Antibody-Mediated Small Molecule Detection Using Programmable DNA-Switches.

PubMed

Rossetti, Marianna; Ippodrino, Rudy; Marini, Bruna; Palleschi, Giuseppe; Porchetta, Alessandro

2018-06-13

The development of rapid, cost-effective, and single-step methods for the detection of small molecules is crucial for improving the quality and efficiency of many applications ranging from life science to environmental analysis. Unfortunately, current methodologies still require multiple complex, time-consuming washing and incubation steps, which limit their applicability. In this work we present a competitive DNA-based platform that makes use of both programmable DNA-switches and antibodies to detect small target molecules. The strategy exploits both the advantages of proximity-based methods and structure-switching DNA-probes. The platform is modular and versatile and it can potentially be applied for the detection of any small target molecule that can be conjugated to a nucleic acid sequence. Here the rational design of programmable DNA-switches is discussed, and the sensitive, rapid, and single-step detection of different environmentally relevant small target molecules is demonstrated.

Single DNA molecule detection using nanopipettes and nanoparticles.

PubMed

Karhanek, Miloslav; Kemp, Jennifer T; Pourmand, Nader; Davis, Ronald W; Webb, Chris D

2005-02-01

Single DNA molecules labeled with nanoparticles can be detected by blockades of ionic current as they are translocated through a nanopipette tip formed by a pulled glass capillary. The nanopipette detection technique can provide not only tools for detection and identification of single DNA and protein molecules but also deeper insight and understanding of stochastic interactions of various biomolecules with their environment.

Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

PubMed

Gahlon, Hailey L; Romano, Louis J; Rueda, David

2017-11-20

Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy.

PubMed

Hengel, Sarah R; Spies, M Ashley; Spies, Maria

2017-09-21

To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

DNA molecules on periodically microstructured lipid membranes: Localization and coil stretching

NASA Astrophysics Data System (ADS)

Hochrein, Marion B.; Leierseder, Judith A.; Golubović, Leonardo; Rädler, Joachim O.

2007-02-01

We explore large scale conformations of DNA molecules adsorbed on curved surfaces. For that purpose, we investigate the behavior of DNA adsorbed on periodically shaped cationic lipid membranes. These unique membrane morphologies are supported on grooved, one-dimensionally periodic microstructured surfaces. Strikingly, we find that these periodically structured membranes are capable to stretch DNA coils. We elucidate this phenomenon in terms of surface curvature dependent potential energy attained by the adsorbed DNA molecules. Due to it, DNA molecules undergo a localization transition causing them to stretch by binding to highly curved sections (edges) of the supported membranes. This effect provides a new venue for controlling conformations of semiflexible polymers such as DNA by employing their interactions with specially designed biocompatible surfaces. We report the first experimental observation of semiflexible polymers unbinding transition in which DNA molecules unbind from one-dimensional manifolds (edges) while remaining bound to two-dimensional manifolds (cationic membranes).

Single-Molecule Interactions of a Monoclonal Anti-DNA Antibody with DNA

PubMed Central

Nevzorova, Tatiana A.; Zhao, Qingze; Lomakin, Yakov A.; Ponomareva, Anastasia A.; Mukhitov, Alexander R.; Purohit, Prashant K.; Weisel, John W.; Litvinov, Rustem I.

2017-01-01

Interactions of DNA with proteins are essential for key biological processes and have both a fundamental and practical significance. In particular, DNA binding to anti-DNA antibodies is a pathogenic mechanism in autoimmune pathology, such as systemic lupus erythematosus. Here we measured at the single-molecule level binding and forced unbinding of surface-attached DNA and a monoclonal anti-DNA antibody MRL4 from a lupus erythematosus mouse. In optical trap-based force spectroscopy, a microscopic antibodycoated latex bead is trapped by a focused laser beam and repeatedly brought into contact with a DNA-coated surface. After careful discrimination of non-specific interactions, we showed that the DNA-antibody rupture force spectra had two regimes, reflecting formation of weaker (20–40 pN) and stronger (>40 pN) immune complexes that implies the existence of at least two bound states with different mechanical stability. The two-dimensional force-free off-rate for the DNA-antibody complexes was ~2.2 × 10−3 s−1, the transition state distance was ~0.94 nm, the apparent on-rate was ~5.26 s−1, and the stiffness of the DNA-antibody complex was characterized by a spring constant of 0.0021 pN/nm, suggesting that the DNA-antibody complex is a relatively stable, but soft and deformable macromolecular structure. The stretching elasticity of the DNA molecules was characteristic of single-stranded DNA, suggesting preferential binding of the MRL4 antibody to one strand of DNA. Collectively, the results provide fundamental characteristics of formation and forced dissociation of DNA-antibody complexes that help to understand principles of DNA-protein interactions and shed light on the molecular basis of autoimmune diseases accompanied by formation of anti-DNA antibodies. PMID:29104846

DNA origami as biocompatible surface to match single-molecule and ensemble experiments

PubMed Central

Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

2012-01-01

Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

SINGLE STRAND-CONTAINING REPLICATING MOLECULES OF CIRCULAR MITOCHONDRIAL DNA

PubMed Central

Wolstenholme, David R.; Koike, Katsuro; Cochran-Fouts, Patricia

1973-01-01

Mitochondrial DNAs (mtDNAs) from Chang rat solid hepatomas and Novikoff rat ascites hepatomas were examined in the electron microscope after preparation by the aqueous and by the formamide protein monolayer techniques. MtDNAs from both tumors were found to include double-forked circular molecules with a form and size suggesting they were replicative intermediates. These molecules were of two classes. In molecules of one class, all three segments were apparently totally double stranded. Molecules of the second class were distinguished by the fact that one of the segments spanning the region between the forks in which replication had occurred (the daughter segments) was either totally single stranded, or contained a single-stranded region associated with one of the forks. Daughter segments of both totally double-stranded and single strand-containing replicating molecules varied in length from about 3 to about 80% of the circular contour length of the molecule. Similar classes of replicating molecules were found in mtDNA from regenerating rat liver and chick embryos, indicating them to be normal intermediates in the replication of mtDNA All of the mtDNAs examined included partially single-stranded simple (nonforked) circular molecules. A possible scheme for the replication of mtDNA is presented, based on the different molecular forms observed PMID:4345165

Developing DNA nanotechnology using single-molecule fluorescence.

PubMed

Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal

2014-06-17

CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and

Single Molecule Visualization of Protein-DNA Complexes: Watching Machines at Work

NASA Astrophysics Data System (ADS)

Kowalczykowski, Stephen

2013-03-01

We can now watch individual proteins acting on single molecules of DNA. Such imaging provides unprecedented interrogation of fundamental biophysical processes. Visualization is achieved through the application of two complementary procedures. In one, single DNA molecules are attached to a polystyrene bead and are then captured by an optical trap. The DNA, a worm-like coil, is extended either by the force of solution flow in a micro-fabricated channel, or by capturing the opposite DNA end in a second optical trap. In the second procedure, DNA is attached by one end to a glass surface. The coiled DNA is elongated either by continuous solution flow or by subsequently tethering the opposite end to the surface. Protein action is visualized by fluorescent reporters: fluorescent dyes that bind double-stranded DNA (dsDNA), fluorescent biosensors for single-stranded DNA (ssDNA), or fluorescently-tagged proteins. Individual molecules are imaged using either epifluorescence microscopy or total internal reflection fluorescence (TIRF) microscopy. Using these approaches, we imaged the search for DNA sequence homology conducted by the RecA-ssDNA filament. The manner by which RecA protein finds a single homologous sequence in the genome had remained undefined for almost 30 years. Single-molecule imaging revealed that the search occurs through a mechanism termed ``intersegmental contact sampling,'' in which the randomly coiled structure of DNA is essential for reiterative sampling of DNA sequence identity: an example of parallel processing. In addition, the assembly of RecA filaments on single molecules of single-stranded DNA was visualized. Filament assembly requires nucleation of a protein dimer on DNA, and subsequent growth occurs via monomer addition. Furthermore, we discovered a class of proteins that catalyzed both nucleation and growth of filaments, revealing how the cell controls assembly of this protein-DNA complex.

Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.

PubMed

Yadav, Hemendra; Sharma, Pulkit

2017-11-01

Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.

Observation of DNA Molecules Using Fluorescence Microscopy and Atomic Force Microscopy

ERIC Educational Resources Information Center

Ito, Takashi

2008-01-01

This article describes experiments for an undergraduate instrumental analysis laboratory that aim to observe individual double-stranded DNA (dsDNA) molecules using fluorescence microscopy and atomic force microscopy (AFM). dsDNA molecules are observed under several different conditions to discuss their chemical and physical properties. In…

How to read and write mechanical information in DNA molecules

NASA Astrophysics Data System (ADS)

Schiessel, Helmut

In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.

DNA curtains for high-throughput single-molecule optical imaging.

PubMed

Greene, Eric C; Wind, Shalom; Fazio, Teresa; Gorman, Jason; Visnapuu, Mari-Liis

2010-01-01

Single-molecule approaches provide a valuable tool in the arsenal of the modern biologist, and new discoveries continue to be made possible through the use of these state-of-the-art technologies. However, it can be inherently difficult to obtain statistically relevant data from experimental approaches specifically designed to probe individual reactions. This problem is compounded with more complex biochemical reactions, heterogeneous systems, and/or reactions requiring the use of long DNA substrates. Here we give an overview of a technology developed in our laboratory, which relies upon simple micro- or nanofabricated structures in combination with "bio-friendly" lipid bilayers, to align thousands of long DNA molecules into defined patterns on the surface of a microfluidic sample chamber. We call these "DNA curtains," and we have developed several different versions varying in complexity and DNA substrate configuration, which are designed to meet different experimental needs. This novel approach to single-molecule imaging provides a powerful experimental platform that offers the potential for concurrent observation of hundreds or even thousands of protein-DNA interactions in real time. Copyright 2010 Elsevier Inc. All rights reserved.

Single-Molecule Denaturation Mapping of Genomic DNA in Nanofluidic Channels

NASA Astrophysics Data System (ADS)

Reisner, Walter; Larsen, Niels; Kristensen, Anders; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik

2009-03-01

We have developed a new DNA barcoding technique based on the partial denaturation of extended fluorescently labeled DNA molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions and can be explained by calculations of sequence-dependent melting probability. We believe this melting mapping technology is the first optically based single molecule technique sensitive to genome wide sequence variation that does not require an additional enzymatic labeling or restriction scheme.

Model of DNA topology simplification has come full (supercoiled) circle after two decades of research. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

NASA Astrophysics Data System (ADS)

Stasiak, Andrzej

2016-09-01

Being a geek of DNA topology, I remember very well the stir caused by 1997 Science paper showing that DNA topoisomerases have the ability to simplify DNA topology below the topological equilibrium values [1]. In their seminal experiments Rybenkov et al. [1] started with linear double-stranded DNA molecules with cohesive ends. The mutual cohesiveness of DNA ends was due to mutual complementarity of single-stranded extensions at both ends of linear double-stranded DNA molecules. When such DNA molecules were heated up and then slowly cooled down the single-stranded ends eventually annealed with each other causing DNA circularization. This experimental protocol permitted the authors to establish topological/thermodynamic equilibrium within samples of circularized DNA molecules. Among simple unknotted circles one also observed knotted and catenated DNA molecules. The fraction of knotted molecules in DNA samples at topological equilibrium was increasing with the length of DNA molecules undergoing slow circularization. The fraction of catenated molecules was increasing with the length and the concentration of the molecules undergoing slow circularization. Rybenkov et al. incubated then such equilibrated DNA samples with type II DNA topoisomerases, which pass DNA duplex regions through each other, and observed that as the result of it the fraction of knotted and catenated DNA molecules was dramatically decreased (up to 80-fold). This elegant experiment indicated for the first time that type II DNA topoisomerases acting on knotted or catenated DNA molecules have the ability to select among many potential sites of DNA-DNA passages these that result in DNA unknotting or decatenation. Without such a selection topoisomerases could only maintain the original topological equilibrium obtained during the slow cyclization. The big question was how DNA topoisomerases can be directed to do DNA-DNA passages that preferentially result in DNA unknotting and decatenation.

Single-Molecule Denaturation Mapping of DNA in Nanofluidic Channels

NASA Astrophysics Data System (ADS)

Reisner, Walter; Larsen, Niels; Silahtaroglu, Asli; Kristensen, Anders; Tommerup, Niels; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik

2010-03-01

Nanochannel based DNA stretching can serve as a platform for a new optical mapping technique based on measuring the pattern of partial melting along the extended molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions along the molecule and can be explained by calculations of sequence-dependent melting probability. Specifically, we obtain experimental melting profiles for T4, T7, lambda-phage and bacterial artificial chromosome DNA (from human chromosome 12) and compare these profiles to theory. In addition, we demonstrate that the BAC melting profile can be used to align the BAC to its correct position on chromosome 12.

The study of electrical conductivity of DNA molecules by scanning tunneling spectroscopy

NASA Astrophysics Data System (ADS)

Sharipov, T. I.; Bakhtizin, R. Z.

2017-10-01

An interest to the processes of charge transport in DNA molecules is very high, due to perspective of their using in nanoelectronics. The original sample preparation for studying electrical conductivity of DNA molecules by scanning tunneling spectroscopy has been proposed and tested. The DNA molecules immobilized on gold surface have been imaged clearly and their current-voltage curves have been measured.

Topological events in single molecules of E. coli DNA confined in nanochannels

PubMed Central

Reifenberger, Jeffrey G.; Dorfman, Kevin D.; Cao, Han

2015-01-01

We present experimental data concerning potential topological events such as folds, internal backfolds, and/or knots within long molecules of double-stranded DNA when they are stretched by confinement in a nanochannel. Genomic DNA from E. coli was labeled near the ‘GCTCTTC’ sequence with a fluorescently labeled dUTP analog and stained with the DNA intercalator YOYO. Individual long molecules of DNA were then linearized and imaged using methods based on the NanoChannel Array technology (Irys® System) available from BioNano Genomics. Data were collected on 189,153 molecules of length greater than 50 kilobases. A custom code was developed to search for abnormal intensity spikes in the YOYO backbone profile along the length of individual molecules. By correlating the YOYO intensity spikes with the aligned barcode pattern to the reference, we were able to correlate the bright intensity regions of YOYO with abnormal stretching in the molecule, which suggests these events were either a knot or a region of internal backfolding within the DNA. We interpret the results of our experiments involving molecules exceeding 50 kilobases in the context of existing simulation data for relatively short DNA, typically several kilobases. The frequency of these events is lower than the predictions from simulations, while the size of the events is larger than simulation predictions and often exceeds the molecular weight of the simulated molecules. We also identified DNA molecules that exhibit large, single folds as they enter the nanochannels. Overall, topological events occur at a low frequency (~7% of all molecules) and pose an easily surmountable obstacle for the practice of genome mapping in nanochannels. PMID:25991508

Theoretical electrical conductivity of hydrogen-bonded benzamide-derived molecules and single DNA bases.

PubMed

Chen, Xiang

2013-09-01

A benzamide molecule is used as a "reader" molecule to form hydrogen bonds with five single DNA bases, i.e., four normal single DNA bases A,T,C,G and one for 5methylC. The whole molecule is then attached to the gold surface so that a meta-molecule junction is formed. We calculate the transmission function and conductance for the five metal-molecule systems, with the implementation of density functional theory-based non-equilibrium Green function method. Our results show that each DNA base exhibits a unique conductance and most of them are on the pS level. The distinguishable conductance of each DNA base provides a way for the fast sequencing of DNA. We also investigate the dependence of conductivity of such a metal-molecule system on the hydrogen bond length between the "reader" molecule and DNA base, which shows that conductance follows an exponential decay as the hydrogen bond length increases, i.e., the conductivity is highly sensitive to the change in hydrogen bond length.

Drug-DNA interactions at single molecule level: A view with optical tweezers

NASA Astrophysics Data System (ADS)

Paramanathan, Thayaparan

Studies of small molecule--DNA interactions are essential for developing new drugs for challenging diseases like cancer and HIV. The main idea behind developing these molecules is to target and inhibit the reproduction of the tumor cells and infected cells. We mechanically manipulate single DNA molecule using optical tweezers to investigate two molecules that have complex and multiple binding modes. Mononuclear ruthenium complexes have been extensively studied as a test for rational drug design. Potential drug candidates should have high affinity to DNA and slow dissociation kinetics. To achieve this, motifs of the ruthenium complexes are altered. Our collaborators designed a dumb-bell shaped binuclear ruthenium complex that can only intercalate DNA by threading through its bases. Studying the binding properties of this complex in bulk studies took hours. By mechanically manipulating a single DNA molecule held with optical tweezers, we lower the barrier to thread and make it fast compared to the bulk experiments. Stretching single DNA molecules with different concentration of drug molecules and holding it at a constant force allows the binding to reach equilibrium. By this we can obtain the equilibrium fractional ligand binding and length of DNA at saturated binding. Fitting these results yields quantitative measurements of the binding thermodynamics and kinetics of this complex process. The second complex discussed in this study is Actinomycin D (ActD), a well studied anti-cancer agent that is used as a prototype for developing new generations of drugs. However, the biophysical basis of its activity is still unclear. Because ActD is known to intercalate double stranded DNA (dsDNA), it was assumed to block replication by stabilizing dsDNA in front of the replication fork. However, recent studies have shown that ActD binds with even higher affinity to imperfect duplexes and some sequences of single stranded DNA (ssDNA). We directly measure the on and off rates by

Winding single-molecule double-stranded DNA on a nanometer-sized reel

PubMed Central

You, Huijuan; Iino, Ryota; Watanabe, Rikiya; Noji, Hiroyuki

2012-01-01

A molecular system of a nanometer-sized reel was developed from F1–ATPase, a rotary motor protein. By combination with magnetic tweezers and optical tweezers, single-molecule double-stranded DNA (dsDNA) was wound around the molecular reel. The bending stiffness of dsDNA was determined from the winding tension (0.9–6.0 pN) and the diameter of the wound loop (21.4–8.5 nm). Our results were in good agreement with the conventional worm-like chain model and a persistence length of 54 ± 9 nm was estimated. This molecular reel system offers a new platform for single-molecule study of micromechanics of sharply bent DNA molecules and is expected to be applicable to the elucidation of the molecular mechanism of DNA-associating proteins on sharply bent DNA strands. PMID:22772992

Direct observation of λ-DNA molecule reversal movement within microfluidic channels under electric field with single molecule imaging technique

NASA Astrophysics Data System (ADS)

Fengyun, Yang; Kaige, Wang; Dan, Sun; Wei, Zhao; Hai-qing, Wang; Xin, He; Gui-ren, Wang; Jin-tao, Bai

2016-07-01

The electrodynamic characteristics of single DNA molecules moving within micro-/nano-fluidic channels are important in the design of biomedical chips and bimolecular sensors. In this study, the dynamic properties of λ-DNA molecules transferring along the microchannels driven by the external electrickinetic force were systemically investigated with the single molecule fluorescence imaging technique. The experimental results indicated that the velocity of DNA molecules was strictly dependent on the value of the applied electric field and the diameter of the channel. The larger the external electric field, the larger the velocity, and the more significant deformation of DNA molecules. More meaningfully, it was found that the moving directions of DNA molecules had two completely different directions: (i) along the direction of the external electric field, when the electric field intensity was smaller than a certain threshold value; (ii) opposite to the direction of the external electric field, when the electric field intensity was greater than the threshold electric field intensity. The reversal movement of DNA molecules was mainly determined by the competition between the electrophoresis force and the influence of electro-osmosis flow. These new findings will theoretically guide the practical application of fluidic channel sensors and lab-on-chips for precisely manipulating single DNA molecules. Project supported by the National Natural Science Foundation of China (Grant No. 61378083), the International Cooperation Foundation of the National Science and Technology Major Project of the Ministry of Science and Technology of China (Grant No. 2011DFA12220), the Major Research Plan of National Natural Science Foundation of China (Grant No. 91123030), and the Natural Science Foundation of Shaanxi Province of China (Grant Nos. 2010JS110 and 2013SZS03-Z01).

Single-molecule analysis of DNA uncoiling by a type II topoisomerase

NASA Astrophysics Data System (ADS)

Strick, Terence R.; Croquette, Vincent; Bensimon, David

2000-04-01

Type II DNA topoisomerases are ubiquitous ATP-dependent enzymes capable of transporting a DNA through a transient double-strand break in a second DNA segment. This enables them to untangle DNA and relax the interwound supercoils (plectonemes) that arise in twisted DNA. In vivo, they are responsible for untangling replicated chromosomes and their absence at mitosis or meiosis ultimately causes cell death. Here we describe a micromanipulation experiment in which we follow in real time a single Drosophila melanogaster topoisomerase II acting on a linear DNA molecule which is mechanically stretched and supercoiled. By monitoring the DNA's extension in the presence of ATP, we directly observe the relaxation of two supercoils during a single catalytic turnover. By controlling the force pulling on the molecule, we determine the variation of the reaction rate with the applied stress. Finally, in the absence of ATP, we observe the clamping of a DNA crossover by a single topoisomerase on at least two different timescales (configurations). These results show that single molecule experiments are a powerful new tool for the study of topoisomerases.

Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

PubMed

Park, Suehyun; Joo, Heesun; Kim, Jun Soo

2018-01-31

Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

NASA Astrophysics Data System (ADS)

Buyukdagli, Sahin

2017-02-01

We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test-charge theory [S. Buyukdagli et al., Phys. Rev. E 94, 042502 (2016), 10.1103/PhysRevE.94.042502] to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the experimental phase diagrams for polymer solutions. First, the addition of polyvalent cations to the electrolyte solution results in the attraction of the negatively charged polymer by the DNA molecule. The glue of the like-charge attraction is the enhanced shielding of the polymer charges by the dense counterion layer at the DNA surface. Second, through the shielding of the DNA-induced electrostatic potential, mono- and polyvalent cations of large concentration both suppress the like-charge attraction. Within the same formalism, we also predict a new opposite-charge repulsion effect between the DNA molecule and a positively charged polymer. In the presence of polyvalent anions such as sulfate or phosphate, their repulsion by the DNA charges leads to the charge screening deficiency of the region around the DNA molecule. This translates into a repulsive force that results in the decomplexation of the polymer from DNA. This opposite-charge repulsion phenomenon can be verified by current experiments and the underlying mechanism can be beneficial to gene therapeutic applications where the control over polymer-DNA interactions is the key factor.

Nanofabricated Racks of Aligned and Anchored DNA Substrates for Single-Molecule Imaging

PubMed Central

2009-01-01

Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This “double-tethered” DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein−DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA. PMID:19736980

Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.

PubMed

Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C

2010-01-19

Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.

Single molecule fluorescence burst detection of DNA fragments separated by capillary electrophoresis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haab, B.B.; Mathies, R.A.

A method has been developed for detecting DNA separated by capillary gel electrophoresis (CGE) using single molecule photon burst counting. A confocal fluorescence microscope was used to observe the fluorescence bursts from single molecules of DNA multiply labeled with the thiazole orange derivative TO6 as they passed through the nearly 2-{mu}m diameter focused laser beam. Amplified photo-electron pulses from the photomultiplier are grouped into bins of 360-450 {mu}s in duration, and the resulting histogram is stored in a computer for analysis. Solutions of M13 DNA were first flowed through the capillary at various concentrations, and the resulting data were usedmore » to optimize the parameters for digital filtering using a low-pass Fourier filter, selecting a discriminator level for peak detection, and applying a peak-calling algorithm. The optimized single molecule counting method was then applied to an electrophoretic separation of M13 DNA and to a separation of pBR 322 DNA from pRL 277 DNA. Clusters of discreet fluorescence bursts were observed at the expected appearance time of each DNA band. The auto-correlation function of these data indicated transit times that were consistent with the observed electrophoretic velocity. These separations were easily detected when only 50-100 molecules of DNA per band traveled through the detection region. This new detection technology should lead to the routine analysis of DNA in capillary columns with an on-column sensitivity of nearly 100 DNA molecules/band or better. 45 refs., 10 figs.« less

Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

NASA Astrophysics Data System (ADS)

Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

2016-03-01

We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

Classic maximum entropy recovery of the average joint distribution of apparent FRET efficiency and fluorescence photons for single-molecule burst measurements.

PubMed

DeVore, Matthew S; Gull, Stephen F; Johnson, Carey K

2012-04-05

We describe a method for analysis of single-molecule Förster resonance energy transfer (FRET) burst measurements using classic maximum entropy. Classic maximum entropy determines the Bayesian inference for the joint probability describing the total fluorescence photons and the apparent FRET efficiency. The method was tested with simulated data and then with DNA labeled with fluorescent dyes. The most probable joint distribution can be marginalized to obtain both the overall distribution of fluorescence photons and the apparent FRET efficiency distribution. This method proves to be ideal for determining the distance distribution of FRET-labeled biomolecules, and it successfully predicts the shape of the recovered distributions.

Classic Maximum Entropy Recovery of the Average Joint Distribution of Apparent FRET Efficiency and Fluorescence Photons for Single-molecule Burst Measurements

PubMed Central

DeVore, Matthew S.; Gull, Stephen F.; Johnson, Carey K.

2012-01-01

We describe a method for analysis of single-molecule Förster resonance energy transfer (FRET) burst measurements using classic maximum entropy. Classic maximum entropy determines the Bayesian inference for the joint probability describing the total fluorescence photons and the apparent FRET efficiency. The method was tested with simulated data and then with DNA labeled with fluorescent dyes. The most probable joint distribution can be marginalized to obtain both the overall distribution of fluorescence photons and the apparent FRET efficiency distribution. This method proves to be ideal for determining the distance distribution of FRET-labeled biomolecules, and it successfully predicts the shape of the recovered distributions. PMID:22338694

DNA Binding Peptide Directed Synthesis of Continuous DNA Nanowires for Analysis of Large DNA Molecules by Scanning Electron Microscope.

PubMed

Kim, Kyung-Il; Lee, Seonghyun; Jin, Xuelin; Kim, Su Ji; Jo, Kyubong; Lee, Jung Heon

2017-01-01

Synthesis of smooth and continuous DNA nanowires, preserving the original structure of native DNA, and allowing its analysis by scanning electron microscope (SEM), is demonstrated. Gold nanoparticles densely assembled on the DNA backbone via thiol-tagged DNA binding peptides work as seeds for metallization of DNA. This method allows whole analysis of DNA molecules with entangled 3D features. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Studying DNA Looping by Single-Molecule FRET

PubMed Central

Le, Tung T.; Kim, Harold D.

2014-01-01

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA. PMID:24998459

Studying DNA looping by single-molecule FRET.

PubMed

Le, Tung T; Kim, Harold D

2014-06-28

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

Biosensing via light scattering from plasmonic core-shell nanospheres coated with DNA molecules

NASA Astrophysics Data System (ADS)

Xie, Huai-Yi; Chen, Minfeng; Chang, Yia-Chung; Moirangthem, Rakesh Singh

2017-05-01

We present both experimental and theoretical studies for investigating DNA molecules attached on metallic nanospheres. We have developed an efficient and accurate numerical method to investigate light scattering from plasmonic nanospheres on a substrate covered by a shell, based on the Green's function approach with suitable spherical harmonic basis. Next, we use this method to study optical scattering from DNA molecules attached to metallic nanoparticles placed on a substrate and compare with experimental results. We obtain fairly good agreement between theoretical predictions and the measured ellipsometric spectra. The metallic nanoparticles were used to detect the binding with DNA molecules in a microfluidic setup via spectroscopic ellipsometry (SE), and a detectable change in ellipsometric spectra was found when DNA molecules are captured on Au nanoparticles. Our theoretical simulation indicates that the coverage of Au nanosphere by a submonolayer of DNA molecules, which is modeled by a thin layer of dielectric material (which may absorb light), can lead to a small but detectable spectroscopic shift in both the Ψ and Δ spectra with more significant change in Δ spectra in agreement with experimental results. Our studies demonstrated the ultrasensitive capability of SE for sensing submonolayer coverage of DNA molecules on Au nanospheres. Hence the spectroscopic ellipsometric measurements coupled with theoretical analysis via an efficient computation method can be an effective tool for detecting DNA molecules attached on Au nanoparticles, thus achieving label-free, non-destructive, and high-sensitivity biosensing with nanoscale resolution.

Current-voltage characteristics of double stranded versus single stranded DNA molecules

NASA Astrophysics Data System (ADS)

Hartzell, B.; Chen, Hong; Heremans, J. J.; McCord, B.; Soghomonian, V.

2004-03-01

Investigation of DNA conductivity has focused on the native, duplex structure, with controversial results. Here, we present the influence of the double-helical structure on charge transport through lambda DNA molecules. The current-voltage (I-V) characteristics of both disulfide-labeled double stranded DNA (dsDNA) and disulfide-labeled single stranded DNA (ssDNA) were measured. The ssDNA was formed from the dsDNA using two different methods for comparison purposes: a thermal/chemical denaturation and enzymatic digestion utilizing lambda exonuclease. Resulting I-V characteristics of both the double stranded and single stranded samples were close-to-linear when measured at room temperature. However, the ssDNA samples consistently gave conductivity values about two orders of magnitude smaller in amplitude. Our results suggest an integral relationship between the native structure of DNA with its stacked base pairs and the molecule's ability to support charge transport.(NSF NIRT 0103034)

DNA Molecules Adsorbed on Rippled Supported Cationic Lipid Membranes -- A new way to stretch DNAs

NASA Astrophysics Data System (ADS)

Golubovic, Leonardo

2005-03-01

We discuss a novel approach to control to shapes of DNA molecules. We elucidate the recent experimental work of M. Hochrein, L. Golubovic and J. Raedler, on the conformational behavior of DNA molecules adsorbed on lipid membranes that are supported on grooved micro-structured surfaces. We explain the striking ability of the edges formed on these supported membranes to adsorb and completely orient (stretch) very long DNA molecules. Here we explain the experimentally observed DNA stretching effect in terms of the surface curvature dependent electrostatic potential seen by the adsorbed DNA molecules. On the curved, rippled membrane, we show that the DNA molecules undergo localization transitions causing them to stretch by binding to the ripple edges of the supported membrane. In the future, this stretching will allow to directly image, by the common fluorescence microscopy, fundamental biological processes of the interactions between DNA and single protein molecules.

Gating electrical transport through DNA molecules that bridge between silicon nanogaps.

PubMed

Takagi, Shogo; Takada, Tadao; Matsuo, Naoto; Yokoyama, Shin; Nakamura, Mitsunobu; Yamana, Kazushige

2012-03-21

DNA electronic devices were prepared on silicon-based three-terminal electrodes. Both ends of DNA molecules (400 bp long, mixed sequences) were bridged via chemical bonds between the source-drain nanogap (120 nm) electrodes. S-Shaped I-V curves were obtained and the electric current can be modulated by the gate voltage. The DNA molecules act as semiconducting p-type nanowires in the three-terminal device. This journal is © The Royal Society of Chemistry 2012

Polymer physics experiments with single DNA molecules

NASA Astrophysics Data System (ADS)

Smith, Douglas E.

1999-11-01

Bacteriophage DNA molecules were taken as a model flexible polymer chain for the experimental study of polymer dynamics at the single molecule level. Video fluorescence microscopy was used to directly observe the conformational dynamics of fluorescently labeled molecules, optical tweezers were used to manipulate individual molecules, and micro-fabricated flow cells were used to apply controlled hydrodynamic strain to molecules. These techniques constitute a powerful new experimental approach in the study of basic polymer physics questions. I have used these techniques to study the diffusion and relaxation of isolated and entangled polymer molecules and the hydrodynamic deformation of polymers in elongational and shear flows. These studies revealed a rich, and previously unobserved, ``molecular individualism'' in the dynamical behavior of single molecules. Individual measurements on ensembles of identical molecules allowed the average conformation to be determined as well as the underlying probability distributions for molecular conformation. Scaling laws, that predict the dependence of properties on chain length and concentration, were also tested. The basic assumptions of the reptation model were directly confirmed by visualizing the dynamics of entangled chains.

DNA molecule stretching through thermo-electrophoresis and thermal convection in a heated converging-diverging microchannel.

PubMed

Hsieh, Shou-Shing; Chen, Jyun-Hong; Tsai, Cheng-Fung

2013-02-18

A novel DNA molecule stretching technique is developed and tested herein. Through a heated converging-diverging microchannel, thermal convection and thermophoresis induced by regional heating are shown to significantly elongate single DNA molecules; they are visualized via a confocal laser scanning microscopy. In addition, electrophoretic stretching is also implemented to examine the hybrid effect on the conformation and dynamics of single DNA molecules. The physical properties of the DNA molecules are secured via experimental measurements.

A 3D-DNA Molecule Made of PlayMais

ERIC Educational Resources Information Center

Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

2015-01-01

More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

Single-molecule DNA detection with an engineered MspA protein nanopore

PubMed Central

Butler, Tom Z.; Pavlenok, Mikhail; Derrington, Ian M.; Niederweis, Michael; Gundlach, Jens H.

2008-01-01

Nanopores hold great promise as single-molecule analytical devices and biophysical model systems because the ionic current blockades they produce contain information about the identity, concentration, structure, and dynamics of target molecules. The porin MspA of Mycobacterium smegmatis has remarkable stability against environmental stresses and can be rationally modified based on its crystal structure. Further, MspA has a short and narrow channel constriction that is promising for DNA sequencing because it may enable improved characterization of short segments of a ssDNA molecule that is threaded through the pore. By eliminating the negative charge in the channel constriction, we designed and constructed an MspA mutant capable of electronically detecting and characterizing single molecules of ssDNA as they are electrophoretically driven through the pore. A second mutant with additional exchanges of negatively-charged residues for positively-charged residues in the vestibule region exhibited a factor of ≈20 higher interaction rates, required only half as much voltage to observe interaction, and allowed ssDNA to reside in the vestibule ≈100 times longer than the first mutant. Our results introduce MspA as a nanopore for nucleic acid analysis and highlight its potential as an engineerable platform for single-molecule detection and characterization applications. PMID:19098105

CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

NASA Astrophysics Data System (ADS)

Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

2018-03-01

CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of <220>. Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

Cell-targetable DNA nanocapsules for spatiotemporal release of caged bioactive small molecules

NASA Astrophysics Data System (ADS)

Veetil, Aneesh T.; Chakraborty, Kasturi; Xiao, Kangni; Minter, Myles R.; Sisodia, Sangram S.; Krishnan, Yamuna

2017-12-01

Achieving triggered release of small molecules with spatial and temporal precision at designated cells within an organism remains a challenge. By combining a cell-targetable, icosahedral DNA-nanocapsule loaded with photoresponsive polymers, we show cytosolic delivery of small molecules with the spatial resolution of single endosomes in specific cells in Caenorhabditis elegans. Our technology can report on the extent of small molecules released after photoactivation as well as pinpoint the location at which uncaging of the molecules occurred. We apply this technology to release dehydroepiandrosterone (DHEA), a neurosteroid that promotes neurogenesis and neuron survival, and determined the timescale of neuronal activation by DHEA, using light-induced release of DHEA from targeted DNA nanocapsules. Importantly, sequestration inside the DNA capsule prevents photocaged DHEA from activating neurons prematurely. Our methodology can in principle be generalized to diverse neurostimulatory molecules.

Mitochondrial genome of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa): A linear DNA molecule encoding a putative DNA-dependent DNA polymerase.

PubMed

Shao, Zhiyong; Graf, Shannon; Chaga, Oleg Y; Lavrov, Dennis V

2006-10-15

The 16,937-nuceotide sequence of the linear mitochondrial DNA (mt-DNA) molecule of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa) - the first mtDNA sequence from the class Scypozoa and the first sequence of a linear mtDNA from Metazoa - has been determined. This sequence contains genes for 13 energy pathway proteins, small and large subunit rRNAs, and methionine and tryptophan tRNAs. In addition, two open reading frames of 324 and 969 base pairs in length have been found. The deduced amino-acid sequence of one of them, ORF969, displays extensive sequence similarity with the polymerase [but not the exonuclease] domain of family B DNA polymerases, and this ORF has been tentatively identified as dnab. This is the first report of dnab in animal mtDNA. The genes in A. aurita mtDNA are arranged in two clusters with opposite transcriptional polarities; transcription proceeding toward the ends of the molecule. The determined sequences at the ends of the molecule are nearly identical but inverted and lack any obvious potential secondary structures or telomere-like repeat elements. The acquisition of mitochondrial genomic data for the second class of Cnidaria allows us to reconstruct characteristic features of mitochondrial evolution in this animal phylum.

3' Homologous Free Ends are Required for Stable Joint Molecule Formation by the RecA and Single-Stranded Binding Proteins of Escherichia coli

NASA Astrophysics Data System (ADS)

Konforti, Boyana B.; Davis, Ronald W.

1987-02-01

The RecA protein of Escherichia coli is important for genetic recombination in vivo and can promote synapsis and strand exchange in vitro. The DNA pairing and strand exchange reactions have been well characterized in reactions with circular single strands and linear duplexes, but little is known about these two processes using substrates more characteristic of those likely to exist in the cell. Single-stranded linear DNAs were prepared by separating strands of duplex molecules or by cleaving single-stranded circles at a unique restriction site created by annealing a short defined oligonucleotide to the circle. Analysis by gel electrophoresis and electron microscopy revealed that, in the presence of RecA and single-stranded binding proteins, a free 3' homologous end is essential for stable joint molecule formation between linear single-stranded and circular duplex DNA.

Imaging and sizing of single DNA molecules on a mobile phone.

PubMed

Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan Lok; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan

2014-12-23

DNA imaging techniques using optical microscopy have found numerous applications in biology, chemistry and physics and are based on relatively expensive, bulky and complicated set-ups that limit their use to advanced laboratory settings. Here we demonstrate imaging and length quantification of single molecule DNA strands using a compact, lightweight and cost-effective fluorescence microscope installed on a mobile phone. In addition to an optomechanical attachment that creates a high contrast dark-field imaging setup using an external lens, thin-film interference filters, a miniature dovetail stage and a laser-diode for oblique-angle excitation, we also created a computational framework and a mobile phone application connected to a server back-end for measurement of the lengths of individual DNA molecules that are labeled and stretched using disposable chips. Using this mobile phone platform, we imaged single DNA molecules of various lengths to demonstrate a sizing accuracy of <1 kilobase-pairs (kbp) for 10 kbp and longer DNA samples imaged over a field-of-view of ∼2 mm2.

