than the original material can be achieved using moderate electrical current and mechanical force. Additionally, joining layers of similar thickness and microstructure were obtained with different reactive media, ranging from pellets of pressed powders (˜1-2 mm) to thin metal foils (˜25 micron). By modifying the schematic of the RRW apparatus, porous C/C was infiltrated with liquid silicon in order to form a new pore-free C/C-SiC composite. It is shown that using such a process, the silicon

  14. Holographic optical assembly and photopolymerized joining of planar microspheres.


    Shaw, L A; Chizari, S; Panas, R M; Shusteff, M; Spadaccini, C M; Hopkins, J B


    The aim of this research is to demonstrate a holographically driven photopolymerization process for joining colloidal particles to create planar microstructures fixed to a substrate, which can be monitored with real-time measurement. Holographic optical tweezers (HOT) have been used to arrange arrays of microparticles prior to this work; here we introduce a new photopolymerization process for rapidly joining simultaneously handled microspheres in a plane. Additionally, we demonstrate a new process control technique for efficiently identifying when particles have been successfully joined by measuring a sufficient reduction in the particles' Brownian motion. This technique and our demonstrated joining approach enable HOT technology to take critical steps toward automated additive fabrication of microstructures.


    SciTech Connect

    Henager, Charles H.


    A new approach to joining SiC-based ceramics is described and evaluated for Fusion Energy systems. The joining method is based on pre-ceramic polymers filled with reactive and inert filler powders and is similar to other approaches that use such materials. This approach differs in the particular polymer system and in the details of the processing. A principal advantage of this approach relative to other, similar approaches is that the polymer system is easily handled in ambient air and can be processed in air. This makes the joining process simple and field repairable. The joining compound is a liquid that can be painted, sprayed, or applied by dip coating.

  16. [Joining WHO of Republic of Korea and the projects in the 1950s].


    Lee, Sun Ho


    The Republic of Korea(ROK) and the World Health Organization(WHO) have done many projects successfully from 1949, in which the government of First Republic joined the WHO. However the relation between the ROK and the WHO have not been studied very much so far. The main purpose of this research, which could be done by the support of WHO, is connected with three questions. First research point would be "how could the ROK joined WHO in 1949 and what's the meaning of it? And the what's the difference in the process for the WHO between the ROK of 1949 and the DPRK(Democratic People's Republic of Korea) of 1973?" The first president of the ROK, Rhee Syngman, who had received his Ph. D.(about international politics) from Princeton University in 1910, was strongly interested in joining international institutes like UN, WHO. The ROK that could join WHO on 17 August 1949, with the approval of Assembly on 25 May 1949, was one of the founder members of the Western Pacific Region. By joining WHO, the ROK could get chance to increase the level of public health and its administration in 1950's. But the DPRK manage to became a member of WHO on 19 May 1973 and joined the South-East Asia Region. The joining of DPRK was influenced by the easing of the cold war after the Nixon Doctrine and the joining of the China(People's Republic of China). Second research point would be "What kind of roll did the WHO take in the First Republic?" Yet the public health administration of the First Republic that had been made in the period of US army military government was been strongly influenced by USA, the roll of WHO was also important in the 1950's. Last research point would be "What kind of the projects did the ROK and the WHO take part in during the period of he First Republic? How could evaluate the results?" The ROK and the WHO handled the projects including health services, communicable disease prevention and control, control of noncommunicable diseases, and protection of health. Specially

  17. Alternative end-joining catalyzes class switch recombination in the absence of both Ku70 and DNA ligase 4

    PubMed Central

    Boboila, Cristian; Yan, Catherine; Wesemann, Duane R.; Jankovic, Mila; Wang, Jing H.; Manis, John; Nussenzweig, Andre; Nussenzweig, Michel


    The classical nonhomologous end-joining (C-NHEJ) DNA double-strand break (DSB) repair pathway employs the Ku70/80 complex (Ku) for DSB recognition and the XRCC4/DNA ligase 4 (Lig4) complex for ligation. During IgH class switch recombination (CSR) in B lymphocytes, switch (S) region DSBs are joined by C-NHEJ to form junctions either with short microhomologies (MHs; “MH-mediated” joins) or no homologies (“direct” joins). In the absence of XRCC4 or Lig4, substantial CSR occurs via “alternative” end-joining (A-EJ) that generates largely MH-mediated joins. Because upstream C-NHEJ components remain in XRCC4- or Lig4-deficient B cells, residual CSR might be catalyzed by C-NHEJ using a different ligase. To address this, we have assayed for CSR in B cells deficient for Ku70, Ku80, or both Ku70 and Lig4. Ku70- or Ku80-deficient B cells have reduced, but still substantial, CSR. Strikingly, B cells deficient for both Ku plus Lig4 undergo CSR similarly to Ku-deficient B cells, firmly demonstrating that an A-EJ pathway distinct from C-NHEJ can catalyze CSR end-joining. Ku-deficient or Ku- plus Lig4-deficient B cells are also biased toward MH-mediated CSR joins; but, in contrast to XRCC4- or Lig4-deficient B cells, generate substantial numbers of direct CSR joins. Our findings suggest that more than one form of A-EJ can function in CSR. PMID:20142431

  18. Highly conserved gene order and numerous novel repetitive elements in genomic regions linked to wing pattern variation in Heliconius butterflies

    PubMed Central

    Papa, Riccardo; Morrison, Clayton M; Walters, James R; Counterman, Brian A; Chen, Rui; Halder, Georg; Ferguson, Laura; Chamberlain, Nicola; ffrench-Constant, Richard; Kapan, Durrell D; Jiggins, Chris D; Reed, Robert D; McMillan, William O


    Background With over 20 parapatric races differing in their warningly colored wing patterns, the butterfly Heliconius erato provides a fascinating example of an adaptive radiation. Together with matching races of its co-mimic Heliconius melpomene, H. erato also represents a textbook case of Müllerian mimicry, a phenomenon where common warning signals are shared amongst noxious organisms. It is of great interest to identify the specific genes that control the mimetic wing patterns of H. erato and H. melpomene. To this end we have undertaken comparative mapping and targeted genomic sequencing in both species. This paper reports on a comparative analysis of genomic sequences linked to color pattern mimicry genes in Heliconius. Results Scoring AFLP polymorphisms in H. erato broods allowed us to survey loci at approximately 362 kb intervals across the genome. With this strategy we were able to identify markers tightly linked to two color pattern genes: D and Cr, which were then used to screen H. erato BAC libraries in order to identify clones for sequencing. Gene density across 600 kb of BAC sequences appeared relatively low, although the number of predicted open reading frames was typical for an insect. We focused analyses on the D- and Cr-linked H. erato BAC sequences and on the Yb-linked H. melpomene BAC sequence. A comparative analysis between homologous regions of H. erato (Cr-linked BAC) and H. melpomene (Yb-linked BAC) revealed high levels of sequence conservation and microsynteny between the two species. We found that repeated elements constitute 26% and 20% of BAC sequences from H. erato and H. melpomene respectively. The majority of these repetitive sequences appear to be novel, as they showed no significant similarity to any other available insect sequences. We also observed signs of fine scale conservation of gene order between Heliconius and the moth Bombyx mori, suggesting that lepidopteran genome architecture may be conserved over very long evolutionary

  19. Highly conserved gene order and numerous novel repetitive elements in genomic regions linked to wing pattern variation in Heliconius butterflies.


    Papa, Riccardo; Morrison, Clayton M; Walters, James R; Counterman, Brian A; Chen, Rui; Halder, Georg; Ferguson, Laura; Chamberlain, Nicola; Ffrench-Constant, Richard; Kapan, Durrell D; Jiggins, Chris D; Reed, Robert D; McMillan, William O


    With over 20 parapatric races differing in their warningly colored wing patterns, the butterfly Heliconius erato provides a fascinating example of an adaptive radiation. Together with matching races of its co-mimic Heliconius melpomene, H. erato also represents a textbook case of Müllerian mimicry, a phenomenon where common warning signals are shared amongst noxious organisms. It is of great interest to identify the specific genes that control the mimetic wing patterns of H. erato and H. melpomene. To this end we have undertaken comparative mapping and targeted genomic sequencing in both species. This paper reports on a comparative analysis of genomic sequences linked to color pattern mimicry genes in Heliconius. Scoring AFLP polymorphisms in H. erato broods allowed us to survey loci at approximately 362 kb intervals across the genome. With this strategy we were able to identify markers tightly linked to two color pattern genes: D and Cr, which were then used to screen H. erato BAC libraries in order to identify clones for sequencing. Gene density across 600 kb of BAC sequences appeared relatively low, although the number of predicted open reading frames was typical for an insect. We focused analyses on the D- and Cr-linked H. erato BAC sequences and on the Yb-linked H. melpomene BAC sequence. A comparative analysis between homologous regions of H. erato (Cr-linked BAC) and H. melpomene (Yb-linked BAC) revealed high levels of sequence conservation and microsynteny between the two species. We found that repeated elements constitute 26% and 20% of BAC sequences from H. erato and H. melpomene respectively. The majority of these repetitive sequences appear to be novel, as they showed no significant similarity to any other available insect sequences. We also observed signs of fine scale conservation of gene order between Heliconius and the moth Bombyx mori, suggesting that lepidopteran genome architecture may be conserved over very long evolutionary time scales. Here

  20. Transcriptional regulation by activation and repression elements located at the 5'-noncoding region of the human alpha9 nicotinic receptor subunit gene.


    Valor, Luis M; Castillo, Mar; Ortiz, José A; Criado, Manuel


    The alpha9 subunit is a component of the neuronal nicotinic acetylcholine receptor gene superfamily that is expressed in very restricted locations. The promoter of the human gene has been analyzed in the human neuroblastoma SH-SY5Y, where alpha9 subunit expression was detected, and in C2C12 cells that do not express alpha9. A proximal promoter region (from -322 to +113) showed maximal transcriptional activity in SH-SY5Y cells, whereas its activity in C1C12 cells was much lower. Two elements unusually located at the 5'-noncoding region exhibited opposite roles. A negative element located between +15 and +48 appears to be cell-specific because it was effective in C2C12 but not in SH-SY5Y cells, where it was counterbalanced by the presence of the promoter region 5' to the initiation site. An activating element located between +66 and +79 and formed by two adjacent Sox boxes increased the activity of the alpha9 promoter about 4-fold and was even able to activate other promoters. This element interacts with Sox proteins, probably through a cooperative mechanism in which the two Sox boxes are necessary. We propose that the Sox complex provides an initial scaffold that facilitates the recruiting of the transcriptional machinery responsible for alpha9 subunit expression.

  1. The Impact of a Nickel-Copper Smelter on Concentrations of Toxic Elements in Local Wild Food from the Norwegian, Finnish, and Russian Border Regions

    PubMed Central

    Hansen, Martine D.; Nøst, Therese H.; Heimstad, Eldbjørg S.; Evenset, Anita; Dudarev, Alexey A.; Rautio, Arja; Myllynen, Päivi; Dushkina, Eugenia V.; Jagodic, Marta; Christensen, Guttorm N.; Anda, Erik E.; Brustad, Magritt; Sandanger, Torkjel M.


    Toxic elements emitted from the Pechenganickel complex on the Kola Peninsula have caused concern about potential effects on local wild food in the border regions between Norway, Finland and Russia. The aim of this study was to assess Ni, Cu, Co, As, Pb, Cd, and Hg concentrations in local wild foods from these border regions. During 2013–2014, we collected samples of different berry, mushroom, fish, and game species from sites at varying distances from the Ni-Cu smelter in all three border regions. Our results indicate that the Ni-Cu smelter is the main source of Ni, Co, and As in local wild foods, whereas the sources of Pb and Cd are more complex. We observed no consistent trends for Cu, one of the main toxic elements emitted by the Ni-Cu smelter; nor did we find any trend for Hg in wild food. Concentrations of all investigated toxic elements were highest in mushrooms, except for Hg, which was highest in fish. EU maximum levels of Pb, Cd, and Hg were exceeded in some samples, but most had levels considered safe for human consumption. No international thresholds exist for the other elements under study. PMID:28657608

  2. Construction and uses of a new transposable element whose insertion is able to produce gene fusions with the neomycin-phosphotransferase-coding region of Tn903.


    Ratet, P; Richaud, F


    We describe the construction of a transposable element derived from the Mu phage that upon insertion is able to create a gene fusion between the region of Tn903 coding for neomycin phosphotransferase (NPT I), which confers resistance to aminoglycosides including kanamycin (KmR), neomycin and G418, and the control elements of the gene where the insertion occurs. A chloramphenicol (Cm) transacetylase gene (cat) that confers resistance to Cm is present in the transposon so that transposition events can be monitored even when no active fusions with the nptI coding region occur. The transposase gene is deleted and, therefore, this transposon is perfectly stable upon insertion. The properties of this new transposable element were studied by obtaining gene fusions between the Escherichia coli L-arabinose operon and 'nptI gene. In some of them the KmR phenotype is induced by arabinose. Insertions of this element in cloned fragments of the T-DNA region of Agrobacterium rhizogenes were also isolated. Some of them confer a KmR phenotype upon its E. coli carriers, which indicates that portions of the T-DNA are expressed in these cells.

  3. Baseline element composition of foliose and fruticose lichens along the steep climatic gradient of SW Patagonia (Aisén Region, Chile).


    Monaci, Fabrizio; Fantozzi, Federica; Figueroa, Ricardo; Parra, Oscar; Bargagli, Roberto


    Samples of foliose (Nephroma antarcticum) and fruticose (Usnea sp.) lichens were collected across a steep climatic and vegetation gradient in a remote, almost pristine region of SW Chilean Patagonia. Concentrations of major and trace elements in lichens from the rainforest were among the lowest ever reported worldwide for foliose and fruticose lichens and can be considered background levels for the region. The two lichen growth forms showed different elemental compositions mainly due to the greater capacity of foliose thalli to intercept elements from windborne and canopy-leached particles. The patterns of spatial variation in the chemical composition of lichens were effectively explained by statistical methods and reflected the different availability of wet and dry deposition along the steep climatic gradient. Baseline values established for N. antarcticum samples growing in temperate Nothofagus forests were therefore distinct from those of samples growing in more open, drier habitats. The fruticose Usnea sp. showed a higher affinity for atmophile Hg, low concentrations of lithophilic elements, and the same baseline composition whether from temperate forests or from dry, barren environments. The provided background and baseline values against which variations can be measured will be useful in the early detection of local or regional climatic and environmental change, especially in view of the planned construction of hydropower dams under the recently approved HidroAysén Project.

  4. Whole process modeling of joining of flareless AA 6061-T4 tube by extrusion-bulging forming using a polyurethane elastomer medium

    NASA Astrophysics Data System (ADS)

    Yang, J. C.; Li, H.; Yang, H.; Li, G. J.


    The tube joining by plastic deformation proves to be a more efficient and environmentally friendly way to achieve the tube-tube joining compared with other traditional types, such as metallurgical joining and mechanical joining. In this study, to reveal the effects of the processing parameters on the filling quality and residual contact stress, an axisymmetric finite element (FE) model of the whole joining process, including extrusion-bulging forming and unloading, was established and validated. The aluminum alloy (AA) 6061-T4 tubes, the stainless steel (ST) 15-5PH sleeve and polyurethane (PU) elastomer medium were characterized and modeled. And the implicit algorithm was adopted by comparing the prediction results between explicit and implicit FE models. The characteristics of stress distribution and plastic strain for the tube, PU elastomer and sleeve were discussed.

  5. A role for palindromic structures in the cis-region of maize Sirevirus LTRs in transposable element evolution and host epigenetic response

    PubMed Central

    Bousios, Alexandros; Diez, Concepcion M.; Takuno, Shohei; Bystry, Vojtech; Darzentas, Nikos; Gaut, Brandon S.


    Transposable elements (TEs) proliferate within the genome of their host, which responds by silencing them epigenetically. Much is known about the mechanisms of silencing in plants, particularly the role of siRNAs in guiding DNA methylation. In contrast, little is known about siRNA targeting patterns along the length of TEs, yet this information may provide crucial insights into the dynamics between hosts and TEs. By focusing on 6456 carefully annotated, full-length Sirevirus LTR retrotransposons in maize, we show that their silencing associates with underlying characteristics of the TE sequence and also uncover three features of the host–TE interaction. First, siRNA mapping varies among families and among elements, but particularly along the length of elements. Within the cis-regulatory portion of the LTRs, a complex palindrome-rich region acts as a hotspot of both siRNA matching and sequence evolution. These patterns are consistent across leaf, tassel, and immature ear libraries, but particularly emphasized for floral tissues and 21- to 22-nt siRNAs. Second, this region has the ability to form hairpins, making it a potential template for the production of miRNA-like, hairpin-derived small RNAs. Third, Sireviruses are targeted by siRNAs as a decreasing function of their age, but the oldest elements remain highly targeted, partially by siRNAs that cross-map to the youngest elements. We show that the targeting of older Sireviruses reflects their conserved palindromes. Altogether, we hypothesize that the palindromes aid the silencing of active elements and influence transposition potential, siRNA targeting levels, and ultimately the fate of an element within the genome. PMID:26631490

  6. A correlation between diet and longevity characterization by means of element profiles in healthy people over 80 years from a Chinese longevous region.


    Cai, Da; Li, Danlei; Zhao, Shancang; Dou, Xiaowei; Wang, Fang; Huang, Guohong; Zhao, Mouming; Li, Quanyang


    Monitoring the element concentrations in the human body is of critical importance for health and longevity. In order to explore the formation mechanism of longevity from the perspective of the body's element loads, this study investigated the prominent feature of element profiles in healthy people over 80 years from Bama County (China), a famous longevous region (LR). The element profiles in nails of elderly people from the LR and a non-longevous region were determined by inductively coupled plasma mass spectrometry, using orthogonal projections to latent structures discriminant analysis (OPLS-DA) for pattern recognition. As a result, four characteristic elements closely related to the healthy elderly people from LR, including Cr, Fe, Mn, and Co, were identified. The concentrations of Cr, Fe, Mn, and Co were significantly increased in the LR group (p < 0.05). The values of fold change of Cr, Fe, Mn, and Co were 3.00, 2.46, 2.24, and 2.21, respectively. These characteristic elements could provide an important material guarantee for health and longevity of elderly people in the LR. The further correlation analysis revealed significant positive correlations between the Sr (r = 0.886), Mn (r = 0.873), Ni (r = 0.786), and Co (r = 0.738) concentrations in nails of elderly people and those in drinking water. Furthermore, significant positive correlations were found between the Se (r = 0.940), Mn (r = 0.833), and Fe (r = 0.733) concentrations in nails and their dietary intake. Consequently, the observations suggested that diet could provide extraordinary reference information in terms of reflecting the feature of element profiles in healthy elderly people over 80 years from the LR.

