Boyer, François; Boutouil, Hend; Dalloul, Iman; Dalloul, Zeinab; Cook-Moreau, Jeanne; Aldigier, Jean-Claude; Carrion, Claire; Herve, Bastien; Scaon, Erwan; Cogné, Michel; Péron, Sophie
2017-05-15
B cells ensure humoral immune responses due to the production of Ag-specific memory B cells and Ab-secreting plasma cells. In secondary lymphoid organs, Ag-driven B cell activation induces terminal maturation and Ig isotype class switch (class switch recombination [CSR]). CSR creates a virtually unique IgH locus in every B cell clone by intrachromosomal recombination between two switch (S) regions upstream of each C region gene. Amount and structural features of CSR junctions reveal valuable information about the CSR mechanism, and analysis of CSR junctions is useful in basic and clinical research studies of B cell functions. To provide an automated tool able to analyze large data sets of CSR junction sequences produced by high-throughput sequencing (HTS), we designed CSReport, a software program dedicated to support analysis of CSR recombination junctions sequenced with a HTS-based protocol (Ion Torrent technology). CSReport was assessed using simulated data sets of CSR junctions and then used for analysis of Sμ-Sα and Sμ-Sγ1 junctions from CH12F3 cells and primary murine B cells, respectively. CSReport identifies junction segment breakpoints on reference sequences and junction structure (blunt-ended junctions or junctions with insertions or microhomology). Besides the ability to analyze unprecedentedly large libraries of junction sequences, CSReport will provide a unified framework for CSR junction studies. Our results show that CSReport is an accurate tool for analysis of sequences from our HTS-based protocol for CSR junctions, thereby facilitating and accelerating their study. Copyright © 2017 by The American Association of Immunologists, Inc.
Expansion of the Preimmune Antibody Repertoire by Junctional Diversity in Bos taurus
Liljavirta, Jenni; Niku, Mikael; Pessa-Morikawa, Tiina; Ekman, Anna; Iivanainen, Antti
2014-01-01
Cattle have a limited range of immunoglobulin genes which are further diversified by antigen independent somatic hypermutation in fetuses. Junctional diversity generated during somatic recombination contributes to antibody diversity but its relative significance has not been comprehensively studied. We have investigated the importance of terminal deoxynucleotidyl transferase (TdT) -mediated junctional diversity to the bovine immunoglobulin repertoire. We also searched for new bovine heavy chain diversity (IGHD) genes as the information of the germline sequences is essential to define the junctional boundaries between gene segments. New heavy chain variable genes (IGHV) were explored to address the gene usage in the fetal recombinations. Our bioinformatics search revealed five new IGHD genes, which included the longest IGHD reported so far, 154 bp. By genomic sequencing we found 26 new IGHV sequences that represent potentially new IGHV genes or allelic variants. Sequence analysis of immunoglobulin heavy chain cDNA libraries of fetal bone marrow, ileum and spleen showed 0 to 36 nontemplated N-nucleotide additions between variable, diversity and joining genes. A maximum of 8 N nucleotides were also identified in the light chains. The junctional base profile was biased towards A and T nucleotide additions (64% in heavy chain VD, 52% in heavy chain DJ and 61% in light chain VJ junctions) in contrast to the high G/C content which is usually observed in mice. Sequence analysis also revealed extensive exonuclease activity, providing additional diversity. B-lymphocyte specific TdT expression was detected in bovine fetal bone marrow by reverse transcription-qPCR and immunofluorescence. These results suggest that TdT-mediated junctional diversity and exonuclease activity contribute significantly to the size of the cattle preimmune antibody repertoire already in the fetal period. PMID:24926997
Luft, F; Klaes, R; Nees, M; Dürst, M; Heilmann, V; Melsheimer, P; von Knebel Doeberitz, M
2001-04-01
Human papillomavirus (HPV) genomes usually persist as episomal molecules in HPV associated preneoplastic lesions whereas they are frequently integrated into the host cell genome in HPV-related cancers cells. This suggests that malignant conversion of HPV-infected epithelia is linked to recombination of cellular and viral sequences. Due to technical limitations, precise sequence information on viral-cellular junctions were obtained only for few cell lines and primary lesions. In order to facilitate the molecular analysis of genomic HPV integration, we established a ligation-mediated PCR assay for the detection of integrated papillomavirus sequences (DIPS-PCR). DIPS-PCR was initially used to amplify genomic viral-cellular junctions from HPV-associated cervical cancer cell lines (C4-I, C4-II, SW756, and HeLa) and HPV-immortalized keratinocyte lines (HPKIA, HPKII). In addition to junctions already reported in public data bases, various new fusion fragments were identified. Subsequently, 22 different viral-cellular junctions were amplified from 17 cervical carcinomas and 1 vulval intraepithelial neoplasia (VIN III). Sequence analysis of each junction revealed that the viral E1 open reading frame (ORF) was fused to cellular sequences in 20 of 22 (91%) cases. Chromosomal integration loci mapped to chromosomes 1 (2n), 2 (3n), 7 (2n), 8 (3n), 10 (1n), 14 (5n), 16 (1n), 17 (2n), and mitochondrial DNA (1n), suggesting random distribution of chromosomal integration sites. Precise sequence information obtained by DIPS-PCR was further used to monitor the monoclonal origin of 4 cervical cancers, 1 case of recurrent premalignant lesions and 1 lymph node metastasis. Therefore, DIPS-PCR might allow efficient therapy control and prediction of relapse in patients with HPV-associated anogenital cancers. Copyright 2001 Wiley-Liss, Inc.
PASTA: splice junction identification from RNA-Sequencing data
2013-01-01
Background Next generation transcriptome sequencing (RNA-Seq) is emerging as a powerful experimental tool for the study of alternative splicing and its regulation, but requires ad-hoc analysis methods and tools. PASTA (Patterned Alignments for Splicing and Transcriptome Analysis) is a splice junction detection algorithm specifically designed for RNA-Seq data, relying on a highly accurate alignment strategy and on a combination of heuristic and statistical methods to identify exon-intron junctions with high accuracy. Results Comparisons against TopHat and other splice junction prediction software on real and simulated datasets show that PASTA exhibits high specificity and sensitivity, especially at lower coverage levels. Moreover, PASTA is highly configurable and flexible, and can therefore be applied in a wide range of analysis scenarios: it is able to handle both single-end and paired-end reads, it does not rely on the presence of canonical splicing signals, and it uses organism-specific regression models to accurately identify junctions. Conclusions PASTA is a highly efficient and sensitive tool to identify splicing junctions from RNA-Seq data. Compared to similar programs, it has the ability to identify a higher number of real splicing junctions, and provides highly annotated output files containing detailed information about their location and characteristics. Accurate junction data in turn facilitates the reconstruction of the splicing isoforms and the analysis of their expression levels, which will be performed by the remaining modules of the PASTA pipeline, still under development. Use of PASTA can therefore enable the large-scale investigation of transcription and alternative splicing. PMID:23557086
Willett-Brozick, J E; Savul, S A; Richey, L E; Baysal, B E
2001-08-01
Constitutional chromosomal translocations are relatively common causes of human morbidity, yet the DNA double-strand break (DSB) repair mechanisms that generate them are incompletely understood. We cloned, sequenced and analyzed the breakpoint junctions of a familial constitutional reciprocal translocation t(9;11)(p24;q23). Within the 10-kb region flanking the breakpoints, chromosome 11 had 25% repeat elements, whereas chromosome 9 had 98% repeats, 95% of which were L1-type LINE elements. The breakpoints occurred within an L1-type repeat element at 9p24 and at the 3'-end of an Alu sequence at 11q23. At the breakpoint junction of derivative chromosome 9, we discovered an unusually large 41-bp insertion, which showed 100% identity to 12S mitochondrial DNA (mtDNA) between nucleotides 896 and 936 of the mtDNA sequence. Analysis of the human genome failed to show the preexistence of the inserted sequence at normal chromosomes 9 and 11 breakpoint junctions or elsewhere in the genome, strongly suggesting that the insertion was derived from human mtDNA and captured into the junction during the DSB repair process. To our knowledge, these findings represent the first observation of spontaneous germ line insertion of modern human mtDNA sequences and suggest that DSB repair may play a role in inter-organellar gene transfer in vivo. Our findings also provide evidence for a previously unrecognized insertional mechanism in human, by which non-mobile extra-chromosomal fragments can be inserted into the genome at DSB repair junctions.
Cornforth, Michael N; Anur, Pavana; Wang, Nicholas; Robinson, Erin; Ray, F Andrew; Bedford, Joel S; Loucas, Bradford D; Williams, Eli S; Peto, Myron; Spellman, Paul; Kollipara, Rahul; Kittler, Ralf; Gray, Joe W; Bailey, Susan M
2018-05-11
Chromosome rearrangements are large-scale structural variants that are recognized drivers of oncogenic events in cancers of all types. Cytogenetics allows for their rapid, genome-wide detection, but does not provide gene-level resolution. Massively parallel sequencing (MPS) promises DNA sequence-level characterization of the specific breakpoints involved, but is strongly influenced by bioinformatics filters that affect detection efficiency. We sought to characterize the breakpoint junctions of chromosomal translocations and inversions in the clonal derivatives of human cells exposed to ionizing radiation. Here, we describe the first successful use of DNA paired-end analysis to locate and sequence across the breakpoint junctions of a radiation-induced reciprocal translocation. The analyses employed, with varying degrees of success, several well-known bioinformatics algorithms, a task made difficult by the involvement of repetitive DNA sequences. As for underlying mechanisms, the results of Sanger sequencing suggested that the translocation in question was likely formed via microhomology-mediated non-homologous end joining (mmNHEJ). To our knowledge, this represents the first use of MPS to characterize the breakpoint junctions of a radiation-induced chromosomal translocation in human cells. Curiously, these same approaches were unsuccessful when applied to the analysis of inversions previously identified by directional genomic hybridization (dGH). We conclude that molecular cytogenetics continues to provide critical guidance for structural variant discovery, validation and in "tuning" analysis filters to enable robust breakpoint identification at the base pair level.
Resolution of model Holliday junctions by yeast endonuclease: effect of DNA structure and sequence.
Parsons, C A; Murchie, A I; Lilley, D M; West, S C
1989-01-01
The resolution of Holliday junctions in DNA involves specific cleavage at or close to the site of the junction. A nuclease from Saccharomyces cerevisiae cleaves model Holliday junctions in vitro by the introduction of nicks in regions of duplex DNA adjacent to the crossover point. In previous studies [Parsons and West (1988) Cell, 52, 621-629] it was shown that cleavage occurred within homologous arm sequences with precise symmetry across the junction. In contrast, junctions with heterologous arm sequences were cleaved asymmetrically. In this work, we have studied the effect of sequence changes and base modification upon the site of cleavage. It is shown that the specificity of cleavage is unchanged providing that perfect homology is maintained between opposing arm sequences. However, in the absence of homology, cleavage depends upon sequence context and is affected by minor changes such as base modification. These data support the proposed mechanism for cleavage of a Holliday junction, which requires homologous alignment of arm sequences in an enzyme--DNA complex as a prerequisite for symmetrical cleavage by the yeast endonuclease. Images PMID:2653810
An optimized protocol for generation and analysis of Ion Proton sequencing reads for RNA-Seq.
Yuan, Yongxian; Xu, Huaiqian; Leung, Ross Ka-Kit
2016-05-26
Previous studies compared running cost, time and other performance measures of popular sequencing platforms. However, comprehensive assessment of library construction and analysis protocols for Proton sequencing platform remains unexplored. Unlike Illumina sequencing platforms, Proton reads are heterogeneous in length and quality. When sequencing data from different platforms are combined, this can result in reads with various read length. Whether the performance of the commonly used software for handling such kind of data is satisfactory is unknown. By using universal human reference RNA as the initial material, RNaseIII and chemical fragmentation methods in library construction showed similar result in gene and junction discovery number and expression level estimated accuracy. In contrast, sequencing quality, read length and the choice of software affected mapping rate to a much larger extent. Unspliced aligner TMAP attained the highest mapping rate (97.27 % to genome, 86.46 % to transcriptome), though 47.83 % of mapped reads were clipped. Long reads could paradoxically reduce mapping in junctions. With reference annotation guide, the mapping rate of TopHat2 significantly increased from 75.79 to 92.09 %, especially for long (>150 bp) reads. Sailfish, a k-mer based gene expression quantifier attained highly consistent results with that of TaqMan array and highest sensitivity. We provided for the first time, the reference statistics of library preparation methods, gene detection and quantification and junction discovery for RNA-Seq by the Ion Proton platform. Chemical fragmentation performed equally well with the enzyme-based one. The optimal Ion Proton sequencing options and analysis software have been evaluated.
Amicarelli, Giulia; Adlerstein, Daniel; Shehi, Erlet; Wang, Fengfei; Makrigiorgos, G Mike
2006-10-01
Genotyping methods that reveal single-nucleotide differences are useful for a wide range of applications. We used digestion of 3-way DNA junctions in a novel technology, OneCutEventAmplificatioN (OCEAN) that allows sequence-specific signal generation and amplification. We combined OCEAN with peptide-nucleic-acid (PNA)-based variant enrichment to detect and simultaneously genotype v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) codon 12 sequence variants in human tissue specimens. We analyzed KRAS codon 12 sequence variants in 106 lung cancer surgical specimens. We conducted a PNA-PCR reaction that suppresses wild-type KRAS amplification and genotyped the product with a set of OCEAN reactions carried out in fluorescence microplate format. The isothermal OCEAN assay enabled a 3-way DNA junction to form between the specific target nucleic acid, a fluorescently labeled "amplifier", and an "anchor". The amplifier-anchor contact contains the recognition site for a restriction enzyme. Digestion produces a cleaved amplifier and generation of a fluorescent signal. The cleaved amplifier dissociates from the 3-way DNA junction, allowing a new amplifier to bind and propagate the reaction. The system detected and genotyped KRAS sequence variants down to approximately 0.3% variant-to-wild-type alleles. PNA-PCR/OCEAN had a concordance rate with PNA-PCR/sequencing of 93% to 98%, depending on the exact implementation. Concordance rate with restriction endonuclease-mediated selective-PCR/sequencing was 89%. OCEAN is a practical and low-cost novel technology for sequence-specific signal generation. Reliable analysis of KRAS sequence alterations in human specimens circumvents the requirement for sequencing. Application is expected in genotyping KRAS codon 12 sequence variants in surgical specimens or in bodily fluids, as well as single-base variations and sequence alterations in other genes.
Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L
1986-01-01
Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221
Kouprina, Natalay; Noskov, Vladimir N.; Waterfall, Joshua J.; Walker, Robert L.; Meltzer, Paul S.; Topol, Eric J.; Larionov, Vladimir
2018-01-01
Tandem segmental duplications (SDs) greater than 10 kb are widespread in complex genomes. They provide material for gene divergence and evolutionary adaptation, while formation of specific de novo SDs is a hallmark of cancer and some human diseases. Most SDs map to distinct genomic regions termed ‘duplication blocks’. SDs organization within these blocks is often poorly characterized as they are mosaics of ancestral duplicons juxtaposed with younger duplicons arising from more recent duplication events. Structural and functional analysis of SDs is further hampered as long repetitive DNA structures are underrepresented in existing BAC and YAC libraries. We applied Transformation-Associated Recombination (TAR) cloning, a versatile technique for large DNA manipulation, to selectively isolate the coronary artery disease (CAD) interval sequence within the 9p21.3 chromosome locus from a patient with coronary artery disease and normal individuals. Four tandem head-to-tail duplicons, each ∼50 kb long, were recovered in the patient but not in normal individuals. Sequence analysis revealed that the repeats varied by 10-15 SNPs between each other and by 82 SNPs between the human genome sequence (version hg19). SNPs polymorphism within the junctions between repeats allowed two junction types to be distinguished, Type 1 and Type 2, which were found at a 2:1 ratio. The junction sequences contained an Alu element, a sequence previously shown to play a role in duplication. Knowledge of structural variation in the CAD interval from more patients could help link this locus to cardiovascular diseases susceptibility, and maybe relevant to other cases of regional amplification, including cancer. PMID:29632643
High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture.
Inagaki, Soichi; Henry, Isabelle M; Lieberman, Meric C; Comai, Luca
2015-01-01
Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA-genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.
Hu, Jiazhi; Meyers, Robin M; Dong, Junchao; Panchakshari, Rohit A; Alt, Frederick W; Frock, Richard L
2016-05-01
Unbiased, high-throughput assays for detecting and quantifying DNA double-stranded breaks (DSBs) across the genome in mammalian cells will facilitate basic studies of the mechanisms that generate and repair endogenous DSBs. They will also enable more applied studies, such as those to evaluate the on- and off-target activities of engineered nucleases. Here we describe a linear amplification-mediated high-throughput genome-wide sequencing (LAM-HTGTS) method for the detection of genome-wide 'prey' DSBs via their translocation in cultured mammalian cells to a fixed 'bait' DSB. Bait-prey junctions are cloned directly from isolated genomic DNA using LAM-PCR and unidirectionally ligated to bridge adapters; subsequent PCR steps amplify the single-stranded DNA junction library in preparation for Illumina Miseq paired-end sequencing. A custom bioinformatics pipeline identifies prey sequences that contribute to junctions and maps them across the genome. LAM-HTGTS differs from related approaches because it detects a wide range of broken end structures with nucleotide-level resolution. Familiarity with nucleic acid methods and next-generation sequencing analysis is necessary for library generation and data interpretation. LAM-HTGTS assays are sensitive, reproducible, relatively inexpensive, scalable and straightforward to implement with a turnaround time of <1 week.
High-throughput analysis of T-DNA location and structure using sequence capture
DOE Office of Scientific and Technical Information (OSTI.GOV)
Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.
Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less
High-throughput analysis of T-DNA location and structure using sequence capture
Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.; ...
2015-10-07
Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less
Biswas, Sovan; Sen, Suman; Im, JongOne; Biswas, Sudipta; Krstic, Predrag; Ashcroft, Brian; Borges, Chad; Zhao, Yanan; Lindsay, Stuart; Zhang, Peiming
2016-12-27
A reader molecule, which recognizes all the naturally occurring nucleobases in an electron tunnel junction, is required for sequencing DNA by a recognition tunneling (RT) technique, referred to as a universal reader. In the present study, we have designed a series of heterocyclic carboxamides based on hydrogen bonding and a large-sized pyrene ring based on a π-π stacking interaction as universal reader candidates. Each of these compounds was synthesized to bear a thiolated linker for attachment to metal electrodes and examined for their interactions with naturally occurring DNA nucleosides and nucleotides by 1 H NMR, ESI-MS, computational calculations, and surface plasmon resonance. RT measurements were carried out in a scanning tunnel microscope. All of these molecules generated electrical signals with DNA nucleotides in tunneling junctions under physiological conditions (phosphate buffered aqueous solution, pH 7.4). Using a support vector machine as a tool for data analysis, we found that these candidates distinguished among naturally occurring DNA nucleotides with the accuracy of pyrene (by π-π stacking interactions) > azole carboxamides (by hydrogen-bonding interactions). In addition, the pyrene reader operated efficiently in a larger tunnel junction. However, the azole carboxamide could read abasic (AP) monophosphate, a product from spontaneous base hydrolysis or an intermediate of base excision repair. Thus, we envision that sequencing DNA using both π-π stacking and hydrogen-bonding-based universal readers in parallel should generate more comprehensive genome sequences than sequencing based on either reader molecule alone.
2013-01-01
Background The production of multiple transcript isoforms from one gene is a major source of transcriptome complexity. RNA-Seq experiments, in which transcripts are converted to cDNA and sequenced, allow the resolution and quantification of alternative transcript isoforms. However, methods to analyze splicing are underdeveloped and errors resulting in incorrect splicing calls occur in every experiment. Results We used RNA-Seq data to develop sequencing and aligner error models. By applying these error models to known input from simulations, we found that errors result from false alignment to minor splice motifs and antisense stands, shifted junction positions, paralog joining, and repeat induced gaps. By using a series of quantitative and qualitative filters, we eliminated diagnosed errors in the simulation, and applied this to RNA-Seq data from Drosophila melanogaster heads. We used high-confidence junction detections to specifically interrogate local splicing differences between transcripts. This method out-performed commonly used RNA-seq methods to identify known alternative splicing events in the Drosophila sex determination pathway. We describe a flexible software package to perform these tasks called Splicing Analysis Kit (Spanki), available at http://www.cbcb.umd.edu/software/spanki. Conclusions Splice-junction centric analysis of RNA-Seq data provides advantages in specificity for detection of alternative splicing. Our software provides tools to better understand error profiles in RNA-Seq data and improve inference from this new technology. The splice-junction centric approach that this software enables will provide more accurate estimates of differentially regulated splicing than current tools. PMID:24209455
Sturgill, David; Malone, John H; Sun, Xia; Smith, Harold E; Rabinow, Leonard; Samson, Marie-Laure; Oliver, Brian
2013-11-09
The production of multiple transcript isoforms from one gene is a major source of transcriptome complexity. RNA-Seq experiments, in which transcripts are converted to cDNA and sequenced, allow the resolution and quantification of alternative transcript isoforms. However, methods to analyze splicing are underdeveloped and errors resulting in incorrect splicing calls occur in every experiment. We used RNA-Seq data to develop sequencing and aligner error models. By applying these error models to known input from simulations, we found that errors result from false alignment to minor splice motifs and antisense stands, shifted junction positions, paralog joining, and repeat induced gaps. By using a series of quantitative and qualitative filters, we eliminated diagnosed errors in the simulation, and applied this to RNA-Seq data from Drosophila melanogaster heads. We used high-confidence junction detections to specifically interrogate local splicing differences between transcripts. This method out-performed commonly used RNA-seq methods to identify known alternative splicing events in the Drosophila sex determination pathway. We describe a flexible software package to perform these tasks called Splicing Analysis Kit (Spanki), available at http://www.cbcb.umd.edu/software/spanki. Splice-junction centric analysis of RNA-Seq data provides advantages in specificity for detection of alternative splicing. Our software provides tools to better understand error profiles in RNA-Seq data and improve inference from this new technology. The splice-junction centric approach that this software enables will provide more accurate estimates of differentially regulated splicing than current tools.
Peters, R; King, C Y; Ukiyama, E; Falsafi, S; Donahoe, P K; Weiss, M A
1995-04-11
SRY, a genetic "master switch" for male development in mammals, exhibits two biochemical activities: sequence-specific recognition of duplex DNA and sequence-independent binding to the sharp angles of four-way DNA junctions. Here, we distinguish between these activities by analysis of a mutant SRY associated with human sex reversal (46, XY female with pure gonadal dysgenesis). The substitution (168T in human SRY) alters a nonpolar side chain in the minor-groove DNA recognition alpha-helix of the HMG box [Haqq, C.M., King, C.-Y., Ukiyama, E., Haqq, T.N., Falsalfi, S., Donahoe, P.K., & Weiss, M.A. (1994) Science 266, 1494-1500]. The native (but not mutant) side chain inserts between specific base pairs in duplex DNA, interrupting base stacking at a site of induced DNA bending. Isotope-aided 1H-NMR spectroscopy demonstrates that analogous side-chain insertion occurs on binding of SRY to a four-way junction, establishing a shared mechanism of sequence- and structure-specific DNA binding. Although the mutant DNA-binding domain exhibits > 50-fold reduction in sequence-specific DNA recognition, near wild-type affinity for four-way junctions is retained. Our results (i) identify a shared SRY-DNA contact at a site of either induced or intrinsic DNA bending, (ii) demonstrate that this contact is not required to bind an intrinsically bent DNA target, and (iii) rationalize patterns of sequence conservation or diversity among HMG boxes. Clinical association of the I68T mutation with human sex reversal supports the hypothesis that specific DNA recognition by SRY is required for male sex determination.
Bai, Donglin
2016-02-01
A gap junction (GJ) channel is formed by docking of two GJ hemichannels and each of these hemichannels is a hexamer of connexins. All connexin genes have been identified in human, mouse, and rat genomes and their homologous genes in many other vertebrates are available in public databases. The protein sequences of these connexins align well with high sequence identity in the same connexin across different species. Domains in closely related connexins and several residues in all known connexins are also well-conserved. These conserved residues form signatures (also known as sequence logos) in these domains and are likely to play important biological functions. In this review, the sequence logos of individual connexins, groups of connexins with common ancestors, and all connexins are analyzed to visualize natural evolutionary variations and the hot spots for human disease-linked mutations. Several gap junction domains are homologous, likely forming similar structures essential for their function. The availability of a high resolution Cx26 GJ structure and the subsequently-derived homology structure models for other connexin GJ channels elevated our understanding of sequence logos at the three-dimensional GJ structure level, thus facilitating the understanding of how disease-linked connexin mutants might impair GJ structure and function. This knowledge will enable the design of complementary variants to rescue disease-linked mutants. Copyright © 2015 Elsevier Ltd. All rights reserved.
A palindrome-mediated mechanism distinguishes translocations involving LCR-B of chromosome 22q11.2.
Gotter, Anthony L; Shaikh, Tamim H; Budarf, Marcia L; Rhodes, C Harker; Emanuel, Beverly S
2004-01-01
Two known recurrent constitutional translocations, t(11;22) and t(17;22), as well as a non-recurrent t(4;22), display derivative chromosomes that have joined to a common site within the low copy repeat B (LCR-B) region of 22q11.2. This breakpoint is located between two AT-rich inverted repeats that form a nearly perfect palindrome. Breakpoints within the 11q23, 17q11 and 4q35 partner chromosomes also fall near the center of palindromic sequences. In the present work the breakpoints of a fourth translocation involving LCR-B, a balanced ependymoma-associated t(1;22), were characterized not only to localize this junction relative to known genes, but also to further understand the mechanism underlying these rearrangements. FISH mapping was used to localize the 22q11.2 breakpoint to LCR-B and the 1p21 breakpoint to single BAC clones. STS mapping narrowed the 1p21.2 breakpoint to a 1990 bp AT-rich region, and junction fragments were amplified by nested PCR. Junction fragment-derived sequence indicates that the 1p21.2 breakpoint splits a 278 nt palindrome capable of forming stem-loop secondary structure. In contrast, the 1p21.2 reference genomic sequence from clones in the database does not exhibit this configuration, suggesting a predisposition for regional genomic instability perhaps etiologic for this rearrangement. Given its similarity to known chromosomal fragile site (FRA) sequences, this polymorphic 1p21.2 sequence may represent one of the FRA1 loci. Comparative analysis of the secondary structure of sequences surrounding translocation breakpoints that involve LCR-B with those not involving this region indicate a unique ability of the former to form stem-loop structures. The relative likelihood of forming these configurations appears to be related to the rate of translocation occurrence. Further analysis suggests that constitutional translocations in general occur between sequences of similar melting temperature and propensity for secondary structure.
A palindrome-mediated mechanism distinguishes translocations involving LCR-B of chromosome 22q11.2
Gotter, Anthony L.; Shaikh, Tamim H.; Budarf, Marcia L.; Rhodes, C. Harker; Emanuel, Beverly S.
2010-01-01
Two known recurrent constitutional translocations, t(11;22) and t(17;22), as well as a non-recurrent t(4;22), display derivative chromosomes that have joined to a common site within the low copy repeat B (LCR-B) region of 22q11.2. This breakpoint is located between two AT-rich inverted repeats that form a nearly perfect palindrome. Breakpoints within the 11q23, 17q11 and 4q35 partner chromosomes also fall near the center of palindromic sequences. In the present work the breakpoints of a fourth translocation involving LCR-B, a balanced ependymoma-associated t(1;22), were characterized not only to localize this junction relative to known genes, but also to further understand the mechanism underlying these rearrangements. FISH mapping was used to localize the 22q11.2 breakpoint to LCR-B and the 1p21 breakpoint to single BAC clones. STS mapping narrowed the 1p21.2 breakpoint to a 1990 bp AT-rich region, and junction fragments were amplified by nested PCR. Junction fragment-derived sequence indicates that the 1p21.2 breakpoint splits a 278 nt palindrome capable of forming stem–loop secondary structure. In contrast, the 1p21.2 reference genomic sequence from clones in the database does not exhibit this configuration, suggesting a predisposition for regional genomic instability perhaps etiologic for this rearrangement. Given its similarity to known chromosomal fragile site (FRA) sequences, this polymorphic 1p21.2 sequence may represent one of the FRA1 loci. Comparative analysis of the secondary structure of sequences surrounding translocation breakpoints that involve LCR-B with those not involving this region indicate a unique ability of the former to form stem–loop structures. The relative likelihood of forming these configurations appears to be related to the rate of translocation occurrence. Further analysis suggests that constitutional translocations in general occur between sequences of similar melting temperature and propensity for secondary structure. PMID:14613967
Schwer, Bjoern; Wei, Pei-Chi; Chang, Amelia N; Kao, Jennifer; Du, Zhou; Meyers, Robin M; Alt, Frederick W
2016-02-23
High-throughput, genome-wide translocation sequencing (HTGTS) studies of activated B cells have revealed that DNA double-strand breaks (DSBs) capable of translocating to defined bait DSBs are enriched around the transcription start sites (TSSs) of active genes. We used the HTGTS approach to investigate whether a similar phenomenon occurs in primary neural stem/progenitor cells (NSPCs). We report that breakpoint junctions indeed are enriched around TSSs that were determined to be active by global run-on sequencing analyses of NSPCs. Comparative analyses of transcription profiles in NSPCs and B cells revealed that the great majority of TSS-proximal junctions occurred in genes commonly expressed in both cell types, possibly because this common set has higher transcription levels on average than genes transcribed in only one or the other cell type. In the latter context, among all actively transcribed genes containing translocation junctions in NSPCs, those with junctions located within 2 kb of the TSS show a significantly higher transcription rate on average than genes with junctions in the gene body located at distances greater than 2 kb from the TSS. Finally, analysis of repair junction signatures of TSS-associated translocations in wild-type versus classical nonhomologous end-joining (C-NHEJ)-deficient NSPCs reveals that both C-NHEJ and alternative end-joining pathways can generate translocations by joining TSS-proximal DSBs to DSBs on other chromosomes. Our studies show that the generation of transcription-associated DSBs is conserved across divergent cell types.
Kuhn, G C S; Teo, C H; Schwarzacher, T; Heslop-Harrison, J S
2009-05-01
Satellite DNA (satDNA) is a major component of genomes but relatively little is known about the fine-scale organization of unrelated satDNAs residing at the same chromosome location, and the sequence structure and dynamics of satDNA junctions. We studied the organization and sequence junctions of two nonhomologous satDNAs, pBuM and DBC-150, in three species from the neotropical Drosophila buzzatii cluster (repleta group). In situ hybridization to microchromosomes, interphase nuclei and extended DNA fibers showed frequent interspersion of the two satellites in D. gouveai, D. antonietae and, to a lesser extent, D. seriema. We isolated by PCR six pBuM x DBC-150 junctions: four are exclusive to D. gouveai and two are exclusive to D. antonietae. The six junction breakpoints occur at different positions within monomers, suggesting independent origin. Four junctions showed abrupt transitions between the two satellites, whereas two junctions showed a distinct 10 bp tandem duplication before the junction. Unlike pBuM, DBC-150 junction repeats are more variable than randomly cloned monomers and showed diagnostic features in common to a 3-monomer higher-order repeat seen in the sister species D. serido. The high levels of interspersion between pBuM and DBC-150 repeats suggest extensive rearrangements between the two satellites, maybe favored by specific features of the microchromosomes. Our interpretation is that the junctions evolved by multiples events of illegitimate recombination between nonhomologous satDNA repeats, with subsequent rounds of unequal crossing-over expanding the copy number of some of the junctions.
Rogan, P K; Schneider, T D
1995-01-01
Predicting the effects of nucleotide substitutions in human splice sites has been based on analysis of consensus sequences. We used a graphic representation of sequence conservation and base frequency, the sequence logo, to demonstrate that a change in a splice acceptor of hMSH2 (a gene associated with familial nonpolyposis colon cancer) probably does not reduce splicing efficiency. This confirms a population genetic study that suggested that this substitution is a genetic polymorphism. The information theory-based sequence logo is quantitative and more sensitive than the corresponding splice acceptor consensus sequence for detection of true mutations. Information analysis may potentially be used to distinguish polymorphisms from mutations in other types of transcriptional, translational, or protein-coding motifs.
Morzunov , Sergey P.; Winton, James R.; Nichol, Stuart T.
1995-01-01
Infectious hematopoietic necrosis virus (IHNV), a member of the family Rhabdoviridae, causes a severe disease with high mortality in salmonid fish. The nucleotide sequence (11, 131 bases) of the entire genome was determined for the pathogenic WRAC strain of IHNV from southern Idaho. This allowed detailed analysis of all 6 genes, the deduced amino acid sequences of their encoded proteins, and important control motifs including leader, trailer and gene junction regions. Sequence analysis revealed that the 6 virus genes are located along the genome in the 3′ to 5′ order: nucleocapsid (N), polymerase-associated phosphoprotein (P or M1), matrix protein (M or M2), surface glycoprotein (G), a unique non-virion protein (NV) and virus polymerase (L). The IHNV genome RNA was found to have highly complementary termini (15 of 16 nucleotides). The gene junction regions display the highly conserved sequence UCURUC(U)7RCCGUG(N)4CACR (in the vRNA sense), which includes the typical rhabdovirus transcription termination/polyadenylation signal and a novel putative transcription initiation signal. Phylogenetic analysis of M, G and L protein sequences allowed insights into the evolutionary and taxonomic relationship of rhabdoviruses of fish relative to those of insects or mammals, and a broader sense of the relationship of non-segmented negative-strand RNA viruses. Based on these data, a new genus, piscivirus, is proposed which will initially contain IHNV, viral hemorrhagic septicemia virus and Hirame rhabdovirus.
Ludowise, Michael J.
1986-01-01
A photovoltaic solar cell is formed in a monolithic semiconductor. The cell contains three junctions. In sequence from the light-entering face, the junctions have a high, a medium, and a low energy gap. The lower junctions are connected in series by one or more metallic members connecting the top of the lower junction through apertures to the bottom of the middle junction. The upper junction is connected in voltage opposition to the lower and middle junctions by second metallic electrodes deposited in holes 60 through the upper junction. The second electrodes are connected to an external terminal.
Non-exomic and synonymous variants in ABCA4 are an important cause of Stargardt disease
Braun, Terry A.; Mullins, Robert F.; Wagner, Alex H.; Andorf, Jeaneen L.; Johnston, Rebecca M.; Bakall, Benjamin B.; Deluca, Adam P.; Fishman, Gerald A.; Lam, Byron L.; Weleber, Richard G.; Cideciyan, Artur V.; Jacobson, Samuel G.; Sheffield, Val C.; Tucker, Budd A.; Stone, Edwin M.
2013-01-01
Mutations in ABCA4 cause Stargardt disease and other blinding autosomal recessive retinal disorders. However, sequencing of the complete coding sequence in patients with clinical features of Stargardt disease sometimes fails to detect one or both mutations. For example, among 208 individuals with clear clinical evidence of ABCA4 disease ascertained at a single institution, 28 had only one disease-causing allele identified in the exons and splice junctions of the primary retinal transcript of the gene. Haplotype analysis of these 28 probands revealed 3 haplotypes shared among ten families, suggesting that 18 of the 28 missing alleles were rare enough to be present only once in the cohort. We hypothesized that mutations near rare alternate splice junctions in ABCA4 might cause disease by increasing the probability of mis-splicing at these sites. Next-generation sequencing of RNA extracted from human donor eyes revealed more than a dozen alternate exons that are occasionally incorporated into the ABCA4 transcript in normal human retina. We sequenced the genomic DNA containing 15 of these minor exons in the 28 one-allele subjects and observed five instances of two different variations in the splice signals of exon 36.1 that were not present in normal individuals (P < 10−6). Analysis of RNA obtained from the keratinocytes of patients with these mutations revealed the predicted alternate transcript. This study illustrates the utility of RNA sequence analysis of human donor tissue and patient-derived cell lines to identify mutations that would be undetectable by exome sequencing. PMID:23918662
Bozdoğan, Sevcan Tuğ; Kuran, Gökhan; Yüregir, Özge Özalp; Aslan, Hüseyin; Haytoğlu, Süheyl; Ayaz, Akif; Arıkan, Osman Kürşat
2015-08-01
To date, studies in all populations showed that mutations in the gene of Gap junction protein beta 2 (GJB2) play an important role in non-syndromic autosomal recessive congenital hearing loss. The aim of this study was to evaluate GJB2 gene of patients with hearing loss in our region using deoxyribonucleic acid (DNA) sequencing method and to demonstrate region-specific mutation and polymorphism distribution. Patients who had bilateral severe sensorineural non-syndromic hearing loss identified by audiologic evaluation were included. Peripheral blood samples were collected and the GJB2 gene exon1 and exon 2 regions were amplified by polymerase chain reaction (PCR). Obtained PCR products were sequenced by the DNA sequence analysis method (SeqFinder Sequencing System; ABI 3130; Foster City, CA, USA) and analyzed using the SeqScape software. Of the 77 patients, 16 had homozygous or heterozygous mutation. The mutation of 35delG, which is known as the most frequent mutation of GJB2 gene, was also the most frequently seen mutation at a ratio of 5.5% in patients with hearing loss in our region; this was followed by the V27I mutation. As this is the first study conducted by sequence analysis in our region, it was worth to be presented in terms of showing the distribution of mutation.
Saveliev, S V; Cox, M M
1994-01-01
Thousands of DNA deletion events occur during macronuclear development in the ciliate Tetrahymena thermophila. In two deleted genomic regions, designated M and R, the eliminated sequences form circles that can be detected by PCR. However, the circles are not normal products of the reaction pathway. The circular forms occur at very low levels in conjugating cells, but are stable. Sequencing analysis showed that many of the circles (as many as 50% of those examined) reflected a precise deletion in the M and R regions. The remaining circles were either smaller or larger and contained varying lengths of sequences derived from the chromosomal DNA surrounding the eliminated region. The chromosomal junctions left behind after deletion were more precise, although deletions in either the M or R regions can generate any of several alternative junctions (1). Some new chromosomal junctions were detected in the present study. The results suggest that the deleted segment is released as a linear DNA species that is degraded rapidly. The species is only rarely converted to the stable circles we detect. The deletion mechanism is different from those proposed for deletion events in hypotrichous ciliates (2-4), and does not reflect a conservative site-specific recombination process such as that promoted by the bacteriophage lambda integrase (5). Images PMID:7838724
Unexpected substrate specificity of T4 DNA ligase revealed by in vitro selection
NASA Technical Reports Server (NTRS)
Harada, Kazuo; Orgel, Leslie E.
1993-01-01
We have used in vitro selection techniques to characterize DNA sequences that are ligated efficiently by T4 DNA ligase. We find that the ensemble of selected sequences ligates about 50 times as efficiently as the random mixture of sequences used as the input for selection. Surprisingly many of the selected sequences failed to produce a match at or close to the ligation junction. None of the 20 selected oligomers that we sequenced produced a match two bases upstream from the ligation junction.
Fushiki, Daisuke; Hamada, Yasuo; Yoshimura, Ryoichi; Endo, Yasuhisa
2010-04-01
All multi-cellular animals, including hydra, insects and vertebrates, develop gap junctions, which communicate directly with neighboring cells. Gap junctions consist of protein families called connexins in vertebrates and innexins in invertebrates. Connexins and innexins have no homology in their amino acid sequence, but both are thought to have some similar characteristics, such as a tetra-membrane-spanning structure, formation of a channel by hexamer, and transmission of small molecules (e.g. ions) to neighboring cells. Pannexins were recently identified as a homolog of innexins in vertebrate genomes. Although pannexins are thought to share the function of intercellular communication with connexins and innexins, there is little information about the relationship among these three protein families of gap junctions. We phylgenetically and bioinformatically examined these protein families and other tetra-membrane-spanning proteins using a database and three analytical softwares. The clades formed by pannexin families do not belong to the species classification but do to paralogs of each member of pannexins. Amino acid sequences of pannexins are closely related to those of innexins but less to those of connexins. These data suggest that innexins and pannexins have a common origin, but the relationship between innexins/pannexins and connexins is as slight as that of other tetra-membrane-spanning members.
Bjorklund, H.V.; Higman, K.H.; Kurath, G.
1996-01-01
The nucleotide sequences of the glycoprotein genes and all of the internal gene junctions of the fish pathogenic rhabdoviruses spring viremia of carp virus (SVCV) and hirame rhabdovirus (HIRRV) have been determined from cDNA clones generated from viral genomic RNA. The SVCV glycoprotein gene sequence is 1588 nucleotides (nt) long and encodes a 509 amino acid (aa) protein. The HIRRV glycoprotein gene sequence comprises 1612 nt, coding for a 508 aa protein. In sequence comparisons of 15 rhabdovirus glycoproteins, the SVCV glycoprotein gene showed the highest amino acid sequence identity (31.2–33.2%) with vesicular stomatitis New Jersey virus (VSNJV), Chandipura virus (CHPV) and vesicular stomatitis Indiana virus (VSIV). The HIRRV glycoprotein gene showed a very high amino acid sequence identity (74.3%) with the glycoprotein gene of another fish pathogenic rhabdovirus, infectious hematopoietic necrosis virus (IHNV), but no significant similarity with glycoproteins of VSIV or rabies virus (RABV). In phylogenetic analyses SVCV was grouped consistently with VSIV, VSNJV and CHPV in the Vesiculovirus genus of Rhabdoviridae. The fish rhabdoviruses HIRRV, IHNV and viral hemorrhagic septicemia virus (VHSV) showed close relationships with each other, but only very distant relationships with mammalian rhabdoviruses. The gene junctions are highly conserved between SVCV and VSIV, well conserved between IHNV and HIRRV, but not conserved between HIRRV/IHNV and RABV. Based on the combined results we suggest that the fish lyssa-type rhabdoviruses HIRRV, IHNV and VHSV may be grouped in their own genus within the family Rhabdoviridae. Aquarhabdovirus has been proposed for the name of this new genus.