Mechanisms of small molecule–DNA interactions probed by single-molecule force spectroscopy

PubMed Central

Almaqwashi, Ali A.; Paramanathan, Thayaparan; Rouzina, Ioulia; Williams, Mark C.

2016-01-01

There is a wide range of applications for non-covalent DNA binding ligands, and optimization of such interactions requires detailed understanding of the binding mechanisms. One important class of these ligands is that of intercalators, which bind DNA by inserting aromatic moieties between adjacent DNA base pairs. Characterizing the dynamic and equilibrium aspects of DNA-intercalator complex assembly may allow optimization of DNA binding for specific functions. Single-molecule force spectroscopy studies have recently revealed new details about the molecular mechanisms governing DNA intercalation. These studies can provide the binding kinetics and affinity as well as determining the magnitude of the double helix structural deformations during the dynamic assembly of DNA–ligand complexes. These results may in turn guide the rational design of intercalators synthesized for DNA-targeted drugs, optical probes, or integrated biological self-assembly processes. Herein, we survey the progress in experimental methods as well as the corresponding analysis framework for understanding single molecule DNA binding mechanisms. We discuss briefly minor and major groove binding ligands, and then focus on intercalators, which have been probed extensively with these methods. Conventional mono-intercalators and bis-intercalators are discussed, followed by unconventional DNA intercalation. We then consider the prospects for using these methods in optimizing conventional and unconventional DNA-intercalating small molecules. PMID:27085806

DNA origami-based shape IDs for single-molecule nanomechanical genotyping

NASA Astrophysics Data System (ADS)

Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

2017-04-01

Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

DNA origami-based shape IDs for single-molecule nanomechanical genotyping

PubMed Central

Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

2017-01-01

Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ∼10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level. PMID:28382928

The Kinetic Mechanism for DNA Unwinding by Multiple Molecules of Dda Helicase Aligned on DNA†

PubMed Central

Eoff, Robert L.; Raney, Kevin D.

2010-01-01

Helicases catalyze the separation of double-stranded nucleic acids to form single-stranded intermediates. Using transient state kinetic methods we have determined the kinetic properties of DNA unwinding under conditions that favor a monomeric form of the Dda helicase as well as conditions that allow multiple molecules to function on the same substrate. Multiple helicase molecules can align like a train on the DNA track. The number of base pairs unwound in a single binding event for Dda is increased from ~19 bp for the monomeric form to ~64 bp when as many as four Dda molecules are aligned on the same substrate, while the kinetic step-size (3.2 ± 0.7 bp) and unwinding rate (242 ± 25 bp s−1) appear to be independent of the number of Dda molecules present on a given substrate. The data support a model in which the helicase molecules bound to the same substrate move along the DNA track independently during DNA unwinding. The observed increase in processivity arises from the increased probability that at least one of the helicases will completely unwind the DNA prior to dissociation. These results are in contrast to previous reports in which multiple Dda molecules on the same track greatly enhanced the rate and amplitude for displacement of protein blocks on the track. Therefore, only when the progress of the lead molecule in the train is impeded by some type of block, such as a protein bound to DNA, do the trailing molecules interact with the lead molecule in order to overcome the block. The fact that trailing helicase molecules have little impact on the lead molecule in the train during routine DNA unwinding suggests that the trailing molecules are moving at similar rates as the lead molecule. This result implicates a step in the translocation mechanism as contributing greatly to the overall rate-limiting step for unwinding of duplex DNA. PMID:20408588

Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

PubMed Central

Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

2012-01-01

Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

Second-generation DNA-templated macrocycle libraries for the discovery of bioactive small molecules.

PubMed

Usanov, Dmitry L; Chan, Alix I; Maianti, Juan Pablo; Liu, David R

2018-07-01

DNA-encoded libraries have emerged as a widely used resource for the discovery of bioactive small molecules, and offer substantial advantages compared with conventional small-molecule libraries. Here, we have developed and streamlined multiple fundamental aspects of DNA-encoded and DNA-templated library synthesis methodology, including computational identification and experimental validation of a 20 × 20 × 20 × 80 set of orthogonal codons, chemical and computational tools for enhancing the structural diversity and drug-likeness of library members, a highly efficient polymerase-mediated template library assembly strategy, and library isolation and purification methods. We have integrated these improved methods to produce a second-generation DNA-templated library of 256,000 small-molecule macrocycles with improved drug-like physical properties. In vitro selection of this library for insulin-degrading enzyme affinity resulted in novel insulin-degrading enzyme inhibitors, including one of unusual potency and novel macrocycle stereochemistry (IC 50  = 40 nM). Collectively, these developments enable DNA-templated small-molecule libraries to serve as more powerful, accessible, streamlined and cost-effective tools for bioactive small-molecule discovery.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Multiplex single-molecule interaction profiling of DNA-barcoded proteins.

PubMed

Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M

2014-11-27

In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.

Global structure of forked DNA in solution revealed by high-resolution single-molecule FRET.

PubMed

Sabir, Tara; Schröder, Gunnar F; Toulmin, Anita; McGlynn, Peter; Magennis, Steven W

2011-02-09

Branched DNA structures play critical roles in DNA replication, repair, and recombination in addition to being key building blocks for DNA nanotechnology. Here we combine single-molecule multiparameter fluorescence detection and molecular dynamics simulations to give a general approach to global structure determination of branched DNA in solution. We reveal an open, planar structure of a forked DNA molecule with three duplex arms and demonstrate an ion-induced conformational change. This structure will serve as a benchmark for DNA-protein interaction studies.

Attomole-level Genomics with Single-molecule Direct DNA, cDNA and RNA Sequencing Technologies.

PubMed

Ozsolak, Fatih

2016-01-01

With the introduction of next-generation sequencing (NGS) technologies in 2005, the domination of microarrays in genomics quickly came to an end due to NGS's superior technical performance and cost advantages. By enabling genetic analysis capabilities that were not possible previously, NGS technologies have started to play an integral role in all areas of biomedical research. This chapter outlines the low-quantity DNA and cDNA sequencing capabilities and applications developed with the Helicos single molecule DNA sequencing technology.

The Dynamics of Entangled DNA Networks using Single-Molecule Methods

NASA Astrophysics Data System (ADS)

Chapman, Cole David

Single molecule experiments were performed on DNA, a model polymer, and entangled DNA networks to explore diffusion within complex polymeric fluids and their linear and non-linear viscoelasticity. DNA molecules of varying length and topology were prepared using biological methods. An ensemble of individual molecules were then fluorescently labeled and tracked in blends of entangled linear and circular DNA to examine the dependence of diffusion on polymer length, topology, and blend ratio. Diffusion was revealed to possess a non-monotonic dependence on the blend ratio, which we believe to be due to a second-order effect where the threading of circular polymers by their linear counterparts greatly slows the mobility of the system. Similar methods were used to examine the diffusive and conformational behavior of DNA within highly crowded environments, comparable to that experienced within the cell. A previously unseen gamma distributed elongation of the DNA in the presence of crowders, proposed to be due to entropic effects and crowder mobility, was observed. Additionally, linear viscoelastic properties of entangled DNA networks were explored using active microrheology. Plateau moduli values verified for the first time the predicted independence from polymer length. However, a clear bead-size dependence was observed for bead radii less than ~3x the tube radius, a newly discovered limit, above which microrheology results are within the continuum limit and may access the bulk properties of the fluid. Furthermore, the viscoelastic properties of entangled DNA in the non-linear regime, where the driven beads actively deform the network, were also examined. By rapidly driving a bead through the network utilizing optical tweezers, then removing the trap and tracking the bead's subsequent motion we are able to model the system as an over-damped harmonic oscillator and find the elasticity to be dominated by stress-dependent entanglements.

DNA combing on low-pressure oxygen plasma modified polysilsesquioxane substrates for single-molecule studies

PubMed Central

Sriram, K. K.; Chang, Chun-Ling; Rajesh Kumar, U.; Chou, Chia-Fu

2014-01-01

Molecular combing and flow-induced stretching are the most commonly used methods to immobilize and stretch DNA molecules. While both approaches require functionalization steps for the substrate surface and the molecules, conventionally the former does not take advantage of, as the latter, the versatility of microfluidics regarding robustness, buffer exchange capability, and molecule manipulation using external forces for single molecule studies. Here, we demonstrate a simple one-step combing process involving only low-pressure oxygen (O2) plasma modified polysilsesquioxane (PSQ) polymer layer to facilitate both room temperature microfluidic device bonding and immobilization of stretched single DNA molecules without molecular functionalization step. Atomic force microscopy and Kelvin probe force microscopy experiments revealed a significant increase in surface roughness and surface potential on low-pressure O2 plasma treated PSQ, in contrast to that with high-pressure O2 plasma treatment, which are proposed to be responsible for enabling effective DNA immobilization. We further demonstrate the use of our platform to observe DNA-RNA polymerase complexes and cancer drug cisplatin induced DNA condensation using wide-field fluorescence imaging. PMID:25332730

Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

NASA Astrophysics Data System (ADS)

Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

2018-04-01

We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

A single molecule study of G-quadruplex and short duplex DNA structures

NASA Astrophysics Data System (ADS)

Roy, William A., Jr.

Given that certain conditions are met, a single stranded DNA/RNA (ssDNA/RNA) structure called G-quadruplex (GQ) can form in regions throughout the genome, including at the telomeres and internal regions of the chromosomes. These structures serve various functions depending on the region in which they form which include protecting the chromosome ends, interfering with telomere elongation in cancer cells, and regulating transcription and translation level gene expression. Due to their high stability, various cellular mechanisms, such as GQ destabilizing proteins, are employed to unfold these structures during DNA replication or repair. Yet, their distinct layered structure has made GQs an attractive drug target in cancer treatment as GQ stabilizing molecules could inhibit telomerase dependent telomere elongation, a mechanism occurring in the majority of cancer cells to avoid senescence and apoptosis. However, proteins or small molecules interact with GQ that is under the influence of various cellular tension mechanisms, including the tension applied by other nearby molecules or the tension due to DNA structure within the chromatin context. Therefore, it is important to characterize the stability of various GQs and their response to interacting molecules when subjected to a tensile force. We employed a novel DNA-based nano tension generator that utilizes the elastic properties of circularized short double-stranded DNA (dsDNA) oligonucleotides to apply tension on the GQ. Since this is a completely new approach, the majority of this thesis was dedicated to proof-of-principle studies that demonstrated the feasibility and functionality of the method.

Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules

NASA Astrophysics Data System (ADS)

Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan

DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.

Torsional stress in DNA limits collaboration among reverse gyrase molecules.

PubMed

Ogawa, Taisaku; Sutoh, Kazuo; Kikuchi, Akihiko; Kinosita, Kazuhiko

2016-04-01

Reverse gyrase is an enzyme that can overwind (introduce positive supercoils into) DNA using the energy obtained from ATP hydrolysis. The enzyme is found in hyperthermophiles, and the overwinding reaction generally requires a temperature above 70 °C. In a previous study using microscopy, we have shown that 30 consecutive mismatched base pairs (a bubble) in DNA serve as a well-defined substrate site for reverse gyrase, warranting the processive overwinding activity down to 50 °C. Here, we inquire how multiple reverse gyrase molecules may collaborate with each other in overwinding one DNA molecule. We introduced one, two, or four bubbles in a linear DNA that tethered a magnetic bead to a coverslip surface. At 40-71 °C in the presence of reverse gyrase, the bead rotated clockwise as viewed from above, to relax the DNA twisted by reverse gyrase. Dependence on the enzyme concentration indicated that each bubble binds reverse gyrase tightly (dissociation constant < 0.1 nm) and that bound enzyme continuously overwinds DNA for > 5 min. Rotation with two bubbles was significantly faster compared with one bubble, indicating that overwinding actions are basically additive, but four bubbles did not show further acceleration except at 40 °C where the activity was very low. The apparent saturation is due to the hydrodynamic friction against the rotating bead, as confirmed by increasing the medium viscosity. When torsional stress in the DNA, determined by the friction, approaches ~ 7 pN·nm (at 71 °C), the overwinding activity of reverse gyrase drops sharply. Multiple molecules of reverse gyrase collaborate additively within this limit. © 2016 The Authors. The FEBS Journal published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.

Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography

NASA Astrophysics Data System (ADS)

Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan

2013-03-01

The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.

Single-molecule live-cell imaging of bacterial DNA repair and damage tolerance.

PubMed

Ghodke, Harshad; Ho, Han; van Oijen, Antoine M

2018-02-19

Genomic DNA is constantly under threat from intracellular and environmental factors that damage its chemical structure. Uncorrected DNA damage may impede cellular propagation or even result in cell death, making it critical to restore genomic integrity. Decades of research have revealed a wide range of mechanisms through which repair factors recognize damage and co-ordinate repair processes. In recent years, single-molecule live-cell imaging methods have further enriched our understanding of how repair factors operate in the crowded intracellular environment. The ability to follow individual biochemical events, as they occur in live cells, makes single-molecule techniques tremendously powerful to uncover the spatial organization and temporal regulation of repair factors during DNA-repair reactions. In this review, we will cover practical aspects of single-molecule live-cell imaging and highlight recent advances accomplished by the application of these experimental approaches to the study of DNA-repair processes in prokaryotes. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Single-Molecule Counting of Point Mutations by Transient DNA Binding

NASA Astrophysics Data System (ADS)

Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

2017-03-01

High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.

PubMed

Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W

2018-03-05

Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1  s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effects of electrostatic screening on the conformation of single DNA molecules confined in a nanochannel

NASA Astrophysics Data System (ADS)

Zhang, Ce; Zhang, Fang; van Kan, Jeroen A.; van der Maarel, Johan R. C.

2008-06-01

Single T4-DNA molecules were confined in rectangular-shaped channels with a depth of 300 nm and a width in the range of 150-300 nm casted in a poly(dimethylsiloxane) nanofluidic chip. The extensions of the DNA molecules were measured with fluorescence microscopy as a function of the ionic strength and composition of the buffer as well as the DNA intercalation level by the YOYO-1 dye. The data were interpreted with the scaling theory for a wormlike polymer in good solvent, including the effects of confinement, charge, and self-avoidance. It was found that the elongation of the DNA molecules with decreasing ionic strength can be interpreted in terms of an increase of the persistence length. Self-avoidance effects on the extension are moderate, due to the small correlation length imposed by the channel cross-sectional diameter. Intercalation of the dye results in an increase of the DNA contour length and a partial neutralization of the DNA charge, but besides effects of electrostatic origin it has no significant effect on the bare bending rigidity. In the presence of divalent cations, the DNA molecules were observed to contract, but they do not collapse into a condensed structure. It is proposed that this contraction results from a divalent counterion mediated attractive force between the segments of the DNA molecule.

Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

PubMed Central

Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

2003-01-01

We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

PubMed

Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

2007-09-15

We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

Detecting single DNA molecule interactions with optical microcavities (Presentation Recording)

NASA Astrophysics Data System (ADS)

Vollmer, Frank

2015-09-01

Detecting molecules and their interactions lies at the heart of all biosensor devices, which have important applications in health, environmental monitoring and biomedicine. Achieving biosensing capability at the single molecule level is, moreover, a particularly important goal since single molecule biosensors would not only operate at the ultimate detection limit by resolving individual molecular interactions, but they could also monitor biomolecular properties which are otherwise obscured in ensemble measurements. For example, a single molecule biosensor could resolve the fleeting interaction kinetics between a molecule and its receptor, with immediate applications in clinical diagnostics. We have now developed a label-free biosensing platform that is capable of monitoring single DNA molecules and their interaction kinetics[1], hence achieving an unprecedented sensitivity in the optical domain, Figure 1. We resolve the specific contacts between complementary oligonucleotides, thereby detecting DNA strands with less than 2.4 kDa molecular weight. Furthermore we can discern strands with single nucleotide mismatches by monitoring their interaction kinetics. Our device utilizes small glass microspheres as optical transducers[1,2, 3], which are capable of increasing the number of interactions between a light beam and analyte molecules. A prism is used to couple the light beam into the microsphere. Ourr biosensing approach resolves the specific interaction kinetics between single DNA fragments. The optical transducer is assembled in a simple three-step protocol, and consists of a gold nanorod attached to a glass microsphere, where the surface of the nanorod is further modified with oligonucleotide receptors. The interaction kinetics of an oligonucleotide receptor with DNA fragments in the surrounding aqueous solution is monitored at the single molecule level[1]. The light remains confined inside the sphere where it is guided by total internal reflections along a

Transforming single DNA molecules into fluorescent magnetic particles for detection and enumeration of genetic variations

PubMed Central

Dressman, Devin; Yan, Hai; Traverso, Giovanni; Kinzler, Kenneth W.; Vogelstein, Bert

2003-01-01

Many areas of biomedical research depend on the analysis of uncommon variations in individual genes or transcripts. Here we describe a method that can quantify such variation at a scale and ease heretofore unattainable. Each DNA molecule in a collection of such molecules is converted into a single magnetic particle to which thousands of copies of DNA identical in sequence to the original are bound. This population of beads then corresponds to a one-to-one representation of the starting DNA molecules. Variation within the original population of DNA molecules can then be simply assessed by counting fluorescently labeled particles via flow cytometry. This approach is called BEAMing on the basis of four of its principal components (beads, emulsion, amplification, and magnetics). Millions of individual DNA molecules can be assessed in this fashion with standard laboratory equipment. Moreover, specific variants can be isolated by flow sorting and used for further experimentation. BEAMing can be used for the identification and quantification of rare mutations as well as to study variations in gene sequences or transcripts in specific populations or tissues. PMID:12857956

Cellular strategies for regulating DNA supercoiling: A single-molecule perspective

PubMed Central

Koster, Daniel A.; Crut, Aurélien; Shuman, Stewart; Bjornsti, Mary-Ann; Dekker, Nynke H.

2010-01-01

Summary Excess entangling and twisting of cellular DNA (i.e., DNA supercoiling) are problems inherent to the helical structure of double-stranded DNA. Supercoiling affects transcription, DNA replication, and chromosomal segregation. Consequently the cell must fine-tune supercoiling to optimize these key processes. Here, we summarize how supercoiling is generated and review experimental and theoretical insights into supercoil relaxation. We distinguish between the passive dissipation of supercoils by diffusion and the active removal of supercoils by topoisomerase enzymes. We also review single-molecule studies that elucidate the timescales and mechanisms of supercoil removal. PMID:20723754

Rad51 is an accessory factor for Dmc1-mediated joint molecule formation during meiosis.

PubMed

Cloud, Veronica; Chan, Yuen-Ling; Grubb, Jennifer; Budke, Brian; Bishop, Douglas K

2012-09-07

Meiotic recombination in budding yeast requires two RecA-related proteins, Rad51 and Dmc1, both of which form filaments on DNA capable of directing homology search and catalyzing formation of homologous joint molecules (JMs) and strand exchange. With use of a separation-of-function mutant form of Rad51 that retains filament-forming but not JM-forming activity, we show that the JM activity of Rad51 is fully dispensable for meiotic recombination. The corresponding mutation in Dmc1 causes a profound recombination defect, demonstrating Dmc1's JM activity alone is responsible for meiotic recombination. We further provide biochemical evidence that Rad51 acts with Mei5-Sae3 as a Dmc1 accessory factor. Thus, Rad51 is a multifunctional protein that catalyzes recombination directly in mitosis and indirectly, via Dmc1, during meiosis.

Single-molecule analysis of DNA cross-links using nanopore technology

NASA Astrophysics Data System (ADS)

Wolna, Anna H.

The alpha-hemolysin (alpha-HL) protein ion channel is a potential next-generation sequencing platform that has been extensively used to study nucleic acids at a single-molecule level. After applying a potential across a lipid bilayer, the imbedded alpha-HL allows monitoring of the duration and current levels of DNA translocation and immobilization. Because this method does not require DNA amplification prior to sequencing, all the DNA damage present in the cell at any given time will be present during the sequencing experiment. The goal of this research is to determine if these damage sites give distinguishable current levels beyond those observed for the canonical nucleobases. Because DNA cross-links are one of the most prevalent types of DNA damage occurring in vivo, the blockage current levels were determined for thymine-dimers, guanine(C8)-thymine(N3) cross-links and platinum adducts. All of these cross-links give a different blockage current level compared to the undamaged strands when immobilized in the ion channel, and they all can easily translocate across the alpha-HL channel. Additionally, the alpha-HL nanopore technique presents a unique opportunity to study the effects of DNA cross-links, such as thymine-dimers, on the secondary structure of DNA G-quadruplexes folded from the human telomere sequence. Using this single-molecule nanopore technique we can detect subtle structural differences that cannot be easily addressed using conventional methods. The human telomere plays crucial roles in maintaining genome stability. In the presence of suitable cations, the repetitive 5'-TTAGGG human telomere sequence can fold into G-quadruplexes that adopt the hybrid fold in vivo. The telomere sequence is hypersensitive to UV-induced thymine-dimer (T=T) formation, and yet the presence of thymine dimers does not cause telomere shortening. The potential structural disruption and thermodynamic stability of the T=T-containing natural telomere sequences were studied to

Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy

PubMed Central

Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto

2011-01-01

DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016

One-by-one single-molecule detection of mutated nucleobases by monitoring tunneling current using a DNA tip.

PubMed

Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu

2015-01-31

A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.

DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

PubMed

Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

2018-06-27

DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

Substrate preparation for reliable imaging of DNA molecules with the scanning force microscope.

PubMed

Vesenka, J; Guthold, M; Tang, C L; Keller, D; Delaine, E; Bustamante, C

1992-07-01

A simple method of substrate preparation for imaging circular DNA molecules with the scanning force microscope (SFM) is presented. These biomolecules are adsorbed onto mica that has been soaked in magnesium acetate, sonicated and glow-discharged. The stylus-sample forces that may be endured before sample damage occurs depends on the ambient relative humidity. Images of circular DNA molecules have been obtained routinely using tips specially modified by an electron beam with a radius of curvature, Rc, of about 10 nm [D. Keller and C. Chih-Chung, Surf. Sci. 268 (1992) 333]. The resolution of these adsorbed biomolecules is determined by the Rc. At higher forces individual circular DNA molecules can be manipulated with the SFM stylus. Strategies to develop still sharper probes will be discussed.

Visualizing Chemical Interaction Dynamics of Confined DNA Molecules

NASA Astrophysics Data System (ADS)

Henkin, Gilead; Berard, Daniel; Stabile, Frank; Leslie, Sabrina

We present a novel nanofluidic approach to controllably introducing reagent molecules to interact with confined biopolymers and visualizing the reaction dynamics in real time. By dynamically deforming a flow cell using CLiC (Convex Lens-induced Confinement) microscopy, we are able to tune reaction chamber dimensions from micrometer to nanometer scales. We apply this gentle deformation to load and extend DNA polymers within embedded nanotopographies and visualize their interactions with other molecules in solution. Quantifying the change in configuration of polymers within embedded nanotopographies in response to binding/unbinding of reagent molecules provides new insights into their consequent change in physical properties. CLiC technology enables an ultra sensitive, massively parallel biochemical analysis platform which can acces a broader range of interaction parameters than existing devices.

Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

NASA Technical Reports Server (NTRS)

Vercoutere, Wenonah; DeGuzman, Veronica

2003-01-01

The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments

NASA Astrophysics Data System (ADS)

Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.

2012-02-01

We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.

Contactless experiments on individual DNA molecules show no evidence for molecular wire behavior.

PubMed

Gómez-Navarro, C; Moreno-Herrero, F; de Pablo, P J; Colchero, J; Gómez-Herrero, J; Baró, A M

2002-06-25

A fundamental requirement for a molecule to be considered a molecular wire (MW) is the ability to transport electrical charge with a reasonably low resistance. We have carried out two experiments that measure first, the charge transfer from an electrode to the molecule, and second, the dielectric response of the MW. The latter experiment requires no contacts to either end of the molecule. From our experiments we conclude that adsorbed individual DNA molecules have a resistivity similar to mica, glass, and silicon oxide substrates. Therefore adsorbed DNA is not a conductor, and it should not be considered as a viable candidate for MW applications. Parallel studies on other nanowires, including single-walled carbon nanotubes, showed conductivity as expected.

Simple horizontal magnetic tweezers for micromanipulation of single DNA molecules and DNA–protein complexes

PubMed Central

McAndrew, Christopher P.; Tyson, Christopher; Zischkau, Joseph; Mehl, Patrick; Tuma, Pamela L.; Pegg, Ian L.; Sarkar, Abhijit

2016-01-01

We report the development of a simple-to-implement magnetic force transducer that can apply a wide range of piconewton (pN) scale forces on single DNA molecules and DNA–protein complexes in the horizontal plane. The resulting low-noise force-extension data enable very high-resolution detection of changes in the DNA tether’s extension: ~0.05 pN in force and <10 nm change in extension. We have also verified that we can manipulate DNA in near equilibrium conditions through the wide range of forces by ramping the force from low to high and back again, and observing minimal hysteresis in the molecule’s force response. Using a calibration technique based on Stokes’ drag law, we have confirmed our force measurements from DNA force-extension experiments obtained using the fluctuation-dissipation theorem applied to transverse fluctuations of the magnetic microsphere. We present data on the force-distance characteristics of a DNA molecule complexed with histones. The results illustrate how the tweezers can be used to study DNA binding proteins at the single molecule level. PMID:26757808

Live-Cell Imaging of DNA Methylation Based on Synthetic-Molecule/Protein Hybrid Probe.

PubMed

Kumar, Naresh; Hori, Yuichiro; Kikuchi, Kazuya

2018-06-04

The epigenetic modification of DNA involves the conversion of cytosine to 5-methylcytosine, also known as DNA methylation. DNA methylation is important in modulating gene expression and thus, regulating genome and cellular functions. Recent studies have shown that aberrations in DNA methylation are associated with various epigenetic disorders or diseases including cancer. This stimulates great interest in the development of methods that can detect and visualize DNA methylation. For instance, fluorescent proteins (FPs) in conjugation with methyl-CpG-binding domain (MBD) have been employed for live-cell imaging of DNA methylation. However, the FP-based approach showed fluorescence signals for both the DNA-bound and -unbound states and thus differentiation between these states is difficult. Synthetic-molecule/protein hybrid probes can provide an alternative to overcome this restriction. In this article, we discuss the synthetic-molecule/protein hybrid probe that we developed recently for live-cell imaging of DNA methylation, which exhibited fluorescence enhancement only after binding to methylated DNA. © 2018 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Analysis of DNA interactions using single-molecule force spectroscopy.

PubMed

Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert

2013-06-01

Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.

An integrated optics microfluidic device for detecting single DNA molecules.

PubMed

Krogmeier, Jeffrey R; Schaefer, Ian; Seward, George; Yantz, Gregory R; Larson, Jonathan W

2007-12-01

A fluorescence-based integrated optics microfluidic device is presented, capable of detecting single DNA molecules in a high throughput and reproducible manner. The device integrates microfluidics for DNA stretching with two optical elements for single molecule detection (SMD): a plano-aspheric refractive lens for fluorescence excitation (illuminator) and a solid parabolic reflective mirror for fluorescence collection (collector). Although miniaturized in size, both optical components were produced and assembled onto the microfluidic device by readily manufacturable fabrication techniques. The optical resolution of the device is determined by the small and relatively low numerical aperture (NA) illuminator lens (0.10 effective NA, 4.0 mm diameter) that delivers excitation light to a diffraction limited 2.0 microm diameter spot at full width half maximum within the microfluidic channel. The collector (0.82 annular NA, 15 mm diameter) reflects the fluorescence over a large collection angle, representing 71% of a hemisphere, toward a single photon counting module in an infinity-corrected scheme. As a proof-of-principle experiment for this simple integrated device, individual intercalated lambda-phage DNA molecules (48.5 kb) were stretched in a mixed elongational-shear microflow, detected, and sized with a fluorescence signal to noise ratio of 9.9 +/-1.0. We have demonstrated that SMD does not require traditional high numerical aperture objective lenses and sub-micron positioning systems conventionally used in many applications. Rather, standard manufacturing processes can be combined in a novel way that promises greater accessibility and affordability for microfluidic-based single molecule applications.

Homebuilt single-molecule scanning confocal fluorescence microscope studies of single DNA/protein interactions.

PubMed

Zheng, Haocheng; Goldner, Lori S; Leuba, Sanford H

2007-03-01

Many technical improvements in fluorescence microscopy over the years have focused on decreasing background and increasing the signal to noise ratio (SNR). The scanning confocal fluorescence microscope (SCFM) represented a major improvement in these efforts. The SCFM acquires signal from a thin layer of a thick sample, rejecting light whose origin is not in the focal plane thereby dramatically decreasing the background signal. A second major innovation was the advent of high quantum-yield, low noise, single-photon counting detectors. The superior background rejection of SCFM combined with low-noise, high-yield detectors makes it possible to detect the fluorescence from single-dye molecules. By labeling a DNA molecule or a DNA/protein complex with a donor/acceptor dye pair, fluorescence resonance energy transfer (FRET) can be used to track conformational changes in the molecule/complex itself, on a single molecule/complex basis. In this methods paper, we describe the core concepts of SCFM in the context of a study that uses FRET to reveal conformational fluctuations in individual Holliday junction DNA molecules and nucleosomal particles. We also discuss data processing methods for SCFM.

Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules.

PubMed

Li, Yueqi; Xiang, Limin; Palma, Julio L; Asai, Yoshihiro; Tao, Nongjian

2016-04-15

Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models.

Synthetic-Molecule/Protein Hybrid Probe with Fluorogenic Switch for Live-Cell Imaging of DNA Methylation.

PubMed

Hori, Yuichiro; Otomura, Norimichi; Nishida, Ayuko; Nishiura, Miyako; Umeno, Maho; Suetake, Isao; Kikuchi, Kazuya

2018-02-07

Hybrid probes consisting of synthetic molecules and proteins are powerful tools for detecting biological molecules and signals in living cells. To date, most targets of the hybrid probes have been limited to pH and small analytes. Although biomacromolecules are essential to the physiological function of cells, the hybrid-probe-based approach has been scarcely employed for live-cell detection of biomacromolecules. Here, we developed a hybrid probe with a chemical switch for live-cell imaging of methylated DNA, an important macromolecule in the repression of gene expression. Using a protein labeling technique, we created a hybrid probe containing a DNA-binding fluorogen and a methylated-DNA-binding domain. The hybrid probe enhanced fluorescence intensity upon binding to methylated DNA and successfully monitored methylated DNA during mitosis. The hybrid probe offers notable advantages absent from probes based on small molecules or fluorescent proteins and is useful for live-cell analyses of epigenetic phenomena and diseases related to DNA methylation.

Design of stapled DNA-minor-groove-binding molecules with a mutable atom simulated annealing method

NASA Astrophysics Data System (ADS)

Walker, Wynn L.; Kopka, Mary L.; Dickerson, Richard E.; Goodsell, David S.

1997-11-01

We report the design of optimal linker geometries for the synthesis of stapledDNA-minor-groove-binding molecules. Netropsin, distamycin, and lexitropsinsbind side-by-side to mixed-sequence DNA and offer an opportunity for thedesign of sequence-reading molecules. Stapled molecules, with two moleculescovalently linked side-by-side, provide entropic gains and restrain theposition of one molecule relative to its neighbor. Using a free-atom simulatedannealing technique combined with a discrete mutable atom definition, optimallengths and atomic composition for covalent linkages are determined, and anovel hydrogen bond `zipper' is proposed to phase two molecules accuratelyside-by-side.

Mapping DNA polymerase errors by single-molecule sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, David F.; Lu, Jenny; Chang, Seungwoo

Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less

Mapping DNA polymerase errors by single-molecule sequencing

DOE PAGES

Lee, David F.; Lu, Jenny; Chang, Seungwoo; ...

2016-05-16

Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less

Rolling Circle Amplification For Spatially Directed Synthesis Of A Solid Phase Anchored Single-Stranded DNA Molecule

NASA Astrophysics Data System (ADS)

Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.

2006-09-01

In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.

Linearisation of λDNA molecules by instantaneous variation of the trapping electrode voltage inside a micro-channel

NASA Astrophysics Data System (ADS)

Hanasaki, Itsuo; Yukimoto, Naoya; Uehara, Satoshi; Shintaku, Hirofumi; Kawano, Satoyuki

2015-04-01

Because long DNA molecules usually exist in random coil states due to the entropic effect, linearisation is required for devices equipped with nanopores where electrical sequencing is necessary during single-file translocation. We present a novel technique for linearising DNA molecules in a micro-channel. In our device, electrodes are embedded in the bottom surface of the channel. The application of a voltage induces the trapping of λDNA molecules on the positive electrode. An instantaneous voltage drop is used to put the λDNA molecules in a partly released state and the hydrodynamic force of the solution induces linearisation. Phenomena were directly observed using an optical microscopy system equipped with a high-speed camera and the linearisation principle was explored in detail. Furthermore, we estimate the tensile characteristics produced by the flow of the solution through a numerical model of a tethered polymer subject to a Poiseuille flow. The mean tensile force is in the range of 0.1-1 pN. This is sufficiently smaller than the structural transition point of λDNA but counterbalances the entropic elasticity that causes the random coil shape of λDNA molecules in solution. We show the important role of thermal fluctuation in the manipulation of molecules in solution and clarify the tensile conditions required for DNA linearisation using a combination of solution flow and voltage variation in a microchannel.

DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering.

PubMed

Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi

2017-12-06

We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.

Molecule counting with alkanethiol and DNA immobilized on gold microplates for extended gate FET.

PubMed

Cao, Zhong; Xiao, Zhong-Liang; Zhang, Ling; Luo, Dong-Mei; Kamahori, Masao; Shimoda, Maki

2013-04-01

Several molecule counting methods based on electrochemical characterization of alkanethiol and thiolated single-stranded oligonucleotide (HS-ssDNA) immobilized on gold microplates, which were used as extended gates of field effect transistors (FETs), have been investigated in this paper. The surface density of alkanethiol and DNA monolayers on gold microplates were quantitatively evaluated from the reductive desorption charge by using cyclic voltammetry (CV) and fast CV (FCV) methods in strong alkali solution. Typically, the surface density of 6-hydroxy-1-hexanethiol (6-HHT) was evaluated to be 4.639 molecules/nm(2), and the 28 base-pair dsDNA about 1.226-4.849 molecules/100 nm(2) on Au microplates after post-treatment with 6-HHT. The behaviors on surface potential and capacitance of different aminoalkanethiols on Au microplates were measured in 0.1 mol/L Na2SO4 and 10 mmol/L Tris-HCl (pH=7.4) solutions, indicating that the surface potential increases and the double-layer capacitance decreases with the length of carbon chain increased for the thiol monolayers, which obey a physics relationship for a capacitor. Comparably, a simple sensing method based on the electronic signals of biochemical reaction events on DNA immobilization and hybridization at the Au surface of the extended gate FET (EGFET) was developed, with which the surface density of the hybridized dsDNA on the gold surface of the EGFET was evaluated to be 1.36 molecules per 100 nm(2), showing that the EGFET is a promising sensing biochip for DNA molecule counting. Copyright © 2012 Elsevier B.V. All rights reserved.

Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules

PubMed Central

Li, Yueqi; Xiang, Limin; Palma, Julio L.; Asai, Yoshihiro; Tao, Nongjian

2016-01-01

Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models. PMID:27079152

Single-Molecule Encoders for Tracking Motor Proteins on DNA

NASA Astrophysics Data System (ADS)

Lipman, Everett A.

2012-02-01

Devices such as inkjet printers and disk drives track position and velocity using optical encoders, which produce periodic signals precisely synchronized with linear or rotational motion. We have implemented this technique at the nanometer scale by labeling DNA with regularly spaced fluorescent dyes. The resulting molecular encoders can be used in several ways for high-resolution continuous tracking of individual motor proteins. These measurements do not require mechanical coupling to macroscopic instrumentation, are automatically calibrated by the underlying structure of DNA, and depend on signal periodicity rather than absolute level. I will describe the synthesis of single-molecule encoders, data from and modeling of experiments on a helicase and a DNA polymerase, and some ideas for future work.

Selective inhibition of c-Myc/Max dimerization and DNA binding by small molecules.

PubMed

Kiessling, Anke; Sperl, Bianca; Hollis, Angela; Eick, Dirk; Berg, Thorsten

2006-07-01

bZip and bHLHZip protein family members comprise a large fraction of eukaryotic transcription factors and need to bind DNA in order to exert most of their fundamental biological roles. Their binding to DNA requires homo- or heterodimerization via alpha-helical domains, which generally do not contain obvious binding sites for small molecules. We have identified two small molecules, dubbed Mycro1 and Mycro2, which inhibit the protein-protein interactions between the bHLHZip proteins c-Myc and Max. Mycros are the first inhibitors of c-Myc/Max dimerization, which have been demonstrated to inhibit DNA binding of c-Myc with preference over other dimeric transcription factors in vitro. Mycros inhibit c-Myc-dependent proliferation, gene transcription, and oncogenic transformation in the low micromolar concentration range. Our data support the idea that dimeric transcription factors can be druggable even in the absence of obvious small-molecule binding pockets.

Separation of large DNA molecules by applying pulsed electric field to size exclusion chromatography-based microchip

NASA Astrophysics Data System (ADS)

Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong

2018-02-01

Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA molecules (λ DNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.

Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

PubMed Central

Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

2003-01-01

Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

Did the Pre-RNA World Rest Upon DNA Molecules?

NASA Technical Reports Server (NTRS)

Lazcano, Antonio; Dworkin, Jason P.; Miller, Stanley L.

2004-01-01

The isolation of a DNA sequence that catalyzes the ligation of oligodeoxynucleotides via the formation of 3' - 5' phosphodiester linkage significance in selection experiments has been reported. Ball recently used this to discuss the possibility that natural DNA molecules may have formed in the primitive Earth leading to the origin of life. As noted by Ferris and Usher, if metabolic pathways evolved backwards, it could be argued that the biosynthesis of 2-deoxyribose from ribose suggests that RNA came from DNA. As summarized elsewhere, there are several properties of deoxyribose which could be interpreted to support the possibility that DNA-like molecules arose prior to the RNA world. For example, 2-deoxyribose is slightly more soluble than ribose (which may have been an advantage in a drying pool scenario), may have been more reactive under possible prebiotic conditions (it forms a nucleoside approx. 150 times faster than ribose with the alternative base urazole at 25 C), while it decomposes in solution (approximately 2.6 times more slowly than ribose at 100 C). Other advantages of DNA over RNA are that it has one fewer chiral center, has a greater stability at the 8.2 pH value of the current oceans, and does not has the 2'5' and 3'5' ambiguity in polymerizations. Yet, there is strong molecular biological and biochemical evidence that RNA was featured in the biology well before the last common ancestor. The presence of sugar acids, including both ribo- and deoxysugar acids, in the 4.6 Ga old Murchison meteorite suggest that both may have been available in the primitive Earth, derived from the accretion of extraterrestrial sources and/or from endogenous processes involving formaldehyde and its derivatives. However, the abiotic synthesis of deoxyribose, ribose, and other sugars from glyceraldehyde and acetaldehyde under alkaline conditions is inefficient and unespecific. Although sugars are labile compounds, the role of cyanamide or borate minerals in the

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

NASA Astrophysics Data System (ADS)

Zhang, Yuning; Reisner, Walter

2013-03-01

Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.