  7. Low Activation Joining of SiC/SiC Composites for Fusion Applications: Tape Casting TiC+Si Powders

    SciTech Connect

    Henager, Charles H.; Kurtz, Richard J.; Canfield, Nathan L.; Shin, Yongsoon; Luscher, Walter G.; Mansurov, Jirgal; Roosendaal, Timothy J.; Borlaug, Brennan A.


    The use of SiC composites in fusion environments likely requires joining of plates using reactive joining or brazing. One promising reactive joining method uses solid-state displacement reactions between Si and TiC to produce Ti3SiC2 + SiC. We continue to explore the processing envelope for this joint for the TITAN collaboration in order to produce optimal joints to undergo irradiation studies in HFIR. One noted feature of the joints produced using tape-calendared powders of TiC+Si has been the large void regions that have been apparently unavoidable. Although the produced joints are very strong, these voids are undesirable. In addition, the tapes that were made for this joining were produced about 20 years ago and were aging. Therefore, we embarked on an effort to produce some new tape cast powders of TiC and Si that could replace our aging tape calendared materials.

  8. Join or be excluded from biomedicine? JOINS and Post-colonial Korea.


    Ma, Eunjeong


    This paper discusses re-emergence of Korean medicine(s) in the global context with a focus on a natural drug JOINS, a highly contentious drug regarding its legal status. By following through its life world, the paper contends that the drug is the embodiment of the postcolonial anxiety that crosses the intersections between the aspiring nation and globalizing strategies of the bio-pharmaceutical industry. JOINS is a natural drug prescribed to alleviate the symptoms of degenerative arthritis. SK Chemicals, Ltd., a giant domestic pharmaceutical company developed the drug by utilizing the knowledge of traditional pharmacopeia and put it on the market in 2001. In the domestic market, the drug is treated as a prescription drug, implying that Western medicine-trained doctors (as opposed to Korean medicine doctors) are entitled to prescribe drugs. It also indicates that the drug has undergone a series of lab tests such as toxicity, efficacy, and clinical trials in compliance with regulatory guidelines. However, the domestic standards are not rigorous enough to satisfy international standards, so that it is exported as a nutritional supplement abroad. The government, the pharmaceutical industry, and the Western medicine profession are happy with how the drug stands domestically and internationally. Rather, it is Korean doctors who try to disrupt the status quo and reclaim their rights to traditional knowledge, who have been alienated from the pharmaceuticalization of traditional knowledge. Thus, the JOINS tablet embodies the complex web of modern Korean society, professional interests, the pharmaceutical industry, and globalization.

  9. Joining mutants of RAG1 and RAG2 that demonstrate impaired interactions with the coding-end DNA.


    Nagawa, Fumikiyo; Hirose, Satoshi; Nishizumi, Hirofumi; Nishihara, Tadashi; Sakano, Hitoshi


    In V(D)J joining of antigen receptor genes, two recombination signal sequences (RSSs), 12- and 23-RSSs, form a complex with the protein products of recombination activating genes, RAG1 and RAG2. DNaseI footprinting demonstrates that the interaction of RAG proteins with substrate RSS DNA is not just limited to the signal region but involves the coding sequence as well. Joining mutants of RAG1 and RAG2 demonstrate impaired interactions with the coding region in both pre- and postcleavage type complexes. A possible role of this RAG coding region interaction is discussed in the context of V(D)J recombination.

  10. Characterization of joining sites of a viral histone H4 on host insect chromosomes

    PubMed Central

    Kumar, Sunil; Jung, Jin-Kyo


    A viral histone H4 (CpBV-H4) is encoded in a polydnavirus, Cotesia plutellae bracovirus (CpBV). It plays a crucial role in parasitism of an endoparasitoid wasp, C. plutellae, against diamondback moth, Plutella xylostella, by altering host gene expression in an epigenetic mode by its N-terminal tail after joining host nucleosomes. Comparative transcriptomic analysis between parasitized and nonparasitized P. xylostella by RNA-Seq indicated that 1,858 genes were altered at more than two folds in expression levels at late parasitic stage, including 877 up-regulated genes and 981 down-regulated genes. Among parasitic factors altering host gene expression, CpBV-H4 alone explained 16.3% of these expressional changes. To characterize the joining sites of CpBV-H4 on host chromosomes, ChIP-Seq (chromatin immunoprecipitation followed by deep sequencing) was applied to chromatins extracted from parasitized larvae. It identified specific 538 ChIP targets. Joining sites were rich (60.2%) in AT sequence. Almost 40% of ChIP targets included short nucleotide repeat sequences presumably recognizable by transcriptional factors and chromatin remodeling factors. To further validate these CpBV-H4 targets, CpBV-H4 was transiently expressed in nonparasitized host at late larval stage and subjected to ChIP-Seq. Two kinds of ChIP-Seqs shared 51 core joining sites. Common targets were close (within 1 kb) to genes regulated at expression levels by CpBV-H4. However, other host genes not close to CpBV-H4 joining sites were also regulated by CpBV-H4. These results indicate that CpBV-H4 joins specific chromatin regions of P. xylostella and controls about one sixth of the total host genes that were regulated by C. plutellae parasitism in an epigenetic mode. PMID:28486493

  11. Identification of cis-acting regulatory elements in the promoter region of the rat brain creatine kinase gene.

    PubMed Central

    Hobson, G M; Molloy, G R; Benfield, P A


    The functional organization of the rat brain creatine kinase (ckb) promoter was analyzed by deletion, linker scanning, and substitution mutagenesis. Mutations were introduced into the ckb promoter of hybrid ckb/neo (neomycin resistance gene) genes, and the mutant genes were expressed transiently in HeLa cells. Expression was assayed by primer extension analysis of neo RNA, which allowed the transcription start sites and the amount of transcription to be determined. Transfections and primer extension reactions were internally controlled by simultaneous analysis of transcription from the adenovirus VA gene located on the same plasmid as the hybrid ckb/neo gene. We demonstrate that 195 bp of the ckb promoter is sufficient for efficient in vivo expression in HeLa cells. A nonconsensus TTAA element at -28 bp appears to provide the TATA box function for the ckb promoter in vivo. Two CCAAT elements, one at -84 bp and the other at -54 bp, and a TATAAA TA element (a consensus TATA box sequence) at -66 bp are required for efficient transcription from the TTAA element. In addition, we present evidence that the consensus beta-globin TATA box responds to the TATAAATA element in the same way as the ckb nonconsensus TTAA element. Images PMID:2247071

  12. UK Announces Intention to Join ESO

    NASA Astrophysics Data System (ADS)


    Summary The Particle Physics and Astronomy Research Council (PPARC) , the UK's strategic science investment agency, today announced that the government of the United Kingdom is making funds available that provide a baseline for this country to join the European Southern Observatory (ESO) . The ESO Director General, Dr. Catherine Cesarsky , and the ESO Community warmly welcome this move towards fuller integration in European astronomy. "With the UK as a potential member country of ESO, our joint opportunities for front-line research and technology will grow significantly", she said. "This announcement is a clear sign of confidence in ESO's abilities, most recently demonstrated with the construction and operation of the unique Very Large Telescope (VLT) on Paranal. Together we will look forward with confidence towards new, exciting projects in ground-based astronomy." It was decided earlier this year to place the 4-m UK Visible and Infrared Survey Telescope (VISTA) at Paranal, cf. ESO Press Release 03/00. Following negotiations between ESO and PPARC, a detailed proposal for the associated UK/ESO Agreement with the various entry modalities will now be presented to the ESO Council for approval. Before this Agreement can enter into force, the ESO Convention and associated protocols must also be ratified by the UK Parliament. Research and key technologies According to the PPARC press release, increased funding for science, announced by the UK government today, will enable UK astronomers to prepare for the next generation of telescopes and expand their current telescope portfolio through membership of the European Southern Observatory (ESO). The uplift to its baseline budget will enable PPARC to enter into final negotiations for UK membership of the ESO. This will ensure that UK astronomers, together with their colleagues in the ESO member states, are actively involved in global scale preparations for the next generation of astronomy facilities. among these are ALMA

  13. The Role of Structural Elements of the 5'-Terminal Region of p53 mRNA in Translation under Stress Conditions Assayed by the Antisense Oligonucleotide Approach.


    Swiatkowska, Agata; Zydowicz, Paulina; Gorska, Agnieszka; Suchacka, Julia; Dutkiewicz, Mariola; Ciesiołka, Jerzy


    The p53 protein is one of the major factors responsible for cell cycle regulation and stress response. In the 5'-terminal region of p53 mRNA, an IRES element has been found which takes part in the translational regulation of p53 expression. Two characteristic hairpin motifs are present in this mRNA region: G56-C169, with the first AUG codon, and U180-A218, which interacts with the Hdm2 protein (human homolog of mouse double minute 2 protein). 2'-OMe modified antisense oligomers hybridizing to the 5'-terminal region of p53 mRNA were applied to assess the role of these structural elements in translation initiation under conditions of cellular stress. Structural changes in the RNA target occurring upon oligomers' binding were monitored by the Pb2+-induced cleavage method. The impact of antisense oligomers on the synthesis of two proteins, the full-length p53 and its isoform Δ40p53, was analysed in HT-29, MCF-7 and HepG2 cells, under normal conditions and under stress, as well as in vitro conditions. The results revealed that the hairpin U180-A218 and adjacent single-stranded region A219-A228 were predominantly responsible for high efficacy of IRES-mediated translation in the presence of stress factors. These motifs play a role of cis-acting elements which are able to modulate IRES activity, likely via interactions with protein factors.

  14. Independent regulatory elements in the upstream region of the Drosophila beta 3 tubulin gene (beta Tub60D) guide expression in the dorsal vessel and the somatic muscles.


    Damm, C; Wolk, A; Buttgereit, D; Löher, K; Wagner, E; Lilly, B; Olson, E N; Hasenpusch-Theil, K; Renkawitz-Pohl, R


    The beta 3 tubulin gene (beta Tub60D) is a structural gene expressed during mesoderm development from the extended germ band stage onward. Expression within the individual mesodermal derivatives is guided by different control elements. The upstream regions allow expression in the dorsal vessel and the somatic mesoderm while enhancers localized in the first intron guide expression in the visceral mesoderm. Deletion analysis carried out in transgenic flies revealed independent regulatory elements for the dorsal vessel and the somatic mesoderm. For expression in the somatic mesoderm, a 279-bp region is absolutely essential. This region contains a binding site for the Drosophila myocyte-specific enhancer binding factor 2 (D-MEF2), a MADS-box transcription factor known to be essential for mesoderm development. Deletion or mutation of this D-MEF2 binding site strongly reduces transcription. This pattern is consistent with the strongly reduced expression of beta 3 tubulin in D-mef2 mutant embryos. This analysis furthermore reveals that the D-MEF2 binding site acts in concert with nearby cis regulatory elements. These data show that the upstream control region of the beta 3 tubulin gene is an early target of the D-MEF2 transcriptional activator.

  15. Evaluating the Upset Protrusion Joining (UPJ) Method to Join Magnesium Castings to Dissimilar Metals

    SciTech Connect

    Logan, Stephen


    This presentation discusses advantages and best practices for incorporating magnesium in automotive component applications to achieve substantial mass reduction, as well as some of the key challenges with respect to joining, coating, and galvanic corrosion, before providing an introduction and status update of the U.S. Department of Energy and Department of Defense jointly sponsored Upset Protrusion Joining (UPJ) process development and evaluation project. This update includes sharing performance results of a benchmark evaluation of the self-pierce riveting (SPR) process for joining dissimilar magnesium (Mg) to aluminum (Al) materials in four unique coating configurations before introducing the UPJ concept and comparing performance results of the joints made with the UPJ process to those made with the SPR process. Key results presented include: • The benchmark SPR process can produce good joints in the MgAM60B-Al 6013 joint configuration with minimal cracking in the Mg coupons if the rivet is inserted from the Mg side into the Al side. • Numerous bare Mg to bare Al joints made with the SPR process separated after only 6-wks of accelerated corrosion testing due to fracture of the rivet as a result of hydrogen embrittlement • For the same joint configurations, UPJ demonstrated substantially higher pre-corrosion joint strengths and post-corrosion joint strengths, primarily because of the larger diameter protrusion compared to smaller SPR rivet diameter and reduced degradation due to accelerated corrosion exposure • As with the SPR process, numerous bare Mg to bare Al joints made with the UPJ process also separated after 6-wks of accelerated corrosion testing, but unlike the SPR experience, the UPJ joints experienced degradation of the boss and head because of galvanic corrosion of the Mg casting, not hydrogen embrittlement of the steel rivet. • In the configuration where both the Mg and Al were pretreated with Alodine 5200 prior to joining and the complete

  16. Germline deletion of Igh 3′ regulatory region elements hs5-7 affects B cell specific regulation, rearrangement and insulation of the Igh locus1

    PubMed Central

    Volpi, Sabrina A.; Verma-Gaur, Jiyoti; Hassan, Rabih; Ju, Zhongliang; Roa, Sergio; Chatterjee, Sanjukta; Werling, Uwe; Hou, Harry; Will, Britta; Steidl, Ulrich; Scharff, Matthew; Edelman, Winfried; Feeney, Ann J.; Birshtein, Barbara K.


    Regulatory elements located within a ~28 kb region 3′ of the Igh gene cluster (3′ regulatory region, 3′ RR) are required for class switch recombination and for high levels of IgH expression in plasma cells. We previously defined novel DNase I hypersensitive (hs) sites, i.e. hs5-7, immediately downstream of this region. Hs5-7 contains a high density of binding sites for CTCF, a zinc finger protein associated with mammalian insulator activity and is an anchor for interactions with CTCF sites flanking the DH region. To test the function of hs5-7, we have generated mice with an 8 kb deletion encompassing all three hs elements. B cells from hs5-7 KO mice showed a modest increase in expression of the nearest downstream gene. In addition, Igh alleles in hs5-7 KO mice were in a less contracted configuration compared to WT Igh alleles and showed a two-fold increase in the usage of proximal VH7183 gene families. Hs5-7 KO mice were essentially indistinguishable from wild type mice in B cell development, allelic regulation, class switch recombination, and chromosomal looping. We conclude that hs5-7--a high-density CTCF binding region at the 3′ end of the Igh locus--impacts usage of VH regions as far as 500 kb away. PMID:22345664

  17. Comparative analysis of the Hrp pathogenicity island of Rubus- and Spiraeoideae-infecting Erwinia amylovora strains identifies the IT region as a remnant of an integrative conjugative element.


    Mann, Rachel A; Blom, Jochen; Bühlmann, Andreas; Plummer, Kim M; Beer, Steven V; Luck, Joanne E; Goesmann, Alexander; Frey, Jürg E; Rodoni, Brendan C; Duffy, Brion; Smits, Theo H M


    The Hrp pathogenicity island (hrpPAI) of Erwinia amylovora not only encodes a type III secretion system (T3SS) and other genes required for pathogenesis on host plants, but also includes the so-called island transfer (IT) region, a region that originates from an integrative conjugative element (ICE). Comparative genomic analysis of the IT regions of two Spiraeoideae- and three Rubus-infecting strains revealed that the regions in Spiraeoideae-infecting strains were syntenic and highly conserved in length and genetic information, but that the IT regions of the Rubus-infecting strains varied in gene content and length, showing a mosaic structure. None of the ICEs in E. amylovora strains were complete, as conserved ICE genes and the left border were missing, probably due to reductive genome evolution. Comparison of the hrpPAI region of E. amylovora strains to syntenic regions from other Erwinia spp. indicates that the hrpPAI and the IT regions are the result of several insertion and deletion events that have occurred within the ICE. It also suggests that the T3SS was present in a common ancestor of the pathoadapted Erwinia spp. and that insertion and deletion events in the IT region occurred during speciation.

  18. Amphiboles on the join pargasite-ferropargasite

    SciTech Connect

    Charles, R.W.


    Amphiboles have been grown across the join NaCa/sub 2/Mg/sub 4/AlSi/sub 6/Al/sub 2/O/sub 22/(OH)/sub 2/ to NaCa/sub 2/Fe/sub 4/AlSi/sub 6/Al/sub 2/O/sub 22/(OH)/sub 2/ on QFM and CCH/sub 4/ oxygen buffers to gain insight into the Fe-Mg substitution in an amphibole without the local charge imbalance caused by Na in the M(4) site. Oxygen fugacity was found to have no effect upon the unit-cell dimensions of amphibole. No change in cell parameters is observed with temperature on a given buffer. The essentially linear trend indicates disorder of Mg and Fe in M(1), M(2), and M(3) sites. Plagioclase and pyroxene were present in all charges. The amount ranged from a few percent to greater than 30%, without affecting the unit-cell parameters of coexisting amphibole.

  19. End Joining at Caenorhabditis elegans Telomeres

    PubMed Central

    Lowden, Mia Rochelle; Meier, Bettina; Lee, Teresa Wei-sy; Hall, Julie; Ahmed, Shawn


    Critically shortened telomeres can be subjected to DNA repair events that generate end-to-end chromosome fusions. The resulting dicentric chromosomes can enter breakage–fusion–bridge cycles, thereby impeding elucidation of the structures of the initial fusion events and a mechanistic understanding of their genesis. Current models for the molecular basis of fusion of critically shortened, uncapped telomeres rely on PCR assays that typically capture fusion breakpoints created by direct ligation of chromosome ends. Here we use independent approaches that rely on distinctive features of Caenorhabditis elegans to study the frequency of direct end-to-end chromosome fusion in telomerase mutants: (1) holocentric chromosomes that allow for genetic isolation of stable end-to-end fusions and (2) unique subtelomeric sequences that allow for thorough PCR analysis of samples of genomic DNA harboring multiple end-to-end fusions. Surprisingly, only a minority of end-to-end fusion events resulted from direct end joining with no additional genome rearrangements. We also demonstrate that deficiency for the C. elegans Ku DNA repair heterodimer does not affect telomere length or cause synthetic effects in the absence of telomerase. PMID:18780750

  20. Method of joining metals of significantly different expansion rates

    NASA Technical Reports Server (NTRS)

    Caler, W.; La Salle, F.; Traylor, J.