Bjorklund, H.V.; Higman, K.H.; Kurath, G.
1996-01-01
The nucleotide sequences of the glycoprotein genes and all of the internal gene junctions of the fish pathogenic rhabdoviruses spring viremia of carp virus (SVCV) and hirame rhabdovirus (HIRRV) have been determined from cDNA clones generated from viral genomic RNA. The SVCV glycoprotein gene sequence is 1588 nucleotides (nt) long and encodes a 509 amino acid (aa) protein. The HIRRV glycoprotein gene sequence comprises 1612 nt, coding for a 508 aa protein. In sequence comparisons of 15 rhabdovirus glycoproteins, the SVCV glycoprotein gene showed the highest amino acid sequence identity (31.2-33.2%) with vesicular stomatitis New Jersey virus (VSNJV), Chandipura virus (CHPV) and vesicular stomatitis Indiana virus (VSIV). The HIRRV glycoprotein gene showed a very high amino acid sequence identity (74.3%) with the glycoprotein gene of another fish pathogenic rhabdovirus, infectious hematopoietic necrosis virus (IHNV), but no significant similarity with glycoproteins of VSIV or rabies virus (RABV). In phylogenetic analyses SVCV was grouped consistently with VSIV, VSNJV and CHPV in the Vesiculovirus genus of Rhabdoviridae. The fish rhabdoviruses HIRRV, IHNV and viral hemorrhagic septicemia virus (VHSV) showed close relationships with each other, but only very distant relationships with mammalian rhabdoviruses. The gene junctions are highly conserved between SVCV and VSIV, well conserved between IHNV and HIRRV, but not conserved between HIRRV/IHNV and RABV. Based on the combined results we suggest that the fish lyssa-type rhabdoviruses HIRRV, IHNV and VHSV may be grouped in their own genus within the family Rhabdoviridae. Aquarhabdovirus has been proposed for the name of this new genus.
2014-01-01
We present primary results from the Sequencing Quality Control (SEQC) project, coordinated by the United States Food and Drug Administration. Examining Illumina HiSeq, Life Technologies SOLiD and Roche 454 platforms at multiple laboratory sites using reference RNA samples with built-in controls, we assess RNA sequencing (RNA-seq) performance for junction discovery and differential expression profiling and compare it to microarray and quantitative PCR (qPCR) data using complementary metrics. At all sequencing depths, we discover unannotated exon-exon junctions, with >80% validated by qPCR. We find that measurements of relative expression are accurate and reproducible across sites and platforms if specific filters are used. In contrast, RNA-seq and microarrays do not provide accurate absolute measurements, and gene-specific biases are observed, for these and qPCR. Measurement performance depends on the platform and data analysis pipeline, and variation is large for transcript-level profiling. The complete SEQC data sets, comprising >100 billion reads (10Tb), provide unique resources for evaluating RNA-seq analyses for clinical and regulatory settings. PMID:25150838
Ascarrunz, F G; Kisley, M A; Flach, K A; Hamilton, R W; MacGregor, R J
1995-07-01
This paper applies a general mathematical system for characterizing and scaling functional connectivity and information flow across the diffuse (EC) and discrete (DG) input junctions to the CA3 hippocampus. Both gross connectivity and coordinated multiunit informational firing patterns are quantitatively characterized in terms of 32 defining parameters interrelated by 17 equations, and then scaled down according to rules for uniformly proportional scaling and for partial representation. The diffuse EC-CA3 junction is shown to be uniformly scalable with realistic representation of both essential spatiotemporal cooperativity and coordinated firing patterns down to populations of a few hundred neurons. Scaling of the discrete DG-CA3 junction can be effected with a two-step process, which necessarily deviates from uniform proportionality but nonetheless produces a valuable and readily interpretable reduced model, also utilizing a few hundred neurons in the receiving population. Partial representation produces a reduced model of only a portion of the full network where each model neuron corresponds directly to a biological neuron. The mathematical analysis illustrated here shows that although omissions and distortions are inescapable in such an application, satisfactorily complete and accurate models the size of pattern modules are possible. Finally, the mathematical characterization of these junctions generates a theory which sees the DG as a definer of the fine structure of embedded traces in the hippocampus and entire coordinated patterns of sequences of 14-cell links in CA3 as triggered by the firing of sequences of individual neurons in DG.
Molecular characterization of a wild poliovirus type 3 epidemic in The Netherlands (1992 and 1993).
Mulders, M N; van Loon, A M; van der Avoort, H G; Reimerink, J H; Ras, A; Bestebroer, T M; Drebot, M A; Kew, O M; Koopmans, M P
1995-01-01
An outbreak of poliomyelitis due to wild poliovirus type 3 (PV3) occurred in an unvaccinated community in The Netherlands between September 1992 and February 1993. The outbreak involved 71 patients. The aim of this study was to characterize the virus at the molecular level and to analyze the molecular evolution of the epidemic virus. Molecular analysis was carried out by sequencing the VP1/2A junction region (150 nucleotides) of 50 PV3 strains isolated in association with this outbreak and the entire VP1 gene of 14 strains. In addition, the sequence of the VP1/2A junction region of strains from geographical regions endemic for PV3 (Egypt, India, and Central Asia) was analyzed and compared with the nucleotide sequence of the epidemic strain from The Netherlands. The earliest isolate was obtained from river water sampled 3 weeks before diagnosis of the first poliomyelitis patient and was found by VP1/2A sequence analysis to be genetically identical to the strain isolated from the first patient. Sequence divergence among the strains from the epidemic in The Netherlands was less than 2%. The closest genetic similarity (97.3%) was found with an Indian isolate (New Delhi, December 1991), indicating the likely source of the virus. A more than 99% sequence similarity was found in the VP1/2A region. Finally, the sequence information was used to design primers for the specific and highly sensitive molecular detection of PV3 strains during the epidemic. PMID:8586711
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miller, S.I.; Wirth, D.F.
1988-06-01
The 5' ends of Leishmania mRNAs contain an identical 35-nucleotide sequence termed the spliced leader (SL) or 5' mini-exon. The SL sequence is at the 5' end of an 85-nucleotide primary transcript that contains a consensus eucaryotic 5' intron-exon splice junction immediately 3' to the SL. The SL is added to protein-coding genes immediately 3' to a consensus eucaryotic 3' intron-exon splice junction. The authors' previous work demonstrated possible intermediates in discontinuous mRNA processing that contain the 50 nucleotides of the SL primary transcript 3' to the SL, the SL intron sequence (SLIS). These RNAs have a 5' terminus atmore » the splice junction of the SL and the SLIS. The authors examined a Leishmania nuclear extract for these RNAs in ribonucleoprotein (RNP) particles. Density centrifugation analysis showed that the SL RNA is predominately in RNP complexes at 60S, while the SLIS-containing RNAs are in complexes at 40S. They also demonstrated that the SLIS can be released from polyadenylated RNA by incubation with a HeLa cell extract containing debranching enzymatic activity. These data suggested that Leishmania enriettii mRNAs are assembled by bimolecular or trans splicing as has been recently demonstrated for Trypanosoma brucei. Furthermore, they determined the partial sequence of the Leishmania U2 equivalent RNA and demonstrated that it cosediments with the SL RNA at 60S in a nuclear extract. These RNP particles may be analogous to so-called spliceosomes that have been demonstrated in other systems.« less
Simultaneous junction formation
NASA Technical Reports Server (NTRS)
Campbell, R. B.
1984-01-01
High-risk, high-payoff improvements to a baseline process sequence of simultaneous junction formation of silicon solar cells are discussed. The feasibility of simultaneously forming front and back junctions of solar cells using liquid dopants on dendritic web silicon was studied. Simultaneous diffusion was compared to sequential diffusion. A belt furnace for the diffusion process was tested.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Park, Hugh; Todorov, Stan; Colombeau, Benjamin
2012-11-06
We report on junction advantages of cryogenic ion implantation with medium current implanters. We propose a methodical approach on maximizing cryogenic effects on junction characteristics near the amorphization threshold doses that are typically used for halo implants for sub-30 nm technologies. BF{sub 2}{sup +} implant at a dose of 8 Multiplication-Sign 10{sup 13}cm{sup -2} does not amorphize silicon at room temperature. When implanted at -100 Degree-Sign C, it forms a 30 - 35 nm thick amorphous layer. The cryogenic BF{sub 2}{sup +} implant significantly reduces the depth of the boron distribution, both as-implanted and after anneals, which improves short channelmore » rolloff characteristics. It also creates a shallower n{sup +}-p junction by steepening profiles of arsenic that is subsequently implanted in the surface region. We demonstrate effects of implant sequences, germanium preamorphization, indium and carbon co-implants for extension/halo process integration. When applied to sequences such as Ge+As+C+In+BF{sub 2}{sup +}, the cryogenic implants at -100 Degree-Sign C enable removal of Ge preamorphization, and form more active n{sup +}-p junctions and steeper B and In halo profiles than sequences at room temperature.« less
Mochida, Ganeshwaran H.; Ganesh, Vijay S.; Felie, Jillian M.; Gleason, Danielle; Hill, R. Sean; Clapham, Katie Rose; Rakiec, Daniel; Tan, Wen-Hann; Akawi, Nadia; Al-Saffar, Muna; Partlow, Jennifer N.; Tinschert, Sigrid; Barkovich, A. James; Ali, Bassam; Al-Gazali, Lihadh; Walsh, Christopher A.
2010-01-01
The tight junction, or zonula occludens, is a specialized cell-cell junction that regulates epithelial and endothelial permeability, and it is an essential component of the blood-brain barrier in the cerebrovascular endothelium. In addition to functioning as a diffusion barrier, tight junctions are also involved in signal transduction. In this study, we identified a homozygous mutation in the tight-junction protein gene JAM3 in a large consanguineous family from the United Arab Emirates. Some members of this family had a rare autosomal-recessive syndrome characterized by severe hemorrhagic destruction of the brain, subependymal calcification, and congenital cataracts. Their clinical presentation overlaps with some reported cases of pseudo-TORCH syndrome as well as with cases involving mutations in occludin, another component of the tight-junction complex. However, massive intracranial hemorrhage distinguishes these patients from others. Homozygosity mapping identified the disease locus in this family on chromosome 11q25 with a maximum multipoint LOD score of 6.15. Sequence analysis of genes in the candidate interval uncovered a mutation in the canonical splice-donor site of intron 5 of JAM3. RT-PCR analysis of a patient lymphoblast cell line confirmed abnormal splicing, leading to a frameshift mutation with early termination. JAM3 is known to be present in vascular endothelium, although its roles in cerebral vasculature have not been implicated. Our results suggest that JAM3 is essential for maintaining the integrity of the cerebrovascular endothelium as well as for normal lens development in humans. PMID:21109224
D'Angelo, Carla S; Gajecka, Marzena; Kim, Chong A; Gentles, Andrew J; Glotzbach, Caron D; Shaffer, Lisa G; Koiffmann, Célia P
2009-06-01
The mechanisms involved in the formation of subtelomeric rearrangements are now beginning to be elucidated. Breakpoint sequencing analysis of 1p36 rearrangements has made important contributions to this line of inquiry. Despite the unique architecture of segmental duplications inherent to human subtelomeres, no common mechanism has been identified thus far and different nonexclusive recombination-repair mechanisms seem to predominate. In order to gain further insights into the mechanisms of chromosome breakage, repair, and stabilization mediating subtelomeric rearrangements in humans, we investigated the constitutional rearrangements of 1p36. Cloning of the breakpoint junctions in a complex rearrangement and three non-reciprocal translocations revealed similarities at the junctions, such as microhomology of up to three nucleotides, along with no significant sequence identity in close proximity to the breakpoint regions. All the breakpoints appeared to be unique and their occurrence was limited to non-repetitive, unique DNA sequences. Several recombination- or cleavage-associated motifs that may promote non-homologous recombination were observed in close proximity to the junctions. We conclude that NHEJ is likely the mechanism of DNA repair that generates these rearrangements. Additionally, two apparently pure terminal deletions were also investigated, and the refinement of the breakpoint regions identified two distinct genomic intervals ~25-kb apart, each containing a series of 1p36 specific segmental duplications with 90-98% identity. Segmental duplications can serve as substrates for ectopic homologous recombination or stimulate genomic rearrangements.
Korshoj, Lee E; Afsari, Sepideh; Chatterjee, Anushree; Nagpal, Prashant
2017-11-01
Electronic conduction or charge transport through single molecules depends primarily on molecular structure and anchoring groups and forms the basis for a wide range of studies from molecular electronics to DNA sequencing. Several high-throughput nanoelectronic methods such as mechanical break junctions, nanopores, conductive atomic force microscopy, scanning tunneling break junctions, and static nanoscale electrodes are often used for measuring single-molecule conductance. In these measurements, "smearing" due to conformational changes and other entropic factors leads to large variances in the observed molecular conductance, especially in individual measurements. Here, we show a method for characterizing smear in single-molecule conductance measurements and demonstrate how binning measurements according to smear can significantly enhance the use of individual conductance measurements for molecular recognition. Using quantum point contact measurements on single nucleotides within DNA macromolecules, we demonstrate that the distance over which molecular junctions are maintained is a measure of smear, and the resulting variance in unbiased single measurements depends on this smear parameter. Our ability to identify individual DNA nucleotides at 20× coverage increases from 81.3% accuracy without smear analysis to 93.9% with smear characterization and binning (SCRIB). Furthermore, merely 7 conductance measurements (7× coverage) are needed to achieve 97.8% accuracy for DNA nucleotide recognition when only low molecular smear measurements are used, which represents a significant improvement over contemporary sequencing methods. These results have important implications in a broad range of molecular electronics applications from designing robust molecular switches to nanoelectronic DNA sequencing.
Zhang, Xi; Zhang, Jing; Wu, Dongzhi; Liu, Zhijing; Cai, Shuxian; Chen, Mei; Zhao, Yanping; Li, Chunyan; Yang, Huanghao; Chen, Jinghua
2014-12-07
Locked nucleic acid (LNA) is applied in toehold-mediated strand displacement reaction (TMSDR) to develop a junction-probe electrochemiluminescence (ECL) biosensor for single-nucleotide polymorphism (SNP) detection in the BRCA1 gene related to breast cancer. More than 65-fold signal difference can be observed with perfectly matched target sequence to single-base mismatched sequence under the same conditions, indicating good selectivity of the ECL biosensor.
ViennaNGS: A toolbox for building efficient next- generation sequencing analysis pipelines
Wolfinger, Michael T.; Fallmann, Jörg; Eggenhofer, Florian; Amman, Fabian
2015-01-01
Recent achievements in next-generation sequencing (NGS) technologies lead to a high demand for reuseable software components to easily compile customized analysis workflows for big genomics data. We present ViennaNGS, an integrated collection of Perl modules focused on building efficient pipelines for NGS data processing. It comes with functionality for extracting and converting features from common NGS file formats, computation and evaluation of read mapping statistics, as well as normalization of RNA abundance. Moreover, ViennaNGS provides software components for identification and characterization of splice junctions from RNA-seq data, parsing and condensing sequence motif data, automated construction of Assembly and Track Hubs for the UCSC genome browser, as well as wrapper routines for a set of commonly used NGS command line tools. PMID:26236465
Li, Zhoufang; Liu, Guangjie; Tong, Yin; Zhang, Meng; Xu, Ying; Qin, Li; Wang, Zhanhui; Chen, Xiaoping; He, Jiankui
2015-01-01
Profiling immune repertoires by high throughput sequencing enhances our understanding of immune system complexity and immune-related diseases in humans. Previously, cloning and Sanger sequencing identified limited numbers of T cell receptor (TCR) nucleotide sequences in rhesus monkeys, thus their full immune repertoire is unknown. We applied multiplex PCR and Illumina high throughput sequencing to study the TCRβ of rhesus monkeys. We identified 1.26 million TCRβ sequences corresponding to 643,570 unique TCRβ sequences and 270,557 unique complementarity-determining region 3 (CDR3) gene sequences. Precise measurements of CDR3 length distribution, CDR3 amino acid distribution, length distribution of N nucleotide of junctional region, and TCRV and TCRJ gene usage preferences were performed. A comprehensive profile of rhesus monkey immune repertoire might aid human infectious disease studies using rhesus monkeys. PMID:25961410
2012-01-01
Background Bread wheat, one of the world’s staple food crops, has the largest, highly repetitive and polyploid genome among the cereal crops. The wheat genome holds the key to crop genetic improvement against challenges such as climate change, environmental degradation, and water scarcity. To unravel the complex wheat genome, the International Wheat Genome Sequencing Consortium (IWGSC) is pursuing a chromosome- and chromosome arm-based approach to physical mapping and sequencing. Here we report on the use of a BAC library made from flow-sorted telosomic chromosome 3A short arm (t3AS) for marker development and analysis of sequence composition and comparative evolution of homoeologous genomes of hexaploid wheat. Results The end-sequencing of 9,984 random BACs from a chromosome arm 3AS-specific library (TaaCsp3AShA) generated 11,014,359 bp of high quality sequence from 17,591 BAC-ends with an average length of 626 bp. The sequence represents 3.2% of t3AS with an average DNA sequence read every 19 kb. Overall, 79% of the sequence consisted of repetitive elements, 1.38% as coding regions (estimated 2,850 genes) and another 19% of unknown origin. Comparative sequence analysis suggested that 70-77% of the genes present in both 3A and 3B were syntenic with model species. Among the transposable elements, gypsy/sabrina (12.4%) was the most abundant repeat and was significantly more frequent in 3A compared to homoeologous chromosome 3B. Twenty novel repetitive sequences were also identified using de novo repeat identification. BESs were screened to identify simple sequence repeats (SSR) and transposable element junctions. A total of 1,057 SSRs were identified with a density of one per 10.4 kb, and 7,928 junctions between transposable elements (TE) and other sequences were identified with a density of one per 1.39 kb. With the objective of enhancing the marker density of chromosome 3AS, oligonucleotide primers were successfully designed from 758 SSRs and 695 Insertion Site Based Polymorphisms (ISBPs). Of the 96 ISBP primer pairs tested, 28 (29%) were 3A-specific and compared to 17 (18%) for 96 SSRs. Conclusion This work reports on the use of wheat chromosome arm 3AS-specific BAC library for the targeted generation of sequence data from a particular region of the huge genome of wheat. A large quantity of sequences were generated from the A genome of hexaploid wheat for comparative genome analysis with homoeologous B and D genomes and other model grass genomes. Hundreds of molecular markers were developed from the 3AS arm-specific sequences; these and other sequences will be useful in gene discovery and physical mapping. PMID:22559868
Kim, Hyehwang; Segal, Dvira
2017-04-28
The electrical conductance of molecular junctions may depend strongly on the temperature and weakly on molecular length, under two distinct mechanisms: phase-coherent resonant conduction, with charges proceeding via delocalized molecular orbitals, and incoherent thermally assisted multi-step hopping. While in the case of coherent conduction, the temperature dependence arises from the broadening of the Fermi distribution in the metal electrodes, in the latter case it corresponds to electron-vibration interaction effects on the junction. With the objective to distill the thermally activated hopping component, thus exposing intrinsic electron-vibration interaction phenomena on the junction, we suggest the design of molecular junctions with "spacers," extended anchoring groups that act to filter out phase-coherent resonant electrons. Specifically, we study the electrical conductance of fixed-gap and variable-gap junctions that include a tunneling block, with spacers at the boundaries. Using numerical simulations and analytical considerations, we demonstrate that in our design, resonant conduction is suppressed. As a result, the electrical conductance is dominated by two (rather than three) mechanisms: superexchange (deep tunneling) and multi-step thermally induced hopping. We further exemplify our analysis on DNA junctions with an A:T block serving as a tunneling barrier. Here, we show that the electrical conductance is insensitive to the number of G:C base-pairs at the boundaries. This indicates that the tunneling-to-hopping crossover revealed in such sequences truly corresponds to the properties of the A:T barrier.
Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y
1981-01-01
The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776
Chao, Mei; Lin, Chia-Chi; Lin, Feng-Ming; Li, Hsin-Pai; Iang, Shan-Bei
2015-12-01
Hepatitis delta virus (HDV) is the only animal RNA virus that has an unbranched rod-like genome with ribozyme activity and is replicated by host RNA polymerase. HDV RNA recombination was previously demonstrated in patients and in cultured cells by analysis of a region corresponding to the C terminus of the delta antigen (HDAg), the only viral-encoded protein. Here, a whole-genome recombination map of HDV was constructed using an experimental system in which two HDV-1 sequences were co-transfected into cultured cells and the recombinants were analysed by sequencing of cloned reverse transcription-PCR products. Fifty homologous recombinants with 60 crossovers mapping to 22 junctions were identified from 200 analysed clones. Small HDAg chimeras harbouring a junction newly detected in the recombination map were then constructed. The results further indicated that the genome-replication level of HDV was sensitive to the sixth amino acid within the N-terminal 22 aa of HDAg. Therefore, the recombination map established in this study provided a tool for not only understanding HDV RNA recombination, but also elucidating the related mechanisms, such as molecular elements responsible for the trans-activation levels of the small HDAg.
Observing Holliday junction branch migration one step at a time
NASA Astrophysics Data System (ADS)
Ha, Taekjip
2004-03-01
During genetic recombination, two homologous DNA molecules undergo strand exchange to form a four-way DNA (Holliday) junction and the recognition and processing of this species by branch migration and junction resolving enzymes determine the outcome. We have used single molecule fluorescence techniques to study two intrinsic structural dynamics of the Holliday junction, stacking conformer transitions and spontaneous branch migration. Our studies show that the dynamics of branch migration, resolved with one base pair resolution, is determined by the stability of conformers which in turn depends on the local DNA sequences. Therefore, the energy landscape of Holliday junction branch migation is not uniform, but is rugged.
A Computational and Theoretical Study of Conductance in Hydrogen-bonded Molecular Junctions
NASA Astrophysics Data System (ADS)
Wimmer, Michael
This thesis is devoted to the theoretical and computational study of electron transport in molecular junctions where one or more hydrogen bonds are involved in the process. While electron transport through covalent bonds has been extensively studied, in recent work the focus has been shifted towards hydrogen-bonded systems due to their ubiquitous presence in biological systems and their potential in forming nano-junctions between molecular electronic devices and biological systems. This analysis allows us to significantly expand our comprehension of the experimentally observed result that the inclusion of hydrogen bonding in a molecular junction significantly impacts its transport properties, a fact that has important implications for our understanding of transport through DNA, and nano-biological interfaces in general. In part of this work I have explored the implications of quasiresonant transport in short chains of weakly-bonded molecular junctions involving hydrogen bonds. I used theoretical and computational analysis to interpret recent experiments and explain the role of Fano resonances in the transmission properties of the junction. In a different direction, I have undertaken the study of the transversal conduction through nucleotide chains that involve a variable number of different hydrogen bonds, e.g. NH˙˙˙O, OH˙˙˙O, and NH˙˙˙N, which are the three most prevalent hydrogen bonds in biological systems and organic electronics. My effort here has focused on the analysis of electronic descriptors that allow a simplified conceptual and computational understanding of transport properties. Specifically, I have expanded our previous work where the molecular polarizability was used as a conductance descriptor to include the possibility of atomic and bond partitions of the molecular polarizability. This is important because it affords an alternative molecular description of conductance that is not based on the conventional view of molecular orbitals as transport channels. My findings suggest that the hydrogen-bond networks are crucial in understanding the conductance of these junctions. A broader impact of this work pertains the fact that characterizing transport through hydrogen bonding networks may help in developing faster and cost-effective approaches to personalized medicine, to advance DNA sequencing and implantable electronics, and to progress in the design and application of new drugs.
RASH, JOHN E.; DAVIDSON, KIMBERLY G. V.; KAMASAWA, NAOMI; YASUMURA, THOMAS; KAMASAWA, MASAMI; ZHANG, CHUNBO; MICHAELS, ROBIN; RESTREPO, DIEGO; OTTERSEN, OLE P.; OLSON, CARL O.; NAGY, JAMES I.
2006-01-01
Odorant/receptor binding and initial olfactory information processing occurs in olfactory receptor neurons (ORNs) within the olfactory epithelium. Subsequent information coding involves high-frequency spike synchronization of paired mitral/tufted cell dendrites within olfactory bulb (OB) glomeruli via positive feedback between glutamate receptors and closely-associated gap junctions. With mRNA for connexins Cx36, Cx43 and Cx45 detected within ORN somata and Cx36 and Cx43 proteins reported in ORN somata and axons, abundant gap junctions were proposed to couple ORNs. We used freeze-fracture replica immunogold labeling (FRIL) and confocal immunofluorescence microscopy to examine Cx36, Cx43 and Cx45 protein in gap junctions in olfactory mucosa, olfactory nerve and OB in adult rats and mice and early postnatal rats. In olfactory mucosa, Cx43 was detected in gap junctions between virtually all intrinsic cell types except ORNs and basal cells; whereas Cx45 was restricted to gap junctions in sustentacular cells. ORN axons contained neither gap junctions nor any of the three connexins. In OB, Cx43 was detected in homologous gap junctions between almost all cell types except neurons and oligodendrocytes. Cx36 and, less abundantly, Cx45 were present in neuronal gap junctions, primarily at “mixed” glutamatergic/electrical synapses between presumptive mitral/tufted cell dendrites. Genomic analysis revealed multiple miRNA (micro interfering RNA) binding sequences in 3′-untranslated regions of Cx36, Cx43 and Cx45 genes, consistent with cell-type-specific post-transcriptional regulation of connexin synthesis. Our data confirm absence of gap junctions between ORNs, and support Cx36- and Cx45-containing gap junctions at glutamatergic mixed synapses between mitral/tufted cells as contributing to higher-order information coding within OB glomeruli. PMID:16841170
Diversity of immunoglobulin lambda light chain gene usage over developmental stages in the horse.
Tallmadge, Rebecca L; Tseng, Chia T; Felippe, M Julia B
2014-10-01
To further studies of neonatal immune responses to pathogens and vaccination, we investigated the dynamics of B lymphocyte development and immunoglobulin (Ig) gene diversity. Previously we demonstrated that equine fetal Ig VDJ sequences exhibit combinatorial and junctional diversity levels comparable to those of adult Ig VDJ sequences. Herein, RACE clones from fetal, neonatal, foal, and adult lymphoid tissue were assessed for Ig lambda light chain combinatorial, junctional, and sequence diversity. Remarkably, more lambda variable genes (IGLV) were used during fetal life than later stages and IGLV gene usage differed significantly with time, in contrast to the Ig heavy chain. Junctional diversity measured by CDR3L length was constant over time. Comparison of Ig lambda transcripts to germline revealed significant increases in nucleotide diversity over time, even during fetal life. These results suggest that the Ig lambda light chain provides an additional dimension of diversity to the equine Ig repertoire. Copyright © 2014 Elsevier Ltd. All rights reserved.
Nucleotide sequence of the gag gene and gag-pol junction of feline leukemia virus.
Laprevotte, I; Hampe, A; Sherr, C J; Galibert, F
1984-01-01
The nucleotide sequence of the gag gene of feline leukemia virus and its flanking sequences were determined and compared with the corresponding sequences of two strains of feline sarcoma virus and with that of the Moloney strain of murine leukemia virus. A high degree of nucleotide sequence homology between the feline leukemia virus and murine leukemia virus gag genes was observed, suggesting that retroviruses of domestic cats and laboratory mice have a common, proximal evolutionary progenitor. The predicted structure of the complete feline leukemia virus gag gene precursor suggests that the translation of nonglycosylated and glycosylated gag gene polypeptides is initiated at two different AUG codons. These initiator codons fall in the same reading frame and are separated by a 222-base-pair segment which encodes an amino terminal signal peptide. The nucleotide sequence predicts the order of amino acids in each of the individual gag-coded proteins (p15, p12, p30, p10), all of which derive from the gag gene precursor. Stable stem-and-loop secondary structures are proposed for two regions of viral RNA. The first falls within sequences at the 5' end of the viral genome, together with adjacent palindromic sequences which may play a role in dimer linkage of RNA subunits. The second includes coding sequences at the gag-pol junction and is proposed to be involved in translation of the pol gene product. Sequence analysis of the latter region shows that the gag and pol genes are translated in different reading frames. Classical consensus splice donor and acceptor sequences could not be localized to regions which would permit synthesis of the expected gag-pol precursor protein. Alternatively, we suggest that the pol gene product (RNA-dependent DNA polymerase) could be translated by a frameshift suppressing mechanism which could involve cleavage modification of stems and loops in a manner similar to that observed in tRNA processing. PMID:6328019
Tripathi, Pooja; Muth, Theodore R.
2017-01-01
Agrobacterium tumefaciens mediated T-DNA integration is a common tool for plant genome manipulation. However, there is controversy regarding whether T-DNA integration is biased towards genes or randomly distributed throughout the genome. In order to address this question, we performed high-throughput mapping of T-DNA-genome junctions obtained in the absence of selection at several time points after infection. T-DNA-genome junctions were detected as early as 6 hours post-infection. T-DNA distribution was apparently uniform throughout the chromosomes, yet local biases toward AT-rich motifs and T-DNA border sequence micro-homology were detected. Analysis of the epigenetic landscape of previously isolated sites of T-DNA integration in Kanamycin-selected transgenic plants showed an association with extremely low methylation and nucleosome occupancy. Conversely, non-selected junctions from this study showed no correlation with methylation and had chromatin marks, such as high nucleosome occupancy and high H3K27me3, that correspond to three-dimensional-interacting heterochromatin islands embedded within euchromatin. Such structures may play a role in capturing and silencing invading T-DNA. PMID:28742090
Chuzhanova, Nadia; Abeysinghe, Shaun S; Krawczak, Michael; Cooper, David N
2003-09-01
Translocations and gross deletions are responsible for a significant proportion of both cancer and inherited disease. Although such gene rearrangements are nonuniformly distributed in the human genome, the underlying mutational mechanisms remain unclear. We have studied the potential involvement of various types of repetitive sequence elements in the formation of secondary structure intermediates between the single-stranded DNA ends that recombine during rearrangements. Complexity analysis was used to assess the potential of these ends to form secondary structures, the maximum decrease in complexity consequent to a gross rearrangement being used as an indicator of the type of repeat and the specific DNA ends involved. A total of 175 pairs of deletion/translocation breakpoint junction sequences available from the Gross Rearrangement Breakpoint Database [GRaBD; www.uwcm.ac.uk/uwcm/mg/grabd/grabd.html] were analyzed. Potential secondary structure was noted between the 5' flanking sequence of the first breakpoint and the 3' flanking sequence of the second breakpoint in 49% of rearrangements and between the 5' flanking sequence of the second breakpoint and the 3' flanking sequence of the first breakpoint in 36% of rearrangements. Inverted repeats, inversions of inverted repeats, and symmetric elements were found in association with gross rearrangements at approximately the same frequency. However, inverted repeats and inversions of inverted repeats accounted for the vast majority (83%) of deletions plus small insertions, symmetric elements for one-half of all antigen receptor-mediated translocations, while direct repeats appear only to be involved in mediating simple deletions. These findings extend our understanding of illegitimate recombination by highlighting the importance of secondary structure formation between single-stranded DNA ends at breakpoint junctions. Copyright 2003 Wiley-Liss, Inc.
Verghese, Bindhu; Lok, Mei; Wen, Jia; Alessandria, Valentina; Chen, Yi; Kathariou, Sophia; Knabel, Stephen
2011-01-01
Different strains of Listeria monocytogenes are well known to persist in individual food processing plants and to contaminate foods for many years; however, the specific genotypic and phenotypic mechanisms responsible for persistence of these unique strains remain largely unknown. Based on sequences in comK prophage junction fragments, different strains of epidemic clones (ECs), which included ECII, ECIII, and ECV, were identified and shown to be specific to individual meat and poultry processing plants. The comK prophage-containing strains showed significantly higher cell densities after incubation at 30°C for 48 h on meat and poultry food-conditioning films than did strains lacking the comK prophage (P < 0.05). Overall, the type of strain, the type of conditioning film, and the interaction between the two were all highly significant (P < 0.001). Recombination analysis indicated that the comK prophage junction fragments in these strains had evolved due to extensive recombination. Based on the results of the present study, we propose a novel model in which the concept of defective comK prophage was replaced with the rapid adaptation island (RAI). Genes within the RAI were recharacterized as “adaptons,” as these genes may allow L. monocytogenes to rapidly adapt to different food processing facilities and foods. If confirmed, the model presented would help explain Listeria's rapid niche adaptation, biofilm formation, persistence, and subsequent transmission to foods. Also, comK prophage junction fragment sequences may permit accurate tracking of persistent strains back to and within individual food processing operations and thus allow the design of more effective intervention strategies to reduce contamination and enhance food safety. PMID:21441318
Verghese, Bindhu; Lok, Mei; Wen, Jia; Alessandria, Valentina; Chen, Yi; Kathariou, Sophia; Knabel, Stephen
2011-05-01
Different strains of Listeria monocytogenes are well known to persist in individual food processing plants and to contaminate foods for many years; however, the specific genotypic and phenotypic mechanisms responsible for persistence of these unique strains remain largely unknown. Based on sequences in comK prophage junction fragments, different strains of epidemic clones (ECs), which included ECII, ECIII, and ECV, were identified and shown to be specific to individual meat and poultry processing plants. The comK prophage-containing strains showed significantly higher cell densities after incubation at 30°C for 48 h on meat and poultry food-conditioning films than did strains lacking the comK prophage (P < 0.05). Overall, the type of strain, the type of conditioning film, and the interaction between the two were all highly significant (P < 0.001). Recombination analysis indicated that the comK prophage junction fragments in these strains had evolved due to extensive recombination. Based on the results of the present study, we propose a novel model in which the concept of defective comK prophage was replaced with the rapid adaptation island (RAI). Genes within the RAI were recharacterized as "adaptons," as these genes may allow L. monocytogenes to rapidly adapt to different food processing facilities and foods. If confirmed, the model presented would help explain Listeria's rapid niche adaptation, biofilm formation, persistence, and subsequent transmission to foods. Also, comK prophage junction fragment sequences may permit accurate tracking of persistent strains back to and within individual food processing operations and thus allow the design of more effective intervention strategies to reduce contamination and enhance food safety.
Detection of herpes simplex virus-specific DNA sequences in latently infected mice and in humans.
Efstathiou, S; Minson, A C; Field, H J; Anderson, J R; Wildy, P
1986-02-01
Herpes simplex virus-specific DNA sequences have been detected by Southern hybridization analysis in both central and peripheral nervous system tissues of latently infected mice. We have detected virus-specific sequences corresponding to the junction fragment but not the genomic termini, an observation first made by Rock and Fraser (Nature [London] 302:523-525, 1983). This "endless" herpes simplex virus DNA is both qualitatively and quantitatively stable in mouse neural tissue analyzed over a 4-month period. In addition, examination of DNA extracted from human trigeminal ganglia has shown herpes simplex virus DNA to be present in an "endless" form similar to that found in the mouse model system. Further restriction enzyme analysis of latently infected mouse brainstem and human trigeminal DNA has shown that this "endless" herpes simplex virus DNA is present in all four isomeric configurations.
Detection of herpes simplex virus-specific DNA sequences in latently infected mice and in humans.
Efstathiou, S; Minson, A C; Field, H J; Anderson, J R; Wildy, P
1986-01-01
Herpes simplex virus-specific DNA sequences have been detected by Southern hybridization analysis in both central and peripheral nervous system tissues of latently infected mice. We have detected virus-specific sequences corresponding to the junction fragment but not the genomic termini, an observation first made by Rock and Fraser (Nature [London] 302:523-525, 1983). This "endless" herpes simplex virus DNA is both qualitatively and quantitatively stable in mouse neural tissue analyzed over a 4-month period. In addition, examination of DNA extracted from human trigeminal ganglia has shown herpes simplex virus DNA to be present in an "endless" form similar to that found in the mouse model system. Further restriction enzyme analysis of latently infected mouse brainstem and human trigeminal DNA has shown that this "endless" herpes simplex virus DNA is present in all four isomeric configurations. Images PMID:3003377
Experimental evidence of a φ Josephson junction.
Sickinger, H; Lipman, A; Weides, M; Mints, R G; Kohlstedt, H; Koelle, D; Kleiner, R; Goldobin, E
2012-09-07
We demonstrate experimentally the existence of Josephson junctions having a doubly degenerate ground state with an average Josephson phase ψ=±φ. The value of φ can be chosen by design in the interval 0<φ<π. The junctions used in our experiments are fabricated as 0-π Josephson junctions of moderate normalized length with asymmetric 0 and π regions. We show that (a) these φ Josephson junctions have two critical currents, corresponding to the escape of the phase ψ from -φ and +φ states, (b) the phase ψ can be set to a particular state by tuning an external magnetic field, or (c) by using a proper bias current sweep sequence. The experimental observations are in agreement with previous theoretical predictions.
Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow.
Suryawanshi, Gajendra W; Xu, Song; Xie, Yiming; Chou, Tom; Kim, Namshin; Chen, Irvin S Y; Kim, Sanggu
2017-06-14
Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral gene therapy studies, IS assays, in combination with next-generation sequencing, have been used as a cell-tracking tool to characterize clonal stem cell populations sharing the same IS. For the accurate comparison of repopulating stem cell clones within and across different samples, the detection sensitivity, data reproducibility, and high-throughput capacity of the assay are among the most important assay qualities. This work provides a detailed protocol and data analysis workflow for bidirectional IS analysis. The bidirectional assay can simultaneously sequence both upstream and downstream vector-host junctions. Compared to conventional unidirectional IS sequencing approaches, the bidirectional approach significantly improves IS detection rates and the characterization of integration events at both ends of the target DNA. The data analysis pipeline described here accurately identifies and enumerates identical IS sequences through multiple steps of comparison that map IS sequences onto the reference genome and determine sequencing errors. Using an optimized assay procedure, we have recently published the detailed repopulation patterns of thousands of Hematopoietic Stem Cell (HSC) clones following transplant in rhesus macaques, demonstrating for the first time the precise time point of HSC repopulation and the functional heterogeneity of HSCs in the primate system. The following protocol describes the step-by-step experimental procedure and data analysis workflow that accurately identifies and quantifies identical IS sequences.
ABMapper: a suffix array-based tool for multi-location searching and splice-junction mapping.
Lou, Shao-Ke; Ni, Bing; Lo, Leung-Yau; Tsui, Stephen Kwok-Wing; Chan, Ting-Fung; Leung, Kwong-Sak
2011-02-01
Sequencing reads generated by RNA-sequencing (RNA-seq) must first be mapped back to the genome through alignment before they can be further analyzed. Current fast and memory-saving short-read mappers could give us a quick view of the transcriptome. However, they are neither designed for reads that span across splice junctions nor for repetitive reads, which can be mapped to multiple locations in the genome (multi-reads). Here, we describe a new software package: ABMapper, which is specifically designed for exploring all putative locations of reads that are mapped to splice junctions or repetitive in nature. The software is freely available at: http://abmapper.sourceforge.net/. The software is written in C++ and PERL. It runs on all major platforms and operating systems including Windows, Mac OS X and LINUX.
Felinski, Edward A; Cox, Amy E; Phillips, Brett E; Antonetti, David A
2008-06-01
Tight junctions between vascular endothelial cells help to create the blood-brain and blood-retinal barriers. Breakdown of the retinal tight junction complex is problematic in several disease states including diabetic retinopathy. Glucocorticoids can restore and/or preserve the endothelial barrier to paracellular permeability, although the mechanism remains unclear. We show that glucocorticoid treatment of primary retinal endothelial cells increases content of the tight junction proteins occludin and claudin-5, co-incident with an increase in barrier properties of endothelial monolayers. The glucocorticoid receptor antagonist RU486 reverses both the glucocorticoid-stimulated increase in occludin content and the increase in barrier properties. Transcriptional activity from the human occludin and claudin-5 promoters increases in retinal endothelial cells upon glucocorticoid treatment, and is dependent on the glucocorticoid receptor (GR) as demonstrated by siRNA. Deletion analysis of the occludin promoter reveals a 205bp sequence responsible for the glucocorticoid response. However, this region does not possess a canonical glucocorticoid response element and does not bind to the GR in a chromatin immunoprecipitation (ChIP) assay. Mutational analysis of this region revealed a novel 40bp occludin enhancer element (OEE), containing two highly conserved regions of 10 and 13 base pairs, that is both necessary and sufficient for glucocorticoid-induced gene expression in retinal endothelial cells. These data suggest a novel mechanism for glucocorticoid induction of vascular endothelial barrier properties through increased occludin and claudin-5 gene expression.