Single molecule analysis of Thermus thermophilus SSB protein dynamics on single-stranded DNA.

PubMed

Zhang, Jichuan; Zhou, Ruobo; Inoue, Jin; Mikawa, Tsutomu; Ha, Taekjip

2014-04-01

Single-stranded (ss) DNA binding (SSB) proteins play central roles in DNA replication, recombination and repair in all organisms. We previously showed that Escherichia coli (Eco) SSB, a homotetrameric bacterial SSB, undergoes not only rapid ssDNA-binding mode transitions but also one-dimensional diffusion (or migration) while remaining bound to ssDNA. Whereas the majority of bacterial SSB family members function as homotetramers, dimeric SSB proteins were recently discovered in a distinct bacterial lineage of extremophiles, the Thermus-Deinococcus group. Here we show, using single-molecule fluorescence resonance energy transfer (FRET), that homodimeric bacterial SSB from Thermus thermophilus (Tth) is able to diffuse spontaneously along ssDNA over a wide range of salt concentrations (20-500 mM NaCl), and that TthSSB diffusion can help transiently melt the DNA hairpin structures. Furthermore, we show that two TthSSB molecules undergo transitions among different DNA-binding modes while remaining bound to ssDNA. Our results extend our previous observations on homotetrameric SSBs to homodimeric SSBs, indicating that the dynamic features may be shared among different types of SSB proteins. These dynamic features of SSBs may facilitate SSB redistribution and removal on/from ssDNA, and help recruit other SSB-interacting proteins onto ssDNA for subsequent DNA processing in DNA replication, recombination and repair.

Interaction of cationic surfactants with DNA: a single-molecule study

PubMed Central

Husale, Sudhir; Grange, Wilfried; Karle, Marc; Bürgi, Stephan; Hegner, Martin

2008-01-01

The interaction of cationic surfactants with single dsDNA molecules has been studied using force-measuring optical tweezers. For hydrophobic chains of length 12 and greater, pulling experiments show characteristic features (e.g. hysteresis between the pulling and relaxation curves, force-plateau along the force curves), typical of a condensed phase (compaction of a long DNA into a micron-sized particle). Depending on the length of the hydrophobic chain of the surfactant, we observe different mechanical behaviours of the complex (DNA-surfactants), which provide evidence for different binding modes. Taken together, our measurements suggest that short-chain surfactants, which do not induce any condensation, could lie down on the DNA surface and directly interact with the DNA grooves through hydrophobic–hydrophobic interactions. In contrast, long-chain surfactants could have their aliphatic tails pointing away from the DNA surface, which could promote inter-molecular interactions between hydrophobic chains and subsequently favour DNA condensation. PMID:18203749

Counterion accumulation effects on a suspension of DNA molecules: Equation of state and pressure-driven denaturation

NASA Astrophysics Data System (ADS)

Nicasio-Collazo, Luz Adriana; Delgado-González, Alexandra; Hernández-Lemus, Enrique; Castañeda-Priego, Ramón

2017-04-01

The study of the effects associated with the electrostatic properties of DNA is of fundamental importance to understand both its molecular properties at the single molecule level, like the rigidity of the chain, and its interaction with other charged bio-molecules, including other DNA molecules; such interactions are crucial to maintain the thermodynamic stability of the intra-cellular medium. In the present work, we combine the Poisson-Boltzmann mean-field theory with an irreversible thermodynamic approximation to analyze the effects of counterion accumulation inside DNA on both the denaturation profile of the chain and the equation of state of the suspension. To this end, we model the DNA molecule as a porous charged cylinder immersed in an aqueous solution. These thermo-electrostatic effects are explicitly studied in the particular case of some genes for which damage in their sequence is associated with diffuse large B-cell lymphoma.

Probing the dynamics of restriction endonuclease NgoMIV-DNA interaction by single-molecule FRET.

PubMed

Tutkus, Marijonas; Sasnauskas, Giedrius; Rutkauskas, Danielis

2017-12-01

Many type II restriction endonucleases require two copies of their recognition sequence for optimal activity. Concomitant binding of two DNA sites by such an enzyme produces a DNA loop. Here we exploit single-molecule Förster resonance energy transfer (smFRET) of surface-immobilized DNA fragments to study the dynamics of DNA looping induced by tetrameric endonuclease NgoMIV. We have employed a DNA fragment with two NgoMIV recognition sites and a FRET dye pair such that upon protein-induced DNA looping the dyes are brought to close proximity resulting in a FRET signal. The dynamics of DNA-NgoMIV interactions proved to be heterogeneous, with individual smFRET trajectories exhibiting broadly different average looped state durations. Distinct types of the dynamics were attributed to different types of DNA-protein complexes, mediated either by one NgoMIV tetramer simultaneously bound to two specific sites ("slow" trajectories) or by semi-specific interactions of two DNA-bound NgoMIV tetramers ("fast" trajectories), as well as to conformational heterogeneity of individual NgoMIV molecules. © 2017 Wiley Periodicals, Inc.

Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

NASA Astrophysics Data System (ADS)

Zhang, Yuning; Reisner, Walter

2012-02-01

Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with nanpore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a nanopore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We will discuss our recent progress on device fabrication and characterization. In particular, we demonstrate that we can detect - using fluorescent microscopy - successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the embedded pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule.

Mechanisms of DNA disentangling by type II topoisomerases. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

NASA Astrophysics Data System (ADS)

Yan, Jie

2016-09-01

In this article [1] Dr. Vologodskii presents a comprehensive discussion on the mechanisms by which the type II topoisomerases unknot/disentangle DNA molecules. It is motivated by a mysterious capability of the nanometer-size enzymes to keep the steady-state probability of DNA entanglement/knot almost two orders of magnitude below that expected from thermal equilibrium [2-5]. In spite of obvious functional advantages of the enzymes, it raises a question regarding how such high efficiency could be achieved. The off-equilibrium steady state distribution of DNA topology is powered by ATP consumption. However, it remains unclear how this energy is utilized to bias the distribution toward disentangled/unknotted topological states of DNA.

Development of a reference material of a single DNA molecule for the quality control of PCR testing.

PubMed

Mano, Junichi; Hatano, Shuko; Futo, Satoshi; Yoshii, Junji; Nakae, Hiroki; Naito, Shigehiro; Takabatake, Reona; Kitta, Kazumi

2014-09-02

We developed a reference material of a single DNA molecule with a specific nucleotide sequence. The double-strand linear DNA which has PCR target sequences at the both ends was prepared as a reference DNA molecule, and we named the PCR targets on each side as confirmation sequence and standard sequence. The highly diluted solution of the reference molecule was dispensed into 96 wells of a plastic PCR plate to make the average number of molecules in a well below one. Subsequently, the presence or absence of the reference molecule in each well was checked by real-time PCR targeting for the confirmation sequence. After an enzymatic treatment of the reaction mixture in the positive wells for the digestion of PCR products, the resultant solution was used as the reference material of a single DNA molecule with the standard sequence. PCR analyses revealed that the prepared samples included only one reference molecule with high probability. The single-molecule reference material developed in this study will be useful for the absolute evaluation of a detection limit of PCR-based testing methods, the quality control of PCR analyses, performance evaluations of PCR reagents and instruments, and the preparation of an accurate calibration curve for real-time PCR quantitation.

Single Molecule Study of DNA Organization and Recombination

NASA Astrophysics Data System (ADS)

Xiao, Botao

We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force

Structure of nascent replicative form DNA of coliphage M13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dasgupta, S.; Mitra, S.

Nascent replicative form type II (RFII) DNA of coliphage M13 synthesized in an Escherichia coli mutant deficient in the 5' ..-->.. 3' exonuclease associated with DNA polymerase I contains ribonucleotides that are retained in the covalently closed RFI DNA sealed in vitro by the joint action of T5 phage DNA polymerase and T4 phage DNA ligase. These RFI molecules are labile to alkali and RNase H, unlike the RFI produced either in vivo or from RFII with E. coli DNA polymerase I and E. coli DNA ligase. The ribonucleotides are located at one site and predominantly in one strand ofmore » the nascent RF DNA. Furthermore, these molecules contain multiple small gaps, randomly located, and one large gap in the intracistronic region.« less

A lab-on-chip for biothreat detection using single-molecule DNA mapping.

PubMed

Meltzer, Robert H; Krogmeier, Jeffrey R; Kwok, Lisa W; Allen, Richard; Crane, Bryan; Griffis, Joshua W; Knaian, Linda; Kojanian, Nanor; Malkin, Gene; Nahas, Michelle K; Papkov, Vyacheslav; Shaikh, Saad; Vyavahare, Kedar; Zhong, Qun; Zhou, Yi; Larson, Jonathan W; Gilmanshin, Rudolf

2011-03-07

Rapid, specific, and sensitive detection of airborne bacteria, viruses, and toxins is critical for biodefense, yet the diverse nature of the threats poses a challenge for integrated surveillance, as each class of pathogens typically requires different detection strategies. Here, we present a laboratory-on-a-chip microfluidic device (LOC-DLA) that integrates two unique assays for the detection of airborne pathogens: direct linear analysis (DLA) with unsurpassed specificity for bacterial threats and Digital DNA for toxins and viruses. The LOC-DLA device also prepares samples for analysis, incorporating upstream functions for concentrating and fractionating DNA. Both DLA and Digital DNA assays are single molecule detection technologies, therefore the assay sensitivities depend on the throughput of individual molecules. The microfluidic device and its accompanying operation protocols have been heavily optimized to maximize throughput and minimize the loss of analyzable DNA. We present here the design and operation of the LOC-DLA device, demonstrate multiplex detection of rare bacterial targets in the presence of 100-fold excess complex bacterial mixture, and demonstrate detection of picogram quantities of botulinum toxoid.

Single-molecule comparison of DNA Pol I activity with native and analog nucleotides

NASA Astrophysics Data System (ADS)

Gul, Osman; Olsen, Tivoli; Choi, Yongki; Corso, Brad; Weiss, Gregory; Collins, Philip

2014-03-01

DNA polymerases are critical enzymes for DNA replication, and because of their complex catalytic cycle they are excellent targets for investigation by single-molecule experimental techniques. Recently, we studied the Klenow fragment (KF) of DNA polymerase I using a label-free, electronic technique involving single KF molecules attached to carbon nanotube transistors. The electronic technique allowed long-duration monitoring of a single KF molecule while processing thousands of template strands. Processivity of up to 42 nucleotide bases was directly observed, and statistical analysis of the recordings determined key kinetic parameters for the enzyme's open and closed conformations. Subsequently, we have used the same technique to compare the incorporation of canonical nucleotides like dATP to analogs like 1-thio-2'-dATP. The analog had almost no affect on duration of the closed conformation, during which the nucleotide is incorporated. On the other hand, the analog increased the rate-limiting duration of the open conformation by almost 40%. We propose that the thiolated analog interferes with KF's recognition and binding, two key steps that determine its ensemble turnover rate.

Molecular threading: mechanical extraction, stretching and placement of DNA molecules from a liquid-air interface.

PubMed

Payne, Andrew C; Andregg, Michael; Kemmish, Kent; Hamalainen, Mark; Bowell, Charlotte; Bleloch, Andrew; Klejwa, Nathan; Lehrach, Wolfgang; Schatz, Ken; Stark, Heather; Marblestone, Adam; Church, George; Own, Christopher S; Andregg, William

2013-01-01

We present "molecular threading", a surface independent tip-based method for stretching and depositing single and double-stranded DNA molecules. DNA is stretched into air at a liquid-air interface, and can be subsequently deposited onto a dry substrate isolated from solution. The design of an apparatus used for molecular threading is presented, and fluorescence and electron microscopies are used to characterize the angular distribution, straightness, and reproducibility of stretched DNA deposited in arrays onto elastomeric surfaces and thin membranes. Molecular threading demonstrates high straightness and uniformity over length scales from nanometers to micrometers, and represents an alternative to existing DNA deposition and linearization methods. These results point towards scalable and high-throughput precision manipulation of single-molecule polymers.

Single-molecule study of DNA unlinking by eukaryotic and prokaryotic type-II topoisomerases

PubMed Central

Charvin, G.; Bensimon, D.; Croquette, V.

2003-01-01

Type-II topoisomerases are responsible for untangling DNA during replication by removing supercoiled and interlinked DNA structures. Using a single-molecule micromanipulation setup, we follow the real-time decatenation of two mechanically braided DNA molecules by Drosophila melanogaster topoisomerase (Topo) II and Escherichia coli Topo IV. Although Topo II relaxes left-handed (L) and right-handed (R-) braids similarly at a rate of ≈2.9 s–1, Topo IV has a marked preference for L-braids, which it relaxes completely and processively at a rate of ≈2.4 s–1. However, Topo IV can unlink R-braids at about half that rate when they supercoil to form L-plectonemes. These results imply that the preferred substrate for unlinking by Topo IV has the symmetry of an L-crossing and shed new light on the decatenation of daughter strands during DNA replication, which are usually assumed to be linked in an R-braid. PMID:12902541

Diffusion of isolated DNA molecules: dependence on length and topology.

PubMed

Robertson, Rae M; Laib, Stephan; Smith, Douglas E

2006-05-09

The conformation and dynamics of circular polymers is a subject of considerable theoretical and experimental interest. DNA is an important example because it occurs naturally in different topological states, including linear, relaxed circular, and supercoiled circular forms. A fundamental question is how the diffusion coefficients of isolated polymers scale with molecular length and how they vary for different topologies. Here, diffusion coefficients D for relaxed circular, supercoiled, and linear DNA molecules of length L ranging from approximately 6 to 290 kbp were measured by tracking the Brownian motion of single molecules. A topology-independent scaling law D approximately L(-nu) was observed with nu(L) = 0.571 +/- 0.014, nu(C) = 0.589 +/- 0.018, and nu(S) = 0.571 +/- 0.057 for linear, relaxed circular, and supercoiled DNA, respectively, in good agreement with the scaling exponent of nu congruent with 0.588 predicted by renormalization group theory for polymers with significant excluded volume interactions. Our findings thus provide evidence in support of several theories that predict an effective diameter of DNA much greater than the Debye screening length. In addition, the measured ratio D(Circular)/D(Linear) = 1.32 +/- 0.014 was closer to the value of 1.45 predicted by using renormalization group theory than the value of 1.18 predicted by classical Kirkwood hydrodynamic theory and agreed well with a value of 1.31 predicted when incorporating a recently proposed expression for the radius of gyration of circular polymers into the Zimm model.

Development of a simulation method for dynamics of electrons ejected from DNA molecules irradiated with X-rays.

PubMed

Kai, Takeshi; Higuchi, Mariko; Fujii, Kentaro; Watanabe, Ritsuko; Yokoya, Akinari

2012-12-01

To develop a method for simulating the dynamics of the photoelectrons and Auger electrons ejected from DNA molecules irradiated with pulsed monochromatic X-rays. A 30-base-pair (bp) DNA molecule was used as the target model, and the X-rays were assumed to have a Gaussian-shaped time distribution. Photoionization and Auger decay were considered as the atomic processes. The atoms from which the photoelectrons or Auger electrons were emitted were specified in the DNA molecule (or DNA ion) using the Monte Carlo method, and the trajectory of each electron in the electric field formed around the positively charged DNA molecule was calculated with a Newtonian equation. The kinetics of the electrons produced by irradiation with X-rays at an intensity ranging from 1 × 10(12) to 1 × 10(16) photons/mm(2) and energies of 380 eV (below the carbon K-edge), 435 eV (above the nitrogen K-edge), and 560 eV (above the oxygen K-edge) were evaluated. It was found that at an X-ray intensity of 1 × 10(14) photons/mm(2) or less, all the produced electrons escaped from the target. However, above an X-ray intensity of 1 × 10(15) photons/mm(2) and an energy of 560 eV, some photoelectrons that were ejected from the oxygen atoms were trapped near the target DNA. A simulation method for studying the trajectories of electrons ejected from a 30-bp DNA molecule irradiated with pulsed monochromatic X-rays has been developed. The present results show that electron dynamics are strongly dependent on the charged density induced in DNA by pulsed X-ray irradiation.

A DNA Crystal Designed to Contain Two Molecules per Asymmetric Unit

DOE Office of Scientific and Technical Information (OSTI.GOV)

T Wang; R Sha; J Birktoft

2011-12-31

We describe the self-assembly of a DNA crystal that contains two tensegrity triangle molecules per asymmetric unit. We have used X-ray crystallography to determine its crystal structure. In addition, we have demonstrated control over the colors of the crystals by attaching either Cy3 dye (pink) or Cy5 dye (blue-green) to the components of the crystal, yielding crystals of corresponding colors. Attaching the pair of dyes to the pair of molecules yields a purple crystal.

DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

PubMed

Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

2014-04-15

DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

Joint-specific DNA methylation and transcriptome signatures in rheumatoid arthritis identify distinct pathogenic processes

PubMed Central

Ai, Rizi; Hammaker, Deepa; Boyle, David L.; Morgan, Rachel; Walsh, Alice M.; Fan, Shicai; Firestein, Gary S.; Wang, Wei

2016-01-01

Stratifying patients on the basis of molecular signatures could facilitate development of therapeutics that target pathways specific to a particular disease or tissue location. Previous studies suggest that pathogenesis of rheumatoid arthritis (RA) is similar in all affected joints. Here we show that distinct DNA methylation and transcriptome signatures not only discriminate RA fibroblast-like synoviocytes (FLS) from osteoarthritis FLS, but also distinguish RA FLS isolated from knees and hips. Using genome-wide methods, we show differences between RA knee and hip FLS in the methylation of genes encoding biological pathways, such as IL-6 signalling via JAK-STAT pathway. Furthermore, differentially expressed genes are identified between knee and hip FLS using RNA-sequencing. Double-evidenced genes that are both differentially methylated and expressed include multiple HOX genes. Joint-specific DNA signatures suggest that RA disease mechanisms might vary from joint to joint, thus potentially explaining some of the diversity of drug responses in RA patients. PMID:27282753

Single Molecule Bioelectronics and Their Application to Amplification-Free Measurement of DNA Lengths

PubMed Central

Gül, O. Tolga; Pugliese, Kaitlin M.; Choi, Yongki; Sims, Patrick C.; Pan, Deng; Rajapakse, Arith J.; Weiss, Gregory A.; Collins, Philip G.

2016-01-01

As biosensing devices shrink smaller and smaller, they approach a scale in which single molecule electronic sensing becomes possible. Here, we review the operation of single-enzyme transistors made using single-walled carbon nanotubes. These novel hybrid devices transduce the motions and catalytic activity of a single protein into an electronic signal for real-time monitoring of the protein’s activity. Analysis of these electronic signals reveals new insights into enzyme function and proves the electronic technique to be complementary to other single-molecule methods based on fluorescence. As one example of the nanocircuit technique, we have studied the Klenow Fragment (KF) of DNA polymerase I as it catalytically processes single-stranded DNA templates. The fidelity of DNA polymerases makes them a key component in many DNA sequencing techniques, and here we demonstrate that KF nanocircuits readily resolve DNA polymerization with single-base sensitivity. Consequently, template lengths can be directly counted from electronic recordings of KF’s base-by-base activity. After measuring as few as 20 copies, the template length can be determined with <1 base pair resolution, and different template lengths can be identified and enumerated in solutions containing template mixtures. PMID:27348011

Single Molecule Bioelectronics and Their Application to Amplification-Free Measurement of DNA Lengths.

PubMed

Gül, O Tolga; Pugliese, Kaitlin M; Choi, Yongki; Sims, Patrick C; Pan, Deng; Rajapakse, Arith J; Weiss, Gregory A; Collins, Philip G

2016-06-24

As biosensing devices shrink smaller and smaller, they approach a scale in which single molecule electronic sensing becomes possible. Here, we review the operation of single-enzyme transistors made using single-walled carbon nanotubes. These novel hybrid devices transduce the motions and catalytic activity of a single protein into an electronic signal for real-time monitoring of the protein's activity. Analysis of these electronic signals reveals new insights into enzyme function and proves the electronic technique to be complementary to other single-molecule methods based on fluorescence. As one example of the nanocircuit technique, we have studied the Klenow Fragment (KF) of DNA polymerase I as it catalytically processes single-stranded DNA templates. The fidelity of DNA polymerases makes them a key component in many DNA sequencing techniques, and here we demonstrate that KF nanocircuits readily resolve DNA polymerization with single-base sensitivity. Consequently, template lengths can be directly counted from electronic recordings of KF's base-by-base activity. After measuring as few as 20 copies, the template length can be determined with <1 base pair resolution, and different template lengths can be identified and enumerated in solutions containing template mixtures.

Conformational transitions in DNA polymerase I revealed by single-molecule FRET

PubMed Central

Santoso, Yusdi; Joyce, Catherine M.; Potapova, Olga; Le Reste, Ludovic; Hohlbein, Johannes; Torella, Joseph P.; Grindley, Nigel D. F.; Kapanidis, Achillefs N.

2010-01-01

The remarkable fidelity of most DNA polymerases depends on a series of early steps in the reaction pathway which allow the selection of the correct nucleotide substrate, while excluding all incorrect ones, before the enzyme is committed to the chemical step of nucleotide incorporation. The conformational transitions that are involved in these early steps are detectable with a variety of fluorescence assays and include the fingers-closing transition that has been characterized in structural studies. Using DNA polymerase I (Klenow fragment) labeled with both donor and acceptor fluorophores, we have employed single-molecule fluorescence resonance energy transfer to study the polymerase conformational transitions that precede nucleotide addition. Our experiments clearly distinguish the open and closed conformations that predominate in Pol-DNA and Pol-DNA-dNTP complexes, respectively. By contrast, the unliganded polymerase shows a broad distribution of FRET values, indicating a high degree of conformational flexibility in the protein in the absence of its substrates; such flexibility was not anticipated on the basis of the available crystallographic structures. Real-time observation of conformational dynamics showed that most of the unliganded polymerase molecules sample the open and closed conformations in the millisecond timescale. Ternary complexes formed in the presence of mismatched dNTPs or complementary ribonucleotides show unique FRET species, which we suggest are relevant to kinetic checkpoints that discriminate against these incorrect substrates. PMID:20080740

Quantum-Sequencing: Fast electronic single DNA molecule sequencing

NASA Astrophysics Data System (ADS)

Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

2014-03-01

A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

DNA origami based Au-Ag-core-shell nanoparticle dimers with single-molecule SERS sensitivity

NASA Astrophysics Data System (ADS)

Prinz, J.; Heck, C.; Ellerik, L.; Merk, V.; Bald, I.

2016-03-01

DNA origami nanostructures are a versatile tool to arrange metal nanostructures and other chemical entities with nanometer precision. In this way gold nanoparticle dimers with defined distance can be constructed, which can be exploited as novel substrates for surface enhanced Raman scattering (SERS). We have optimized the size, composition and arrangement of Au/Ag nanoparticles to create intense SERS hot spots, with Raman enhancement up to 1010, which is sufficient to detect single molecules by Raman scattering. This is demonstrated using single dye molecules (TAMRA and Cy3) placed into the center of the nanoparticle dimers. In conjunction with the DNA origami nanostructures novel SERS substrates are created, which can in the future be applied to the SERS analysis of more complex biomolecular targets, whose position and conformation within the SERS hot spot can be precisely controlled.DNA origami nanostructures are a versatile tool to arrange metal nanostructures and other chemical entities with nanometer precision. In this way gold nanoparticle dimers with defined distance can be constructed, which can be exploited as novel substrates for surface enhanced Raman scattering (SERS). We have optimized the size, composition and arrangement of Au/Ag nanoparticles to create intense SERS hot spots, with Raman enhancement up to 1010, which is sufficient to detect single molecules by Raman scattering. This is demonstrated using single dye molecules (TAMRA and Cy3) placed into the center of the nanoparticle dimers. In conjunction with the DNA origami nanostructures novel SERS substrates are created, which can in the future be applied to the SERS analysis of more complex biomolecular targets, whose position and conformation within the SERS hot spot can be precisely controlled. Electronic supplementary information (ESI) available: Additional information about materials and methods, designs of DNA origami templates, height profiles, additional SERS spectra, assignment of DNA

Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p: reinterpretation of recent single molecule experiments.

PubMed

Stigter, Dirk

2004-07-01

Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).

Organization of 'nanocrystal molecules' using DNA

NASA Astrophysics Data System (ADS)

Alivisatos, A. Paul; Johnsson, Kai P.; Peng, Xiaogang; Wilson, Troy E.; Loweth, Colin J.; Bruchez, Marcel P.; Schultz, Peter G.

1996-08-01

PATTERNING matter on the nanometre scale is an important objective of current materials chemistry and physics. It is driven by both the need to further miniaturize electronic components and the fact that at the nanometre scale, materials properties are strongly size-dependent and thus can be tuned sensitively1. In nanoscale crystals, quantum size effects and the large number of surface atoms influence the, chemical, electronic, magnetic and optical behaviour2-4. 'Top-down' (for example, lithographic) methods for nanoscale manipulation reach only to the upper end of the nanometre regime5; but whereas 'bottom-up' wet chemical techniques allow for the preparation of mono-disperse, defect-free crystallites just 1-10 nm in size6-10, ways to control the structure of nanocrystal assemblies are scarce. Here we describe a strategy for the synthesis of'nanocrystal molecules', in which discrete numbers of gold nanocrystals are organized into spatially defined structures based on Watson-Crick base-pairing interactions. We attach single-stranded DNA oligonucleotides of defined length and sequence to individual nanocrystals, and these assemble into dimers and trimers on addition of a complementary single-stranded DNA template. We anticipate that this approach should allow the construction of more complex two-and three-dimensional assemblies.

Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics

PubMed Central

Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.

2014-01-01

Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (<10 bp) and long (>10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254

Design, synthesis and selection of DNA-encoded small-molecule libraries.

PubMed

Clark, Matthew A; Acharya, Raksha A; Arico-Muendel, Christopher C; Belyanskaya, Svetlana L; Benjamin, Dennis R; Carlson, Neil R; Centrella, Paolo A; Chiu, Cynthia H; Creaser, Steffen P; Cuozzo, John W; Davie, Christopher P; Ding, Yun; Franklin, G Joseph; Franzen, Kurt D; Gefter, Malcolm L; Hale, Steven P; Hansen, Nils J V; Israel, David I; Jiang, Jinwei; Kavarana, Malcolm J; Kelley, Michael S; Kollmann, Christopher S; Li, Fan; Lind, Kenneth; Mataruse, Sibongile; Medeiros, Patricia F; Messer, Jeffrey A; Myers, Paul; O'Keefe, Heather; Oliff, Matthew C; Rise, Cecil E; Satz, Alexander L; Skinner, Steven R; Svendsen, Jennifer L; Tang, Lujia; van Vloten, Kurt; Wagner, Richard W; Yao, Gang; Zhao, Baoguang; Morgan, Barry A

2009-09-01

Biochemical combinatorial techniques such as phage display, RNA display and oligonucleotide aptamers have proven to be reliable methods for generation of ligands to protein targets. Adapting these techniques to small synthetic molecules has been a long-sought goal. We report the synthesis and interrogation of an 800-million-member DNA-encoded library in which small molecules are covalently attached to an encoding oligonucleotide. The library was assembled by a combination of chemical and enzymatic synthesis, and interrogated by affinity selection. We describe methods for the selection and deconvolution of the chemical display library, and the discovery of inhibitors for two enzymes: Aurora A kinase and p38 MAP kinase.

Application of differential scanning calorimetry to measure the differential binding of ions, water and protons in the unfolding of DNA molecules.

PubMed

Olsen, Chris M; Shikiya, Ronald; Ganugula, Rajkumar; Reiling-Steffensmeier, Calliste; Khutsishvili, Irine; Johnson, Sarah E; Marky, Luis A

2016-05-01

The overall stability of DNA molecules globally depends on base-pair stacking, base-pairing, polyelectrolyte effect and hydration contributions. In order to understand how they carry out their biological roles, it is essential to have a complete physical description of how the folding of nucleic acids takes place, including their ion and water binding. To investigate the role of ions, water and protons in the stability and melting behavior of DNA structures, we report here an experimental approach i.e., mainly differential scanning calorimetry (DSC), to determine linking numbers: the differential binding of ions (Δnion), water (ΔnW) and protons (ΔnH(+)) in the helix-coil transition of DNA molecules. We use DSC and temperature-dependent UV spectroscopic techniques to measure the differential binding of ions, water, and protons for the unfolding of a variety of DNA molecules: salmon testes DNA (ST-DNA), one dodecamer, one undecamer and one decamer duplexes, nine hairpin loops, and two triplexes. These methods can be applied to any conformational transition of a biomolecule. We determined complete thermodynamic profiles, including all three linking numbers, for the unfolding of each molecule. The favorable folding of a DNA helix results from a favorable enthalpy-unfavorable entropy compensation. DSC thermograms and UV melts as a function of salt, osmolyte and proton concentrations yielded releases of ions and water. Therefore, the favorable folding of each DNA molecule results from the formation of base-pair stacks and uptake of both counterions and water molecules. In addition, the triplex with C(+)GC base triplets yielded an uptake of protons. Furthermore, the folding of a DNA duplex is accompanied by a lower uptake of ions and a similar uptake of four water molecules as the DNA helix gets shorter. In addition, the oligomer duplexes and hairpin thermodynamic data suggest ion and water binding depends on the DNA sequence rather than DNA composition. Copyright �

Effect of gold nanoparticle on stability of the DNA molecule: A study of molecular dynamics simulation.

PubMed

Izanloo, Cobra

2017-09-02

An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.

Integration of single-molecule detection with magnetic separation for multiplexed detection of DNA glycosylases.

PubMed

Li, Chen-Chen; Zhang, Yan; Tang, Bo; Zhang, Chun-Yang

2018-06-05

We combine single-molecule detection with magnetic separation for simultaneous measurement of human 8-oxoG DNA glycosylase 1 (hOGG1) and uracil DNA glycosylase (UDG) based on excision repair-initiated endonuclease IV (Endo IV)-assisted signal amplification. This method can sensitively detect multiple DNA glycosylases, and it can be further applied for the simultaneous measurement of enzyme kinetic parameters and screening of both hOGG1 and UDG inhibitors.

Utilizing Molecular Dynamics ' Multipotent Methodologies to Measure Microscopic Motions of DNA Molecules: A Magniloquent Manuscript On DNA's Means and Mannerisms

NASA Astrophysics Data System (ADS)

Kingsland, Addie

DNA is an amazing molecule which is the basic template for all genetics. It is the primary molecule for storing biological information, and has many applications in nanotechnology. Double-stranded DNA may contain mismatched base pairs beyond the Watson-Crick pairs guanine-cytosine and adenine-thymine. To date, no one has found a physical property of base pair mismatches which describes the behavior of naturally occurring mismatch repair enzymes. Many materials properties of DNA are also unknown, for instance, when pulling DNA in different configurations, different energy differences are observed with no obvious reason why. DNA mismatches also affect their local environment, for instance changing the quantum yield of nearby azobenzene moieties. We utilize molecular dynamics computer simulations to study the structure and dynamics for both matched and mismatched base pairs, within both biological and materials contexts, and in both equilibrium and biased dynamics. We show that mismatched pairs shift further in the plane normal to the DNA strand and are more likely to exhibit non-canonical structures, including the e-motif. Base pair mismatches alter their local environment, affecting the trans- to cis- photoisomerization quantum yield of azobenzene, as well as increasing the likelihood of observing the e-motif. We also show that by using simulated data, we can give new insights on theoretical models to calculate the energetics of pulling DNA strands apart. These results, all relatively inexpensive on modern computer hardware, can help guide the design of DNA-based nanotechnologies, as well as give new insights into the functioning of mismatch repair systems in cancer prevention.

DNA Molecules in Microfluidic Oscillatory Flow

PubMed Central

Chen, Y.-L.; Graham, M.D.; de Pablo, J.J.; Jo, K.; Schwartz, D.C.

2008-01-01

The conformation and dynamics of a single DNA molecule undergoing oscillatory pressure-driven flow in microfluidic channels is studied using Brownian dynamics simulations, accounting for hydrodynamic interactions between segments in the bulk and between the chain and the walls. Oscillatory flow provides a scenario under which the polymers may remain in the channel for an indefinite amount of time as they are stretched and migrate away from the channel walls. We show that by controlling the chain length, flow rate and oscillatory flow frequency, we are able to manipulate the chain extension and the chain migration from the channel walls. The chain stretch and the chain depletion layer thickness near the wall are found to increase as the Weissenberg number increases and as the oscillatory frequency decreases. PMID:19057656

Screening by imaging: scaling up single-DNA-molecule analysis with a novel parabolic VA-TIRF reflector and noise-reduction techniques.

PubMed

van 't Hoff, Marcel; Reuter, Marcel; Dryden, David T F; Oheim, Martin

2009-09-21

Bacteriophage lambda-DNA molecules are frequently used as a scaffold to characterize the action of single proteins unwinding, translocating, digesting or repairing DNA. However, scaling up such single-DNA-molecule experiments under identical conditions to attain statistically relevant sample sizes remains challenging. Additionally the movies obtained are frequently noisy and difficult to analyse with any precision. We address these two problems here using, firstly, a novel variable-angle total internal reflection fluorescence (VA-TIRF) reflector composed of a minimal set of optical reflective elements, and secondly, using single value decomposition (SVD) to improve the signal-to-noise ratio prior to analysing time-lapse image stacks. As an example, we visualize under identical optical conditions hundreds of surface-tethered single lambda-DNA molecules, stained with the intercalating dye YOYO-1 iodide, and stretched out in a microcapillary flow. Another novelty of our approach is that we arrange on a mechanically driven stage several capillaries containing saline, calibration buffer and lambda-DNA, respectively, thus extending the approach to high-content, high-throughput screening of single molecules. Our length measurements of individual DNA molecules from noise-reduced kymograph images using SVD display a 6-fold enhanced precision compared to raw-data analysis, reaching approximately 1 kbp resolution. Combining these two methods, our approach provides a straightforward yet powerful way of collecting statistically relevant amounts of data in a semi-automated manner. We believe that our conceptually simple technique should be of interest for a broader range of single-molecule studies, well beyond the specific example of lambda-DNA shown here.

Dmc1 catalyzes interhomolog joint molecule formation in meiosis with Rad51 and Mei5-Sae3 as accessory factors

PubMed Central

Cloud, Veronica; Chan, Yuen-Ling; Grubb, Jennifer; Budke, Brian; Bishop, Douglas K.

2014-01-01

Meiotic recombination in budding yeast requires two RecA-related proteins, Rad51 and Dmc1, both of which form filaments on DNA capable of directing homology search and catalyzing formation of homologous joint molecules (JMs) and strand exchange. Using a separation-of-function mutant form of Rad51, that retains filament-forming but not JM forming activity, we show that the JM activity of Rad51 is fully dispensable for meiotic recombination. The corresponding mutation in Dmc1 causes a profound recombination defect, demonstrating Dmc1’s JM activity alone is responsible for meiotic recombination. We further provide biochemical evidence that Rad51 acts with Mei5-Sae3 as a Dmc1 accessory factor. Thus, Rad51 is a multifunctional protein that catalyzes recombination directly in mitosis and indirectly, via Dmc1, during meiosis. PMID:22955832

Single molecule photobleaching (SMPB) technology for counting of RNA, DNA, protein and other molecules in nanoparticles and biological complexes by TIRF instrumentation.

PubMed

Zhang, Hui; Guo, Peixuan

2014-05-15

Direct counting of biomolecules within biological complexes or nanomachines is demanding. Single molecule counting using optical microscopy is challenging due to the diffraction limit. The single molecule photobleaching (SMPB) technology for direct counting developed by our team (Shu et al., 2007 [18]; Zhang et al., 2007 [19]) offers a simple and straightforward method to determine the stoichiometry of molecules or subunits within biocomplexes or nanomachines at nanometer scales. Stoichiometry is determined by real-time observation of the number of descending steps resulted from the photobleaching of individual fluorophore. This technology has now been used extensively for single molecule counting of protein, RNA, and other macromolecules in a variety of complexes or nanostructures. Here, we elucidate the SMPB technology, using the counting of RNA molecules within a bacteriophage phi29 DNA-packaging biomotor as an example. The method described here can be applied to the single molecule counting of other molecules in other systems. The construction of a concise, simple and economical single molecule total internal reflection fluorescence (TIRF) microscope combining prism-type and objective-type TIRF is described. The imaging system contains a deep-cooled sensitive EMCCD camera with single fluorophore detection sensitivity, a laser combiner for simultaneous dual-color excitation, and a Dual-View™ imager to split the multiple outcome signals to different detector channels based on their wavelengths. Methodology of the single molecule photobleaching assay used to elucidate the stoichiometry of RNA on phi29 DNA packaging motor and the mechanism of protein/RNA interaction are described. Different methods for single fluorophore labeling of RNA molecules are reviewed. The process of statistical modeling to reveal the true copy number of the biomolecules based on binomial distribution is also described. Copyright © 2014 Elsevier Inc. All rights reserved.

Effect of genomic long-range correlations on DNA persistence length: from theory to single molecule experiments.