    To join a refractory metal to a dissimilar high-temperature metal, braze a section of high elasticity, high ductility metal /such as columbium or columbium alloy/ between the metals to be joined, using a fork-type joint to hold the braze and transition member in place during expansion.

  1. Thermal-stress-free fasteners for joining orthotropic materials

    NASA Technical Reports Server (NTRS)

    Blosser, Max L.


    Hot structures fabricated from orthotropic materials are an attractive design option for future high speed vehicles. Joining subassemblies of these materials with standard cylindrical fasteners can lead to loose joints or highly stressed joints due to thermal stress. A method has been developed to eliminate thermal stress and maintain a tight joint by shaping the fastener and mating hole. This method allows both materials (fastener and structure), with different coefficients of thermal expansion (CTE's) in each of the three principal material directions, to expand freely with temperature yet remain in contact. For the assumptions made in the analysis, the joint will remain snug, yet free of thermal stress at any temperature. Finite element analysis was used to verify several thermal-stress-free fasteners and to show that conical fasteners, which are thermal-stress-free for isotropic materials, can reduce thermal stresses for transversely isotropic materials compared to a cylindrical fastener. Equations for thermal-stress-free shapes are presented and typical fastener shapes are shown.

  2. Thermal-stress-free fasteners for joining orthotropic materials

    NASA Technical Reports Server (NTRS)

    Blosser, M. L.


    Hot structures fabricated from orthotropic materials are an attractive design option for future high speed vehicles. Joining subassemblies of these materials with standard cylindrical fasteners can lead to loose joints or highly stressed joints due to thermal stress. A method has been developed to eliminate thermal stresses and maintain a tight joint by shaping the fastener and mating hole. This method allows both materials (fastener and structure), with different coefficients of thermal expansion (CTEs) in each of the three material directions, to expand freely with temperature yet remain in contact. For the assumptions made in the analysis, the joint will remain snug, yet free of thermal stress at any temperature. Finite element analysis was used to verify several thermal-stress-free fasteners and to show that conical fasteners, which are thermal-stress-free for isotropic materials, can reduce thermal stresses for transversely isotropic materials compared to a cylindrical fastener. Equations for thermal-stress-free shapes are presented and typical fastener shapes are shown.

  3. Structure-Property Correlations in Microwave Joining of Inconel 718

    NASA Astrophysics Data System (ADS)

    Bansal, Amit; Sharma, Apurbba Kumar; Kumar, Pradeep; Das, Shantanu


    The butt joining of Inconel 718 plates at 981°C solution treated and aged (981STA) condition was carried out using the microwave hybrid heating technique with Inconel 718 powder as a filler material. The developed joints were free from any microfissures (cracks) and were metallurgically bonded through complete melting of the powder particles. The as-welded joints were subjected to postweld heat treatments, including direct-aged, 981STA and 1080STA. The microstructural features of the welded joints were investigated using a field emission-scanning electron microscope equipped with x-ray elemental analysis. Microhardness and room-temperature tensile properties of the welded joints were evaluated. The postweld heat-treated specimens exhibited higher microhardness and tensile strength than the as-welded specimens due to the formation of strengthening precipitates in the microstructure after postweld heat treatments. The microhardness of the fusion zone of the joint in 1080STA condition was higher than all welded conditions due to the complete dissolution of Laves phase after 1080STA treatment. However, the tensile strength of the welded specimen in 981STA condition was higher than all welded conditions. The tensile strength in 1080STA condition was lower than that in 981STA condition because of the grain coarsening that took place after 1080STA condition. The fractography of the fractured surfaces was carried out to determine the structure-property-fracture correlation.

  4. Non-homologous end joining: advances and frontiers.


    Yang, Kai; Guo, Rong; Xu, Dongyi


    DNA double-strand breaks (DSBs) are the most serious form of DNA damage. In human cells, non-homologous end joining (NHEJ) is the major pathway for the repair of DSBs. Different types of DSBs result in different subsets of NHEJ repair strategies. These variations in NHEJ repair strategies depend on numerous elements, such as the flexible recruitment of NHEJ-related proteins, the complexity of the DSB ends, and the spatial- and temporal-ordered formation of the multi-protein complex. On the one hand, current studies of DNA DSBs repair focus on the repair pathway choices between homologous recombination and classic or alternative NHEJ. On the other hand, increasing researches have also deepened the significance and dug into the cross-links between the NHEJ pathway and the area of genome organization and aging. Although remarkable progress has been made in elucidating the underlying principles during the past decades, the detailed mechanism of action in response to different types of DSBs remains largely unknown and needs further evaluation in the future study. © The Author 2016. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail:

  5. Efficient compression scheme by use of the region division of elemental images on MALT in three-dimensional integral imaging

    NASA Astrophysics Data System (ADS)

    Kang, Ho-Hyun; Lee, Jung-Woo; Shin, Dong-Hak; Kim, Eun-Soo


    This paper addresses the efficient compression scheme of elemental image array (EIA) generated from the moving array lenslet technique (MALT) based on MPEG-4. The EIAs are picked-up by MALT controlling the spatial ray sampling of ray and which produces few EIAs that the positions of the lenslet arrays are rapidly vibrated in the lateral directions within the retention time of the afterimage of human eye. To enhance the similarity in each EIA picked-up by MALT, several EIAs obtained from MALT are regenerated by the collection of an elemental image occupied at the same position in each EIA. The newly generated each EIA has high similarity among adjacent elemental images. To illustrate the feasibility of the proposed scheme, some experiments are carried out to show the increased compression efficiency and we obtained the improved compression ratio of 12% compared to the unhandled compression scheme.

  6. [Correlation of mercury, selenium and other elements in the tissues of fishes from the regions at different mercury exposure level].


    Zhang, Pei-qun; Chen, Chun-ying; Zhao, Jiu-jiang; Li, Bai; Qu, Li-ya; Chai, Zhi-fang


    The contents of selenium and other elements in fish liver and muscle tissues collected from mercury polluted area of Wanshan, Guizhou province of China and non-known mercury polluted one of Beijing were determined with instrumental neutron activation analysis, and that of mercury was determined with atomic fluorescence spectrometry. The correlation among the determined elements, especially between mercury and selenium, in the fish tissues were studied. For most of the elements significant difference of elemental content was found between tissues of liver and muscle, and mostly the content in liver was higher than that in muscle. It was interesting to note that the average content of mercury in Guizhou fish liver was 25-fold higher than that in Beijing one, and 5-fold higher in Guizhou fish muscle than that in Beijing one. For most of the elements no significant difference on the average content was found between the same tissues of the two areas. The molar ratio of Hg/Se increased with the increasing of Hg content at the low Hg level, but the alteration trend became gently and reached to a higher constant value (about 0.2) at the higher Hg level. Only the element of bromine and rubidium was found to have strong linear correlation between the two different tissues of liver and muscle. Though certain correlation existed among the different elements of fish tissues from the two areas, the most significant and the closest one existed between the mercury and selenium of muscle tissue of Guizhou fishes. A closer correlation was also found between them of liver tissue of Guizhou fishes. As for Beijing fish tissues, the correlation of mercury and selenium only existed in liver but no correlation of them was found in muscle. Our results confirm the fact that a certain interaction exists between mercury and selenium in organisms including fish, and it is more evident as the mercury-exposed level is higher. Some significant correlation was also observed between other elements

  7. Trace elements and common ions in southeastern Idaho snow: Regional air pollutant tracers for source area emissions

    USGS Publications Warehouse

    Abbott, M.; Einerson, J.; Schuster, P.; Susong, D.; Taylor, H.E.; ,


    Snow sampling and analysis methods which produce accurate and ultra-low measurements of trace elements and common ion concentration in southeastern Idaho snow, were developed. Snow samples were collected over two winters to assess trace elements and common ion concentrations in air pollutant fallout across the southeastern Idaho. The area apportionment of apportionment of fallout concentrations measured at downwind location were investigated using pattern recognition and multivariate statistical technical techniques. Results show a high level of contribution from phosphates processing facilities located outside Pocatello in the southern portion of the Eastern Snake River Plain, and no obvious source area profiles other than at Pocatello.

  8. Decoding a Signature-Based Model of Transcription Cofactor Recruitment Dictated by Cardinal Cis-Regulatory Elements in Proximal Promoter Regions

    PubMed Central

    Benner, Christopher; Hutt, Kasey R.; Stunnenberg, Rieka; Garcia-Bassets, Ivan


    Genome-wide maps of DNase I hypersensitive sites (DHSs) reveal that most human promoters contain perpetually active cis-regulatory elements between −150 bp and +50 bp (−150/+50 bp) relative to the transcription start site (TSS). Transcription factors (TFs) recruit cofactors (chromatin remodelers, histone/protein-modifying enzymes, and scaffold proteins) to these elements in order to organize the local chromatin structure and coordinate the balance of post-translational modifications nearby, contributing to the overall regulation of transcription. However, the rules of TF-mediated cofactor recruitment to the −150/+50 bp promoter regions remain poorly understood. Here, we provide evidence for a general model in which a series of cis-regulatory elements (here termed ‘cardinal’ motifs) prefer acting individually, rather than in fixed combinations, within the −150/+50 bp regions to recruit TFs that dictate cofactor signatures distinctive of specific promoter subsets. Subsequently, human promoters can be subclassified based on the presence of cardinal elements and their associated cofactor signatures. In this study, furthermore, we have focused on promoters containing the nuclear respiratory factor 1 (NRF1) motif as the cardinal cis-regulatory element and have identified the pervasive association of NRF1 with the cofactor lysine-specific demethylase 1 (LSD1/KDM1A). This signature might be distinctive of promoters regulating nuclear-encoded mitochondrial and other particular genes in at least some cells. Together, we propose that decoding a signature-based, expanded model of control at proximal promoter regions should lead to a better understanding of coordinated regulation of gene transcription. PMID:24244184

  9. Toroid Joining Gun. [thermoplastic welding system using induction heating

    NASA Technical Reports Server (NTRS)

    Buckley, J. D.; Fox, R. L.; Swaim, R J.


    The Toroid Joining Gun is a low cost, self-contained, portable low powered (100-400 watts) thermoplastic welding system developed at Langley Research Center for joining plastic and composite parts using an induction heating technique. The device developed for use in the fabrication of large space sructures (LSST Program) can be used in any atmosphere or in a vacuum. Components can be joined in situ, whether on earth or on a space platform. The expanded application of this welding gun is in the joining of thermoplastic composites, thermosetting composites, metals, and combinations of these materials. Its low-power requirements, light weight, rapid response, low cost, portability, and effective joining make it a candidate for solving many varied and unique bonding tasks.

  10. Enabling Dissimilar Material Joining Using Friction Stir Scribe Technology


    Hovanski, Yuri; Upadyay, Piyush; Kleinbaum, Sarah; ...


    One challenge in adapting welding processes to dissimilar material joining is the diversity of melting temperatures of the different materials. Although the use of mechanical fasteners and adhesives have mostly paved the way for near-term implementation of dissimilar material systems, these processes only accentuate the need for low-cost welding processes capable of impartially joining dissimilar material components regardless of alloy, properties, or melting temperature. Friction stir scribe technology was developed to overcome the challenges of joining dissimilar material components where melting temperatures vary greatly, and properties and/or chemistry are not compatible with more traditional welding processes. Finally, although the frictionmore » stir scribe process is capable of joining dissimilar metals and metal/polymer systems, a more detailed evaluation of several aluminum/steel joints is presented herein to demonstrate the ability to both chemically and mechanically join dissimilar materials.« less

  11. Toroid Joining Gun. [thermoplastic welding system using induction heating

    NASA Technical Reports Server (NTRS)

    Buckley, J. D.; Fox, R. L.; Swaim, R J.


    The Toroid Joining Gun is a low cost, self-contained, portable low powered (100-400 watts) thermoplastic welding system developed at Langley Research Center for joining plastic and composite parts using an induction heating technique. The device developed for use in the fabrication of large space sructures (LSST Program) can be used in any atmosphere or in a vacuum. Components can be joined in situ, whether on earth or on a space platform. The expanded application of this welding gun is in the joining of thermoplastic composites, thermosetting composites, metals, and combinations of these materials. Its low-power requirements, light weight, rapid response, low cost, portability, and effective joining make it a candidate for solving many varied and unique bonding tasks.

  12. Rapid infrared joining takes on the advanced materials

    NASA Astrophysics Data System (ADS)

    Blue, C. A.; Warrier, S. G.; Robson, M. T.; Lin, R. Y.


    In this work, 4340 steel was joined with a nickel-based brazing alloy AMS 4777, using rapid infrared joining technique (Blue et al., 1991), and the microstructure of the joint was examined using SEM. The effects of the bond thickness and the joint lap area on the bond shear strength were investigated following the ASTM D1002-72 standard joint testing procedure. Results of SEM examination indicated that the microstructure of the material was preserved throughout the joining process. Bond shear tests showed that, as the bond thickness increases, the shear strength also increases, reaching a constant bond strength plateau at about 2 mils. It is concluded that, compared with traditional joining methods, the rapid infrared joining technique has the advantages of fast heating, little energy consumption, easy operation, no need for vacuum, little metallurgical modification to the base metal, and low cost.

  13. Enabling Dissimilar Material Joining Using Friction Stir Scribe Technology

    NASA Astrophysics Data System (ADS)

    Hovanski, Yuri; Upadyay, Piyush; Kleinbaum, Sarah; Carlson, Blair; Boettcher, Eric; Ruokolainen, Robert


    One challenge in adapting welding processes to dissimilar material joining is the diversity of melting temperatures of the different materials. Although the use of mechanical fasteners and adhesives have mostly paved the way for near-term implementation of dissimilar material systems, these processes only accentuate the need for low-cost welding processes capable of impartially joining dissimilar material components regardless of alloy, properties, or melting temperature. Friction stir scribe technology was developed to overcome the challenges of joining dissimilar material components where melting temperatures vary greatly, and properties and/or chemistry are not compatible with more traditional welding processes. Although the friction stir scribe process is capable of joining dissimilar metals and metal/polymer systems, a more detailed evaluation of several aluminum/steel joints is presented herein to demonstrate the ability to both chemically and mechanically join dissimilar materials.

  14. Affordable, Robust Ceramic Joining Technology (ARCJoinT)

    NASA Technical Reports Server (NTRS)

    Singh, M.


    Joining is recognized as one of the enabling technologies for the application of silicon carbide-based ceramic and composite components in a number of demanding and high temperature applications in aerospace and ground-based systems. An affordable, robust ceramic joining technology (ARCJoinT) for joining of silicon carbide-based ceramics and fiber reinforced composites has been developed. This technique is capable of producing joints with tailorable thickness and composition. A wide variety of silicon carbide-based ceramics and composites, in different shapes and sizes, have been joined using this technique. These joints maintain their mechanical strength up to 1350 C in air. This technology is suitable for the joining of large and complex shaped ceramic and composite components and with certain modifications, can be applied to repair ceramic components damaged in service.



    Ermakov, A A; Karpova, E A; Malysheva, A G; Mikhaylova, R I; Ryzhova, I N


    The monitoring of snow cover pollution by heavy metals and elements (zinc, copper, lead, cadmium, arsenic, nickel, chromium, strontium, manganese, fluorine, lithium) was performed in 20 districts of the Moscow region in 2009, 2012 and 2013. The assessment of the levels of contamination by heavy metals and elements was given by means of comparison of them with the average values in the snow cover near Moscow in the end of the last century and in some areas of the world, that no exposed to technological environmental impact. 7 districts of Moscow region were characterized by a high content of lead and cadmium in the snow water. It requires the control of water, soil and agricultural products pollution.

  16. A new case of an Holarctic element in the Colombian Andes: first record of Cordyla Meigen (Diptera, Mycetophilidae) from the Neotropical region

    PubMed Central

    Kurina, Olavi; Oliveira, Sarah Siqueira


    Abstract Three new species of Mycetophilidae – Cordyla monticola sp. n., Cordyla pseudopusilla sp. n. and Cordyla reducta sp. n. – are described from the Colombian Andes, representing the first described species of Cordyla Meigen from the Neotropical region. Colour photos of their habitus, wing and terminalia are provided. The morphological affinities of male terminalia are discussed in a worldwide context. The distributional pattern of the genus clearly indicates a case of northern elements reaching the north-western region of the Neotropics that corresponds to a secondary extension of a Holarctic clade to the south. PMID:26445929

  17. Contextual influences in texture-segmentation: distinct effects from elements along the edge and in the texture-region.


    Robol, Valentina; Grassi, Massimo; Casco, Clara


    Both neurophysiological and psychophysical evidence suggest a strong influence of context on texture-segmentation. Here we extend and further analyse this issue, with a particular focus on the underlying mechanism. Specifically, we use a texture-edge discrimination task and separately investigate the effect of elements far from and along the edge. Consistent with previous studies, we report both an iso-near contextual effect - whereby performance is better if elements along the edge are iso-oriented compared to ortho-oriented to the edge - as well as an ortho-far effect - whereby discrimination is higher when elements far from the edge are orthogonal to the edge. We found that backward mask, which is known to interrupt re-entrant processing from extrastriate areas, only interferes with the iso-near effect whereas perturbing orientation, position or contrast polarity of elements far from the edge only abolishes the ortho-far effect. This suggests that feedback processes may be involved in the iso-near effect. Instead, the ortho-far effect may be accounted for by recurrent interactions among 1st order filters. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. The effect of alloy elements on the density variation of steel melt at the interdendritic region during solidification

    NASA Astrophysics Data System (ADS)

    Cao, Y. F.; Chen, Y.; Ma, X. P.; Fu, P. X.; Kang, X. H.; Liu, H. W.; Li, D. Z.