Felinski, Edward A.; Cox, Amy E.; Phillips, Brett E.; Antonetti, David A.
2008-01-01
Tight junctions between vascular endothelial cells help to create the blood-brain and blood-retinal barriers. Breakdown of the retinal tight junction complex is problematic in several disease states including diabetic retinopathy. Glucocorticoids can restore and/or preserve the endothelial barrier to paracellular permeability, although the mechanism remains unclear. We show that glucocorticoid treatment of primary retinal endothelial cells increases content of the tight junction proteins occludin and claudin-5, co-incident with an increase in barrier properties of endothelial monolayers. The glucocorticoid receptor antagonist RU486 reverses both the glucocorticoid-stimulated increase in occludin content and the increase in barrier properties. Transcriptional activity from the human occludin and claudin-5 promoters increases in retinal endothelial cells upon glucocorticoid treatment, and is dependent on the glucocorticoid receptor (GR) as demonstrated by siRNA. Deletion analysis of the occludin promoter reveals a 205 bp sequence responsible for the glucocorticoid response. However, this region does not posses a canonical glucocorticoid response element and does not bind to the GR in a chromatin immunoprecipitation (ChIP) assay. Mutational analysis of this region revealed a novel 40 bp occludin enhancer element (OEE), containing two highly-conserved regions of 10 and 13 base pairs, that is both necessary and sufficient for glucocorticoid-induced gene expression in retinal endothelial cells. These data suggest a novel mechanism for glucocorticoid induction of vascular endothelial barrier properties through increased occludin and claudin-5 gene expression. PMID:18501346
Hasing, Maria E; Hazes, Bart; Lee, Bonita E; Preiksaitis, Jutta K; Pang, Xiaoli L
2014-10-01
Recombination is an important mechanism generating genetic diversity in norovirus (NoV) that occurs commonly at the NoV polymerase-capsid (ORF1/2) junction. The genotyping method based on partial ORF2 sequences currently used to characterize circulating NoV strains in gastroenteritis outbreaks in Alberta cannot detect such recombination events and provides only limited information on NoV genetic evolution. The objective of this study was to determine whether any NoV GII.4 strains causing outbreaks in Alberta are recombinants. Twenty stool samples collected during outbreaks occurring between July 2004 and January 2012 were selected to include the GII.4 variants Farmington Hills 2002, Hunter 2004, Yerseke 2006a, Den Haag 2006b, Apeldoorn 2007, New Orleans 2009, and Sydney 2012 based on previous NoV ORF2-genotyping results. Near full-length NoV genome sequences were obtained, aligned with reference sequences from GenBank and analyzed with RDPv4.13. Two sequences corresponding to Apeldoorn 2007, and Sydney 2012 were identified as recombinants with breakpoints near the ORF1/2 junction and putative parental strains as previously reported. We also identified, for the first time, a non-recombinant sequence resembling the ORF2-3 parent of the recombinant cluster Sydney 2012 responsible for the most recent pandemic. Our results confirmed the presence of recombinant NoV GII.4 strains in Alberta, and highlight the importance of including additional genomic regions in surveillance studies to trace the evolution of pandemic NoV GII.4 strains. Copyright © 2014 Elsevier B.V. All rights reserved.
Junctions between i-motif tetramers in supramolecular structures
Guittet, Eric; Renciuk, Daniel; Leroy, Jean-Louis
2012-01-01
The symmetry of i-motif tetramers gives to cytidine-rich oligonucleotides the capacity to associate into supramolecular structures (sms). In order to determine how the tetramers are linked together in such structures, we have measured by gel filtration chromatography and NMR the formation and dissociation kinetics of sms built by oligonucleotides containing two short C stretches separated by a non-cytidine-base. We show that a stretch of only two cytidines either at the 3′- or 5′-end is long enough to link the tetramers into sms. The analysis of the properties of sms formed by oligonucleotides differing by the length of the oligo-C stretches, the sequence orientation and the nature of the non-C base provides a model of the junction connecting the tetramers in sms. PMID:22362739
Gustavsson, Peter; Förster, Alisa; Hofmeister, Wolfgang; Wincent, Josephine; Zachariadis, Vasilios; Anderlid, Britt-Marie; Nordgren, Ann; Mäkitie, Outi; Wirta, Valtteri; Käller, Max; Vezzi, Francesco; Lupski, James R; Nordenskjöld, Magnus; Lundberg, Elisabeth Syk; Carvalho, Claudia M. B.; Lindstrand, Anna
2016-01-01
Most balanced translocations are thought to result mechanistically from non-homologous endjoining (NHEJ) or, in rare cases of recurrent events, by nonallelic homologous recombination (NAHR). Here, we use low coverage mate pair whole genome sequencing to fine map rearrangement breakpoint junctions in both phenotypically normal and affected translocation carriers. In total, 46 junctions from 22 carriers of balanced translocations were characterized. Genes were disrupted in 48% of the breakpoints; recessive genes in four normal carriers and known dominant intellectual disability genes in three affected carriers. Finally, seven candidate disease genes were disrupted in five carriers with neurocognitive disabilities (SVOPL, SUSD1, TOX, NCALD, SLC4A10) and one XX-male carrier with Tourette syndrome (LYPD6, GPC5). Breakpoint junction analyses revealed microhomology and small templated insertions in a substantive fraction of the analyzed translocations (17.4%; n=4); an observation that was substantiated by reanalysis of 37 previously published translocation junctions. Microhomology associated with templated-insertions is a characteristic seen in the breakpoint junctions of rearrangements mediated by the error prone replication-based repair mechanisms (RBMs). Our data implicate that a mechanism involving template switching might contribute to the formation of at least 15% of the interchromosomal translocation events. PMID:27862604
NASA Technical Reports Server (NTRS)
Huang, J. F.; Teyton, L.; Harper, J. F.; Evans, M. L. (Principal Investigator)
1996-01-01
Ca(2+)-dependent protein kinases (CDPKs) are regulated by a C-terminal calmodulin-like domain (CaM-LD). The CaM-LD is connected to the kinase by a short junction sequence which contains a pseudosubstrate autoinhibitor. To understand how the CaM-LD regulates a CDPK, a recombinant CDPK (isoform CPK-1 from Arabidopsis, accession no. L14771) was made as a fusion protein in Escherichia coli. We show here that a truncated CDPK lacking a CaM-LD (e.g. mutant delta NC-26H) can be activated by exogenous calmodulin or an isolated CaM-LD (Kact approximately 2 microM). We propose that Ca2+ activation of a CDPK normally occurs through intramolecular binding of the CaM-LD to the junction. When the junction and CaM-LD are made as two separate polypeptides, the CaM-LD can bind the junction in a Ca(2+)-dependent fashion with a dissociation constant (KD) of 6 x 10(-6) M, as determined by kinetic binding analyses. When the junction and CaM-LD are tethered in a single polypeptide (e.g. in protein JC-1), their ability to engage in bimolecular binding is suppressed (e.g. the tethered CaM-LD cannot bind a separate junction). A mutation which disrupts the putative CaM-LD binding sequence (e.g. substitution LRV-1444 to DLPG) appears to block intramolecular binding, as indicated by the restored ability of a tethered CaM-LD to engage in bimolecular binding. This mutation, in the context of a full-length enzyme (mutant KJM46H), appears to block Ca2+ activation. Thus, a disruption of intramolecular binding correlates with a disruption of the Ca2+ activation mechanism. CDPKs provide the first example of a member of the calmodulin superfamily where a target binding sequence is located within the same polypeptide.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Venkadesh, S.; Mandal, P.K.; Gautham, N., E-mail: n_gautham@hotmail.com
Highlights: {yields} This is the first crystal structure of a four-way junction with sticky ends. {yields} Four junction structures bind to each other and form a rhombic cavity. {yields} Each rhombus binds to others to form 'infinite' 2D tiles. {yields} This is an example of bottom-up fabrication of a DNA nano-lattice. -- Abstract: We report here the crystal structure of the partially self-complementary decameric sequence d(CGGCGGCCGC), which self assembles to form a four-way junction with sticky ends. Each junction binds to four others through Watson-Crick base pairing at the sticky ends to form a rhombic structure. The rhombuses bind tomore » each other and form two dimensional tiles. The tiles stack to form the crystal. The crystal diffracted in the space group P1 to a resolution of 2.5 A. The junction has the anti-parallel stacked-X conformation like other junction structures, though the formation of the rhombic net noticeably alters the details of the junction geometry.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Solera, J.; Magallon, M.; Martin-Villar, J.
1992-02-01
DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends ofmore » the deleted DNA fragment.« less
Mikulecky, Peter J.; Takach, Jennifer C.; Feig, Andrew L.
2008-01-01
Helical junctions are extremely common motifs in naturally occurring RNAs, but little is known about the thermodynamics that drive their folding. Studies of junction folding face several challenges: non-two-state folding behavior, superposition of secondary and tertiary structural energetics, and drastically opposing enthalpic and entropic contributions to folding. Here we describe a thermodynamic dissection of the folding of the hammerhead ribozyme, a three-way RNA helical junction, by using isothermal titration calorimetry of bimolecular RNA constructs. By using this method, we show that tertiary folding of the hammerhead core occurs with a highly unfavorable enthalpy change, and is therefore entropically driven. Furthermore, the enthalpies and heat capacities of core folding are the same whether supported by monovalent or divalent ions. These properties appear to be general to the core sequence of bimolecular hammerhead constructs. We present a model for the ion-induced folding of the hammerhead core that is similar to those advanced for the folding of much larger RNAs, involving ion-induced collapse to a structured, non-native state accompanied by rearrangement of core residues to produce the native fold. In agreement with previous enzymological and structural studies, our thermodynamic data suggest that the hammerhead structure is stabilized in vitro predominantly by diffusely bound ions. Our approach addresses several significant challenges that accompany the study of junction folding, and should prove useful in defining the thermodynamic determinants of stability in these important RNA motifs. PMID:15134461
Mapping RNA-seq Reads with STAR
Dobin, Alexander; Gingeras, Thomas R.
2015-01-01
Mapping of large sets of high-throughput sequencing reads to a reference genome is one of the foundational steps in RNA-seq data analysis. The STAR software package performs this task with high levels of accuracy and speed. In addition to detecting annotated and novel splice junctions, STAR is capable of discovering more complex RNA sequence arrangements, such as chimeric and circular RNA. STAR can align spliced sequences of any length with moderate error rates providing scalability for emerging sequencing technologies. STAR generates output files that can be used for many downstream analyses such as transcript/gene expression quantification, differential gene expression, novel isoform reconstruction, signal visualization, and so forth. In this unit we describe computational protocols that produce various output files, use different RNA-seq datatypes, and utilize different mapping strategies. STAR is Open Source software that can be run on Unix, Linux or Mac OS X systems. PMID:26334920
Mapping RNA-seq Reads with STAR.
Dobin, Alexander; Gingeras, Thomas R
2015-09-03
Mapping of large sets of high-throughput sequencing reads to a reference genome is one of the foundational steps in RNA-seq data analysis. The STAR software package performs this task with high levels of accuracy and speed. In addition to detecting annotated and novel splice junctions, STAR is capable of discovering more complex RNA sequence arrangements, such as chimeric and circular RNA. STAR can align spliced sequences of any length with moderate error rates, providing scalability for emerging sequencing technologies. STAR generates output files that can be used for many downstream analyses such as transcript/gene expression quantification, differential gene expression, novel isoform reconstruction, and signal visualization. In this unit, we describe computational protocols that produce various output files, use different RNA-seq datatypes, and utilize different mapping strategies. STAR is open source software that can be run on Unix, Linux, or Mac OS X systems. Copyright © 2015 John Wiley & Sons, Inc.
The LAM-PCR Method to Sequence LV Integration Sites.
Wang, Wei; Bartholomae, Cynthia C; Gabriel, Richard; Deichmann, Annette; Schmidt, Manfred
2016-01-01
Integrating viral gene transfer vectors are commonly used gene delivery tools in clinical gene therapy trials providing stable integration and continuous gene expression of the transgene in the treated host cell. However, integration of the reverse-transcribed vector DNA into the host genome is a potentially mutagenic event that may directly contribute to unwanted side effects. A comprehensive and accurate analysis of the integration site (IS) repertoire is indispensable to study clonality in transduced cells obtained from patients undergoing gene therapy and to identify potential in vivo selection of affected cell clones. To date, next-generation sequencing (NGS) of vector-genome junctions allows sophisticated studies on the integration repertoire in vitro and in vivo. We have explored the use of the Illumina MiSeq Personal Sequencer platform to sequence vector ISs amplified by non-restrictive linear amplification-mediated PCR (nrLAM-PCR) and LAM-PCR. MiSeq-based high-quality IS sequence retrieval is accomplished by the introduction of a double-barcode strategy that substantially minimizes the frequency of IS sequence collisions compared to the conventionally used single-barcode protocol. Here, we present an updated protocol of (nr)LAM-PCR for the analysis of lentiviral IS using a double-barcode system and followed by deep sequencing using the MiSeq device.
Fast multiclonal clusterization of V(D)J recombinations from high-throughput sequencing.
Giraud, Mathieu; Salson, Mikaël; Duez, Marc; Villenet, Céline; Quief, Sabine; Caillault, Aurélie; Grardel, Nathalie; Roumier, Christophe; Preudhomme, Claude; Figeac, Martin
2014-05-28
V(D)J recombinations in lymphocytes are essential for immunological diversity. They are also useful markers of pathologies. In leukemia, they are used to quantify the minimal residual disease during patient follow-up. However, the full breadth of lymphocyte diversity is not fully understood. We propose new algorithms that process high-throughput sequencing (HTS) data to extract unnamed V(D)J junctions and gather them into clones for quantification. This analysis is based on a seed heuristic and is fast and scalable because in the first phase, no alignment is performed with germline database sequences. The algorithms were applied to TR γ HTS data from a patient with acute lymphoblastic leukemia, and also on data simulating hypermutations. Our methods identified the main clone, as well as additional clones that were not identified with standard protocols. The proposed algorithms provide new insight into the analysis of high-throughput sequencing data for leukemia, and also to the quantitative assessment of any immunological profile. The methods described here are implemented in a C++ open-source program called Vidjil.
Daveau, Romain; Combaret, Valérie; Pierre-Eugène, Cécile; Cazes, Alex; Louis-Brennetot, Caroline; Schleiermacher, Gudrun; Ferrand, Sandrine; Pierron, Gaëlle; Lermine, Alban; Frio, Thomas Rio; Raynal, Virginie; Vassal, Gilles; Barillot, Emmanuel; Delattre, Olivier; Janoueix-Lerosey, Isabelle
2013-01-01
Neuroblastoma is a pediatric cancer of the peripheral nervous system in which structural chromosome aberrations are emblematic of aggressive tumors. In this study, we performed an in-depth analysis of somatic rearrangements in two neuroblastoma cell lines and two primary tumors using paired-end sequencing of mate-pair libraries and RNA-seq. The cell lines presented with typical genetic alterations of neuroblastoma and the two tumors belong to the group of neuroblastoma exhibiting a profile of chromothripsis. Inter and intra-chromosomal rearrangements were identified in the four samples, allowing in particular characterization of unbalanced translocations at high resolution. Using complementary experiments, we further characterized 51 rearrangements at the base pair resolution that revealed 59 DNA junctions. In a subset of cases, complex rearrangements were observed with templated insertion of fragments of nearby sequences. Although we did not identify known particular motifs in the local environment of the breakpoints, we documented frequent microhomologies at the junctions in both chromothripsis and non-chromothripsis associated breakpoints. RNA-seq experiments confirmed expression of several predicted chimeric genes and genes with disrupted exon structure including ALK, NBAS, FHIT, PTPRD and ODZ4. Our study therefore indicates that both non-homologous end joining-mediated repair and replicative processes may account for genomic rearrangements in neuroblastoma. RNA-seq analysis allows the identification of the subset of abnormal transcripts expressed from genomic rearrangements that may be involved in neuroblastoma oncogenesis. PMID:23991058
Barik, Sailen
2008-01-01
The significance of the intron-exon structure of genes is a mystery. As eukaryotic proteins are made up of modular functional domains, each exon was suspected to encode some form of module; however, the definition of a module remained vague. Comparison of pre-mRNA splice junctions with the three-dimensional architecture of its protein product from different eukaryotes revealed that the junctions were far less likely to occur inside the α-helices and β-strands of proteins than within the more flexible linker regions (‘turns’ and ‘loops’) connecting them. The splice junctions were equally distributed in the different types of linkers and throughout the linker sequence, although a slight preference for the central region of the linker was observed. The avoidance of the α-helix and the β-strand by splice junctions suggests the existence of a selection pressure against their disruption, perhaps underscoring the investment made by nature in building these intricate secondary structures. A corollary is that the helix and the strand are the smallest integral architectural units of a protein and represent the minimal modules in the evolution of protein structure. These results should find use in comparative genomics, designing of cloning strategies, and in the mutual verification of genome sequences with protein structures. PMID:15381847
Barik, Sailen
2004-09-01
The significance of the intron-exon structure of genes is a mystery. As eukaryotic proteins are made up of modular functional domains, each exon was suspected to encode some form of module; however, the definition of a module remained vague. Comparison of pre-mRNA splice junctions with the three-dimensional architecture of its protein product from different eukaryotes revealed that the junctions were far less likely to occur inside the alpha-helices and beta-strands of proteins than within the more flexible linker regions ('turns' and 'loops') connecting them. The splice junctions were equally distributed in the different types of linkers and throughout the linker sequence, although a slight preference for the central region of the linker was observed. The avoidance of the alpha-helix and the beta-strand by splice junctions suggests the existence of a selection pressure against their disruption, perhaps underscoring the investment made by nature in building these intricate secondary structures. A corollary is that the helix and the strand are the smallest integral architectural units of a protein and represent the minimal modules in the evolution of protein structure. These results should find use in comparative genomics, designing of cloning strategies, and in the mutual verification of genome sequences with protein structures.
Tuning electronic transport via hepta-alanine peptides junction by tryptophan doping.
Guo, Cunlan; Yu, Xi; Refaely-Abramson, Sivan; Sepunaru, Lior; Bendikov, Tatyana; Pecht, Israel; Kronik, Leeor; Vilan, Ayelet; Sheves, Mordechai; Cahen, David
2016-09-27
Charge migration for electron transfer via the polypeptide matrix of proteins is a key process in biological energy conversion and signaling systems. It is sensitive to the sequence of amino acids composing the protein and, therefore, offers a tool for chemical control of charge transport across biomaterial-based devices. We designed a series of linear oligoalanine peptides with a single tryptophan substitution that acts as a "dopant," introducing an energy level closer to the electrodes' Fermi level than that of the alanine homopeptide. We investigated the solid-state electron transport (ETp) across a self-assembled monolayer of these peptides between gold contacts. The single tryptophan "doping" markedly increased the conductance of the peptide chain, especially when its location in the sequence is close to the electrodes. Combining inelastic tunneling spectroscopy, UV photoelectron spectroscopy, electronic structure calculations by advanced density-functional theory, and dc current-voltage analysis, the role of tryptophan in ETp is rationalized by charge tunneling across a heterogeneous energy barrier, via electronic states of alanine and tryptophan, and by relatively efficient direct coupling of tryptophan to a Au electrode. These results reveal a controlled way of modulating the electrical properties of molecular junctions by tailor-made "building block" peptides.
Self-Organizing Hidden Markov Model Map (SOHMMM).
Ferles, Christos; Stafylopatis, Andreas
2013-12-01
A hybrid approach combining the Self-Organizing Map (SOM) and the Hidden Markov Model (HMM) is presented. The Self-Organizing Hidden Markov Model Map (SOHMMM) establishes a cross-section between the theoretic foundations and algorithmic realizations of its constituents. The respective architectures and learning methodologies are fused in an attempt to meet the increasing requirements imposed by the properties of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and protein chain molecules. The fusion and synergy of the SOM unsupervised training and the HMM dynamic programming algorithms bring forth a novel on-line gradient descent unsupervised learning algorithm, which is fully integrated into the SOHMMM. Since the SOHMMM carries out probabilistic sequence analysis with little or no prior knowledge, it can have a variety of applications in clustering, dimensionality reduction and visualization of large-scale sequence spaces, and also, in sequence discrimination, search and classification. Two series of experiments based on artificial sequence data and splice junction gene sequences demonstrate the SOHMMM's characteristics and capabilities. Copyright © 2013 Elsevier Ltd. All rights reserved.
NASA Technical Reports Server (NTRS)
Goldman, H.; Wolf, M.
1979-01-01
The energy consumed in manufacturing silicon solar cell modules was calculated for the current process, as well as for 1982 and 1986 projected processes. In addition, energy payback times for the above three sequences are shown. The module manufacturing energy was partitioned two ways. In one way, the silicon reduction, silicon purification, sheet formation, cell fabrication, and encapsulation energies were found. In addition, the facility, equipment, processing material and direct material lost-in-process energies were appropriated in junction formation processes and full module manufacturing sequences. A brief methodology accounting for the energy of silicon wafers lost-in-processing during cell manufacturing is described.
Charge transport and ac response under light illumination in gate-modulated DNA molecular junctions.
Zhang, Yan; Zhu, Wen-Huan; Ding, Guo-Hui; Dong, Bing; Wang, Xue-Feng
2015-05-22
Using a two-strand tight-binding model and within nonequilibrium Green's function approach, we study charge transport through DNA sequences (GC)NGC and (GC)1(TA)NTA (GC)3 sandwiched between two Pt electrodes. We show that at low temperature DNA sequence (GC)NGC exhibits coherent charge carrier transport at very small bias, since the highest occupied molecular orbital in the GC base pair can be aligned with the Fermi energy of the metallic electrodes by a gate voltage. A weak distance dependent conductance is found in DNA sequence (GC)1(TA)NTA (GC)3 with large NTA. Different from the mechanism of thermally induced hopping of charges proposed by the previous experiments, we find that this phenomenon is dominated by quantum tunnelling through discrete quantum well states in the TA base pairs. In addition, ac response of this DNA junction under light illumination is also investigated. The suppression of ac conductances of the left and right lead of DNA sequences at some particular frequencies is attributed to the excitation of electrons in the DNA to the lead Fermi surface by ac potential, or the excitation of electrons in deep DNA energy levels to partially occupied energy levels in the transport window. Therefore, measuring ac response of DNA junctions can reveal a wealth of information about the intrinsic dynamics of DNA molecules.
Kiviranta, Anna-Mariam; McFadyen, Angus K.; Jokinen, Tarja S.; La Ragione, Roberto M.; Rusbridge, Clare
2017-01-01
Objectives To characterize and compare the phenotypic variables of the hindbrain and craniocervical junction associated with syringomyelia (SM) in the Chihuahua, Affenpinscher and Cavalier King Charles Spaniel (CKCS). Method Analysis of 273 T1-weighted mid-sagittal DICOM sequences of the hindbrain and craniocervical junction from 99 Chihuahuas, 42 Affenpinschers and 132 CKCSs. The study compared 22 morphometric features (11 lines, eight angles and three ratios) of dogs with and without SM using refined techniques based on previous studies of the Griffon Bruxellois (GB) using Discriminant Function Analysis and ANOVA with post-hoc corrections. Results The analysis identified 14/22 significant traits for SM in the three dog breeds, five of which were identical to those reported for the GB and suggest inclusion of a common aetiology. One ratio, caudal fossa height to the length of the skull base extended to an imaginary point of alignment between the atlas and supraoccipital bones, was common to all three breeds (p values 0.029 to <0.001). Associated with SM were a reduced occipital crest and two acute changes in angulation i) ‘sphenoid flexure’ at the spheno-occipital synchondrosis ii) ‘cervical flexure’ at the foramen magnum allied with medulla oblongata elevation. Comparing dogs with and without SM, each breed had a unique trait: Chihuahua had a smaller angle between the dens, atlas and basioccipital bone (p value < 0.001); Affenpinschers had a smaller distance from atlas to dens (p value 0.009); CKCS had a shorter distance between the spheno-occipital synchondrosis and atlas (p value 0.007). Conclusion The selected morphometries successfully characterised conformational changes in the brain and craniocervical junction that might form the basis of a diagnostic tool for all breeds. The severity of SM involved a spectrum of abnormalities, incurred by changes in both angulation and size that could alter neural parenchyma compliance and/or impede cerebrospinal fluid channels. PMID:28121988
Knowler, Susan P; Kiviranta, Anna-Mariam; McFadyen, Angus K; Jokinen, Tarja S; La Ragione, Roberto M; Rusbridge, Clare
2017-01-01
To characterize and compare the phenotypic variables of the hindbrain and craniocervical junction associated with syringomyelia (SM) in the Chihuahua, Affenpinscher and Cavalier King Charles Spaniel (CKCS). Analysis of 273 T1-weighted mid-sagittal DICOM sequences of the hindbrain and craniocervical junction from 99 Chihuahuas, 42 Affenpinschers and 132 CKCSs. The study compared 22 morphometric features (11 lines, eight angles and three ratios) of dogs with and without SM using refined techniques based on previous studies of the Griffon Bruxellois (GB) using Discriminant Function Analysis and ANOVA with post-hoc corrections. The analysis identified 14/22 significant traits for SM in the three dog breeds, five of which were identical to those reported for the GB and suggest inclusion of a common aetiology. One ratio, caudal fossa height to the length of the skull base extended to an imaginary point of alignment between the atlas and supraoccipital bones, was common to all three breeds (p values 0.029 to <0.001). Associated with SM were a reduced occipital crest and two acute changes in angulation i) 'sphenoid flexure' at the spheno-occipital synchondrosis ii) 'cervical flexure' at the foramen magnum allied with medulla oblongata elevation. Comparing dogs with and without SM, each breed had a unique trait: Chihuahua had a smaller angle between the dens, atlas and basioccipital bone (p value < 0.001); Affenpinschers had a smaller distance from atlas to dens (p value 0.009); CKCS had a shorter distance between the spheno-occipital synchondrosis and atlas (p value 0.007). The selected morphometries successfully characterised conformational changes in the brain and craniocervical junction that might form the basis of a diagnostic tool for all breeds. The severity of SM involved a spectrum of abnormalities, incurred by changes in both angulation and size that could alter neural parenchyma compliance and/or impede cerebrospinal fluid channels.
Gardner, Qurra-tul-Ann Afza; Younas, Hooria; Akhtar, Muhammad
2013-01-01
Human M-proinsulin was cleaved by trypsin at the R(31)R(32)-E(33) and K(64)R(65)-G(66) bonds (B/C and C/A junctions), showing the same cleavage specificity as exhibited by prohormone convertases 1 and 2 respectively. Buffalo/bovine M-proinsulin was also cleaved by trypsin at the K(59)R(60)-G(61) bond but at the B/C junction cleavage occurred at the R(31)R(32)-E(33) as well as the R(31)-R(32)E(33) bond. Thus, the human isoform in the native state, with a 31 residue connecting C-peptide, seems to have a unique structure around the B/C and C/A junctions and cleavage at these sites is predominantly governed by the structure of the proinsulin itself. In the case of both the proinsulin species the cleavage at the B/C junction was preferred (65%) over that at the C/A junction (35%) supporting the earlier suggestion of the presence of some form of secondary structure at the C/A junction. Proinsulin and its derivatives, as natural substrates for trypsin, were used and mass spectrometric analysis showed that the k(cat.)/K(m) values for the cleavage were most favourable for the scission of the bonds at the two junctions (1.02±0.08×10(5)s(-1)M(-1)) and the cleavage of the K(29)-T(30) bond of M-insulin-RR (1.3±0.07×10(5)s(-1)M(-1)). However, the K(29)-T(30) bond in M-insulin, insulin as well as M-proinsulin was shielded from attack by trypsin (k(cat.)/K(m) values around 1000s(-1)M(-1)). Hence, as the biosynthetic path follows the sequence; proinsulin→insulin-RR→insulin, the K(29)-T(30) bond becomes shielded, exposed then shielded again respectively. Copyright © 2012 Elsevier B.V. All rights reserved.
The tight junction protein ZO-1 and an interacting transcription factor regulate ErbB-2 expression
Balda, Maria S.; Matter, Karl
2000-01-01
Epithelial tight junctions regulate paracellular diffusion and restrict the intermixing of apical and basolateral plasma membrane components. We now identify a Y-box transcription factor, ZONAB (ZO-1-associated nucleic acid-binding protein), that binds to the SH3 domain of ZO-1, a submembrane protein of tight junctions. ZONAB localizes to the nucleus and at tight junctions, and binds to sequences of specific promoters containing an inverted CCAAT box. In reporter assays, ZONAB and ZO-1 functionally interact in the regulation of the ErbB-2 promoter in a cell density-dependent manner. In stably transfected overexpressing cells, ZO-1 and ZONAB control expression of endogenous ErbB-2 and function in the regulation of paracellular permeability. These data indicate that tight junctions directly participate in the control of gene expression and suggest that they function in the regulation of epithelial cell differentiation. PMID:10790369
Tsakou, Eugenia; Agathagelidis, Andreas; Boudjoghra, Myriam; Raff, Thorsten; Dagklis, Antonis; Chatzouli, Maria; Smilevska, Tatjana; Bourikas, George; Merle-Beral, Helene; Manioudaki-Kavallieratou, Eleni; Anagnostopoulos, Achilles; Brüggemann, Monika; Davi, Frederic; Stamatopoulos, Kostas; Belessi, Chrysoula
2012-01-01
The frequent occurrence of stereotyped heavy complementarity-determining region 3 (VH CDR3) sequences among unrelated cases with chronic lymphocytic leukemia (CLL) is widely taken as evidence for antigen selection. Stereotyped VH CDR3 sequences are often defined by the selective association of certain immunoglobulin heavy diversity (IGHD) genes in specific reading frames with certain immunoglobulin heavy joining (IGHJ ) genes. To gain insight into the mechanisms underlying VH CDR3 restrictions and also determine the developmental stage when restrictions in VH CDR3 are imposed, we analyzed partial IGHD-IGHJ rearrangements (D-J) in 829 CLL cases and compared the productively rearranged D-J joints (that is, in-frame junctions without junctional stop codons) to (a) the productive immunoglobulin heavy variable (IGHV )-IGHD-IGHJ rearrangements (V-D-J) from the same cases and (b) 174 D-J rearrangements from 160 precursor B-cell acute lymphoblastic leukemia cases (pre-B acute lymphoblastic leukemia [ALL]). Partial D-J rearrangements were detected in 272/829 CLL cases (32.8%). Sequence analysis was feasible in 238 of 272 D-J rearrangements; 198 of 238 (83.2%) were productively rearranged. The D-J joints in CLL did not differ significantly from those in pre-B ALL, except for higher frequency of the IGHD7-27 and IGHJ6 genes in the latter. Among CLL carrying productively rearranged D-J, comparison of the IGHD gene repertoire in productive V-D-J versus D-J revealed the following: (a) overuse of IGHD reading frames encoding hydrophilic peptides among V-D-J and (b) selection of the IGHD3-3 and IGHD6-19 genes in V-D-J junctions. These results document that the IGHD and IGHJ gene biases in the CLL expressed VH CDR3 repertoire are not stochastic but are directed by selection operating at the immunoglobulin protein level. PMID:21968789
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ton, H.; Yeung, E.S.
1997-02-15
An integrated on-line prototype for coupling a microreactor to capillary electrophoresis for DNA sequencing has been demonstrated. A dye-labeled terminator cycle-sequencing reaction is performed in a fused-silica capillary. Subsequently, the sequencing ladder is directly injected into a size-exclusion chromatographic column operated at nearly 95{degree}C for purification. On-line injection to a capillary for electrophoresis is accomplished at a junction set at nearly 70{degree}C. High temperature at the purification column and injection junction prevents the renaturation of DNA fragments during on-line transfer without affecting the separation. The high solubility of DNA in and the relatively low ionic strength of 1 x TEmore » buffer permit both effective purification and electrokinetic injection of the DNA sample. The system is compatible with highly efficient separations by a replaceable poly(ethylene oxide) polymer solution in uncoated capillary tubes. Future automation and adaptation to a multiple-capillary array system should allow high-speed, high-throughput DNA sequencing from templates to called bases in one step. 32 refs., 5 figs.« less
Fingerprinting and quantification of GMOs in the agro-food sector.
Taverniers, I; Van Bockstaele, E; De Loose, M
2003-01-01
Most strategies for analyzing GMOs in plants and derived food and feed products, are based on the polymerase chain reaction (PCR) technique. In conventional PCR methods, a 'known' sequence between two specific primers is amplified. To the contrary, with the 'anchor PCR' technique, unknown sequences adjacent to a known sequence, can be amplified. Because T-DNA/plant border sequences are being amplified, anchor PCR is the perfect tool for unique identification of transgenes, including non-authorized GMOs. In this work, anchor PCR was applied to characterize the 'transgene locus' and to clarify the complete molecular structure of at least six different commercial transgenic plants. Based on sequences of T-DNA/plant border junctions, obtained by anchor PCR, event specific primers were developed. The junction fragments, together with endogeneous reference gene targets, were cloned in plasmids. The latter were then used as event specific calibrators in real-time PCR, a new technique for the accurate relative quantification of GMOs. We demonstrate here the importance of anchor PCR for identification and the usefulness of plasmid DNA calibrators in quantification strategies for GMOs, throughout the agro-food sector.
Guo, Bingfu; Guo, Yong; Hong, Huilong; Qiu, Li-Juan
2016-01-01
Molecular characterization of sequence flanking exogenous fragment insertion is essential for safety assessment and labeling of genetically modified organism (GMO). In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS) method. More than 22.4 Gb sequence data (∼21 × coverage) for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundaries of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of genomic insertion sites of G2-EPSPS and GAT transgenes will facilitate the utilization of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS was a cost-effective and rapid method for identifying sites of T-DNA insertions and flanking sequences in soybean.
Rabano, Miriam; Vivanco, Maria d M; Perrin, Florence Evelyne
2012-01-01
Background Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disorder characterized by selective motoneurons degeneration. There is today no clear-cut pathogenesis sequence nor any treatment. However growing evidences are in favor of the involvement, besides neurons, of several partners such as glia and muscles. To better characterize the time course of pathological events in an animal model that recapitulates human ALS symptoms, we investigated functional and cellular characteristics of hSOD1G93A mice. Methods and Findings We have evaluated locomotor function of hSOD1G93A mice through dynamic walking patterns and spontaneous motor activity analysis. We detected early functional deficits that redefine symptoms onset at 60 days of age, i.e. 20 days earlier than previously described. Moreover, sequential combination of these approaches allows monitoring of motor activity up to disease end stage. To tentatively correlate early functional deficit with cellular alterations we have used flow cytometry and immunohistochemistry approaches to characterize neuromuscular junctions, astrocytes and microglia. We show that (1) decrease in neuromuscular junction's number correlates with motor impairment, (2) astrocytes number is not altered at pre- and early-symptomatic ages but intraspinal repartition is modified at symptoms onset, and (3) microglia modifications precede disease onset. At pre-symptomatic age, we show a decrease in microglia number whereas at onset of the disease two distinct microglia sub-populations emerge. Conclusions In conclusion, precise motor analysis updates the onset of the disease in hSOD1G93A mice and allows locomotor monitoring until the end stage of the disease. Early functional deficits coincide with alterations of neuromuscular junctions. Importantly, we identify different sets of changes in microglia before disease onset as well as at early-symptomatic stage. This finding not only brings a new sequence of cellular events in the natural history of the disease, but it may also provide clues in the search for biomarkers of the disease, and potential therapeutic targets. PMID:22558300
Direct Free Carrier Photogeneration in Single Layer and Stacked Organic Photovoltaic Devices.
Chandran, Hrisheekesh Thachoth; Ng, Tsz-Wai; Foo, Yishu; Li, Ho-Wa; Qing, Jian; Liu, Xiao-Ke; Chan, Chiu-Yee; Wong, Fu-Lung; Zapien, Juan Antonio; Tsang, Sai-Wing; Lo, Ming-Fai; Lee, Chun-Sing
2017-06-01
High performance organic photovoltaic devices typically rely on type-II P/N junctions for assisting exciton dissociation. Heremans and co-workers recently reported a high efficiency device with a third organic layer which is spatially separated from the active P/N junction; but still contributes to the carrier generation by passing its energy to the P/N junction via a long-range exciton energy transfer mechanism. In this study the authors show that there is an additional mechanism contributing to the high efficiency. Some bipolar materials (e.g., subnaphthalocyanine chloride (SubNc) and subphthalocyanine chloride (SubPc)) are observed to generate free carriers much more effectively than typical organic semiconductors upon photoexcitation. Single-layer devices with SubNc or SubPc sandwiched between two electrodes can give power conversion efficiencies 30 times higher than those of reported single-layer devices. In addition, internal quantum efficiencies (IQEs) of bilayer devices with opposite stacking sequences (i.e., SubNc/SubPc vs SubPc/SubNc) are found to be the sum of IQEs of single layer devices. These results confirm that SubNc and SubPc can directly generate free carriers upon photoexcitation without assistance from a P/N junction. These allow them to be stacked onto each other with reversible sequence or simply stacking onto another P/N junction and contribute to the photocarrier generation. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Detection and characterization of hepatitis A virus circulating in Egypt.
Hamza, Hazem; Abd-Elshafy, Dina Nadeem; Fayed, Sayed A; Bahgat, Mahmoud Mohamed; El-Esnawy, Nagwa Abass; Abdel-Mobdy, Emam
2017-07-01
Hepatitis A virus (HAV) still poses a considerable problem worldwide. In the current study, hepatitis A virus was recovered from wastewater samples collected from three wastewater treatment plants over one year. Using RT-PCR, HAV was detected in 43 out of 68 samples (63.2%) representing both inlet and outlet. Eleven positive samples were subjected to sequencing targeting the VP1-2A junction region. Phylogenetic analysis revealed that all samples belonged to subgenotype IB with few substitutions at the amino acid level. The complete sequence of one isolate (HAV/Egy/BI-11/2015) showed that the similarity at the amino acid level was not reflected at the nucleotide level. However, the deduced amino acid sequence derived from the complete nucleotide sequence showed distinct substitutions in the 2B, 2C, and 3A regions. Recombination analysis revealed a recombination event between X75215 (subgenotype IA) and AF268396 (subgenotype IB) involving a portion of the 2B nonstructural protein coding region (nucleotides 3757-3868) assuming the herein characterized sequence an actual recombinant. Despite the role of recombination in picornaviruses evolution, its involvement in HAV evolution has rarely been reported, and this may be due to the limited available complete HAV sequences. To our knowledge, this represents the first characterized complete sequence of an Egyptian isolate and the described recombination event provides an important update on the circulating HAV strains in Egypt.
Zhang, Xinxin; Ma, Dehua; Zou, Wei; Ding, Yibing; Zhu, Chengchu; Min, Haiyan; Zhang, Bin; Wang, Wei; Chen, Baofu; Ye, Minhua; Cai, Minghui; Pan, Yanqing; Cao, Lei; Wan, Yueming; Jin, Yu; Gao, Qian; Yi, Long
2016-05-27
Primary spontaneous pneumothorax (PSP) or pulmonary cysts is one of the manifestations of Birt-Hogg-Dube syndrome (BHDS) that is caused by heterozygous mutations in FLCN gene. Most of the mutations are SNVs and small indels, and there are also approximately 10 % large intragenic deletions and duplications of the mutations. These molecular findings are generally obtained by disparate methods including Sanger sequencing and Multiple Ligation-dependent Probe Amplification in the clinical laboratory. In addition, as a genetically heterogeneous disorder, PSP may be caused by mutations in multiple genes include FBN1, COL3A1, CBS, SERPINA1 and TSC1/TSC2 genes. For differential diagnosis, these genes should also be screened which makes the diagnostic procedure more time-consuming and labor-intensive. Forty PSP patients were divided into 2 groups. Nineteen patients with different pathogenic mutations of FLCN previously identified by conventional Sanger sequencing and MLPA were included in test group, 21 random PSP patients without any genetic screening were included in blinded sample group. 7 PSP genes including FLCN, FBN1, COL3A1, CBS, SERPINA1 and TSC1/TSC2 were designed and enriched by Haloplex system, sequenced on a Miseq platform and analyzed in the 40 patients to evaluate the performance of the targeted-NGS method. We demonstrated that the full spectrum of genes associated with pneumothorax including FLCN gene mutations can be identified simultaneously in multiplexed sequence data. Noteworthy, by our in-house copy number analysis of the sequence data, we could not only detect intragenic deletions, but also determine approximate deletion junctions simultaneously. NGS based Haloplex target enrichment technology is proved to be a rapid and cost-effective screening strategy for the comprehensive molecular diagnosis of BHDS in PSP patients, as it can replace Sanger sequencing and MLPA by simultaneously detecting exonic and intronic SNVs, small indels, large intragenic deletions and determining deletion junctions in PSP-related genes.
Transposable element junctions in marker development and genomic characterization of barley
USDA-ARS?s Scientific Manuscript database
Barley is a model plant in genomic studies of Triticeae species. A complete barley genome sequence will facilitate not only barley breeding programs, but also those for related species. However, the large genome size and high repetitive sequence content complicate the barley genome assembly. The ma...