PubMed

Moukhtar, Julien; Faivre-Moskalenko, Cendrine; Milani, Pascale; Audit, Benjamin; Vaillant, Cedric; Fontaine, Emeline; Mongelard, Fabien; Lavorel, Guillaume; St-Jean, Philippe; Bouvet, Philippe; Argoul, Françoise; Arneodo, Alain

2010-04-22

Sequence dependency of DNA intrinsic bending properties has been emphasized as a possible key ingredient to in vivo chromatin organization. We use atomic force microscopy (AFM) in air and liquid to image intrinsically straight (synthetic), uncorrelated (hepatitis C RNA virus) and persistent long-range correlated (human) DNA fragments in various ionic conditions such that the molecules freely equilibrate on the mica surface before being captured in a particular conformation. 2D thermodynamic equilibrium is experimentally verified by a detailed statistical analysis of the Gaussian nature of the DNA bend angle fluctuations. We show that the worm-like chain (WLC) model, commonly used to describe the average conformation of long semiflexible polymers, reproduces remarkably well the persistence length estimates for the first two molecules as consistently obtained from (i) mean square end-to-end distance measurement and (ii) mean projection of the end-to-end vector on the initial orientation. Whatever the operating conditions (air or liquid, concentration of metal cations Mg(2+) and/or Ni(2+)), the persistence length found for the uncorrelated viral DNA underestimates the value obtained for the straight DNA. We show that this systematic difference is the signature of the presence of an uncorrelated structural intrinsic disorder in the hepatitis C virus (HCV) DNA fragment that superimposes on local curvatures induced by thermal fluctuations and that only the entropic disorder depends upon experimental conditions. In contrast, the WLC model fails to describe the human DNA conformations. We use a mean-field extension of the WLC model to account for the presence of long-range correlations (LRC) in the intrinsic curvature disorder of human genomic DNA: the stronger the LRC, the smaller the persistence length. The comparison of AFM imaging of human DNA with LRC DNA simulations confirms that the rather small mean square end-to-end distance observed, particularly for G

Double-strand breaks in genome-sized DNA caused by mechanical stress under mixing: Quantitative evaluation through single-molecule observation

NASA Astrophysics Data System (ADS)

Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi

2018-06-01

It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.

Photonic-plasmonic hybrid single-molecule nanosensor measures the effect of fluorescent labels on DNA-protein dynamics

PubMed Central

Liang, Feng; Guo, Yuzheng; Hou, Shaocong; Quan, Qimin

2017-01-01

Current methods to study molecular interactions require labeling the subject molecules with fluorescent reporters. However, the effect of the fluorescent reporters on molecular dynamics has not been quantified because of a lack of alternative methods. We develop a hybrid photonic-plasmonic antenna-in-a-nanocavity single-molecule biosensor to study DNA-protein dynamics without using fluorescent labels. Our results indicate that the fluorescein and fluorescent protein labels decrease the interaction between a single DNA and a protein due to weakened electrostatic interaction. Although the study is performed on the DNA-XPA system, the conclusion has a general implication that the traditional fluorescent labeling methods might be misestimating the molecular interactions. PMID:28560341

Interaction of HIV-1 Gag protein components with single DNA molecules

NASA Astrophysics Data System (ADS)

Cruceanu, Margareta; Gorelick, Robert J.; Williams, Mark C.

2003-03-01

The Gag protein of the HIV-1 retrovirus is cleaved into three major proteins as part of viral maturation: nucleocapsid (NC), capsid, and matrix. NC is the first of these proteins to be cleaved, and it is cleaved in three stages into NCp15, followed by NCp9, and finally NCp7. In this study, we use optical tweezers to investigate the capability of these NC proteins to alter the helix-coil transition of single DNA molecules. We have previously shown that the capability to alter the DNA helix-coil transition is an excellent probe of the nucleic acid chaperone activity of NC proteins, in which the secondary structure of nucleic acids is rearranged to facilitate reverse transcription. By examining the capability of NCp15, NCp9, and NCp7 to alter DNA stretching, the current studies will test the role of proteolytic cleavage of Gag in regulating the nucleic acid chaperone activity of NC. Whereas binding studies suggest that NCp9 and NCp15 bind more strongly to DNA than NCp7, our DNA stretching results indicate that these proteins all have similar effects on DNA stretching.

Small-molecule inhibitors of APE1 DNA repair function: an overview.

PubMed

Al-Safi, Rasha I; Odde, Srinivas; Shabaik, Yumna; Neamati, Nouri

2012-01-01

APE1 is a multifaceted protein that orchestrates multiple activities in the cell, one of which is the preservation of genomic integrity; a vital process that takes place in the context of the base excision repair (BER) pathway. Studies have implicated APE1 in rendering cancerous cells less vulnerable to the effects of DNA-damaging agents that are commonly used for the treatment of cancer. Furthermore, suppression of APE1 expression in cancer cell lines is accompanied by the potentiation of the activity of cytotoxic agents. As a result, major efforts have been directed towards the identification of small-molecule inhibitors of this DNA-repair enzyme. Herein, we review all patented small-molecule APE1 inhibitors reported prior to 2011. Unfortunately, the potency and selectivity of many of the reported inhibitors were not disclosed by the original authors, and at present it is unclear if APE1 is a bona fide target for many of the purported inhibitors. Moreover, cellular activity and toxicity of many inhibitors remain to be established. Since this is the first comprehensive review of small molecule APE1 inhibitors, we present all compounds reported to inhibit APE1 activity with an IC50 value ≤ 25 μM. Efforts towards a careful validation and optimization of these compounds are warranted. Furthermore, we explore potential allosteric drug-binding sites on the protein as an alternative approach for modulating the activity of this multifunctional protein. In addition, we give an overview of APE2, as well as other APE1 homologues in some disease-causing pathogens. Finally, given the universal importance of DNA repair, as well as the considerable conservation of repair proteins across all living organisms, we propose targeting the AP endonuclease activity of pathogens by the compounds discussed in this review, thereby expanding their therapeutic potential and application.

Quantitative Single-Molecule Surface-Enhanced Raman Scattering by Optothermal Tuning of DNA Origami-Assembled Plasmonic Nanoantennas.

PubMed

Simoncelli, Sabrina; Roller, Eva-Maria; Urban, Patrick; Schreiber, Robert; Turberfield, Andrew J; Liedl, Tim; Lohmüller, Theobald

2016-11-22

DNA origami is a powerful approach for assembling plasmonic nanoparticle dimers and Raman dyes with high yields and excellent positioning control. Here we show how optothermal-induced shrinking of a DNA origami template can be employed to control the gap sizes between two 40 nm gold nanoparticles in a range from 1 to 2 nm. The high field confinement achieved with this optothermal approach was demonstrated by detection of surface-enhanced Raman spectroscopy (SERS) signals from single molecules that are precisely placed within the DNA origami template that spans the nanoparticle gap. By comparing the SERS intensity with respect to the field enhancement in the plasmonic hot-spot region, we found good agreement between measurement and theory. Our straightforward approach for the fabrication of addressable plasmonic nanosensors by DNA origami demonstrates a path toward future sensing applications with single-molecule resolution.

Protein dynamics during presynaptic complex assembly on individual ssDNA molecules

PubMed Central

Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

2014-01-01

Homologous recombination is a conserved pathway for repairing double–stranded breaks, which are processed to yield single–stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single–molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA–ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 binding extends the ssDNA, and Rad52–RPA clusters remain interspersed along the presynaptic complex. These clusters promote additional binding of RPA and Rad52. Together, our work illustrates the spatial and temporal progression of RPA and Rad52 association with the presynaptic complex, and reveals a novel RPA–Rad52–Rad51–ssDNA intermediate, which has implications for understanding how the activities of Rad52 and RPA are coordinated with Rad51 during the later stages recombination. PMID:25195049

Genome organization of Tobacco leaf curl Zimbabwe virus, a new, distinct monopartite begomovirus associated with subgenomic defective DNA molecules.

PubMed

Paximadis, M; Rey, M E

2001-12-01

The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.

Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

2015-07-28

Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less

The role of solitons on the tunneling magnetoresistance through a double-stranded DNA molecule

NASA Astrophysics Data System (ADS)

Ashhadi, M.

2018-07-01

We have studied the role of solitons on the spin-dependent transport properties of through a double-stranded DNA (dsDNA) molecule attached to two the semi-infinite ferromagnetic (FM) electrodes. The work is based on a tight-binding Hamiltonian model within the framework of a generalized Green's function technique and relies on the Landauer-Bütikker formalism as the basis for studying the current-voltage characteristic of this system. The conductance properties of the spin system are studied for a ladder model for poly (dG)-poly (dC) DNA molecule. Our calculations indicate that the presence of a homogeneous distribution of the solitons along the molecular, as a sublattice of the correlated solitons, gives rise to significant enhancement in the density of states within the bandgap and large enhancement in conductance and the current-voltage characteristic. It is also shown that tunnel magnetoresistance (TMR) decreases in compared with TMR obtained in the absence of solitons.

[The joint applications of DNA chips and single nucleotide polymorphisms in forensic science].

PubMed

Bai, Peng; Tian, Li; Zhou, Xue-ping

2005-05-01

DNA chip technology, being a new high-technology, shows its vigorous life and rapid growth. Single Nucleotide Polymorphisms (SNPs) is the most common diversity in the human genome. It provides suitable genetic markers which play a key role in disease linkage study, pharmacogenomics, forensic medicine, population evolution and immigration study. Their advantage such as being analyzed with DNA chips technology, is predicted to play an important role in the field of forensic medicine, especially in paternity test and individual identification. This report mainly reviews the characteristics of DNA chip and SNPs, and their joint applications in the practice of forensic medicine.

Directed self-organization of single DNA molecules in a nanoslit via embedded nanopit arrays

PubMed Central

Reisner, Walter; Larsen, Niels B.; Flyvbjerg, Henrik; Tegenfeldt, Jonas O.; Kristensen, Anders

2009-01-01

We show that arrays of nanopit structures etched in a nanoslit can control the positioning and conformation of single DNA molecules in nanofluidic devices. By adjusting the spacing, organization and placement of the nanopits it is possible to immobilize DNA at predetermined regions of a device without additional chemical modification and achieve a high degree of control over local DNA conformation. DNA can be extended between two nanopits and in closely spaced arrays will self-assemble into “connect-the-dots” conformations consisting of locally pinned segments joined by fluctuating linkers. These results have broad implications for nanotechnology fields that require methods for the nanoscale positioning and manipulation of DNA. PMID:19122138

Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

NASA Astrophysics Data System (ADS)

Bell, Nicholas A. W.; Keyser, Ulrich F.

2016-07-01

The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores.

PubMed

Bell, Nicholas A W; Keyser, Ulrich F

2016-07-01

The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

Elasticity of short DNA molecules: theory and experiment for contour lengths of 0.6-7 microm.

PubMed

Seol, Yeonee; Li, Jinyu; Nelson, Philip C; Perkins, Thomas T; Betterton, M D

2007-12-15

The wormlike chain (WLC) model currently provides the best description of double-stranded DNA elasticity for micron-sized molecules. This theory requires two intrinsic material parameters-the contour length L and the persistence length p. We measured and then analyzed the elasticity of double-stranded DNA as a function of L (632 nm-7.03 microm) using the classic solution to the WLC model. When the elasticity data were analyzed using this solution, the resulting fitted value for the persistence length p(wlc) depended on L; even for moderately long DNA molecules (L = 1300 nm), this apparent persistence length was 10% smaller than its limiting value for long DNA. Because p is a material parameter, and cannot depend on length, we sought a new solution to the WLC model, which we call the "finite wormlike chain (FWLC)," to account for effects not considered in the classic solution. Specifically we accounted for the finite chain length, the chain-end boundary conditions, and the bead rotational fluctuations inherent in optical trapping assays where beads are used to apply the force. After incorporating these corrections, we used our FWLC solution to generate force-extension curves, and then fit those curves with the classic WLC solution, as done in the standard experimental analysis. These results qualitatively reproduced the apparent dependence of p(wlc) on L seen in experimental data when analyzed with the classic WLC solution. Directly fitting experimental data to the FWLC solution reduces the apparent dependence of p(fwlc) on L by a factor of 3. Thus, the FWLC solution provides a significantly improved theoretical framework in which to analyze single-molecule experiments over a broad range of experimentally accessible DNA lengths, including both short (a few hundred nanometers in contour length) and very long (microns in contour length) molecules.

Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p.

PubMed

Brewer, Laurence R; Friddle, Raymond; Noy, Aleksandr; Baldwin, Enoch; Martin, Shelley S; Corzett, Michele; Balhorn, Rod; Baskin, Ronald J

2003-10-01

Mitochondrial and nuclear DNA are packaged by proteins in a very different manner. Although protein-DNA complexes called "nucleoids" have been identified as the genetic units of mitochondrial inheritance in yeast and man, little is known about their physical structure. The yeast mitochondrial protein Abf2p was shown to be sufficient to compact linear dsDNA, without the benefit of supercoiling, using optical and atomic force microscopy single molecule techniques. The packaging of DNA by Abf2p was observed to be very weak as evidenced by a fast Abf2p off-rate (k(off) = 0.014 +/- 0.001 s(-1)) and the extremely small forces (<0.6 pN) stabilizing the condensed protein-DNA complex. Atomic force microscopy images of individual complexes showed the 190-nm structures are loosely packaged relative to nuclear chromatin. This organization may leave mtDNA accessible for transcription and replication, while making it more vulnerable to damage.

[Interactions of DNA bases with individual water molecules. Molecular mechanics and quantum mechanics computation results vs. experimental data].

PubMed

Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I

2013-01-01

To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.

Nanopore arrays in a silicon membrane for parallel single-molecule detection: DNA translocation

NASA Astrophysics Data System (ADS)

Zhang, Miao; Schmidt, Torsten; Jemt, Anders; Sahlén, Pelin; Sychugov, Ilya; Lundeberg, Joakim; Linnros, Jan

2015-08-01

Optical nanopore sensing offers great potential in single-molecule detection, genotyping, or DNA sequencing for high-throughput applications. However, one of the bottle-necks for fluorophore-based biomolecule sensing is the lack of an optically optimized membrane with a large array of nanopores, which has large pore-to-pore distance, small variation in pore size and low background photoluminescence (PL). Here, we demonstrate parallel detection of single-fluorophore-labeled DNA strands (450 bps) translocating through an array of silicon nanopores that fulfills the above-mentioned requirements for optical sensing. The nanopore array was fabricated using electron beam lithography and anisotropic etching followed by electrochemical etching resulting in pore diameters down to ∼7 nm. The DNA translocation measurements were performed in a conventional wide-field microscope tailored for effective background PL control. The individual nanopore diameter was found to have a substantial effect on the translocation velocity, where smaller openings slow the translocation enough for the event to be clearly detectable in the fluorescence. Our results demonstrate that a uniform silicon nanopore array combined with wide-field optical detection is a promising alternative with which to realize massively-parallel single-molecule detection.

Two distinct overstretched DNA structures revealed by single-molecule thermodynamics measurements

PubMed Central

Zhang, Xinghua; Chen, Hu; Fu, Hongxia; Doyle, Patrick S.; Yan, Jie

2012-01-01

Double-stranded DNA is a dynamic molecule whose structure can change depending on conditions. While there is consensus in the literature about many structures DNA can have, the state of highly-stretched DNA is still not clear. Several groups have shown that DNA in the torsion-unconstrained B-form undergoes an “overstretching” transition at a stretching force of around 65 pN, which leads to approximately 1.7-fold elongation of the DNA contour length. Recent experiments have revealed that two distinct structural transitions are involved in the overstretching process: (i) a hysteretic “peeling” off one strand from its complementary strand, and (ii) a nonhysteretic transition that leads to an undetermined DNA structure. We report the first simultaneous determination of the entropy (ΔS) and enthalpy changes (ΔH) pertaining to these respective transitions. For the hysteretic peeling transition, we determined ΔS ∼ 20 cal/(K.mol) and ΔH ∼ 7 kcal/mol. In the case of the nonhysteretic transition, ΔS ∼ -3 cal/(K.mol) and ΔH ∼ 1 kcal/mol. Furthermore, the response of the transition force to salt concentration implies that the two DNA strands are spatially separated after the hysteretic peeling transition. In contrast, the corresponding response after the nonhysteretic transition indicated that the strands remained in close proximity. The selection between the two transitions depends on DNA base-pair stability, and it can be illustrated by a multidimensional phase diagram. Our results provide important insights into the thermodynamics of DNA overstretching and conformational structures of overstretched DNA that may play an important role in vivo. PMID:22532662

Single DNA molecules on freestanding and supported cationic lipid bilayers: diverse conformational dynamics controlled by the local bilayer properties

NASA Astrophysics Data System (ADS)

Herold, Christoph; Schwille, Petra; Petrov, Eugene P.

2016-02-01

We present experimental results on the interaction of DNA macromolecules with cationic lipid membranes with different properties, including freestanding membranes in the fluid and gel state, and supported lipid membranes in the fluid state and under conditions of fluid-gel phase coexistence. We observe diverse conformational dynamics of membrane-bound DNA molecules controlled by the local properties of the lipid bilayer. In case of fluid-state freestanding lipid membranes, the behaviour of DNA on the membrane is controlled by the membrane charge density: whereas DNA bound to weakly charged membranes predominantly behaves as a 2D random coil, an increase in the membrane charge density leads to membrane-driven irreversible DNA collapse and formation of subresolution-sized DNA globules. On the other hand, electrostatic binding of DNA macromolecules to gel-state freestanding membranes leads to completely arrested diffusion and conformational dynamics of membrane-adsorbed DNA. A drastically different picture is observed in case of DNA interaction with supported cationic lipid bilayers: When the supported bilayer is in the fluid state, membrane-bound DNA molecules undergo 2D translational Brownian motion and conformational fluctuations, irrespectively of the charge density of the supported bilayer. At the same time, when the supported cationic membrane shows fluid-gel phase coexistence, membrane-bound DNA molecules are strongly attracted to micrometre-sized gel-phase domains enriched with the cationic lipid, which results in 2D compaction of the membrane-bound macromolecules. This DNA compaction, however, is fully reversible, and disappears as soon as the membrane is heated above the fluid-gel coexistence. We also discuss possible biological implications of our experimental findings.

Ultrasonic irradiation enhanced the ability of Fluorescein-DA-Fe(III) on sonodynamic and sonocatalytic damages of DNA molecules.

PubMed

Wu, Qiong; Chen, Xia; Jia, Lizhen; Wang, Yi; Sun, Ying; Huang, Xingjun; Shen, Yuxiang; Wang, Jun

2017-11-01

The interaction of DNA with Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein-Ferrous(III) (Fluorescein-DA-Fe(III)) with dual functional (sonodynamic and sonocatalytic) activity was studied by UV-vis spectroscopy, fluorescence spectroscopy, FT-IR spectroscopy, circular dichroism (CD) spectroscopy and viscosity measurements. And then, the damage of DNA caused by Fluorescein-DA-Fe(III) under ultrasonic irradiation (US) was researched by agarose gel electrophoresis and cytotoxicity assay. Meanwhile, some influenced factors such as ultrasonic irradiation time and Fluorescein-DA-Fe(III) concentration on the damage degree of DNA molecules were also examined. As a control, for Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein (Fluorescein-DA), the same experiments were carried out. The results showed that both Fluorescein-DA-Fe(III) and Fluorescein-DA can interact with DNA molecules. Under ultrasonic irradiation, Fluorescein-DA shows sonodynamic activity, which can damage DNA molecules. While, in the presence of Fe(III) ion, the Fluorescein-DA-Fe(III) displays not only sonodynamic activity but also sonocatalytic activity under ultrasonic irradiation, which injures DNA more serious than Fluorescein-DA. The researches confirmed the dual function (sonodynamic activity and sonocatalytic activity) of Fluorescein-DA-Fe(III) and expanded the usage of Fluorescein-DA-Fe(III) as a sonosensitizer in sonodynamic therapy (SDT). Copyright © 2017 Elsevier B.V. All rights reserved.

Lesion search and recognition by thymine DNA glycosylase revealed by single molecule imaging

PubMed Central

Buechner, Claudia N.; Maiti, Atanu; Drohat, Alexander C.; Tessmer, Ingrid

2015-01-01

The ability of DNA glycosylases to rapidly and efficiently detect lesions among a vast excess of nondamaged DNA bases is vitally important in base excision repair (BER). Here, we use single molecule imaging by atomic force microscopy (AFM) supported by a 2-aminopurine fluorescence base flipping assay to study damage search by human thymine DNA glycosylase (hTDG), which initiates BER of mutagenic and cytotoxic G:T and G:U mispairs in DNA. Our data reveal an equilibrium between two conformational states of hTDG–DNA complexes, assigned as search complex (SC) and interrogation complex (IC), both at target lesions and undamaged DNA sites. Notably, for both hTDG and a second glycosylase, hOGG1, which recognizes structurally different 8-oxoguanine lesions, the conformation of the DNA in the SC mirrors innate structural properties of their respective target sites. In the IC, the DNA is sharply bent, as seen in crystal structures of hTDG lesion recognition complexes, which likely supports the base flipping required for lesion identification. Our results support a potentially general concept of sculpting of glycosylases to their targets, allowing them to exploit the energetic cost of DNA bending for initial lesion sensing, coupled with continuous (extrahelical) base interrogation during lesion search by DNA glycosylases. PMID:25712093

Determination of adsorption and desorption of DNA molecules on freshwater and marine sediments.

PubMed

Xue, J; Feng, Y

2018-06-01

Free DNA and its adsorption by sediment in the aquatic environment lead to ambiguity in the identification of recent faecal pollution sources. The goal of this study was to understand the mechanisms of DNA adsorption and desorption on aquatic sediment under various conditions using quantitative polymerase chain reaction (qPCR). Both raw sewage (RS) DNA and purified PCR product (PPP) were used in adsorption and desorption experiments; autoclaved freshwater and marine sediments served as sorbents. Thirty-six hours were needed for adsorption to reach equilibrium. More DNA was adsorbed on both sediments in stream water than in 5 mmol l -1 NaCl and DNA adsorption increased in the presence of Ca 2+ and Mg 2+ . Successive desorption experiments showed that between 5% and 22% of adsorbed DNA was desorbed. Organic matter and clay played a significant role in determining the DNA adsorption capacity on sediment. The data suggest the presence of multilayer adsorption. DNA molecules on sediments were mostly adsorbed through ligand binding rather than electrostatic binding. Quantitative polymerase chain reaction assays provide a better way to investigate the DNA adsorption and desorption mechanisms by sediment. DNA desorption can potentially complicate the outcomes of microbial source tracking studies. © 2018 The Society for Applied Microbiology.

Single molecule analysis of Trypanosoma brucei DNA replication dynamics

PubMed Central

Calderano, Simone Guedes; Drosopoulos, William C.; Quaresma, Marina Mônaco; Marques, Catarina A.; Kosiyatrakul, Settapong; McCulloch, Richard; Schildkraut, Carl L.; Elias, Maria Carolina

2015-01-01

Eukaryotic genome duplication relies on origins of replication, distributed over multiple chromosomes, to initiate DNA replication. A recent genome-wide analysis of Trypanosoma brucei, the etiological agent of sleeping sickness, localized its replication origins to the boundaries of multigenic transcription units. To better understand genomic replication in this organism, we examined replication by single molecule analysis of replicated DNA. We determined the average speed of replication forks of procyclic and bloodstream form cells and we found that T. brucei DNA replication rate is similar to rates seen in other eukaryotes. We also analyzed the replication dynamics of a central region of chromosome 1 in procyclic forms. We present evidence for replication terminating within the central part of the chromosome and thus emanating from both sides, suggesting a previously unmapped origin toward the 5′ extremity of chromosome 1. Also, termination is not at a fixed location in chromosome 1, but is rather variable. Importantly, we found a replication origin located near an ORC1/CDC6 binding site that is detected after replicative stress induced by hydroxyurea treatment, suggesting it may be a dormant origin activated in response to replicative stress. Collectively, our findings support the existence of more replication origins in T. brucei than previously appreciated. PMID:25690894

Multiplex single-molecule interaction profiling of DNA barcoded proteins

PubMed Central

Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.

2014-01-01

In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978

Conformational changes of the phenyl and naphthyl isocyanate-DNA adducts during DNA replication and by minor groove binding molecules

PubMed Central

Nakano, Shu-ichi; Uotani, Yuuki; Sato, Yuichi; Oka, Hirohito; Fujii, Masayuki; Sugimoto, Naoki

2013-01-01

DNA lesions produced by aromatic isocyanates have an extra bulky group on the nucleotide bases, with the capability of forming stacking interaction within a DNA helix. In this work, we investigated the conformation of the 2′-deoxyadenosine and 2′-deoxycytidine derivatives tethering a phenyl or naphthyl group, introduced in a DNA duplex. The chemical modification experiments using KMnO4 and 1-cyclohexyl-3 -(2-morpholinoethyl) carbodiimide metho-p-toluenesulfonate have shown that the 2′-deoxycytidine lesions form the base pair with guanine while the 2′-deoxyadenosine lesions have less ability of forming the base pair with thymine in solution. Nevertheless, the kinetic analysis shows that these DNA lesions are compatible with DNA ligase and DNA polymerase reactions, as much as natural DNA bases. We suggest that the adduct lesions have a capability of adopting dual conformations, depending on the difference in their interaction energies between stacking of the attached aromatic group and base pairing through hydrogen bonds. It is also presented that the attached aromatic groups change their orientation by interacting with the minor groove binding netropsin, distamycin and synthetic polyamide. The nucleotide derivatives would be useful for enhancing the phenotypic diversity of DNA molecules and for exploring new non-natural nucleotides. PMID:23873956

Preparation, Single-Molecule Manipulation, and Energy Transfer Investigation of a Polyfluorene-graft-DNA polymer.

PubMed

Madsen, Mikael; Christensen, Rasmus S; Krissanaprasit, Abhichart; Bakke, Mette R; Riber, Camilla F; Nielsen, Karina S; Zelikin, Alexander N; Gothelf, Kurt V

2017-08-04

Conjugated polymers have been intensively studied due to their unique optical and electronic properties combined with their physical flexibility and scalable bottom up synthesis. Although the bulk qualities of conjugated polymers have been extensively utilized in research and industry, the ability to handle and manipulate conjugated polymers at the nanoscale lacks significantly behind. Here, the toolbox for controlled manipulation of conjugated polymers was expanded through the synthesis of a polyfluorene-DNA graft-type polymer (poly(F-DNA)). The polymer possesses the characteristics associated with the conjugated polyfluorene backbone, but the protruding single-stranded DNA provides the material with an exceptional addressability. This study demonstrates controlled single-molecule patterning of poly(F-DNA), as well as energy transfer between two different polymer-DNA conjugates. Finally, highly efficient DNA-directed quenching of polyfluorene fluorescence was shown. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Modeling DNA methylation by analyzing the individual configurations of single molecules

PubMed Central

Affinito, Ornella; Scala, Giovanni; Palumbo, Domenico; Florio, Ermanno; Monticelli, Antonella; Miele, Gennaro; Avvedimento, Vittorio Enrico; Usiello, Alessandro; Chiariotti, Lorenzo; Cocozza, Sergio

2016-01-01

ABSTRACT DNA methylation is often analyzed by reporting the average methylation degree of each cytosine. In this study, we used a single molecule methylation analysis in order to look at the methylation conformation of individual molecules. Using D-aspartate oxidase as a model gene, we performed an in-depth methylation analysis through the developmental stages of 3 different mouse tissues (brain, lung, and gut), where this gene undergoes opposite methylation destiny. This approach allowed us to track both methylation and demethylation processes at high resolution. The complexity of these dynamics was markedly simplified by introducing the concept of methylation classes (MCs), defined as the number of methylated cytosines per molecule, irrespective of their position. The MC concept smooths the stochasticity of the system, allowing a more deterministic description. In this framework, we also propose a mathematical model based on the Markov chain. This model aims to identify the transition probability of a molecule from one MC to another during methylation and demethylation processes. The results of our model suggest that: 1) both processes are ruled by a dominant class of phenomena, namely, the gain or loss of one methyl group at a time; and 2) the probability of a single CpG site becoming methylated or demethylated depends on the methylation status of the whole molecule at that time. PMID:27748645

Topology simplification: Important biological phenomenon or evolutionary relic?. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

NASA Astrophysics Data System (ADS)

Bates, Andrew D.; Maxwell, Anthony

2016-09-01

The review, Disentangling DNA molecules[1], gives an excellent technical description of the phenomenon of topology simplification (TS) by type IIA DNA topoisomerases (topos). In the 20 years since its discovery [2], this effect has attracted a good deal of attention, probably because of its apparently magical nature, and because it seemed to offer a solution to the conundrum that all type II topos rely on ATP hydrolysis, but only bacterial DNA gyrases were known to transduce the free energy of hydrolysis into torsion (supercoiling) in the DNA. It made good sense to think that the other enzymes are using the energy to reduce the level of supercoiling, knotting, and particularly decatenation (unlinking), below equilibrium, since the key activity of the non-supercoiling topos is the removal of links between daughter chromosomes [3]. As Vologodskii discusses [1], there have been a number of theoretical models developed to explain how the local effect of a type II topo can influence the global level of knotting and catenation in large DNA molecules, and he explains how features of two of the most successful models (bent G segment and hooked juxtapositions) may be combined to explain the magnitude of the effect and overcome a kinetic problem with the hooked juxtaposition model.

Single molecule analysis of Trypanosoma brucei DNA replication dynamics.

PubMed

Calderano, Simone Guedes; Drosopoulos, William C; Quaresma, Marina Mônaco; Marques, Catarina A; Kosiyatrakul, Settapong; McCulloch, Richard; Schildkraut, Carl L; Elias, Maria Carolina

2015-03-11

Eukaryotic genome duplication relies on origins of replication, distributed over multiple chromosomes, to initiate DNA replication. A recent genome-wide analysis of Trypanosoma brucei, the etiological agent of sleeping sickness, localized its replication origins to the boundaries of multigenic transcription units. To better understand genomic replication in this organism, we examined replication by single molecule analysis of replicated DNA. We determined the average speed of replication forks of procyclic and bloodstream form cells and we found that T. brucei DNA replication rate is similar to rates seen in other eukaryotes. We also analyzed the replication dynamics of a central region of chromosome 1 in procyclic forms. We present evidence for replication terminating within the central part of the chromosome and thus emanating from both sides, suggesting a previously unmapped origin toward the 5' extremity of chromosome 1. Also, termination is not at a fixed location in chromosome 1, but is rather variable. Importantly, we found a replication origin located near an ORC1/CDC6 binding site that is detected after replicative stress induced by hydroxyurea treatment, suggesting it may be a dormant origin activated in response to replicative stress. Collectively, our findings support the existence of more replication origins in T. brucei than previously appreciated. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Another expert system rule inference based on DNA molecule logic gates

NASA Astrophysics Data System (ADS)

WÄ siewicz, Piotr

2013-10-01

With the help of silicon industry microfluidic processors were invented utilizing nano membrane valves, pumps and microreactors. These so called lab-on-a-chips combined together with molecular computing create molecular-systems-ona- chips. This work presents a new approach to implementation of molecular inference systems. It requires the unique representation of signals by DNA molecules. The main part of this work includes the concept of logic gates based on typical genetic engineering reactions. The presented method allows for constructing logic gates with many inputs and for executing them at the same quantity of elementary operations, regardless of a number of input signals. Every microreactor of the lab-on-a-chip performs one unique operation on input molecules and can be connected by dataflow output-input connections to other ones.

Small-molecule inhibitors of DNA damage-repair pathways: an approach to overcome tumor resistance to alkylating anticancer drugs

PubMed Central

Srinivasan, Ajay; Gold, Barry

2013-01-01

A major challenge in the future development of cancer therapeutics is the identification of biological targets and pathways, and the subsequent design of molecules to combat the drug-resistant cells hiding in virtually all cancers. This therapeutic approach is justified based upon the limited advances in cancer cures over the past 30 years, despite the development of many novel chemotherapies and earlier detection, which often fail due to drug resistance. Among the various targets to overcome tumor resistance are the DNA repair systems that can reverse the cytotoxicity of many clinically used DNA-damaging agents. Some progress has already been made but much remains to be done. We explore some components of the DNA-repair process, which are involved in repair of alkylation damage of DNA, as targets for the development of novel and effective molecules designed to improve the efficacy of existing anticancer drugs. PMID:22709253

Highly sensitive detection of mutations in CHO cell recombinant DNA using multi-parallel single molecule real-time DNA sequencing.

PubMed

Cartwright, Joseph F; Anderson, Karin; Longworth, Joseph; Lobb, Philip; James, David C

2018-06-01

High-fidelity replication of biologic-encoding recombinant DNA sequences by engineered mammalian cell cultures is an essential pre-requisite for the development of stable cell lines for the production of biotherapeutics. However, immortalized mammalian cells characteristically exhibit an increased point mutation frequency compared to mammalian cells in vivo, both across their genomes and at specific loci (hotspots). Thus unforeseen mutations in recombinant DNA sequences can arise and be maintained within producer cell populations. These may affect both the stability of recombinant gene expression and give rise to protein sequence variants with variable bioactivity and immunogenicity. Rigorous quantitative assessment of recombinant DNA integrity should therefore form part of the cell line development process and be an essential quality assurance metric for instances where synthetic/multi-component assemblies are utilized to engineer mammalian cells, such as the assessment of recombinant DNA fidelity or the mutability of single-site integration target loci. Based on Pacific Biosciences (Menlo Park, CA) single molecule real-time (SMRT™) circular consensus sequencing (CCS) technology we developed a rDNA sequence analysis tool to process the multi-parallel sequencing of ∼40,000 single recombinant DNA molecules. After statistical filtering of raw sequencing data, we show that this analytical method is capable of detecting single point mutations in rDNA to a minimum single mutation frequency of 0.0042% (<1/24,000 bases). Using a stable CHO transfectant pool harboring a randomly integrated 5 kB plasmid construct encoding GFP we found that 28% of recombinant plasmid copies contained at least one low frequency (<0.3%) point mutation. These mutations were predominantly found in GC base pairs (85%) and that there was no positional bias in mutation across the plasmid sequence. There was no discernable difference between the mutation frequencies of coding and non

Quantification of DNA-associated proteins inside eukaryotic cells using single-molecule localization microscopy

PubMed Central

Etheridge, Thomas J.; Boulineau, Rémi L.; Herbert, Alex; Watson, Adam T.; Daigaku, Yasukazu; Tucker, Jem; George, Sophie; Jönsson, Peter; Palayret, Matthieu; Lando, David; Laue, Ernest; Osborne, Mark A.; Klenerman, David; Lee, Steven F.; Carr, Antony M.

2014-01-01

Development of single-molecule localization microscopy techniques has allowed nanometre scale localization accuracy inside cells, permitting the resolution of ultra-fine cell structure and the elucidation of crucial molecular mechanisms. Application of these methodologies to understanding processes underlying DNA replication and repair has been limited to defined in vitro biochemical analysis and prokaryotic cells. In order to expand these techniques to eukaryotic systems, we have further developed a photo-activated localization microscopy-based method to directly visualize DNA-associated proteins in unfixed eukaryotic cells. We demonstrate that motion blurring of fluorescence due to protein diffusivity can be used to selectively image the DNA-bound population of proteins. We designed and tested a simple methodology and show that it can be used to detect changes in DNA binding of a replicative helicase subunit, Mcm4, and the replication sliding clamp, PCNA, between different stages of the cell cycle and between distinct genetic backgrounds. PMID:25106872

Distribution of pericellular matrix molecules in the temporomandibular joint and their chondroprotective effects against inflammation

PubMed Central

Chu, Wern Cui; Zhang, Shipin; Sng, Timothy J; Ong, Yu Jie; Tan, Wen-Li; Ang, Vivien Y; Foldager, Casper B; Toh, Wei Seong

2017-01-01

The objectives of this study were to (1) determine the distribution and synthesis of pericellular matrix (PCM) molecules (collagen VI, collagen IV and laminin) in rat temporomandibular joint (TMJ) and (2) investigate the effects of PCM molecules on chondrocytes against inflammation in osteoarthritis. Four zones (fibrous, proliferating, mature and hypertrophic) of condylar cartilage and three bands (anterior, intermediate and posterior) of disc were analysed by immunohistochemistry for the presence of PCM molecules in rat TMJs. Isolated chondrocytes were pre-treated with PCM molecules before being subjected to interleukin (IL)-1β treatment to stimulate inflammation. The responses of the chondrocytes were analysed using gene expression, nitric oxide release and matrix metalloproteinase (MMP)-13 production measures. Histomorphometric analyses revealed that the highest areal deposition of collagen VI (67.4%), collagen IV (45.7%) and laminin (52.4%) was in the proliferating zone of TMJ condylar cartilage. No significant difference in the distribution of PCM molecules was noted among the three bands of the TMJ disc. All three PCM molecules were expressed intracellularly by chondrocytes cultured in the monolayer. Among the PCM molecules, pre-treatment with collagen VI enhanced cellular proliferation, ameliorated IL-1β-induced MMP-3, MMP-9, MMP-13 and inducible nitric oxide synthase gene expression, and attenuated the downregulation of cartilage matrix genes, including collagen I, aggrecan and cartilage oligomeric matrix protein (COMP). Concurrently, collagen VI pretreatment inhibited nitric oxide and MMP-13 production. Our study demonstrates for the first time the distribution and role of PCM molecules, particularly collagen VI, in the protection of chondrocytes against inflammation. PMID:28282029

Simultaneous Single-Molecule Force and Fluorescence Sampling of DNA Nanostructure Conformations Using Magnetic Tweezers.

PubMed

Kemmerich, Felix E; Swoboda, Marko; Kauert, Dominik J; Grieb, M Svea; Hahn, Steffen; Schwarz, Friedrich W; Seidel, Ralf; Schlierf, Michael

2016-01-13

We present a hybrid single-molecule technique combining magnetic tweezers and Förster resonance energy transfer (FRET) measurements. Through applying external forces to a paramagnetic sphere, we induce conformational changes in DNA nanostructures, which are detected in two output channels simultaneously. First, by tracking a magnetic bead with high spatial and temporal resolution, we observe overall DNA length changes along the force axis. Second, the measured FRET efficiency between two fluorescent probes monitors local conformational changes. The synchronized orthogonal readout in different observation channels will facilitate deciphering the complex mechanisms of biomolecular machines.

Extracting physical chemistry from mechanics: a new approach to investigate DNA interactions with drugs and proteins in single molecule experiments.