    Alloying elements in steels have essential effects on the formation of macrosegregation by inducing a density difference between the mushy zone and the bulk melt, and even by the alteration of the solidified microstructure. Hence, in terms of the thermodynamic laws for solidification of an idealized dilute solution, a systematic theoretical analysis on the effect of elements on the density variation of the interdendritic melt is presented for common Fe-based binary alloys. It shows that density variation closely associates with three crucial parameters: the microsegregation parameter λ, the temp-comp-expansion parameter β and the initial composition CL o . With these derived parameters, a simple analytical model is proposed to assess the influence of alloy elements on density change. The theoretical analysis indicates that compared to silicon, the effect of carbon on the density variation cannot be ignored, which is remarkably different from the previous recognition of these two elements. The macrosegregation induced by carbon only is experimentally validated by two dissected 500 kg ingots with different carbon contents. Furthermore, to directly validate the results of theoretical analysis a macrosegregation model with two different microsegregation laws (lever rule and Scheil equation) is established. Then simulations of the convection during solidification in the experimental 500 kg reference ingot are performed for Fe-C and Fe-Si alloys, respectively. It demonstrates that numerically simulated effects of carbon and silicon on the interdendritic convection induced by density inversion are fairly consistent with the analytical predictions.

  19. Putative regulatory elements within the non-coding regions of Chrysomelidae Diapause Associated Transcript-1 (DAT-1) orthologs

    USDA-ARS?s Scientific Manuscript database

    To develop a more comprehensive understanding of diapause within Chrysomelidae, we are employing phylogenetic foot-printing to isolate and characterize the regulatory elements associated with the diapause-associated gene, DAT-1. Leptinotarsa decemlineata (Colorado potato beetle, CPB) DAT-1 has been ...

  20. Screening of Trace Elements in Hair of the Female Population with Different Types of Cancers in Wielkopolska Region of Poland

    PubMed Central

    Czerny, Bogusław; Krupka, Krzysztof; Ożarowski, Marcin; Seremak-Mrozikiewicz, Agnieszka


    Background. Cancer constitutes a major health problem worldwide. Thus, search for reliable and practical markers of the disease process remains the key issue of the diagnostic process. Objectives. The study aims at linking the trace element status of an organism, assessed by hair analysis, with the occurrence of cancer diseases. Material and Methods. Hair samples were collected from 299 patients with cancer diseases confirmed by a histopathological test and from 100 controls. Cancer patients were divided into three groups, depending on cancer type: hormone-dependent cancer, cancer of the alimentary tract, and cancer with high glycolytic activity. Mineral element analysis of hair was performed using an atomic emission spectrophotometer with inductively coupled plasma (ICP-OES) and inductively coupled plasma mass spectrometry (ICP-MS). Results. Statistically significantly lower concentrations of selenium, zinc, copper, germanium and boron, iron, and magnesium were observed in the three groups of cancer patients. Disturbance in the axis glucose-insulin and changes in concentrations of heavy metals and toxic elements were also noted. Conclusions. It seems safe to conclude that our results confirmed usefulness of hair element analysis in screening tests for the assessment of the biomarker of various cancer diseases in a female population. PMID:25580464

  1. A meiotic drive element in the maize pathogen Fusarium verticillioides is located within a 102-kb region of chromosome V

    USDA-ARS?s Scientific Manuscript database

    Fusarium verticillioides is an agriculturally important fungus because of its association with maize and its propensity to contaminate grain with toxic compounds. Some isolates of the fungus harbor a meiotic drive element known as Spore killer (SkK) that causes nearly all surviving meiotic progeny f...

  2. Space construction requirements for joining, inspection, development testing, and flight checkout

    NASA Technical Reports Server (NTRS)

    Morgenthaler, George W.; Nii, Kendall M.


    Space construction poses new challenges not yet met in the space program to date. New materials: High strength to weight ratio metal matrix composites and other kinds of composites have been developed. They have not been fully characterized as regards rolling, drilling, cutting, forming, joining, etc. New joining methods: Many types of joining methods are proposed for use in space construction. It is important to understand the key discriminators in choosing one method over another. Once the discriminators are known, one can rank the various methods of joining or connecting things in space. New constructors: Astronauts frequently mention that EVA effort is very exhausting because of the suit inflexibility. For these reasons, as well as the inherent risk, hazards due to radiation, and other concerns mentioned in the literature, it is likely that robot workers of various sorts will play a key role. Now one must consider the question of qualifying space joining methods that will be applied by robots as well as those being applied by humans. New NDE methods/space qualification of detectors: For every joining method that is used here on earth, there are various non-destructive inspection techniques, such as ultrasonic inspection and x-ray inspection. It will be necessary to develop inspection techniques for all joining methods that will be approved for use in space. The detector must also be space qualified. Development testing: As a new concept for space habitat goes through its conceptual phases, various development tests are anticipated for the first time. Some elements cannot be adequately tested except in space itself. Flight check-out: Assuming that one is assembling the Mars spacecraft in earth orbit and that all of the preceding questions have been resolved, the day finally arrives when the fully assembled vehicle is ready for occupancy and journeying to Mars. It will be necessary to conduct a final flight readiness review, countdown procedure, and certification

  3. Determination of mineral, trace element, and pesticide levels in honey samples originating from different regions of Malaysia compared to manuka honey.


    Moniruzzaman, Mohammed; Chowdhury, Muhammed Alamgir Zaman; Rahman, Mohammad Abdur; Sulaiman, Siti Amrah; Gan, Siew Hua


    The present study was undertaken to determine the content of six minerals, five trace elements, and ten pesticide residues in honeys originating from different regions of Malaysia. Calcium (Ca), magnesium (Mg), iron (Fe), and zinc (Zn) were analyzed by flame atomic absorption spectrometry (FAAS), while sodium (Na) and potassium (K) were analyzed by flame emission spectrometry (FAES). Trace elements such as arsenic (As), lead (Pb), cadmium (Cd), copper (Cu), and cobalt (Co) were analyzed by graphite furnace atomic absorption spectrometry (GFAAS) following the microwave digestion of honey. High mineral contents were observed in the investigated honeys with K, Na, Ca, and Fe being the most abundant elements (mean concentrations of 1349.34, 236.80, 183.67, and 162.31 mg/kg, resp.). The concentrations of the trace elements were within the recommended limits, indicating that the honeys were of good quality. Principal component analysis reveals good discrimination between the different honey samples. The pesticide analysis for the presence of organophosphorus and carbamates was performed by high performance liquid chromatography (HPLC). No pesticide residues were detected in any of the investigated honey samples, indicating that the honeys were pure. Our study reveals that Malaysian honeys are rich sources of minerals with trace elements present within permissible limits and that they are free from pesticide contamination.

  4. Determination of Mineral, Trace Element, and Pesticide Levels in Honey Samples Originating from Different Regions of Malaysia Compared to Manuka Honey

    PubMed Central

    Moniruzzaman, Mohammed; Chowdhury, Muhammed Alamgir Zaman; Rahman, Mohammad Abdur; Sulaiman, Siti Amrah; Gan, Siew Hua


    The present study was undertaken to determine the content of six minerals, five trace elements, and ten pesticide residues in honeys originating from different regions of Malaysia. Calcium (Ca), magnesium (Mg), iron (Fe), and zinc (Zn) were analyzed by flame atomic absorption spectrometry (FAAS), while sodium (Na) and potassium (K) were analyzed by flame emission spectrometry (FAES). Trace elements such as arsenic (As), lead (Pb), cadmium (Cd), copper (Cu), and cobalt (Co) were analyzed by graphite furnace atomic absorption spectrometry (GFAAS) following the microwave digestion of honey. High mineral contents were observed in the investigated honeys with K, Na, Ca, and Fe being the most abundant elements (mean concentrations of 1349.34, 236.80, 183.67, and 162.31 mg/kg, resp.). The concentrations of the trace elements were within the recommended limits, indicating that the honeys were of good quality. Principal component analysis reveals good discrimination between the different honey samples. The pesticide analysis for the presence of organophosphorus and carbamates was performed by high performance liquid chromatography (HPLC). No pesticide residues were detected in any of the investigated honey samples, indicating that the honeys were pure. Our study reveals that Malaysian honeys are rich sources of minerals with trace elements present within permissible limits and that they are free from pesticide contamination. PMID:24982869

  5. Brazil to Join the European Southern Observatory

    NASA Astrophysics Data System (ADS)


    The Federative Republic of Brazil has yesterday signed the formal accession agreement paving the way for it to become a Member State of the European Southern Observatory (ESO). Following government ratification Brazil will become the fifteenth Member State and the first from outside Europe. On 29 December 2010, at a ceremony in Brasilia, the Brazilian Minister of Science and Technology, Sergio Machado Rezende and the ESO Director General, Tim de Zeeuw signed the formal accession agreement aiming to make Brazil a Member State of the European Southern Observatory. Brazil will become the fifteen Member State and the first from outside Europe. Since the agreement means accession to an international convention, the agreement must now be submitted to the Brazilian Parliament for ratification [1]. The signing of the agreement followed the unanimous approval by the ESO Council during an extraordinary meeting on 21 December 2010. "Joining ESO will give new impetus to the development of science, technology and innovation in Brazil as part of the considerable efforts our government is making to keep the country advancing in these strategic areas," says Rezende. The European Southern Observatory has a long history of successful involvement with South America, ever since Chile was selected as the best site for its observatories in 1963. Until now, however, no non-European country has joined ESO as a Member State. "The membership of Brazil will give the vibrant Brazilian astronomical community full access to the most productive observatory in the world and open up opportunities for Brazilian high-tech industry to contribute to the European Extremely Large Telescope project. It will also bring new resources and skills to the organisation at the right time for them to make a major contribution to this exciting project," adds ESO Director General, Tim de Zeeuw. The European Extremely Large Telescope (E-ELT) telescope design phase was recently completed and a major review was

  6. Modeling Non-homologous End Joining

    NASA Technical Reports Server (NTRS)

    Li, Yongfeng


    Non-homologous end joining (NHEJ) is the dominant DNA double strand break (DSB) repair pathway and involves several NHEJ proteins such as Ku, DNA-PKcs, XRCC4, Ligase IV and so on. Once DSBs are generated, Ku is first recruited to the DNA end, followed by other NHEJ proteins for DNA end processing and ligation. Because of the direct ligation of break ends without the need for a homologous template, NHEJ turns out to be an error-prone but efficient repair pathway. Some mechanisms have been proposed of how the efficiency of NHEJ repair is affected. The type of DNA damage is an important factor of NHEJ repair. For instance, the length of DNA fragment may determine the recruitment efficiency of NHEJ protein such as Ku [1], or the complexity of the DNA breaks [2] is accounted for the choice of NHEJ proteins and subpathway of NHEJ repair. On the other hand, the chromatin structure also plays a role of the accessibility of NHEJ protein to the DNA damage site. In this talk, some mathematical models of NHEJ, that consist of series of biochemical reactions complying with the laws of chemical reaction (e.g. mass action, etc.), will be introduced. By mathematical and numerical analysis and parameter estimation, the models are able to capture the qualitative biological features and show good agreement with experimental data. As conclusions, from the viewpoint of modeling, how the NHEJ proteins are recruited will be first discussed for connection between the classical sequential model [4] and recently proposed two-phase model [5]. Then how the NHEJ repair pathway is affected, by the length of DNA fragment [6], the complexity of DNA damage [7] and the chromatin structure [8], will be addressed

  7. Geochemical cycling and depositional patterns across the northeast region of the Greenland Ice Sheet as determined from trace element chemistry

    NASA Astrophysics Data System (ADS)

    Wong, G. J.; Osterberg, E. C.; Courville, Z.; Hawley, R. L.; Lutz, E.; Overly, T. B.


    The Greenland Ice Sheet is both a repository of climate history and a major driver in Arctic and global climate. Between 1952 and 1955, Carl Benson led a series of traverses of the Greenland Ice Sheet (GIS), and characterized the GIS via mapping of the spatial distribution of annual net accumulation and classifying the diagenetic glacier facies (Benson, 1962). While polar ice sheets represent a unique archive of past atmospheric and climatic conditions, little information exists on large-scale geographical trends in trace element snow chemistry across GIS because of the remote, challenging location. In the spring of 2011, we undertook a 1120 km traverse of the GIS from Thule Air Base to Summit Station. Samples from 11 snow pits and 3 firn cores, dated by stable water isotopes, were analyzed and evaluated in seasonal resolution for their trace element content (23Na, 24Mg, 27Al, 32S, 39K, 44Ca, 47Ti, 51V, 52Cr, 55Mn, 56Fe, 59Co, 63Cu, 66Zn, 75As, 88Sr, 111Cd, 133Cs, 138Ba, 139La, 140Ce, 141Pr, 208Pb, 209Bi, 238U). Here, we present an initial analysis of the spatial gradients of these trace elements and an interpretation of how their depositional patterns characterize the GIS. The seasonal trends coupled with spatial variability of certain trace elements establish the behavior of specific aerosols (e.g. dust, sea salt, pollution), which will be useful in quantifying geochemical cycling across the GIS and comparing characterizations with results from Benson's traverses. Benson, CS. 1962. Stratigraphic studies in the snow and firn of the Greenland Ice Sheet. SIPRE Research Report, 70, 89 pp.

  8. A Modeling Approach for Plastic-Metal Laser Direct Joining

    NASA Astrophysics Data System (ADS)

    Lutey, Adrian H. A.; Fortunato, Alessandro; Ascari, Alessandro; Romoli, Luca


    Laser processing has been identified as a feasible approach to direct joining of metal and plastic components without the need for adhesives or mechanical fasteners. The present work sees development of a modeling approach for conduction and transmission laser direct joining of these materials based on multi-layer optical propagation theory and numerical heat flow simulation. The scope of this methodology is to predict process outcomes based on the calculated joint interface and upper surface temperatures. Three representative cases are considered for model verification, including conduction joining of PBT and aluminum alloy, transmission joining of optically transparent PET and stainless steel, and transmission joining of semi-transparent PA 66 and stainless steel. Conduction direct laser joining experiments are performed on black PBT and 6082 anticorodal aluminum alloy, achieving shear loads of over 2000 N with specimens of 2 mm thickness and 25 mm width. Comparison with simulation results shows that consistently high strength is achieved where the peak interface temperature is above the plastic degradation temperature. Comparison of transmission joining simulations and published experimental results confirms these findings and highlights the influence of plastic layer optical absorption on process feasibility.

  9. Special phase space regions with minimal energy and momentum dependencies of the ARPES matrix element in Bi2212

    NASA Astrophysics Data System (ADS)

    Lindroos, Matti; Markiewicz, Robert; Bansil, Arun


    Strong momentum (k_allel) and photon energy (hν) dependencies of the ARPES matrix element[1,2] will significantly complicate the applicability of recently proposed ARPES-based tests of the fundamental mechanism of cuprate superconductivity[3]. In this connection, we have carried out extensive first-principles simulations of the angle-resolved photointensity in Bi_2Sr_2CaCu_2O_8+δ (Bi2212) within the one-step photoemission model. A careful search of simulated photointensities in the (hν,k_allel) phase space indicates that it is generally difficult to minimize the effect of the ARPES matrix element with polarized light, but that for unpolarized radiation, it is possible to identify special energies around which the ARPES matrix element is more or less constant. ARPES spectra for emission from the Fermi energy at such selected photon energies are presented and discussed. 1. A. Bansil, and M. Lindroos, Phys. Rev. Letters 83, 5154 (1999). 2. M. Lindroos, S. Sahrakorpi, and A. Bansil, Phys. Rev. B 65, 054514 (2002). 3: I. Vekhter, and C.M. Varma, cond-mat/0210508.

  10. The spatial organization of non-homologous end joining: From bridging to end joining

    PubMed Central

    Ochi, Takashi; Wu, Qian; Blundell, Tom L.


    Non-homologous end joining (NHEJ) repairs DNA double-strand breaks generated by DNA damage and also those occurring in V(D)J recombination in immunoglobulin and T cell receptor production in the immune system. In NHEJ DNA-PKcs assembles with Ku heterodimer on the DNA ends at double-strand breaks, in order to bring the broken ends together and to assemble other proteins, including DNA ligase IV (LigIV), required for DNA repair. Here we focus on structural aspects of the interactions of LigIV with XRCC4, XLF, Artemis and DNA involved in the bridging and end-joining steps of NHEJ. We begin with a discussion of the role of XLF, which interacts with Ku and forms a hetero-filament with XRCC4; this likely forms a scaffold bridging the DNA ends. We then review the well-defined interaction of XRCC4 with LigIV, and discuss the possibility of this complex interrupting the filament formation, so positioning the ligase at the correct positions close to the broken ends. We also describe the interactions of LigIV with Artemis, the nuclease that prepares the ends for ligation and also interacts with DNA-PK. Lastly we review the likely affects of Mendelian mutations on these multiprotein assemblies and their impacts on the form of inherited disease. PMID:24636752

  11. The spatial organization of non-homologous end joining: from bridging to end joining.


    Ochi, Takashi; Wu, Qian; Blundell, Tom L


    Non-homologous end joining (NHEJ) repairs DNA double-strand breaks generated by DNA damage and also those occurring in V(D)J recombination in immunoglobulin and T cell receptor production in the immune system. In NHEJ DNA-PKcs assembles with Ku heterodimer on the DNA ends at double-strand breaks, in order to bring the broken ends together and to assemble other proteins, including DNA ligase IV (LigIV), required for DNA repair. Here we focus on structural aspects of the interactions of LigIV with XRCC4, XLF, Artemis and DNA involved in the bridging and end-joining steps of NHEJ. We begin with a discussion of the role of XLF, which interacts with Ku and forms a hetero-filament with XRCC4; this likely forms a scaffold bridging the DNA ends. We then review the well-defined interaction of XRCC4 with LigIV, and discuss the possibility of this complex interrupting the filament formation, so positioning the ligase at the correct positions close to the broken ends. We also describe the interactions of LigIV with Artemis, the nuclease that prepares the ends for ligation and also interacts with DNA-PK. Lastly we review the likely affects of Mendelian mutations on these multiprotein assemblies and their impacts on the form of inherited disease.

  12. Joining of parts via magnetic heating of metal aluminum powders

    SciTech Connect

    Baker, Ian


    A method of joining at least two parts includes steps of dispersing a joining material comprising a multi-phase magnetic metal-aluminum powder at an interface between the at least two parts to be joined and applying an alternating magnetic field (AMF). The AMF has a magnetic field strength and frequency suitable for inducing magnetic hysteresis losses in the metal-aluminum powder and is applied for a period that raises temperature of the metal-aluminum powder to an exothermic transformation temperature. At the exothermic transformation temperature, the metal-aluminum powder melts and resolidifies as a metal aluminide solid having a non-magnetic configuration.

  13. Solid State Joining of Dissimilar Titanium Alloys

    NASA Astrophysics Data System (ADS)

    Morton, Todd W.