Vidjil: A Web Platform for Analysis of High-Throughput Repertoire Sequencing.
Duez, Marc; Giraud, Mathieu; Herbert, Ryan; Rocher, Tatiana; Salson, Mikaël; Thonier, Florian
2016-01-01
The B and T lymphocytes are white blood cells playing a key role in the adaptive immunity. A part of their DNA, called the V(D)J recombinations, is specific to each lymphocyte, and enables recognition of specific antigenes. Today, with new sequencing techniques, one can get billions of DNA sequences from these regions. With dedicated Repertoire Sequencing (RepSeq) methods, it is now possible to picture population of lymphocytes, and to monitor more accurately the immune response as well as pathologies such as leukemia. Vidjil is an open-source platform for the interactive analysis of high-throughput sequencing data from lymphocyte recombinations. It contains an algorithm gathering reads into clonotypes according to their V(D)J junctions, a web application made of a sample, experiment and patient database and a visualization for the analysis of clonotypes along the time. Vidjil is implemented in C++, Python and Javascript and licensed under the GPLv3 open-source license. Source code, binaries and a public web server are available at http://www.vidjil.org and at http://bioinfo.lille.inria.fr/vidjil. Using the Vidjil web application consists of four steps: 1. uploading a raw sequence file (typically a FASTQ); 2. running RepSeq analysis software; 3. visualizing the results; 4. annotating the results and saving them for future use. For the end-user, the Vidjil web application needs no specific installation and just requires a connection and a modern web browser. Vidjil is used by labs in hematology or immunology for research and clinical applications.
Vidjil: A Web Platform for Analysis of High-Throughput Repertoire Sequencing
Duez, Marc; Herbert, Ryan; Rocher, Tatiana; Salson, Mikaël; Thonier, Florian
2016-01-01
Background The B and T lymphocytes are white blood cells playing a key role in the adaptive immunity. A part of their DNA, called the V(D)J recombinations, is specific to each lymphocyte, and enables recognition of specific antigenes. Today, with new sequencing techniques, one can get billions of DNA sequences from these regions. With dedicated Repertoire Sequencing (RepSeq) methods, it is now possible to picture population of lymphocytes, and to monitor more accurately the immune response as well as pathologies such as leukemia. Methods and Results Vidjil is an open-source platform for the interactive analysis of high-throughput sequencing data from lymphocyte recombinations. It contains an algorithm gathering reads into clonotypes according to their V(D)J junctions, a web application made of a sample, experiment and patient database and a visualization for the analysis of clonotypes along the time. Vidjil is implemented in C++, Python and Javascript and licensed under the GPLv3 open-source license. Source code, binaries and a public web server are available at http://www.vidjil.org and at http://bioinfo.lille.inria.fr/vidjil. Using the Vidjil web application consists of four steps: 1. uploading a raw sequence file (typically a FASTQ); 2. running RepSeq analysis software; 3. visualizing the results; 4. annotating the results and saving them for future use. For the end-user, the Vidjil web application needs no specific installation and just requires a connection and a modern web browser. Vidjil is used by labs in hematology or immunology for research and clinical applications. PMID:27835690
2014-01-01
Background A rare neuro-ichthyotic disorder characterized by ichthyosis, spastic quadriplegia and intellectual disability and caused by recessive mutations in ELOVL4, encoding elongase-4 protein has recently been described. The objective of the study was to search for sequence variants in the gene ELOVL4 in three affected individuals of a consanguineous Pakistani family exhibiting features of neuro-ichthyotic disorder. Methods Linkage in the family was searched by genotyping microsatellite markers linked to the gene ELOVL4, mapped at chromosome 6p14.1. Exons and splice junction sites of the gene ELOVL4 were polymerase chain reaction amplified and sequenced in an automated DNA sequencer. Results DNA sequence analysis revealed a novel homozygous nonsense mutation (c.78C > G; p.Tyr26*). Conclusions Our report further confirms the recently described ELOVL4-related neuro-ichthyosis and shows that the neurological phenotype can be absent in some individuals. PMID:24571530
Structure and inhibition analysis of the mouse SAD-B C-terminal fragment.
Ma, Hui; Wu, Jing-Xiang; Wang, Jue; Wang, Zhi-Xin; Wu, Jia-Wei
2016-10-01
The SAD (synapses of amphids defective) kinases, including SAD-A and SAD-B, play important roles in the regulation of neuronal development, cell cycle, and energy metabolism. Our recent study of mouse SAD-A identified a unique autoinhibitory sequence (AIS), which binds at the junction of the kinase domain (KD) and the ubiquitin-associated (UBA) domain and exerts autoregulation in cooperation with UBA. Here, we report the crystal structure of the mouse SAD-B C-terminal fragment including the AIS and the kinase-associated domain 1 (KA1) at 2.8 Å resolution. The KA1 domain is structurally conserved, while the isolated AIS sequence is highly flexible and solvent-accessible. Our biochemical studies indicated that the SAD-B AIS exerts the same autoinhibitory role as that in SAD-A. We believe that the flexible isolated AIS sequence is readily available for interaction with KD-UBA and thus inhibits SAD-B activity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kerr, J.M.; Fisher, L.W.; Termine, J.D.
The authors have isolated and partially sequenced the human bone sialoprotein gene (IBSP). IBSP has been sublocalized by in situ hybridization to chromosome 4q38-q31 and is composed of six small exons (51 to 159 bp) and 1 large exon ([approximately]2.6 kb). The intron/exon junctions defined by sequence analysis are of class O, retaining an intact coding triplet. Sequence analysis of the 5[prime] upstream region revealed a TATAA (nucleotides -30 to-25 from the transcriptional start point) and a CCAAT (nucleotides -56 to-52) box, both in the reverse orientation. Intron 1 contains interesting structural elements composed of polypyrimidine repeats followed by amore » poly(AC)[sub n] tract. Both types of structural elements have been detected in promoter regions of other genes and have been implicated in transcriptional regulation. Several differences between the previously published cDNA sequence and the authors' sequence have been identified, most of which are contained within the untranslated exon 1. Three base revisions in the coding region include a G to T (Gly to Val, amino acid 195), T to C (Val to Ala, amino acid 268), and T to A (Glu to Asp, amino acid 270). In conclusion, the genomic organization and potential regulatory elements of human IBSP have been elucidated. 42 refs., 4 figs., 1 tab.« less
Chen, Neng; Tranebjærg, Lisbeth; Rendtorff, Nanna Dahl; Schrijver, Iris
2011-01-01
Pendred syndrome and DFNB4 (autosomal recessive nonsyndromic congenital deafness, locus 4) are associated with autosomal recessive congenital sensorineural hearing loss and mutations in the SLC26A4 gene. Extensive allelic heterogeneity, however, necessitates analysis of all exons and splice sites to identify mutations for individual patients. Although Sanger sequencing is the gold standard for mutation detection, screening methods supplemented with targeted sequencing can provide a cost-effective alternative. One such method, denaturing high-performance liquid chromatography, was developed for clinical mutation detection in SLC26A4. However, this method inherently cannot distinguish homozygous changes from wild-type sequences. High-resolution melting (HRM), on the other hand, can detect heterozygous and homozygous changes cost-effectively, without any post-PCR modifications. We developed a closed-tube HRM mutation detection method specific for SLC26A4 that can be used in the clinical diagnostic setting. Twenty-eight primer pairs were designed to cover all 21 SLC26A4 exons and splice junction sequences. Using the resulting amplicons, initial HRM analysis detected all 45 variants previously identified by sequencing. Subsequently, a 384-well plate format was designed for up to three patient samples per run. Blinded HRM testing on these plates of patient samples collected over 1 year in a clinical diagnostic laboratory accurately detected all variants identified by sequencing. In conclusion, HRM with targeted sequencing is a reliable, simple, and cost-effective method for SLC26A4 mutation screening and detection. PMID:21704276
Jiang, Lingxi; Yang, Litao; Rao, Jun; Guo, Jinchao; Wang, Shu; Liu, Jia; Lee, Seonghun; Zhang, Dabing
2010-02-01
To implement genetically modified organism (GMO) labeling regulations, an event-specific analysis method based on the junction sequence between exogenous integration and host genomic DNA has become the preferential approach for GMO identification and quantification. In this study, specific primers and TaqMan probes based on the revealed 5'-end junction sequence of GM cotton MON15985 were designed, and qualitative and quantitative polymerase chain reaction (PCR) assays were established employing the designed primers and probes. In the qualitative PCR assay, the limit of detection (LOD) was 0.5 g kg(-1) in 100 ng total cotton genomic DNA, corresponding to about 17 copies of haploid cotton genomic DNA, and the LOD and limit of quantification (LOQ) for quantitative PCR assay were 10 and 17 copies of haploid cotton genomic DNA, respectively. Furthermore, the developed quantitative PCR assays were validated in-house by five different researchers. Also, five practical samples with known GM contents were quantified using the developed PCR assay in in-house validation, and the bias between the true and quantification values ranged from 2.06% to 12.59%. This study shows that the developed qualitative and quantitative PCR methods are applicable for the identification and quantification of GM cotton MON15985 and its derivates.
Four photon parametric amplification. [in unbiased Josephson junction
NASA Technical Reports Server (NTRS)
Parrish, P. T.; Feldman, M. J.; Ohta, H.; Chiao, R. Y.
1974-01-01
An analysis is presented describing four-photon parametric amplification in an unbiased Josephson junction. Central to the theory is the model of the Josephson effect as a nonlinear inductance. Linear, small signal analysis is applied to the two-fluid model of the Josephson junction. The gain, gain-bandwidth product, high frequency limit, and effective noise temperature are calculated for a cavity reflection amplifier. The analysis is extended to multiple (series-connected) junctions and subharmonic pumping.
NASA Technical Reports Server (NTRS)
Mardesich, N.; Garcia, A.; Bunyan, S.; Pepe, A.
1979-01-01
The technological readiness of the proposed process sequence was reviewed. Process steps evaluated include: (1) plasma etching to establish a standard surface; (2) forming junctions by diffusion from an N-type polymeric spray-on source; (3) forming a p+ back contact by firing a screen printed aluminum paste; (4) forming screen printed front contacts after cleaning the back aluminum and removing the diffusion oxide; (5) cleaning the junction by a laser scribe operation; (6) forming an antireflection coating by baking a polymeric spray-on film; (7) ultrasonically tin padding the cells; and (8) assembling cell strings into solar circuits using ethylene vinyl acetate as an encapsulant and laminating medium.
Radiation comb generation with extended Josephson junctions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Solinas, P., E-mail: paolo.solinas@spin.cnr.it; Bosisio, R., E-mail: riccardo.bosisio@nano.cnr.it; NEST, Instituto Nanoscienze-CNR and Scuola Normale Superiore, I-56127 Pisa
2015-09-21
We propose the implementation of a Josephson radiation comb generator based on an extended Josephson junction subject to a time dependent magnetic field. The junction critical current shows known diffraction patterns and determines the position of the critical nodes when it vanishes. When the magnetic flux passes through one of such critical nodes, the superconducting phase must undergo a π-jump to minimize the Josephson energy. Correspondingly, a voltage pulse is generated at the extremes of the junction. Under periodic driving, this allows us to produce a comb-like voltage pulses sequence. In the frequency domain, it is possible to generate upmore » to hundreds of harmonics of the fundamental driving frequency, thus mimicking the frequency comb used in optics and metrology. We discuss several implementations through a rectangular, cylindrical, and annular junction geometries, allowing us to generate different radiation spectra and to produce an output power up to 10 pW at 50 GHz for a driving frequency of 100 MHz.« less
Hollenbeck, S Matt; Glattes, R Christopher; Asher, Marc A; Lai, Sue Min; Burton, Douglas C
2008-07-01
Retrospective case series. To determine the prevalence of proximal junctional sagittal plane flexion increase after posterior instrumentation and arthrodesis. Increased flexion proximal to the junction of the instrumented and fused spinal region with the adjacent mobile spine seems to be a relatively recent observation, may be increasing, and is occasionally problematic. The proximal junctional sagittal angulation 2 motion segments above the upper end instrumentation levels was measured on lateral standing preoperative and follow-up radiographs. One hundred seventy-four of 208 consecutive patients (84%) at an average radiograph follow-up of 4.9 +/- 2.73 years had increased proximal junctional flexion in 9.2%. The preoperative junctional measurements were normal for both normal and increased flexion groups. At follow-up, proximal junctional flexion had increased significantly more in the increased flexion group (2.1 degrees vs. 14.1 degrees , P < 0.0001). None of the possible risk factors studied, including demographic comparisons, Lenke classification (including lumbar and sagittal modifiers), end-instrumented vertebrae, end vertebra anchor configurations, surgical sequence, additional anterior surgery, rib osteotomies, and instrumentation length, were significantly associated with increased proximal junctional flexion at follow-up. Lenke 6 curves were at marginal risk of increased proximal junctional flexion (P = 0.0108). There were no differences between the groups in total Scoliosis Research Society-22r scores at an average follow-up of 8.0 +/- 3.74 years. No patient had additional surgery related to increased proximal junctional flexion. The prevalence of increased proximal junctional flexion was 9.2%. No significant risk factors were identified. Total Scoliosis Research Society-22r scores were similar for groups with normal and increased proximal junctional flexion at follow-up.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ruggles, Kelly V.; Tang, Zuojian; Wang, Xuya
Improvements in mass spectrometry (MS)-based peptide sequencing provide a new opportunity to determine whether polymorphisms, mutations and splice variants identified in cancer cells are translated. Herein we therefore describe a proteogenomic data integration tool (QUILTS) and illustrate its application to whole genome, transcriptome and global MS peptide sequence datasets generated from a pair of luminal and basal-like breast cancer patient derived xenografts (PDX). The sensitivity of proteogenomic analysis for singe nucleotide variant (SNV) expression and novel splice junction (NSJ) detection was probed using multiple MS/MS process replicates. Despite over thirty sample replicates, only about 10% of all SNV (somatic andmore » germline) were detected by both DNA and RNA sequencing were observed as peptides. An even smaller proportion of peptides corresponding to NSJ observed by RNA sequencing were detected (<0.1%). Peptides mapping to DNA-detected SNV without a detectable mRNA transcript were also observed demonstrating the transcriptome coverage was also incomplete (~80%). In contrast to germ-line variants, somatic variants were less likely to be detected at the peptide level in the basal-like tumor than the luminal tumor raising the possibility of differential translation or protein degradation effects. In conclusion, the QUILTS program integrates DNA, RNA and peptide sequencing to assess the degree to which somatic mutations are translated and therefore biologically active. By identifying gaps in sequence coverage QUILTS benchmarks current technology and assesses progress towards whole cancer proteome and transcriptome analysis.« less
Verma, Vandana; Larsen, Bjarne Due; Coombs, Wanda; Lin, Xianming; Sarrou, Eliana; Taffet, Steven M.; Delmar, Mario
2010-01-01
Background Gap junctions are potential targets for pharmacological intervention. We have previously developed a series of peptide sequences that prevent closure of Cx43 channels, bind to cardiac Cx43 and prevent acidification-induced uncoupling of cardiac gap junctions. Objective We aimed to identify and validate the minimum core active structure in peptides containing an RR-N/Q-Y motif. Based on that information, we sought to generate a peptidomimetic molecule that acts on the chemical regulation of Cx43 channels. Methods Experiments were based on a combination of biochemical, spectroscopic and electrophysiological techniques, as well as molecular modeling of active pharmacophores with Cx43 activity. Results Molecular modeling analysis indicated that the functional elements of the side chains in the motif RRXY form a triangular structure. Experimental data revealed that compounds containing such a structure bind to Cx43 and prevent Cx43 chemical gating. These results provided us with the first platform for drug design targeted to the carboxyl terminal of Cx43. Using that platform, we designed and validated a peptidomimetic compound (ZP2519; molecular weight 619 Da) that prevented octanol-induced uncoupling of Cx43 channels, and pH gating of cardiac gap junctions. Conclusion Structure-based drug design can be applied to the development of pharmacophores that act directly on Cx43. Small molecules containing these pharmacophores can serve as tools to determine the role of gap junction regulation in the control of cardiac rhythm. Future studies will determine whether these compounds can function as pharmacological agents for the treatment of a selected subset of cardiac arrhythmias. PMID:20601149
Felsenstein, K M; Goff, S P
1992-01-01
The gag-pol polyprotein of the murine and feline leukemia viruses is expressed by translational readthrough of a UAG terminator codon at the 3' end of the gag gene. To explore the cis-acting sequence requirements for the readthrough event in vivo, we generated a library of mutants of the Moloney murine leukemia virus with point mutations near the terminator codon and tested the mutant viral DNAs for the ability to direct synthesis of the gag-pol fusion protein and formation of infectious virus. The analysis showed that sequences 3' to the terminator are necessary and sufficient for the process. The results do not support a role for one proposed stem-loop structure that includes the terminator but are consistent with the involvement of another stem-loop 3' to the terminator. One mutant, containing two compensatory changes in this stem structure, was temperature sensitive for replication and for formation of the gag-pol protein. The results suggest that RNA sequence and structure are critical determinants of translational readthrough in vivo. Images PMID:1404606
Moreira, K G; Prates, M V; Andrade, F A C; Silva, L P; Beirão, P S L; Kushmerick, C; Naves, L A; Bloch, C
2010-08-01
Neurotoxicity is a major symptom of envenomation caused by Brazilian coral snake Micrurus frontalis. Due to the small amount of material that can be collected, no neurotoxin has been fully sequenced from this venom. In this work we report six new three-finger like toxins isolated from the venom of the coral snake M. frontalis which we named Frontoxin (FTx) I-VI. Toxins were purified using multiple steps of RP-HPLC. Molecular masses were determined by MALDI-TOF and ESI ion-trap mass spectrometry. The complete amino acid sequence of FTx II, III, IV and V were determined by sequencing of overlapping proteolytic fragments by Edman degradation and by de novo sequencing. The amino acid sequences of FTx I, II, III and VI predict 4 conserved disulphide bonds and structural similarity to previously reported short-chain alpha-neurotoxins. FTx IV and V each contained 10 conserved cysteines and share high similarity with long-chain alpha-neurotoxins. At the frog neuromuscular junction FTx II, III and IV reduced miniature endplate potential amplitudes in a time-and concentration-dependent manner suggesting Frontoxins block nicotinic acetylcholine receptors. Copyright 2010 Elsevier Ltd. All rights reserved.
Zhang, Yanju; Lameijer, Eric-Wubbo; 't Hoen, Peter A C; Ning, Zemin; Slagboom, P Eline; Ye, Kai
2012-02-15
RNA-seq is a powerful technology for the study of transcriptome profiles that uses deep-sequencing technologies. Moreover, it may be used for cellular phenotyping and help establishing the etiology of diseases characterized by abnormal splicing patterns. In RNA-Seq, the exact nature of splicing events is buried in the reads that span exon-exon boundaries. The accurate and efficient mapping of these reads to the reference genome is a major challenge. We developed PASSion, a pattern growth algorithm-based pipeline for splice site detection in paired-end RNA-Seq reads. Comparing the performance of PASSion to three existing RNA-Seq analysis pipelines, TopHat, MapSplice and HMMSplicer, revealed that PASSion is competitive with these packages. Moreover, the performance of PASSion is not affected by read length and coverage. It performs better than the other three approaches when detecting junctions in highly abundant transcripts. PASSion has the ability to detect junctions that do not have known splicing motifs, which cannot be found by the other tools. Of the two public RNA-Seq datasets, PASSion predicted ≈ 137,000 and 173,000 splicing events, of which on average 82 are known junctions annotated in the Ensembl transcript database and 18% are novel. In addition, our package can discover differential and shared splicing patterns among multiple samples. The code and utilities can be freely downloaded from https://trac.nbic.nl/passion and ftp://ftp.sanger.ac.uk/pub/zn1/passion.
Lackey, Daniel P; Carruth, Eric D; Lasher, Richard A; Boenisch, Jan; Sachse, Frank B; Hitchcock, Robert W
2011-11-01
Gap junctions play a fundamental role in intercellular communication in cardiac tissue. Various types of heart disease including hypertrophy and ischemia are associated with alterations of the spatial arrangement of gap junctions. Previous studies applied two-dimensional optical and electron-microscopy to visualize gap junction arrangements. In normal cardiomyocytes, gap junctions were primarily found at cell ends, but can be found also in more central regions. In this study, we extended these approaches toward three-dimensional reconstruction of gap junction distributions based on high-resolution scanning confocal microscopy and image processing. We developed methods for quantitative characterization of gap junction distributions based on analysis of intensity profiles along the principal axes of myocytes. The analyses characterized gap junction polarization at cell ends and higher-order statistical image moments of intensity profiles. The methodology was tested in rat ventricular myocardium. Our analysis yielded novel quantitative data on gap junction distributions. In particular, the analysis demonstrated that the distributions exhibit significant variability with respect to polarization, skewness, and kurtosis. We suggest that this methodology provides a quantitative alternative to current approaches based on visual inspection, with applications in particular in characterization of engineered and diseased myocardium. Furthermore, we propose that these data provide improved input for computational modeling of cardiac conduction.
2015-08-01
Sequence tags were mapped on the human reference genome using the Novoalign software. Only those tags... the linear islands to create a novel junctional sequence that does not exist in the genome . Thus the PE- sequence of a fragment that breaks at or...identified in cancer cell lines. (b) Median percent GC content of microDNAs and the genomic sequences up- or downstream of the source loci are
2016-04-01
Sequence tags were mapped on the human reference genome using the Novoalign software. Only those...ends of the linear islands to create a novel junctional sequence that does not exist in the genome . Thus the PE- sequence of a fragment that breaks at... genome (Fig. 3b). Those PE-tags where one tag maps uniquely to an island and the other remains unmapped, but passes the sequence quality filter,
A molecular model for illegitimate recombination in Bacillus subtilis.
Temeyer, K B; Hopkins, K M; Chapman, L F
1991-01-01
The recombinant DNA junctions at which pUB110 and Bacillus subtilis chromosomal DNA were joined to form the plasmid pKBT1 were cloned and sequenced. From the sequencing data we conclude that the pUB110 sequence is intact in the pair of cloned pKBT1 fragments and pTL12 sequences are not present. A molecular model for the formation of pKBT1 based on structural motifs characteristic of the joint sites is presented.
Phase 2 of the Array Automated Assembly Task for the Low Cost Solar Array Project
NASA Technical Reports Server (NTRS)
Campbell, R. B.; Rai-Choundhury, P.; Seman, E. J.; Rohatgi, A.; Davis, J. R.; Ostroski, J. W.; Stapleton, R. E.
1979-01-01
Two process specifications supplied by contractors were tested. The aluminum silk screening process resulted in cells comparable to those from sputtered Al. The electroless plating of contacts specification could be used only with extensive modification. Several experiments suggest that there is some degradation of the front junction during the Al back surface field (BSF) fabrication. A revised process sequence was defined which incorporates Al BSF formation. A cost analysis of this process yielded a selling price of $0.75/watt peak in 1980.
Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N
2016-02-03
We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.
TopHat: discovering splice junctions with RNA-Seq
Trapnell, Cole; Pachter, Lior; Salzberg, Steven L.
2009-01-01
Motivation: A new protocol for sequencing the messenger RNA in a cell, known as RNA-Seq, generates millions of short sequence fragments in a single run. These fragments, or ‘reads’, can be used to measure levels of gene expression and to identify novel splice variants of genes. However, current software for aligning RNA-Seq data to a genome relies on known splice junctions and cannot identify novel ones. TopHat is an efficient read-mapping algorithm designed to align reads from an RNA-Seq experiment to a reference genome without relying on known splice sites. Results: We mapped the RNA-Seq reads from a recent mammalian RNA-Seq experiment and recovered more than 72% of the splice junctions reported by the annotation-based software from that study, along with nearly 20 000 previously unreported junctions. The TopHat pipeline is much faster than previous systems, mapping nearly 2.2 million reads per CPU hour, which is sufficient to process an entire RNA-Seq experiment in less than a day on a standard desktop computer. We describe several challenges unique to ab initio splice site discovery from RNA-Seq reads that will require further algorithm development. Availability: TopHat is free, open-source software available from http://tophat.cbcb.umd.edu Contact: cole@cs.umd.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:19289445
Occludin confers adhesiveness when expressed in fibroblasts.
Van Itallie, C M; Anderson, J M
1997-05-01
Occludin is an integral membrane protein specifically associated with tight junctions. Previous studies suggest it is likely to function in forming the intercellular seal. In the present study, we expressed occludin under an inducible promotor in occludin-null fibroblasts to determine whether this protein confers intercellular adhesion. When human occludin is stably expressed in NRK and Rat-1 fibroblasts, which lack endogenous occludin and tight junctions but do have well developed ZO-1-containing adherens-like junctions, occludin colocalizes with ZO-1 to points of cell-cell contact. In contrast, L-cell fibroblasts which lack cadherin-based adherens junctions, target neither ZO-1 nor occludin to sites of cell contact. Occludin-induced adhesion was next quantified using a suspended cell assay. In NRK and Rat-1 cells, occludin expression induces adhesion in the absence of calcium, thus independent of cadherin-cadherin contacts. In contrast, L-cells are nonadhesive in this assay and show no increase in adhesion after induction of occludin expression. Binding of an antibody to the first of the putative extracellular loops of occludin confirmed that this sequence was exposed on the cell surface, and synthetic peptides containing the amino acid sequence of this loop inhibit adhesion induced by occludin expression. These results suggest that the extracellular surface of occludin is directly involved in cell-cell adhesion and the ability to confer adhesiveness correlates with the ability to colocalize with its cytoplasmic binding protein, ZO-1.
Jannovar: a java library for exome annotation.
Jäger, Marten; Wang, Kai; Bauer, Sebastian; Smedley, Damian; Krawitz, Peter; Robinson, Peter N
2014-05-01
Transcript-based annotation and pedigree analysis are two basic steps in the computational analysis of whole-exome sequencing experiments in genetic diagnostics and disease-gene discovery projects. Here, we present Jannovar, a stand-alone Java application as well as a Java library designed to be used in larger software frameworks for exome and genome analysis. Jannovar uses an interval tree to identify all transcripts affected by a given variant, and provides Human Genome Variation Society-compliant annotations both for variants affecting coding sequences and splice junctions as well as untranslated regions and noncoding RNA transcripts. Jannovar can also perform family-based pedigree analysis with Variant Call Format (VCF) files with data from members of a family segregating a Mendelian disorder. Using a desktop computer, Jannovar requires a few seconds to annotate a typical VCF file with exome data. Jannovar is freely available under the BSD2 license. Source code as well as the Java application and library file can be downloaded from http://compbio.charite.de (with tutorial) and https://github.com/charite/jannovar. © 2014 WILEY PERIODICALS, INC.
Event-specific real-time detection and quantification of genetically modified Roundup Ready soybean.
Huang, Chia-Chia; Pan, Tzu-Ming
2005-05-18
The event-specific real-time detection and quantification of Roundup Ready soybean (RRS) using an ABI PRISM 7700 sequence detection system with light upon extension (LUX) primer was developed in this study. The event-specific primers were designed, targeting the junction of the RRS 5' integration site and the endogenous gene lectin1. Then, a standard reference plasmid was constructed that carried both of the targeted sequences for quantitative analysis. The detection limit of the LUX real-time PCR system was 0.05 ng of 100% RRS genomic DNA, which was equal to 20.5 copies. The range of quantification was from 0.1 to 100%. The sensitivity and range of quantification successfully met the requirement of the labeling rules in the European Union and Taiwan.
2014-01-01
The myotendinous junction is a specialized structure of the muscle fibre enriched in mechanosensing complexes, including costameric proteins and core elements of the z-disc. Here, laser capture microdissection was applied to purify membrane regions from the myotendinous junctions of mouse skeletal muscles, which were then processed for proteomic analysis. Sarcolemma sections from the longitudinal axis of the muscle fibre were used as control for the specificity of the junctional preparation. Gene ontology term analysis of the combined lists indicated a statistically significant enrichment in membrane-associated proteins. The myotendinous junction preparation contained previously uncharacterized proteins, a number of z-disc costameric ligands (e.g., actinins, capZ, αB cristallin, filamin C, cypher, calsarcin, desmin, FHL1, telethonin, nebulin, titin and an enigma-like protein) and other proposed players of sarcomeric stretch sensing and signalling, such as myotilin and the three myomesin homologs. A subset were confirmed by immunofluorescence analysis as enriched at the myotendinous junction, suggesting that laser capture microdissection from muscle sections is a valid approach to identify novel myotendinous junction players potentially involved in mechanotransduction pathways. PMID:25071420
Dynamic Tunneling Junctions at the Atomic Intersection of Two Twisted Graphene Edges.
Bellunato, Amedeo; Vrbica, Sasha D; Sabater, Carlos; de Vos, Erik W; Fermin, Remko; Kanneworff, Kirsten N; Galli, Federica; van Ruitenbeek, Jan M; Schneider, Grégory F
2018-04-11
The investigation of the transport properties of single molecules by flowing tunneling currents across extremely narrow gaps is relevant for challenges as diverse as the development of molecular electronics and sequencing of DNA. The achievement of well-defined electrode architectures remains a technical challenge, especially due to the necessity of high precision fabrication processes and the chemical instability of most bulk metals. Here, we illustrate a continuously adjustable tunneling junction between the edges of two twisted graphene sheets. The unique property of the graphene electrodes is that the sheets are rigidly supported all the way to the atomic edge. By analyzing the tunneling current characteristics, we also demonstrate that the spacing across the gap junction can be controllably adjusted. Finally, we demonstrate the transition from the tunneling regime to contact and the formation of an atomic-sized junction between the two edges of graphene.
Hüser, Daniela; Weger, Stefan; Heilbronn, Regine
2003-01-01
Adeno-associated virus type 2 (AAV-2) establishes latency by site-specific integration into a unique locus on human chromosome 19, called AAVS1. During the development of a sensitive real-time PCR assay for site-specific integration, AAV-AAVS1 junctions were reproducibly detected in highly purified AAV wild-type and recombinant AAV vector stocks. A series of controls documented that the junctions were packaged in AAV capsids and were newly generated during a single round of AAV production. Cloned junctions displayed variable AAV sequences fused to AAVS1. These data suggest that packaged junctions represent footprints of AAV integration during productive infection. Apparently, AAV latency established by site-specific integration and the helper virus-dependent, productive AAV cycle are more closely related than previously thought. PMID:12663794
Dynamic Tunneling Junctions at the Atomic Intersection of Two Twisted Graphene Edges
2018-01-01
The investigation of the transport properties of single molecules by flowing tunneling currents across extremely narrow gaps is relevant for challenges as diverse as the development of molecular electronics and sequencing of DNA. The achievement of well-defined electrode architectures remains a technical challenge, especially due to the necessity of high precision fabrication processes and the chemical instability of most bulk metals. Here, we illustrate a continuously adjustable tunneling junction between the edges of two twisted graphene sheets. The unique property of the graphene electrodes is that the sheets are rigidly supported all the way to the atomic edge. By analyzing the tunneling current characteristics, we also demonstrate that the spacing across the gap junction can be controllably adjusted. Finally, we demonstrate the transition from the tunneling regime to contact and the formation of an atomic-sized junction between the two edges of graphene. PMID:29513997
Gap junctions in cells of the immune system: structure, regulation and possible functional roles.
Sáez, J C; Brañes, M C; Corvalán, L A; Eugenín, E A; González, H; Martínez, A D; Palisson, F
2000-04-01
Gap junction channels are sites of cytoplasmic communication between contacting cells. In vertebrates, they consist of protein subunits denoted connexins (Cxs) which are encoded by a gene family. According to their Cx composition, gap junction channels show different gating and permeability properties that define which ions and small molecules permeate them. Differences in Cx primary sequences suggest that channels composed of different Cxs are regulated differentially by intracellular pathways under specific physiological conditions. Functional roles of gap junction channels could be defined by the relative importance of permeant substances, resulting in coordination of electrical and/or metabolic cellular responses. Cells of the native and specific immune systems establish transient homo- and heterocellular contacts at various steps of the immune response. Morphological and functional studies reported during the last three decades have revealed that many intercellular contacts between cells in the immune response present gap junctions or "gap junction-like" structures. Partial characterization of the molecular composition of some of these plasma membrane structures and regulatory mechanisms that control them have been published recently. Studies designed to elucidate their physiological roles suggest that they might permit coordination of cellular events which favor the effective and timely response of the immune system.
Epidemiology and Genetic Characterization of Hepatitis A Virus Genotype IIA▿
Desbois, Delphine; Couturier, Elisabeth; Mackiewicz, Vincent; Graube, Arielle; Letort, Marie-José; Dussaix, Elisabeth; Roque-Afonso, Anne-Marie
2010-01-01
Three hepatitis A virus (HAV) genotypes, I, II, and III, divided into subtypes A and B, infect humans. Genotype I is the most frequently reported, while genotype II is hardly ever isolated, and its genetic diversity is unknown. From 2002 to 2007, a French epidemiological survey of HAV identified 6 IIA isolates, mostly from patients who did not travel abroad. The possible African origin of IIA strains was investigated by screening the 2008 mandatory notification records of HAV infection: 171 HAV strains from travelers to West Africa and Morocco were identified. Genotyping was performed by sequencing of the VP1/2A junction in 68 available sera. Entire P1 and 5′ untranslated regions of IIA strains were compared to reference sequences of other genotypes. The screening retrieved 5 imported IIA isolates. An additional autochthonous case and 2 more African cases were identified in 2008 and 2009, respectively. A total of 14 IIA isolates (8 African and 6 autochthonous) were analyzed. IIA sequences presented lower nucleotide and amino acid variability than other genotypes. The highest variability was observed in the N-terminal region of VP1, while for other genotypes the highest variability was observed at the VP1/2A junction. Phylogenetic analysis identified 2 clusters, one gathering all African and two autochthonous cases and a second including only autochthonous isolates. In conclusion, most IIA strains isolated in France are imported by travelers returning from West Africa. However, the unexplained contamination mode of autochthonous cases suggests another, still to be discovered geographical origin or a French reservoir to be explored. PMID:20592136
Retroviral DNA Integration Directed by HIV Integration Protein in Vitro
NASA Astrophysics Data System (ADS)
Bushman, Frederic D.; Fujiwara, Tamio; Craigie, Robert
1990-09-01
Efficient retroviral growth requires integration of a DNA copy of the viral RNA genome into a chromosome of the host. As a first step in analyzing the mechanism of integration of human immunodeficiency virus (HIV) DNA, a cell-free system was established that models the integration reaction. The in vitro system depends on the HIV integration (IN) protein, which was partially purified from insect cells engineered to express IN protein in large quantities. Integration was detected in a biological assay that scores the insertion of a linear DNA containing HIV terminal sequences into a λ DNA target. Some integration products generated in this assay contained five-base pair duplications of the target DNA at the recombination junctions, a characteristic of HIV integration in vivo; the remaining products contained aberrant junctional sequences that may have been produced in a variation of the normal reaction. These results indicate that HIV IN protein is the only viral protein required to insert model HIV DNA sequences into a target DNA in vitro.
2011-01-01
Background Many plants have large and complex genomes with an abundance of repeated sequences. Many plants are also polyploid. Both of these attributes typify the genome architecture in the tribe Triticeae, whose members include economically important wheat, rye and barley. Large genome sizes, an abundance of repeated sequences, and polyploidy present challenges to genome-wide SNP discovery using next-generation sequencing (NGS) of total genomic DNA by making alignment and clustering of short reads generated by the NGS platforms difficult, particularly in the absence of a reference genome sequence. Results An annotation-based, genome-wide SNP discovery pipeline is reported using NGS data for large and complex genomes without a reference genome sequence. Roche 454 shotgun reads with low genome coverage of one genotype are annotated in order to distinguish single-copy sequences and repeat junctions from repetitive sequences and sequences shared by paralogous genes. Multiple genome equivalents of shotgun reads of another genotype generated with SOLiD or Solexa are then mapped to the annotated Roche 454 reads to identify putative SNPs. A pipeline program package, AGSNP, was developed and used for genome-wide SNP discovery in Aegilops tauschii-the diploid source of the wheat D genome, and with a genome size of 4.02 Gb, of which 90% is repetitive sequences. Genomic DNA of Ae. tauschii accession AL8/78 was sequenced with the Roche 454 NGS platform. Genomic DNA and cDNA of Ae. tauschii accession AS75 was sequenced primarily with SOLiD, although some Solexa and Roche 454 genomic sequences were also generated. A total of 195,631 putative SNPs were discovered in gene sequences, 155,580 putative SNPs were discovered in uncharacterized single-copy regions, and another 145,907 putative SNPs were discovered in repeat junctions. These SNPs were dispersed across the entire Ae. tauschii genome. To assess the false positive SNP discovery rate, DNA containing putative SNPs was amplified by PCR from AL8/78 and AS75 and resequenced with the ABI 3730 xl. In a sample of 302 randomly selected putative SNPs, 84.0% in gene regions, 88.0% in repeat junctions, and 81.3% in uncharacterized regions were validated. Conclusion An annotation-based genome-wide SNP discovery pipeline for NGS platforms was developed. The pipeline is suitable for SNP discovery in genomic libraries of complex genomes and does not require a reference genome sequence. The pipeline is applicable to all current NGS platforms, provided that at least one such platform generates relatively long reads. The pipeline package, AGSNP, and the discovered 497,118 Ae. tauschii SNPs can be accessed at (http://avena.pw.usda.gov/wheatD/agsnp.shtml). PMID:21266061
Zhou, Jing; Chen, Chin Ho; Aiken, Christopher
2004-06-29
Despite the effectiveness of currently available antiretroviral therapies in the treatment of HIV-1 infection, a continuing need exists for novel compounds that can be used in combination with existing drugs to slow the emergence of drug-resistant viruses. We previously reported that the small molecule 3-O-{3',3'-dimethylsuccinyl}-betulinic acid (DSB) specifically inhibits HIV-1 replication by delaying the processing of the CA-SP1 junction in Pr55Gag. By contrast, SIVmac239 replicates efficiently in the presence of high concentrations of DSB. To determine whether sequence differences in the CA-SP1 junction can fully account for the differential sensitivity of HIV-1 and SIV to DSB, we engineered mutations in this region of two viruses and tested their sensitivity to DSB in replication assays using activated human primary CD4+ T cells. Substitution of the P2 and P1 residues of HIV-1 by the corresponding amino acids of SIV resulted in strong resistance to DSB, but the mutant virus replicated with reduced efficiency. Conversely, replication of an SIV mutant containing three amino acid substitutions in the CA-SP1 cleavage site was highly sensitive to DSB, and the mutations resulted in delayed cleavage of the CA-SP1 junction in the presence of the drug. These results demonstrate that the CA-SP1 junction in Pr55Gag represents the primary viral target of DSB. They further suggest that the therapeutic application of DSB will be accompanied by emergence of mutant viruses that are highly resistant to the drug but which exhibit reduced fitness relative to wild type HIV-1.
Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang
2016-01-01
Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032
Wei, Yunzhou; Chesne, Megan T.; Terns, Rebecca M.; Terns, Michael P.
2015-01-01
CRISPR-Cas systems are RNA-based immune systems that protect prokaryotes from invaders such as phages and plasmids. In adaptation, the initial phase of the immune response, short foreign DNA fragments are captured and integrated into host CRISPR loci to provide heritable defense against encountered foreign nucleic acids. Each CRISPR contains a ∼100–500 bp leader element that typically includes a transcription promoter, followed by an array of captured ∼35 bp sequences (spacers) sandwiched between copies of an identical ∼35 bp direct repeat sequence. New spacers are added immediately downstream of the leader. Here, we have analyzed adaptation to phage infection in Streptococcus thermophilus at the CRISPR1 locus to identify cis-acting elements essential for the process. We show that the leader and a single repeat of the CRISPR locus are sufficient for adaptation in this system. Moreover, we identified a leader sequence element capable of stimulating adaptation at a dormant repeat. We found that sequences within 10 bp of the site of integration, in both the leader and repeat of the CRISPR, are required for the process. Our results indicate that information at the CRISPR leader-repeat junction is critical for adaptation in this Type II-A system and likely other CRISPR-Cas systems. PMID:25589547
Contour junctions defined by dynamic image deformations enhance perceptual transparency.
Kawabe, Takahiro; Nishida, Shin'ya
2017-11-01
The majority of work on the perception of transparency has focused on static images with luminance-defined contour junctions, but recent work has shown that dynamic image sequences with dynamic image deformations also provide information about transparency. The present study demonstrates that when part of a static image is dynamically deformed, contour junctions at which deforming and nondeforming contours are connected facilitate the deformation-based perception of a transparent layer. We found that the impression of a transparent layer was stronger when a dynamically deforming area was adjacent to static nondeforming areas than when presented alone. When contour junctions were not formed at the dynamic-static boundaries, however, the impression of a transparent layer was not facilitated by the presence of static surrounding areas. The effect of the deformation-defined junctions was attenuated when the spatial pattern of luminance contrast at the junctions was inconsistent with the perceived transparency related to luminance contrast, while the effect did not change when the spatial luminance pattern was consistent with it. In addition, the results showed that contour completions across the junctions were required for the perception of a transparent layer. These results indicate that deformation-defined junctions that involve contour completion between deforming and nondeforming regions enhance the perception of a transparent layer, and that the deformation-based perceptual transparency can be promoted by the simultaneous presence of appropriately configured luminance and contrast-other features that can also by themselves produce the sensation of perceiving transparency.