PubMed

Rocha, M S

2015-09-01

In this review we focus on the idea of establishing connections between the mechanical properties of DNA-ligand complexes and the physical chemistry of DNA-ligand interactions. This type of connection is interesting because it opens the possibility of performing a robust characterization of such interactions by using only one experimental technique: single molecule stretching. Furthermore, it also opens new possibilities in comparing results obtained by very different approaches, in particular when comparing single molecule techniques to ensemble-averaging techniques. We start the manuscript reviewing important concepts of DNA mechanics, from the basic mechanical properties to the Worm-Like Chain model. Next we review the basic concepts of the physical chemistry of DNA-ligand interactions, revisiting the most important models used to analyze the binding data and discussing their binding isotherms. Then, we discuss the basic features of the single molecule techniques most used to stretch DNA-ligand complexes and to obtain "force × extension" data, from which the mechanical properties of the complexes can be determined. We also discuss the characteristics of the main types of interactions that can occur between DNA and ligands, from covalent binding to simple electrostatic driven interactions. Finally, we present a historical survey of the attempts to connect mechanics to physical chemistry for DNA-ligand systems, emphasizing a recently developed fitting approach useful to connect the persistence length of DNA-ligand complexes to the physicochemical properties of the interaction. Such an approach in principle can be used for any type of ligand, from drugs to proteins, even if multiple binding modes are present.

Robust joint score tests in the application of DNA methylation data analysis.

PubMed

Li, Xuan; Fu, Yuejiao; Wang, Xiaogang; Qiu, Weiliang

2018-05-18

Recently differential variability has been showed to be valuable in evaluating the association of DNA methylation to the risks of complex human diseases. The statistical tests based on both differential methylation level and differential variability can be more powerful than those based only on differential methylation level. Anh and Wang (2013) proposed a joint score test (AW) to simultaneously detect for differential methylation and differential variability. However, AW's method seems to be quite conservative and has not been fully compared with existing joint tests. We proposed three improved joint score tests, namely iAW.Lev, iAW.BF, and iAW.TM, and have made extensive comparisons with the joint likelihood ratio test (jointLRT), the Kolmogorov-Smirnov (KS) test, and the AW test. Systematic simulation studies showed that: 1) the three improved tests performed better (i.e., having larger power, while keeping nominal Type I error rates) than the other three tests for data with outliers and having different variances between cases and controls; 2) for data from normal distributions, the three improved tests had slightly lower power than jointLRT and AW. The analyses of two Illumina HumanMethylation27 data sets GSE37020 and GSE20080 and one Illumina Infinium MethylationEPIC data set GSE107080 demonstrated that three improved tests had higher true validation rates than those from jointLRT, KS, and AW. The three proposed joint score tests are robust against the violation of normality assumption and presence of outlying observations in comparison with other three existing tests. Among the three proposed tests, iAW.BF seems to be the most robust and effective one for all simulated scenarios and also in real data analyses.

Single-molecule FRET studies of the cooperative and non-cooperative binding kinetics of the bacteriophage T4 single-stranded DNA binding protein (gp32) to ssDNA lattices at replication fork junctions

PubMed Central

Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.

2016-01-01

Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621

Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

PubMed Central

Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

2015-01-01

In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

Single-molecule manipulation reveals supercoiling-dependent modulation of lac repressor-mediated DNA looping

PubMed Central

Normanno, Davide; Vanzi, Francesco; Pavone, Francesco Saverio

2008-01-01

Gene expression regulation is a fundamental biological process which deploys specific sets of genomic information depending on physiological or environmental conditions. Several transcription factors (including lac repressor, LacI) are present in the cell at very low copy number and increase their local concentration by binding to multiple sites on DNA and looping the intervening sequence. In this work, we employ single-molecule manipulation to experimentally address the role of DNA supercoiling in the dynamics and stability of LacI-mediated DNA looping. We performed measurements over a range of degrees of supercoiling between −0.026 and +0.026, in the absence of axial stretching forces. A supercoiling-dependent modulation of the lifetimes of both the looped and unlooped states was observed. Our experiments also provide evidence for multiple structural conformations of the LacI–DNA complex, depending on torsional constraints. The supercoiling-dependent modulation demonstrated here adds an important element to the model of the lac operon. In fact, the complex network of proteins acting on the DNA in a living cell constantly modifies its topological and mechanical properties: our observations demonstrate the possibility of establishing a signaling pathway from factors affecting DNA supercoiling to transcription factors responsible for the regulation of specific sets of genes. PMID:18310101

Investigating Deinococcus radiodurans RecA protein filament formation on dsDNA by a real-time single-molecule approach

PubMed Central

Hsu, Hsin-Fang; Ngo, Khanh V.; Chitteni-Pattu, Sindhu; Cox, Michael M.; Li, Hung-Wen

2011-01-01

With the aid of an efficient, precise, and almost error-free DNA repair system, Deinococcus radiodurans can survive hundreds of double strand breaks inflicted by high doses of irradiation or desiccation. The RecA of Deinococcus radiodurans (DrRecA) plays a central role both in the early phase of repair by an extended synthesis-dependent strand annealing process and in the later more general homologous recombination phase. Both roles likely require DrRecA filament formation on duplex DNA. We have developed single-molecule tethered particle motion (TPM) experiments to study the assembly dynamics of RecA proteins on individual duplex DNA molecules by observing changes in DNA tether length resulting from RecA binding. We demonstrate that DrRecA nucleation on dsDNA is much faster than Escherichia coli (Ec) RecA protein, but the extension is slower. This combination of attributes would tend to increase the number and decrease the length of DrRecA filaments relative to those of EcRecA, a feature that may reflect the requirement to repair hundreds of genomic double strand breaks concurrently in irradiated Deinococcus cells. PMID:21853996

Influence of Ionic Liquids on Thermodynamics of Small Molecule-DNA Interaction: The Binding of Ethidium Bromide to Calf Thymus DNA.

PubMed

Mishra, Arpit; Ekka, Mary Krishna; Maiti, Souvik

2016-03-17

Ionic liquids (ILs) are salts with poor ionic coordination, resultantly remaining in liquid state below 100 °C and some may retain liquid state even at room temperature. ILs are known to provide a conducive environment for many biological enzymatic reactions, but their interaction with biomacromolecules are poorly understood. In the present study, we investigate the effect of various ionic liquids on DNA-small molecule interaction using calf thymus DNA (ctDNA)-ethidium bromide (EB) as a model system. The effect of various ionic liquids on these interactions is studied by an array of techniques such as circular dichroism (CD), UV melting, fluorescence exclusion and isothermal titration calorimetry. Interestingly, we observed that presence of IL increased the stability of ctDNA without altering its structure. The binding affinities Kbs for EB binding to ctDNA in the presence of 300 mM ILs are about half order of magnitude smaller than the Kbs in absence of ILs and correspond to a less favorable free energy. We noted that, when adjusted to corresponding buffer condition, the unfavorable shift in ΔG of ctDNA-EB interaction is attributed to decreased entropy in the case of ILs, whereas the same effect by NaCl was due to increased enthalpy.

DNA Physical Mapping via the Controlled Translocation of Single Molecules through a 5-10nm Silicon Nitride Nanopore

NASA Astrophysics Data System (ADS)

Stein, Derek; Reisner, Walter; Jiang, Zhijun; Hagerty, Nick; Wood, Charles; Chan, Jason

2009-03-01

The ability to map the binding position of sequence-specific markers, including transcription-factors, protein-nucleic acids (PNAs) or deactivated restriction enzymes, along a single DNA molecule in a nanofluidic device would be of key importance for the life-sciences. Such markers could give an indication of the active genes at particular stage in a cell's transcriptional cycle, pinpoint the location of mutations or even provide a DNA barcode that could aid in genomics applications. We have developed a setup consisting of a 5-10 nm nanopore in a 20nm thick silicon nitride film coupled to an optical tweezer setup. The translocation of DNA across the nanopore can be detected via blockades in the electrical current through the pore. By anchoring one end of the translocating DNA to an optically trapped microsphere, we hope to stretch out the molecule in the nanopore and control the translocation speed, enabling us to slowly scan across the genome and detect changes in the baseline current due to the presence of bound markers.

Label-free in-flow detection of single DNA molecules using glass nanopipettes.

PubMed

Gong, Xiuqing; Patil, Amol V; Ivanov, Aleksandar P; Kong, Qingyuan; Gibb, Thomas; Dogan, Fatma; deMello, Andrew J; Edel, Joshua B

2014-01-07

With the view of enhancing the functionality of label-free single molecule nanopore-based detection, we have designed and developed a highly robust, mechanically stable, integrated nanopipette-microfluidic device which combines the recognized advantages of microfluidic systems and the unique properties/advantages of nanopipettes. Unlike more typical planar solid-state nanopores, which have inherent geometrical constraints, nanopipettes can be easily positioned at any point within a microfluidic channel. This is highly advantageous, especially when taking into account fluid flow properties. We show that we are able to detect and discriminate between DNA molecules of varying lengths when motivated through a microfluidic channel, upon the application of appropriate voltage bias across the nanopipette. The effects of applied voltage and volumetric flow rates have been studied to ascertain translocation event frequency and capture rate. Additionally, by exploiting the advantages associated with microfluidic systems (such as flow control and concomitant control over analyte concentration/presence), we show that the technology offers a new opportunity for single molecule detection and recognition in microfluidic devices.

Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

PubMed Central

Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

2016-01-01

DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

PubMed

Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2018-03-20

A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Crowding Induces Complex Ergodic Diffusion and Dynamic Elongation of Large DNA Molecules

PubMed Central

Chapman, Cole D.; Gorczyca, Stephanie; Robertson-Anderson, Rae M.

2015-01-01

Despite the ubiquity of molecular crowding in living cells, the effects of crowding on the dynamics of genome-sized DNA are poorly understood. Here, we track single, fluorescent-labeled large DNA molecules (11, 115 kbp) diffusing in dextran solutions that mimic intracellular crowding conditions (0–40%), and determine the effects of crowding on both DNA mobility and conformation. Both DNAs exhibit ergodic Brownian motion and comparable mobility reduction in all conditions; however, crowder size (10 vs. 500 kDa) plays a critical role in the underlying diffusive mechanisms and dependence on crowder concentration. Surprisingly, in 10-kDa dextran, crowder influence saturates at ∼20% with an ∼5× drop in DNA diffusion, in stark contrast to exponentially retarded mobility, coupled to weak anomalous subdiffusion, with increasing concentration of 500-kDa dextran. Both DNAs elongate into lower-entropy states (compared to random coil conformations) when crowded, with elongation states that are gamma distributed and fluctuate in time. However, the broadness of the distribution of states and the time-dependence and length scale of elongation length fluctuations depend on both DNA and crowder size with concentration having surprisingly little impact. Results collectively show that mobility reduction and coil elongation of large crowded DNAs are due to a complex interplay between entropic effects and crowder mobility. Although elongation and initial mobility retardation are driven by depletion interactions, subdiffusive dynamics, and the drastic exponential slowing of DNA, up to ∼300×, arise from the reduced mobility of larger crowders. Our results elucidate the highly important and widely debated effects of cellular crowding on genome-sized DNA. PMID:25762333

Visualization of nanoconstructions with DNA-Aptamers for targeted molecules binding on the surface of screen-printed electrodes

NASA Astrophysics Data System (ADS)

Lapin, Ivan N.; Shabalina, Anastasiia V.; Svetlichyi, Valery A.; Kolovskaya, Olga S.

2018-04-01

Nanoconstructions of gold nanoparticles (NPs) obtained via pulsed laser ablation in liquid with DNA-aptamer specific to protein tumor marker were visualized on the surface of screen-printed electrode using scanning electron microscopy (SEM) and confocal laser scanning microscopy (CLSM). AuNPs/aptamer nanoconstuctions distribution on the solid surface was studied. More uniform coverage of the carbon electrode surface with the nanoconstuctions was showed in comparison with DNA-aptamer alone on the golden electrode surface. Targeted binding of the tumor marker molecules with the AuNPs/DNA-aptamer nanoconstuctions was approved.

Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory.

PubMed

Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-Ichi; Sugimoto, Naoki

2015-12-02

In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water-water interactions, (ii) ethylene glycol more effectively disrupted water-water interactions around Watson-Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson-Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Competition between B-Z and B-L transitions in a single DNA molecule: Computational studies

NASA Astrophysics Data System (ADS)

Kwon, Ah-Young; Nam, Gi-Moon; Johner, Albert; Kim, Seyong; Hong, Seok-Cheol; Lee, Nam-Kyung

2016-02-01

Under negative torsion, DNA adopts left-handed helical forms, such as Z-DNA and L-DNA. Using the random copolymer model developed for a wormlike chain, we represent a single DNA molecule with structural heterogeneity as a helical chain consisting of monomers which can be characterized by different helical senses and pitches. By Monte Carlo simulation, where we take into account bending and twist fluctuations explicitly, we study sequence dependence of B-Z transitions under torsional stress and tension focusing on the interaction with B-L transitions. We consider core sequences, (GC) n repeats or (TG) n repeats, which can interconvert between the right-handed B form and the left-handed Z form, imbedded in a random sequence, which can convert to left-handed L form with different (tension dependent) helical pitch. We show that Z-DNA formation from the (GC) n sequence is always supported by unwinding torsional stress but Z-DNA formation from the (TG) n sequence, which are more costly to convert but numerous, can be strongly influenced by the quenched disorder in the surrounding random sequence.

The Mitochondrial Transcription Factor TFAM Coordinates the Assembly of Multiple DNA Molecules into Nucleoid-like Structures

PubMed Central

Kaufman, Brett A.; Durisic, Nela; Mativetsky, Jeffrey M.; Costantino, Santiago; Hancock, Mark A.; Grutter, Peter

2007-01-01

Packaging DNA into condensed structures is integral to the transmission of genomes. The mammalian mitochondrial genome (mtDNA) is a high copy, maternally inherited genome in which mutations cause a variety of multisystem disorders. In all eukaryotic cells, multiple mtDNAs are packaged with protein into spheroid bodies called nucleoids, which are the fundamental units of mtDNA segregation. The mechanism of nucleoid formation, however, remains unknown. Here, we show that the mitochondrial transcription factor TFAM, an abundant and highly conserved High Mobility Group box protein, binds DNA cooperatively with nanomolar affinity as a homodimer and that it is capable of coordinating and fully compacting several DNA molecules together to form spheroid structures. We use noncontact atomic force microscopy, which achieves near cryo-electron microscope resolution, to reveal the structural details of protein–DNA compaction intermediates. The formation of these complexes involves the bending of the DNA backbone, and DNA loop formation, followed by the filling in of proximal available DNA sites until the DNA is compacted. These results indicate that TFAM alone is sufficient to organize mitochondrial chromatin and provide a mechanism for nucleoid formation. PMID:17581862

Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami

PubMed Central

2017-01-01

Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 103 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale. PMID:29166033

Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami.

PubMed

Chikkaraddy, Rohit; Turek, V A; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F; Baumberg, Jeremy J

2018-01-10

Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 10 3 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale.

Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami

NASA Astrophysics Data System (ADS)

Chikkaraddy, Rohit; Turek, V. A.; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F.; Baumberg, Jeremy J.

2018-01-01

Fabricating nanocavities in which optically-active single quantum emitters are precisely positioned, is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore, and obtain enhancements of $\\geq4\\times10^3$ with high quantum yield ($\\geq50$%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of $\\pm1.5$ nm. Our approach introduces a straightforward non-invasive way to measure and quantify confined optical modes on the nanoscale.

Structure of Escherichia coli dGTP Triphosphohydrolase: A Hexameric Enzyme with DNA Effector Molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Deepa; Gawel, Damian; Itsko, Mark

The Escherichia coli dgt gene encodes a dGTP triphosphohydrolase whose detailed role still remains to be determined. Deletion of dgt creates a mutator phenotype, indicating that the dGTPase has a fidelity role, possibly by affecting the cellular dNTP pool. In the present paper, we have investigated the structure of the Dgt protein at 3.1-Å resolution. One of the obtained structures revealed a protein hexamer that contained two molecules of single-stranded DNA. The presence of DNA caused significant conformational changes in the enzyme, including in the catalytic site of the enzyme. Dgt preparations lacking DNA were able to bind single-stranded DNAmore » with high affinity (K d ~ 50 nM). DNA binding positively affected the activity of the enzyme: dGTPase activity displayed sigmoidal (cooperative) behavior without DNA but hyperbolic (Michaelis-Menten) kinetics in its presence, consistent with a specific lowering of the apparent K m for dGTP. A mutant Dgt enzyme was also created containing residue changes in the DNA binding cleft. This mutant enzyme, whereas still active, was incapable of DNA binding and could no longer be stimulated by addition of DNA. We also created an E. coli strain containing the mutant dgt gene on the chromosome replacing the wild-type gene. The mutant also displayed a mutator phenotype. Finally, our results provide insight into the allosteric regulation of the enzyme and support a physiologically important role of DNA binding.« less

Structure of Escherichia coli dGTP Triphosphohydrolase: A Hexameric Enzyme with DNA Effector Molecules

DOE PAGES

Singh, Deepa; Gawel, Damian; Itsko, Mark; ...

2015-02-18

The Escherichia coli dgt gene encodes a dGTP triphosphohydrolase whose detailed role still remains to be determined. Deletion of dgt creates a mutator phenotype, indicating that the dGTPase has a fidelity role, possibly by affecting the cellular dNTP pool. In the present paper, we have investigated the structure of the Dgt protein at 3.1-Å resolution. One of the obtained structures revealed a protein hexamer that contained two molecules of single-stranded DNA. The presence of DNA caused significant conformational changes in the enzyme, including in the catalytic site of the enzyme. Dgt preparations lacking DNA were able to bind single-stranded DNAmore » with high affinity (K d ~ 50 nM). DNA binding positively affected the activity of the enzyme: dGTPase activity displayed sigmoidal (cooperative) behavior without DNA but hyperbolic (Michaelis-Menten) kinetics in its presence, consistent with a specific lowering of the apparent K m for dGTP. A mutant Dgt enzyme was also created containing residue changes in the DNA binding cleft. This mutant enzyme, whereas still active, was incapable of DNA binding and could no longer be stimulated by addition of DNA. We also created an E. coli strain containing the mutant dgt gene on the chromosome replacing the wild-type gene. The mutant also displayed a mutator phenotype. Finally, our results provide insight into the allosteric regulation of the enzyme and support a physiologically important role of DNA binding.« less

Localization microscopy of DNA in situ using Vybrant(®) DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution.

PubMed

Żurek-Biesiada, Dominika; Szczurek, Aleksander T; Prakash, Kirti; Mohana, Giriram K; Lee, Hyun-Keun; Roignant, Jean-Yves; Birk, Udo J; Dobrucki, Jurek W; Cremer, Christoph

2016-05-01

Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant(®) DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10(6) signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. Copyright © 2016. Published by Elsevier Inc.

The nature of the force-induced conformation transition of dsDNA studied by using single molecule force spectroscopy.

PubMed

Liu, Ningning; Bu, Tianjia; Song, Yu; Zhang, Wei; Li, Jinjing; Zhang, Wenke; Shen, Jiacong; Li, Hongbin

2010-06-15

Single-stranded DNA binding proteins (SSB) interact with single-stranded DNA (ssDNA) specifically. Taking advantage of this character, we have employed Bacillus subtilis SSB protein to investigate the nature of force-induced conformation transition of double-stranded DNA (dsDNA) by using AFM-based single molecule force spectroscopy (SMFS) technique. Our results show that, when a dsDNA is stretched beyond its contour length, the dsDNA is partially melted, producing some ssDNA segments which can be captured by SSB proteins. We have also systematically investigated the effects of stretching length, waiting time, and salt concentration on the conformation transition of dsDNA and SSB-ssDNA interactions, respectively. Furthermore, the effect of proflavine, a DNA intercalator, on the SSB-DNA interactions has been investigated, and the results indicate that the proflavine-saturated dsDNA can be stabilized to the extent that the dsDNA will no longer melt into ssDNA under the mechanical force even up to 150 pN, and no SSB-DNA interactions are detectable.

A New Three-Dimensional Educational Model Kit for Building DNA and RNA Molecules: Development and Evaluation

ERIC Educational Resources Information Center

Beltramini, Leila Maria; Araujo, Ana Paula Ulian; de Oliveira, Tales Henrique Goncalves; dos Santos Abel, Luciano Douglas; da Silva, Aparecido Rodrigues; dos Santos, Neusa Fernandes

2006-01-01

International specialized literature focused on research in biology education is sadly scarce, especially regarding biochemical and molecular aspects. In this light, researchers from this Centre for Structural Molecular Biotechnology developed and evaluated a three-dimensional educational model named "Building Life Molecules DNA and RNA." The…

When Maxwellian demon meets action at a distance. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

NASA Astrophysics Data System (ADS)

Rybenkov, Valentin V.

2016-09-01

The ability of living systems to defy thermodynamics without explicitly violating it is a continued source of inspiration to many biophysicists. The story of type-2 DNA topoisomerases is a beautiful example from that book. DNA topoisomerases catalyze a concerted DNA cleavage-religation reaction, which is interjected by a strand passage event. This sequence of events results in a seemingly unhindered transfer of one piece of DNA through another upon their random collision. An obvious consequence of such transfer is a change in the topological state of the colliding DNAs; hence the name of the enzymes, topoisomerases. There are several classes of topoisomerases, which differ in how they capture the cleaved and transported DNA segments (which are often referred to as the gate and transfer segments; or the G- and T-segments, to be short). Type-2 topoisomerases have two cleavage-religation centers. They open a gate in double stranded DNA and transfer another piece of double stranded DNA through it [1]. And in doing so, they manage to collect information about the rest of the DNA and perform strand passage in a directional manner so as to take the molecule away from the thermodynamic equilibrium [2].

An Overview of the Molecular Mechanisms of Recombinational DNA Repair

PubMed Central

Kowalczykowski, Stephen C.

2015-01-01

Recombinational DNA repair is a universal aspect of DNA metabolism and is essential for genomic integrity. It is a template-directed process that uses a second chromosomal copy (sister, daughter, or homolog) to ensure proper repair of broken chromosomes. The key steps of recombination are conserved from phage through human, and an overview of those steps is provided in this review. The first step is resection by helicases and nucleases to produce single-stranded DNA (ssDNA) that defines the homologous locus. The ssDNA is a scaffold for assembly of the RecA/RAD51 filament, which promotes the homology search. On finding homology, the nucleoprotein filament catalyzes exchange of DNA strands to form a joint molecule. Recombination is controlled by regulating the fate of both RecA/RAD51 filaments and DNA pairing intermediates. Finally, intermediates that mature into Holliday structures are disjoined by either nucleolytic resolution or topological dissolution. PMID:26525148

Substitutions of short heterologous DNA segments of intragenomic or extragenomic origins produce clustered genomic polymorphisms

PubMed Central

Harms, Klaus; Lunnan, Asbjørn; Hülter, Nils; Mourier, Tobias; Vinner, Lasse; Andam, Cheryl P.; Marttinen, Pekka; Fridholm, Helena; Hansen, Anders Johannes; Hanage, William P.; Nielsen, Kaare Magne; Willerslev, Eske; Johnsen, Pål Jarle

2016-01-01

In a screen for unexplained mutation events we identified a previously unrecognized mechanism generating clustered DNA polymorphisms such as microindels and cumulative SNPs. The mechanism, short-patch double illegitimate recombination (SPDIR), facilitates short single-stranded DNA molecules to invade and replace genomic DNA through two joint illegitimate recombination events. SPDIR is controlled by key components of the cellular genome maintenance machinery in the gram-negative bacterium Acinetobacter baylyi. The source DNA is primarily intragenomic but can also be acquired through horizontal gene transfer. The DNA replacements are nonreciprocal and locus independent. Bioinformatic approaches reveal occurrence of SPDIR events in the gram-positive human pathogen Streptococcus pneumoniae and in the human genome. PMID:27956618

Identification of a small molecule that inhibits herpes simplex virus DNA Polymerase subunit interactions and viral replication.

PubMed

Pilger, Beatrice D; Cui, Can; Coen, Donald M

2004-05-01

The interaction between the catalytic subunit Pol and the processivity subunit UL42 of herpes simplex virus DNA polymerase has been characterized structurally and mutationally and is a potential target for novel antiviral drugs. We developed and validated an assay for small molecules that could disrupt the interaction of UL42 and a Pol-derived peptide and used it to screen approximately 16,000 compounds. Of 37 "hits" identified, four inhibited UL42-stimulated long-chain DNA synthesis by Pol in vitro, of which two exhibited little inhibition of polymerase activity by Pol alone. One of these specifically inhibited the physical interaction of Pol and UL42 and also inhibited viral replication at concentrations below those that caused cytotoxic effects. Thus, a small molecule can inhibit this protein-protein interaction, which provides a starting point for the discovery of new antiviral drugs.

Ultrafast and Wide Range Analysis of DNA Molecules Using Rigid Network Structure of Solid Nanowires

PubMed Central

Rahong, Sakon; Yasui, Takao; Yanagida, Takeshi; Nagashima, Kazuki; Kanai, Masaki; Klamchuen, Annop; Meng, Gang; He, Yong; Zhuge, Fuwei; Kaji, Noritada; Kawai, Tomoji; Baba, Yoshinobu

2014-01-01

Analyzing sizes of DNA via electrophoresis using a gel has played an important role in the recent, rapid progress of biology and biotechnology. Although analyzing DNA over a wide range of sizes in a short time is desired, no existing electrophoresis methods have been able to fully satisfy these two requirements. Here we propose a novel method using a rigid 3D network structure composed of solid nanowires within a microchannel. This rigid network structure enables analysis of DNA under applied DC electric fields for a large DNA size range (100 bp–166 kbp) within 13 s, which are much wider and faster conditions than those of any existing methods. The network density is readily varied for the targeted DNA size range by tailoring the number of cycles of the nanowire growth only at the desired spatial position within the microchannel. The rigid dense 3D network structure with spatial density control plays an important role in determining the capability for analyzing DNA. Since the present method allows the spatial location and density of the nanostructure within the microchannels to be defined, this unique controllability offers a new strategy to develop an analytical method not only for DNA but also for other biological molecules. PMID:24918865

Ultrafast and Wide Range Analysis of DNA Molecules Using Rigid Network Structure of Solid Nanowires

NASA Astrophysics Data System (ADS)

Rahong, Sakon; Yasui, Takao; Yanagida, Takeshi; Nagashima, Kazuki; Kanai, Masaki; Klamchuen, Annop; Meng, Gang; He, Yong; Zhuge, Fuwei; Kaji, Noritada; Kawai, Tomoji; Baba, Yoshinobu

2014-06-01

Analyzing sizes of DNA via electrophoresis using a gel has played an important role in the recent, rapid progress of biology and biotechnology. Although analyzing DNA over a wide range of sizes in a short time is desired, no existing electrophoresis methods have been able to fully satisfy these two requirements. Here we propose a novel method using a rigid 3D network structure composed of solid nanowires within a microchannel. This rigid network structure enables analysis of DNA under applied DC electric fields for a large DNA size range (100 bp-166 kbp) within 13 s, which are much wider and faster conditions than those of any existing methods. The network density is readily varied for the targeted DNA size range by tailoring the number of cycles of the nanowire growth only at the desired spatial position within the microchannel. The rigid dense 3D network structure with spatial density control plays an important role in determining the capability for analyzing DNA. Since the present method allows the spatial location and density of the nanostructure within the microchannels to be defined, this unique controllability offers a new strategy to develop an analytical method not only for DNA but also for other biological molecules.

A small-molecule-linked DNA-graphene oxide-based fluorescence-sensing system for detection of biotin.

PubMed

Zhang, Hao; Li, Yan; Su, Xingguang

2013-11-15

In this paper, we establish a novel fluorescence-sensing system for the detection of biotin based on the interaction between DNA and graphene oxide and on protection of the terminal of the biotinylated single-stranded DNA fluorescent probe by streptavidin. In this system, streptavidin binds to the biotinylated DNA, which protects the DNA from hydrolysis by exonuclease I. The streptavidin-DNA conjugate is then adsorbed to the graphene oxide resulting in the fluorescence being quenched. Upon the addition of free biotin, it competes with the labeled biotin for the binding sites of streptavidin and then the exonuclease I digests the unbound DNA probe from the 3' to the 5' terminal, releasing the fluorophore from the DNA. Because of the weak affinity between the fluorophore and graphene oxide, the fluorescence is recovered. Under optimal conditions, the fluorescence intensity is proportional to the concentration of biotin in the concentration range of 0.5-20nmol/L. The detection limit for biotin is 0.44nmol/L. The proposed fluorescence-sensing system was applied to the determination of biotin in some real samples with satisfactory reproducibility and accuracy. This work could provide a common platform for detecting small biomolecules based on protein-small molecule ligand binding. Copyright © 2013 Elsevier Inc. All rights reserved.

A mathematical model for DNA

NASA Astrophysics Data System (ADS)

Sepehri, Alireza

Recently, some authors have shown that a DNA molecule produces electromagnetic signals and communicates with other DNA molecules or other molecules. In fact, a DNA acts like a receiver or transmitter of radio waves. In this paper, we suggest a mathematical model for the DNA molecule and use of its communication to cure some diseases like cancer. In this model, first, by using concepts from string theory and M-theory, we calculate the energy of a DNA in terms of interactions between free electrons and bound electrons. We show that when a DNA is damaged, its energy changes and an extra current is produced. This extra current causes the electromagnetic signals of a damaged DNA molecule to be different when compared to the electromagnetic signals of a normal DNA molecule. The electromagnetic signals of a damaged DNA molecule induce an extra current in a normal DNA molecule and lead to its destruction. By sending crafted electromagnetic signals to normal DNA molecules and inducing an opposite current with respect to this extra current, we can prevent the destruction of normal DNA. Finally, we argue that the type of packing of DNA in chromosomes of men and women is different. This causes radiated waves from DNAs of men and women to have opposite signs and cancel the effect of each other in a pair. Using this property, we suggest another mechanism to cancel the effect of extra waves, which are produced by DNAs in cancer cells of a male or a female, by extra waves which are produced by DNAs in similar cells of a female or a male and prevent the progression of the disease.

Mechanism of How Salt-Gradient-Induced Charges Affect the Translocation of DNA Molecules through a Nanopore

PubMed Central

He, Yuhui; Tsutsui, Makusu; Scheicher, Ralph H.; Fan, Chun; Taniguchi, Masateru; Kawai, Tomoji

2013-01-01

Experiments using nanopores demonstrated that a salt gradient enhances the capture rate of DNA and reduces its translocation speed. These two effects can help to enable electrical DNA sequencing with nanopores. Here, we provide a quantitative theoretical evaluation that shows the positive net charges, which accumulate around the pore entrance due to the salt gradient, are responsible for the two observed effects: they reinforce the electric capture field, resulting in promoted molecule capture rate; and they induce cationic electroosmotic flow through the nanopore, thus significantly retarding the motion of the anionic DNA through the nanopore. Our multiphysical simulation results show that, during the polymer trapping stage, the former effect plays the major role, thus resulting in promoted DNA capture rate, while during the nanopore-penetrating stage the latter effect dominates and consequently reduces the DNA translocation speed significantly. Quantitative agreement with experimental results has been reached by further taking nanopore wall surface charges into account. PMID:23931325

Depth of focus extended microscope configuration for imaging of incorporated groups of molecules, DNA constructs and clusters inside bacterial cells

NASA Astrophysics Data System (ADS)

Fessl, Tomas; Ben-Yaish, Shai; Vacha, Frantisek; Adamec, Frantisek; Zalevsky, Zeev

2009-07-01

Imaging of small objects such as single molecules, DNA clusters and single bacterial cells is problematic not only due to the lateral resolution that is obtainable in currently existing microscopy but also, and as much fundamentally limiting, due to the lack of sufficient axial depth of focus to have the full object focused simultaneously. Extension in depth of focus is helpful also for single molecule steady state FRET measurements. In this technique it is crucial to obtain data from many well focused molecules, which are often located in different axial depths. In this paper we present the implementation of an all-optical and a real time technique of extension in the depth of focus that may be incorporated in any high NA microscope system and to be used for the above mentioned applications. We demonstrate experimentally how after the integration of special optical element in high NA 100× objective lens of a single molecule imaging microscope system, the depth of focus is significantly improved while maintaining the same lateral resolution in imaging applications of incorporated groups of molecules, DNA constructs and clusters inside bacterial cells.

Localization microscopy of DNA in situ using Vybrant{sup ®} DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Żurek-Biesiada, Dominika; Szczurek, Aleksander T.; Prakash, Kirti

Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant{sup ®} DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei ofmore » fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10{sup 6} signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100 nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. - Highlights: • Super-resolution imaging of nuclear DNA with Vybrant Violet and blue excitation. • 90nm resolution images of DNA structures in optically thick eukaryotic nuclei. • Enhanced resolution confirms the existence of DNA-free regions inside the nucleus. • Optimized imaging conditions enable multicolor super-resolution imaging.« less

Methods of DNA methylation detection

NASA Technical Reports Server (NTRS)

Maki, Wusi Chen (Inventor); Filanoski, Brian John (Inventor); Mishra, Nirankar (Inventor); Rastogi, Shiva (Inventor)

2010-01-01

The present invention provides for methods of DNA methylation detection. The present invention provides for methods of generating and detecting specific electronic signals that report the methylation status of targeted DNA molecules in biological samples.Two methods are described, direct and indirect detection of methylated DNA molecules in a nano transistor based device. In the direct detection, methylated target DNA molecules are captured on the sensing surface resulting in changes in the electrical properties of a nano transistor. These changes generate detectable electronic signals. In the indirect detection, antibody-DNA conjugates are used to identify methylated DNA molecules. RNA signal molecules are generated through an in vitro transcription process. These RNA molecules are captured on the sensing surface change the electrical properties of nano transistor thereby generating detectable electronic signals.

Nanosecond to submillisecond dynamics in dye-labeled single-stranded DNA, as revealed by ensemble measurements and photon statistics at single-molecule level.

PubMed

Kaji, Takahiro; Ito, Syoji; Iwai, Shigenori; Miyasaka, Hiroshi

2009-10-22

Single-molecule and ensemble time-resolved fluorescence measurements were applied for the investigation of the conformational dynamics of single-stranded DNA, ssDNA, connected with a fluorescein dye by a C6 linker, where the motions both of DNA and the C6 linker affect the geometry of the system. From the ensemble measurement of the fluorescence quenching via photoinduced electron transfer with a guanine base in the DNA sequence, three main conformations were found in aqueous solution: a conformation unaffected by the guanine base in the excited state lifetime of fluorescein, a conformation in which the fluorescence is dynamically quenched in the excited-state lifetime, and a conformation leading to rapid quenching via nonfluorescent complex. The analysis by using the parameters acquired from the ensemble measurements for interphoton time distribution histograms and FCS autocorrelations by the single-molecule measurement revealed that interconversion in these three conformations took place with two characteristic time constants of several hundreds of nanoseconds and tens of microseconds. The advantage of the combination use of the ensemble measurements with the single-molecule detections for rather complex dynamic motions is discussed by integrating the experimental results with those obtained by molecular dynamics simulation.

Fidelity by design: Yoctoreactor and binder trap enrichment for small-molecule DNA-encoded libraries and drug discovery.

PubMed

Blakskjaer, Peter; Heitner, Tara; Hansen, Nils Jakob Vest

2015-06-01

DNA-encoded small-molecule library (DEL) technology allows vast drug-like small molecule libraries to be efficiently synthesized in a combinatorial fashion and screened in a single tube method for binding, with an assay readout empowered by advances in next generation sequencing technology. This approach has increasingly been applied as a viable technology for the identification of small-molecule modulators to protein targets and as precursors to drugs in the past decade. Several strategies for producing and for screening DELs have been devised by both academic and industrial institutions. This review highlights some of the most significant and recent strategies along with important results. A special focus on the production of high fidelity DEL technologies with the ability to eliminate screening noise and false positives is included: using a DNA junction called the Yoctoreactor, building blocks (BBs) are spatially confined at the center of the junction facilitating both the chemical reaction between BBs and encoding of the synthetic route. A screening method, known as binder trap enrichment, permits DELs to be screened robustly in a homogeneous manner delivering clean data sets and potent hits for even the most challenging targets. Copyright © 2015 Elsevier Ltd. All rights reserved.

A Synthetic DNA-Binding Domain Guides Distinct Chromatin-Modifying Small Molecules to Activate an Identical Gene Network.

PubMed

Han, Le; Pandian, Ganesh N; Chandran, Anandhakumar; Sato, Shinsuke; Taniguchi, Junichi; Kashiwazaki, Gengo; Sawatani, Yoshito; Hashiya, Kaori; Bando, Toshikazu; Xu, Yufang; Qian, Xuhong; Sugiyama, Hiroshi

2015-07-20

Synthetic dual-function ligands targeting specific DNA sequences and histone-modifying enzymes were applied to achieve regulatory control over multi-gene networks in living cells. Unlike the broad array of targeting small molecules for histone deacetylases (HDACs), few modulators are known for histone acetyltransferases (HATs), which play a central role in transcriptional control. As a novel chemical approach to induce selective HAT-regulated genes, we conjugated a DNA-binding domain (DBD) "I" to N-(4-chloro-3-trifluoromethyl-phenyl)-2-ethoxy-benzamide (CTB), an artificial HAT activator. In vitro enzyme activity assays and microarray studies were used to demonstrate that distinct functional small molecules could be transformed to have identical bioactivity when conjugated with a targeting DBD. This proof-of-concept synthetic strategy validates the switchable functions of HDACs and HATs in gene regulation and provides a molecular basis for developing versatile bioactive ligands. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Joint Molecule Resolution Requires the Redundant Activities of MUS-81 and XPF-1 during Caenorhabditis elegans Meiosis

PubMed Central

O'Neil, Nigel J.; Martin, Julie S.; Youds, Jillian L.; Ward, Jordan D.; Petalcorin, Mark I. R.; Rose, Anne M.; Boulton, Simon J.