    Solid state joining of titanium via friction stir welding and diffusion bonding have emerged as enablers of efficient monolithic structural designs by the eliminations fasteners for the aerospace industry. As design complexity and service demands increase, the need for joints of dissimilar alloys has emerged. Complex thermomechanical conditions in friction stir weld joints and high temperature deformation behavior differences between alloys used in dissimilar joints gives rise to a highly variable flow pattern within a stir zone. Experiments performed welding Ti-6Al-4V to beta21S show that mechanical intermixing of the two alloys is the primary mechanism for the generation of the localized chemistry and microstructure, the magnitude of which can be directly related to pin rotation and travel speed weld parameters. Mechanical mixing of the two alloys is heavily influenced by strain rate softening phenomena, and can be used to manipulate weld nugget structure by switching which alloy is subjected to the advancing side of the pin. Turbulent mixing of a weld nugget and a significant reduction in defects and weld forces are observed when the beta21S is put on the advancing side of the weld where higher strain rates are present. Chemical diffusion driven by the heat of weld parameters is characterized using energy dispersive x-ray spectroscopy (EDS) and is shown to be a secondary process responsible for generating short-range chemical gradients that lead to a gradient of alpha particle structures. Diffusion calculations are inconsistent with an assumption of steady-state diffusion and show that material interfaces in the weld nugget evolve through the break-down of turbulent interface features generated by material flows. A high degree of recrystallization is seen throughout the welds, with unique, hybrid chemistry grains that are generated at material interfaces in the weld nugget that help to unify the crystal structure of dissimilar alloys. The degree of

  14. The Schizosaccharomyces pombe inv1+ regulatory region is unusually large and contains redundant cis-acting elements that function in a SAGA- and Swi/Snf-dependent fashion.


    Ahn, Sejin; Spatt, Dan; Winston, Fred


    The Schizosaccharomyces pombe inv1(+) gene encodes invertase, the enzyme required for hydrolysis of sucrose and raffinose. Transcription of inv1(+) is regulated by glucose levels, with transcription tightly repressed in high glucose and strongly induced in low glucose. To understand this regulation, we have analyzed the inv1(+) cis-regulatory region and the requirement for the trans-acting coactivators SAGA and Swi/Snf. Surprisingly, deletion of the entire 1-kilobase intergenic region between the inv1(+) TATA element and the upstream open reading frame SPCC191.10 does not significantly alter regulation of inv1(+) transcription. However, a longer deletion that extends through SPCC191.10 abolishes inv1(+) induction in low glucose. Additional analysis demonstrates that there are multiple, redundant regulatory regions spread over 1.5 kb 5' of inv1(+), including within SPCC191.10, that can confer glucose-mediated transcriptional regulation to inv1(+). Furthermore, SPCC191.10 can regulate inv1(+) transcription in an orientation-independent fashion and from a distance as great as 3 kb. With respect to trans-acting factors, both SAGA and Swi/Snf are recruited to SPCC191.10 and to other locations in the large inv1(+) regulatory region in a glucose-dependent fashion, and both are required for inv1(+) derepression. Taken together, these results demonstrate that inv1(+) regulation in S. pombe occurs via the use of multiple regulatory elements and that activation can occur over a great distance, even from elements within other open reading frames.

  15. Endothelin-1 expression is strongly repressed by AU-rich elements in the 3′-untranslated region of the gene

    PubMed Central


    The regulation of the synthesis of the endothelial-derived vasoconstrictor ET-1 (endothelin-1) is a complex process that occurs mainly at the mRNA level. Transcription of the gene accounts for an important part of the regulation of expression, as already described for different modulators such as the cytokine TGF-β (transforming growth factor-β). However, very little is known about mechanisms governing ET-1 expression at the post-transcriptional level. The aim of the present study was to investigate the regulation of the ET-1 expression at this level. Since the 3′-UTR (3′-untranslated region) of mRNAs commonly contains genetic determinants for the post-transcriptional control of gene expression, we focused on the potential role of the 3′-UTR of ET-1 mRNA. Experiments performed with luciferase reporter constructs containing the 3′-UTR showed that this region exerts a potent destabilizing effect. Deletional analyses allowed us to locate this activity within a region at positions 924–1127. Some (but not all) of the AREs (AU-rich elements) present in this region were found to be essential for this mRNA-destabilizing activity. We also present evidence that cytosolic proteins from endothelial cells interact specifically with these RNA elements, and that a close correlation exists between the ability of the AREs to destabilize ET-1 mRNA and the binding of proteins to these elements. Our results are compatible with the existence of a strong repressional control of ET-1 expression mediated by destabilization of the mRNA exerted through the interaction of specific cytosolic proteins with AREs present in the 3′-UTR of the gene. PMID:15595926

  16. Joining of alumina via copper/niobium/copper interlayers

    SciTech Connect

    Marks, Robert A.; Chapman, Daniel R.; Danielson, David T.; Glaeser, Andreas M.


    Alumina has been joined at 1150 degrees C and 1400 degrees C using multilayer copper/niobium/copper interlayers. Four-point bend strengths are sensitive to processing temperature, bonding pressure, and furnace environment (ambient oxygen partial pressure). Under optimum conditions, joints with reproducibly high room temperature strengths (approximately equal 240 plus/minus 20 MPa) can be produced; most failures occur within the ceramic. Joints made with sapphire show that during bonding an initially continuous copper film undergoes a morphological instability, resulting in the formation of isolated copper-rich droplets/particles at the sapphire/interlayer interface, and extensive regions of direct bonding between sapphire and niobium. For optimized alumina bonds, bend tests at 800 degrees C-1100 degrees C indicate significant strength is retained; even at the highest test temperature, ceramic failure is observed. Post-bonding anneals at 1000 degrees C in vacuum or in gettered argon were used to assess joint stability and to probe the effect of ambient oxygen partial pressure on joint characteristics. Annealing in vacuum for up to 200 h causes no significant decrease in room temperature bend strength or change in fracture path. With increasing anneal time in a lower oxygen partial pressure environment, the fracture strength decreases only slightly, but the fracture path shifts from the ceramic to the interface.

  17. Trace elements in free-range hen eggs in the Campania region (Italy) analyzed by inductively coupled plasma mass spectrometry (ICP-MS).


    Esposito, Mauro; Cavallo, Stefania; Chiaravalle, Eugenio; Miedico, Oto; Pellicanò, Roberta; Rosato, Guido; Sarnelli, Paolo; Baldi, Loredana


    Eggs from hens raised on rural or domestic farms are a good indicator of environmental contamination, as the hens are in close contact with the ground and the air and can therefore accumulate heavy metals and other toxic contaminants from the environment as well as from the diet. In this paper, we report the results of the determination of 19 trace elements (As, Be, Cd, Co, Cr, Cu, Hg, Mo, Mn, Ni, Pb, Sb, Se, Sn, Sr, Tl, U, V, Zn) in 39 hen egg samples collected from domestic poultry farms in the territory dubbed the "Land of fires" in the Campania region (Italy). This area is characterized by environmental problems caused by the illegal dumping of industrial or domestic waste in fields or by roadsides. In some cases, these wastes have been burned, thereby spreading persistent contaminants into the atmosphere. The content of trace elements in whole egg samples was determined by mass spectrometer after a microwave-assisted digestion procedure. Because European legislation does not indicate maximum values of these elements in this foodstuff, the results were compared with the content of trace elements reported in literature for eggs, in particular home-produced eggs, in various countries. In some cases (Cd, Cu, Ni, Mn), the content determined in this study was in line with those reported elsewhere, in other cases (Pb, Cr), lower values were found.

  18. Identification of region-specific yeast artificial chromosomes using pools of Alu element-mediated polymerase chain reaction probes labeled via linear amplification.


    Cole, C G; Patel, K; Shipley, J; Sheer, D; Bobrow, M; Bentley, D R; Dunham, I


    The ability to identify large numbers of yeast artificial chromosomes (YACs) specific to any given genomic region rapidly and efficiently enhances both the construction of clone maps and the isolation of region-specific landmarks (e.g., polymorphic markers). We describe a method of preparing region-specific single-stranded hybridization probes from Alu element-mediated polymerase chain reaction (Alu-PCR) products of somatic cell hybrids for YAC library screening. Pools of up to 50 cloned Alu-PCR products from an irradiation-reduced hybrid containing 22q11.2-q13.1 were labeled to high specific activity by linear amplification using a single vector primer. The resulting single-stranded probes were extensively competed to remove repetitive sequences, while retaining the full complexity of the probe. Extensive coverage of the region by YACs using multiple probe pools was demonstrated as many YACs were detected more than once. In situ analysis using chosen YACs confirmed that the clones were specific for the region. Thus, this pooled probe approach constitutes a rapid method to identify large numbers of YACs relevant to a large chromosomal region.

  19. A compilation of mineral occurrences and the relationship of occurrences to structural elements of the Kentucky and Tennessee region

    NASA Technical Reports Server (NTRS)

    Mayhew, M. A.; Myers, D. M.


    A very prominent magnetic anomaly measured by MAGSAT over the eastern mid-continent of the United States was inferred to have a source region beneath Kentucky and Tennessee. Prominent aeromagnetic and gravity anomalies are also associated with the inferred source region. A crustal model constructed to fit these anomalies interpreted the complex as a large mafic plutonic intrusion of Precambrian age. The complex was named the Kentucky body. It was noticed that the Jessamine Dome, which is a locus of intense faulting and mineralization, occurs near the northern end of the Kentucky body, and that more generally there seemed to be a spatial relationship between mineral occurrence and the body. The relationship between mineral deposits in Kentucky and Tennessee and the Kentucky body was investigated. A compilation of mineral occurrences in the region, classified according to type and age, is presented.

  20. Definition of a lipopolysaccharide-responsive element in the 5'-flanking regions of MuRantes and crg-2.

    PubMed Central

    Shin, H S; Drysdale, B E; Shin, M L; Noble, P W; Fisher, S N; Paznekas, W A


    Macrophages are stimulated by lipopolysaccharide (LPS) of gram-negative organisms. The changes in LPS-stimulated macrophages include transcriptional activation of multiple immediate-early genes, which may contribute to the natural immunity to microorganisms. We have defined by deletion and mutational analysis LPS-responsive elements (LREs) in two chemokine genes, MuRantes and crg-2, which are activated in an immediate-early manner. LRE consists of two motifs, TCAYR, which is an AP-1 half site with two flanking bases, and (A/T) (G/C)NTTYC(A/T)NTTY, which resembles in part the interferon-stimulated responsive element (ISRE). The orientation of these two motifs relative to each other in MuRantes differed from that in crg-2. These two motifs are separated by 10 and 6 nonconsensus nucleotides in the MuRantes and crg-2 LREs, respectively. Stimulation of macrophage-like RAW 264.7 cells with alpha/beta interferon did not activate MuRantes, indicating that the ISRE-like motif in MuRantes does not have ISRE activity. Upon stimulation of RAW 264.7 cells with LPS, proteins capable of binding to LRE accumulate in the nuclei as measured by electrophoretic mobility shift assay. These LRE-binding proteins include c-Jun and CREB. Images PMID:7513046

  1. Conventional and Microwave Joining of Silicon Carbide Using Displacement Reactions

    NASA Technical Reports Server (NTRS)

    Kingsley, J.; Yiin, T.; Barmatz, M.


    Microwave heating was used to join Silicon Carbide rods using a thin TiC /Si tape interlayer . Microwaves quickly heated the rods and tape to temperatures where solid-state displacement reactions between TiC and Si occurred.

  2. Who Should Join the Environmental Response Laboratory Network

    EPA Pesticide Factsheets

    Laboratories that analyze biological samples, chemical warfare agents, radiological, or toxic industrial chemical samples can join the ERLN. Members make up a critical infrastructure that delivers data necessary for responses to large scale emergencies.

  3. South Pole Telescope joins black-hole project

    NASA Astrophysics Data System (ADS)

    Allen, Michael


    Astronomers are one step closer to observing the event horizon of a black hole after Antarctica's largest telescope joined a worldwide collection of millimetre/submillimetre facilities pursuing this goal.



    Bittner, B.J.; Opperman, R.H.


    An improved transformer is invented for joining an unbalanced transmission means to a balanced transmission means and is useful, for example, in transmitting an electromagnetic signal from a coaxial cable to a balanced dipole antenna.

  5. Joining of Aluminium Alloy Sheets by Rectangular Mechanical Clinching

    SciTech Connect

    Abe, Y.; Mori, K.; Kato, T.


    A mechanical clinching has the advantage of low running costs. However, the joint strength is not high. To improve the maximum load of the joined sheets by a mechanical clinching, square and rectangular mechanical clinching were introduced. In the mechanical clinching, the two sheets are mechanically joined by forming an interlock between the lower and upper sheets by the punch and die. The joined length with the interlock was increased by the rectangular punch and die. The deforming behaviours of the sheets in the mechanical clinching were investigated, and then the interlock in the sheets had distribution in the circumference of the projection. Although the interlocks were formed in both projection side and diagonal, the interlock in the diagonal was smaller because of the long contact length between the lower sheet and the die cavity surface. The maximum load of the joined sheets by the rectangular mechanical clinching was two times larger than the load by the round mechanical clinching.

  6. Explosive Joining for the Mars Sample Return Mission

    NASA Technical Reports Server (NTRS)

    Bement, Laurence J.; Sanok, Joseph T.


    A unique, small-scale, ribbon explosive joining process is being developed as an option for closing and sealing a metal canister to allow the return of a pristine sample of the Martian surface and atmosphere to Earth. This joining process is accomplished by an explosively driven, high-velocity, angular collision of the metal, which melts and effaces the oxide films from the surfaces to allow valence electron sharing to bond the interface. Significant progress has been made through more than 100 experimental tests to meet the goals of this ongoing developmental effort. The metal of choice, aluminum alloy 6061, has been joined in multiple interface configurations and in complete cylinders. This process can accommodate dust and debris on the surfaces to be joined. It can both create and sever a joint at its midpoint with one explosive input. Finally, an approach has been demonstrated that can capture the back blast from the explosive.

  7. Holographic optical assembly and photopolymerized joining of planar microspheres


    Shaw, L. A.; Chizari, S.; Panas, R. M.; ...


    The aim of this research is to demonstrate a holographically driven photopolymerization process for joining colloidal particles to create planar microstructures fixed to a substrate, which can be monitored with real-time measurement. Holographic optical tweezers (HOT) have been used to arrange arrays of microparticles prior to this work; here we introduce a new photopolymerization process for rapidly joining simultaneously handled microspheres in a plane. Additionally, we demonstrate a new process control technique for efficiently identifying when particles have been successfully joined by measuring a sufficient reduction in the particles’ Brownian motion. Furthermore, this technique and our demonstrated joining approach enablemore » HOT technology to take critical steps toward automated additive fabrication of microstructures.« less

  8. Holographic optical assembly and photopolymerized joining of planar microspheres

    SciTech Connect

    Shaw, L. A.; Chizari, S.; Panas, R. M.; Shusteff, M.; Spadaccini, C. M.; Hopkins, J. B.


    The aim of this research is to demonstrate a holographically driven photopolymerization process for joining colloidal particles to create planar microstructures fixed to a substrate, which can be monitored with real-time measurement. Holographic optical tweezers (HOT) have been used to arrange arrays of microparticles prior to this work; here we introduce a new photopolymerization process for rapidly joining simultaneously handled microspheres in a plane. Additionally, we demonstrate a new process control technique for efficiently identifying when particles have been successfully joined by measuring a sufficient reduction in the particles’ Brownian motion. Furthermore, this technique and our demonstrated joining approach enable HOT technology to take critical steps toward automated additive fabrication of microstructures.


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. EYEBAR PIN CONNECTION JOINING VERTICAL SUSPENSION STRINGER WITH LATERAL BRACING MEMBERS - Spruce Street Bridge, East Spruce Street, 500 Block, spanning Power Canal, Sault Ste. Marie, Chippewa County, MI

  10. Microwave joining of SiC ceramics and composites

    SciTech Connect

    Ahmad, I.; Silberglitt, R.; Tian, Y.L.; Katz, J.D.


    Potential applications of SiC include components for advanced turbine engines, tube assemblies for radiant burners and petrochemical processing and heat exchangers for high efficiency electric power generation systems. Reliable methods for joining SiC are required in order to cost-effectively fabricate components for these applications from commercially available shapes and sizes. This manuscript reports the results of microwave joining experiments performed using two different types of SiC materials. The first were on reaction bonded SiC, and produced joints with fracture toughness equal to or greater than that of the base material over an extended range of joining temperatures. The second were on continuous fiber-reinforced SiC/SiC composite materials, which were successfully joined with a commercial active brazing alloy, as well as by using a polymer precursor.

  11. Join NASA: The Sky is NOT the Limit

    NASA Image and Video Library

    We're going to send humans farther into space than ever before ... and eventually to Mars. We need YOU to help plan for this future of exploration. Join NASA: Get your application in now for the 20...

  12. Conventional and Microwave Joining of Silicon Carbide Using Displacement Reactions

    NASA Technical Reports Server (NTRS)

    Kingsley, J.; Yiin, T.; Barmatz, M.


    Microwave heating was used to join Silicon Carbide rods using a thin TiC /Si tape interlayer . Microwaves quickly heated the rods and tape to temperatures where solid-state displacement reactions between TiC and Si occurred.

  13. Holographic optical assembly and photopolymerized joining of planar microspheres

    SciTech Connect

    Shaw, L. A.; Chizari, S.; Panas, R. M.; Shusteff, M.; Spadaccini, C. M.; Hopkins, J. B.


    The aim of this research is to demonstrate a holographically driven photopolymerization process for joining colloidal particles to create planar microstructures fixed to a substrate, which can be monitored with real-time measurement. Holographic optical tweezers (HOT) have been used to arrange arrays of microparticles prior to this work; here we introduce a new photopolymerization process for rapidly joining simultaneously handled microspheres in a plane. Additionally, we demonstrate a new process control technique for efficiently identifying when particles have been successfully joined by measuring a sufficient reduction in the particles’ Brownian motion. Furthermore, this technique and our demonstrated joining approach enable HOT technology to take critical steps toward automated additive fabrication of microstructures.