Gandhi, Manish J; Pendergrass, Thomas W; Cummings, Carrie C; Ihara, Kenji; Blau, C Anthony; Drachman, Jonathan G
2005-10-01
An 11-year-old girl, presenting with fatigue and bruising, was found to be profoundly pancytopenic. Bone marrow exam and clinical evaluation were consistent with aplastic anemia. Family members were studied as potential stem cell donors, revealing that both younger siblings displayed significant thrombocytopenia, whereas both parents had normal blood counts. We evaluated this pedigree to understand the unusually late presentation of congenital amegakaryocytic thrombocytopenia (CAMT). The coding region and the intron/exon junctions of MPL were sequenced from each family member. Vectors representing each of the mutations were constructed and tested for the ability to support growth of Baf3/Mpl(mutant) cells. All three siblings had elevated thrombopoietin levels. Analysis of genomic DNA demonstrated that each parent had mutations/polymorphisms in a single MPL allele and that each child was a compound heterozygote, having inherited both abnormal alleles. The maternal allele encoded a mutation of the donor splice-junction at the exon-3/intron-3 boundary. A mini-gene construct encoding normal vs mutant versions of the intron-3 donor-site demonstrated that physiologic splicing was significantly reduced in the mutant construct. Mutations that incompletely eliminate Mpl expression/function may result in delayed diagnosis of CAMT and confusion with aplastic anemia.
The complete genome sequence of the Atlantic salmon paramyxovirus (ASPV)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nylund, Stian; Karlsen, Marius; Nylund, Are
2008-03-30
The complete RNA genome of the Atlantic salmon paramyxovirus (ASPV), isolated from Atlantic salmon suffering from proliferative gill inflammation (PGI), has been determined. The genome is 16,965 nucleotides in length and consists of six nonoverlapping genes in the order 3'- N - P/C/V - M - F - HN - L -5', coding for the nucleocapsid, phospho-, matrix, fusion, hemagglutinin-neuraminidase and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and trinucleotide intergenic regions similar to those of other Paramyxoviridae. The ASPV P-gene expression strategy is like that of the respiro- and morbilliviruses,more » which express the phosphoprotein from the primary transcript, and edit a portion of the mRNA to encode the accessory proteins V and W. It also encodes the C-protein by ribosomal choice of translation initiation. Pairwise comparisons of amino acid identities, and phylogenetic analysis of deduced ASPV protein sequences with homologous sequences from other Paramyxoviridae, show that ASPV has an affinity for the genus Respirovirus, but may represent a new genus within the subfamily Paramyxovirinae.« less
Richards, Stephen; Liu, Yue; Bettencourt, Brian R.; Hradecky, Pavel; Letovsky, Stan; Nielsen, Rasmus; Thornton, Kevin; Hubisz, Melissa J.; Chen, Rui; Meisel, Richard P.; Couronne, Olivier; Hua, Sujun; Smith, Mark A.; Zhang, Peili; Liu, Jing; Bussemaker, Harmen J.; van Batenburg, Marinus F.; Howells, Sally L.; Scherer, Steven E.; Sodergren, Erica; Matthews, Beverly B.; Crosby, Madeline A.; Schroeder, Andrew J.; Ortiz-Barrientos, Daniel; Rives, Catharine M.; Metzker, Michael L.; Muzny, Donna M.; Scott, Graham; Steffen, David; Wheeler, David A.; Worley, Kim C.; Havlak, Paul; Durbin, K. James; Egan, Amy; Gill, Rachel; Hume, Jennifer; Morgan, Margaret B.; Miner, George; Hamilton, Cerissa; Huang, Yanmei; Waldron, Lenée; Verduzco, Daniel; Clerc-Blankenburg, Kerstin P.; Dubchak, Inna; Noor, Mohamed A.F.; Anderson, Wyatt; White, Kevin P.; Clark, Andrew G.; Schaeffer, Stephen W.; Gelbart, William; Weinstock, George M.; Gibbs, Richard A.
2005-01-01
We have sequenced the genome of a second Drosophila species, Drosophila pseudoobscura, and compared this to the genome sequence of Drosophila melanogaster, a primary model organism. Throughout evolution the vast majority of Drosophila genes have remained on the same chromosome arm, but within each arm gene order has been extensively reshuffled, leading to a minimum of 921 syntenic blocks shared between the species. A repetitive sequence is found in the D. pseudoobscura genome at many junctions between adjacent syntenic blocks. Analysis of this novel repetitive element family suggests that recombination between offset elements may have given rise to many paracentric inversions, thereby contributing to the shuffling of gene order in the D. pseudoobscura lineage. Based on sequence similarity and synteny, 10,516 putative orthologs have been identified as a core gene set conserved over 25–55 million years (Myr) since the pseudoobscura/melanogaster divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome-wide average, consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than random and nearby sequences between the species—but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a pattern of repeat-mediated chromosomal rearrangement, and high coadaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence between these species of Drosophila. PMID:15632085
Statistical evidence of strain induced breaking of metallic point contacts
NASA Astrophysics Data System (ADS)
Alwan, Monzer; Candoni, Nadine; Dumas, Philippe; Klein, Hubert R.
2013-06-01
A scanning tunneling microscopy in break junction regime and a mechanically controllable break junction are used to acquire thousands of conductance-elongation curves by stretching until breaking and re-connecting Au junctions. From a robust statistical analysis performed on large sets of experiments, parameters such as lifetime, elongation and occurrence probabilities are extracted. The analysis of results obtained for different stretching speeds of the electrodes indicates that the breaking mechanism of di- and mono-atomic junction is identical, and that the junctions undergo atomic rearrangement during their stretching and at the moment of breaking.
Initiation and Along-Axis Segmentation of Seaward-Dipping Volcanic Sequences Captured in Afar
NASA Astrophysics Data System (ADS)
Ebinger, C.; Wolfenden, E.; Yirgu, G.; Keir, D.
2003-12-01
The Afar triple junction zone provides a unique opportunity to examine the early development of magmatic margins, as respective limbs of the triple junction capture different stages of the breakup process. Initial rifting in the southernmost Red Sea occurred concurrent with, or soon after flood basaltic magmatism at ~31 Ma in the Ethiopia-Yemen plume province, whereas the northern part of the Main Ethiopian rift initiated after 12 Ma. Both rift systems initiated with the development of high-angle border fault systems bounding broad basins, but 8-10 My after rifting we see riftward migration of strain from the western border fault to narrow zones of increasingly more basaltic magmatism. These localised zones of faulting and volcanism (magmatic segments) show a segmentation independent of the border fault segmentation. The much older, more evolved magmatic segments in the southern Red Sea, where not onlapped by Pliocene-Recent sedimentary strata, dip steeply riftward and define a regional eastward flexure into transitional oceanic crust, as indicated by gravity models constrained by seismic refraction and receiver function data. The southern Red Sea magmatic segments have been abandoned in Pliocene-Recent triple junction reorganisations, whereas the process of seaward-dipping volcanic sequence emplacement is ongoing in the seismically and volcanically active Main Ethiopian rift. Field, remote sensing, gravity, and seismicity data from the Main Ethiopian and southern Red Sea rifts indicate that seaward-dipping volcanic sequences initiate in moderately stretched continental crust above a narrow zone of dike-intrusion. Our comparison of active and ancient magmatic segments show that they are the precursors to seaward-dipping volcanic sequences analogous to those seen on passive continental margins, and provides insights into the initiation of along-axis segmentation of seafloor-spreading centers.
Mustoe, Anthony M.; Bailor, Maximillian H.; Teixeira, Robert M.; Brooks, Charles L.; Al-Hashimi, Hashim M.
2012-01-01
Recent studies have shown that topological constraints encoded at the RNA secondary structure level involving basic steric and stereochemical forces can significantly restrict the orientations sampled by helices across two-way RNA junctions. Here, we formulate these topological constraints in greater quantitative detail and use this topological framework to rationalize long-standing but poorly understood observations regarding the basic behavior of RNA two-way junctions. Notably, we show that the asymmetric nature of the A-form helix and the finite length of a bulge provide a physical basis for the experimentally observed directionality and bulge-length amplitude dependence of bulge induced inter-helical bends. We also find that the topologically allowed space can be modulated by variations in sequence, particularly with the addition of non-canonical GU base pairs at the junction, and, surprisingly, by the length of the 5′ and 3′ helices. A survey of two-way RNA junctions in the protein data bank confirms that junction residues have a strong preference to adopt looped-in, non-canonically base-paired conformations, providing a route for extending our bulge-directed framework to internal loop motifs and implying a simplified link between secondary and tertiary structure. Finally, our results uncover a new simple mechanism for coupling junction-induced topological constraints with tertiary interactions. PMID:21937512
1992-01-01
To investigate the structural and genetic basis of the T cell response to defined peptide/major histocompatibility (MHC) class II complexes in humans, we established a large panel of T cell clones (61) from donors of different HLA-DR haplotypes and reactive with a tetanus toxin- derived peptide (tt830-844) recognized in association with most DR molecules (universal peptide). By using a bacterial enterotoxin-based proliferation assay and cDNA sequencing, we found preferential use of a particular V beta region gene segment, V beta 2.1, in three of the individuals studied (64%, n = 58), irrespective of whether the peptide was presented by the DR6wcI, DR4w4, or DRw11.1 and DRw11.2 alleles, demonstrating that shared MHC class II antigens are not required for shared V beta gene use by T cell receptors (TCRs) specific for this peptide. V alpha gene use was more heterogeneous, with at least seven different V alpha segments derived from five distinct families encoding alpha chains able to pair with V beta 2.1 chains to form a tt830-844/DR- specific binding site. Several cases were found of clones restricted to different DR alleles that expressed identical V beta and (or very closely related) V alpha gene segments and that differed only in their junctional sequences. Thus, changes in the putative complementary determining region 3 (CDR3) of the TCR may, in certain cases, alter MHC specificity and maintain peptide reactivity. Finally, in contrast to what has been observed in other defined peptide/MHC systems, a striking heterogeneity was found in the junctional regions of both alpha and beta chains, even for TCRs with identical V alpha and/or V beta gene segments and the same restriction. Among 14 anti-tt830-844 clones using the V beta 2.1 gene segment, 14 unique V beta-D-J beta junctions were found, with no evident conservation in length and/or amino acid composition. One interpretation for this apparent lack of coselection of specific junctional sequences in the context of a common V element, V beta 2.1, is that this V region plays a dominant role in the recognition of the tt830-844/DR complex. PMID:1371303
Shukla, Sanjay K; Kislow, Jennifer; Briska, Adam; Henkhaus, John; Dykes, Colin
2009-09-01
Staphylococcus aureus is a highly versatile and evolving bacterium of great clinical importance. S. aureus can evolve by acquiring single nucleotide polymorphisms and mobile genetic elements and by recombination events. Identification and location of novel genomic elements in a bacterial genome are not straightforward, unless the whole genome is sequenced. Optical mapping is a new tool that creates a high-resolution, in situ ordered restriction map of a bacterial genome. These maps can be used to determine genomic organization and perform comparative genomics to identify genomic rearrangements, such as insertions, deletions, duplications, and inversions, compared to an in silico (virtual) restriction map of a known genome sequence. Using this technology, we report here the identification, approximate location, and characterization of a genetic inversion of approximately 500 kb of a DNA element between the NRS387 (USA800) and FPR3757 (USA300) strains. The presence of the inversion and location of its junction sites were confirmed by site-specific PCR and sequencing. At both the left and right junction sites in NRS387, an IS1181 element and a 73-bp sequence were identified as inverted repeats, which could explain the possible mechanism of the inversion event.
Interchromosomal recombination in Zea mays.
Hu, W; Timmermans, M C; Messing, J
1998-01-01
A new allele of the 27-kD zein locus in maize has been generated by interchromosomal recombination between chromosomes of two different inbred lines. A continuous patch of at least 11,817 bp of inbred W64A, containing the previously characterized Ra allele of the 27-kD zein gene, has been inserted into the genome of A188 by a single crossover. While both junction sequences are conserved, sequences of the two homologs between these junctions differ considerably. W64A contains the 7313-bp-long retrotransposon, Zeon-1. A188 contains a second copy of the 27-kD zein gene and a 2-kb repetitive element. Therefore, recombination results in a 7.3-kb insertion and a 14-kb deletion compared to the original S+A188 allele. If nonpairing sequences are looped out, 206 single base changes, frequently clustered, are present. The structure of this allele may explain how a recently discovered example of somatic recombination occurred in an A188/W64A hybrid. This would indicate that despite these sequence differences, pairing between these alleles could occur early during plant development. Therefore, such a somatically derived chimeric chromosome can also be heritable and give rise to new alleles. PMID:9799274
Murata, M; Uchida, T; Yang, Y; Lezhava, A; Kinashi, H
2011-04-01
We have comprehensively analyzed the linear chromosomes of Streptomyces griseus mutants constructed and kept in our laboratory. During this study, macrorestriction analysis of AseI and DraI fragments of mutant 402-2 suggested a large chromosomal inversion. The junctions of chromosomal inversion were cloned and sequenced and compared with the corresponding target sequences in the parent strain 2247. Consequently, a transposon-involved mechanism was revealed. Namely, a transposon originally located at the left target site was replicatively transposed to the right target site in an inverted direction, which generated a second copy and at the same time caused a 2.5-Mb chromosomal inversion. The involved transposon named TnSGR was grouped into a new subfamily of the resolvase-encoding Tn3 family transposons based on its gene organization. At the end, terminal diversity of S. griseus chromosomes is discussed by comparing the sequences of strains 2247 and IFO13350.
Single Molecule Spectroscopy of Amino Acids and Peptides by Recognition Tunneling
Zhao, Yanan; Ashcroft, Brian; Zhang, Peiming; Liu, Hao; Sen, Suman; Song, Weisi; Im, JongOne; Gyarfas, Brett; Manna, Saikat; Biswas, Sovan; Borges, Chad; Lindsay, Stuart
2014-01-01
The human proteome has millions of protein variants due to alternative RNA splicing and post-translational modifications, and variants that are related to diseases are frequently present in minute concentrations. For DNA and RNA, low concentrations can be amplified using the polymerase chain reaction, but there is no such reaction for proteins. Therefore, the development of single molecule protein sequencing is a critical step in the search for protein biomarkers. Here we show that single amino acids can be identified by trapping the molecules between two electrodes that are coated with a layer of recognition molecules and measuring the electron tunneling current across the junction. A given molecule can bind in more than one way in the junction, and we therefore use a machine-learning algorithm to distinguish between the sets of electronic ‘fingerprints’ associated with each binding motif. With this recognition tunneling technique, we are able to identify D, L enantiomers, a methylated amino acid, isobaric isomers, and short peptides. The results suggest that direct electronic sequencing of single proteins could be possible by sequentially measuring the products of processive exopeptidase digestion, or by using a molecular motor to pull proteins through a tunnel junction integrated with a nanopore. PMID:24705512
Oviedo‐orta, E; Hoy, T; Evans, W H
2000-01-01
The distribution and function of connexins (integral membrane proteins assembled into gap junction intercellular communication channels) were studied in human lymphocyte subpopulations. The expression of mRNA encoding connexins in peripheral blood and tonsil‐derived T, B and natural killer (NK) lymphocytes was examined. Connexin43 (Cx43) mRNA was expressed in peripheral blood and tonsil lymphocytes, but Cx40 mRNA expression was confined to tonsil‐derived T and B lymphocytes; Cx26, Cx32, Cx37 and Cx45 were not detected by reverse transcription–polymerase chain reaction (RT–PCR). Western blot analysis also demonstrated the presence of Cx40 and Cx43 proteins in T and B lymphocytes in a manner coincidental to the mRNA detection. Stimulation in vitro of T and B lymphocytes with phytohaemagglutinin (PHA) and lipopolysaccharide (LPS), respectively, increased Cx40 and Cx43 protein expression. Flow cytometric analysis, using antibodies to extracellular loop amino acid sequences of connexins, confirmed the surface expression of connexins in all lymphocyte subpopulations. Assembly of connexins into gap junctions providing direct intercellular channels linking attached lymphocytes was demonstrated by using a dye transfer technique. The exchange of dye between lymphocytes was inhibited by a connexin extracellular loop mimetic peptide and α‐glycyrrhetinic acid, two reagents that restrict intercellular communication across gap junctions. Dye coupling occurred between homologous and heterologous co‐cultures of T and B lymphocytes, and was not influenced by their stimulation with PHA and LPS. The connexin mimetic peptide caused a significant decrease in the in vitro synthesis of immunoglobulin M (IgM) by T‐ and B‐lymphocyte co‐cultured populations in the presence or absence of stimulation by PHA. The results identify connexins as important cell surface components that modulate immune processes. PMID:10792506
Suárez-Vega, Aroa; Gutiérrez-Gil, Beatriz; Benavides, Julio; Perez, Valentín; Tosser-Klopp, Gwenola; Klopp, Christophe; Keennel, Stephen J.; Arranz, Juan José
2015-01-01
In this study, we demonstrate the use of a genome-wide association mapping together with RNA-seq in a reduced number of samples, as an efficient approach to detect the causal mutation for a Mendelian disease. Junctional epidermolysis bullosa is a recessive genodermatosis that manifests with neonatal mechanical fragility of the skin, blistering confined to the lamina lucida of the basement membrane and severe alteration of the hemidesmosomal junctions. In Spanish Churra sheep, junctional epidermolysis bullosa (JEB) has been detected in two commercial flocks. The JEB locus was mapped to Ovis aries chromosome 11 by GWAS and subsequently fine-mapped to an 868-kb homozygous segment using the identical-by-descent method. The ITGB4, which is located within this region, was identified as the best positional and functional candidate gene. The RNA-seq variant analysis enabled us to discover a 4-bp deletion within exon 33 of the ITGB4 gene (c.4412_4415del). The c.4412_4415del mutation causes a frameshift resulting in a premature stop codon at position 1472 of the integrin β4 protein. A functional analysis of this deletion revealed decreased levels of mRNA in JEB skin samples and the absence of integrin β4 labeling in immunohistochemical assays. Genotyping of c.4412_4415del showed perfect concordance with the recessive mode of the disease phenotype. Selection against this causal mutation will now be used to solve the problem of JEB in flocks of Churra sheep. Furthermore, the identification of the ITGB4 mutation means that affected sheep can be used as a large mammal animal model for the human form of epidermolysis bullosa with aplasia cutis. Our approach evidences that RNA-seq offers cost-effective alternative to identify variants in the species in which high resolution exome-sequencing is not straightforward. PMID:25955497
Suárez-Vega, Aroa; Gutiérrez-Gil, Beatriz; Benavides, Julio; Perez, Valentín; Tosser-Klopp, Gwenola; Klopp, Christophe; Keennel, Stephen J; Arranz, Juan José
2015-01-01
In this study, we demonstrate the use of a genome-wide association mapping together with RNA-seq in a reduced number of samples, as an efficient approach to detect the causal mutation for a Mendelian disease. Junctional epidermolysis bullosa is a recessive genodermatosis that manifests with neonatal mechanical fragility of the skin, blistering confined to the lamina lucida of the basement membrane and severe alteration of the hemidesmosomal junctions. In Spanish Churra sheep, junctional epidermolysis bullosa (JEB) has been detected in two commercial flocks. The JEB locus was mapped to Ovis aries chromosome 11 by GWAS and subsequently fine-mapped to an 868-kb homozygous segment using the identical-by-descent method. The ITGB4, which is located within this region, was identified as the best positional and functional candidate gene. The RNA-seq variant analysis enabled us to discover a 4-bp deletion within exon 33 of the ITGB4 gene (c.4412_4415del). The c.4412_4415del mutation causes a frameshift resulting in a premature stop codon at position 1472 of the integrin β4 protein. A functional analysis of this deletion revealed decreased levels of mRNA in JEB skin samples and the absence of integrin β4 labeling in immunohistochemical assays. Genotyping of c.4412_4415del showed perfect concordance with the recessive mode of the disease phenotype. Selection against this causal mutation will now be used to solve the problem of JEB in flocks of Churra sheep. Furthermore, the identification of the ITGB4 mutation means that affected sheep can be used as a large mammal animal model for the human form of epidermolysis bullosa with aplasia cutis. Our approach evidences that RNA-seq offers cost-effective alternative to identify variants in the species in which high resolution exome-sequencing is not straightforward.
Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.
2016-01-01
Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621
Li, Wei; Jiang, Wei; Wang, Lei
2016-10-12
In this work, a novel self-locked aptamer probe mediated cascade amplification strategy has been constructed for highly sensitive and specific detection of protein. First, the self-locked aptamer probe was designed with three functions: one was specific molecular recognition attributed to the aptamer sequence, the second was signal transduction owing to the transduction sequence, and the third was self-locking through the hybridization of the transduction sequence and part of the aptamer sequence. Then, the aptamer sequence specific recognized the target and folded into a three-way helix junction, leading to the release of the transduction sequence. Next, the 3'-end of this three-way junction acted as primer to trigger the strand displacement amplification (SDA), yielding a large amount of primers. Finally, the primers initiated the dual-exponential rolling circle amplification (DE-RCA) and generated numerous G-quadruples sequences. By inserting the fluorescent dye N-methyl mesoporphyrin IX (NMM), enhanced fluorescence signal was achieved. In this strategy, the self-locked aptamer probe was more stable to reduce the interference signals generated by the uncontrollable folding in unbounded state. Through the cascade amplification of SDA and DE-RCA, the sensitivity was further improved with a detection limit of 3.8 × 10(-16) mol/L for protein detection. Furthermore, by changing the aptamer sequence of the probe, sensitive and selective detection of adenosine has been also achieved, suggesting that the proposed strategy has good versatility and can be widely used in sensitive and selective detection of biomolecules. Copyright © 2016 Elsevier B.V. All rights reserved.
Detection and Analysis of Circular RNAs by RT-PCR.
Panda, Amaresh C; Gorospe, Myriam
2018-03-20
Gene expression in eukaryotic cells is tightly regulated at the transcriptional and posttranscriptional levels. Posttranscriptional processes, including pre-mRNA splicing, mRNA export, mRNA turnover, and mRNA translation, are controlled by RNA-binding proteins (RBPs) and noncoding (nc)RNAs. The vast family of ncRNAs comprises diverse regulatory RNAs, such as microRNAs and long noncoding (lnc)RNAs, but also the poorly explored class of circular (circ)RNAs. Although first discovered more than three decades ago by electron microscopy, only the advent of high-throughput RNA-sequencing (RNA-seq) and the development of innovative bioinformatic pipelines have begun to allow the systematic identification of circRNAs (Szabo and Salzman, 2016; Panda et al ., 2017b; Panda et al ., 2017c). However, the validation of true circRNAs identified by RNA sequencing requires other molecular biology techniques including reverse transcription (RT) followed by conventional or quantitative (q) polymerase chain reaction (PCR), and Northern blot analysis (Jeck and Sharpless, 2014). RT-qPCR analysis of circular RNAs using divergent primers has been widely used for the detection, validation, and sometimes quantification of circRNAs (Abdelmohsen et al ., 2015 and 2017; Panda et al ., 2017b). As detailed here, divergent primers designed to span the circRNA backsplice junction sequence can specifically amplify the circRNAs and not the counterpart linear RNA. In sum, RT-PCR analysis using divergent primers allows direct detection and quantification of circRNAs.
Thermopower of molecular junctions: Tunneling to hopping crossover in DNA
NASA Astrophysics Data System (ADS)
Korol, Roman; Kilgour, Michael; Segal, Dvira
2016-12-01
We study the electrical conductance G and the thermopower S of single-molecule junctions and reveal signatures of different transport mechanisms: off-resonant tunneling, on-resonant coherent (ballistic) motion, and multi-step hopping. These mechanisms are identified by studying the behavior of G and S while varying molecular length and temperature. Based on a simple one-dimensional model for molecular junctions, we derive approximate expressions for the thermopower in these different regimes. Analytical results are compared to numerical simulations, performed using a variant of Büttiker's probe technique, the so-called voltage-temperature probe, which allows us to phenomenologically introduce environmentally induced elastic and inelastic electron scattering effects, while applying both voltage and temperature biases across the junction. We further simulate the thermopower of GC-rich DNA sequences with mediating A:T blocks and manifest the tunneling-to-hopping crossover in both the electrical conductance and the thermopower, in accord with measurements by Li et al. [Nat. Commun. 7, 11294 (2016)].
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lopes, J.; LeGuern, E.; Gouider, R.
1996-06-01
Charcot-Marie-Tooth type 1A (CMT1A) disease and hereditary neuropathy with liability to pressure palsies (HNPP) are autosomal dominant neuropathies, associated, respectively, with duplications and deletions of the same 1.5-Mb region on 17p11.2-p12. These two rearrangements are the reciprocal products of an unequal meiotic crossover between the two chromosome 17 homologues, caused by the misalignment of the CMT1A repeat sequences (CMT1A-REPs), the homologous sequences flanking the 1.5-Mb CMT1A/HNPP monomer unit. In order to map recombination breakpoints within the CMT1A-REPs, a 12.9-kb restriction map was constructed from cloned EcoRI fragments of the proximal and distal CMT1A-REPs. Only 3 of the 17 tested restrictionmore » sites were present in the proximal CMT1A-REP but absent in the distal CMT1A-REP, indicating a high degree of homology between these sequences. The rearrangements were mapped in four regions of the CMT1A-REPs by analysis of 76 CMT1A index cases and 38 HNPP patients, who were unrelated. A hot spot of crossover breakpoints located in a 3.2-kb region accounted for three-quarters of the rearrangements, detected after EcoRI/SacI digestion, by the presence of 3.2-kb and 7.8-kb junction fragments in CMT1A and HNPP patients, respectively. These junction fragments, which can be detected on classical Southern blots, permit molecular diagnosis. Other rearrangements can also be detected by gene dosage on the same Southern blots. 25 refs., 4 figs., 2 tabs.« less
Genomic similarity between gastroesophageal junction and esophageal Barrett's adenocarcinomas
Kuick, Rork; Thomas, Dafydd G.; Nadal, Ernest; Lin, Jules; Chang, Andrew C.; Reddy, Rishindra M.; Orringer, Mark B.; Taylor, Jeremy M. G.; Wang, Thomas D.; Beer, David G.
2016-01-01
The current high mortality rate of esophageal adenocarcinoma (EAC) reflects frequent presentation at an advanced stage. Recent efforts utilizing fluorescent peptides have identified overexpressed cell surface targets for endoscopic detection of early stage Barrett's-derived EAC. Unfortunately, 30% of EAC patients present with gastroesophageal junction adenocarcinomas (GEJAC) and lack premalignant Barrett's metaplasia, limiting this early detection strategy. We compared mRNA profiles from 52 EACs (tubular EAC; tEAC) collected above the gastroesophageal junction with 70 GEJACs, 8 normal esophageal and 5 normal gastric mucosa samples. We also analyzed our previously published whole-exome sequencing data in a large cohort of these tumors. Principal component analysis, hierarchical clustering and survival-based analyses demonstrated that GEJAC and tEAC were highly similar, with only modest differences in expression and mutation profiles. The combined expression cohort allowed identification of 49 genes coding cell surface targets overexpressed in both GEJAC and tEAC. We confirmed that three of these candidates (CDH11, ICAM1 and CLDN3) were overexpressed in tumors when compared to normal esophagus, normal gastric and non-dysplastic Barrett's, and localized to the surface of tumor cells. Molecular profiling of tEAC and GEJAC tumors indicated extensive similarity and related molecular processes. Identified genes that encode cell surface proteins overexpressed in both Barrett's-derived EAC and those that arise without Barrett's metaplasia will allow simultaneous detection strategies. PMID:27363029
Ruggles, Kelly V; Tang, Zuojian; Wang, Xuya; Grover, Himanshu; Askenazi, Manor; Teubl, Jennifer; Cao, Song; McLellan, Michael D; Clauser, Karl R; Tabb, David L; Mertins, Philipp; Slebos, Robbert; Erdmann-Gilmore, Petra; Li, Shunqiang; Gunawardena, Harsha P; Xie, Ling; Liu, Tao; Zhou, Jian-Ying; Sun, Shisheng; Hoadley, Katherine A; Perou, Charles M; Chen, Xian; Davies, Sherri R; Maher, Christopher A; Kinsinger, Christopher R; Rodland, Karen D; Zhang, Hui; Zhang, Zhen; Ding, Li; Townsend, R Reid; Rodriguez, Henry; Chan, Daniel; Smith, Richard D; Liebler, Daniel C; Carr, Steven A; Payne, Samuel; Ellis, Matthew J; Fenyő, David
2016-03-01
Improvements in mass spectrometry (MS)-based peptide sequencing provide a new opportunity to determine whether polymorphisms, mutations, and splice variants identified in cancer cells are translated. Herein, we apply a proteogenomic data integration tool (QUILTS) to illustrate protein variant discovery using whole genome, whole transcriptome, and global proteome datasets generated from a pair of luminal and basal-like breast-cancer-patient-derived xenografts (PDX). The sensitivity of proteogenomic analysis for singe nucleotide variant (SNV) expression and novel splice junction (NSJ) detection was probed using multiple MS/MS sample process replicates defined here as an independent tandem MS experiment using identical sample material. Despite analysis of over 30 sample process replicates, only about 10% of SNVs (somatic and germline) detected by both DNA and RNA sequencing were observed as peptides. An even smaller proportion of peptides corresponding to NSJ observed by RNA sequencing were detected (<0.1%). Peptides mapping to DNA-detected SNVs without a detectable mRNA transcript were also observed, suggesting that transcriptome coverage was incomplete (∼80%). In contrast to germline variants, somatic variants were less likely to be detected at the peptide level in the basal-like tumor than in the luminal tumor, raising the possibility of differential translation or protein degradation effects. In conclusion, this large-scale proteogenomic integration allowed us to determine the degree to which mutations are translated and identify gaps in sequence coverage, thereby benchmarking current technology and progress toward whole cancer proteome and transcriptome analysis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Franke, Werner W; Heid, Hans; Zimbelmann, Ralf; Kuhn, Caecilia; Winter-Simanowski, Stefanie; Dörflinger, Yvette; Grund, Christine; Rickelt, Steffen
2013-07-01
Protein PERP (p53 apoptosis effector related to PMP-22) is a small (21.4 kDa) transmembrane polypeptide with an amino acid sequence indicative of a tetraspanin character. It is enriched in the plasma membrane and apparently contributes to cell-cell contacts. Hitherto, it has been reported to be exclusively a component of desmosomes of some stratified epithelia. However, by using a series of newly generated mono- and polyclonal antibodies, we show that protein PERP is not only present in all kinds of stratified epithelia but also occurs in simple, columnar, complex and transitional epithelia, in various types of squamous metaplasia and epithelium-derived tumors, in diverse epithelium-derived cell cultures and in myocardial tissue. Immunofluorescence and immunoelectron microscopy allow us to localize PERP predominantly in small intradesmosomal locations and in variously sized, junction-like peri- and interdesmosomal regions ("tessellate junctions"), mostly in mosaic or amalgamated combinations with other molecules believed, to date, to be exclusive components of tight and adherens junctions. In the heart, PERP is a major component of the composite junctions of the intercalated disks connecting cardiomyocytes. Finally, protein PERP is a cobblestone-like general component of special plasma membrane regions such as the bile canaliculi of liver and subapical-to-lateral zones of diverse columnar epithelia and upper urothelial cell layers. We discuss possible organizational and architectonic functions of protein PERP and its potential value as an immunohistochemical diagnostic marker.
A supine cranio-spinal irradiation technique using moving field junctions
NASA Astrophysics Data System (ADS)
Mani, Karthick Raj; Sapru, Shantanu; Maria Das, K. J.; Basu, Ayan
2016-12-01
Aim: To demonstrate a simple technique of cranio-spinal irradiation (CSI) in supine position using inter fraction moving field junctions to feather out any potential hot and cold spots. Materials and Methods: Fifteen patients diagnosed with medulloblastoma were treated during the period February 2011 to June 2015 were included in this study. Out of fifteen patients in the study nine were male and 6 were female with a median age of 13.4 years (range 5-27 years). All the patients were positioned supine on CT simulation, immobilized using thermoplastic mask and aligned using room based laser system. Two parallel opposed lateral fields for the whole brain using an asymmetrical jaw with isocenter at C2 vertebral body. A posterior field also placed to cover the cervical and dorsal field using the same isocenter at C2. The second isocenter was placed at lumbar vertebral region to cover the remaining dorsal, lumbar and sacral region using an inter-fraction moving junction. Field-in-field and enhanced dynamic wedge used to homogeneous dose distribution when required. Results and Discussion: In this study, we found that only two patients failed in the primary site, no radiation myelitis or recurrences in the filed junctions were reported in these fifteen patients with a median follow-up of 36.4 months. The automated sequence of treatment plans with moving junctions in the comfortable supine position negating the need for manual junction matching or junction shifts avoiding potential treatment errors and also facilitating delivery of anesthesia where necessary.
A structural and functional comparison of gap junction channels composed of connexins and innexins
Williams, Jamal B.
2016-01-01
ABSTRACT Methods such as electron microscopy and electrophysiology led to the understanding that gap junctions were dense arrays of channels connecting the intracellular environments within almost all animal tissues. The characteristics of gap junctions were remarkably similar in preparations from phylogenetically diverse animals such as cnidarians and chordates. Although few studies directly compared them, minor differences were noted between gap junctions of vertebrates and invertebrates. For instance, a slightly wider gap was noted between cells of invertebrates and the spacing between invertebrate channels was generally greater. Connexins were identified as the structural component of vertebrate junctions in the 1980s and innexins as the structural component of pre‐chordate junctions in the 1990s. Despite a lack of similarity in gene sequence, connexins and innexins are remarkably similar. Innexins and connexins have the same membrane topology and form intercellular channels that play a variety of tissue‐ and temporally specific roles. Both protein types oligomerize to form large aqueous channels that allow the passage of ions and small metabolites and are regulated by factors such as pH, calcium, and voltage. Much more is currently known about the structure, function, and structure–function relationships of connexins. However, the innexin field is expanding. Greater knowledge of innexin channels will permit more detailed comparisons with their connexin‐based counterparts, and provide insight into the ubiquitous yet specific roles of gap junctions. © 2016 Wiley Periodicals, Inc. Develop Neurobiol 77: 522–547, 2017 PMID:27582044
A structural and functional comparison of gap junction channels composed of connexins and innexins.
Skerrett, I Martha; Williams, Jamal B
2017-05-01
Methods such as electron microscopy and electrophysiology led to the understanding that gap junctions were dense arrays of channels connecting the intracellular environments within almost all animal tissues. The characteristics of gap junctions were remarkably similar in preparations from phylogenetically diverse animals such as cnidarians and chordates. Although few studies directly compared them, minor differences were noted between gap junctions of vertebrates and invertebrates. For instance, a slightly wider gap was noted between cells of invertebrates and the spacing between invertebrate channels was generally greater. Connexins were identified as the structural component of vertebrate junctions in the 1980s and innexins as the structural component of pre-chordate junctions in the 1990s. Despite a lack of similarity in gene sequence, connexins and innexins are remarkably similar. Innexins and connexins have the same membrane topology and form intercellular channels that play a variety of tissue- and temporally specific roles. Both protein types oligomerize to form large aqueous channels that allow the passage of ions and small metabolites and are regulated by factors such as pH, calcium, and voltage. Much more is currently known about the structure, function, and structure-function relationships of connexins. However, the innexin field is expanding. Greater knowledge of innexin channels will permit more detailed comparisons with their connexin-based counterparts, and provide insight into the ubiquitous yet specific roles of gap junctions. © 2016 Wiley Periodicals, Inc. Develop Neurobiol 77: 522-547, 2017. © 2016 The Authors Developmental Neurobiology Published by Wiley Periodicals, Inc.
Yao, Jia-Long; Tomes, Sumathi; Gleave, Andrew P
2013-05-01
Apple acetolactate synthase mutants were generated by site-specific mutagenesis and successfully used as selection marker in tobacco and apple transformation. T-DNA/Apple genome junctions were analysed using genome-walking PCR and sequencing. An Agrobacterium-mediated genetic transformation system was developed for apple (Malus × domestica), using mutants of apple acetolactate synthase (ALS) as a selectable marker. Four apple ALS mutants were generated by site-specific mutagenesis and subsequently cloned under the transcriptional control of the CaMV 35S promoter and ocs 3' terminator, in a pART27-derived plant transformation vector. Three of the four mutations were found to confer resistance to the herbicide Glean(®), containing the active agent chlorsulfuron, in tobacco (Nicotiana tabacum) transformation. In apple transformation, leaf explants infected with Agrobacterium tumefaciens EHA105 containing one of the three ALS mutants resulted in the production of shoots on medium containing 2-8 μg L(-1) Glean(®), whilst uninfected wild-type explants failed to regenerate shoots or survive on medium containing 1 and 3 μg L(-1) Glean(®), respectively. Glean(®)-resistant, regenerated shoots were further multiplied and rooted on medium containing 10 μg L(-1) Glean(®). The T-DNA and apple genome-DNA junctions from eight rooted transgenic apple plants were analysed using genome-walking PCR amplification and sequencing. This analysis confirmed T-DNA integration into the apple genome, identified the genome integration sites and revealed the extent of any vector backbone integration, T-DNA rearrangements and deletions of apple genome DNA at the sites of integration.
Biswas, Sondip K; Lo, Woo-Kuen
2007-03-09
To determine the possible changes in the distribution of cholesterol in gap junction plaques during fiber cell differentiation and maturation in the embryonic chicken lens. The possible mechanism by which cholesterol is removed from gap junction plaques is also investigated. Filipin cytochemistry in conjunction with freeze-fracture TEM was used to visualize cholesterol, as represented by filipin-cholesterol complexes (FCCs) in gap junction plaques. Quantitative analysis on the heterogeneous distribution of cholesterol in gap junction plaques was conducted from outer and inner cortical regions. A novel technique combining filipin cytochemistry with freeze-fracture replica immunogold labeling (FRIL) was used to label Cx45.6 and Cx56 antibodies in cholesterol-containing gap junctions. Filipin cytochemistry and freeze-fracture TEM and thin-section TEM were used to examine the appearance and nature of the cholesterol-containing vesicular structures associated with gap junction plaques. Chicken lens fibers contain cholesterol-rich, cholesterol-intermediate and cholesterol-free gap junction populations in both outer and inner cortical regions. Filipin cytochemistry and FRIL studies confirmed that cholesterol-containing junctions were gap junctions. Quantitative analysis showed that approximately 86% of gap junctions in the outer cortical zone were cholesterol-rich gap junctions, whereas approximately 81% of gap junctions in the inner cortical zone were cholesterol-free gap junctions. A number of pleiomorphic cholesterol-rich vesicles of varying sizes were often observed in the gap junction plaques. They appear to be involved in the removal of cholesterol from gap junction plaques through endocytosis. Gap junctions in the young fibers are enriched with cholesterol because they are assembled in the unique cholesterol-rich cell membranes in the lens. A majority of cholesterol-rich gap junctions in the outer young fibers are transformed into cholesterol-free ones in the inner mature fibers during fiber cell maturation. A distinct endocytotic process appears to be involved in removing cholesterol from the cholesterol-containing gap junctions, and it may play a major role in the transformation of cholesterol-rich gap junctions into cholesterol-free ones during fiber cell maturation.
Zhang, Yanju; Lameijer, Eric-Wubbo; 't Hoen, Peter A. C.; Ning, Zemin; Slagboom, P. Eline; Ye, Kai
2012-01-01
Motivation: RNA-seq is a powerful technology for the study of transcriptome profiles that uses deep-sequencing technologies. Moreover, it may be used for cellular phenotyping and help establishing the etiology of diseases characterized by abnormal splicing patterns. In RNA-Seq, the exact nature of splicing events is buried in the reads that span exon–exon boundaries. The accurate and efficient mapping of these reads to the reference genome is a major challenge. Results: We developed PASSion, a pattern growth algorithm-based pipeline for splice site detection in paired-end RNA-Seq reads. Comparing the performance of PASSion to three existing RNA-Seq analysis pipelines, TopHat, MapSplice and HMMSplicer, revealed that PASSion is competitive with these packages. Moreover, the performance of PASSion is not affected by read length and coverage. It performs better than the other three approaches when detecting junctions in highly abundant transcripts. PASSion has the ability to detect junctions that do not have known splicing motifs, which cannot be found by the other tools. Of the two public RNA-Seq datasets, PASSion predicted ∼ 137 000 and 173 000 splicing events, of which on average 82 are known junctions annotated in the Ensembl transcript database and 18% are novel. In addition, our package can discover differential and shared splicing patterns among multiple samples. Availability: The code and utilities can be freely downloaded from https://trac.nbic.nl/passion and ftp://ftp.sanger.ac.uk/pub/zn1/passion Contact: y.zhang@lumc.nl; k.ye@lumc.nl Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22219203
Parks, Jason C; Patton, Alyssa L; McCallie, Blair R; Griffin, Darren K; Schoolcraft, William B; Katz-Jaffe, Mandy G
2016-05-01
Corona cells surround the oocyte and maintain a close relationship through transzonal processes and gap junctions, and may be used to assess oocyte competence. In this study, the corona cell transcriptome of individual cumulus oocyte complexes (COCs) was investigated. Isolated corona cells were collected from COCs that developed into euploid blastocysts and were transferred in a subsequent frozen embryo transfer. Ten corona cell samples underwent RNA-sequencing to generate unique gene expression profiles. Live birth was compared with negative implantation after the transfer of a euploid blastocyst using bioinformatics and statistical analysis. Individual corona cell samples produced a mean of 21.2 million sequence reads, and 307 differentially expressed transcrpits (P < 0.05; fold change ≥ 2). Enriched pathway analysis showed Wnt signalling, mitogen-activated protein kinases signalling, focal adhesion and tricarboxylic acid cycle to be affected by implantation outcome. The Wnt/beta-catenin signalling pathway, including genes APC, AXIN and GSK3B, were independently validated by real-time quantitative reverse transcription. Individual, corona cell transcriptome was successfully generated using RNA-sequencing. Key genes and signalling pathways were identified in association with implantation outcome after the transfer of a euploid blastocyst in a frozen embryo transfer. These data could provide novel biomarkers for the non-invasive assessment of embryo viability. Copyright © 2016 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
Evolution of the vertebrate claudin gene family: insights from a basal vertebrate, the sea lamprey.