2013-01-01

The generation and resolution of joint molecule recombination intermediates is required to ensure bipolar chromosome segregation during meiosis. During wild type meiosis in Caenorhabditis elegans, SPO-11-generated double stranded breaks are resolved to generate a single crossover per bivalent and the remaining recombination intermediates are resolved as noncrossovers. We discovered that early recombination intermediates are limited by the C. elegans BLM ortholog, HIM-6, and in the absence of HIM-6 by the structure specific endonuclease MUS-81. In the absence of both MUS-81 and HIM-6, recombination intermediates persist, leading to chromosome breakage at diakinesis and inviable embryos. MUS-81 has an additional role in resolving late recombination intermediates in C. elegans. mus-81 mutants exhibited reduced crossover recombination frequencies suggesting that MUS-81 is required to generate a subset of meiotic crossovers. Similarly, the Mus81-related endonuclease XPF-1 is also required for a subset of meiotic crossovers. Although C. elegans gen-1 mutants have no detectable meiotic defect either alone or in combination with him-6, mus-81 or xpf-1 mutations, mus-81;xpf-1 double mutants are synthetic lethal. While mus-81;xpf-1 double mutants are proficient for the processing of early recombination intermediates, they exhibit defects in the post-pachytene chromosome reorganization and the asymmetric disassembly of the synaptonemal complex, presumably triggered by crossovers or crossover precursors. Consistent with a defect in resolving late recombination intermediates, mus-81; xpf-1 diakinetic bivalents are aberrant with fine DNA bridges visible between two distinct DAPI staining bodies. We were able to suppress the aberrant bivalent phenotype by microinjection of activated human GEN1 protein, which can cleave Holliday junctions, suggesting that the DNA bridges in mus-81; xpf-1 diakinetic oocytes are unresolved Holliday junctions. We propose that the MUS-81 and XPF-1

Visualization of yeast chromosomal DNA

NASA Technical Reports Server (NTRS)

Lubega, Seth

1990-01-01

The DNA molecule is the most significant life molecule since it codes the blue print for other structural and functional molecules of all living organisms. Agarose gel electrophoresis is now being widely used to separate DNA of virus, bacteria, and lower eukaryotes. The task was undertaken of reviewing the existing methods of DNA fractionation and microscopic visualization of individual chromosonal DNA molecules by gel electrophoresis as a basis for a proposed study to investigate the feasibility of separating DNA molecules in free fluids as an alternative to gel electrophoresis. Various techniques were studied. On the molecular level, agarose gel electrophoresis is being widely used to separate chromosomal DNA according to molecular weight. Carl and Olson separate and characterized the entire karyotype of a lab strain of Saccharomyces cerevisiae. Smith et al. and Schwartz and Koval independently reported the visualization of individual DNA molecules migrating through agarose gel matrix during electrophoresis. The techniques used by these researchers are being reviewed in the lab as a basis for the proposed studies.

A new electrochemical method for the detection of cancer cells based on small molecule-linked DNA.

PubMed

Zhao, Jing; Zhu, Li; Guo, Chao; Gao, Tao; Zhu, Xiaoli; Li, Genxi

2013-11-15

Sensitive and accurate detection of cancer cells plays a crucial role in clinical diagnosis, treatment and prognosis of tumors. In this paper, we report a new electrochemical method for highly selective and sensitive detection of cancer cells by using small molecule-linked DNA as probes. The methodology is based on the fact that exonuclease I can catalyze the digestion of folate-linked DNA probes that are immobilized on an electrode surface; however, in the presence of the target cells, such as human breast cancer MCF-7 cells, the probes can be protected from digestion upon the binding with folate receptor that is over-expressed on the cell surface. Consequently, cancer cells can be efficiently detected by monitoring the status of the probe DNA with electrochemical techniques. In this study, the protection to exonuclease I-catalyzed digestion has also been proven by electrochemical studies. Moreover, the proposed method has been proven to linearly detect MCF-7 cells in a wide range from 10(2)-10(6) cell mL(-1) with a low detection limit of 67 cell mL(-1), which can also easily distinguish the folate receptor-negative normal cells, for instance, islet β cells. The reproduction of the detection is also satisfactory, since the relative standard deviations for three independent measurements of different concentration of MCF-7 cells are all within 10%. By replacing the small molecules linked on the DNA probe, other cancer cells can also be detected by making use of this proposed method. Therefore, our cytosensor may have great potential in clinical applications. Copyright © 2013 Elsevier B.V. All rights reserved.

Small-Molecule-Based Self-Assembled Ligands for G-Quadruplex DNA Surface Recognition.

PubMed

Rivera-Sánchez, María Del C; García-Arriaga, Marilyn; Hobley, Gerard; Morales-de-Echegaray, Ana V; Rivera, José M

2017-10-31

Most drugs are small molecules because of their attractive pharmacokinetics, manageable development and manufacturing, and effective binding into the concave crevices of bio-macromolecules. Despite these features, they often fall short when it comes to effectively recognizing the surfaces of bio-macromolecules. One way to overcome the challenge of biomolecular surface recognition is to develop small molecules that become self-assembled ligands (SALs) prior to binding. Herein, we report SALs made from 8-aryl-2'-deoxyguanosine derivatives forming precise hydrophilic supramolecular G-quadruplexes (SGQs) with excellent size, shape, and charge complementarity to G-quadruplex DNA (QDNA). We show that only those compounds forming SGQs act as SALs, which in turn differentially stabilize QDNAs from selected oncogene promoters and the human telomeric regions. Fluorescence resonance energy-transfer melting assays are consistent with spectroscopic, calorimetric, and light scattering studies, showing the formation of a "sandwichlike" complex QDNA·SGQ·QDNA. These results open the door for the advent of SALs that recognize QDNAs and potentially the surfaces of other bio-macromolecules such as proteins.

Reading Out Single-Molecule Digital RNA and DNA Isothermal Amplification in Nanoliter Volumes with Unmodified Camera Phones

PubMed Central

2016-01-01

Digital single-molecule technologies are expanding diagnostic capabilities, enabling the ultrasensitive quantification of targets, such as viral load in HIV and hepatitis C infections, by directly counting single molecules. Replacing fluorescent readout with a robust visual readout that can be captured by any unmodified cell phone camera will facilitate the global distribution of diagnostic tests, including in limited-resource settings where the need is greatest. This paper describes a methodology for developing a visual readout system for digital single-molecule amplification of RNA and DNA by (i) selecting colorimetric amplification-indicator dyes that are compatible with the spectral sensitivity of standard mobile phones, and (ii) identifying an optimal ratiometric image-process for a selected dye to achieve a readout that is robust to lighting conditions and camera hardware and provides unambiguous quantitative results, even for colorblind users. We also include an analysis of the limitations of this methodology, and provide a microfluidic approach that can be applied to expand dynamic range and improve reaction performance, allowing ultrasensitive, quantitative measurements at volumes as low as 5 nL. We validate this methodology using SlipChip-based digital single-molecule isothermal amplification with λDNA as a model and hepatitis C viral RNA as a clinically relevant target. The innovative combination of isothermal amplification chemistry in the presence of a judiciously chosen indicator dye and ratiometric image processing with SlipChip technology allowed the sequence-specific visual readout of single nucleic acid molecules in nanoliter volumes with an unmodified cell phone camera. When paired with devices that integrate sample preparation and nucleic acid amplification, this hardware-agnostic approach will increase the affordability and the distribution of quantitative diagnostic and environmental tests. PMID:26900709

Of Molecules and Models.

ERIC Educational Resources Information Center

Brinner, Bonnie

1992-01-01

Presents an activity in which models help students visualize both the DNA process and transcription. After constructing DNA, RNA messenger, and RNA transfer molecules; students model cells, protein synthesis, codons, and RNA movement. (MDH)

DNA encoding a DNA repair protein

DOEpatents

Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

2006-08-15

An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

Cell-Based Selection Expands the Utility of DNA-Encoded Small-Molecule Library Technology to Cell Surface Drug Targets: Identification of Novel Antagonists of the NK3 Tachykinin Receptor.

PubMed

Wu, Zining; Graybill, Todd L; Zeng, Xin; Platchek, Michael; Zhang, Jean; Bodmer, Vera Q; Wisnoski, David D; Deng, Jianghe; Coppo, Frank T; Yao, Gang; Tamburino, Alex; Scavello, Genaro; Franklin, G Joseph; Mataruse, Sibongile; Bedard, Katie L; Ding, Yun; Chai, Jing; Summerfield, Jennifer; Centrella, Paolo A; Messer, Jeffrey A; Pope, Andrew J; Israel, David I

2015-12-14

DNA-encoded small-molecule library technology has recently emerged as a new paradigm for identifying ligands against drug targets. To date, this technology has been used with soluble protein targets that are produced and used in a purified state. Here, we describe a cell-based method for identifying small-molecule ligands from DNA-encoded libraries against integral membrane protein targets. We use this method to identify novel, potent, and specific inhibitors of NK3, a member of the tachykinin family of G-protein coupled receptors (GPCRs). The method is simple and broadly applicable to other GPCRs and integral membrane proteins. We have extended the application of DNA-encoded library technology to membrane-associated targets and demonstrate the feasibility of selecting DNA-tagged, small-molecule ligands from complex combinatorial libraries against targets in a heterogeneous milieu, such as the surface of a cell.

Ketone-DNA: a versatile postsynthetic DNA decoration platform.

PubMed

Dey, S; Sheppard, T L

2001-12-13

[reaction: see text] A general strategy for the functional diversification of DNA oligonucleotides under physiological conditions was developed. We describe the synthesis of DNA molecules bearing ketone ports (ketone-DNA) and the efficient postsynthetic decoration of ketone-DNA with structurally diverse aminooxy compounds.

Development of programmable small DNA-binding molecules with epigenetic activity for induction of core pluripotency genes.

PubMed

Pandian, Ganesh N; Ohtsuki, Akimichi; Bando, Toshikazu; Sato, Shinsuke; Hashiya, Kaori; Sugiyama, Hiroshi

2012-04-15

Epigenetic modifications that govern the gene expression are often overlooked with the design of artificial genetic switches. N-Methylpyrrole-N-methylimidazole (PI) hairpin polyamides are programmable small DNA binding molecules that have been studied in the context of gene regulation. Recently, we synthesized a library of compounds by conjugating PI polyamides with SAHA, a chromatin-modifier. Among these novel compounds, PI polyamide-SAHA conjugate 1 was shown to epigenetically activate pluripotency genes in mouse embryonic fibroblasts. Here, we report the synthesis of the derivatives of conjugate 1 and demonstrate that these epigenetically active molecules could be developed to improve the induction of pluripotency factors. Copyright © 2012 Elsevier Ltd. All rights reserved.

Targeting of loaded Sendai virus envelopes by covalently attached insulin molecules to virus receptor-depleted cells: fusion-mediated microinjection of ricin A and simian virus 40 DNA.

PubMed

Gitman, A G; Graessmann, A; Loyter, A

1985-11-01

Insulin molecules were covalently attached to detergent-solubilized Sendai virus envelope glycoproteins (HN and F polypeptides) by the use of the crosslinking reagent succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB). Reconstitution of modified viral glycoproteins (carrying covalently attached insulin) together with unmodified viral glycoproteins resulted in the formation of "fusogenic" viral envelopes bearing insulin molecules. Reconstitution of such fusogenic viral envelopes in the presence of ricin A or simian virus 40 (SV40) DNA resulted in the formation of viral envelopes bearing insulin molecules and loaded with ricin A or SV40 DNA. Such viral envelopes were able to bind to hepatoma tissue culture cells (HTCC) from which Sendai virus receptors were removed by treatment with neuraminidase. Incubation of viral envelopes loaded with ricin A with virus receptor-depleted HTCC resulted in fusion-mediated injection of the toxin, as inferred from inhibition of protein synthesis and decrease in cell viability of the microinjected cells. Fusion-mediated injection of SV40 DNA was inferred from the appearance of SV40 tumor antigen in microinjected cells. Binding and fusion of the loaded viral envelopes to neuraminidase-treated HTCC was mediated solely by the virus-associated insulin molecules. Addition of free insulin molecules inhibited binding of the viral envelopes and, consequently, the microinjection of ricin A and SV40 DNA.

Targeting of loaded Sendai virus envelopes by covalently attached insulin molecules to virus receptor-depleted cells: fusion-mediated microinjection of ricin A and simian virus 40 DNA.

PubMed Central

Gitman, A G; Graessmann, A; Loyter, A

1985-01-01

Insulin molecules were covalently attached to detergent-solubilized Sendai virus envelope glycoproteins (HN and F polypeptides) by the use of the crosslinking reagent succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB). Reconstitution of modified viral glycoproteins (carrying covalently attached insulin) together with unmodified viral glycoproteins resulted in the formation of "fusogenic" viral envelopes bearing insulin molecules. Reconstitution of such fusogenic viral envelopes in the presence of ricin A or simian virus 40 (SV40) DNA resulted in the formation of viral envelopes bearing insulin molecules and loaded with ricin A or SV40 DNA. Such viral envelopes were able to bind to hepatoma tissue culture cells (HTCC) from which Sendai virus receptors were removed by treatment with neuraminidase. Incubation of viral envelopes loaded with ricin A with virus receptor-depleted HTCC resulted in fusion-mediated injection of the toxin, as inferred from inhibition of protein synthesis and decrease in cell viability of the microinjected cells. Fusion-mediated injection of SV40 DNA was inferred from the appearance of SV40 tumor antigen in microinjected cells. Binding and fusion of the loaded viral envelopes to neuraminidase-treated HTCC was mediated solely by the virus-associated insulin molecules. Addition of free insulin molecules inhibited binding of the viral envelopes and, consequently, the microinjection of ricin A and SV40 DNA. PMID:2997783

The Alarmin Properties of DNA and DNA-associated Nuclear Proteins.

PubMed

Magna, Melinda; Pisetsky, David S

2016-05-01

The communication of cell injury and death is a critical element in host defense. Although immune cells can serve this function by elaborating cytokines and chemokines, somatic cells can repurpose nuclear macromolecules to function as damage-associated molecular patterns (DAMPs) or alarmins to exert similar activity. Among these molecules, DNA, high-mobility group box-1, and histone proteins can all act as DAMPs once they are in an extracellular location. This review describes current information on the role of the nuclear DAMPs, their translocation to the outside of cells, and pathways of activation after uptake into the inside of immune cells. MEDLINE and PubMed databases were searched for citations (1990-2016) in English related to the following terms: DAMPs, high-mobility group box-1, DNA, histones, cell death, danger, and immune activation. Selected articles with the most relevant studies were included for a more detailed consideration. Although nuclear molecules have important structural and genetic regulatory roles inside the cell nucleus, when released into the extracellular space during cell death, these molecules can acquire immune activity and serve as alarmins or DAMPs. Although apoptosis is generally considered the source of extracellular nuclear material, other cell death pathways such as necroptosis, NETosis, and pyroptosis can contribute to the release of nuclear molecules. Importantly, the release of nuclear DAMPs occurs with both soluble and particulate forms of these molecules. The activity of nuclear molecules may depend on posttranslational modifications, redox changes, and the binding of other molecules. Once in an extracellular location, nuclear DAMPs can engage the same pattern recognition receptors as do pathogen-associated molecular patterns. These interactions can activate immune cells and lead to cytokine and chemokine production. Among these receptors, internal receptors for DNA are key to the response to this molecule; the likely

DNA nanotechnology-enabled biosensors.

PubMed

Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai

2016-02-15

Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.

Nanomaterials Based on DNA

PubMed Central

Seeman, Nadrian C.

2012-01-01

The combination of synthetic stable branched DNA and sticky ended cohesion has led to the development of structural DNA nanotechnology over the past 30 years. The basis of this enterprise is that it is possible to construct novel DNA-based materials by combining these features in a self-assembly protocol. Thus, simple branched molecules lead directly to the construction of polyhedra whose edges consist of double helical DNA, and whose vertices correspond to the branch points. Stiffer branched motifs can be used to produce self-assembled two-dimensional and three-dimensional periodic lattices of DNA (crystals). DNA has also been used to make a variety of nanomechanical devices, including molecules that change their shapes, and molecules that can walk along a DNA sidewalk. Devices have been incorporated into two-dimensional DNA arrangements; sequence-dependent devices are driven by increases in nucleotide pairing at each step in their machine cycles. PMID:20222824

A single-molecule sequencing assay for the comprehensive profiling of T4 DNA ligase fidelity and bias during DNA end-joining.

PubMed

Potapov, Vladimir; Ong, Jennifer L; Langhorst, Bradley W; Bilotti, Katharina; Cahoon, Dan; Canton, Barry; Knight, Thomas F; Evans, Thomas C; Lohman, Gregory Js

2018-05-08

DNA ligases are key enzymes in molecular and synthetic biology that catalyze the joining of breaks in duplex DNA and the end-joining of DNA fragments. Ligation fidelity (discrimination against the ligation of substrates containing mismatched base pairs) and bias (preferential ligation of particular sequences over others) have been well-studied in the context of nick ligation. However, almost no data exist for fidelity and bias in end-joining ligation contexts. In this study, we applied Pacific Biosciences Single-Molecule Real-Time sequencing technology to directly sequence the products of a highly multiplexed ligation reaction. This method has been used to profile the ligation of all three-base 5'-overhangs by T4 DNA ligase under typical ligation conditions in a single experiment. We report the relative frequency of all ligation products with or without mismatches, the position-dependent frequency of each mismatch, and the surprising observation that 5'-TNA overhangs ligate extremely inefficiently compared to all other Watson-Crick pairings. The method can easily be extended to profile other ligases, end-types (e.g. blunt ends and overhangs of different lengths), and the effect of adjacent sequence on the ligation results. Further, the method has the potential to provide new insights into the thermodynamics of annealing and the kinetics of end-joining reactions.

Reinforced self-assembly of donor-acceptor π-conjugated molecules to DNA templates by dipole-dipole interactions together with complementary hydrogen bonding interactions for biomimetics.

PubMed

Yang, Wanggui; Chen, Yali; Wong, Man Shing; Lo, Pik Kwan

2012-10-08

One of the most important criteria for the successful DNA-templated polymerization to generate fully synthetic biomimetic polymers is to design the complementary structural monomers, which assemble to the templates strongly and precisely before carrying polymerization. In this study, water-soluble, laterally thymine-substituted donor-acceptor π-conjugated molecules were designed and synthesized to self-assemble with complementary oligoadenines templates, dA(20) and dA(40), into stable and tubular assemblies through noncovalent interactions including π-π stacking, dipole-dipole interactions, and the complementary adenine-thymine (A-T) hydrogen-bonding. UV-vis, fluorescence, circular dichroism (CD), atomic force microscopy (AFM), and transmission electron microscopy (TEM) techniques were used to investigate the formation of highly robust nanofibrous structures. Our results have demonstrated for the first time that the dipole-dipole interactions are stronger and useful to reinforce the assembly of donor-acceptor π-conjugated molecules to DNA templates and the formation of the stable and robust supramolecular nanofibrous complexes together with the complementary hydrogen bonding interactions. This provides an initial step toward DNA-templated polymerization to create fully synthetic DNA-mimetic polymers for biotechnological applications. This study also presents an opportunity to precisely position donor-acceptor type molecules in a controlled manner and tailor-make advanced materials for various biotechnological applications.

Theory of high-force DNA stretching and overstretching.

PubMed

Storm, C; Nelson, P C

2003-05-01

Single-molecule experiments on single- and double-stranded DNA have sparked a renewed interest in the force versus extension of polymers. The extensible freely jointed chain (FJC) model is frequently invoked to explain the observed behavior of single-stranded DNA, but this model does not satisfactorily describe recent high-force stretching data. We instead propose a model (the discrete persistent chain) that borrows features from both the FJC and the wormlike chain, and show that it resembles the data more closely. We find that most of the high-force behavior previously attributed to stretch elasticity is really a feature of the corrected entropic elasticity; the true stretch compliance of single-stranded DNA is several times smaller than that found by previous authors. Next we elaborate our model to allow coexistence of two conformational states of DNA, each with its own stretch and bend elastic constants. Our model is computationally simple and gives an excellent fit through the entire overstretching transition of nicked, double-stranded DNA. The fit gives the first value for the bend stiffness of the overstretched state. In particular, we find the effective bend stiffness for DNA in this state to be about 12 nm k(B)T, a value quite different from either the B-form or single-stranded DNA.

The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET.

PubMed

Yang, Mengyi; Peng, Sijia; Sun, Ruirui; Lin, Jingdi; Wang, Nan; Chen, Chunlai

2018-01-09

Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

DOEpatents

Gardner, Shea N [San Leandro, CA; Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Young, Jennifer A [Berkeley, CA; Clague, David S [Livermore, CA

2011-01-18

A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.

DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules.

PubMed

Eernisse, D J

1992-04-01

DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.

Fluorescence Microscopy of Nanochannel-Confined DNA.

PubMed

Westerlund, Fredrik; Persson, Fredrik; Fritzsche, Joachim; Beech, Jason P; Tegenfeldt, Jonas O

2018-01-01

Stretching of DNA in nanoscale confinement allows for several important studies. The genetic contents of the DNA can be visualized on the single DNA molecule level and both the polymer physics of confined DNA and also DNA/protein and other DNA/DNA-binding molecule interactions can be explored. This chapter describes the basic steps to fabricate the nanostructures, perform the experiments and analyze the data.

Irradiation of DNA loaded with platinum containing molecules by fast atomic ions C(6+) and Fe(26+).

PubMed

Usami, N; Kobayashi, K; Furusawa, Y; Frohlich, H; Lacombe, S; Sech, C Le

2007-09-01

In order to study the role of the Linear Energy Transfer (LET) of fast atomic ions in platinum-DNA complexes inducing breaks, DNA Plasmids were irradiated by C(6+) and Fe(26+) ions. DNA Plasmids (pBR322) loaded with different amounts of platinum contained in a terpyridine-platinum molecule (PtTC) were irradiated by C(6+) ions and Fe(26+) ions. The LET values ranged between 13.4 keV/microm and 550 keV/microm. In some experiments, dimethyl sulfoxide (DMSO) was added. In all experiments, a significant increase in DNA strand breaks was observed when platinum was present. The yield of breaks induced per Gray decreased when the LET increased. The yield of single and double strand breaks per plasmid per track increased with the LET, indicating that the number of DNA breaks per Gray was related to the number of tracks through the medium. These findings show that more DNA breaks are induced by atomic ions when platinum is present. This effect increases for low LET heavy atoms. As DSB induction may induce cell death, these results could open new perspectives with the association of hadrontherapy and chemotherapy. Thus the therapeutic index might be improved by loading the tumour with platinum salts.

Microarray Detection of Duplex and Triplex DNA Binders with DNA-Modified Gold Nanoparticles

PubMed Central

Lytton-Jean, Abigail K. R.; Han, Min Su; Mirkin, Chad A.

2008-01-01

We have designed a chip-based assay, using microarray technology, for determining the relative binding affinities of duplex and triplex DNA binders. This assay combines the high discrimination capabilities afforded by DNA-modified Au nanoparticles with the high-throughput capabilities of DNA microarrays. The detection and screening of duplex DNA binders are important because these molecules, in many cases, are potential anticancer agents as well as toxins. Triplex DNA binders are also promising drug candidates. These molecules, in conjunction with triplex forming oligonucleotides, could potentially be used to achieve control of gene expression by interfering with transcription factors that bind to DNA. Therefore, the ability to screen for these molecules in a high-throughput fashion could dramatically improve the drug screening process. The assay reported here provides excellent discrimination between strong, intermediate, and weak duplex and triplex DNA binders in a high-throughput fashion. PMID:17614366

Identifying DNA methylation in a nanochannel

NASA Astrophysics Data System (ADS)

Sun, Xiaoyin; Yasui, Takao; Yanagida, Takeshi; Kaji, Noritada; Rahong, Sakon; Kanai, Masaki; Nagashima, Kazuki; Kawai, Tomoji; Baba, Yoshinobu

2016-01-01

DNA methylation is a stable epigenetic modification, which is well known to be involved in gene expression regulation. In general, however, analyzing DNA methylation requires rather time consuming processes (24-96 h) via DNA replication and protein modification. Here we demonstrate a methodology to analyze DNA methylation at a single DNA molecule level without any protein modifications by measuring the contracted length and relaxation time of DNA within a nanochannel. Our methodology is based on the fact that methylation makes DNA molecules stiffer, resulting in a longer contracted length and a longer relaxation time (a slower contraction rate). The present methodology offers a promising way to identify DNA methylation without any protein modification at a single DNA molecule level within 2 h.

DNA Motion Capture Reveals the Mechanical Properties of DNA at the Mesoscale

PubMed Central

Price, Allen C.; Pilkiewicz, Kevin R.; Graham, Thomas G.W.; Song, Dan; Eaves, Joel D.; Loparo, Joseph J.

2015-01-01

Single-molecule studies probing the end-to-end extension of long DNAs have established that the mechanical properties of DNA are well described by a wormlike chain force law, a polymer model where persistence length is the only adjustable parameter. We present a DNA motion-capture technique in which DNA molecules are labeled with fluorescent quantum dots at specific sites along the DNA contour and their positions are imaged. Tracking these positions in time allows us to characterize how segments within a long DNA are extended by flow and how fluctuations within the molecule are correlated. Utilizing a linear response theory of small fluctuations, we extract elastic forces for the different, ∼2-μm-long segments along the DNA backbone. We find that the average force-extension behavior of the segments can be well described by a wormlike chain force law with an anomalously small persistence length. PMID:25992731

Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

PubMed

Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

2018-01-01

Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

[Biophysics of single molecules].

PubMed

Serdiuk, I N; Deriusheva, E I

2011-01-01

The modern methods of research of biological molecules whose application led to the development of a new field of science, biophysics of single molecules, are reviewed. The measurement of the characteristics of single molecules enables one to reveal their individual features, and it is just for this reason that much more information can be obtained from one molecule than from the entire ensample of molecules. The high sensitivity of the methods considered in detail makes it possible to come close to the solution of the basic problem of practical importance, namely, the determination of the nucleotide sequence of a single DNA molecule.

Mobius Molecules

ERIC Educational Resources Information Center

Eckert, J. M.

1973-01-01

Discusses formation of chemical molecules via Mobius strip intermediates, and concludes that many special physics-chemical properties of the fully closed circular form (1) of polyoma DNA are explainable by this topological feature. (CC)

Single-molecule optical-trapping measurements with DNA anchored to an array of gold nanoposts.

PubMed

Paik, D Hern; Perkins, Thomas T

2012-01-01

Gold-thiol chemistry is one of the most successful chemistries for conjugating biomolecules to surfaces, but such chemistry has not been exploited in optical-trapping experiments because of laser-induced ablation of gold. In this work, we describe a method to combine these two separate technologies without undue heating using DNA anchored to gold nanostructures (r = 50-250 nm; h ≈ 20 nm). Moreover, we demonstrate a quantitative and mechanically robust (>100 pN) optical-trapping assay. By using three dithiol phosphoramidites (DTPAs) incorporated into a polymerase chain reaction (PCR) primer, the gold-DNA bond remained stable in the presence of excess thiolated compounds. This chemical robustness allowed us to reduce nonspecific sticking by passivating the unreacted gold with methoxy-(polyethylene glycol)-thiol (mPEG-SH). Overall, this surface conjugation of biomolecules onto an ordered array of gold nanostructures by chemically and mechanically robust bonds provides a unique way to carry out spatially controlled, repeatable measurements of single molecules.

Conductivity of Langmuir-Blodgett films of a disk-shaped liquid-crystalline molecule-DNA complex studied by current-sensing atomic force microscopy.

PubMed

Nayak, Alpana; Suresh, K A

2008-08-01

We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.

Conductivity of Langmuir-Blodgett films of a disk-shaped liquid-crystalline molecule-DNA complex studied by current-sensing atomic force microscopy

NASA Astrophysics Data System (ADS)

Nayak, Alpana; Suresh, K. A.

2008-08-01

We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.

Light of DNA-alkylating agents in castration-resistant prostate cancer cells: a novel mixed EGFR/DNA targeting combi-molecule.

PubMed

Liang, Guan-Can; Zheng, Hao-Feng; Chen, Yan-Xiong; Li, Teng-Cheng; Liu, Wei; Fang, You-Qiang

2017-01-01

The mechanism underlying the therapeutic effects of combi-molecule JDF12 on prostate cancer (PCa) DU145 cells remains still unclear. This study aimed to investigate the proteomic profile after JDF12 treatment in DU145 cells by comparing with that in Iressa treated cells and untreated cells. MTT was used to evaluate drug cytotoxicity, DAPI staining was done to assess apoptosis of cells, and flow cytometry was used to analyze cell cycle. iTRAQ and qPCR were employed to obtain the proteomic profiles of JDF12 treated, Iressa treated, and untreated DU145 cells, and validate the expression of selected differentially expressed proteins, respectively. JDF12 could significantly inhibit the proliferation and increase the apoptosis of DU145 cells when compared with Iressa or blank group. In total, 5071 proteins were obtained, out of which, 42, including 21 up-regulated and 21 down-regulated proteins, were differentially expressed in JDF12 group when compared with Iressa and blank groups. The up-regulated proteins were mainly involved in DNA damage/repair and energy metabolism; while the down-regulated proteins were mainly associated with cell apoptosis. qPCR confirmed the expression of several biologically important proteins in DU145 cells after JDF12 treatment. The molecular mechanisms of DNA alkylating agents on PCa therapy that with the assistant of EGFR-blocker were revealed on proteomic level, which may increase the possible applications of DNA alkylating agents and JDF12 on PCa therapy.

ZRBA1, a Mixed EGFR/DNA Targeting Molecule, Potentiates Radiation Response Through Delayed DNA Damage Repair Process in a Triple Negative Breast Cancer Model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Heravi, Mitra; Department of Radiation Oncology, McGill University, Montreal; Segal Cancer Center, Jewish General Hospital, Montreal

2015-06-01

Purpose: ZRBA1 is a combi-molecule designed to induce DNA alkylating lesions and to block epidermal growth factor receptor (EGFR) TK domain. Inasmuch as ZRBA1 downregulates the EGFR TK-mediated antisurvival signaling and induces DNA damage, we postulated that it might be a radiosensitizer. The aim of this study was to further investigate the potentiating effect of ZRBA1 in combination with radiation and to elucidate the possible mechanisms of interaction between these 2 treatment modalities. Methods and Materials: The triple negative human breast MDA-MB-468 cancer cell line and mouse mammary cancer 4T1 cell line were used in this study. Clonogenic assay, Westernmore » blot analysis, and DNA damage analysis were performed at multiple time points after treatment. To confirm our in vitro findings, in vivo tumor growth delay assay was performed. Results: Our results show that a combination of ZRBA1 and radiation increases the radiation sensitivity of both cell lines significantly with a dose enhancement factor of 1.56, induces significant numbers of DNA strand breaks, prolongs higher DNA damage up to 24 hours after treatment, and significantly increases tumor growth delay in a syngeneic mouse model. Conclusions: Our data suggest that the higher efficacy of this combination could be partially due to increased DNA damage and delayed DNA repair process and to the inhibition of EGFR. The encouraging results of this combination demonstrated a significant improvement in treatment efficiency and therefore could be applicable in early clinical trial settings.« less

DNA motion capture reveals the mechanical properties of DNA at the mesoscale.

PubMed

Price, Allen C; Pilkiewicz, Kevin R; Graham, Thomas G W; Song, Dan; Eaves, Joel D; Loparo, Joseph J

2015-05-19

Single-molecule studies probing the end-to-end extension of long DNAs have established that the mechanical properties of DNA are well described by a wormlike chain force law, a polymer model where persistence length is the only adjustable parameter. We present a DNA motion-capture technique in which DNA molecules are labeled with fluorescent quantum dots at specific sites along the DNA contour and their positions are imaged. Tracking these positions in time allows us to characterize how segments within a long DNA are extended by flow and how fluctuations within the molecule are correlated. Utilizing a linear response theory of small fluctuations, we extract elastic forces for the different, ∼2-μm-long segments along the DNA backbone. We find that the average force-extension behavior of the segments can be well described by a wormlike chain force law with an anomalously small persistence length. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.

DNA recombination activity in soybean mitochondria.

PubMed

Manchekar, Medha; Scissum-Gunn, Karyn; Song, Daqing; Khazi, Fayaz; McLean, Stephanie L; Nielsen, Brent L

2006-02-17

Mitochondrial genomes in higher plants are much larger and more complex as compared to animal mitochondrial genomes. There is growing evidence that plant mitochondrial genomes exist predominantly as a collection of linear and highly branched DNA molecules and replicate by a recombination-dependent mechanism. However, biochemical evidence of mitochondrial DNA (mtDNA) recombination activity in plants has previously been lacking. We provide the first report of strand-invasion activity in plant mitochondria. Similar to bacterial RecA, this activity from soybean is dependent on the presence of ATP and Mg(2+). Western blot analysis using an antibody against the Arabidopsis mitochondrial RecA protein shows cross-reaction with a soybean protein of about 44 kDa, indicating conservation of this protein in at least these two plant species. mtDNA structure was analyzed by electron microscopy of total soybean mtDNA and molecules recovered after field-inversion gel electrophoresis (FIGE). While most molecules were found to be linear, some molecules contained highly branched DNA structures and a small but reproducible proportion consisted of circular molecules (many with tails) similar to recombination intermediates. The presence of recombination intermediates in plant mitochondria preparations is further supported by analysis of mtDNA molecules by 2-D agarose gel electrophoresis, which indicated the presence of complex recombination structures along with a considerable amount of single-stranded DNA. These data collectively provide convincing evidence for the occurrence of homologous DNA recombination in plant mitochondria.

DNA of a Human Hepatitis B Virus Candidate

PubMed Central

Robinson, William S.; Clayton, David A.; Greenman, Richard L.

1974-01-01

Particles containing DNA polymerase (Dane particles) were purified from the plasma of chronic carriers of hepatitis B antigen. After a DNA polymerase reaction with purified Dane particle preparations treated with Nonidet P-40 detergent, Dane particle core structures containing radioactive DNA product were isolated by sedimentation in a sucrose density gradient. The radioactive DNA was extracted with sodium dodecyl sulfate and isolated by band sedimentation in a preformed CsCl gradient. Examination of the radioactive DNA band by electron microscopy revealed exclusively circular double-stranded DNA molecules approximately 0.78 μm in length. Identical circular molecules were observed when DNA was isolated by a similar procedure from particles that had not undergone a DNA polymerase reaction. The molecules were completely degraded by DNase 1. When Dane particle core structures were treated with DNase 1 before DNA extraction, only 0.78-μm circular DNA molecules were detected. Without DNase treatment of core structures, linear molecules with lengths between 0.5 and 12 μm, in addition to the 0.78-μm circles were found. These results suggest that the 0.78-μm circular molecules were in a protected position within Dane particle cores and the linear molecules were not within core structures. Length measurements on 225 circular molecules revealed a mean length of 0.78 ± 0.09 μm which would correspond to a molecular weight of around 1.6 × 106. The circular molecules probably serve as primer-template for the DNA polymerase reaction carried out by Dane particle cores. Thermal denaturation and buoyant density measurements on the Dane particle DNA polymerase reaction product revealed a guanosine plus cytosine content of 48 to 49%. Images PMID:4847328

An optical conveyor for molecules.

PubMed

Weinert, Franz M; Braun, Dieter

2009-12-01

Trapping single ions under vacuum allows for precise spectroscopy in atomic physics. The confinement of biological molecules in bulk water is hindered by the lack of comparably strong forces. Molecules have been immobilized to surfaces, however often with detrimental effects on their function. Here, we optically trap molecules by creating the microscale analogue of a conveyor belt: a bidirectional flow is combined with a perpendicular thermophoretic molecule drift. Arranged in a toroidal geometry, the conveyor accumulates a hundredfold excess of 5-base DNA within seconds. The concentrations of the trapped DNA scale exponentially with length, reaching trapping potential depths of 14 kT for 50 bases. The mechanism does not require microfluidics, electrodes, or surface modifications. As a result, the trap can be dynamically relocated. The optical conveyor can be used to enhance diffusion-limited surface reactions, redirect cellular signaling, observe individual biomolecules over a prolonged time, or approach single-molecule chemistry in bulk water.

A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage.

PubMed

Kubiak, Jeffrey M; Culyba, Matthew J; Liu, Monica Yun; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M

2017-11-17

The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway.

Probing the rate-limiting step for intramolecular transfer of a transcription factor between specific sites on the same DNA molecule by (15)Nz-exchange NMR spectroscopy.

PubMed

Ryu, Kyoung-Seok; Tugarinov, Vitali; Clore, G Marius

2014-10-15

The kinetics of translocation of the homeodomain transcription factor HoxD9 between specific sites of the same or opposite polarities on the same DNA molecule have been studied by (15)Nz-exchange NMR spectroscopy. We show that exchange occurs by two facilitated diffusion mechanisms: a second-order intermolecular exchange reaction between specific sites located on different DNA molecules without the protein dissociating into free solution that predominates at high concentrations of free DNA, and a first-order intramolecular process involving direct transfer between specific sites located on the same DNA molecule. Control experiments using a mixture of two DNA molecules, each possessing only a single specific site, indicate that transfer between specific sites by full dissociation of HoxD9 into solution followed by reassociation is too slow to measure by z-exchange spectroscopy. Intramolecular transfer with comparable rate constants occurs between sites of the same and opposing polarity, indicating that both rotation-coupled sliding and hopping/flipping (analogous to geminate recombination) occur. The half-life for intramolecular transfer (0.5-1 s) is many orders of magnitude larger than the calculated transfer time (1-100 μs) by sliding, leading us to conclude that the intramolecular transfer rates measured by z-exchange spectroscopy represent the rate-limiting step for a one-base-pair shift from the specific site to the immediately adjacent nonspecific site. At zero concentration of added salt, the intramolecular transfer rate constants between sites of opposing polarity are smaller than those between sites of the same polarity, suggesting that hopping/flipping may become rate-limiting at very low salt concentrations.

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

Single-molecule multiparameter fluorescence spectroscopy reveals directional MutS binding to mismatched bases in DNA

PubMed Central

Cristóvão, Michele; Sisamakis, Evangelos; Hingorani, Manju M.; Marx, Andreas D.; Jung, Caroline P.; Rothwell, Paul J.; Seidel, Claus A. M.; Friedhoff, Peter

2012-01-01

Mismatch repair (MMR) corrects replication errors such as mismatched bases and loops in DNA. The evolutionarily conserved dimeric MMR protein MutS recognizes mismatches by stacking a phenylalanine of one subunit against one base of the mismatched pair. In all crystal structures of G:T mismatch-bound MutS, phenylalanine is stacked against thymine. To explore whether these structures reflect directional mismatch recognition by MutS, we monitored the orientation of Escherichia coli MutS binding to mismatches by FRET and anisotropy with steady state, pre-steady state and single-molecule multiparameter fluorescence measurements in a solution. The results confirm that specifically bound MutS bends DNA at the mismatch. We found additional MutS–mismatch complexes with distinct conformations that may have functional relevance in MMR. The analysis of individual binding events reveal significant bias in MutS orientation on asymmetric mismatches (G:T versus T:G, A:C versus C:A), but not on symmetric mismatches (G:G). When MutS is blocked from binding a mismatch in the preferred orientation by positioning asymmetric mismatches near the ends of linear DNA substrates, its ability to authorize subsequent steps of MMR, such as MutH endonuclease activation, is almost abolished. These findings shed light on prerequisites for MutS interactions with other MMR proteins for repairing the appropriate DNA strand. PMID:22367846

Single-molecule dilution and multiple displacement amplification for molecular haplotyping.