  14. Chord Splicing & Joining Detail; Chord & CrossBracing Joint Details; ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Chord Splicing & Joining Detail; Chord & Cross-Bracing Joint Details; Cross Bracing Center Joint Detail; Chord & Diagonal Joint Detail - Vermont Covered Bridge, Highland Park, spanning Kokomo Creek at West end of Deffenbaugh Street (moved to), Kokomo, Howard County, IN

  15. Retrotransposons in the flanking regions of normal plant genes: a role for copia-like elements in the evolution of gene structure and expression.

    PubMed Central

    White, S E; Habera, L F; Wessler, S R


    The wx-K mutation results from the insertion of a copia-like retrotransposon into exon 12 of the maize waxy gene. This retrotransposon, named Hopscotch, has one long open reading frame encoding all of the domains required for transposition. Computer-assisted database searches using Hopscotch and other plant copia-like retroelements as query sequences have revealed that ancient, degenerate retrotransposon insertions are found in close proximity to 21 previously sequenced plant genes. The data suggest that these elements may be involved in gene duplication and the regulation of gene expression. Similar searches using the Drosophila retrotransposon copia did not reveal any retrotransposon-like sequences in the flanking regions of animal genes. These results, together with the recent finding that reverse-transcriptase sequences characteristic of copia-like elements are ubiquitous and diverse in plants, suggest that copia-like retrotransposons are an ancient component of plant genomes. Images PMID:7991537

  16. Trace element uptake by Eleocharis equisetina (spike rush) in an abandoned acid mine tailings pond, northeastern Australia: implications for land and water reclamation in tropical regions.


    Lottermoser, Bernd G; Ashley, Paul M


    This study was conducted to determine the uptake of trace elements by the emergent wetland plant species Eleocharis equisetina at the historic Jumna tin processing plant, tropical Australia. The perennial emergent sedge was found growing in acid waters (pH 2.45) and metal-rich tailings (SnAsCuPbZn). E. equisetina displayed a pronounced acid tolerance and tendency to exclude environmentally significant elements (Al, As, Cd, Ce, Co, Cu, Fe, La, Ni, Pb, Se, Th, U, Y, Zn) from its above-substrate biomass. This study demonstrates that geobotanical and biogeochemical examinations of wetland plants at abandoned mined lands of tropical areas can reveal pioneering, metal-excluding macrophytes. Such aquatic macrophytes are of potential use in the remediation of acid mine waters and sulfidic tailings and the reclamation of disturbed acid sulfate soils in subtropical and tropical regions. Copyright © 2011 Elsevier Ltd. All rights reserved.

  17. Orientation-specific joining of AID-initiated DNA breaks promotes antibody class switching.


    Dong, Junchao; Panchakshari, Rohit A; Zhang, Tingting; Zhang, Yu; Hu, Jiazhi; Volpi, Sabrina A; Meyers, Robin M; Ho, Yu-Jui; Du, Zhou; Robbiani, Davide F; Meng, Feilong; Gostissa, Monica; Nussenzweig, Michel C; Manis, John P; Alt, Frederick W


    During B-cell development, RAG endonuclease cleaves immunoglobulin heavy chain (IgH) V, D, and J gene segments and orchestrates their fusion as deletional events that assemble a V(D)J exon in the same transcriptional orientation as adjacent Cμ constant region exons. In mice, six additional sets of constant region exons (CHs) lie 100-200 kilobases downstream in the same transcriptional orientation as V(D)J and Cμ exons. Long repetitive switch (S) regions precede Cμ and downstream CHs. In mature B cells, class switch recombination (CSR) generates different antibody classes by replacing Cμ with a downstream CH (ref. 2). Activation-induced cytidine deaminase (AID) initiates CSR by promoting deamination lesions within Sμ and a downstream acceptor S region; these lesions are converted into DNA double-strand breaks (DSBs) by general DNA repair factors. Productive CSR must occur in a deletional orientation by joining the upstream end of an Sμ DSB to the downstream end of an acceptor S-region DSB. However, the relative frequency of deletional to inversional CSR junctions has not been measured. Thus, whether orientation-specific joining is a programmed mechanistic feature of CSR as it is for V(D)J recombination and, if so, how this is achieved is unknown. To address this question, we adapt high-throughput genome-wide translocation sequencing into a highly sensitive DSB end-joining assay and apply it to endogenous AID-initiated S-region DSBs in mouse B cells. We show that CSR is programmed to occur in a productive deletional orientation and does so via an unprecedented mechanism that involves in cis Igh organizational features in combination with frequent S-region DSBs initiated by AID. We further implicate ATM-dependent DSB-response factors in enforcing this mechanism and provide an explanation of why CSR is so reliant on the 53BP1 DSB-response factor.

  18. CTCF Binding Elements Mediate Control of V(D)J Recombination

    PubMed Central

    Guo, Chunguang; Yoon, Hye Suk; Franklin, Andrew; Jain, Suvi; Ebert, Anja; Cheng, Hwei-Ling; Hansen, Erica; Despo, Orion; Bossen, Claudia; Vettermann, Christian; Bates, Jamie G.; Richards, Nicholas; Myers, Darienne; Patel, Harin; Gallagher, Michael; Schlissel, Mark S.; Murre, Cornelis; Busslinger, Meinrad; Giallourakis, Cosmas C.; Alt, Frederick W.


    Immunoglobulin heavy chain (IgH) variable region exons are assembled from VH, D and JH gene segments in developing B lymphocytes. Within the 2.7 megabase (Mb) mouse IgH locus (IgH), V(D)J recombination is regulated to ensure specific and diverse antibody repertoires. Herein, we report a key IgH V(D)J recombination regulatory region, termed InterGenic Control Region-1 (IGCR1), that lies between the VH and D clusters. Functionally, IGCR1 employs CTCF looping/insulator factor binding elements and, correspondingly, mediates IgH loops containing distant enhancers. IGCR1 promotes normal B cell development and balances antibody repertoires by inhibiting transcription and rearrangement of DH-proximal VHs and promoting rearrangement of distal VHs. IGCR1 maintains ordered and lineage-specific VH(D)JH recombination, respectively, by suppressing VH joining to Ds not joined to JHs and VH to DJH joins in thymocytes. IGCR1 also is required to allow feedback regulation and allelic exclusion of proximal VH to DJH recombination. Our studies elucidate a long-sought IgH V(D)J recombination control region and implicate a new role for the generally expressed CTCF protein. PMID:21909113

  19. Joining of SiC parts by polishing and hipping


    Rossi, Guilio A.; Pelletier, Paul J.


    A method of joining two pre-sintered pieces of silicon carbide is disclosed. It entails polishing the surfaces to be joined to a mirror-finish, fitting the polished surfaces together to form a composite structure, and then subjecting the composite structure to hot isostatic pressing under conditions which are sufficient to form a joint which is essentially indistinguishable from the original silicon carbide pieces.

  20. Top scientists join Stephen Hawking at Perimeter Institute

    NASA Astrophysics Data System (ADS)

    Banks, Michael


    Nine leading researchers are to join Stephen Hawking as visiting fellows at the Perimeter Institute for Theoretical Physics in Ontario, Canada. The researchers, who include string theorists Leonard Susskind from Stanford University and Asoka Sen from the Harisch-Chandra Research Institute in India, will each spend a few months of the year at the institute as "distinguished research chairs". They will be joined by another 30 scientists to be announced at a later date.

  1. Parametric weight evaluation of joined wings by structural optimization

    NASA Technical Reports Server (NTRS)

    Miura, Hirokazu; Shyu, Albert T.; Wolkovitch, Julian


    Joined-wing aircraft employ tandem wings having positive and negative sweep and dihedral, arranged to form diamond shapes in both plan and front views. An optimization method was applied to study the effects of joined-wing geometry parameters on structural weight. The lightest wings were obtained by increasing dihedral and taper ratio, decreasing sweep and span, increasing fraction of airfoil chord occupied by structural box, and locating the joint inboard of the front wing tip.

  2. Fastening, coupling and joining technique between diaspora and irredenta

    NASA Astrophysics Data System (ADS)

    Bauer, C.-O.


    The problem of eliminating the present divergence and shattering (diaspora) in the treatment of problems of the fastening, coupling, and joining technique on different technical branches is examined. It is shown that by an appropriate independence the fastening, coupling and joining techniques can recognize and consequently utilize the numerous performance reserves which are concealed by the present organization and action due to the lack of systematically tended works.

  3. Joining of Thin Metal Sheets by Shot Peening

    NASA Astrophysics Data System (ADS)

    Harada, Yasunori


    In shot peening the substrate undergoes large plastic deformation near the surface due to the hit with shots. The plastic flow areas formed by cold working may form the surface layer. Authors have recently proposed new joining methods using shot peening, shot lining and shot caulking. Our approach has been applied to the butt joining of the dissimilar metal sheets. In the present study, joining of thin metal sheets using a shot peening process was investigated to improve the joinability. In the joined section, the edge of sheets is the equally-spaced slits. In this method, the convex edges of the sheet are laid on top of the other sheet. Namely, the two sheets are superimposed in the joining area. When the connection is shot-peened, the material of the convex area undergoes large plastic deformation near the surface due to the collision of shots. In this process, particularly noteworthy is the plastic flow near surface layer. The convex edges of the sheet can be joined to the other sheet, thus two sheets are joined each other. In the experiment, the shot peening treatment was performed by using an air-type peening machine. The shots used were made of high carbon cast steel. Air pressure was 0.6 MPa and peening time was in the range of 30-150s. The peening conditions were controlled in the experiment. The thin sheets were commercial low-carbon steel, stainless steel, pure aluminum, and aluminium alloy. The effects of processing conditions on the joinability were mainly examined. The joint strength increased with the kinetic energy of shots. It was found that the present method was effective for joining of thin metal sheets.

  4. Light regulation of Fed-1 mRNA requires an element in the 5' untranslated region and correlates with differential polyribosome association.

    PubMed Central

    Dickey, L F; Petracek, M E; Nguyen, T T; Hansen, E R; Thompson, W F


    Light regulation of Fed-1 mRNA abundance in the leaves of green plants is primarily a post-transcriptional process. Previously, we have shown that the Fed-1 mRNA light response requires an open reading frame, indicating that the light regulation of the mRNA depends on its concurrent translation. We now show that light-induced increases in Fed-1 mRNA abundance are associated with increases in polyribosome association that require both a functional AUG and a normal Fed-1 translational start context. We also present evidence that light regulation of Fed-1 mRNA levels requires more than efficient translation per se. Substitution of the efficiently translated tobacco mosaic virus Omega 5' untranslated region resulted in a loss of Fed-1 light regulation. In addition, we identified a CAT T repeat element located near the 5' terminus of the Fed-1 5' untranslated region that is essential for light regulation. We introduced two different mutations in the CAT T repeat element, but only one of these substitutions blocked the normal light effect on polyribosome association, whereas both altered dark-induced Fed-1 mRNA disappearance. The element may thus be important for Fed-1 mRNA stability rather than polyribosome loading. We propose a model in which Fed-1 mRNA is relatively stable when it is associated with polyribosomes in illuminated plants but in darkness is not polyribosome associated and is thus rapidly degraded by a process involving the CAT T repeat element. PMID:9501119

  5. Ultramafic xenoliths from Damaping (Hannuoba region, NE-China): Petrogenetic implications from crystal chemistry of pyroxenes, olivine and Cr-spinel and trace element content of clinopyroxene

    NASA Astrophysics Data System (ADS)

    Princivalle, F.; De Min, A.; Lenaz, D.; Scarbolo, M.; Zanetti, A.


    Olivine, orthopyroxene, clinopyroxene and spinel from 16 different lherzolite mantle xenoliths from Damaping (Hannuoba region, NE-China) have been analyzed by X-ray single crystal diffraction and electron microprobe to define their structure, chemistry and cation distribution. LA-ICP-MS analysis has been carried out on clinopyroxenes to determine their LILE (Large-Ion Lithophile Elements), HFSE (High Field Strength Elements) and REE (Rare Earth Elements) contents. These latter define Depleted, Enriched, U-shaped and Transitional CI-normalized patterns suggesting that the xenolith suite here studied experienced at least two metasomatic events related to the porous flow percolation of melts with tholeiitic and alkaline affinity, respectively. The cation distribution of the mineral phases allowed determination of their intra- and inter-crystalline temperatures of equilibration. The closure temperature of intra-crystalline reactions for the constituent phases is in the range 600-800 °C, suggesting a relatively slow cooling rate, while the inter-crystalline temperature interval found out is in the range 866-1048 °C. The pressure conditions estimated for Hannuoba xenoliths through structural considerations correspond to a depth of about 50-60 km, consistent with the Moho depth beneath the Hannuoba area, which is estimated at about 42 km. The pressures of equilibration, as estimated from the cell and T site volumes of the clinopyroxenes, have been compared with the trace element and REE signatures; they demonstrate that Enriched, Depleted, U-shaped and Transitional clinopyroxenes formed at different pressures and are not restricted to a specific region of the mantle, testifying that the metasomatism took place at different depths in the mantle.

  6. Genomic matrix attachment region and chromosome conformation capture quantitative real time PCR assays identify novel putative regulatory elements at the imprinted Dlk1/Gtl2 locus.


    Braem, Caroline; Recolin, Bénédicte; Rancourt, Rebecca C; Angiolini, Christopher; Barthès, Pauline; Branchu, Priscillia; Court, Franck; Cathala, Guy; Ferguson-Smith, Anne C; Forné, Thierry


    We previously showed that genomic imprinting regulates matrix attachment region activities at the mouse Igf2 (insulin-like growth factor 2) locus and that these activities are functionally linked to neighboring differentially methylated regions (DMRs). Here, we investigate the similarly structured Dlk1/Gtl2 imprinted domain and show that in the mouse liver, the G/C-rich intergenic germ line-derived DMR, a sequence involved in domain-wide imprinting, is highly retained within the nuclear matrix fraction exclusively on the methylated paternal copy, reflecting its differential function on that chromosome. Therefore, not only "classical" A/T-rich matrix attachment region (MAR) sequences but also other important regulatory DNA elements (such as DMRs) can be recovered from genomic MAR assays following a high salt treatment. Interestingly, the recovery of one A/T-rich sequence (MAR4) from the "nuclear matrix" fraction is strongly correlated with gene expression. We show that this element possesses an intrinsic activity that favors transcription, and using chromosome conformation capture quantitative real time PCR assays, we demonstrate that the MAR4 interacts with the intergenic germ line-derived DMR specifically on the paternal allele but not with the Dlk1/Gtl2 promoters. Altogether, our findings shed a new light on gene regulation at this locus.

  7. A hemicentric inversion in the maize line knobless Tama flint created two sites of centromeric elements and moved the kinetochore-forming region.


    Lamb, Jonathan C; Meyer, Julie M; Birchler, James A


    A maize line, knobless Tama flint (KTF), was found to contain a version of chromosome 8 with two spatially distinct regions of centromeric elements, one at the original genetic position and the other at a novel location on the long arm. The new site of centromeric elements functions as the kinetochore-forming region resulting in a change of arm length ratio. Examination of fluorescence in situ hybridization markers on chromosome 8 revealed an inversion between the two centromere sites relative to standard maize lines, indicating that this chromosome 8 resulted from a hemicentric inversion with one breakpoint approximately 20 centi-McClintocks (cMc) on the long arm (20% of the total arm length from the centromere) and the other in the original cluster of centromere repeats. This inversion moved the kinetochore-forming region but left the remainder of the centromere repeats. In a hybrid between a standard line (Mo17) and KTF, both chromosome 8 homologues were completely synapsed at pachytene despite the inversion. Although the homologous centromeres were not paired, they were always correctly oriented at anaphase and migrated to opposite poles. Additionally, recombination on 8L was severely repressed in the hybrid.

  8. Plasma Joining of Metal Matrix Composites.

    DTIC Science & Technology


    coefficient (a<l) P = vapor pressure of Al in dynes/cm2 at T K o = density of Al (2.7 g/cm 3 r = radius of Al droplets in cm. R = gas constant (8.31 x...atom of the alloying element, and k = Boltzmann constant For dilute solutions: n x (4) n Al and 4 N 3 o nAl 7r C Al (5) 3Al!% W. . . 1 where: n...atomic weight of Al (27 g/mole) N = Avogadros Number (6.1 x 10 2 3/mole) o Substituting Equations (4) and (5) into Equation (3), we obtain: "- ’dn

  9. Modeling and testing miniature torsion specimens for SiC joining development studies for fusion

    NASA Astrophysics Data System (ADS)

    Henager, C. H.; Nguyen, B. N.; Kurtz, R. J.; Roosendaal, T. J.; Borlaug, B. A.; Ferraris, M.; Ventrella, A.; Katoh, Y.


    The international fusion community has designed a miniature torsion specimen for neutron irradiation studies of joined SiC and SiC/SiC composite materials. Miniature torsion joints based on this specimen design were fabricated using displacement reactions between Si and TiC to produce Ti3SiC2 + SiC joints with SiC and tested in torsion-shear prior to and after neutron irradiation. However, many miniature torsion specimens fail out-of-plane within the SiC specimen body, which makes it problematic to assign a shear strength value to the joints and makes it difficult to compare unirradiated and irradiated strengths to determine irradiation effects. Finite element elastic damage and elastic-plastic damage models of miniature torsion joints are developed that indicate shear fracture is more likely to occur within the body of the joined sample and cause out-of-plane failures for miniature torsion specimens when a certain modulus and strength ratio between the joint material and the joined material exists. The model results are compared and discussed with regard to unirradiated and irradiated test data for a variety of joint materials. The unirradiated data includes Ti3SiC2 + SiC/CVD-SiC joints with tailored joint moduli, and includes steel/epoxy and CVD-SiC/epoxy joints. The implications for joint data based on this sample design are discussed.


    SciTech Connect



    The successful use of a cobalt-based metallic-glass in joining molybdenum disilicide (MoSi{sub 2}) to stainless steel 316L was demonstrated. Such joints are being investigated for sensor tube applications in glass melting operations. The cobalt-based metallic-glass (METGLAS{trademark} 2714A) was found to wet the MoSi{sub 2} and stainless steel surfaces and provide high quality joints. Joining was completed at 1050 C for 60 minutes in two different ways; either by feeding excess braze into the braze gap upon heating or by constraining the MoSi{sub 2}/stainless steel assembly with an alumina (Al{sub 2}O{sub 3}) fixture during the heating cycle. These steps were necessary to ensure the production of a high quality void free joint. Post-brazing metallographic evaluations coupled with quantitative elemental analysis indicated the presence of a Co-Cr-Si ternary phase with CoSi and CoSi{sub 2} precipitates within the braze. The residual stresses in these molybdenum disilicide (MoSi{sub 2})/stainless steel 316 L joints were evaluated using X-ray diffraction and instrumented indentation techniques. These measurements revealed that significant differences are induced in the residual stresses in MoSi{sub 2} and stainless steel depending on the joining technique employed. Push-out tests were carried out on these joints to evaluate the joint strength.