Mukendi, Christian; Dean, Nicholas; Lala, Rushil; Smith, Jeramiah; Bronner, Marianne E; Nikitina, Natalya V
2016-01-01
Claudins are major constituents of tight junctions, contributing both to their intercellular sealing and selective permeability properties. While claudins and claudin-like molecules are present in some invertebrates, the association of claudins with tight junctions has been conclusively documented only in vertebrates. Here we report the sequencing, phylogenetic analysis and comprehensive spatiotemporal expression analysis of the entire claudin gene family in the basal extant vertebrate, the sea lamprey. Our results demonstrate that clear orthologues to about half of all mammalian claudins are present in the lamprey, suggesting that at least one round of whole genome duplication contributed to the diversification of this gene family. Expression analysis revealed that claudins are expressed in discrete and specific domains, many of which represent vertebrate-specific innovations, such as in cranial ectodermal placodes and the neural crest; whereas others represent structures characteristic of chordates, e.g. pronephros, notochord, somites, endostyle and pharyngeal arches. By comparing the embryonic expression of claudins in the lamprey to that of other vertebrates, we found that ancestral expression patterns were often preserved in higher vertebrates. Morpholino mediated loss of Cldn3b demonstrated a functional role for this protein in placode and pharyngeal arch morphogenesis. Taken together, our data provide novel insights into the origins and evolution of the claudin gene family and the significance of claudin proteins in the evolution of vertebrates.
Leung, Tommy W C; Mak, Darwin; Wong, K H; Wang, Y; Song, Y H; Tsang, D N C; Wong, C; Shao, Y M; Lim, W L
2008-07-01
We conducted a molecular epidemiological study on newly diagnosed human immunodeficiency virus type 1 (HIV-1)-infected patients in Hong Kong to identify the epidemiological linkage of HIV-1 infection in the locality. Reverse transcription polymerase chain reaction (RT-PCR) for HIV-1 was performed on newly diagnosed HIV-1-positive sera collected from January 2002 to December 2006. PCR products correspond to the env C2V3V4 region and gag p17/p24 junction of the HIV-1 genome were nucleotide sequenced. Phylogenetic analyses performed on the acquired nucleotide sequences revealed that CRF01_AE and subtype B were the two dominant HIV-1 subtypes. Analyses also demonstrated the presence of three emerging HIV-1 clusters among the subtype B sequences in Hong Kong. Individual cluster possesses a unique cluster-specific amino acid signature for identification. Data show that one of the clusters (Cluster I) is rapidly expanding. In addition to the unique cluster-specific amino acid signature, the majority of sequences in Cluster I harbor a 6-amino acid insertion at the gag p17/p24 junction in a region that is thought to be closely associated with HIV-1 infectivity.
Lowry, Kym; Woodman, Andrew; Cook, Jonathan; Evans, David J.
2014-01-01
Recombination in enteroviruses provides an evolutionary mechanism for acquiring extensive regions of novel sequence, is suggested to have a role in genotype diversity and is known to have been key to the emergence of novel neuropathogenic variants of poliovirus. Despite the importance of this evolutionary mechanism, the recombination process remains relatively poorly understood. We investigated heterologous recombination using a novel reverse genetic approach that resulted in the isolation of intermediate chimeric intertypic polioviruses bearing genomes with extensive duplicated sequences at the recombination junction. Serial passage of viruses exhibiting such imprecise junctions yielded progeny with increased fitness which had lost the duplicated sequences. Mutations or inhibitors that changed polymerase fidelity or the coalescence of replication complexes markedly altered the yield of recombinants (but did not influence non-replicative recombination) indicating both that the process is replicative and that it may be possible to enhance or reduce recombination-mediated viral evolution if required. We propose that extant recombinants result from a biphasic process in which an initial recombination event is followed by a process of resolution, deleting extraneous sequences and optimizing viral fitness. This process has implications for our wider understanding of ‘evolution by duplication’ in the positive-strand RNA viruses. PMID:24945141
Experimental single-strain mobilomics reveals events that shape pathogen emergence
Schoeniger, Joseph S.; Hudson, Corey M.; Bent, Zachary W.; ...
2016-07-04
Virulence and resistance genes carried on mobile DNAs such as genomic islands (GIs) and plasmids promote bacterial pathogen emergence. An early step in the mobilization of GIs is their excision, which produces both a circular form of the GI and a deletion site in the chromosome; circular forms have also been described for some bacterial insertion sequences (ISs). We demonstrate that the recombinant sequence produced at the junction of such circles, and their corresponding deletion sites, can be detected sensitively in high throughput sequencing data, using new computational methods that enable empirical discovery of new mobile DNAs. Applied to themore » rich mobilome of a single strain (Kpn2146) of the emerging multidrug-resistant pathogen Klebsiella pneumoniae, our approach detected circular junctions for six GIs and seven IS types (several of the latter not previously known to circularize). Our methods further revealed differential biology of multiple mobile DNAs, imprecision of integrases and transposases, and differential activity among identical IS copies for IS26, ISKpn18 and ISKpn21. Exonuclease was used to enrich for circular dsDNA molecules, and internal calibration with the native Kpn2146 plasmids showed that not all molecules bearing GI and IS circular junctions were circular dsDNAs. Transposition events were also detected, revealing replicon preference (ISKpn18 preferring a conjugative IncA/C2 plasmid), local action (IS26), regional preferences, selection (against capsule synthesis), and left-right IS end swapping. Efficient discovery and global characterization of numerous mobile elements per experiment will allow detailed accounting of bacterial evolution, explaining the new gene combinations that arise in emerging pathogens.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schoeniger, Joseph S.; Hudson, Corey M.; Bent, Zachary W.
Virulence and resistance genes carried on mobile DNAs such as genomic islands (GIs) and plasmids promote bacterial pathogen emergence. An early step in the mobilization of GIs is their excision, which produces both a circular form of the GI and a deletion site in the chromosome; circular forms have also been described for some bacterial insertion sequences (ISs). We demonstrate that the recombinant sequence produced at the junction of such circles, and their corresponding deletion sites, can be detected sensitively in high throughput sequencing data, using new computational methods that enable empirical discovery of new mobile DNAs. Applied to themore » rich mobilome of a single strain (Kpn2146) of the emerging multidrug-resistant pathogen Klebsiella pneumoniae, our approach detected circular junctions for six GIs and seven IS types (several of the latter not previously known to circularize). Our methods further revealed differential biology of multiple mobile DNAs, imprecision of integrases and transposases, and differential activity among identical IS copies for IS26, ISKpn18 and ISKpn21. Exonuclease was used to enrich for circular dsDNA molecules, and internal calibration with the native Kpn2146 plasmids showed that not all molecules bearing GI and IS circular junctions were circular dsDNAs. Transposition events were also detected, revealing replicon preference (ISKpn18 preferring a conjugative IncA/C2 plasmid), local action (IS26), regional preferences, selection (against capsule synthesis), and left-right IS end swapping. Efficient discovery and global characterization of numerous mobile elements per experiment will allow detailed accounting of bacterial evolution, explaining the new gene combinations that arise in emerging pathogens.« less
j5 DNA assembly design automation.
Hillson, Nathan J
2014-01-01
Modern standardized methodologies, described in detail in the previous chapters of this book, have enabled the software-automated design of optimized DNA construction protocols. This chapter describes how to design (combinatorial) scar-less DNA assembly protocols using the web-based software j5. j5 assists biomedical and biotechnological researchers construct DNA by automating the design of optimized protocols for flanking homology sequence as well as type IIS endonuclease-mediated DNA assembly methodologies. Unlike any other software tool available today, j5 designs scar-less combinatorial DNA assembly protocols, performs a cost-benefit analysis to identify which portions of an assembly process would be less expensive to outsource to a DNA synthesis service provider, and designs hierarchical DNA assembly strategies to mitigate anticipated poor assembly junction sequence performance. Software integrated with j5 add significant value to the j5 design process through graphical user-interface enhancement and downstream liquid-handling robotic laboratory automation.
Medical Sequencing at the extremes of Human Body Mass
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahituv, Nadav; Kavaslar, Nihan; Schackwitz, Wendy
2006-09-01
Body weight is a quantitative trait with significantheritability in humans. To identify potential genetic contributors tothis phenotype, we resequenced the coding exons and splice junctions of58 genes in 379 obese and 378 lean individuals. Our 96Mb survey included21 genes associated with monogenic forms of obesity in humans or mice, aswell as 37 genes that function in body weight-related pathways. We foundthat the monogenic obesity-associated gene group was enriched for rarenonsynonymous variants unique to the obese (n=46) versus lean (n=26)populations. Computational analysis further predicted a significantlygreater fraction of deleterious variants within the obese cohort.Consistent with the complex inheritance of body weight,more » we did notobserve obvious familial segregation in the majority of the 28 availablekindreds. Taken together, these data suggest that multiple rare alleleswith variable penetrance contribute to obesity in the population andprovide a deep medical sequencing based approach to detectthem.« less
Somatic mitochondrial mutation in gastric cancer.
Burgart, L. J.; Zheng, J.; Shu, Q.; Strickler, J. G.; Shibata, D.
1995-01-01
Likely hot spots for mutations are mitochondrial sequences as there is less repair and more damage by carcinogens compared with nuclear sequences. A somatic 50-bp mitochondrial D-loop deletion was detected in four gastric adenocarcinomas. The deletion included the CSB2 region and was flanked by 9-bp direct repeats. The deletion was more frequent in adenocarcinomas arising from the gastroesophageal junction (4/32, 12.5%) compared with more distal tumors (0/45). Topographical analysis revealed the absence of the deletion from normal tissues except in focal portions of smooth muscle in one case. In two cases, apparent mutant homoplasmy was present throughout two tumors, including their metastases. In the two other cases, the mutation was present in only minor focal portions ( < 5%) of their primary tumors. These findings document the presence of somatic mitochondrial alterations in gastric cancer, which may reflect the environmental and genetic influences operative during tumor progression. Images Figure 3 Figure 4 Figure 5 PMID:7573355
Griffiths, Ewen A; Pritchard, Susan A; Mapstone, Nicholas P; Welch, Ian M
2006-01-01
Adenocarcinoma of the oesophagus and gastro-oesophageal junction are rapidly increasing in incidence and have a well described sequence of carcinogenesis: the Barrett's metaplasia-dysplasia-adenocarcinoma sequence. During recent years there have been changes in the knowledge surrounding disease progression, cancer management and histopathology specimen reporting. Tumours around the gastro-oesophageal junction (GOJ) pose several specific challenges. Numerous difficulties arise when the existing TNM staging systems for gastric and oesophageal cancers are applied to GOJ tumours. The issues facing the current TNM staging and GOJ tumour classification systems are reviewed in this article. Recent evidence regarding the importance of several histopathologically derived prognostic factors, such as circumferential resection margin status and lymph node metastases, have implications for specimen reporting. With the rising use of multimodal treatments for oesophageal cancer it is important that the response of the tumour to this therapy is carefully documented pathologically. In addition, several controversial and novel areas such as endoscopic mucosal resection, lymph node micrometastases and the sentinel node concept are being studied. We aim to review these aspects, with special relevance to oesophageal and gastro-oesophageal cancer specimen reporting, to update the surgical oncologist with an interest in upper gastrointestinal cancer. PMID:17118194
Vedula, Pavan; Cruz, Lissette A; Gutierrez, Natasha; Davis, Justin; Ayee, Brian; Abramczyk, Rachel; Rodriguez, Alexis J
2016-06-30
Quantifying multi-molecular complex assembly in specific cytoplasmic compartments is crucial to understand how cells use assembly/disassembly of these complexes to control function. Currently, biophysical methods like Fluorescence Resonance Energy Transfer and Fluorescence Correlation Spectroscopy provide quantitative measurements of direct protein-protein interactions, while traditional biochemical approaches such as sub-cellular fractionation and immunoprecipitation remain the main approaches used to study multi-protein complex assembly/disassembly dynamics. In this article, we validate and quantify multi-protein adherens junction complex assembly in situ using light microscopy and Fluorescence Covariance Analysis. Utilizing specific fluorescently-labeled protein pairs, we quantified various stages of adherens junction complex assembly, the multiprotein complex regulating epithelial tissue structure and function following de novo cell-cell contact. We demonstrate: minimal cadherin-catenin complex assembly in the perinuclear cytoplasm and subsequent localization to the cell-cell contact zone, assembly of adherens junction complexes, acto-myosin tension-mediated anchoring, and adherens junction maturation following de novo cell-cell contact. Finally applying Fluorescence Covariance Analysis in live cells expressing fluorescently tagged adherens junction complex proteins, we also quantified adherens junction complex assembly dynamics during epithelial monolayer formation.
Baoutina, A; Coldham, T; Bains, G S; Emslie, K R
2010-08-01
As clinical gene therapy has progressed toward realizing its potential, concern over misuse of the technology to enhance performance in athletes is growing. Although 'gene doping' is banned by the World Anti-Doping Agency, its detection remains a major challenge. In this study, we developed a methodology for direct detection of the transferred genetic material and evaluated its feasibility for gene doping detection in blood samples from athletes. Using erythropoietin (EPO) as a model gene and a simple in vitro system, we developed real-time PCR assays that target sequences within the transgene complementary DNA corresponding to exon/exon junctions. As these junctions are absent in the endogenous gene due to their interruption by introns, the approach allows detection of trace amounts of a transgene in a large background of the endogenous gene. Two developed assays and one commercial gene expression assay for EPO were validated. On the basis of ability of these assays to selectively amplify transgenic DNA and analysis of literature on testing of gene transfer in preclinical and clinical gene therapy, it is concluded that the developed approach would potentially be suitable to detect gene doping through gene transfer by analysis of small volumes of blood using regular out-of-competition testing.
Giorgio, Elisa; Rolyan, Harshvardhan; Kropp, Laura; Chakka, Anish Baswanth; Yatsenko, Svetlana; Gregorio, Eleonora Di; Lacerenza, Daniela; Vaula, Giovanna; Talarico, Flavia; Mandich, Paola; Toro, Camilo; Pierre, Eleonore Eymard; Labauge, Pierre; Capellari, Sabina; Cortelli, Pietro; Vairo, Filippo Pinto; Miguel, Diego; Stubbolo, Danielle; Marques, Lourenco Charles; Gahl, William; Boespflug-Tanguy, Odile; Melberg, Atle; Hassin-Baer, Sharon; Cohen, Oren S; Pjontek, Rastislav; Grau, Armin; Klopstock, Thomas; Fogel, Brent; Meijer, Inge; Rouleau, Guy; Bouchard, Jean-Pierre L; Ganapathiraju, Madhavi; Vanderver, Adeline; Dahl, Niklas; Hobson, Grace; Brusco, Alfredo; Brussino, Alessandro; Padiath, Quasar Saleem
2013-01-01
ABSTRACT Autosomal dominant leukodystrophy (ADLD) is an adult onset demyelinating disorder that is caused by duplications of the lamin B1 (LMNB1) gene. However, as only a few cases have been analyzed in detail, the mechanisms underlying LMNB1 duplications are unclear. We report the detailed molecular analysis of the largest collection of ADLD families studied, to date. We have identified the minimal duplicated region necessary for the disease, defined all the duplication junctions at the nucleotide level and identified the first inverted LMNB1 duplication. We have demonstrated that the duplications are not recurrent; patients with identical duplications share the same haplotype, likely inherited from a common founder and that the duplications originated from intrachromosomal events. The duplication junction sequences indicated that nonhomologous end joining or replication-based mechanisms such fork stalling and template switching or microhomology-mediated break induced repair are likely to be involved. LMNB1 expression was increased in patients’ fibroblasts both at mRNA and protein levels and the three LMNB1 alleles in ADLD patients show equal expression, suggesting that regulatory regions are maintained within the rearranged segment. These results have allowed us to elucidate duplication mechanisms and provide insights into allele-specific LMNB1 expression levels. PMID:23649844
Automated Array Assembly, Phase 2
NASA Technical Reports Server (NTRS)
Daiello, R. V.
1978-01-01
The purpose of the overall program is to establish technological readiness and provide verification for the elements of a manufacturing sequence which would ultimately be suitable for the large-scale production of silicon solar-array modules at a selling price of less than $500/kW. A program and process plan for accomplishing this objective was developed and put into operation. Three junction-formation processes are shown; since cost analysis shows that they do not differ greatly in cost, each should be considered for technical merits and possible future cost reduction. The progress made in the various process steps of the plan is described, and conclusions are presented.
Molecular structure of r/GCG/d/TATACGC/ - A DNA-RNA hybrid helix joined to double helical DNA
NASA Technical Reports Server (NTRS)
Wang, A. H.-J.; Fujii, S.; Rich, A.; Van Boom, J. H.; Van Der Marel, G. A.; Van Boeckel, S. A. A.
1982-01-01
The molecule r(GCG)d(TATACGC) is self-complementary and forms two DNA-RNA hybrid segments surrounding a central region of double helical DNA; its molecular structure has been solved by X-ray analysis. All three parts of the molecule adopt a conformation which is close to that seen in the 11-fold RNA double helix. The conformation of the ribonucleotides is partly determined by water molecules bridging between the ribose O2' hydroxyl group and cytosine O2. The hybrid-DNA duplex junction contains no structural discontinuities. However, the central DNA TATA sequence has some structural irregularities.
Tsuchiaka, Shinobu; Naoi, Yuki; Imai, Ryo; Masuda, Tsuneyuki; Ito, Mika; Akagami, Masataka; Ouchi, Yoshinao; Ishii, Kazuo; Sakaguchi, Shoichi; Omatsu, Tsutomu; Katayama, Yukie; Oba, Mami; Shirai, Junsuke; Satani, Yuki; Takashima, Yasuhiro; Taniguchi, Yuji; Takasu, Masaki; Madarame, Hiroo; Sunaga, Fujiko; Aoki, Hiroshi; Makino, Shinji; Mizutani, Tetsuya; Nagai, Makoto
2018-01-01
To study the genetic diversity of enterovirus G (EV-G) among Japanese pigs, metagenomics sequencing was performed on fecal samples from pigs with or without diarrhea, collected between 2014 and 2016. Fifty-nine EV-G sequences, which were >5,000 nucleotides long, were obtained. By complete VP1 sequence analysis, Japanese EV-G isolates were classified into G1 (17 strains), G2 (four strains), G3 (22 strains), G4 (two strains), G6 (two strains), G9 (six strains), G10 (five strains), and a new genotype (one strain). Remarkably, 16 G1 and one G2 strain identified in diarrheic (23.5%; four strains) or normal (76.5%; 13 strains) fecal samples possessed a papain-like cysteine protease (PL-CP) sequence, which was recently found in the USA and Belgium in the EV-G genome, at the 2C-3A junction site. This paper presents the first report of the high prevalence of viruses carrying PL-CP in the EV-G population. Furthermore, possible inter- and intragenotype recombination events were found among EV-G strains, including G1-PL-CP strains. Our findings may advance the understanding of the molecular epidemiology and genetic evolution of EV-Gs.
Small Deletion Variants Have Stable Breakpoints Commonly Associated with Alu Elements
Coin, Lachlan J. M.; Steinfeld, Israel; Yakhini, Zohar; Sladek, Rob; Froguel, Philippe; Blakemore, Alexandra I. F.
2008-01-01
Copy number variants (CNVs) contribute significantly to human genomic variation, with over 5000 loci reported, covering more than 18% of the euchromatic human genome. Little is known, however, about the origin and stability of variants of different size and complexity. We investigated the breakpoints of 20 small, common deletions, representing a subset of those originally identified by array CGH, using Agilent microarrays, in 50 healthy French Caucasian subjects. By sequencing PCR products amplified using primers designed to span the deleted regions, we determined the exact size and genomic position of the deletions in all affected samples. For each deletion studied, all individuals carrying the deletion share identical upstream and downstream breakpoints at the sequence level, suggesting that the deletion event occurred just once and later became common in the population. This is supported by linkage disequilibrium (LD) analysis, which has revealed that most of the deletions studied are in moderate to strong LD with surrounding SNPs, and have conserved long-range haplotypes. Analysis of the sequences flanking the deletion breakpoints revealed an enrichment of microhomology at the breakpoint junctions. More significantly, we found an enrichment of Alu repeat elements, the overwhelming majority of which intersected deletion breakpoints at their poly-A tails. We found no enrichment of LINE elements or segmental duplications, in contrast to other reports. Sequence analysis revealed enrichment of a conserved motif in the sequences surrounding the deletion breakpoints, although whether this motif has any mechanistic role in the formation of some deletions has yet to be determined. Considered together with existing information on more complex inherited variant regions, and reports of de novo variants associated with autism, these data support the presence of different subgroups of CNV in the genome which may have originated through different mechanisms. PMID:18769679
Federal Register 2010, 2011, 2012, 2013, 2014
2010-09-17
...: Grand Junction Operations Office. Location: Grand Junction, Colorado. Job Titles and/or Job Duties: All..., Division of Compensation Analysis and Support, National Institute for Occupational Safety and Health (NIOSH...
Method for shallow junction formation
Weiner, K.H.
1996-10-29
A doping sequence is disclosed that reduces the cost and complexity of forming source/drain regions in complementary metal oxide silicon (CMOS) integrated circuit technologies. The process combines the use of patterned excimer laser annealing, dopant-saturated spin-on glass, silicide contact structures and interference effects creates by thin dielectric layers to produce source and drain junctions that are ultrashallow in depth but exhibit low sheet and contact resistance. The process utilizes no photolithography and can be achieved without the use of expensive vacuum equipment. The process margins are wide, and yield loss due to contact of the ultrashallow dopants is eliminated. 8 figs.
Method for shallow junction formation
Weiner, Kurt H.
1996-01-01
A doping sequence that reduces the cost and complexity of forming source/drain regions in complementary metal oxide silicon (CMOS) integrated circuit technologies. The process combines the use of patterned excimer laser annealing, dopant-saturated spin-on glass, silicide contact structures and interference effects creates by thin dielectric layers to produce source and drain junctions that are ultrashallow in depth but exhibit low sheet and contact resistance. The process utilizes no photolithography and can be achieved without the use of expensive vacuum equipment. The process margins are wide, and yield loss due to contact of the ultrashallow dopants is eliminated.
Alternative types of molecule-decorated atomic chains in Au–CO–Au single-molecule junctions
Balogh, Zoltán; Makk, Péter
2015-01-01
Summary We investigate the formation and evolution of Au–CO single-molecule break junctions. The conductance histogram exhibits two distinct molecular configurations, which are further investigated by a combined statistical analysis. According to conditional histogram and correlation analysis these molecular configurations show strong anticorrelations with each other and with pure Au monoatomic junctions and atomic chains. We identify molecular precursor configurations with somewhat higher conductance, which are formed prior to single-molecule junctions. According to detailed length analysis two distinct types of molecule-affected chain-formation processes are observed, and we compare these results to former theoretical calculations considering bridge- and atop-type molecular configurations where the latter has reduced conductance due to destructive Fano interference. PMID:26199840
Alternative types of molecule-decorated atomic chains in Au-CO-Au single-molecule junctions.
Balogh, Zoltán; Makk, Péter; Halbritter, András
2015-01-01
We investigate the formation and evolution of Au-CO single-molecule break junctions. The conductance histogram exhibits two distinct molecular configurations, which are further investigated by a combined statistical analysis. According to conditional histogram and correlation analysis these molecular configurations show strong anticorrelations with each other and with pure Au monoatomic junctions and atomic chains. We identify molecular precursor configurations with somewhat higher conductance, which are formed prior to single-molecule junctions. According to detailed length analysis two distinct types of molecule-affected chain-formation processes are observed, and we compare these results to former theoretical calculations considering bridge- and atop-type molecular configurations where the latter has reduced conductance due to destructive Fano interference.
DeVry, C G; Tsai, W; Clarke, S
1996-11-15
The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.
2011-01-01
Background Readthrough fusions across adjacent genes in the genome, or transcription-induced chimeras (TICs), have been estimated using expressed sequence tag (EST) libraries to involve 4-6% of all genes. Deep transcriptional sequencing (RNA-Seq) now makes it possible to study the occurrence and expression levels of TICs in individual samples across the genome. Methods We performed single-end RNA-Seq on three human prostate adenocarcinoma samples and their corresponding normal tissues, as well as brain and universal reference samples. We developed two bioinformatics methods to specifically identify TIC events: a targeted alignment method using artificial exon-exon junctions within 200,000 bp from adjacent genes, and genomic alignment allowing splicing within individual reads. We performed further experimental verification and characterization of selected TIC and fusion events using quantitative RT-PCR and comparative genomic hybridization microarrays. Results Targeted alignment against artificial exon-exon junctions yielded 339 distinct TIC events, including 32 gene pairs with multiple isoforms. The false discovery rate was estimated to be 1.5%. Spliced alignment to the genome was less sensitive, finding only 18% of those found by targeted alignment in 33-nt reads and 59% of those in 50-nt reads. However, spliced alignment revealed 30 cases of TICs with intervening exons, in addition to distant inversions, scrambled genes, and translocations. Our findings increase the catalog of observed TIC gene pairs by 66%. We verified 6 of 6 predicted TICs in all prostate samples, and 2 of 5 predicted novel distant gene fusions, both private events among 54 prostate tumor samples tested. Expression of TICs correlates with that of the upstream gene, which can explain the prostate-specific pattern of some TIC events and the restriction of the SLC45A3-ELK4 e4-e2 TIC to ERG-negative prostate samples, as confirmed in 20 matched prostate tumor and normal samples and 9 lung cancer cell lines. Conclusions Deep transcriptional sequencing and analysis with targeted and spliced alignment methods can effectively identify TIC events across the genome in individual tissues. Prostate and reference samples exhibit a wide range of TIC events, involving more genes than estimated previously using ESTs. Tissue specificity of TIC events is correlated with expression patterns of the upstream gene. Some TIC events, such as MSMB-NCOA4, may play functional roles in cancer. PMID:21261984
Zhang, Bochao; Meng, Wenzhao; Prak, Eline T Luning; Hershberg, Uri
2015-12-01
Immune repertoires are collections of lymphocytes that express diverse antigen receptor gene rearrangements consisting of Variable (V), (Diversity (D) in the case of heavy chains) and Joining (J) gene segments. Clonally related cells typically share the same germline gene segments and have highly similar junctional sequences within their third complementarity determining regions. Identifying clonal relatedness of sequences is a key step in the analysis of immune repertoires. The V gene is the most important for clone identification because it has the longest sequence and the greatest number of sequence variants. However, accurate identification of a clone's germline V gene source is challenging because there is a high degree of similarity between different germline V genes. This difficulty is compounded in antibodies, which can undergo somatic hypermutation. Furthermore, high-throughput sequencing experiments often generate partial sequences and have significant error rates. To address these issues, we describe a novel method to estimate which germline V genes (or alleles) cannot be discriminated under different conditions (read lengths, sequencing errors or somatic hypermutation frequencies). Starting with any set of germline V genes, this method measures their similarity using different sequencing lengths and calculates their likelihood of unambiguous assignment under different levels of mutation. Hence, one can identify, under different experimental and biological conditions, the germline V genes (or alleles) that cannot be uniquely identified and bundle them together into groups of specific V genes with highly similar sequences. Copyright © 2015 Elsevier B.V. All rights reserved.
Revealing the transcriptomic complexity of switchgrass by PacBio long-read sequencing.
Zuo, Chunman; Blow, Matthew; Sreedasyam, Avinash; Kuo, Rita C; Ramamoorthy, Govindarajan Kunde; Torres-Jerez, Ivone; Li, Guifen; Wang, Mei; Dilworth, David; Barry, Kerrie; Udvardi, Michael; Schmutz, Jeremy; Tang, Yuhong; Xu, Ying
2018-01-01
Switchgrass ( Panicum virgatum L.) is an important bioenergy crop widely used for lignocellulosic research. While extensive transcriptomic analyses have been conducted on this species using short read-based sequencing techniques, very little has been reliably derived regarding alternatively spliced (AS) transcripts. We present an analysis of transcriptomes of six switchgrass tissue types pooled together, sequenced using Pacific Biosciences (PacBio) single-molecular long-read technology. Our analysis identified 105,419 unique transcripts covering 43,570 known genes and 8795 previously unknown genes. 45,168 are novel transcripts of known genes. A total of 60,096 AS transcripts are identified, 45,628 being novel. We have also predicted 1549 transcripts of genes involved in cell wall construction and remodeling, 639 being novel transcripts of known cell wall genes. Most of the predicted transcripts are validated against Illumina-based short reads. Specifically, 96% of the splice junction sites in all the unique transcripts are validated by at least five Illumina reads. Comparisons between genes derived from our identified transcripts and the current genome annotation revealed that among the gene set predicted by both analyses, 16,640 have different exon-intron structures. Overall, substantial amount of new information is derived from the PacBio RNA data regarding both the transcriptome and the genome of switchgrass.
NASA Astrophysics Data System (ADS)
Sokolović, I.; Mali, P.; Odavić, J.; Radošević, S.; Medvedeva, S. Yu.; Botha, A. E.; Shukrinov, Yu. M.; Tekić, J.
2017-08-01
The devil's staircase structure arising from the complete mode locking of an entirely nonchaotic system, the overdamped dc+ac driven Frenkel-Kontorova model with deformable substrate potential, was observed. Even though no chaos was found, a hierarchical ordering of the Shapiro steps was made possible through the use of a previously introduced continued fraction formula. The absence of chaos, deduced here from Lyapunov exponent analyses, can be attributed to the overdamped character and the Middleton no-passing rule. A comparative analysis of a one-dimensional stack of Josephson junctions confirmed the disappearance of chaos with increasing dissipation. Other common dynamic features were also identified through this comparison. A detailed analysis of the amplitude dependence of the Shapiro steps revealed that only for the case of a purely sinusoidal substrate potential did the relative sizes of the steps follow a Farey sequence. For nonsinusoidal (deformed) potentials, the symmetry of the Stern-Brocot tree, depicting all members of particular Farey sequence, was seen to be increasingly broken, with certain steps being more prominent and their relative sizes not following the Farey rule.
Beamer, B A; Negri, C; Yen, C J; Gavrilova, O; Rumberger, J M; Durcan, M J; Yarnall, D P; Hawkins, A L; Griffin, C A; Burns, D K; Roth, J; Reitman, M; Shuldiner, A R
1997-04-28
We determined the chromosomal localization and partial genomic structure of the coding region of the human PPAR gamma gene (hPPAR gamma), a nuclear receptor important for adipocyte differentiation and function. Sequence analysis and long PCR of human genomic DNA with primers that span putative introns revealed that intron positions and sizes of hPPAR gamma are similar to those previously determined for the mouse PPAR gamma gene[13]. Fluorescent in situ hybridization localized hPPAR gamma to chromosome 3, band 3p25. Radiation hybrid mapping with two independent primer pairs was consistent with hPPAR gamma being within 1.5 Mb of marker D3S1263 on 3p25-p24.2. These sequences of the intron/exon junctions of the 6 coding exons shared by hPPAR gamma 1 and hPPAR gamma 2 will facilitate screening for possible mutations. Furthermore, D3S1263 is a suitable polymorphic marker for linkage analysis to evaluate PPAR gamma's potential contribution to genetic susceptibility to obesity, lipoatrophy, insulin resistance, and diabetes.
Forbi, Joseph C; Agwale, Simon M; Ndip, Lucy M; Esona, Mathew D
2012-05-01
Molecular investigation was undertaken of circulating hepatitis A virus (HAV) associated with cases of acute diarrhea among children under 5 years of age in Kumba-Cameroon. Reverse transcription PCR, sequencing, and phylogenetic analysis of a 371 bp segment of the VP1/P2A junction of six isolates obtained from stool samples showed the exclusive emergence of genetically related HAV subgenotype IA. All the isolates clustered within a unique lineage exhibiting a 99.5% nucleotide identity suggesting infection from a common source. The Cameroonian HAV isolates did not intermix or cluster with those from other regions of Africa and the rest of the world. Tajima's neutralization tests using the six sequences suggested HAV/IA population expansion (D = -1.37; P = 0.016). This is the first description of indigenous HAV genotypes circulating in Cameroon revealing a community-wide spread and predominance of HAV/1A infection in the Kumba area. These findings stress the need for routine molecular tracking of HAV infection as a contributory cause of acute diarrhea in Cameroonian children. Copyright © 2012 Wiley Periodicals, Inc.
A novel site-specific recombination system derived from bacteriophage phiMR11.
Rashel, Mohammad; Uchiyama, Jumpei; Ujihara, Takako; Takemura, Iyo; Hoshiba, Hiroshi; Matsuzaki, Shigenobu
2008-04-04
We report identification of a novel site-specific DNA recombination system that functions in both in vivo and in vitro, derived from lysogenic Staphylococcus aureus phage phiMR11. In silico analysis of the phiMR11 genome indicated orf1 as a putative integrase gene. Phage and bacterial attachment sites (attP and attB, respectively) and attachment junctions were determined and their nucleotide sequences decoded. Sequences of attP and attB were mostly different to each other except for a two bp common core that was the crossover point. We found several inverted repeats adjacent to the core sequence of attP as potential protein binding sites. The precise and efficient integration properties of phiMR11 integrase were shown on attP and attB in Escherichia coli and the minimum size of attP was found to be 34bp. In in vitro assays using crude or purified integrase, only buffer and substrate DNAs were required for the recombination reaction, indicating that other bacterially encoded factors are not essential for activity.
Poulter, James A; El-Sayed, Walid; Shore, Roger C; Kirkham, Jennifer; Inglehearn, Chris F; Mighell, Alan J
2014-01-01
The conventional approach to identifying the defective gene in a family with an inherited disease is to find the disease locus through family studies. However, the rapid development and decreasing cost of next generation sequencing facilitates a more direct approach. Here, we report the identification of a frameshift mutation in LAMB3 as a cause of dominant hypoplastic amelogenesis imperfecta (AI). Whole-exome sequencing of three affected family members and subsequent filtering of shared variants, without prior genetic linkage, sufficed to identify the pathogenic variant. Simultaneous analysis of multiple family members confirms segregation, enhancing the power to filter the genetic variation found and leading to rapid identification of the pathogenic variant. LAMB3 encodes a subunit of Laminin-5, one of a family of basement membrane proteins with essential functions in cell growth, movement and adhesion. Homozygous LAMB3 mutations cause junctional epidermolysis bullosa (JEB) and enamel defects are seen in JEB cases. However, to our knowledge, this is the first report of dominant AI due to a LAMB3 mutation in the absence of JEB.
Tam, Annie S; Chu, Jeffrey S C; Rose, Ann M
2015-11-12
Cancer therapy largely depends on chemotherapeutic agents that generate DNA lesions. However, our understanding of the nature of the resulting lesions as well as the mutational profiles of these chemotherapeutic agents is limited. Among these lesions, DNA interstrand crosslinks are among the more toxic types of DNA damage. Here, we have characterized the mutational spectrum of the commonly used DNA interstrand crosslinking agent mitomycin C (MMC). Using a combination of genetic mapping, whole genome sequencing, and genomic analysis, we have identified and confirmed several genomic lesions linked to MMC-induced DNA damage in Caenorhabditis elegans. Our data indicate that MMC predominantly causes deletions, with a 5'-CpG-3' sequence context prevalent in the deleted regions of DNA. Furthermore, we identified microhomology flanking the deletion junctions, indicative of DNA repair via nonhomologous end joining. Based on these results, we propose a general repair mechanism that is likely to be involved in the biological response to this highly toxic agent. In conclusion, the systematic study we have described provides insight into potential sequence specificity of MMC with DNA. Copyright © 2016 Tam et al.
Cho, Kwang-Soo; Yun, Bong-Kyoung; Yoon, Young-Ho; Hong, Su-Young; Mekapogu, Manjulatha; Kim, Kyung-Hee; Yang, Tae-Jin
2015-01-01
We report the chloroplast (cp) genome sequence of tartary buckwheat (Fagopyrum tataricum) obtained by next-generation sequencing technology and compared this with the previously reported common buckwheat (F. esculentum ssp. ancestrale) cp genome. The cp genome of F. tataricum has a total sequence length of 159,272 bp, which is 327 bp shorter than the common buckwheat cp genome. The cp gene content, order, and orientation are similar to those of common buckwheat, but with some structural variation at tandem and palindromic repeat frequencies and junction areas. A total of seven InDels (around 100 bp) were found within the intergenic sequences and the ycf1 gene. Copy number variation of the 21-bp tandem repeat varied in F. tataricum (four repeats) and F. esculentum (one repeat), and the InDel of the ycf1 gene was 63 bp long. Nucleotide and amino acid have highly conserved coding sequence with about 98% homology and four genes—rpoC2, ycf3, accD, and clpP—have high synonymous (Ks) value. PCR based InDel markers were applied to diverse genetic resources of F. tataricum and F. esculentum, and the amplicon size was identical to that expected in silico. Therefore, these InDel markers are informative biomarkers to practically distinguish raw or processed buckwheat products derived from F. tataricum and F. esculentum. PMID:25966355
Single Nucleobase Identification Using Biophysical Signatures from Nanoelectronic Quantum Tunneling.
Korshoj, Lee E; Afsari, Sepideh; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-03-01
Nanoelectronic DNA sequencing can provide an important alternative to sequencing-by-synthesis by reducing sample preparation time, cost, and complexity as a high-throughput next-generation technique with accurate single-molecule identification. However, sample noise and signature overlap continue to prevent high-resolution and accurate sequencing results. Probing the molecular orbitals of chemically distinct DNA nucleobases offers a path for facile sequence identification, but molecular entropy (from nucleotide conformations) makes such identification difficult when relying only on the energies of lowest-unoccupied and highest-occupied molecular orbitals (LUMO and HOMO). Here, nine biophysical parameters are developed to better characterize molecular orbitals of individual nucleobases, intended for single-molecule DNA sequencing using quantum tunneling of charges. For this analysis, theoretical models for quantum tunneling are combined with transition voltage spectroscopy to obtain measurable parameters unique to the molecule within an electronic junction. Scanning tunneling spectroscopy is then used to measure these nine biophysical parameters for DNA nucleotides, and a modified machine learning algorithm identified nucleobases. The new parameters significantly improve base calling over merely using LUMO and HOMO frontier orbital energies. Furthermore, high accuracies for identifying DNA nucleobases were observed at different pH conditions. These results have significant implications for developing a robust and accurate high-throughput nanoelectronic DNA sequencing technique. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Pulse-voltammetric glucose detection at gold junction electrodes.
Rassaei, Liza; Marken, Frank
2010-09-01
A novel glucose sensing concept based on the localized change or "modulation" in pH within a symmetric gold-gold junction electrode is proposed. A paired gold-gold junction electrode (average gap size ca. 500 nm) is prepared by simultaneous bipotentiostatic electrodeposition of gold onto two closely spaced platinum disk electrodes. For glucose detection in neutral aqueous solution, the potential of the "pH-modulator" electrode is set to -1.5 V vs saturated calomel reference electrode (SCE) to locally increase the pH, and simultaneously, either cyclic voltammetry or square wave voltammetry experiments are conducted at the sensor electrode. A considerable improvement in the sensor electrode response is observed when a normal pulse voltammetry sequence is applied to the modulator electrode (to generate "hydroxide pulses") and the glucose sensor electrode is operated with fixed bias at +0.5 V vs SCE (to eliminate capacitive charging currents). Preliminary data suggest good linearity for the glucose response in the medically relevant 1-10 mM concentration range (corresponding to 0.18-1.8 g L(-1)). Future electroanalytical applications of multidimensional pulse voltammetry in junction electrodes are discussed.