PubMed

Paul, Philip; Apgar, Josh

2005-04-01

Separate haploid analysis is frequently required for heterozygous genotyping to resolve phase ambiguity or confirm allelic sequence. We demonstrate a technique of single-molecule dilution followed by multiple strand displacement amplification to haplotype polymorphic alleles. Dilution of DNA to haploid equivalency, or a single molecule, is a simple method for separating di-allelic DNA. Strand displacement amplification is a robust method for non-specific DNA expansion that employs random hexamers and phage polymerase Phi29 for double-stranded DNA displacement and primer extension, resulting in high processivity and exceptional product length. Single-molecule dilution was followed by strand displacement amplification to expand separated alleles to microgram quantities of DNA for more efficient haplotype analysis of heterozygous genes.

The unusual and dynamic character of PX-DNA

DOE PAGES

Niu, Dong; Jiang, Hualin; Sha, Ruojie; ...

2015-07-15

PX-DNA is a four-stranded DNA structure that has been implicated in the recognition of homology, either continuously, or in an every-other-half-turn fashion. Some of the structural features of the molecule have been noted previously, but the structure requires further characterization. Here, we report atomic force microscopic characterization of PX molecules that contain periodically placed biotin groups, enabling the molecule to be labeled by streptavidin molecules at these sites. In comparison with conventional double stranded DNA and with antiparallel DNA double crossover molecules, it is clear that PX-DNA is a more dynamic structure. Moreover, the spacing between the nucleotide pairs alongmore » the helix axis is shorter, suggesting a mixed B/A structure. Circular dichroism spectroscopy indicates unusual features in the PX molecule that are absent in both the molecules to which it is compared.« less

Current characteristics of λ-DNA molecules/polystyrene nanoparticles in TBE buffer solution through micro/nanofluidic capillaries under DC electric field

NASA Astrophysics Data System (ADS)

Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Li, Junjie; Bai, Jintao; Gu, Changzhi

2017-03-01

In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ-DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices.

DNA.

ERIC Educational Resources Information Center

Felsenfeld, Gary

1985-01-01

Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

Novel Replication-Competent Circular DNA Molecules from Healthy Cattle Serum and Milk and Multiple Sclerosis-Affected Human Brain Tissue

PubMed Central

Whitley, Corinna; Gunst, Karin; Müller, Hermann; Funk, Mathis; zur Hausen, Harald

2014-01-01

Epidemiological data point to the involvement of a cow milk factor in the etiology of multiple sclerosis (MS). Eleven circular DNA molecules closely related to transmissible spongiform encephalopathy (TSE)-associated isolate Sphinx 1.76 were isolated from healthy cattle serum, cow milk, and serum and brain tissue from MS patients. PMID:25169859

Model systems for single molecule polymer dynamics

PubMed Central

Latinwo, Folarin

2012-01-01

Double stranded DNA (dsDNA) has long served as a model system for single molecule polymer dynamics. However, dsDNA is a semiflexible polymer, and the structural rigidity of the DNA double helix gives rise to local molecular properties and chain dynamics that differ from flexible chains, including synthetic organic polymers. Recently, we developed single stranded DNA (ssDNA) as a new model system for single molecule studies of flexible polymer chains. In this work, we discuss model polymer systems in the context of “ideal” and “real” chain behavior considering thermal blobs, tension blobs, hydrodynamic drag and force–extension relations. In addition, we present monomer aspect ratio as a key parameter describing chain conformation and dynamics, and we derive dynamical scaling relations in terms of this molecular-level parameter. We show that asymmetric Kuhn segments can suppress monomer–monomer interactions, thereby altering global chain dynamics. Finally, we discuss ssDNA in the context of a new model system for single molecule polymer dynamics. Overall, we anticipate that future single polymer studies of flexible chains will reveal new insight into the dynamic behavior of “real” polymers, which will highlight the importance of molecular individualism and the prevalence of non-linear phenomena. PMID:22956980

Normal-Mode Analysis of Circular DNA at the Base-Pair Level. 2. Large-Scale Configurational Transformation of a Naturally Curved Molecule.

PubMed

Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K

2005-01-01

Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the

DNA nanotechnology

NASA Astrophysics Data System (ADS)

Seeman, Nadrian C.; Sleiman, Hanadi F.

2018-01-01

DNA is the molecule that stores and transmits genetic information in biological systems. The field of DNA nanotechnology takes this molecule out of its biological context and uses its information to assemble structural motifs and then to connect them together. This field has had a remarkable impact on nanoscience and nanotechnology, and has been revolutionary in our ability to control molecular self-assembly. In this Review, we summarize the approaches used to assemble DNA nanostructures and examine their emerging applications in areas such as biophysics, diagnostics, nanoparticle and protein assembly, biomolecule structure determination, drug delivery and synthetic biology. The introduction of orthogonal interactions into DNA nanostructures is discussed, and finally, a perspective on the future directions of this field is presented.

Small Molecule Protection of Bone Marrow Hematopoietic Stem Cells

DTIC Science & Technology

2015-10-01

several recently identified small molecules can protect hematopoietic stem cells (HSCs) from damage or killing by endogenous aldehydes . Proof-of-concept...anemia bone marrow failure CD34+ hematopoietic stem cells aldehydes formaldehyde DNA damage DNA base adduct DNA-protein crosslink mass...below. Revised Specific Aim 1: Small molecule protection of human cells from aldehyde - induced killing (in vitro studies - no mice or human subjects

Synthesis of bifunctional molecules containing [12]aneN3 and coumarin moieties as effective DNA condensation agents and new non-viral gene vectors.

PubMed

Yue, Pan; Zhang, Ying; Guo, Zhi-Fo; Cao, Ao-Cheng; Lu, Zhong-Lin; Zhai, Yong-Gong

2015-04-21

A series of bifunctional molecules with different combinations of macrocyclic polyamine [12]aneN3 and coumarin moieties, 4a/b and 5a/b, were synthesized by a two-step copper(I)-mediated alkyne–azide click reactions between 1,3,5-tris(azidomethyl)benzene and Boc-protected N-propynyl-[12]aneN3/7-propynyloxycoumarins. Agarose gel electrophoresis experiments indicated that bifunctional molecules 4b and 5b effectively induced complete plasmid DNA condensation at concentrations up to 40 μM. It was found that the structural variation had a major impact on the condensation behavior of these compounds. The electrostatic interaction involving the [12]aneN3 moiety can be compensated by the binding contribution of the coumarin units during the DNA condensation process. These two types of interaction showed different effects on the reversibility of DNA condensation. Results from studies using dynamic laser scattering, atomic force microscopy, and EB replacement assay further supported the above conclusion. Cytotoxicity assays on bifunctional compounds 4a/b and 5a/b indicated their low cytotoxicity. Results from cellular uptake and cell transfection experiments proved that bifunctional compounds 4b and 5b successfully served as non-viral gene vectors. Furthermore, methyl substituents attached to the coumarin unit (4b and 5b) greatly enhanced their DNA condensation capability and gene transfection. These bifunctional molecules, with the advantages of lower cytotoxicity, good water solubility, and potential structural modification, will have great potential for the development of new non-viral gene delivery agents.

Recombinant DNA encoding a desulfurization biocatalyst

DOEpatents

Rambosek, John; Piddington, Chris S.; Kovacevich, Brian R.; Young, Kevin D.; Denome, Sylvia A.

1994-01-01

This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous.

A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage

PubMed Central

2017-01-01

The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway. PMID:28826208

Single Molecule Nano-Metronome

PubMed Central

Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

2008-01-01

We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050

3D DNA Crystals and Nanotechnology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paukstelis, Paul; Seeman, Nadrian

DNA's molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.

3D DNA Crystals and Nanotechnology

DOE PAGES

Paukstelis, Paul; Seeman, Nadrian

2016-08-18

DNA's molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.

Influence of amine and thiol modifications at the 3' ends of single stranded DNA molecules on their adsorption on gold surface and the efficiency of their hybridization.

PubMed

Jaworska, Aleksandra; Jablonska, Anna; Wilanowski, Tomasz; Palys, Barbara; Sek, Slawomir; Kudelski, Andrzej

2018-05-24

Adsorption of molecules of DNA (deoxyribonucleic acid) or modified DNA on gold surfaces is often the first step in construction of many various biosensors, including biosensors for detection of DNA with a particular sequence. In this work we study the influence of amine and thiol modifications at the 3' ends of single stranded DNA (ssDNA) molecules on their adsorption on the surface of gold substrates and on the efficiency of hybridization of immobilized DNA with the complementary single stranded DNA. The characterization of formed layers has been carried out using infrared spectroscopy and atomic force microscopy. As model single stranded DNA we used DNA containing 20 adenine bases, whereas the complementary DNA contained 20 thymine bases. We found that the bands in polarization modulation-infrared reflection-adsorption spectroscopy (PM-IRRAS) spectra of layers formed from thiol-modified DNA are significantly narrower and sharper, indicating their higher regularity in the orientation of DNA on gold surface when using thiol linker. Also, hybridization of the layer of thiol-modified DNA containing 20 adenine bases with the respective DNA containing thymine bases leads to formation of much more organized structures than in the case of unmodified DNA or DNA with the amine linker. We conclude that the thiol-modified ssDNA is more promising for the preparation of biosensors, in comparison with the amine-modified or unmodified ssDNA. We have also found that the above-mentioned modifications at the 3' end of ssDNA significantly influence the IR spectrum (and hence the structure) of polycrystalline films formed from such compounds, even though adsorbed fragments contain less than 5% of the DNA chain. This effect should be taken into account when comparing IR spectra of various polycrystalline films formed from modified and unmodified DNA. Copyright © 2018. Published by Elsevier B.V.

Recombinant DNA encoding a desulfurization biocatalyst

DOEpatents

Rambosek, J.; Piddington, C.S.; Kovacevich, B.R.; Young, K.D.; Denome, S.A.

1994-10-18

This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous. 13 figs.

Unraveling the complexity of the interactions of DNA nucleotides with gold by single molecule force spectroscopy

NASA Astrophysics Data System (ADS)

Bano, Fouzia; Sluysmans, Damien; Wislez, Arnaud; Duwez, Anne-Sophie

2015-11-01

Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct adsorption behavior of the deoxyribonucleotides (i.e., a nitrogenous base, a deoxyribose sugar, and a phosphate group) and on the factors that govern the DNA-gold bond strength. Here, using single molecule force spectroscopy, we investigated the interaction of the four individual nucleotides, adenine, guanine, cytosine, and thymine, with gold. Experiments were performed in three salinity conditions and two surface dwell times to reveal the factors that influence nucleotide-Au bond strength. Force data show that, at physiological ionic strength, adenine-Au interactions are stronger, asymmetrical and independent of surface dwell time as compared to cytosine-Au and guanine-Au interactions. We suggest that in these conditions only adenine is able to chemisorb on gold. A decrease of the ionic strength significantly increases the bond strength for all nucleotides. We show that moderate ionic strength along with longer surface dwell period suggest weak chemisorption also for cytosine and guanine.Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct

Stretching, twisting and supercoiling in short, single DNA molecules

NASA Astrophysics Data System (ADS)

Lam, Pui-Man; Zhen, Yi

2018-02-01

We had combined the Neukirch-Marko model that describes the extension, torque and supercoiling in single, stretched and twisted DNA of infinite contour length, with a form of the free energy suggested by Sinha and Samuels to describe short DNA, with contour length only a few times the persistence length. We find that the free energy of the stretched but untwisted DNA, is significantly modified from its infinitely length value and this in turn modifies significantly the torque and supercoiling. We show that this is consistent with short DNA being more flexible than infinitely long DNA. We hope our results will stimulate experimental investigation of torque and supercoiling in short DNA.

High-fidelity target sequencing of individual molecules identified using barcode sequences: de novo detection and absolute quantitation of mutations in plasma cell-free DNA from cancer patients.

PubMed

Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya

2015-08-01

Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Molecular structure of r/GCG/d/TATACGC/ - A DNA-RNA hybrid helix joined to double helical DNA

NASA Technical Reports Server (NTRS)

Wang, A. H.-J.; Fujii, S.; Rich, A.; Van Boom, J. H.; Van Der Marel, G. A.; Van Boeckel, S. A. A.

1982-01-01

The molecule r(GCG)d(TATACGC) is self-complementary and forms two DNA-RNA hybrid segments surrounding a central region of double helical DNA; its molecular structure has been solved by X-ray analysis. All three parts of the molecule adopt a conformation which is close to that seen in the 11-fold RNA double helix. The conformation of the ribonucleotides is partly determined by water molecules bridging between the ribose O2' hydroxyl group and cytosine O2. The hybrid-DNA duplex junction contains no structural discontinuities. However, the central DNA TATA sequence has some structural irregularities.

Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene: DNA BINDING AND IDENTIFICATION OF SMALL MOLECULE INHIBITORS.

PubMed

Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

2016-06-03

Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Single Molecule Enzymology via Nanoelectronic Circuits

NASA Astrophysics Data System (ADS)

Collins, Philip

Traditional single-molecule techniques rely on fluorescence or force transduction to monitor conformational changes and biochemical activity. Recent demonstrations of single-molecule monitoring with electronic transistors are poised to add to the single-molecule research toolkit. The transistor-based technique is sensitive to the motion of single charged side chain residues and can transduce those motions with microsecond resolution, opening the doors to single-molecule enzymology with unprecedented resolution. Furthermore, the solid-state platform provides opportunities for parallelization in arrays and long-duration monitoring of one molecule's activity or processivity, all without the limitations caused by photo-oxidation or mutagenic fluorophore incorporation. This presentation will review some of these advantages and their particular application to DNA polymerase I processing single-stranded DNA templates. This research was supported financially by the NIH NCI (R01 CA133592-01), the NIH NIGMS (1R01GM106957-01) and the NSF (DMR-1104629 and ECCS-1231910).

DNA condensation and size effects of DNA condensation agent

NASA Astrophysics Data System (ADS)

Liu, Yan-Hui; Jiang, Chong-Ming; Guo, Xin-Miao; Tang, Yan-Lin; Hu, Lin

2013-08-01

Based on the model of the strong correlation of counterions condensed on DNA molecule, by tailoring interaction potential, interduplex spacing and correlation spacing between condensed counterions on DNA molecule and interduplex spacing fluctuation strength, toroidal configuration, rod-like configuration and two-hole configurations are possible. The size effects of counterion structure on the toroidal structure can be detected by this model. The autocorrelation function of the tangent vectors is found as an effective way to detect the structure of toroidal conformations and the generic pathway of the process of DNA condensation. The generic pathway of all of the configurations involves an initial nucleation loop, and the next part of the DNA chain is folded on the top of the initial nucleation loop with different manners, in agreement with the recent experimental results.

Characterization of individual polynucleotide molecules using a membrane channel

NASA Technical Reports Server (NTRS)

Kasianowicz, J. J.; Brandin, E.; Branton, D.; Deamer, D. W.

1996-01-01

We show that an electric field can drive single-stranded RNA and DNA molecules through a 2.6-nm diameter ion channel in a lipid bilayer membrane. Because the channel diameter can accommodate only a single strand of RNA or DNA, each polymer traverses the membrane as an extended chain that partially blocks the channel. The passage of each molecule is detected as a transient decrease of ionic current whose duration is proportional to polymer length. Channel blockades can therefore be used to measure polynucleotide length. With further improvements, the method could in principle provide direct, high-speed detection of the sequence of bases in single molecules of DNA or RNA.

Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

DOEpatents

Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

2013-06-25

A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

Structural Transitions in Supercoiled Stretched DNA

NASA Astrophysics Data System (ADS)

v, Croquette

1998-03-01

Using magnetic micromanipulation techniques [Strick 96]( uc(T.R.) Strick, J.-F. Allemand, D. Bensimon, A. Bensimon) and uc(V.) Croquette, "The elasticity of a single supercoiled DNA molecule", Science, 271, 1835 (1996)., we have studied the mechanical properties (force versus extension) of single DNA molecules under a wide range of torsional stresses (supercoiling). We show that unwinding the DNA double helix leads to a phase separation between regular B-DNA and denaturation bubbles. The fraction of denatured molecule increases linearly with the degree of unwinding, beginning at a value of 1% unwinding. We have confirmed this denatured state by hybridization of homologous single-stranded DNA probes and by a chemical attack of the exposed bases. Surprisingly, when we overwind the molecule, the elasticity curves we obtain may also be interpreted by the coexistence of two phases, B-DNA and a new phase which we note P-DNA. The fraction of this new phase increases smoothly with overwinding, beginning at 3 % and continuing up to 300 %. Our results indicate that this new phase is four times more twisted that the standard B-DNA and is 1.75 times longer. Although the structure of this phase is not yet known, such a high twisting can only be attained if the sugar-phosphate backbones of the two strands are twisted closely while the bases are expelled outside of the molecule's core, in a structure reminiscent of the one proposed by Pauling. Indeed we have shown that this new phase is sensitive to chemical attack whereas the B-DNA is not. This new phase begins to appear on a molecule overwound by 3 % and stretched by a force of 5 pN, conditions typically encountered in vivo during gene transcription. This new phase may thus play a biological role (for more details).

Dynamics of flexible molecules in thinning fluid filaments

NASA Astrophysics Data System (ADS)

Arratia, Paulo E.; Juarez, Gabriel

2011-11-01

Newtonian liquids that contain small amounts (~ppm) of flexible polymers can exhibit viscoelastic behavior in extensional flows. In this talk, we report the results of experiments on the thinning and breakup of polymeric fluids in a simple microfluidic device. We aim to understand the stretching dynamics of flexible polymers by direct visualization of fluorescent DNA molecules, a model polymer. A Boger fluid, composed of 100 ppm polyacrylamide and 85% w/w glycerol, is seeded with stained lambdaâDNA molecules (<10% v/v) imaged by high speed epifluorescence microscopy. We observe that the strong flow in the thinning fluid threads provide sufficient forces to stretch the DNA molecules away from their equilibrium coiled state. The distribution of stretch lengths, however, is very heterogeneous due to molecular individualism and initial conditions. Once the molecules are stretched to their full length and aligned with the flow, they translate along the fluid thread as rigid rods until the point of pinch off. After pinch off, both the fluid and molecules return to a relaxed state.

Enhanced Mitochondrial DNA Repair of the Common Disease-Associated Variant, Ser326Cys, of hOGG1 through Small Molecule Intervention.

PubMed

Baptiste, Beverly A; Katchur, Steven R; Fivenson, Elayne M; Croteau, Deborah L; Rumsey, William L; Bohr, Vilhelm A

2018-06-04

The common oxidatively generated lesion, 8-oxo-7,8-dihydroguanine (8-oxoGua), is removed from DNA by base excision repair. The glycosylase primarily charged with recognition and removal of this lesion is 8-oxoGuaDNA glycosylase 1 (OGG1). When left unrepaired, 8-oxodG alters transcription and is mutagenic. Individuals homozygous for the less active OGG1 allele, Ser326Cys, have increased risk of several cancers. Here, small molecule enhancers of OGG1 were identified and tested for their ability to stimulate DNA repair and protect cells from the environmental hazard paraquat (PQ). PQ-induced mtDNA damage was inversely proportional to the levels of OGG1 expression whereas stimulation of OGG1, in some cases, entirely abolished its cellular effects. The PQ-mediated decline of mitochondrial membrane potential or nuclear condensation were prevented by the OGG1 activators. In addition, in Ogg1 -/- mouse embryonic fibroblasts complemented with hOGG1 S326C , there was increased cellular and mitochondrial reactive oxygen species compared to their wild type counterparts. Mitochondrial extracts from cells expressing hOGG1 S326C were deficient in mitochondrial 8-oxodG incision activity, which was rescued by the OGG1 activators. These data demonstrate that small molecules can stimulate OGG1 activity with consequent cellular protection. Thus, OGG1-activating compounds may be useful in select humans to mitigate the deleterious effects of environmental oxidants and mutagens. Copyright © 2018 Elsevier Inc. All rights reserved.

Interactions of DNA binding proteins with G-Quadruplex structures at the single molecule level

NASA Astrophysics Data System (ADS)

Ray, Sujay

Guanine-rich nucleic acid (DNA/RNA) sequences can form non-canonical secondary structures, known as G-quadruplex (GQ). Numerous in vivo and in vitro studies have demonstrated formation of these structures in telomeric and non-telomeric regions of the genome. Telomeric GQs protect the chromosome ends whereas non-telomeric GQs either act as road blocks or recognition sites for DNA metabolic machinery. These observations suggest the significance of these structures in regulation of different metabolic processes, such as replication and repair. GQs are typically thermodynamically more stable than the corresponding Watson-Crick base pairing formed by G-rich and C-rich strands, making protein activity a crucial factor for their destabilization. Inside the cell, GQs interact with different proteins and their enzymatic activity is the determining factor for their stability. We studied interactions of several proteins with GQs to understand the underlying principles of protein-GQ interactions using single-molecule FRET and other biophysical techniques. Replication Protein-A (RPA), a single stranded DNA (ssDNA) binding protein, is known to posses GQ unfolding activity. First, we compared the thermal stability of three potentially GQ-forming DNA sequences (PQS) to their stability against RPA-mediated unfolding. One of these sequences is the human telomeric repeat and the other two, located in the promoter region of tyrosine hydroxylase gene, are highly heterogeneous sequences that better represent PQS in the genome. The thermal stability of these structures do not necessarily correlate with their stability against protein-mediated unfolding. We conclude that thermal stability is not necessarily an adequate criterion for predicting the physiological viability of GQ structures. To determine the critical structural factors that influence protein-GQ interactions we studied two groups of GQ structures that have systematically varying loop lengths and number of G-tetrad layers. We

Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

PubMed Central

Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

2016-01-01

Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

Heterologous mitochondrial DNA recombination in human cells.

PubMed

D'Aurelio, Marilena; Gajewski, Carl D; Lin, Michael T; Mauck, William M; Shao, Leon Z; Lenaz, Giorgio; Moraes, Carlos T; Manfredi, Giovanni

2004-12-15

Inter-molecular heterologous mitochondrial DNA (mtDNA) recombination is known to occur in yeast and plants. Nevertheless, its occurrence in human cells is still controversial. To address this issue we have fused two human cytoplasmic hybrid cell lines, each containing a distinct pathogenic mtDNA mutation and specific sets of genetic markers. In this hybrid model, we found direct evidence of recombination between these two mtDNA haplotypes. Recombinant mtDNA molecules in the hybrid cells were identified using three independent experimental approaches. First, recombinant molecules containing genetic markers from both parental alleles were demonstrated with restriction fragment length polymorphism of polymerase chain reaction products, by measuring the relative frequencies of each marker. Second, fragments of recombinant mtDNA were cloned and sequenced to identify the regions involved in the recombination events. Finally, recombinant molecules were demonstrated directly by Southern blot using appropriate combinations of polymorphic restriction sites and probes. This combined approach confirmed the existence of heterogeneous species of recombinant mtDNA molecules in the hybrid cells. These findings have important implications for mtDNA-related diseases, the interpretation of human evolution and population genetics and forensic analyses based on mtDNA genotyping.

High-throughput DNA separation in nanofilter arrays.

PubMed

Choi, Sungup; Kim, Ju Min; Ahn, Kyung Hyun; Lee, Seung Jong

2014-08-01

We numerically investigated the dynamics of short double-stranded DNA molecules moving through a deep-shallow alternating nanofilter, by utilizing Brownian dynamics simulation. We propose a novel mechanism for high-throughput DNA separation with a high electric field, which was originally predicted by Laachi et al. [Phys. Rev. Lett. 2007, 98, 098106]. In this work, we show that DNA molecules deterministically move along different electrophoretic streamlines according to their length, owing to geometric constraint at the exit of the shallow region. Consequently, it is more probable that long DNA molecules pass over a deep well region without significant lateral migration toward the bottom of the deep well, which is in contrast to the long dwelling time for short DNA molecules. We investigated the dynamics of DNA passage through a nanofilter facilitating electrophoretic field kinematics. The statistical distribution of the DNA molecules according to their size clearly corroborates our assumption. On the other hand, it was also found that the tapering angle between the shallow and deep regions significantly affects the DNA separation performance. The current results show that the nonuniform field effect combined with geometric constraint plays a key role in nanofilter-based DNA separation. We expect that our results will be helpful in designing and operating nanofluidics-based DNA separation devices and in understanding the polymer dynamics in confined geometries. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

PubMed

Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

2010-06-01

A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

Multisegment nanowire sensors for the detection of DNA molecules.

PubMed

Wang, Xu; Ozkan, Cengiz S

2008-02-01

We describe a novel application for detecting specific single strand DNA sequences using multisegment nanowires via a straightforward surface functionalization method. Nanowires comprising CdTe-Au-CdTe segments are fabricated using electrochemical deposition, and electrical characterization indicates a p-type behavior for the multisegment nanostructures, in a back-to-back Schottky diode configuration. Such nanostructures modified with thiol-terminated probe DNA fragments could function as high fidelity sensors for biomolecules at very low concentration. The gold segment is utilized for functionalization and binding of single strand DNA (ssDNA) fragments while the CdTe segments at both ends serve to modulate the equilibrium Fermi level of the heterojunction device upon hybridization of the complementary DNA fragments (cDNA) to the ssDNA over the Au segment. Employing such multisegment nanowires could lead to the fabrication more sophisticated and high multispecificity biosensors via selective functionalization of individual segments for biowarfare sensing and medical diagnostics applications.

Modeling DNA

ERIC Educational Resources Information Center

Robertson, Carol

2016-01-01

Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

Investigating the impacts of DNA binding mode and sequence on thermodynamic quantities and water exchange values for two small molecule drugs.

PubMed

Kenney, Rachael M; Buxton, Katherine E; Glazier, Samantha

2016-09-01

Doxorubicin and nogalamycin are antitumor antibiotics that interact with DNA via intercalation and threading mechanisms, respectively. Because the importance of water, particularly its impact on entropy changes, has been established in other biological processes, we investigated the role of water in these two drug-DNA binding events. We used the osmotic stress method to calculate the number of water molecules exchanged (Δnwater), and isothermal titration calorimetry to measure Kbinding, ΔH, and ΔS for two synthetic DNAs, poly(dA·dT) and poly(dG·dC), and calf thymus DNA (CT DNA). For nogalamycin, Δnwater<0 for CT DNA and poly(dG·dC). For doxorubicin, Δnwater>0 for CT DNA and Δnwater<0 for poly(dG·dC). For poly(dA·dT), Δnwater~0 with both drugs. Net enthalpy changes were always negative, but net entropy changes depended on the drug. The effect of water exchange on the overall sign of entropy change appears to be smaller than other contributions. Copyright © 2016 Elsevier B.V. All rights reserved.

All gene-sized DNA molecules in four species of hypotrichs have the same terminal sequence and an unusual 3' terminus.

PubMed Central

Klobutcher, L A; Swanton, M T; Donini, P; Prescott, D M

1981-01-01

In hypotrichous ciliates, all of the macronuclear DNA is in the form of low molecular weight molecules with an average size of approximately 2200 base pairs. Total macronuclear DNA from four hypotrichs has been shown to have inverted terminal repeats by direct sequence analysis. In Oxytricha nova, Oxytricha sp., and Stylonychia pustulata, this terminal sequence may be written as 5'-C4A4C4A4C4 ... 3'-G4T4G4T4G4T4G4T4G4 ... In Euplotes aediculatus, the sequences is similar but differs in the lengths of the duplex region (28 base pairs) and of the putative 3' extension (14 base pairs). Also in Euplotes, a second common sequence of 5 base pairs (A-A-C-T-T-T-T-G-A-A) occurs internal to the terminal repeat and a 17-base-pair heterogeneous region: 5'-C4A4C4A4C4A4C4(X)17T-T-G-A-A ... 3'-G2T4G4T4G4T4G4T4G4T4G4(X)17A-A-C-T-T ... The length of the terminal repeat sequence for O. nova was confirmed in cloned macronuclear DNA molecules. Images PMID:6265931

Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).

PubMed

Schneider, Uffe Vest

2012-01-01

This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA

May the Best Molecule Win: Competition ESI Mass Spectrometry

PubMed Central

Laughlin, Sarah; Wilson, W. David

2015-01-01

Electrospray ionization mass spectrometry has become invaluable in the characterization of macromolecular biological systems such as nucleic acids and proteins. Recent advances in the field of mass spectrometry and the soft conditions characteristic of electrospray ionization allow for the investigation of non-covalent interactions among large biomolecules and ligands. Modulation of genetic processes through the use of small molecule inhibitors with the DNA minor groove is gaining attention as a potential therapeutic approach. In this review, we discuss the development of a competition method using electrospray ionization mass spectrometry to probe the interactions of multiple DNA sequences with libraries of minor groove binding molecules. Such an approach acts as a high-throughput screening method to determine important information including the stoichiometry, binding mode, cooperativity, and relative binding affinity. In addition to small molecule-DNA complexes, we highlight other applications in which competition mass spectrometry has been used. A competitive approach to simultaneously investigate complex interactions promises to be a powerful tool in the discovery of small molecule inhibitors with high specificity and for specific, important DNA sequences. PMID:26501262

Simple method of DNA stretching on glass substrate for fluorescence image and spectroscopy

NASA Astrophysics Data System (ADS)

Neupane, Guru P.; Dhakal, Krishna P.; Lee, Hyunsoo; Guthold, Martin; Joseph, Vincent S.; Hong, Jong-Dal; Kim, Jeongyong

2013-05-01

Study of biological molecule DNA has contributed to developing many breaking thoughts and wide applications in multidisciplinary fields, such as genomic, medical, sensing and forensic fields. Stretching of DNA molecules is an important supportive tool for AFM or spectroscopic studies of DNA in a single molecular level. In this article, we established a simple method of DNA stretching (to its full length) that occurred on a rotating negatively-charged surface of glass substrate. The isolation of a single DNA molecule was attained by the two competitive forces on DNA molecules, that is, the electrostatic attraction developed between the positively charged YOYO-1 stained DNA and the negatively charged substrate, and the centrifugal force of the rotating substrate, which separates the DNA aggregates into the single molecule. Density of stretched DNA molecules was controlled by selecting the specific parameters such as spinning time and rates, loading volume of DNA-dye complex solution etc. The atomic force microscopy image exhibited a single DNA molecule on the negatively-charged substrate in an isolated state. Further, the photoluminescence spectra of a single DNA molecule stained with YOYO-1 were achieved using the method developed in the present study, which is strongly believed to effectively support the spectroscopic analysis of DNA in a single molecular level.

Diversity of Dicotyledenous-Infecting Geminiviruses and Their Associated DNA Molecules in Southern Africa, Including the South-West Indian Ocean Islands

PubMed Central

Rey, Marie E. C.; Ndunguru, Joseph; Berrie, Leigh C.; Paximadis, Maria; Berry, Shaun; Cossa, Nurbibi; Nuaila, Valter N.; Mabasa, Ken G.; Abraham, Natasha; Rybicki, Edward P.; Martin, Darren; Pietersen, Gerhard; Esterhuizen, Lindy L.

2012-01-01

The family Geminiviridae comprises a group of plant-infecting circular ssDNA viruses that severely constrain agricultural production throughout the temperate regions of the world, and are a particularly serious threat to food security in sub-Saharan Africa. While geminiviruses exhibit considerable diversity in terms of their nucleotide sequences, genome structures, host ranges and insect vectors, the best characterised and economically most important of these viruses are those in the genus Begomovirus. Whereas begomoviruses are generally considered to be either monopartite (one ssDNA component) or bipartite (two circular ssDNA components called DNA-A and DNA-B), many apparently monopartite begomoviruses are associated with additional subviral ssDNA satellite components, called alpha- (DNA-αs) or betasatellites (DNA-βs). Additionally, subgenomic molecules, also known as defective interfering (DIs) DNAs that are usually derived from the parent helper virus through deletions of parts of its genome, are also associated with bipartite and monopartite begomoviruses. The past three decades have witnessed the emergence and diversification of various new begomoviral species and associated DI DNAs, in southern Africa, East Africa, and proximal Indian Ocean islands, which today threaten important vegetable and commercial crops such as, tobacco, cassava, tomato, sweet potato, and beans. This review aims to describe what is known about these viruses and their impacts on sustainable production in this sensitive region of the world. PMID:23170182

Agarose gel electrophoresis for the separation of DNA fragments.

PubMed

Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

2012-04-20

Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate

DNA-DNA interaction beyond the ground state

NASA Astrophysics Data System (ADS)

Lee, D. J.; Wynveen, A.; Kornyshev, A. A.

2004-11-01

The electrostatic interaction potential between DNA duplexes in solution is a basis for the statistical mechanics of columnar DNA assemblies. It may also play an important role in recombination of homologous genes. We develop a theory of this interaction that includes thermal torsional fluctuations of DNA using field-theoretical methods and Monte Carlo simulations. The theory extends and rationalizes the earlier suggested variational approach which was developed in the context of a ground state theory of interaction of nonhomologous duplexes. It shows that the heuristic variational theory is equivalent to the Hartree self-consistent field approximation. By comparison of the Hartree approximation with an exact solution based on the QM analogy of path integrals, as well as Monte Carlo simulations, we show that this easily analytically-tractable approximation works very well in most cases. Thermal fluctuations do not remove the ability of DNA molecules to attract each other at favorable azimuthal conformations, neither do they wash out the possibility of electrostatic “snap-shot” recognition of homologous sequences, considered earlier on the basis of ground state calculations. At short distances DNA molecules undergo a “torsional alignment transition,” which is first order for nonhomologous DNA and weaker order for homologous sequences.

Sensitive and inexpensive digital DNA analysis by microfluidic enrichment of rolling circle amplified single-molecules

PubMed Central

Kühnemund, Malte; Hernández-Neuta, Iván; Sharif, Mohd Istiaq; Cornaglia, Matteo; Gijs, Martin A.M.

2017-01-01

Abstract Single molecule quantification assays provide the ultimate sensitivity and precision for molecular analysis. However, most digital analysis techniques, i.e. droplet PCR, require sophisticated and expensive instrumentation for molecule compartmentalization, amplification and analysis. Rolling circle amplification (RCA) provides a simpler means for digital analysis. Nevertheless, the sensitivity of RCA assays has until now been limited by inefficient detection methods. We have developed a simple microfluidic strategy for enrichment of RCA products into a single field of view of a low magnification fluorescent sensor, enabling ultra-sensitive digital quantification of nucleic acids over a dynamic range from 1.2 aM to 190 fM. We prove the broad applicability of our analysis platform by demonstrating 5-plex detection of as little as ∼1 pg (∼300 genome copies) of pathogenic DNA with simultaneous antibiotic resistance marker detection, and the analysis of rare oncogene mutations. Our method is simpler, more cost-effective and faster than other digital analysis techniques and provides the means to implement digital analysis in any laboratory equipped with a standard fluorescent microscope. PMID:28077562

New branched DNA constructs.

PubMed

Chandra, Madhavaiah; Keller, Sascha; Gloeckner, Christian; Bornemann, Benjamin; Marx, Andreas

2007-01-01

The Watson-Crick base pairing of DNA is an advantageous phenomenon that can be exploited when using DNA as a scaffold for directed self-organization of nanometer-sized objects. Several reports have appeared in the literature that describe the generation of branched DNA (bDNA) with variable numbers of arms that self-assembles into predesigned architectures. These bDNA units are generated by using cleverly designed rigid crossover DNA molecules. Alternatively, bDNA can be generated by using synthetic branch points derived from either nucleoside or non-nucleoside building blocks. Branched DNA has scarcely been explored for use in nanotechnology or from self-assembling perspectives. Herein, we wish to report our results for the synthesis, characterization, and assembling properties of asymmetrical bDNA molecules that are able to generate linear and circular bDNA constructs. Our strategy for the generation of bDNA is based on a branching point that makes use of a novel protecting-group strategy. The bDNA units were generated by means of automated DNA synthesis methods and were used to generate novel objects by employing chemical and biological techniques. The entities generated might be useful building blocks for DNA-based nanobiotechnology.

Microfluidic DNA sample preparation method and device

DOEpatents

Krulevitch, Peter A.; Miles, Robin R.; Wang, Xiao-Bo; Mariella, Raymond P.; Gascoyne, Peter R. C.; Balch, Joseph W.

2002-01-01

Manipulation of DNA molecules in solution has become an essential aspect of genetic analyses used for biomedical assays, the identification of hazardous bacterial agents, and in decoding the human genome. Currently, most of the steps involved in preparing a DNA sample for analysis are performed manually and are time, labor, and equipment intensive. These steps include extraction of the DNA from spores or cells, separation of the DNA from other particles and molecules in the solution (e.g. dust, smoke, cell/spore debris, and proteins), and separation of the DNA itself into strands of specific lengths. Dielectrophoresis (DEP), a phenomenon whereby polarizable particles move in response to a gradient in electric field, can be used to manipulate and separate DNA in an automated fashion, considerably reducing the time and expense involved in DNA analyses, as well as allowing for the miniaturization of DNA analysis instruments. These applications include direct transport of DNA, trapping of DNA to allow for its separation from other particles or molecules in the solution, and the separation of DNA into strands of varying lengths.

Single molecule detection of nitric oxide enabled by d(AT)15 DNA adsorbed to near infrared fluorescent single-walled carbon nanotubes.