  11. Modeling and Testing Miniature Torsion Specimens for SiC Joining Development Studies for Fusion

    SciTech Connect

    Henager, Charles H.; Nguyen, Ba Nghiep; Kurtz, Richard J.; Roosendaal, Timothy J.; Borlaug, Brennan A.; Ferraris, Monica; Ventrella, Andrea; Katoh, Yutai


    The international fusion community has designed a miniature torsion specimen for neutron irradiation studies of joined SiC and SiC/SiC composite materials. Miniature torsion joints based on this specimen design were fabricated using displacement reactions between Si and TiC to produce Ti3SiC2 + SiC joints with CVD-SiC and tested in torsion-shear prior to and after neutron irradiation. However, many of these miniature torsion specimens fail out-of-plane within the CVD-SiC specimen body, which makes it problematic to assign a shear strength value to the joints and makes it difficult to compare unirradiated and irradiated joint strengths to determine the effects of the irradiation. Finite element elastic damage and elastic-plastic damage models of miniature torsion joints are developed that indicate shear fracture is likely to occur within the body of the joined sample and cause out-of-plane failures for miniature torsion specimens when a certain modulus and strength ratio between the joint material and the joined material exists. The model results are compared and discussed with regard to unirradiated and irradiated joint test data for a variety of joint materials. The unirradiated data includes Ti3SiC2 + SiC/CVD-SiC joints with tailored joint moduli, and includes steel/epoxy and CVD-SiC/epoxy joints. The implications for joint data based on this sample design are discussed.

  12. Long-term familiarity promotes joining in neighbour nest defence.


    Grabowska-Zhang, A M; Sheldon, B C; Hinde, C A


    Familiarity plays an important role in the evolution of sociality and cooperation. Familiar individuals may gain a reputation for participating in, or defecting from, cooperative tasks. Previous research suggests that long-term familiarity with territorial neighbours benefits breeders. We tested the hypothesis that great tits (Parus major) are more likely to join in neighbours' nest defence if those neighbours are familiar from the previous year. We show that neighbours that shared a territory boundary the previous year are more likely to join their neighbours' nest defence than neighbours that did not share a boundary before. Closer neighbours did not differ from distant neighbours in their latency to join. For familiar neighbours that joined, there was no difference in call rate in relation to whether one or both members of the focal pair were familiar. First-time breeders (by definition unfamiliar) did not join each other's nest defence. This is the first evidence of a relationship between familiarity and joining in nest defence. Such direct benefits of familiarity may have important implications in the evolution of sociality.


    SciTech Connect

    Upadhyay, Piyush; Hovanski, Yuri; Jana, Saumyadeep; Fifield, Leonard S.


    Development of robust and cost effective method of joining dissimilar materials can provide a critical pathway to enable widespread use of multi-material design and components in mainstream industrial applications. The use of multi-material components such as Steel-Aluminum, Aluminum-Polymer allows design engineers to optimize material utilization based on service requirements and often lead weight and cost reductions. However producing an effective joint between materials with vastly different thermal, microstructural and deformation response is highly problematic using conventional joining and /or fastening methods. This is especially challenging in cost sensitive high volume markets that largely rely on low–cost joining solutions. Friction Stir Scribe technology was developed to meet the demands of joining materials with drastically different properties and melting regimes. The process enables joining of light metals like Magnesium and Aluminum to high temperature materials like Steels and Titanium. Additionally viable joints between polymer composites and metal can also be made using this method. This paper will present state of the art, progress made and challenges associated with this innovative derivative of Friction Stir welding in reference to joining dissimilar metals and polymer/metal combinations.

  14. Joining Dissimilar Materials Using Friction Stir Scribe Technique

    SciTech Connect

    Upadhyay, Piyush; Hovanski, Yuri; Jana, Saumyadeep; Fifield, Leonard S.


    Development of a robust and cost-effective method of joining dissimilar materials could provide a critical pathway to enable widespread use of multi-material designs and components in mainstream industrial applications. The use of multi-material components such as steel-aluminum and aluminum-polymer would allow design engineers to optimize material utilization based on service requirements and could often lead to weight and cost reductions. However, producing an effective joint between materials with vastly different thermal, microstructural, and deformation responses is highly problematic using conventional joining and/or fastening methods. This is especially challenging in cost sensitive, high volume markets that largely rely on low cost joining solutions. Friction stir scribe technology was developed to meet the demands of joining materials with drastically different properties and melting regimes. The process enables joining of light metals like magnesium and aluminum to high temperature materials like steel and titanium. Viable joints between polymer composites and metal can also be made using this method. This paper will present the state of the art, progress made, and challenges associated with this innovative derivative of friction stir welding in reference to joining dissimilar metals and polymer/metal combinations.

  15. Elemental composition of atmospheric PM10 and PM2.5 for a savanna (Cerrado) region of southern Amazonia

    NASA Astrophysics Data System (ADS)

    Vourlitis, G. L.; Santanna, F. B.; Almeida Filho, E. O.; Arruda, P. H. Z. D.; Nogueira, J. D. S.; Palácios, R.


    Ecosystems such as the Amazonian tropical forest and savanna (known locally as Cerrado) are undergoing sweeping changes, such as deforestation and burning to expand new areas of agriculture and farming. These activities generate an increase in the concentration of gases and particles emitted into the atmosphere, which can affect energy balance and biogeochemical cycles. To determine how human activities affected the emission of coarse and fine particulate matter (PM10 and PM2.5, respectively), atmospheric aerosol samples were collected continuously from June 2004 until April 2005 in the Cuiaba Basin of south-central Mato Grosso, Brazil, which contains a mixture of urban, agricultural, and native Cerrado land surface types. Aerosols were sampled using stacked filter units (SFU), which separate fine (d<2.5 μm) and coarse mode (2.5 μm2.5 and PM10, representing ca. 98% of all elements measured in the dry season and 94% in the wet season. The high enrichment factors observed in PM2.5 and PM10 suggest that anthropogenic activities were the dominant source for elements such as Cu, Zn and Pb. Factorial analysis allowed the identification of four main sources contributing to PM10 and PM2.5 composition, including biomass burning, soil dust, urban emissions and natural biogenic emissions. These data indicate that most of the aerosols measured in the Cuiaba Basin originate from land conversion and biomass burning, and to a lesser extent, urban activities. These patterns are similar to those observed from other Cerrado and Amazonian forest areas that are undergoing rapid and spatially extensive land-cover change.

  16. Regional Missile Defense: DOD’s 2014 Report Generally Addressed Required Reporting Elements, but Excluded Additional Key Details

    DTIC Science & Technology


    Page ii GAO-15-32 Regional Ballistic Missile Defense Abbreviations AN/ TPY -2 Army Navy...manage networked sensors. • Army Navy/Transportable Radar Surveillance and Control Model 2 (AN/ TPY -2) X-Band Radar: a sensor that tracks ballistic...MDA delivered an AN/ TPY -2 X-band radar, an Aegis BMD ship with SM-3 Block IA missiles, and an upgrade to C2BMC. As we reported in March 2014,12

  17. Laser-generated Macroscopic and Microscopic Surface Structures for the Joining of Aluminum and Thermoplastics using Friction Press Joining

    NASA Astrophysics Data System (ADS)

    Fuchs, Alexander N.; Wirth, Franz X.; Rinck, Philipp; Zaeh, Michael F.

    Structural lightweight construction is increasingly utilized in the aerospace and automotive industry. Hybrid structures have great potential, especially with regard to load-specific component layouts. Usually, a surface pre-treatment is applied prior to joining dissimilar materials to improve bonding mechanisms such as form closure. In previous studies pulsed wave (pw) lasers were used for structuring metals. This paper presents the results of aluminum pre-treatment via a continuous wave (cw) single-mode fiber laser: macroscopic and microscopic structures were generated on the aluminum surface; the samples were joined with glass fiber reinforced polyamide using Friction Press Joining (FPJ), a method for joining metals and thermoplastic polymers in lap joint configuration. Using these new methods for surface structuring, shear strength was increased by 40% compared to previous studies with pw lasers.

  18. Boeing technicians join Node 1 for ISS to PMA-1 in the SSPF

    NASA Technical Reports Server (NTRS)


    Boeing technicians join Node 1 for the International Space Station (ISS) with the Pressurized Mating Adapter (PMA)-1 in KSC's Space Station Processing Facility. This PMA, identifiable by its bright red ring, is a cone-shaped connector for the space station's structural building block, known as Node 1. Seen here surrounded by scaffolding, Node 1 will have two PMAs attached, the second of which is scheduled for mating to the node in January 1998. The node and PMAs, which will be the first element of the ISS, are scheduled to be launched aboard the Space Shuttle Endeavour on STS-88 in July 1998.

  19. Comparison of joining processes for Haynes 230 nickel based super alloy

    NASA Astrophysics Data System (ADS)

    Williston, David Hugh

    Haynes 230 is a nickel based, solid-solution strengthened alloy that is used for high-temperature applications in the aero-engine and power generation industries. The alloy composition is balanced to avoid precipitation of undesirable topologically closed-packed (TCP) intermetallic phases, such as Sigma, Mu, or Laves-type, that are detrimental to mechanical and corrosion properties. This material is currently being used for the NASA's J2X upper stage rocket nozzle extension. Current fabrication procedures use fusion welding processes to join blanks that are subsequently formed. Cracks have been noted to occur in the fusion welded region during the forming operations. Use of solid state joining processes, such as friction stir welding are being proposed to eliminate the fusion weld cracks. Of interest is a modified friction stir welding process called thermal stir welding. Three welding process: Gas Metal Arc Welding (GMAW), Electron Beam Welding (EBW), and Thermal Stir Welding (TSWing) are compared in this study.

  20. Physical Conditions of the Small Magellanic Cloud HII Region NGC 456 and the Underestimated Heavy Element Abundances of the Universe

    NASA Astrophysics Data System (ADS)

    Pena-Guerrero, Maria Angeles; Peimbert, A.


    We study the O/H abundance determinations in HII regions in the presence of temperature inhomogeneities (as proposed by Peimbert in 1967), t2. The first object of our study is NGC 456, which the second brightest HII region of the Small Magellanic Clouds (SMC); we find it has an abundance 1.75 times higher than previously determined. Traditionally it is assumed that these objects have the same temperature throughout the whole volume; this temperature is then used to calculate abundances. Our determination was done using Collisionally Excited Lines (CEL) and the t2 obtained from HeI lines; it is consistent with abundances determined with Recombination Lines (RL). The most well known strong-line ratio or metallicity indicator used to determine the O/H ratio is O23= ([OII]3727Å + [OIII]4959,5007Å) / Hβ introduced by Pagel et al. (1979). The log(O23) vs. 12+log(O/H) diagram constitutes an important tool in the study of objects with low intrinsecal brightness or high redshift. To account for the presence of thermal inhomogeneities, the upper branch of the O23-O/H diagram can be recalibrated using RLs whereas in the lower branch of the diagram RLs cannot be used due to their faintness. For low metallicity objects the formalism of t2 is applied to CELs to determine abundances and recalibrate the O23-O/H diagram. We find that the point corresponding to NGC 456 in the diagram shifts up by 0.24 dex in the 12+log(O/H) axis. This is consistent with preliminary results for the next 3 objects of our sample and with the behavior of other HII regions from the literature were t2 has been measured. The systematic shift in the curve of the O23-O/H diagram implies that abundances in the Universe need to be corrected by a factor of approximately 2.

  1. Transport of elemental mercury in the unsaturated zone from a waste disposal site in an arid region

    USGS Publications Warehouse

    Walvoord, M.A.; Andraski, B.J.; Krabbenhoft, D.P.; Striegl, R.G.


    Mercury contained in buried landfill waste may be released via upward emission to the atmosphere or downward leaching to groundwater. Data from the US Geological Survey's Amargosa Desert Research Site (ADRS) in arid southwestern Nevada reveal another potential pathway of Hg release: long-distance (102 m) lateral migration of elemental Hg (Hg0) through the unsaturated zone. Gas collected from multiple depths from two instrumented boreholes that sample the entire 110-m unsaturated zone thickness and are located 100 and 160 m away from the closest waste burial trench exhibit gaseous Hg concentrations of up to 33 and 11 ng m-3, respectively. The vertical distribution of gaseous Hg in the borehole closest to the disposal site shows distinct subsurface peaks in concentration at depths of 1.5 and 24 m that cannot be explained by radial diffusive transport through a heterogeneous layered unsaturated zone. The inability of current models to explain gaseous Hg distribution at the ADRS highlights the need to advance the understanding of gas-phase contaminant transport in unsaturated zones to attain a comprehensive model of landfill Hg release.

  2. Expression of Trypanosoma cruzi surface antigen FL-160 is controlled by elements in the 3' untranslated, the 3' intergenic, and the coding regions.


    Weston, D; La Flamme, A C; Van Voorhis, W C


    The FL-160 surface antigen gene family of T. cruzi consists of hundreds of members of 160 kDa glycoproteins expressed in trypomastigotes, but not in epimastigotes. Steady-state levels of FL-160 mRNA were 80 to 100-fold higher in trypomastigotes than in epimastigotes, yet transcription rates were equivalent between the lifecycle stages. Luciferase reporter constructs demonstrated that the 3' untranslated region (UTR) and intergenic region (IR) following the coding sequence of FL-160 was sufficient to generate 8-fold higher luciferase expression in trypomastigotes compared with epimastigotes. Transfection of 3' UTR/IR deletion constructs revealed cis-acting elements which conferred a trypomastigote-specific expression pattern similar to that of FL-160. Parasites treated with translation and transcription inhibitors, cyclohexamide and Actinomycin D, respectively, displayed a stage-specific pattern of FL-160 mRNA degradation. Epimastigotes, but not trypomastigotes, treated with the inhibitors accumulated a 1.4 Kb FL-160 cleavage product. The cleavage site mapped to a 31 base poly-purine tract in the FL-160 coding region. The first 526 aa of FL-160, containing the 31 base poly-purine tract and several smaller tracts, were fused to green fluorescent protein (GFP) and expressed from the T. cruzi tubulin locus. Stable transformants expressed 4-fold more FL-160:GFP fusion mRNA and 12-fold more fusion protein in the trypomastigote stage than in the epimastigote stage suggesting post-transcriptional and translational control elements. These data reveal at least two distinct control mechanisms for trypomastigote-specific expression of FL-160 surface glycoproteins, one involving the 3' UTR/IR and one involving the coding region of FL-160.

  3. A regional inventory of the landslide processes and the elements at risk on the Rift flanks west of Lake Kivu (DRC)

    NASA Astrophysics Data System (ADS)

    Maki Mateso, Jean-Claude; Monsieurs, Elise; Jacobs, Liesbet; Bagalwa Mateso, Luc; Fiama Bondo, Silvanos; Delvaux, Damien; Albino, Fabien; Kervyn, François; Dewitte, Olivier


    The Rift flanks west of Lake Kivu (DRC) are one of the Congolese regions most affected by fatal landslides. However, information on the distribution of these processes and their impact on society is still lacking. Here we present a first regional landslide inventory and the associated elements at risk. The inventory was conducted in an area of 5,700 km² in three administrative territories between the cities of Bukavu and Goma. The region is one of the most densely populated area of DRC with a density of up to 200 persons/km². The approach for the inventory relies on visual analysis of Google Earth imagery and a 5 m resolution DEM that we produced from TanDEM-X interferometry. Field validation was performed in target places accounting for 5% of the study area. More than 2,000 landslides were mapped and distinction was made between deep and shallow, and slide and flow processes. Average landslide area is 6 ha (max. = 430 ha). Geomorphological analysis of landslide distribution shows topographic, lithologic, climatic and seismic controls. For 600 randomly-selected landslides, elements at risk (house, road, cultivated land, river) were inventoried in the areas affected and potentially affected by the instabilities; 10% of the landslides are inhabited and 25% do not present any risk. Numerous landslides have caused direct and indirect damage in recent years. In some places, the impact of mining activities on slope stability can be important. Google Earth was the only way to locate the recent shallow failures triggered by known extreme rainfall events. This inventory is a first step towards the understanding of the landslide processes in the region. Further studies are needed to complete and validate the information, to better infer about the triggers, and to compute susceptibility and risk maps.

  4. Soil properties, strontium isotopic signatures and multi-element profiles to authenticate the origin of vegetables from small-scale regions: illustration with early potatoes from southern Italy.


    Zampella, Mariavittoria; Quétel, Christophe R; Paredes, Eduardo; Goitom Asfaha, Daniel; Vingiani, Simona; Adamo, Paola


    We propose a method for the authentication of the origin of vegetables grown under similar weather conditions, in sites less than 10 km distance from the sea and distributed over a rather small scale area (58651 km(2)). We studied how the strontium (Sr) isotopic signature and selected elemental concentrations ([Mn], [Cu], [Zn], [Rb], [Sr] and [Cd]) in early potatoes from three neighbouring administrative regions in the south of Italy were related to the geological substrate (alluvial sediments, volcanic substrates and carbonate rocks) and to selected soil chemical properties influencing the bioavailability of elements in soils (pH, cation exchange capacity and total carbonate content). Through multiple-step multivariate statistics (PLS-DA) we could assign 26 potatoes (including two already commercialised samples) to their respective eight sites of production, corresponding to the first two types of geological substrates. The other 12 potatoes from four sites of production had similar characteristics in terms of the geological substrate (third type) and these soil properties could be grouped together. In this case, more discriminative parameters would be required to allow the differentiation between sites. The validation of our models included external prediction tests with data of potatoes harvested the year before and a study on the robustness of the uncertainties of the measurement results. Annual variations between multi-elemental and Sr isotopic fingerprints were observed in potatoes harvested from soils overlying carbonate rocks, stressing the importance of testing long term variations in authentication studies.