Lee, Donald W; Khavrutskii, Ilja V; Wallqvist, Anders; Bavari, Sina; Cooper, Christopher L; Chaudhury, Sidhartha
2016-01-01
The somatic diversity of antigen-recognizing B-cell receptors (BCRs) arises from Variable (V), Diversity (D), and Joining (J) (VDJ) recombination and somatic hypermutation (SHM) during B-cell development and affinity maturation. The VDJ junction of the BCR heavy chain forms the highly variable complementarity determining region 3 (CDR3), which plays a critical role in antigen specificity and binding affinity. Tracking the selection and mutation of the CDR3 can be useful in characterizing humoral responses to infection and vaccination. Although tens to hundreds of thousands of unique BCR genes within an expressed B-cell repertoire can now be resolved with high-throughput sequencing, tracking SHMs is still challenging because existing annotation methods are often limited by poor annotation coverage, inconsistent SHM identification across the VDJ junction, or lack of B-cell lineage data. Here, we present B-cell repertoire inductive lineage and immunosequence annotator (BRILIA), an algorithm that leverages repertoire-wide sequencing data to globally improve the VDJ annotation coverage, lineage tree assembly, and SHM identification. On benchmark tests against simulated human and mouse BCR repertoires, BRILIA correctly annotated germline and clonally expanded sequences with 94 and 70% accuracy, respectively, and it has a 90% SHM-positive prediction rate in the CDR3 of heavily mutated sequences; these are substantial improvements over existing methods. We used BRILIA to process BCR sequences obtained from splenic germinal center B cells extracted from C57BL/6 mice. BRILIA returned robust B-cell lineage trees and yielded SHM patterns that are consistent across the VDJ junction and agree with known biological mechanisms of SHM. By contrast, existing BCR annotation tools, which do not account for repertoire-wide clonal relationships, systematically underestimated both the size of clonally related B-cell clusters and yielded inconsistent SHM frequencies. We demonstrate BRILIA's utility in B-cell repertoire studies related to VDJ gene usage, mechanisms for adenosine mutations, and SHM hot spot motifs. Furthermore, we show that the complete gene usage annotation and SHM identification across the entire CDR3 are essential for studying the B-cell affinity maturation process through immunosequencing methods.
Sastre-Garau, X; Favre, M; Couturier, J; Orth, G
2000-08-01
We previously described two genital carcinomas (IC2, IC4) containing human papillomavirus type 16 (HPV-16)- or HPV-18-related sequences integrated in chromosomal bands containing the c-myc (8q24) or N-myc (2p24) gene, respectively. The c-myc gene was rearranged and amplified in IC2 cells without evidence of overexpression. The N-myc gene was amplified and highly transcribed in IC4 cells. Here, the sequence of an 8039 bp IC4 DNA fragment containing the integrated viral sequences and the cellular junctions is reported. A 3948 bp segment of the genome of HPV-45 encompassing the upstream regulatory region and the E6 and E7 ORFs was integrated into the untranslated part of N-myc exon 3, upstream of the N-myc polyadenylation signal. Both N-myc and HPV-45 sequences were amplified 10- to 20-fold. The 3' ends of the major N-myc transcript were mapped upstream of the 5' junction. A minor N-myc/HPV-45 fusion transcript was also identified, as well as two abundant transcripts from the HPV-45 E6-E7 region. Large amounts of N-myc protein were detected in IC4 cells. A major alteration of c-myc sequences in IC2 cells involved the insertion of a non-coding sequence into the second intron and their co-amplification with the third exon, without any evidence for the integration of HPV-16 sequences within or close to the gene. Different patterns of myc gene alterations may thus be associated with integration of HPV DNA in genital tumours, including the activation of the protooncogene via a mechanism of insertional mutagenesis and/or gene amplification.
Hüsler, P L; Klump, H H
1995-09-10
We have designed a Hoogsteen (HG) triple-helical three-way junction (ternary complex) constructed from three 33-mer oligonucleotides based on the same subset of sequences used for the Watson-Crick (WC) triple-helical three-way junction, characterized previously (P. L. Hüsler and H. H. Klump (1994) Arch. Biochem. Biophys., 313, 29-38). The junction differs primarily in the assembly of the branch point and the ends of the arms. The three oligonucleotides can each fold into a WC hairpin, linked by a four-member cytosine loop, each containing a homo-pyrimidine 10-mer single-strand extension. On lowering the pH (between 6 and 4), the extensions mutually associate to one of the other hairpins via Hoogsteen (HG) hydrogen bonding. Collectively, this process results in the formation of the branch point and the triple-helical arms. The HG triple-helical three-way junction is characterized by gel electrophoresis, circular dichroism, uv melting, and differential scanning calorimetry. The junction undergoes thermal unfolding in two distinct temperature regions. In the temperature range 15 to 50 degrees C loss of HG base pairing results in the dissociation of the three-way junction. Between 55 and 95 degrees C the resulting hairpins undergo further successive unfolding. The overall calorimetric unfolding enthalpy and entropy changes associated with the loss of HG base pairing are approximately equal to the sum of the enthalpy and entropy changes associated with the dissociation of the HG base pairing in the isolated arms (170.6 kcal.mol-1; 540.1 cal.mol-1.K-1). It is apparent from these results that in the proximity of the branch point the structure is not perturb or strain. This result is contrary to the results obtained for the WC triple-helical three-way and for three-way junctions constructed from canonical double-helical DNA. Complete folding of the junction requires either high Na+ (600 mM) ion concentrations or 40-60 mM Mg2+.
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Farnsworth, Nikki L; Hemmati, Alireza; Pozzoli, Marina; Benninger, Richard K P
2014-01-01
The pancreatic islets are central to the maintenance of glucose homeostasis through insulin secretion. Glucose-stimulated insulin secretion is tightly linked to electrical activity in β cells within the islet. Gap junctions, composed of connexin36 (Cx36), form intercellular channels between β cells, synchronizing electrical activity and insulin secretion. Loss of gap junction coupling leads to altered insulin secretion dynamics and disrupted glucose homeostasis. Gap junction coupling is known to be disrupted in mouse models of pre-diabetes. Although approaches to measure gap junction coupling have been devised, they either lack cell specificity, suitable quantification of coupling or spatial resolution, or are invasive. The purpose of this study was to develop fluorescence recovery after photobleaching (FRAP) as a technique to accurately and robustly measure gap junction coupling in the islet. The cationic dye Rhodamine 123 was used with FRAP to quantify dye diffusion between islet β cells as a measure of Cx36 gap junction coupling. Measurements in islets with reduced Cx36 verified the accuracy of this technique in distinguishing between distinct levels of gap junction coupling. Analysis of individual cells revealed that the distribution of coupling across the islet is highly heterogeneous. Analysis of several modulators of gap junction coupling revealed glucose- and cAMP-dependent modulation of gap junction coupling in islets. Finally, FRAP was used to determine cell population specific coupling, where no functional gap junction coupling was observed between α cells and β cells in the islet. The results of this study show FRAP to be a robust technique which provides the cellular resolution to quantify the distribution and regulation of Cx36 gap junction coupling in specific cell populations within the islet. Future studies utilizing this technique may elucidate the role of gap junction coupling in the progression of diabetes and identify mechanisms of gap junction regulation for potential therapies. PMID:25172942
Farnsworth, Nikki L; Hemmati, Alireza; Pozzoli, Marina; Benninger, Richard K P
2014-10-15
The pancreatic islets are central to the maintenance of glucose homeostasis through insulin secretion. Glucose‐stimulated insulin secretion is tightly linked to electrical activity in β cells within the islet. Gap junctions, composed of connexin36 (Cx36), form intercellular channels between β cells, synchronizing electrical activity and insulin secretion. Loss of gap junction coupling leads to altered insulin secretion dynamics and disrupted glucose homeostasis. Gap junction coupling is known to be disrupted in mouse models of pre‐diabetes. Although approaches to measure gap junction coupling have been devised, they either lack cell specificity, suitable quantification of coupling or spatial resolution, or are invasive. The purpose of this study was to develop fluorescence recovery after photobleaching (FRAP) as a technique to accurately and robustly measure gap junction coupling in the islet. The cationic dye Rhodamine 123 was used with FRAP to quantify dye diffusion between islet β cells as a measure of Cx36 gap junction coupling. Measurements in islets with reduced Cx36 verified the accuracy of this technique in distinguishing between distinct levels of gap junction coupling. Analysis of individual cells revealed that the distribution of coupling across the islet is highly heterogeneous. Analysis of several modulators of gap junction coupling revealed glucose‐ and cAMP‐dependent modulation of gap junction coupling in islets. Finally, FRAP was used to determine cell population specific coupling, where no functional gap junction coupling was observed between α cells and β cells in the islet. The results of this study show FRAP to be a robust technique which provides the cellular resolution to quantify the distribution and regulation of Cx36 gap junction coupling in specific cell populations within the islet. Future studies utilizing this technique may elucidate the role of gap junction coupling in the progression of diabetes and identify mechanisms of gap junction regulation for potential therapies.
Freeman, Alasdair D J; Liu, Yijin; Déclais, Anne-Cécile; Gartner, Anton; Lilley, David M J
2014-12-12
Processing of Holliday junctions is essential in recombination. We have identified the gene for the junction-resolving enzyme GEN1 from the thermophilic fungus Chaetomium thermophilum and expressed the N-terminal 487-amino-acid section. The protein is a nuclease that is highly selective for four-way DNA junctions, cleaving 1nt 3' to the point of strand exchange on two strands symmetrically disposed about a diagonal axis. CtGEN1 binds to DNA junctions as a discrete homodimer with nanomolar affinity. Analysis of the kinetics of cruciform cleavage shows that cleavage of the second strand occurs an order of magnitude faster than the first cleavage so as to generate a productive resolution event. All these properties are closely similar to those described for bacterial, phage and mitochondrial junction-resolving enzymes. CtGEN1 is also similar in properties to the human enzyme but lacks the problems with aggregation that currently prevent detailed analysis of the latter protein. CtGEN1 is thus an excellent enzyme with which to engage in biophysical and structural analysis of eukaryotic GEN1. Copyright © 2014. Published by Elsevier Ltd.
Experimental Testing and Modeling Analysis of Solute Mixing at Water Distribution Pipe Junctions
Flow dynamics at a pipe junction controls particle trajectories, solute mixing and concentrations in downstream pipes. Here we have categorized pipe junctions into five hydraulic types, for which flow distribution factors and analytical equations for describing the solute mixing ...
Hines, Thomas; Díez-Pérez, Ismael; Nakamura, Hisao; Shimazaki, Tomomi; Asai, Yoshihiro; Tao, Nongjian
2013-03-06
We report controlling the formation of single-molecule junctions by means of electrochemically reducing two axialdiazonium terminal groups on a molecule, thereby producing direct Au-C covalent bonds in situ between the molecule and gold electrodes. We report a yield enhancement in molecular junction formation as the electrochemical potential of both junction electrodes approach the reduction potential of the diazonium terminal groups. Step length analysis shows that the molecular junction is significantly more stable, and can be pulled over a longer distance than a comparable junction created with amine anchoring bonds. The stability of the junction is explained by the calculated lower binding energy associated with the direct Au-C bond compared with the Au-N bond.
Hiremath, Pavana J; Farmer, Andrew; Cannon, Steven B; Woodward, Jimmy; Kudapa, Himabindu; Tuteja, Reetu; Kumar, Ashish; Bhanuprakash, Amindala; Mulaosmanovic, Benjamin; Gujaria, Neha; Krishnamurthy, Laxmanan; Gaur, Pooran M; Kavikishor, Polavarapu B; Shah, Trushar; Srinivasan, Ramamurthy; Lohse, Marc; Xiao, Yongli; Town, Christopher D; Cook, Douglas R; May, Gregory D; Varshney, Rajeev K
2011-10-01
Chickpea (Cicer arietinum L.) is an important legume crop in the semi-arid regions of Asia and Africa. Gains in crop productivity have been low however, particularly because of biotic and abiotic stresses. To help enhance crop productivity using molecular breeding techniques, next generation sequencing technologies such as Roche/454 and Illumina/Solexa were used to determine the sequence of most gene transcripts and to identify drought-responsive genes and gene-based molecular markers. A total of 103,215 tentative unique sequences (TUSs) have been produced from 435,018 Roche/454 reads and 21,491 Sanger expressed sequence tags (ESTs). Putative functions were determined for 49,437 (47.8%) of the TUSs, and gene ontology assignments were determined for 20,634 (41.7%) of the TUSs. Comparison of the chickpea TUSs with the Medicago truncatula genome assembly (Mt 3.5.1 build) resulted in 42,141 aligned TUSs with putative gene structures (including 39,281 predicted intron/splice junctions). Alignment of ∼37 million Illumina/Solexa tags generated from drought-challenged root tissues of two chickpea genotypes against the TUSs identified 44,639 differentially expressed TUSs. The TUSs were also used to identify a diverse set of markers, including 728 simple sequence repeats (SSRs), 495 single nucleotide polymorphisms (SNPs), 387 conserved orthologous sequence (COS) markers, and 2088 intron-spanning region (ISR) markers. This resource will be useful for basic and applied research for genome analysis and crop improvement in chickpea. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd. No claim to original US government works.
Guo, Xianwu; Castillo-Ramírez, Santiago; González, Víctor; Bustos, Patricia; Luís Fernández-Vázquez, José; Santamaría, Rosa Isela; Arellano, Jesús; Cevallos, Miguel A; Dávila, Guillermo
2007-01-01
Background Fabaceae (legumes) is one of the largest families of flowering plants, and some members are important crops. In contrast to what we know about their great diversity or economic importance, our knowledge at the genomic level of chloroplast genomes (cpDNAs or plastomes) for these crops is limited. Results We sequenced the complete genome of the common bean (Phaseolus vulgaris cv. Negro Jamapa) chloroplast. The plastome of P. vulgaris is a 150,285 bp circular molecule. It has gene content similar to that of other legume plastomes, but contains two pseudogenes, rpl33 and rps16. A distinct inversion occurred at the junction points of trnH-GUG/rpl14 and rps19/rps8, as in adzuki bean [1]. These two pseudogenes and the inversion were confirmed in 10 varieties representing the two domestication centers of the bean. Genomic comparative analysis indicated that inversions generally occur in legume plastomes and the magnitude and localization of insertions/deletions (indels) also vary. The analysis of repeat sequences demonstrated that patterns and sequences of tandem repeats had an important impact on sequence diversification between legume plastomes and tandem repeats did not belong to dispersed repeats. Interestingly, P. vulgaris plastome had higher evolutionary rates of change on both genomic and gene levels than G. max, which could be the consequence of pressure from both mutation and natural selection. Conclusion Legume chloroplast genomes are widely diversified in gene content, gene order, indel structure, abundance and localization of repetitive sequences, intracellular sequence exchange and evolutionary rates. The P. vulgaris plastome is a rapidly evolving genome. PMID:17623083
Fowler, Stephanie; Akins, Mark; Bennett, Steffany A L
2016-01-01
Protein interaction networks at gap junction plaques are increasingly implicated in a variety of intracellular signaling cascades. Identifying protein interactions of integral membrane proteins is a valuable tool for determining channel function. However, several technical challenges exist. Subcellular fractionation of the bait protein matrix is usually required to identify less abundant proteins in complex homogenates. Sufficient solvation of the lipid environment without perturbation of the protein interactome must also be achieved. The present chapter describes the flotation of light and heavy liver tissue membrane microdomains to facilitate the identification and analysis of endogenous gap junction proteins and includes technical notes for translation to other integral membrane proteins, tissues, or cell culture models. These procedures are valuable tools for the enrichment of gap junction membrane compartments and for the identification of gap junction signaling interactomes.
Beckmann, Anja; Schubert, Madline; Hainz, Nadine; Haase, Alexandra; Martin, Ulrich; Tschernig, Thomas; Meier, Carola
2016-11-01
Gap junction proteins are essential for direct intercellular communication but also influence cellular differentiation and migration. The expression of various connexin gap junction proteins has been demonstrated in embryonic stem cells, with Cx43 being the most intensely studied. As Cx43 is the most prominent gap junction protein in the heart, cardiomyocyte-differentiated stem cells have been studied intensely. To date, however, little is known about the expression and the subcellular distribution of Cx43 in undifferentiated stem cells or about the structural arrangement of channels. We, therefore, here investigate expression of Cx43 in undifferentiated human cord-blood-derived induced pluripotent stem cells (hCBiPS2). For this purpose, we carried out quantitative real-time PCR and immunohistochemistry. For analysis of Cx43 ultrastructure and protein assembly, we performed freeze-fracture replica immunogold labeling (FRIL). Cx43 expression was detected at mRNA and protein level in hCBIPS2 cells. For the first time, ultrastructural data are presented on gap junction morphology in induced pluripotent stem (iPS) cells from cord blood: Our FRIL and electron microscopical analysis revealed the occurrence of gap junction plaques in undifferentiated iPS cells. In addition, these gap junctions were shown to contain the gap junction protein Cx43.
Bindewald, Eckart; Grunewald, Calvin; Boyle, Brett; O'Connor, Mary; Shapiro, Bruce A
2008-10-01
One approach to designing RNA nanoscale structures is to use known RNA structural motifs such as junctions, kissing loops or bulges and to construct a molecular model by connecting these building blocks with helical struts. We previously developed an algorithm for detecting internal loops, junctions and kissing loops in RNA structures. Here we present algorithms for automating or assisting many of the steps that are involved in creating RNA structures from building blocks: (1) assembling building blocks into nanostructures using either a combinatorial search or constraint satisfaction; (2) optimizing RNA 3D ring structures to improve ring closure; (3) sequence optimisation; (4) creating a unique non-degenerate RNA topology descriptor. This effectively creates a computational pipeline for generating molecular models of RNA nanostructures and more specifically RNA ring structures with optimized sequences from RNA building blocks. We show several examples of how the algorithms can be utilized to generate RNA tecto-shapes.
Bindewald, Eckart; Grunewald, Calvin; Boyle, Brett; O’Connor, Mary; Shapiro, Bruce A.
2013-01-01
One approach to designing RNA nanoscale structures is to use known RNA structural motifs such as junctions, kissing loops or bulges and to construct a molecular model by connecting these building blocks with helical struts. We previously developed an algorithm for detecting internal loops, junctions and kissing loops in RNA structures. Here we present algorithms for automating or assisting many of the steps that are involved in creating RNA structures from building blocks: (1) assembling building blocks into nanostructures using either a combinatorial search or constraint satisfaction; (2) optimizing RNA 3D ring structures to improve ring closure; (3) sequence optimisation; (4) creating a unique non-degenerate RNA topology descriptor. This effectively creates a computational pipeline for generating molecular models of RNA nanostructures and more specifically RNA ring structures with optimized sequences from RNA building blocks. We show several examples of how the algorithms can be utilized to generate RNA tecto-shapes. PMID:18838281
Microhomology-mediated end joining induces hypermutagenesis at breakpoint junctions
Li, Fuyang; Villarreal, Diana; Shim, Jae Hoon; Myung, Kyungjae; Shim, Eun Yong; Lee, Sang Eun
2017-01-01
Microhomology (MH) flanking a DNA double-strand break (DSB) drives chromosomal rearrangements but its role in mutagenesis has not yet been analyzed. Here we determined the mutation frequency of a URA3 reporter gene placed at multiple locations distal to a DSB, which is flanked by different sizes (15-, 18-, or 203-bp) of direct repeat sequences for efficient repair in budding yeast. Induction of a DSB accumulates mutations in the reporter gene situated up to 14-kb distal to the 15-bp MH, but more modestly to those carrying 18- and 203-bp or no homology. Increased mutagenesis in MH-mediated end joining (MMEJ) appears coupled to its slower repair kinetics and the extensive resection occurring at flanking DNA. Chromosomal translocations via MMEJ also elevate mutagenesis of the flanking DNA sequences 7.1 kb distal to the breakpoint junction as compared to those without MH. The results suggest that MMEJ could destabilize genomes by triggering structural alterations and increasing mutation burden. PMID:28419093
NASA Technical Reports Server (NTRS)
Goldman, H.; Wolf, M.
1979-01-01
Analyses of slicing processes and junction formation processes are presented. A simple method for evaluation of the relative economic merits of competing process options with respect to the cost of energy produced by the system is described. An energy consumption analysis was developed and applied to determine the energy consumption in the solar module fabrication process sequence, from the mining of the SiO2 to shipping. The analysis shows that, in current technology practice, inordinate energy use in the purification step, and large wastage of the invested energy through losses, particularly poor conversion in slicing, as well as inadequate yields throughout. The cell process energy expenditures already show a downward trend based on increased throughput rates. The large improvement, however, depends on the introduction of a more efficient purification process and of acceptable ribbon growing techniques.
NASA Astrophysics Data System (ADS)
Sannikov, S. P.; Timohovetz, V. D.; Kuzuek, A. Y.
2017-11-01
This article presents the justification of structurally-technological decisions on a junction perfecting on the intersection of Permyakova and Shirotnaya Streets in Tyumen. The authors made a comparative analysis of typical road junctions. Based on the comparison, the engineering decisions were made for an individual type of transport junctions. Several options of individual design were proposed and analyzed and three most suitable types for the road junctions were offered. On the basis of a multilateral studying and evaluation of the developed transport the article further proposed a transport junction with change-side traffic. The use of this type of intersection will increase the road junction capacity, reduce the number of accidents due to conflicting flows reduction which, in its turn, will increase the speed of cars.
Homologous and heterologous recombination between adenovirus vector DNA and chromosomal DNA.
Stephen, Sam Laurel; Sivanandam, Vijayshankar Ganesh; Kochanek, Stefan
2008-11-01
Adenovirus vector DNA is perceived to remain as episome following gene transfer. We quantitatively and qualitatively analysed recombination between high capacity adenoviral vector (HC-AdV) and chromosomal DNA following gene transfer in vitro. We studied homologous and heterologous recombination with a single HC-AdV carrying (i) a large genomic HPRT fragment with the HPRT CHICAGO mutation causing translational stop upon homologous recombination with the HPRT locus and (ii) a selection marker to allow for clonal selection in the event of heterologous recombination. We analysed the sequences at the junctions between vector and chromosomal DNA. In primary cells and in cell lines, the frequency of homologous recombination ranged from 2 x 10(-5) to 1.6 x 10(-6). Heterologous recombination occurred at rates between 5.5 x 10(-3) and 1.1 x 10(-4). HC-AdV DNA integrated via the termini mostly as intact molecules. Analysis of the junction sequences indicated vector integration in a relatively random manner without an obvious preference for particular chromosomal regions, but with a preference for integration into genes. Integration into protooncogenes or tumor suppressor genes was not observed. Patchy homologies between vector termini and chromosomal DNA were found at the site of integration. Although the majority of integrations had occurred without causing mutations in the chromosomal DNA, cases of nucleotide substitutions and insertions were observed. In several cases, deletions of even relative large chromosomal regions were likely. These results extend previous information on the integration patterns of adenovirus vector DNA and contribute to a risk-benefit assessment of adenovirus-mediated gene transfer.
2011-01-01
Background During development, the branchial mesoderm of Torpedo californica transdifferentiates into an electric organ capable of generating high voltage discharges to stun fish. The organ contains a high density of cholinergic synapses and has served as a biochemical model for the membrane specialization of myofibers, the neuromuscular junction (NMJ). We studied the genome and proteome of the electric organ to gain insight into its composition, to determine if there is concordance with skeletal muscle and the NMJ, and to identify novel synaptic proteins. Results Of 435 proteins identified, 300 mapped to Torpedo cDNA sequences with ≥2 peptides. We identified 14 uncharacterized proteins in the electric organ that are known to play a role in acetylcholine receptor clustering or signal transduction. In addition, two human open reading frames, C1orf123 and C6orf130, showed high sequence similarity to electric organ proteins. Our profile lists several proteins that are highly expressed in skeletal muscle or are muscle specific. Synaptic proteins such as acetylcholinesterase, acetylcholine receptor subunits, and rapsyn were present in the electric organ proteome but absent in the skeletal muscle proteome. Conclusions Our integrated genomic and proteomic analysis supports research describing a muscle-like profile of the organ. We show that it is a repository of NMJ proteins but we present limitations on its use as a comprehensive model of the NMJ. Finally, we identified several proteins that may become candidates for signaling proteins not previously characterized as components of the NMJ. PMID:21798097
Zhang, Qun; Hu, Huan; Liu, Hongda; Jin, Jiajia; Zhu, Peiyuan; Wang, Shujun; Shen, Kaikai; Hu, Yangbo; Li, Zhou; Zhan, Ping; Zhu, Suhua; Fan, Hang; Zhang, Jianya; Lv, Tangfeng; Song, Yong
2018-05-29
Platelets are implicated as key players in the metastatic dissemination of tumor cells. Previous evidence demonstrated platelets retained cytoplasmic RNAs with physiologically activity, splicing pre-mRNA to mRNA and translating into functional proteins in response to external stimulation. Recently, platelets gene profile of healthy or diseased individuals were characterized with the help of RNA sequencing (RNA-Seq) in some studies, leading to new insights into the mechanisms underlying disease pathogenesis. In this study, we performed RNA-seq in platelets from 7 healthy individuals and 15 non-small cell lung cancer (NSCLC) patients. Our data revealed a subset of near universal differently expressed gene (DEG) profiles in platelets of metastatic NSCLC compared to healthy individuals, including 626 up-regulated RNAs (mRNAs and ncRNAs) and 1497 down-regulated genes. The significant over-expressed genes showed enrichment in focal adhesion, platelets activation, gap junction and adherens junction pathways. The DEGs also included previously reported tumor-related genes such as PDGFR, VEGF, EGF, etc., verifying the consistence and significance of platelet RNA-Seq in oncology study. We also validated several up-regulated DEGs involved in tumor cell-induced platelet aggregation (TCIPA) and tumorigenesis. Additionally, transcriptomic comparison analyses of NSCLC subgroups were conducted. Between non-metastatic and metastatic NSCLC patients, 526 platelet DEGs were identified with the most altered expression. The outcomes from subgroup analysis between lung adenocarcinoma and lung squamous cell carcinoma demonstrated the diagnostic potential of platelet RNA-Seq on distinguishing tumor histological types. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
NASA Technical Reports Server (NTRS)
1982-01-01
Liquid diffusion masks and liquid applied dopants to replace the CVD Silox masking and gaseous diffusion operations specified for forming junctions in the Westinghouse baseline process sequence for producing solar cells from dendritic web silicon were investigated.
Fukami, Maki; Dateki, Sumito; Kato, Fumiko; Hasegawa, Yukihiro; Mochizuki, Hiroshi; Horikawa, Reiko; Ogata, Tsutomu
2008-01-01
Although short-stature homeobox-containing gene (SHOX ) haploinsufficiency is responsible for Léri-Weill dyschondrosteosis (LWD), the molecular defect has not been identified in approximately 20% of Japanese LWD patients. Furthermore, although high prevalence of microdeletions affecting SHOX is primarily ascribed to the presence of repeat sequences such as Alu elements around SHOX, it remains to be determined whether microdeletions are actually mediated by repeat sequences. We performed multiple ligation probe amplification (MLPA) assay in six Japanese LWD patients with apparently normal SHOX, followed by fluorescent in situ hybridization (FISH) analysis and sequencing for polymerase chain reaction (PCR) products encompassing the deletion junctions in patients with abnormal MLPA patterns. Consequently, heterozygous intragenic deletions were identified in three cases, i.e., a 5,906-bp deletion involving exons 4-5 in case 1, a 5,594-bp deletion involving exons 4-6a in case 2, and a 50,199-bp deletion involving exons 4-6b in case 3. The deletion breakpoints of cases 1 and 2 were present in nonrepeat sequences, whereas those of case 3 resided within Alu elements. The results suggest that cryptic SHOX intragenic deletions account for a small fraction of LWD and that microdeletions affecting SHOX can be generated by repeat-sequence-mediated aberrant recombinations and by nonhomologous end joining.
Unusual Intron Conservation near Tissue-Regulated Exons Found by Splicing Microarrays
Sugnet, Charles W; Srinivasan, Karpagam; Clark, Tyson A; O'Brien, Georgeann; Cline, Melissa S; Wang, Hui; Williams, Alan; Kulp, David; Blume, John E; Haussler, David; Ares, Manuel
2006-01-01
Alternative splicing contributes to both gene regulation and protein diversity. To discover broad relationships between regulation of alternative splicing and sequence conservation, we applied a systems approach, using oligonucleotide microarrays designed to capture splicing information across the mouse genome. In a set of 22 adult tissues, we observe differential expression of RNA containing at least two alternative splice junctions for about 40% of the 6,216 alternative events we could detect. Statistical comparisons identify 171 cassette exons whose inclusion or skipping is different in brain relative to other tissues and another 28 exons whose splicing is different in muscle. A subset of these exons is associated with unusual blocks of intron sequence whose conservation in vertebrates rivals that of protein-coding exons. By focusing on sets of exons with similar regulatory patterns, we have identified new sequence motifs implicated in brain and muscle splicing regulation. Of note is a motif that is strikingly similar to the branchpoint consensus but is located downstream of the 5′ splice site of exons included in muscle. Analysis of three paralogous membrane-associated guanylate kinase genes reveals that each contains a paralogous tissue-regulated exon with a similar tissue inclusion pattern. While the intron sequences flanking these exons remain highly conserved among mammalian orthologs, the paralogous flanking intron sequences have diverged considerably, suggesting unusually complex evolution of the regulation of alternative splicing in multigene families. PMID:16424921
An RNAi-enhanced Logic Circuit for Cancer Specific Detection and Destruction
2010-07-01
Bcl-2 family: mBax (Mus musculus), hBax ( Homo sapiens ), and its mutant hBax-S184A [4]. A plasmid containing the tested gene was transfected into HEK...the far-red fluorescent protein mKate to express the Gata3 mStaple. Intron- feature sequences – donor site, branch point, poly- pyrimidine tract, and...intron-exon junction. Among the donor and acceptor sequences found in literature our intron features were chosen according SplicePort [5], an
A four-way junction with triple-helical arms: design, characterization, and stability.
Makube, N; Klump, H H
2000-05-01
The formation of the four-way junction containing four triple-helical arms has been demonstrated using chemical methods (polyacrylamide gel electrophoresis and chemical footprinting using OsO(4) as a probe) and physical methods (UV absorbance melting and DSC). The junction J(T1T3) was assembled from two 20-mer purine strands and two 44-mer pyrimidine strands. To determine the contribution of the different arms to the stability of the complete structure of J(T1T3), the junction was compared to two simplified substructures, J(T1) and J(T3), respectively. Common to these complexes is the underlying double-helical four-way junction Js. Addition of Na(+) had a profound effect on stabilizing and subsequently folding the junctions into the stacked X-structures. The following results support the structure present: (i) The native polyacrylamide electrophoresis exhibits only a single band(s) corresponding to one species present when all four single strands are mixed in equal amounts. (ii) OsO(4) modifications were investigated at pH 5.0 and in the presence of 10 mM Mg(2+) and 100 mM Na(+). There is no cleavage of thymine residues at the branch point and throughout the structure. (iii) The thermal unfolding of J(T1) and J(T3) illustrates that the triple-helical arms are more stable than the double-helical arms which are contained in these junctions and that J(T1T3) with four triple-helical arms is slightly more stable than J(T1) and J(T3). (iv) The calorimetric transition enthalpies determined for the arms of J(T1T3) are comparable to those associated with the unfolding of its corresponding arms in J(T1) and J(T3). The results also illustrate that the formation of the junctions is not restricted by the pH, [Na(+)], sequence composition of the arms, and/or the loop position. Copyright 2000 Academic Press.
Alternative splicing regulated by butyrate in bovine epithelial cells.
Wu, Sitao; Li, Congjun; Huang, Wen; Li, Weizhong; Li, Robert W
2012-01-01
As a signaling molecule and an inhibitor of histone deacetylases (HDACs), butyrate exerts its impact on a broad range of biological processes, such as apoptosis and cell proliferation, in addition to its critical role in energy metabolism in ruminants. This study examined the effect of butyrate on alternative splicing in bovine epithelial cells using RNA-seq technology. Junction reads account for 11.28 and 12.32% of total mapped reads between the butyrate-treated (BT) and control (CT) groups. 201,326 potential splicing junctions detected were supported by ≥ 3 junction reads. Approximately 94% of these junctions conformed to the consensus sequence (GT/AG) while ~3% were GC/AG junctions. No AT/AC junctions were observed. A total of 2,834 exon skipping events, supported by a minimum of 3 junction reads, were detected. At least 7 genes, their mRNA expression significantly affected by butyrate, also had exon skipping events differentially regulated by butyrate. Furthermore, COL5A3, which was induced 310-fold by butyrate (FDR <0.001) at the gene level, had a significantly higher number of junction reads mapped to Exon#8 (Donor) and Exon#11 (Acceptor) in BT. This event had the potential to result in the formation of a COL5A3 mRNA isoform with 2 of the 69 exons missing. In addition, 216 differentially expressed transcript isoforms regulated by butyrate were detected. For example, Isoform 1 of ORC1 was strongly repressed by butyrate while Isoform 2 remained unchanged. Butyrate physically binds to and inhibits all zinc-dependent HDACs except HDAC6 and HDAC10. Our results provided evidence that butyrate also regulated deacetylase activities of classical HDACs via its transcriptional control. Moreover, thirteen gene fusion events differentially affected by butyrate were identified. Our results provided a snapshot into complex transcriptome dynamics regulated by butyrate, which will facilitate our understanding of the biological effects of butyrate and other HDAC inhibitors.
Giudicelli, Véronique; Duroux, Patrice; Kossida, Sofia; Lefranc, Marie-Paule
2017-06-26
IMGT®, the international ImMunoGeneTics information system® ( http://www.imgt.org ), was created in 1989 in Montpellier, France (CNRS and Montpellier University) to manage the huge and complex diversity of the antigen receptors, and is at the origin of immunoinformatics, a science at the interface between immunogenetics and bioinformatics. Immunoglobulins (IG) or antibodies and T cell receptors (TR) are managed and described in the IMGT® databases and tools at the level of receptor, chain and domain. The analysis of the IG and TR variable (V) domain rearranged nucleotide sequences is performed by IMGT/V-QUEST (online since 1997, 50 sequences per batch) and, for next generation sequencing (NGS), by IMGT/HighV-QUEST, the high throughput version of IMGT/V-QUEST (portal begun in 2010, 500,000 sequences per batch). In vitro combinatorial libraries of engineered antibody single chain Fragment variable (scFv) which mimic the in vivo natural diversity of the immune adaptive responses are extensively screened for the discovery of novel antigen binding specificities. However the analysis of NGS full length scFv (~850 bp) represents a challenge as they contain two V domains connected by a linker and there is no tool for the analysis of two V domains in a single chain. The functionality "Analyis of single chain Fragment variable (scFv)" has been implemented in IMGT/V-QUEST and, for NGS, in IMGT/HighV-QUEST for the analysis of the two V domains of IG and TR scFv. It proceeds in five steps: search for a first closest V-REGION, full characterization of the first V-(D)-J-REGION, then search for a second V-REGION and full characterization of the second V-(D)-J-REGION, and finally linker delimitation. For each sequence or NGS read, positions of the 5'V-DOMAIN, linker and 3'V-DOMAIN in the scFv are provided in the 'V-orientated' sense. Each V-DOMAIN is fully characterized (gene identification, sequence description, junction analysis, characterization of mutations and amino changes). The functionality is generic and can analyse any IG or TR single chain nucleotide sequence containing two V domains, provided that the corresponding species IMGT reference directory is available. The "Analysis of single chain Fragment variable (scFv)" implemented in IMGT/V-QUEST and, for NGS, in IMGT/HighV-QUEST provides the identification and full characterization of the two V domains of full-length scFv (~850 bp) nucleotide sequences from combinatorial libraries. The analysis can also be performed on concatenated paired chains of expressed antigen receptor IG or TR repertoires.
An ultrastructural analysis of the epithelial-fiber interface (EFI) in primate lenses.
Kuszak, J R; Novak, L A; Brown, H G
1995-11-01
The purpose of this study was to conduct a comprehensive ultrastructural analysis of the epithelial-fiber interface (EFI) in normal adult primate (Macaque nemestrina and fascicularis; 6-9 years old, n = 10) lenses. Scanning electron microscopy (SEM) was used to initially characterize the gross size, shape and three-dimensional organization of central zone (cz) epithelial cells and the anterior ends of elongating fibers beneath these cells. This fiducial information was essential to properly orient lens pieces in freeze fracture specimen carriers for the production of replicas with unambiguously identifiable EFI. Transmission electron microscopy (TEM) of replicas and thin-sectioned material were used to ultrastructurally analyse the cz EFI. TEM thin-sectioned material was also used to ultrastructurally analyse the pregerminative (pgz), germinative (gz) and transitional zone (tz) EFI. Correlative SEM and TEM of cz EFI components revealed that the apical membrane of both epithelial and elongating fiber cells were irregularly polygonal in shape, and aligned in parallel as smooth, concave-convex surfaces. However, whereas epithelial cell apical surfaces had minimal size variation, elongating fibers were larger and considerably variable in size. Quantitative analysis of > 10000 micron2 cz elongating fiber apical surfaces failed to detect any gap junctions defined in freeze fracture replicas as complementary aggregates of transmembrane proteins (connexons) conjoined across a narrowed extracellular space. However, a comparable frequency of vesicular events was noted in this region as quantified previously in adult and embryonic chick lens. Correlative TEM analysis > 1500 linear micrometers of thin-sectioned EFI from this region confirmed the presence of epithelial-epithelial gap junctions, elongating fiber-elongating fiber gap junctions, and an extreme paucity of epithelial-elongating fiber gap junctions. In contrast, TEM analysis of > 1000 linear micrometers of thin-sectioned pgz, gz and tz EFI, confirmed the presence of epithelial-epithelial gap junctions, elongating fiber-elongating fiber gap junctions, numerous epithelial-elongating fiber adherens junctions and a few epithelial-elongating fiber gap junctions. Thus, the results of this and previous quantitative morphological and physiological studies (electronic and dye coupling) demonstrate that there is limited coupling between cz epithelial cells and underlying elongating fibers. Furthermore, the absence of gap junctional plaques in cz EFI freeze-fracture replicas and either pentalaminar or septalaminar profiles in correlative thin-sections, suggests that this limited coupling could be mediated via isolated gap junction channels. However, the results of this and previous quantitative studies further show that a greater degree of coupling exists across the pgz, gz and tz regions of the EFI and that this coupling is likely to be mediated by gap junction plaques. Finally, this and other studies continue to demonstrate that transcytotic processes play a role in lens physiology at the EFI.
Ning, N; Wen, Y; Li, Y; Li, J
2013-11-01
Nonsteroidal anti-inflammatory drugs (NSAIDs) are commonly used to manage the pain and inflammation. NSAIDs can cause serious side effects, including vision problems. However, the underlying mechanisms are still unclear. Therefore, we aimed to investigate the effect of meclofenamic acid (MFA) on retinal pigment epithelium (RPE). In our study, we applied image analysis and whole-cell patch clamp recording to directly measure the effect of MFA on the gap junctional coupling between RPE cells. Analysis of Lucifer yellow (LY) transfer revealed that the gap junction communication existed between RPE cells. Functional experiments using the whole-cell configuration of the patch clamp technique showed that a gap junction conductance also existed between this kind of cells. Importantly, MFA largely inhibited the gap junction conductance and induced the uncoupling of RPE cells. Other NSAIDs, like aspirin and flufenamic acid (FFA), had the same effect. The gap junction functionally existed in RPE cells, which can be blocked by MFA. These findings may explain, at least partially, the vision problems with certain clinically used NSAIDs.
NASA Technical Reports Server (NTRS)
Vonroos, O.
1978-01-01
A standard procedure for the determination of the minority carrier diffusion length by means of a scanning electron microscope (SEM) consists in scanning across an angle-lapped surface of a P-N junction and measuring the resultant short circuit current I sub sc as a function of beam position. A detailed analysis of the I sub sc originating from this configuration is presented. It is found that, for a point source excitation, the I sub sc depends very simply on x, the variable distance between the surface and the junction edge. The expression for the I sub sc of a planar junction device is well known. If d, the constant distance between the plane of the surface of the semiconductor and the junction edge in the expression for the I of a planar junction is merely replaced by x, the variable distance of the corresponding angle-lapped junction, an expression results which is correct to within a small fraction of a percent as long as the angle between the surfaces, 2 theta sub 1, is smaller than 10 deg.
Extracellular domains play different roles in gap junction formation and docking compatibility.
Bai, Donglin; Wang, Ao Hong
2014-02-15
GJ (gap junction) channels mediate direct intercellular communication and play an important role in many physiological processes. Six connexins oligomerize to form a hemichannel and two hemichannels dock together end-to-end to form a GJ channel. Connexin extracellular domains (E1 and E2) have been shown to be important for the docking, but the molecular mechanisms behind the docking and formation of GJ channels are not clear. Recent developments in atomic GJ structure and functional studies on a series of connexin mutants revealed that E1 and E2 are likely to play different roles in the docking. Non-covalent interactions at the docking interface, including hydrogen bonds, are predicted to form between interdocked extracellular domains. Protein sequence alignment analysis on the docking compatible/incompatible connexins indicate that the E1 domain is important for the formation of the GJ channel and the E2 domain is important in the docking compatibility in heterotypic channels. Interestingly, the hydrogen-bond forming or equivalent residues in both E1 and E2 domains are mutational hot spots for connexin-linked human diseases. Understanding the molecular mechanisms of GJ docking can assist us to develop novel strategies in rescuing the disease-linked connexin mutants.