PubMed

Zhang, Jingqing; Boghossian, Ardemis A; Barone, Paul W; Rwei, Alina; Kim, Jong-Ho; Lin, Dahua; Heller, Daniel A; Hilmer, Andrew J; Nair, Nitish; Reuel, Nigel F; Strano, Michael S

2011-01-26

We report the selective detection of single nitric oxide (NO) molecules using a specific DNA sequence of d(AT)(15) oligonucleotides, adsorbed to an array of near-infrared fluorescent semiconducting single-walled carbon nanotubes (AT(15)-SWNT). While SWNT suspended with eight other variant DNA sequences show fluorescence quenching or enhancement from analytes such as dopamine, NADH, L-ascorbic acid, and riboflavin, d(AT)(15) imparts SWNT with a distinct selectivity toward NO. In contrast, the electrostatically neutral polyvinyl alcohol enables no response to nitric oxide, but exhibits fluorescent enhancement to other molecules in the tested library. For AT(15)-SWNT, a stepwise fluorescence decrease is observed when the nanotubes are exposed to NO, reporting the dynamics of single-molecule NO adsorption via SWNT exciton quenching. We describe these quenching traces using a birth-and-death Markov model, and the maximum likelihood estimator of adsorption and desorption rates of NO is derived. Applying the method to simulated traces indicates that the resulting error in the estimated rate constants is less than 5% under our experimental conditions, allowing for calibration using a series of NO concentrations. As expected, the adsorption rate is found to be linearly proportional to NO concentration, and the intrinsic single-site NO adsorption rate constant is 0.001 s(-1) μM NO(-1). The ability to detect nitric oxide quantitatively at the single-molecule level may find applications in new cellular assays for the study of nitric oxide carcinogenesis and chemical signaling, as well as medical diagnostics for inflammation.

C60 fullerene binding to DNA

NASA Astrophysics Data System (ADS)

Alshehri, Mansoor H.; Cox, Barry J.; Hill, James M.

2014-09-01

Fullerenes have attracted considerable attention in various areas of science and technology. Owing to their exceptional physical, chemical, and biological properties, they have many applications, particularly in cosmetic and medical products. Using the Lennard-Jones 6-12 potential function and the continuum approximation, which assumes that intermolecular interactions can be approximated by average atomic surface densities, we determine the binding energies of a C60 fullerene with respect to both single-strand and double-strand DNA molecules. We assume that all configurations are in a vacuum and that the C60 fullerene is initially at rest. Double integrals are performed to determine the interaction energy of the system. We find that the C60 fullerene binds to the double-strand DNA molecule, at either the major or minor grooves, with binding energies of -4.7 eV or -2.3 eV, respectively, and that the C60 molecule binds to the single-strand DNA molecule with a binding energy of -1.6 eV. Our results suggest that the C60 molecule is most likely to be linked to the major groove of the dsDNA molecule.

An evolution based biosensor receptor DNA sequence generation algorithm.

PubMed

Kim, Eungyeong; Lee, Malrey; Gatton, Thomas M; Lee, Jaewan; Zang, Yupeng

2010-01-01

A biosensor is composed of a bioreceptor, an associated recognition molecule, and a signal transducer that can selectively detect target substances for analysis. DNA based biosensors utilize receptor molecules that allow hybridization with the target analyte. However, most DNA biosensor research uses oligonucleotides as the target analytes and does not address the potential problems of real samples. The identification of recognition molecules suitable for real target analyte samples is an important step towards further development of DNA biosensors. This study examines the characteristics of DNA used as bioreceptors and proposes a hybrid evolution-based DNA sequence generating algorithm, based on DNA computing, to identify suitable DNA bioreceptor recognition molecules for stable hybridization with real target substances. The Traveling Salesman Problem (TSP) approach is applied in the proposed algorithm to evaluate the safety and fitness of the generated DNA sequences. This approach improves efficiency and stability for enhanced and variable-length DNA sequence generation and allows extension to generation of variable-length DNA sequences with diverse receptor recognition requirements.

DNA-Mediated Patterning of Single Quantum Dot Nanoarrays: A Reusable Platform for Single-Molecule Control

NASA Astrophysics Data System (ADS)

Huang, Da; Freeley, Mark; Palma, Matteo

2017-03-01

We present a facile strategy of general applicability for the assembly of individual nanoscale moieties in array configurations with single-molecule control. Combining the programming ability of DNA as a scaffolding material with a one-step lithographic process, we demonstrate the patterning of single quantum dots (QDs) at predefined locations on silicon and transparent glass surfaces: as proof of concept, clusters of either one, two, or three QDs were assembled in highly uniform arrays with a 60 nm interdot spacing within each cluster. Notably, the platform developed is reusable after a simple cleaning process and can be designed to exhibit different geometrical arrangements.

An isolated Hda-clamp complex is functional in the regulatory inactivation of DnaA and DNA replication.

PubMed

Kawakami, Hironori; Su'etsugu, Masayuki; Katayama, Tsutomu

2006-10-01

In Escherichia coli, a complex consisting of Hda and the DNA-loaded clamp-subunit of the DNA polymerase III holoenzyme promotes hydrolysis of DnaA-ATP. The resultant ADP-DnaA is inactive for initiation of chromosomal DNA replication, thereby repressing excessive initiations. As the cellular content of the clamp is 10-100 times higher than that of Hda, most Hda molecules might be complexed with the clamp in vivo. Although Hda predominantly forms irregular aggregates when overexpressed, in the present study we found that co-overexpression of the clamp with Hda enhances Hda solubility dramatically and we efficiently isolated the Hda-clamp complex. A single molecule of the complex appears to consist of two Hda molecules and a single clamp. The complex is competent in DnaA-ATP hydrolysis and DNA replication in the presence of DNA and the clamp deficient subassembly of the DNA polymerase III holoenzyme (pol III*). These findings indicate that the clamp contained in the complex is loaded onto DNA through an interaction with the pol III* and that the Hda activity is preserved in these processes. The complex consisting of Hda and the DNA-unloaded clamp may play a specific role in a process proceeding to the DnaA-ATP hydrolysis in vivo.

Logic Gate Operation by DNA Translocation through Biological Nanopores.

PubMed

Yasuga, Hiroki; Kawano, Ryuji; Takinoue, Masahiro; Tsuji, Yutaro; Osaki, Toshihisa; Kamiya, Koki; Miki, Norihisa; Takeuchi, Shoji

2016-01-01

Logical operations using biological molecules, such as DNA computing or programmable diagnosis using DNA, have recently received attention. Challenges remain with respect to the development of such systems, including label-free output detection and the rapidity of operation. Here, we propose integration of biological nanopores with DNA molecules for development of a logical operating system. We configured outputs "1" and "0" as single-stranded DNA (ssDNA) that is or is not translocated through a nanopore; unlabeled DNA was detected electrically. A negative-AND (NAND) operation was successfully conducted within approximately 10 min, which is rapid compared with previous studies using unlabeled DNA. In addition, this operation was executed in a four-droplet network. DNA molecules and associated information were transferred among droplets via biological nanopores. This system would facilitate linking of molecules and electronic interfaces. Thus, it could be applied to molecular robotics, genetic engineering, and even medical diagnosis and treatment.

Logic Gate Operation by DNA Translocation through Biological Nanopores

PubMed Central

Takinoue, Masahiro; Tsuji, Yutaro; Osaki, Toshihisa; Kamiya, Koki; Miki, Norihisa; Takeuchi, Shoji

2016-01-01

Logical operations using biological molecules, such as DNA computing or programmable diagnosis using DNA, have recently received attention. Challenges remain with respect to the development of such systems, including label-free output detection and the rapidity of operation. Here, we propose integration of biological nanopores with DNA molecules for development of a logical operating system. We configured outputs “1” and “0” as single-stranded DNA (ssDNA) that is or is not translocated through a nanopore; unlabeled DNA was detected electrically. A negative-AND (NAND) operation was successfully conducted within approximately 10 min, which is rapid compared with previous studies using unlabeled DNA. In addition, this operation was executed in a four-droplet network. DNA molecules and associated information were transferred among droplets via biological nanopores. This system would facilitate linking of molecules and electronic interfaces. Thus, it could be applied to molecular robotics, genetic engineering, and even medical diagnosis and treatment. PMID:26890568

Discovery and characterization of small molecules targeting the DNA-binding ETS domain of ERG in prostate cancer

PubMed Central

Kim, Ari; Yen, Paul; Mroczek, Marta; Nouri, Mannan; Lien, Scott; Axerio-Cilies, Peter; Dalal, Kush; Yau, Clement; Ghaidi, Fariba; Guo, Yubin; Yamazaki, Takeshi; Lawn, Sam; Gleave, Martin E.; Gregory-Evans, Cheryl Y.

2017-01-01

Genomic alterations involving translocations of the ETS-related gene ERG occur in approximately half of prostate cancer cases. These alterations result in aberrant, androgen-regulated production of ERG protein variants that directly contribute to disease development and progression. This study describes the discovery and characterization of a new class of small molecule ERG antagonists identified through rational in silico methods. These antagonists are designed to sterically block DNA binding by the ETS domain of ERG and thereby disrupt transcriptional activity. We confirmed the direct binding of a lead compound, VPC-18005, with the ERG-ETS domain using biophysical approaches. We then demonstrated VPC-18005 reduced migration and invasion rates of ERG expressing prostate cancer cells, and reduced metastasis in a zebrafish xenograft model. These results demonstrate proof-of-principal that small molecule targeting of the ERG-ETS domain can suppress transcriptional activity and reverse transformed characteristics of prostate cancers aberrantly expressing ERG. Clinical advancement of the developed small molecule inhibitors may provide new therapeutic agents for use as alternatives to, or in combination with, current therapies for men with ERG-expressing metastatic castration-resistant prostate cancer. PMID:28465491

Single molecule fluorescence microscopy for ultra-sensitive RNA expression profiling

NASA Astrophysics Data System (ADS)

Hesse, Jan; Jacak, Jaroslaw; Regl, Gerhard; Eichberger, Thomas; Aberger, Fritz; Schlapak, Robert; Howorka, Stefan; Muresan, Leila; Frischauf, Anna-Maria; Schütz, Gerhard J.

2007-02-01

We developed a microarray analysis platform for ultra-sensitive RNA expression profiling of minute samples. It utilizes a novel scanning system for single molecule fluorescence detection on cm2 size samples in combination with specialized biochips, optimized for low autofluorescence and weak unspecific adsorption. 20 μg total RNA was extracted from 10 6 cells of a human keratinocyte cell line (HaCaT) and reversely transcribed in the presence of Alexa647-aha-dUTP. 1% of the resulting labeled cDNA was used for complex hybridization to a custom-made oligonucleotide microarray representing a set of 125 different genes. For low abundant genes, individual cDNA molecules hybridized to the microarray spots could be resolved. Single cDNA molecules hybridized to the chip surface appeared as diffraction limited features in the fluorescence images. The à trous wavelet method was utilized for localization and counting of the separated cDNA signals. Subsequently, the degree of labeling of the localized cDNA molecules was determined by brightness analysis for the different genes. Variations by factors up to 6 were found, which in conventional microarray analysis would result in a misrepresentation of the relative abundance of mRNAs.

Recent advances in DNA nanotechnology.

PubMed

Chidchob, Pongphak; Sleiman, Hanadi F

2018-05-08

DNA is a powerful guiding molecule to achieve the precise construction of arbitrary structures and high-resolution organization of functional materials. The combination of sequence programmability, rigidity and highly specific molecular recognition in this molecule has resulted in a wide range of exquisitely designed DNA frameworks. To date, the impressive potential of DNA nanomaterials has been demonstrated from fundamental research to technological advancements in materials science and biomedicine. This review presents a summary of some of the most recent developments in structural DNA nanotechnology regarding new assembly approaches and efforts in translating DNA nanomaterials into practical use. Recent work on incorporating blunt-end stacking and hydrophobic interactions as orthogonal instruction rules in DNA assembly, and several emerging applications of DNA nanomaterials will also be highlighted. Copyright © 2018. Published by Elsevier Ltd.

DNA-Based Applications in Nanobiotechnology

PubMed Central

Abu-Salah, Khalid M.; Ansari, Anees A.; Alrokayan, Salman A.

2010-01-01

Biological molecules such as deoxyribonucleic acid (DNA) have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated. PMID:20652049

DNA-based applications in nanobiotechnology.

PubMed

Abu-Salah, Khalid M; Ansari, Anees A; Alrokayan, Salman A

2010-01-01

Biological molecules such as deoxyribonucleic acid (DNA) have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated.

Study of Auger effect in DNA when bound to molecules containing platinum. A possible application to hadrontherapy

NASA Astrophysics Data System (ADS)

Kobayashi, K.; Usami, N.; Sasaki, I.; Frohlich, H.; Le Sech, C.

2003-01-01

Complexes made of DNA and Cyclo-Pt bound to plasmid DNA, were placed in aqueous solution and irradiated with monochromatic X-rays in the range E=8.5-13 keV, including the resonant photoabsorption energy of the L III shell of the platinum atom. The number of single- and double-strand breaks (ssb and dsb) induced by irradiation on a supercoiled DNA plasmid was measured by the production of circular-nicked and linear forms. In order to disentangle the contribution of the direct effects imparted to ionization, and the indirect effects due to a free radical attack, experiments have been performed in the presence of a small concentration (64 mmol l -1) of hydroxyl free radical scavenger dimethyl sulfoxide (DMSO). An enhancement of the number of ssb and dsb is observed when the plasmids contain the Pt intercalating molecules. Even when off-resonant X-rays are used, the strand break efficiency remains higher than expected based upon the absorption cross-section, as if the Pt bound to DNA is increasing the yield of strand breaks. A mechanism is suggested, involving photoelectrons generated from the ionization of water which efficiently ionize Pt atoms. This observation may provide an insight to understanding the effects of new radiotherapy protocols, associated chemotherapeutic agents such as cisplatin and ordinary radiotherapy for tumoral treatments.

Probabilistic switching circuits in DNA

PubMed Central

Wilhelm, Daniel; Bruck, Jehoshua

2018-01-01

A natural feature of molecular systems is their inherent stochastic behavior. A fundamental challenge related to the programming of molecular information processing systems is to develop a circuit architecture that controls the stochastic states of individual molecular events. Here we present a systematic implementation of probabilistic switching circuits, using DNA strand displacement reactions. Exploiting the intrinsic stochasticity of molecular interactions, we developed a simple, unbiased DNA switch: An input signal strand binds to the switch and releases an output signal strand with probability one-half. Using this unbiased switch as a molecular building block, we designed DNA circuits that convert an input signal to an output signal with any desired probability. Further, this probability can be switched between 2n different values by simply varying the presence or absence of n distinct DNA molecules. We demonstrated several DNA circuits that have multiple layers and feedback, including a circuit that converts an input strand to an output strand with eight different probabilities, controlled by the combination of three DNA molecules. These circuits combine the advantages of digital and analog computation: They allow a small number of distinct input molecules to control a diverse signal range of output molecules, while keeping the inputs robust to noise and the outputs at precise values. Moreover, arbitrarily complex circuit behaviors can be implemented with just a single type of molecular building block. PMID:29339484

DNA under Force: Mechanics, Electrostatics, and Hydration.

PubMed

Li, Jingqiang; Wijeratne, Sithara S; Qiu, Xiangyun; Kiang, Ching-Hwa

2015-02-25

Quantifying the basic intra- and inter-molecular forces of DNA has helped us to better understand and further predict the behavior of DNA. Single molecule technique elucidates the mechanics of DNA under applied external forces, sometimes under extreme forces. On the other hand, ensemble studies of DNA molecular force allow us to extend our understanding of DNA molecules under other forces such as electrostatic and hydration forces. Using a variety of techniques, we can have a comprehensive understanding of DNA molecular forces, which is crucial in unraveling the complex DNA functions in living cells as well as in designing a system that utilizes the unique properties of DNA in nanotechnology.

Conformation-dependent DNA attraction

NASA Astrophysics Data System (ADS)

Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

2014-05-01

Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by

Effect of genome sequence on the force-induced unzipping of a DNA molecule.

PubMed

Singh, N; Singh, Y

2006-02-01

We considered a dsDNA polymer in which distribution of bases are random at the base pair level but ordered at a length of 18 base pairs and calculated its force elongation behaviour in the constant extension ensemble. The unzipping force F(y) vs. extension y is found to have a series of maxima and minima. By changing base pairs at selected places in the molecule we calculated the change in F(y) curve and found that the change in the value of force is of the order of few pN and the range of the effect depending on the temperature, can spread over several base pairs. We have also discussed briefly how to calculate in the constant force ensemble a pause or a jump in the extension-time curve from the knowledge of F(y).

Quantitative DNA fiber mapping

DOEpatents

Gray, Joe W.; Weier, Heinz-Ulrich G.

1998-01-01

The present invention relates generally to the DNA mapping and sequencing technologies. In particular, the present invention provides enhanced methods and compositions for the physical mapping and positional cloning of genomic DNA. The present invention also provides a useful analytical technique to directly map cloned DNA sequences onto individual stretched DNA molecules.

Joint Actions of Developmental Toxicants.

DTIC Science & Technology

1991-06-01

antagonistic response may have been the result of poorer absorption of hydroxyurea by the severly malformed embryos, as isoniazid had a much greater...chain carboxylic acids showed concentration additive joint actions for induction of malformation . Combinations of DNA synthesis inhibitors showed...response additive to antagonistic joint actions at malformation -inducing con- centrations. Since each compound inhibits a different enzyme in the process of

Solving traveling salesman problems with DNA molecules encoding numerical values.

PubMed

Lee, Ji Youn; Shin, Soo-Yong; Park, Tai Hyun; Zhang, Byoung-Tak

2004-12-01

We introduce a DNA encoding method to represent numerical values and a biased molecular algorithm based on the thermodynamic properties of DNA. DNA strands are designed to encode real values by variation of their melting temperatures. The thermodynamic properties of DNA are used for effective local search of optimal solutions using biochemical techniques, such as denaturation temperature gradient polymerase chain reaction and temperature gradient gel electrophoresis. The proposed method was successfully applied to the traveling salesman problem, an instance of optimization problems on weighted graphs. This work extends the capability of DNA computing to solving numerical optimization problems, which is contrasted with other DNA computing methods focusing on logical problem solving.

Searching target sites on DNA by proteins: Role of DNA dynamics under confinement

PubMed Central

Mondal, Anupam; Bhattacherjee, Arnab

2015-01-01

DNA-binding proteins (DBPs) rapidly search and specifically bind to their target sites on genomic DNA in order to trigger many cellular regulatory processes. It has been suggested that the facilitation of search dynamics is achieved by combining 3D diffusion with one-dimensional sliding and hopping dynamics of interacting proteins. Although, recent studies have advanced the knowledge of molecular determinants that affect one-dimensional search efficiency, the role of DNA molecule is poorly understood. In this study, by using coarse-grained simulations, we propose that dynamics of DNA molecule and its degree of confinement due to cellular crowding concertedly regulate its groove geometry and modulate the inter-communication with DBPs. Under weak confinement, DNA dynamics promotes many short, rotation-decoupled sliding events interspersed by hopping dynamics. While this results in faster 1D diffusion, associated probability of missing targets by jumping over them increases. In contrast, strong confinement favours rotation-coupled sliding to locate targets but lacks structural flexibility to achieve desired specificity. By testing under physiological crowding, our study provides a plausible mechanism on how DNA molecule may help in maintaining an optimal balance between fast hopping and rotation-coupled sliding dynamics, to locate target sites rapidly and form specific complexes precisely. PMID:26400158

A robust statistical estimation (RoSE) algorithm jointly recovers the 3D location and intensity of single molecules accurately and precisely

NASA Astrophysics Data System (ADS)

Mazidi, Hesam; Nehorai, Arye; Lew, Matthew D.

2018-02-01

In single-molecule (SM) super-resolution microscopy, the complexity of a biological structure, high molecular density, and a low signal-to-background ratio (SBR) may lead to imaging artifacts without a robust localization algorithm. Moreover, engineered point spread functions (PSFs) for 3D imaging pose difficulties due to their intricate features. We develop a Robust Statistical Estimation algorithm, called RoSE, that enables joint estimation of the 3D location and photon counts of SMs accurately and precisely using various PSFs under conditions of high molecular density and low SBR.

Preparation and self-folding of amphiphilic DNA origami.

PubMed

Zhou, Chao; Wang, Dianming; Dong, Yuanchen; Xin, Ling; Sun, Yawei; Yang, Zhongqiang; Liu, Dongsheng

2015-03-01

Amphiphilic DNA origami is prepared by dressing multiple hydrophobic molecules on a rectangular single layer DNA origami, which is then folded or coupled in sandwich-like structures with two outer DNA origami layer and one inner hydrophobic molecules layer. The preference to form different kinds of structures could be tailored by rational design of DNA origami. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Human Mitochondrial DNA Replication

PubMed Central

Holt, Ian J.; Reyes, Aurelio

2012-01-01

Elucidation of the process of DNA replication in mitochondria is in its infancy. For many years, maintenance of the mitochondrial genome was regarded as greatly simplified compared to the nucleus. Mammalian mitochondria were reported to lack all DNA repair systems, to eschew DNA recombination, and to possess but a single DNA polymerase, polymerase γ. Polγ was said to replicate mitochondrial DNA exclusively via one mechanism, involving only two priming events and a handful of proteins. In this “strand-displacement model,” leading strand DNA synthesis begins at a specific site and advances approximately two-thirds of the way around the molecule before DNA synthesis is initiated on the “lagging” strand. Although the displaced strand was long-held to be coated with protein, RNA has more recently been proposed in its place. Furthermore, mitochondrial DNA molecules with all the features of products of conventional bidirectional replication have been documented, suggesting that the process and regulation of replication in mitochondria is complex, as befits a genome that is a core factor in human health and longevity. PMID:23143808

DNA confinement in nanochannels: physics and biological applications

NASA Astrophysics Data System (ADS)

Reisner, Walter; Pedersen, Jonas N.; Austin, Robert H.

2012-10-01

DNA is the central storage molecule of genetic information in the cell, and reading that information is a central problem in biology. While sequencing technology has made enormous advances over the past decade, there is growing interest in platforms that can readout genetic information directly from long single DNA molecules, with the ultimate goal of single-cell, single-genome analysis. Such a capability would obviate the need for ensemble averaging over heterogeneous cellular populations and eliminate uncertainties introduced by cloning and molecular amplification steps (thus enabling direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement—including the effect of varying ionic strength—and then discuss recent applications of these systems to genomic mapping. Apart from the intense biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100 µm range.

DNA confinement in nanochannels: physics and biological applications.

PubMed

Reisner, Walter; Pedersen, Jonas N; Austin, Robert H

2012-10-01

DNA is the central storage molecule of genetic information in the cell, and reading that information is a central problem in biology. While sequencing technology has made enormous advances over the past decade, there is growing interest in platforms that can readout genetic information directly from long single DNA molecules, with the ultimate goal of single-cell, single-genome analysis. Such a capability would obviate the need for ensemble averaging over heterogeneous cellular populations and eliminate uncertainties introduced by cloning and molecular amplification steps (thus enabling direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement--including the effect of varying ionic strength--and then discuss recent applications of these systems to genomic mapping. Apart from the intense biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100 µm range.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

1999-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

1999-05-18

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

Rapid purification of circular DNA by triplex-mediated affinity capture

DOEpatents

Ji, Huamin; Smith, Lloyd M.

1997-01-01

A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support.

Rapid purification of circular DNA by triplex-mediated affinity capture

DOEpatents

Ji, H.; Smith, L.M.

1997-01-07

A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

Methods And Devices For Characterizing Duplex Nucleic Acid Molecules

DOEpatents

Akeson, Mark; Vercoutere, Wenonah; Haussler, David; Winters-Hilt, Stephen

2005-08-30

Methods and devices are provided for characterizing a duplex nucleic acid, e.g., a duplex DNA molecule. In the subject methods, a fluid conducting medium that includes a duplex nucleic acid molecule is contacted with a nanopore under the influence of an applied electric field and the resulting changes in current through the nanopore caused by the duplex nucleic acid molecule are monitored. The observed changes in current through the nanopore are then employed as a set of data values to characterize the duplex nucleic acid, where the set of data values may be employed in raw form or manipulated, e.g., into a current blockade profile. Also provided are nanopore devices for practicing the subject methods, where the subject nanopore devices are characterized by the presence of an algorithm which directs a processing means to employ monitored changes in current through a nanopore to characterize a duplex nucleic acid molecule responsible for the current changes. The subject methods and devices find use in a variety of applications, including, among other applications, the identification of an analyte duplex DNA molecule in a sample, the specific base sequence at a single nulceotide polymorphism (SNP), and the sequencing of duplex DNA molecules.

Deregulation upon DNA damage revealed by joint analysis of context-specific perturbation data.

PubMed

Szczurek, Ewa; Markowetz, Florian; Gat-Viks, Irit; Biecek, Przemysław; Tiuryn, Jerzy; Vingron, Martin

2011-06-21

Deregulation between two different cell populations manifests itself in changing gene expression patterns and changing regulatory interactions. Accumulating knowledge about biological networks creates an opportunity to study these changes in their cellular context. We analyze re-wiring of regulatory networks based on cell population-specific perturbation data and knowledge about signaling pathways and their target genes. We quantify deregulation by merging regulatory signal from the two cell populations into one score. This joint approach, called JODA, proves advantageous over separate analysis of the cell populations and analysis without incorporation of knowledge. JODA is implemented and freely available in a Bioconductor package 'joda'. Using JODA, we show wide-spread re-wiring of gene regulatory networks upon neocarzinostatin-induced DNA damage in Human cells. We recover 645 deregulated genes in thirteen functional clusters performing the rich program of response to damage. We find that the clusters contain many previously characterized neocarzinostatin target genes. We investigate connectivity between those genes, explaining their cooperation in performing the common functions. We review genes with the most extreme deregulation scores, reporting their involvement in response to DNA damage. Finally, we investigate the indirect impact of the ATM pathway on the deregulated genes, and build a hypothetical hierarchy of direct regulation. These results prove that JODA is a step forward to a systems level, mechanistic understanding of changes in gene regulation between different cell populations.

Sensitive and inexpensive digital DNA analysis by microfluidic enrichment of rolling circle amplified single-molecules.

PubMed

Kühnemund, Malte; Hernández-Neuta, Iván; Sharif, Mohd Istiaq; Cornaglia, Matteo; Gijs, Martin A M; Nilsson, Mats

2017-05-05

Single molecule quantification assays provide the ultimate sensitivity and precision for molecular analysis. However, most digital analysis techniques, i.e. droplet PCR, require sophisticated and expensive instrumentation for molecule compartmentalization, amplification and analysis. Rolling circle amplification (RCA) provides a simpler means for digital analysis. Nevertheless, the sensitivity of RCA assays has until now been limited by inefficient detection methods. We have developed a simple microfluidic strategy for enrichment of RCA products into a single field of view of a low magnification fluorescent sensor, enabling ultra-sensitive digital quantification of nucleic acids over a dynamic range from 1.2 aM to 190 fM. We prove the broad applicability of our analysis platform by demonstrating 5-plex detection of as little as ∼1 pg (∼300 genome copies) of pathogenic DNA with simultaneous antibiotic resistance marker detection, and the analysis of rare oncogene mutations. Our method is simpler, more cost-effective and faster than other digital analysis techniques and provides the means to implement digital analysis in any laboratory equipped with a standard fluorescent microscope. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Smoking induces transcription of the heat shock protein system in the joints.

PubMed

Ospelt, Caroline; Camici, Giovanni G; Engler, Anna; Kolling, Christoph; Vogetseder, Alexander; Gay, Renate E; Michel, Beat A; Gay, Steffen

2014-07-01

Smoking increases the risk of developing rheumatoid arthritis (RA) and worsens the course of the disease. In the current study we analysed whether smoking can affect gene expression directly in the joints. Synovial fibroblasts were incubated with 5% cigarette smoke extract and changes in gene expression were detected using whole genome microarrays and verified with real-time PCR. Synovial tissues were obtained from smoking and non-smoking patients with RA undergoing joint replacement surgery and from mice exposed to cigarette smoke or ambient air in a whole body exposure chamber for 3 weeks. Microarray and real-time PCR analysis showed a significant upregulation of the heat shock proteins DnaJA4, DnaJB4, DnaJC6, HspB8 and Hsp70 after stimulation of synovial fibroblasts with 5% cigarette smoke extract. Similarly, in synovial tissues of smokers with RA the expression of DnaJB4, DnaJC6, HspB8 and Hsp70 was significantly higher compared with non-smokers with RA. Upregulation of DnaJB4 and DnaJC6 in joints by smoking was also confirmed in mice exposed to cigarette smoke. Our data clearly show that smoking can change gene expression in the joints, which can lead to the activation of signalling pathways that promote development of autoimmunity and chronic joint inflammation. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Trehalose facilitates DNA melting: a single-molecule optical tweezers study.

PubMed

Bezrukavnikov, Sergey; Mashaghi, Alireza; van Wijk, Roeland J; Gu, Chan; Yang, Li Jiang; Gao, Yi Qin; Tans, Sander J

2014-10-07

Using optical tweezers, here we show that the overstretching transition force of double-stranded DNA (dsDNA) is lowered significantly by the addition of the disaccharide trehalose as well as certain polyol osmolytes. This effect is found to depend linearly on the logarithm of the trehalose concentration. We propose an entropic driving mechanism for the experimentally observed destabilization of dsDNA that is rooted in the higher affinity of the DNA bases for trehalose than for water, which promotes base exposure and DNA melting. Molecular dynamics simulation reveals the direct interaction of trehalose with nucleobases. Experiments with other osmolytes confirm that the extent of dsDNA destabilization is governed by the ratio between polar and apolar fractions of an osmolyte.

Mitochondrial DNA copy number threshold in mtDNA depletion myopathy.

PubMed

Durham, S E; Bonilla, E; Samuels, D C; DiMauro, S; Chinnery, P F

2005-08-09

The authors measured the absolute amount of mitochondrial DNA (mtDNA) within single muscle fibers from two patients with thymidine kinase 2 (TK2) deficiency and two healthy controls. TK2 deficient fibers containing more than 0.01 mtDNA/microm3 had residual cytochrome c oxidase (COX) activity. This defines the minimum amount of wild-type mtDNA molecules required to maintain COX activity in skeletal muscle and provides an explanation for the mosaic histochemical pattern seen in patients with mtDNA depletion syndrome.

Identification of small molecule inhibitors of ERCC1-XPF that inhibit DNA repair and potentiate cisplatin efficacy in cancer cells

PubMed Central

Arora, Sanjeevani; Heyza, Joshua; Zhang, Hao; Kalman-Maltese, Vivian; Tillison, Kristin; Floyd, Ashley M.; Chalfin, Elaine M.; Bepler, Gerold; Patrick, Steve M.

2016-01-01

ERCC1-XPF heterodimer is a 5′-3′ structure-specific endonuclease which is essential in multiple DNA repair pathways in mammalian cells. ERCC1-XPF (ERCC1-ERCC4) repairs cisplatin-DNA intrastrand adducts and interstrand crosslinks and its specific inhibition has been shown to enhance cisplatin cytotoxicity in cancer cells. In this study, we describe a high throughput screen (HTS) used to identify small molecules that inhibit the endonuclease activity of ERCC1-XPF. Primary screens identified two compounds that inhibit ERCC1-XPF activity in the nanomolar range. These compounds were validated in secondary screens against two other non-related endonucleases to ensure specificity. Results from these screens were validated using an in vitro gel-based nuclease assay. Electrophoretic mobility shift assays (EMSAs) further show that these compounds do not inhibit the binding of purified ERCC1-XPF to DNA. Next, in lung cancer cells these compounds potentiated cisplatin cytotoxicity and inhibited DNA repair. Structure activity relationship (SAR) studies identified related compounds for one of the original Hits, which also potentiated cisplatin cytotoxicity in cancer cells. Excitingly, dosing with NSC16168 compound potentiated cisplatin antitumor activity in a lung cancer xenograft model. Further development of ERCC1-XPF DNA repair inhibitors is expected to sensitize cancer cells to DNA damage-based chemotherapy. PMID:27650543

Biophysics of protein-DNA interactions and chromosome organization

PubMed Central

Marko, John F.

2014-01-01

The function of DNA in cells depends on its interactions with protein molecules, which recognize and act on base sequence patterns along the double helix. These notes aim to introduce basic polymer physics of DNA molecules, biophysics of protein-DNA interactions and their study in single-DNA experiments, and some aspects of large-scale chromosome structure. Mechanisms for control of chromosome topology will also be discussed. PMID:25419039

Single-molecule studies of multi-protein machines

NASA Astrophysics Data System (ADS)

van Oijen, Antoine

2010-03-01

Advances in optical imaging and molecular manipulation techniques have made it possible to observe individual enzymes and record molecular movies that provide new insight into their dynamics and reaction mechanisms. In a biological context, most of these enzymes function in concert with other enzymes in multi-protein complexes, so an important future direction will be the utilization of single-molecule techniques to unravel the orchestration of large macromolecular assemblies. Our group is developing the single-molecule tools that will make it possible to study biochemical pathways of arbitrary complexity at the single-molecule level. I will discuss results of single-molecule experiments on the replisome, the molecular machinery that is responsible for replication of DNA. We stretch individual DNA molecules and use their elastic properties to obtain dynamic information on the proteins that unwind the double helix and copy its genetic information. Furthermore, we visualize fluorescently labeled components of the replisome and thus obtain information on stochiometry and exchange kinetics. This simultaneous observation of catalytic activity and composition allows us to gain deeper insight into the structure-function relationship of the replisome.

Rapid screening for plasmid DNA.

PubMed

Hughes, C; Meynell, G G

1977-03-07

A procedure is described for demonstrating plasmid DNA and its molecular weight, based on rate zonal centrifugation of unlabelled DNA in neutral sucrose gradients containing a low concentration of ethidium bromide. Each DNA species is then visualized as a discrete fluorescent band when the centrifuge tube is illuminated with ultra-violet light. Plasmids exist as closed circular and as relaxed circular molecules, which sediment separately, but during preparation of lysates, closed circular molecules are nicked so that each plasmid forms only a single band of relaxed circles within the gradient.

Investigation of sliding DNA clamp dynamics by single-molecule fluorescence, mass spectrometry and structure-based modeling

PubMed Central

Gadkari, Varun V; Harvey, Sophie R; Raper, Austin T; Chu, Wen-Ting; Wang, Jin; Wysocki, Vicki H; Suo, Zucai

2018-01-01

Abstract Proliferating cell nuclear antigen (PCNA) is a trimeric ring-shaped clamp protein that encircles DNA and interacts with many proteins involved in DNA replication and repair. Despite extensive structural work to characterize the monomeric, dimeric, and trimeric forms of PCNA alone and in complex with interacting proteins, no structure of PCNA in a ring-open conformation has been published. Here, we use a multidisciplinary approach, including single-molecule Förster resonance energy transfer (smFRET), native ion mobility-mass spectrometry (IM-MS), and structure-based computational modeling, to explore the conformational dynamics of a model PCNA from Sulfolobus solfataricus (Sso), an archaeon. We found that Sso PCNA samples ring-open and ring-closed conformations even in the absence of its clamp loader complex, replication factor C, and transition to the ring-open conformation is modulated by the ionic strength of the solution. The IM-MS results corroborate the smFRET findings suggesting that PCNA dynamics are maintained in the gas phase and further establishing IM-MS as a reliable strategy to investigate macromolecular motions. Our molecular dynamic simulations agree with the experimental data and reveal that ring-open PCNA often adopts an out-of-plane left-hand geometry. Collectively, these results implore future studies to define the roles of PCNA dynamics in DNA loading and other PCNA-mediated interactions. PMID:29529283

Multiplexed Sequence Encoding: A Framework for DNA Communication

PubMed Central

Zakeri, Bijan; Carr, Peter A.; Lu, Timothy K.

2016-01-01

Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication—data encoding, data transfer & data extraction—and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system—Multiplexed Sequence Encoding (MuSE)—that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA. PMID:27050646

Multiplexed Sequence Encoding: A Framework for DNA Communication.

PubMed

Zakeri, Bijan; Carr, Peter A; Lu, Timothy K

2016-01-01

Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication-data encoding, data transfer & data extraction-and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system-Multiplexed Sequence Encoding (MuSE)-that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA.

The Knowledge of DNA and DNA Technologies among Pre-Service Science Teachers

ERIC Educational Resources Information Center

Cardak, Osman; Dikmenli, Musa

2008-01-01

The purpose of this study is to determine the alternative conceptions of elementary school pre-service science teachers regarding DNA and DNA technologies. The questions asked in the study related to subjects including the structure and role of DNA molecule, structure of genes, some genetic technologies, Genetically Modified Organism (GMO) plants,…

Circulating Tumor DNA Analysis in Patients With Cancer: American Society of Clinical Oncology and College of American Pathologists Joint Review.

PubMed

Merker, Jason D; Oxnard, Geoffrey R; Compton, Carolyn; Diehn, Maximilian; Hurley, Patricia; Lazar, Alexander J; Lindeman, Neal; Lockwood, Christina M; Rai, Alex J; Schilsky, Richard L; Tsimberidou, Apostolia M; Vasalos, Patricia; Billman, Brooke L; Oliver, Thomas K; Bruinooge, Suanna S; Hayes, Daniel F; Turner, Nicholas C

2018-06-01

Purpose Clinical use of analytical tests to assess genomic variants in circulating tumor DNA (ctDNA) is increasing. This joint review from ASCO and the College of American Pathologists summarizes current information about clinical ctDNA assays and provides a framework for future research. Methods An Expert Panel conducted a literature review on the use of ctDNA assays for solid tumors, including pre-analytical variables, analytical validity, interpretation and reporting, and clinical validity and utility. Results The literature search identified 1,338 references. Of those, 390, plus 31 references supplied by the Expert Panel, were selected for full-text review. There were 77 articles selected for inclusion. Conclusion The evidence indicates that testing for ctDNA is optimally performed on plasma collected in cell stabilization or EDTA tubes, with EDTA tubes processed within 6 hours of collection. Some ctDNA assays have demonstrated clinical validity and utility with certain types of advanced cancer; however, there is insufficient evidence of clinical validity and utility for the majority of ctDNA assays in advanced cancer. Evidence shows discordance between the results of ctDNA assays and genotyping tumor specimens and supports tumor tissue genotyping to confirm undetected results from ctDNA tests. There is no evidence of clinical utility and little evidence of clinical validity of ctDNA assays in early-stage cancer, treatment monitoring, or residual disease detection. There is no evidence of clinical validity and clinical utility to suggest that ctDNA assays are useful for cancer screening, outside of a clinical trial. Given the rapid pace of research, re-evaluation of the literature will shortly be required, along with the development of tools and guidance for clinical practice.