  5. Isotope and trace element geochemistry of sediments from the Barbados Ridge-Demerara Plain region, Atlantic Ocean

    NASA Astrophysics Data System (ADS)

    White, William M.; Dupré, Bernard; Vidal, Philippe


    Twenty-four piston core sediment samples and 13 sediments and 3 basalts from DSDP Leg 78 Site 543 were analyzed for Sr, Nd and Pb isotopic compositions. The results show sediment with highly radiogenic Pb 206Pb /204Pb up to 19.8) and rather radiogenic Sr and unradiogenic Nd has been deposited in the region since the Cretaceous. The source of this sediment is probably the Archean Guiana Highland, which is drained by the Orinoco River. Pb and Sr isotopic compositions and sediment thickness decrease and 143Nd /144Nd increases northward due to a decrease in turbiditic component. This decrease is partly due to the damming action of basement ridges. Rare earth concentrations in the sediments are somewhat low, due to the abundance of detrital and biogenic components in the sediment and rapid sedimentation rates. Both positive and negative Ce anomalies occur in the surface sediments, but only positive Ce anomalies occur in the Site 543 sediments. It is unlikely that sediment subducted to the source region of Lesser Antilles arc magmas could be the cause of negative Ce anomalies in those magmas. Isotopic compositions of Site 543 basalts show some effect of contamination by seawater-basalt reaction products and sediments. Beyond this, however, they are typical of "normal" depleted MORB.

  6. Alternative end-joining mechanisms: a historical perspective

    PubMed Central

    Decottignies, Anabelle


    In the presence of functional DNA repair pathways, DNA double-strand breaks (DSBs) are mainly repaired by non-homologous end-joining (NHEJ) or homologous recombination (HR), two conserved pathways that protect cells from aberrant chromosomal rearrangements. During the past two decades however, unusual and presumably distinct DNA end-joining repair activities have been unraveled in NHEJ-deficient cells and these are likely to operate in various chromosomal contexts and species. Most alternative DNA end-joining events reported so far appear to involve microhomologous sequences and are likely to rely on a subset of HR enzymes, namely those responsible for the single-strand annealing mechanism of HR, and on DNA Ligase III. Usually, microhomologies are not initially present at DSB ends and thus need to be unmasked through DNA end resection, a process that can lead to extensive nucleotide loss and is therefore highly mutagenic. In addition to microhomology-mediated end-joining events, recent studies in mammalian cells point toward the existence of a distinct and still ill defined alternative end-joining pathway that does not appear to rely on pre-existing microhomologies and may possibly involve DNA Ligase I. Whether dependent on microhomologies or not, alternative DNA end-joining mechanisms are likely to be highly mutagenic in vivo, being able to drive telomere fusion events and cancer-associated chromosomal translocations in mouse models. In the future, it will be important to better characterize the genetic requirements of these mutagenic alternative mechanisms of DNA end-joining. PMID:23565119

  7. Spark plasma sintering and spark plasma joining of refractory ceramics

    NASA Astrophysics Data System (ADS)

    Hoefer, Jeffrey Andrew

    Consolidation of refractory ceramics such as boron carbide (B4C) and silicon carbide (SiC) by conventional sintering techniques (pressure-less sintering, hot pressing, hot isostatic pressing etc.) can prove challenging due to the high temperatures required for sintering. Typically sintering additives are used in order to decrease sintering temperature, but at the sacrifice of purity. Typically B4C requires sintering temperatures above 2000°C without the use of additives, while SiC is generally considered not sinterable without additives, and requires temperatures above 2000°C even with additives. Spark Plasma Sintering (SPS) has emerged as a technology that can reduce the sintering temperature considerably compared to more conventional techniques. The simultaneous application of pressure, heat, and current can reduce sintering temperatures without the use of sintering aids to 1600°C and 2000°C for boron carbide and silicon carbide respectively. One shortcoming of SPS, however, is the difficulty in producing complex shapes. Therefore, for carbide materials such as B4C and SiC, which are difficult to machine, the ability to produce complex shapes is worthy of investigation. One means of creating complex shapes is by joining simple shapes. Joining of monolithic ceramics, in particular SiC, has been achieved, however in all cases an intermediate joining material is used (Ti foil, Silica Powder etc.). Joining of materials using SPS, or as it is called, Spark Plasma Joining, can eliminate the need for an intermediate joining material, producing a high purity and high strength joint. This study investigates SPS of 3 different B4C Powders, as well as SPS joining of simple shape monolithic SiC. Sintering parameters such as temperature, pressure, time, and heating rate are all considered. Influence of sintering parameters on density, grain size, mechanical strength, and joint quality is investigated in detail.

  8. A novel coding-region RNA element modulates infectious dengue virus particle production in both mammalian and mosquito cells and regulates viral replication in Aedes aegypti mosquitoes

    PubMed Central

    Groat-Carmona, Anna Maria; Orozco, Susana; Friebe, Peter; Payne, Anne; Kramer, Laura; Harris, Eva


    Dengue virus (DENV) is an enveloped flavivirus with a positive-sense RNA genome transmitted by Aedes mosquitoes, causing the most important arthropod-borne viral disease affecting humans. Relatively few cis-acting RNA regulatory elements have been described in the DENV coding-region. Here, by introducing silent mutations into a DENV-2 infectious clone, we identify the conserved capsid-coding region 1 (CCR1), an RNA sequence element that regulates viral replication in mammalian cells and to a greater extent in Ae. albopictus mosquito cells. These defects were confirmed in vivo, resulting in decreased replication in Ae. aegypti mosquito bodies and dissemination to the salivary glands. Furthermore, CCR1 does not regulate translation, RNA synthesis or virion retention but likely modulates assembly, as mutations resulted in the release of non-infectious viral particles from both cell types. Understanding the role of CCR1 could help characterize the poorly-defined stage of assembly in the DENV life cycle and uncover novel anti-viral targets. PMID:22840606

  9. Novel Human Intervertebral Disc Strain Template to Quantify Regional Three-Dimensional Strains in a Population and Compare to Internal Strains Predicted by a Finite Element Model

    PubMed Central

    Showalter, Brent L.; DeLucca, John F.; Peloquin, John M.; Cortes, Daniel H.; Yoder, Jonathon H.; Jacobs, Nathan T.; Wright, Alexander C.; Gee, James C.; Vresilovic, Edward J.; Elliott, Dawn M.


    Tissue strain is an important indicator of mechanical function, but is difficult to noninvasively measure in the intervertebral disc. The objective of this study was to generate a disc strain template, a 3D average of disc strain, of a group of human L4–L5 discs loaded in axial compression. To do so, magnetic resonance images of uncompressed discs were used to create an average disc shape. Next, the strain tensors were calculated pixel-wise by using a previously developed registration algorithm. Individual disc strain tensor components were then transformed to the template space and averaged to create the disc strain template. The strain template reduced individual variability while highlighting group trends. For example, higher axial and circumferential strains were present in the lateral and posterolateral regions of the disc, which may lead to annular tears. This quantification of group-level trends in local 3D strain is a significant step forward in the study of disc biomechanics. These trends were compared to a finite element model that had been previously validated against the disc-level mechanical response. Depending on the strain component, 81–99% of the regions within the finite element model had calculated strains within one standard deviation of the template strain results. The template creation technique provides a new measurement technique useful for a wide range of studies, including more complex loading conditions, the effect of disc pathologies and degeneration, damage mechanisms, and design and evaluation of treatments. PMID:26694516

  10. Biomechanics of cervical tooth region and noncarious cervical lesions of different morphology; three-dimensional finite element analysis

    PubMed Central

    Jakupović, Selma; Anić, Ivica; Ajanović, Muhamed; Korać, Samra; Konjhodžić, Alma; Džanković, Aida; Vuković, Amra


    Objective: The present study aims to investigate the influence of presence and shape of cervical lesions on biomechanical behavior of mandibular first premolar, subjected to two types of occlusal loading using three-dimensional (3D) finite element method (FEM). Materials and Methods: 3D models of the mandibular premolar are created from a micro computed tomography X-ray image: model of sound mandibular premolar, model with the wedge-shaped cervical lesion (V lesion), and model with saucer-shaped cervical lesion (U lesion). By FEM, straining of the tooth tissues under functional and nonfunctional occlusal loading of 200 (N) is analyzed. For the analysis, the following software was used: CTAn program 1.10 and ANSYS Workbench (version 14.0). The results are presented in von Mises stress. Results: Values of calculated stress in all tooth structures are higher under nonfunctional occlusal loading, while the functional loading is resulted in homogeneous stress distribution. Nonfunctional load in the cervical area of sound tooth model as well as in the sub-superficial layer of the enamel resulted with a significant stress (over 50 [MPa]). The highest stress concentration on models with lesions is noticed on the apex of the V-shaped lesion, while stress in saucer U lesion is significantly lower and distributed over wider area. Conclusion: The type of the occlusal teeth loading has the biggest influence on cervical stress intensity. Geometric shape of the existing lesion is very important in the distribution of internal stress. Compared to the U-shaped lesions, V-shaped lesions show significantly higher stress concentrations under load. Exposure to stress would lead to its progression. PMID:27403064

  11. Full-length L1 elements have arisen recently in the same 1-kb region of the gorilla and human genomes.


    DeBerardinis, R J; Kazazian, H H


    New copies of the mammalian retrotransposon L1 arise in the germline at an undetermined rate. Each new L1 copy appears at a specific evolutionary time point that can be estimated by phylogenetic analysis. In humans, the active L1 sequence L1.2 resides at the genomic locus LRE1. Here we analyzed the region surrounding the LRE1 locus in humans and gorillas to determine the evolutionary history of the region and to estimate the age of L1.2. We found that the region was composed of an ancient L1, L1Hs-Lrg, which was significantly divergent from all other L1 sequences available in the databases. We also determined that L1.2 was absent from the gorilla genome and arose in humans after the divergence of gorilla and human lineages. In the gorilla LRE1 region, we discovered a different full-length L1 element, L1Gg-1, which was allelic and present at a high gene frequency in gorillas but absent from other primates. We determined the nucleotide sequence of L1Gg-1 and found that it was 98% identical to L1.2, suggesting a close relationship between active L1s in gorillas and humans.

  12. Using the P[wHy] hybrid transposable element to disrupt genes in region 54D-55B in Drosophila melanogaster.

    PubMed Central

    Mohr, Stephanie E; Gelbart, William M


    Understanding the function of each gene in the genome of a model organism such as Drosophila melanogaster is an important goal. The development of improved methods for uncovering the mutant phenotypes of specific genes can accelerate achievement of this goal. The P[wHy] hybrid transposable element can be used to generate nested sets of precisely mapped deletions in a given region of the Drosophila genome. Here we use the P[wHy] method to generate overlapping, molecularly defined deletions from a set of three P[wHy] insertions in the 54E-F region of chromosome 2. Deletions that span a total of 0.5 Mb were identified and molecularly mapped precisely. Using overlapping deletions, the mutant phenotypes of nine previously uncharacterized genes in a 101-kb region were determined, including identification of new loci required for viability and female fertility. In addition, the deletions were used to molecularly map previously isolated lethal mutations. Thus, the P[wHy] method provides an efficient method for systematically determining the phenotypes of genes in a given region of the fly genome. PMID:12242231

  13. Population-based dietary intakes and tap water concentrations for selected elements in the EPA region V National Human Exposure Assessment Survey (NHEXAS).


    Thomas, K W; Pellizzari, E D; Berry, M R


    A National Human Exposure Assessment Survey (NHEXAS) field study was performed in U.S. Environmental Protection Agency (EPA) Region V, providing population-based exposure distribution data for selected elements in several personal, environmental, and biological media. Population distributions are reported for the 11 elements that were measured in water and dietary samples. Dietary intakes and home tap water concentrations of lead, arsenic, and cadmium were further examined for intermedia associations, for differences between dietary exposure for adults and children, and to estimate the proportion of the population above health-based reference values (dietary) or regulatory action levels or maximum contaminant levels (water). Water lead and arsenic concentrations were significantly associated with dietary intake. Intake of all elements was higher from solid foods than from liquid foods (including drinking water). Dietary intakes of Pb, As, and Cd were greater than those calculated for intake from home tap water or inhalation on a microg/day basis. Median dietary intakes for the Region V population for Pb, As, and Cd were 0.10, 0.13, and 0.19 microg/kg bw/day, respectively. While Pb, As, and Cd concentrations in the foods consumed by 0 to 6-year-old children were similar to or lower than those for adults, dietary intakes calculated on a body weight basis were 1.5 to 2.5 times higher for young children. Intrapersonal intake differences accounted for most of the variance in short-term (daily) dietary intakes for Pb and As, while interpersonal differences accounted for more of the intake variance for Cd. Only small percentages of the population exceeded health-based intake reference values or concentrations equal to regulatory levels in water for Pb, As, and Cd.

  14. Population substructure of North Atlantic minke whales ( Balaenoptera acutorostrata) inferred from regional variation of elemental and stable isotopic signatures in tissues

    NASA Astrophysics Data System (ADS)

    Born, E. W.; Outridge, P.; Riget, F. F.; Hobson, K. A.; Dietz, R.; Øien, N.; Haug, T.


    Information on population structure is essential for estimating population demographics and managing the impacts of exploitation of North Atlantic minke whales ( Balaenoptera acutorostrata). New approaches including assessment of geochemical signatures in tissues can assist in defining such structure. This study determined regional variations in long-term elemental diagnostics of stock differences among 159 minke whales harvested in West Greenland, the Northeast Atlantic Ocean and the North Sea in 1998. The diagnostics tested included mercury (Hg), selenium (Se) and cadmium (Cd) in various tissues, and the trace and major element composition of baleen. Supporting data was also gathered on δ15N and δ13C and stable lead isotope ratios. For female whales, significant differences in at least one long-term diagnostic element occurred between several areas. Existence of the following population substructure was inferred: (a) West Greenland, (b) a central group represented by whales from Jan Mayen, (c) a northeastern stock encompassing the Barents Sea, Svalbard and coastal Norway, and (d) the North Sea. These groups were consistent with those defined genetically by Andersen et al. [Mar. Ecol., Prog. Ser. 247 (2003) 263]. Males appeared to fall into similar groupings to females but because of smaller sample sizes fewer significant differences occurred between areas. Stable-isotopic values in minke whales suggested lower trophic-level feeding in this species than hitherto suspected, with significant dietary differences between areas. Variations in feeding habits appeared to explain part of the geographical variation in tissue Cd, but not tissue Hg or Se. Differences among elements with a relatively long biological half-life in specific tissues suggested that groups of minke whales have fidelity to certain summer feeding areas at least for several years.

  15. Accurate solution of multi-region continuum biomolecule electrostatic problems using the linearized Poisson-Boltzmann equation with curved boundary elements.


    Altman, Michael D; Bardhan, Jaydeep P; White, Jacob K; Tidor, Bruce


    We present a boundary-element method (BEM) implementation for accurately solving problems in biomolecular electrostatics using the linearized Poisson-Boltzmann equation. Motivating this implementation is the desire to create a solver capable of precisely describing the geometries and topologies prevalent in continuum models of biological molecules. This implementation is enabled by the synthesis of four technologies developed or implemented specifically for this work. First, molecular and accessible surfaces used to describe dielectric and ion-exclusion boundaries were discretized with curved boundary elements that faithfully reproduce molecular geometries. Second, we avoided explicitly forming the dense BEM matrices and instead solved the linear systems with a preconditioned iterative method (GMRES), using a matrix compression algorithm (FFTSVD) to accelerate matrix-vector multiplication. Third, robust numerical integration methods were employed to accurately evaluate singular and near-singular integrals over the curved boundary elements. Fourth, we present a general boundary-integral approach capable of modeling an arbitrary number of embedded homogeneous dielectric regions with differing dielectric constants, possible salt treatment, and point charges. A comparison of the presented BEM implementation and standard finite-difference techniques demonstrates that for certain classes of electrostatic calculations, such as determining absolute electrostatic solvation and rigid-binding free energies, the improved convergence properties of the BEM approach can have a significant impact on computed energetics. We also demonstrate that the improved accuracy offered by the curved-element BEM is important when more sophisticated techniques, such as nonrigid-binding models, are used to compute the relative electrostatic effects of molecular modifications. In addition, we show that electrostatic calculations requiring multiple solves using the same molecular geometry, such as

  16. Delayed secondary glucocorticoid response elements. Unusual nucleotide motifs specify glucocorticoid receptor binding to transcribed regions of alpha 2u-globulin DNA.


    Chan, G C; Hess, P; Meenakshi, T; Carlstedt-Duke, J; Gustafsson, J A; Payvar, F


    Glucocorticoids stimulate the transcription of rat alpha 2u-globulin (RUG) genes. Because this induction occurs after a time lag of several hours and is blocked by inhibitors of protein synthesis, it exemplifies a delayed secondary response to steroid hormones. In this report, we show that a region of RUG-transcribed DNA (approximately +1800 to +2174) contains multiple footprint sites for glucocorticoid receptor that are, apparently, organized into at least three independent binding clusters. The DNA sequences bound by the receptor and the location of binding sites were determined. A family of sequences related to half-sites of the consensus primary glucocorticoid response element (GRE) is discernible at each cluster of sites. Compared to the consensus GRE, which contains two pseudo-palindromic hexanucleotides arranged in a tail-to-tail fashion and separated by three bases, the arrangements of hexanucleotides within this segment of RUG DNA are unusual and heterogeneous. Methylation interference of a binding cluster containing three receptor footprints demonstrates that certain guanines of the GRE-like hexanucleotides are essential for efficient receptor binding. A synthetic 29-base pair (bp) RUG element, containing one receptor footprint from this cluster, selectively binds the receptor. Within this 29-bp element, six nucleotides separate two directly repeated copies of GRE-like hexanucleotides. RUG DNA fragments containing all or part of the three binding clusters, including the 29-bp element, confer a delayed secondary hormone responsiveness upon a linked heterologous promoter and reporter gene in stably transfected cell lines. We speculate that the unusual DNA sequence motifs of the receptor-binding sites are crucial for the generation of certain delayed secondary responses.

  17. Three-Dimensional Finite Element Analysis of the Biomechanical Behaviors of Implants with Different Connections, Lengths, and Diameters Placed in the Maxillary Anterior Region.


    Borie, Eduardo; Orsi, Iara Augusta; Noritomi, Pedro Yoshito; Kemmoku, Daniel Takanori


    To evaluate the biomechanical behaviors of multiple implant-supported prostheses with different implant lengths, connections, locations, and restoration materials in the maxillary anterior region using three-dimensional finite