Length Variation in Mitochondrial DNA of the Minnow Cyprinella Spiloptera
Broughton, R. E.; Dowling, T. E.
1994-01-01
Length differences in animal mitochondrial DNA (mtDNA) are common, frequently due to variation in copy number of direct tandem duplications. While such duplications appear to form without great difficulty in some taxonomic groups, they appear to be relatively short-lived, as typical duplication products are geographically restricted within species and infrequently shared among species. To better understand such length variation, we have studied a tandem and direct duplication of approximately 260 bp in the control region of the cyprinid fish, Cyprinella spiloptera. Restriction site analysis of 38 individuals was used to characterize population structure and the distribution of variation in repeat copy number. This revealed two length variants, including individuals with two or three copies of the repeat, and little geographic structure among populations. No standard length (single copy) genomes were found and heteroplasmy, a common feature of length variation in other taxa, was absent. Nucleotide sequence of tandem duplications and flanking regions localized duplication junctions in the phenylalanine tRNA and near the origin of replication. The locations of these junctions and the stability of folded repeat copies support the hypothesized importance of secondary structures in models of duplication formation. PMID:8001785
Simonen, Marja-Leena; Roivainen, Merja; Iber, Jane; Burns, Cara; Hovi, Tapani
2010-01-01
In 1984, a wild type 3 poliovirus (PV3/FIN84) spread all over Finland causing nine cases of paralytic poliomyelitis and one case of aseptic meningitis. The outbreak was ended in 1985 with an intensive vaccination campaign. By limited sequence comparison with previously isolated PV3 strains, closest relatives of PV3/FIN84 were found among strains circulating in the Mediterranean region. Now we wanted to reanalyse the relationships using approaches currently exploited in poliovirus surveillance. Cell lysates of 22 strains isolated during the outbreak and stored frozen were subjected to RT-PCR amplification in three genomic regions without prior subculture. Sequences of the entire VP1 coding region, 150 nucleotides in the VP1-2A junction, most of the 5' non-coding region, partial sequences of the 3D RNA polymerase coding region and partial 3' non-coding region were compared within the outbreak and with sequences available in data banks. In addition, complete nucleotide sequences were obtained for 2 strains isolated from two different cases of disease during the outbreak. The results confirmed the previously described wide intraepidemic variation of the strains, including amino acid substitutions in antigenic sites, as well as the likely Mediterranean region origin of the strains. Simplot and bootscanning analyses of the complete genomes indicated complicated evolutionary history of the non-capsid coding regions of the genome suggesting several recombinations with different HEV-C viruses in the past.
Gap junctions modulate glioma invasion by direct transfer of microRNA.
Hong, Xiaoting; Sin, Wun Chey; Harris, Andrew L; Naus, Christian C
2015-06-20
The invasiveness of high-grade glioma is the primary reason for poor survival following treatment. Interaction between glioma cells and surrounding astrocytes are crucial to invasion. We investigated the role of gap junction mediated miRNA transfer in this context. By manipulating gap junctions with a gap junction inhibitor, siRNAs, and a dominant negative connexin mutant, we showed that functional glioma-glioma gap junctions suppress glioma invasion while glioma-astrocyte and astrocyte-astrocyte gap junctions promote it in an in vitro transwell invasion assay. After demonstrating that glioma-astrocyte gap junctions are permeable to microRNA, we compared the microRNA profiles of astrocytes before and after co-culture with glioma cells, identifying specific microRNAs as candidates for transfer through gap junctions from glioma cells to astrocytes. Further analysis showed that transfer of miR-5096 from glioma cells to astrocytes is through gap junctions; this transfer is responsible, in part, for the pro-invasive effect. Our results establish a role for glioma-astrocyte gap junction mediated microRNA signaling in modulation of glioma invasive behavior, and that gap junction coupling among astrocytes magnifies the pro-invasive signaling. Our findings reveal the potential for therapeutic interventions based on abolishing alteration of stromal cells by tumor cells via manipulation of microRNA and gap junction channel activity.
Gap junctions modulate glioma invasion by direct transfer of microRNA
Hong, Xiaoting; Sin, Wun Chey; Harris, Andrew L.; Naus, Christian C.
2015-01-01
The invasiveness of high-grade glioma is the primary reason for poor survival following treatment. Interaction between glioma cells and surrounding astrocytes are crucial to invasion. We investigated the role of gap junction mediated miRNA transfer in this context. By manipulating gap junctions with a gap junction inhibitor, siRNAs, and a dominant negative connexin mutant, we showed that functional glioma-glioma gap junctions suppress glioma invasion while glioma-astrocyte and astrocyte-astrocyte gap junctions promote it in an in vitro transwell invasion assay. After demonstrating that glioma-astrocyte gap junctions are permeable to microRNA, we compared the microRNA profiles of astrocytes before and after co-culture with glioma cells, identifying specific microRNAs as candidates for transfer through gap junctions from glioma cells to astrocytes. Further analysis showed that transfer of miR-5096 from glioma cells to astrocytes is through gap junctions; this transfer is responsible, in part, for the pro-invasive effect. Our results establish a role for glioma-astrocyte gap junction mediated microRNA signaling in modulation of glioma invasive behavior, and that gap junction coupling among astrocytes magnifies the pro-invasive signaling. Our findings reveal the potential for therapeutic interventions based on abolishing alteration of stromal cells by tumor cells via manipulation of microRNA and gap junction channel activity. PMID:25978028
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tarlinton, D.; Strasser, A.; McLean, M.
1995-04-01
Mouse B cell precursors containing Ig D{sub H}J{sub H} junctions in one particular reading frame are selectively lost during B cell development. In this register, arbitrarily referred to as reading frame 2, D{sub H}J{sub H} junctions give rise to an open reading frame starting upstream of the D{sub H} element and including the D{sub H}J{sub H}-peptide fused to the constant region of IgM. Expression of this protein, called D{mu}, has been strongly implicated in the loss of B cell precursors containing reading frame 2 D{sub H}J{sub H} junctions. In an attempt to elucidate the means of D{mu} counterselection, we havemore » examined the reading frame distribution of D{sub H}J{sub H} junctions in peripheral B cells from mice transgenic for either the human bcl-2 oncogene or for a functionally rearranged Ig {mu} heavy chain. In bcl-2 transgenic mice, reading frame 2 accounted for < 5% of the D{sub H}J{sub H} junctions in peripheral B cells, a value not significantly different from controls. Reading frames 1 and 3 were equally represented among the remaining junctions. By contrast, the reading frame distribution of endogenous D{sub H}J{sub H} junctions in splenic B cells from Ig {mu} heavy chain transgenic mice showed no evidence of bias against D{mu} encoding D{sub H}J{sub H} junctions. Reading frames 2 and 3 accounted for 27% and 30% of the sequenced D{sub H}J{sub H} junctions, respectively, and the remaining 43% were reading frame 1. Thus although the presence of BCL-2 cannot prevent the selective loss of reading frame 2 D{sub H}J{sub H} B cells, a functional {mu} heavy chain can. These results suggest that D{mu}-expressing B cell precursors may be selectively lost because of the premature and inappropriate cessation of heavy chain gene rearrangement rather than because of the induction of an apoptotic process which can be blocked by BCL-2. 42 refs., 4 figs., 4 tabs.« less
Evaluation of the Kinetic Property of Single-Molecule Junctions by Tunneling Current Measurements.
Harashima, Takanori; Hasegawa, Yusuke; Kiguchi, Manabu; Nishino, Tomoaki
2018-01-01
We investigated the formation and breaking of single-molecule junctions of two kinds of dithiol molecules by time-resolved tunneling current measurements in a metal nanogap. The resulting current trajectory was statistically analyzed to determine the single-molecule conductance and, more importantly, to reveal the kinetic property of the single-molecular junction. These results suggested that combining a measurement of the single-molecule conductance and statistical analysis is a promising method to uncover the kinetic properties of the single-molecule junction.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schachtner, Michael, E-mail: michael.schachtner@ise.fraunhofer.de; Prado, Marcelo Loyo; Reichmuth, S. Kasimir
2015-09-28
It has been known for a long time that the precise characterization of multi-junction solar cells demands spectrally tunable solar simulators. The calibration of innovative multi-junction solar cells for CPV applications now requires tunable solar simulators which provide high irradiation levels. This paper describes the commissioning and calibration of a flash-based four-lamp simulator to be used for the measurement of multi-junction solar cells with up to four subcells under concentrated light.
Pre-crash scenarios at road junctions: A clustering method for car crash data.
Nitsche, Philippe; Thomas, Pete; Stuetz, Rainer; Welsh, Ruth
2017-10-01
Given the recent advancements in autonomous driving functions, one of the main challenges is safe and efficient operation in complex traffic situations such as road junctions. There is a need for comprehensive testing, either in virtual simulation environments or on real-world test tracks. This paper presents a novel data analysis method including the preparation, analysis and visualization of car crash data, to identify the critical pre-crash scenarios at T- and four-legged junctions as a basis for testing the safety of automated driving systems. The presented method employs k-medoids to cluster historical junction crash data into distinct partitions and then applies the association rules algorithm to each cluster to specify the driving scenarios in more detail. The dataset used consists of 1056 junction crashes in the UK, which were exported from the in-depth "On-the-Spot" database. The study resulted in thirteen crash clusters for T-junctions, and six crash clusters for crossroads. Association rules revealed common crash characteristics, which were the basis for the scenario descriptions. The results support existing findings on road junction accidents and provide benchmark situations for safety performance tests in order to reduce the possible number parameter combinations. Copyright © 2017 Elsevier Ltd. All rights reserved.
Desmosomes: A light microscopic and ultrastructural analysis of desmosomes in odontogenic cysts.
Raju, Pratima; Wadhwan, Vijay; Chaudhary, Minal S
2014-01-01
Desmosomes together with adherens junctions represent the major adhesive cell-cell junctions of epithelial cells. Any damage to these junctions leads to loss of structural balance. The present study was designed to analyze the desmosomal junctions in different odontogenic cysts and compare them with their corresponding hematoxylin and eosin (H and E) stained sections. Ten cases each of odontogenic keratocyst (OKC), dentigerous cysts (DCs), radicular cysts (RCs) and normal mucosa were stained with hematoxylin and eosin. Scanning electron microscopy (SEM) analysis of the sections was then carried out of all the sections. The area of interest on H and E stained section was marked and this marking was later superimposed onto the corresponding unstained sections and were subjected to SEM analysis. OKC at ×1000 magnification showed many prominent desmosomes. However, an increase in the intercellular space was also noted. SEM analysis demonstrated similar findings with the presence of many desmosomes, though they were seen to be damaged and fragile. H and E stained DC under oil immersion did not show any prominent desmosomes. SEM analysis of the same confirmed the observation and very minimal number were seen with a very condense arrangement of the epithelial cells. RC at ×1000 magnification revealed plenty of desmosomes, which were again confirmed by SEM. The number and quality of desmosomal junctions in all the cysts has a role in the clinical behavior of the cyst.
A Single Electrochemical Probe Used for Analysis of Multiple Nucleic Acid Sequences
Mills, Dawn M.; Calvo-Marzal, Percy; Pinzon, Jeffer M.; Armas, Stephanie; Kolpashchikov, Dmitry M.; Chumbimuni-Torres, Karin Y.
2017-01-01
Electrochemical hybridization sensors have been explored extensively for analysis of specific nucleic acids. However, commercialization of the platform is hindered by the need for attachment of separate oligonucleotide probes complementary to a RNA or DNA target to an electrode’s surface. Here we demonstrate that a single probe can be used to analyze several nucleic acid targets with high selectivity and low cost. The universal electrochemical four-way junction (4J)-forming (UE4J) sensor consists of a universal DNA stem-loop (USL) probe attached to the electrode’s surface and two adaptor strands (m and f) which hybridize to the USL probe and the analyte to form a 4J associate. The m adaptor strand was conjugated with a methylene blue redox marker for signal ON sensing and monitored using square wave voltammetry. We demonstrated that a single sensor can be used for detection of several different DNA/RNA sequences and can be regenerated in 30 seconds by a simple water rinse. The UE4J sensor enables a high selectivity by recognition of a single base substitution, even at room temperature. The UE4J sensor opens a venue for a re-useable universal platform that can be adopted at low cost for the analysis of DNA or RNA targets. PMID:29371782
Cho, Sun Young; Law, Chun Yiu; Ng, Kwok Leung; Lam, Ching Wan
2016-04-01
The diagnosis of cranial and nephrogenic diabetes insipidus (DI) can be clinically challenging. The application of molecular genetic analysis can help in resolving diagnostic difficulties. A 3 month-old boy presented with recurrent polyuria was admitted to Intensive Care Unit and was treated as DI. The patient also had a strong family history of polyuria affecting his maternal uncles. Molecular genetic analysis using Single Nucleotide Polymorphism (SNP) array detected a large deletion located at Xq28 region and the breakpoint was identified using PCR and Sanger sequencing. An 11,535 bp novel deletion affecting the entire APVR2 gene and the last intron and exon of the ARHGAP4 gene was confirmed. This large deletion is likely due to the 7-bp microhomology sequence at the junctions of both 5' and 3' breakpoints. No disease-causing mutation was identified for AQP2. We report a novel deletion in a Chinese patient with congenital nephrogenic DI. We suggested that patients with suspected congenital DI should undergo genetic analysis of AVPR2 and AQP2 genes. A definitive diagnosis can benefit patient by treatment of hydrochlorothiazide and amiloride and avoiding unnecessary investigations. Copyright © 2016 Elsevier B.V. All rights reserved.
On simulation of local fluxes in molecular junctions
NASA Astrophysics Data System (ADS)
Cabra, Gabriel; Jensen, Anders; Galperin, Michael
2018-05-01
We present a pedagogical review of the current density simulation in molecular junction models indicating its advantages and deficiencies in analysis of local junction transport characteristics. In particular, we argue that current density is a universal tool which provides more information than traditionally simulated bond currents, especially when discussing inelastic processes. However, current density simulations are sensitive to the choice of basis and electronic structure method. We note that while discussing the local current conservation in junctions, one has to account for the source term caused by the open character of the system and intra-molecular interactions. Our considerations are illustrated with numerical simulations of a benzenedithiol molecular junction.
Monocytic cell junction proteins serve important roles in atherosclerosis via the endoglin pathway
Chen, Lina; Chen, Zhongliang; Ge, Menghua; Tang, Oushan; Cheng, Yinhong; Zhou, Haoliang; Shen, Yu; Qin, Fengming
2017-01-01
The formation of atherosclerosis is recognized to be caused by multiple factors including pathogenesis in monocytes during inflammation. The current study provided evidence that monocytic junctions were significantly altered in patients with atherosclerosis, which suggested an association between cell junctions and atherosclerosis. Claudin-1, occludin-1 and ZO-1 were significantly enhanced in atherosclerosis, indicating that the tight junction pathway was activated during the pathogenesis of atherosclerosis. In addition, the gene expression of 5 connexin members involved in the gap junction pathway were quantified, indicating that connexin 43 and 46 were significantly up-regulated in atherosclerosis. Furthermore, inflammatory factors including endoglin and SMAD were observed, suggesting that immune regulative factors were down-regulated in this pathway. Silicon-based analysis additionally identified that connexins and tight junctions were altered in association with monocytic inflammation regulations, endoglin pathway. The results imply that reduced expression of the immune regulation pathway in monocytes is correlated with the generation of gap junctions and tight junctions which serve important roles in atherosclerosis. PMID:28901429
Direct analysis of Holliday junction resolving enzyme in a DNA origami nanostructure.
Suzuki, Yuki; Endo, Masayuki; Cañas, Cristina; Ayora, Silvia; Alonso, Juan C; Sugiyama, Hiroshi; Takeyasu, Kunio
2014-06-01
Holliday junction (HJ) resolution is a fundamental step for completion of homologous recombination. HJ resolving enzymes (resolvases) distort the junction structure upon binding and prior cleavage, raising the possibility that the reactivity of the enzyme can be affected by a particular geometry and topology at the junction. Here, we employed a DNA origami nano-scaffold in which each arm of a HJ was tethered through the base-pair hybridization, allowing us to make the junction core either flexible or inflexible by adjusting the length of the DNA arms. Both flexible and inflexible junctions bound to Bacillus subtilis RecU HJ resolvase, while only the flexible junction was efficiently resolved into two duplexes by this enzyme. This result indicates the importance of the structural malleability of the junction core for the reaction to proceed. Moreover, cleavage preferences of RecU-mediated reaction were addressed by analyzing morphology of the reaction products. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Advance of Mechanically Controllable Break Junction for Molecular Electronics.
Wang, Lu; Wang, Ling; Zhang, Lei; Xiang, Dong
2017-06-01
Molecular electronics stands for the ultimate size of functional elements, keeping up with an unstoppable trend over the past few decades. As a vital component of molecular electronics, single molecular junctions have attracted significant attention from research groups all over the world. Due to its pronounced superiority, the mechanically controllable break junctions (MCBJ) technique has been widely applied to characterize the dynamic performance of single molecular junctions. This review presents a system analysis for single-molecule junctions and offers an overview of four test-beds for single-molecule junctions, thus offering more insight into the mechanisms of electron transport. We mainly focus on the development of state-of-the-art mechanically controlled break junctions. The three-terminal gated MCBJ approaches are introduced to manipulate the electron transport of molecules, and MCBJs are combined with characterization techniques. Additionally, applications of MCBJs and remarkable properties of single molecules are addressed. Finally, the challenges and perspective for the mechanically controllable break junctions technique are provided.
Weng, Mo
2016-01-01
Although Snail is essential for disassembly of adherens junctions during epithelial–mesenchymal transitions (EMTs), loss of adherens junctions in Drosophila melanogaster gastrula is delayed until mesoderm is internalized, despite the early expression of Snail in that primordium. By combining live imaging and quantitative image analysis, we track the behavior of E-cadherin–rich junction clusters, demonstrating that in the early stages of gastrulation most subapical clusters in mesoderm not only persist, but move apically and enhance in density and total intensity. All three phenomena depend on myosin II and are temporally correlated with the pulses of actomyosin accumulation that drive initial cell shape changes during gastrulation. When contractile myosin is absent, the normal Snail expression in mesoderm, or ectopic Snail expression in ectoderm, is sufficient to drive early disassembly of junctions. In both cases, junctional disassembly can be blocked by simultaneous induction of myosin contractility. Our findings provide in vivo evidence for mechanosensitivity of cell–cell junctions and imply that myosin-mediated tension can prevent Snail-driven EMT. PMID:26754645
Samson, Marie-Laure
2008-01-01
Background The Drosophila gene embryonic lethal abnormal visual system (elav) is the prototype of a gene family present in all metazoans. Its members encode structurally conserved neuronal proteins with three RNA Recognition Motifs (RRM) but they paradoxically act at diverse levels of post-transcriptional regulation. In an attempt to understand the history of this family, we searched for orthologs in eleven completely sequenced genomes, including those of humans, D. melanogaster and C. elegans, for which cDNAs are available. Results We analyzed 23 orthologs/paralogs of elav, and found evidence of gain/loss of gene copy number. For one set of genes, including elav itself, the coding sequences are free of introns and their products most resemble ELAV. The remaining genes show remarkable conservation of their exon organization, and their products most resemble FNE and RBP9, proteins encoded by the two elav paralogs of Drosophila. Remarkably, three of the conserved exon junctions are both close to structural elements, involved respectively in protein-RNA interactions and in the regulation of sub-cellular localization, and in the vicinity of diverse sequence variations. Conclusion The data indicate that the essential elav gene of Drosophila is newly emerged, restricted to dipterans and of retrotransposed origin. We propose that the conserved exon junctions constitute potential sites for sequence/function modifications, and that RRM binding proteins, whose function relies upon plastic RNA-protein interactions, may have played an important role in brain evolution. PMID:18715504
Analysis of the neuroligin 4Y gene in patients with autism.
Yan, Jin; Feng, Jinong; Schroer, Richard; Li, Wenyan; Skinner, Cindy; Schwartz, Charles E; Cook, Edwin H; Sommer, Steve S
2008-08-01
Frameshift and missense mutations in the X-linked neuroligin 4 (NLGN4, MIM# 300427) and neuroligin 3 (NLGN3, MIM# 300336) genes have been identified in patients with autism, Asperger syndrome and mental retardation. We hypothesize that sequence variants in NLGN4Y are associated with autism or mental retardation. The coding sequences and splice junctions of the NLGN4Y gene were analyzed in 335 male samples (290 with autism and 45 with mental retardation). A total of 1.1 Mb of genomic DNA was sequenced. One missense variant, p.I679V, was identified in a patient with autism, as well as his father with learning disabilities. The I679 residue is highly conserved in three members of the neuroligin family. The absence of p.I679V in 2986 control Y chromosomes and the high similarity of NLGN4 and NLGN4Y are consistent with the hypothesis that p.I679V contributes to the etiology of autism. The presence of only one structural variant in our population of 335 males with autism/mental retardation, the unavailability of significant family cosegregation and an absence of functional assays are, however, important limitations of this study.
Detection and genetic analysis of aquabirnaviruses in subclinically infected aquarium fish.
Shin, Sang Phil; Gomez, Dennis Kaw; Kim, Ji Hyung; Choresca, Casiano Hermorpia; Han, Jee Eun; Jun, Jin Woo; Park, Se Chang
2011-03-01
Aquabirnaviruses (ABVs) cause serious diseases in a variety of fish species used worldwide in aquaculture and have been isolated from a variety of healthy fish and shellfish species. The type species of ABV is Infectious pancreatic necrosis virus (IPNV), which is the causative agent of a highly contagious disease in juvenile salmonid fish. Marine birnaviruses (MABVs) have been isolated from various marine fish and shellfish. In Korea, ABV infection has been identified in several fish and shellfish. The current study presents sequence data from nested polymerase chain reaction products of 3 ABV strains obtained from different species of asymptomatic aquarium fish collected from a private commercial aquarium in Korea. Phylogenetic analysis of these strains, based on the partial nucleotide sequence of the VP2/NS junction, placed them within the genogroup VII (95-99% bootstrap confidence), which also contains MABV. The subclinically infected fish may be a source of MABV infection for other susceptible fish species inside the aquarium and potentially represent a serious challenge for the management of MABV infections. Additionally, the presence of MABV in these subclinically infected aquarium fish imported from other countries indicates that there is a need for the establishment of appropriate quarantine practices.
Single-molecule detection of dihydroazulene photo-thermal reaction using break junction technique
NASA Astrophysics Data System (ADS)
Huang, Cancan; Jevric, Martyn; Borges, Anders; Olsen, Stine T.; Hamill, Joseph M.; Zheng, Jue-Ting; Yang, Yang; Rudnev, Alexander; Baghernejad, Masoud; Broekmann, Peter; Petersen, Anne Ugleholdt; Wandlowski, Thomas; Mikkelsen, Kurt V.; Solomon, Gemma C.; Brøndsted Nielsen, Mogens; Hong, Wenjing
2017-05-01
Charge transport by tunnelling is one of the most ubiquitous elementary processes in nature. Small structural changes in a molecular junction can lead to significant difference in the single-molecule electronic properties, offering a tremendous opportunity to examine a reaction on the single-molecule scale by monitoring the conductance changes. Here, we explore the potential of the single-molecule break junction technique in the detection of photo-thermal reaction processes of a photochromic dihydroazulene/vinylheptafulvene system. Statistical analysis of the break junction experiments provides a quantitative approach for probing the reaction kinetics and reversibility, including the occurrence of isomerization during the reaction. The product ratios observed when switching the system in the junction does not follow those observed in solution studies (both experiment and theory), suggesting that the junction environment was perturbing the process significantly. This study opens the possibility of using nano-structured environments like molecular junctions to tailor product ratios in chemical reactions.
Bypass Diode Temperature Tests of a Solar Array Coupon Under Space Thermal Environment Conditions
NASA Technical Reports Server (NTRS)
Wright, Kenneth H., Jr.; Schneider, Todd A.; Vaughn, Jason A.; Hoang, Bao; Wong, Frankie; Wu, Gordon
2016-01-01
Tests were performed on a 56-cell Advanced Triple Junction solar array coupon whose purpose was to determine margin available for bypass diodes integrated with new, large multi-junction solar cells that are manufactured from a 4-inch wafer. The tests were performed under high vacuum with coupon back side thermal conditions of both cold and ambient. The bypass diodes were subjected to a sequence of increasing discrete current steps from 0 Amp to 2.0 Amp in steps of 0.25 Amp. At each current step, a temperature measurement was obtained via remote viewing by an infrared camera. This paper discusses the experimental methodology, experiment results, and the thermal model.
By-Pass Diode Temperature Tests of a Solar Array Coupon Under Space Thermal Environment Conditions
NASA Technical Reports Server (NTRS)
Wright, Kenneth H., Jr.; Schneider, Todd A.; Vaughn, Jason A.; Hoang, Bao; Wong, Frankie
2016-01-01
Tests were performed on a 56-cell Advanced Triple Junction solar array coupon whose purpose was to determine margin available for bypass diodes integrated with new, large multi-junction solar cells that are manufactured from a 4-inch wafer. The tests were performed under high vacuum with cold and ambient coupon back-side. The bypass diodes were subjected to a sequence of increasing discrete current steps from 0 Amp to 2.0 Amp in steps of 0.25 Amp. At each current step, a temperature measurement was obtained via remote viewing by an infrared camera. This paper discusses the experimental methodology, including the calibration of the thermal imaging system, and the results.
Mayr, B; Reifinger, M; Alton, K; Schaffner, G
1998-06-01
Twenty feline neoplasms were sequenced in the region from exons 5 to 8 for the presence of tumour suppressor gene p53 mutations. In a spindle cell sarcoma of the bladder, a missense mutation (codon 164 AAG-->GAG, lysine-->glutamic acid) in exon 5 was detected. In a pleomorphic sarcoma, a 23 bp deletion involving the splicing junction between intron 5 and exon 6 was observed. In a fibrosarcoma, a 6 bp deletion of p53 covering 2 bp of exon 7 and 4 bp of intron 7, including the splicing junction, was found. The study demonstrates three new p53 mutations in different types of sarcomas in cats.
Nayak, Dhananjaya; Siller, Sylvester; Guo, Qing; Sousa, Rui
2008-02-15
The T7RNA polymerase (RNAP) elongation complex (EC) pauses and is destabilized at a unique 8 nucleotide (nt) sequence found at the junction of the head-to-tail concatemers of T7 genomic DNA generated during T7 DNA replication. The paused EC may recruit the T7 DNA processing machinery, which cleaves the concatemerized DNA within this 8 nt concatemer junction (CJ). Pausing of the EC at the CJ involves structural changes in both the RNAP and transcription bubble. However, these structural changes have not been fully defined, nor is it understood how the CJ sequence itself causes the EC to change its structure, to pause, and to become less stable. Here we use solution and RNAP-tethered chemical nucleases to probe the CJ transcript and changes in the EC structure as the polymerase pauses and terminates at the CJ. Together with extensive mutational scanning of regions of the polymerase that are likely to be involved in recognition of the CJ, we are able to develop a description of the events that occur as the EC transcribes through the CJ and subsequently pauses. In this process, a local change in the structure of the transcription bubble drives a large change in the architecture of the EC. This altered EC structure may then serve as the signal that recruits the processing machinery to the CJ.
Role of heteromeric gap junctions in the cytotoxicity of cisplatin.
Tong, Xuhui; Dong, Shuying; Yu, Meiling; Wang, Qin; Tao, Liang
2013-08-09
In several systems, the presence of gap junctions made of a single connexin has been shown to enhance the cytotoxicity of cisplatin. However, most gap junction channels in vivo appear to be heteromeric (composed of more than one connexin isoform). Here we explore in HeLa cells the cytotoxicity to cisplatin that is enhanced by heteromeric gap junctions composed of Cx26 and Cx32, which have been shown to be more selective among biological permeants than the corresponding homomeric channels. We found that survival and subsequent proliferation of cells exposed to cisplatin were substantially reduced when gap junctions were present than when there were no gap junctions. Functional inhibition of gap junctions by oleamide enhanced survival/proliferation, and enhancement of gap junctions by retinoic acid decreased survival/proliferation. These effects occurred only in high density cultures, and the treatments were without effect when there was no opportunity for gap junction formation. The presence of functional gap junctions enhanced apoptosis as reflected in markers of both early-stage and late-stage apoptosis. Furthermore, analysis of caspases 3, 8 and 9 showed that functional gap junctions specifically induced apoptosis by the mitochondrial pathway. These results demonstrate that heteromeric Cx26/Cx32 gap junctions increase the cytotoxicity of cisplatin by induction of apoptosis via the mitochondrial pathway. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Geisz, John F.; France, Ryan M.; Steiner, Myles A.
Quantitative electroluminescence (EL) and luminescent coupling (LC) analysis, along with more conventional characterization techniques, are combined to completely characterize the subcell JV curves within a fourjunction (4J) inverted metamorphic solar cell (IMM). The 4J performance under arbitrary spectral conditions can be predicted from these subcell JV curves. The internal radiative efficiency (IRE) of each junction has been determined as a function of current density from the external radiative efficiency using optical modeling, but this required the accurate determination of the individual junction current densities during the EL measurement as affected by LC. These measurement and analysis techniques can be appliedmore » to any multijunction solar cell. The 4J IMM solar cell used to illustrate these techniques showed excellent junction quality as exhibited by high IRE and a one-sun AM1.5D efficiency of 36.3%. This device operates up to 1000 suns without limitations due to any of the three tunnel junctions.« less
Laleh, Masoud Akbarzadeh; Naseri, Marzieh; Zonouzi, Ali Akbar Poursadegh; Zonouzi, Ahmad Poursadegh; Masoudi, Marjan; Ahangari, Najmeh; Shams, Leila; Nejatizadeh, Azim
2017-01-01
We aimed to determine the contribution of four DFNB loci and mutation analysis of gap junction beta-2 ( GJB2 ) and GJB4 genes in autosomal recessive nonsyndromic hearing loss (ARNSHL) in South of Iran. A total of 36 large ARNSHL pedigrees with at least two affected subjects were enrolled in the current study. The GJB2 and GJB4 genes mutations were screened using direct sequencing method. The GJB2 and GJB4 negative families were analyzed for the linkage to DFNB21, DFNB24, DFNB29, and DFNB42 loci by genotyping the corresponding STR markers using polymerase chain reaction-PAGE method. We found a homozygous nonsense mutation W77X and a homozygous missense mutation C169W in 5.55% of studied families in GJB2 and GJB4 genes, respectively. Five heterozygous mutations including V63G, A78T, and R127H in GJB2 gene, and R103C and R227W in GJB4 gene were detected. We identified two novel variations V63G in GJB2 and R227W in GJB4 . In silico analysis predicted that both novel variations are deleterious mutations. We did not unveil any linkage between DFNB21, DFNB24, DFNB29, and DFNB42 loci and ARNSHL among studied families. This is the first report of GJB2 and GJB4 mutations from Hormozgan population. According to the previous publications regarding GJB2 and GJB4 mutations, the distribution of the mutations is different from other parts of Iran that should be considered in primary health-care programs. Further investigations are needed to evaluate the contribution of other loci in ARNSHL subjects in South of Iran.
Genetic Relatedness among Hepatitis A Virus Strains Associated with Food-Borne Outbreaks
Vaughan, Gilberto; Xia, Guoliang; Forbi, Joseph C.; Purdy, Michael A.; Rossi, Lívia Maria Gonçalves; Spradling, Philip R.; Khudyakov, Yury E.
2013-01-01
The genetic characterization of hepatitis A virus (HAV) strains is commonly accomplished by sequencing subgenomic regions, such as the VP1/P2B junction. HAV genome is not extensively variable, thus presenting opportunity for sharing sequences of subgenomic regions among genetically unrelated isolates. The degree of misrepresentation of phylogenetic relationships by subgenomic regions is especially important for tracking transmissions. Here, we analyzed whole-genome (WG) sequences of 101 HAV strains identified from 4 major multi-state, food-borne outbreaks of hepatitis A in the Unites States and from 14 non-outbreak-related HAV strains that shared identical VP1/P2B sequences with the outbreak strains. Although HAV strains with an identical VP1/P2B sequence were specific to each outbreak, WG were different, with genetic diversity reaching 0.31% (mean 0.09%). Evaluation of different subgenomic regions did not identify any other section of the HAV genome that could accurately represent phylogenetic relationships observed using WG sequences. The identification of 2–3 dominant HAV strains in 3 out of 4 outbreaks indicates contamination of the implicated food items with a heterogeneous HAV population. However, analysis of intra-host HAV variants from eight patients involved in one outbreak showed that only a single sequence variant established infection in each patient. Four non-outbreak strains were found closely related to strains from 2 outbreaks, whereas ten were genetically different from the outbreak strains. Thus, accurate tracking of HAV strains can be accomplished using HAV WG sequences, while short subgenomic regions are useful for identification of transmissions only among cases with known epidemiological association. PMID:24223112
Targeting MED1 LxxLL Motifs for Tissue-Selective Treatment of Human Breast Cancer
2012-09-01
his colleagues have successfully conjugated malachite green (MG) aptamer to RNA nanoparticles characterized by a three-way junction (3WJ) pRNA motif...nanoparticle harboring malachite green (MG) aptamer, survivin siRNA and folate-DNA/RNA sequence for targeting delivery, using 3WJ-pRNA as scaffolds. Figure
NASA Technical Reports Server (NTRS)
Chi, J. Y.; Gatos, H. C.; Mao, B. Y.
1980-01-01
Multiple p-n junctions have been prepared in as-grown Czochralski p-type silicon through overcompensation near the oxygen periodic concentration maxima by oxygen thermal donors generated during heat treatment at 450 C. Application of the multiple p-n-junction configuration to photovoltaic energy conversion has been investigated. A new solar-cell structure based on multiple p-n-junctions was developed. Theoretical analysis showed that a significant increase in collection efficiency over the conventional solar cells can be achieved.
Switching Dynamics of an Underdamped Josephson Junction Coupled to a Microwave Cavity
NASA Astrophysics Data System (ADS)
Oelsner, G.; Il'ichev, E.
2018-05-01
Current-biased Josephson junctions are promising candidates for the detection of single photons in the microwave frequency domain. With modern fabrication technologies, the switching properties of the junction can be adjusted to achieve quantum limited sensitivity. Namely, the width of the switching current distribution can be reduced well below the current amplitude produced by a single photon trapped inside a superconducting cavity. However, for an effective detection a strong junction cavity coupling is required, providing nonlinear system dynamics. We compare experimental findings for our prototype device with a theoretical analysis aimed to describe the switching dynamics of junctions under microwave irradiation. Measurements are found in qualitative agreement with our simulations.
NASA Astrophysics Data System (ADS)
Mintairov, M. A.; Evstropov, V. V.; Mintairov, S. A.; Shvarts, M. Z.; Kozhukhovskaia, S. A.; Kalyuzhnyy, N. A.
2017-11-01
The existence within monolithic double- and triple-junction solar cells of a photoelectric source, which counteracts the basic photovoltaic p-n junctions, is proved. The paper presents a detailed analysis of the shape of the light IV-characteristics, as well as the dependence Voc-Jsc (open circuit voltage - short-circuit current). It is established that the counteracting source is tunnel p+-n+ junction. The photoelectric characteristics of samples with different tunnel diode peak current values were investigated, including the case of a zero value. When the tunnel p+-n+ junction is photoactive, the Voc-Jsc dependence has a dropping part, including a sharp jump. This undesirable effect decreases with increasing peak current.
Gene expression profiles of fin regeneration in loach (Paramisgurnus dabryanu).
Li, Li; He, Jingya; Wang, Linlin; Chen, Weihua; Chang, Zhongjie
2017-11-01
Teleost fins can regenerate accurate position-matched structure and function after amputation. However, we still lack systematic transcriptional profiling and methodologies to understand the molecular basis of fin regeneration. After histological analysis, we established a suppression subtraction hybridization library containing 418 distinct sequences expressed differentially during the process of blastema formation and differentiation in caudal fin regeneration. Genome ontology and comparative analysis of differential distribution of our data and the reference zebrafish genome showed notable subcategories, including multi-organism processes, response to stimuli, extracellular matrix, antioxidant activity, and cell junction function. KEGG pathway analysis allowed the effective identification of relevant genes in those pathways involved in tissue morphogenesis and regeneration, including tight junction, cell adhesion molecules, mTOR and Jak-STAT signaling pathway. From relevant function subcategories and signaling pathways, 78 clones were examined for further Southern-blot hybridization. Then, 17 genes were chosen and characterized using semi-quantitative PCR. Then 4 candidate genes were identified, including F11r, Mmp9, Agr2 and one without a match to any database. After real-time quantitative PCR, the results showed obvious expression changes in different periods of caudal fin regeneration. We can assume that the 4 candidates, likely valuable genes associated with fin regeneration, deserve additional attention. Thus, our study demonstrated how to investigate the transcript profiles with an emphasis on bioinformatics intervention and how to identify potential genes related to fin regeneration processes. The results also provide a foundation or knowledge for further research into genes and molecular mechanisms of fin regeneration. Copyright © 2017 Elsevier B.V. All rights reserved.
High efficiency solar cells for concentrator systems: silicon or multi-junction?
NASA Astrophysics Data System (ADS)
Slade, Alexander; Stone, Kenneth W.; Gordon, Robert; Garboushian, Vahan
2005-08-01
Amonix has become the first company to begin production of high concentration silicon solar cells where volumes are over 10 MW/year. Higher volumes are available due to the method of manufacture; Amonix solely uses semiconductor foundries for solar cell production. In the previous years of system and cell field testing, this method of manufacturing enabled Amonix to maintain a very low overhead while incurring a high cost for the solar cell. However, recent simplifications to the solar cell processing sequence resulted in cost reduction and increased yield. This new process has been tested by producing small qualities in very short time periods, enabling a simulation of high volume production. Results have included over 90% wafer yield, up to 100% die yield and world record performance (η =27.3%). This reduction in silicon solar cell cost has increased the required efficiency for multi-junction concentrator solar cells to be competitive / advantageous. Concentrator systems are emerging as a low-cost, high volume option for solar-generated electricity due to the very high utilization of the solar cell, leading to a much lower $/Watt cost of a photovoltaic system. Parallel to this is the onset of alternative solar cell technologies, such as the very high efficiency multi-junction solar cells developed at NREL over the last two decades. The relatively high cost of these type of solar cells has relegated their use to non-terrestrial applications. However, recent advancements in both multi-junction concentrator cell efficiency and their stability under high flux densities has made their large-scale terrestrial deployment significantly more viable. This paper presents Amonix's experience and testing results of both high-efficiency silicon rear-junction solar cells and multi-junction solar cells made for concentrated light operation.
Analysis of long-channel nanotube field-effect-transistors (NT FETs)
NASA Technical Reports Server (NTRS)
Toshishige, Yamada; Kwak, Dochan (Technical Monitor)
2001-01-01
This viewgraph presentation provides an analysis of long-channel nanotube (NT) field effect transistors (FET) from NASA's Ames Research Center. The structure of such a transistor including the electrode contact, 1D junction, and the planar junction is outlined. Also mentioned are various characteristics of a nanotube tip-equipped scanning tunnel microscope (STM).
Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing
2005-11-30
Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate.
Sequence of retrovirus provirus resembles that of bacterial transposable elements
NASA Astrophysics Data System (ADS)
Shimotohno, Kunitada; Mizutani, Satoshi; Temin, Howard M.
1980-06-01
The nucleotide sequences of the terminal regions of an infectious integrated retrovirus cloned in the modified λ phage cloning vector Charon 4A have been elucidated. There is a 569-base pair direct repeat at both ends of the viral DNA. The cell-virus junctions at each end consist of a 5-base pair direct repeat of cell DNA next to a 3-base pair inverted repeat of viral DNA. This structure resembles that of a transposable element and is consistent with the protovirus hypothesis that retroviruses evolved from the cell genome.
Kristensen, Thea; Normann, Preben; Gullberg, Maria; Fahnøe, Ulrik; Polacek, Charlotta; Rasmussen, Thomas Bruun; Belsham, Graham J
2017-03-01
The foot-and-mouth disease virus (FMDV) capsid precursor, P1-2A, is cleaved by FMDV 3C protease to yield VP0, VP3, VP1 and 2A. Cleavage of the VP1/2A junction is the slowest. Serotype O FMDVs with uncleaved VP1-2A (having a K210E substitution in VP1; at position P2 in cleavage site) have been described previously and acquired a second site substitution (VP1 E83K) during virus rescue. Furthermore, introduction of the VP1 E83K substitution alone generated a second site change at the VP1/2A junction (2A L2P, position P2' in cleavage site). These virus adaptations have now been analysed using next-generation sequencing to determine sub-consensus level changes in the virus; this revealed other variants within the E83K mutant virus population that changed residue VP1 K210. The construction of serotype A viruses with a blocked VP1/2A cleavage site (containing K210E) has now been achieved. A collection of alternative amino acid substitutions was made at this site, and the properties of the mutant viruses were determined. Only the presence of a positively charged residue at position P2 in the cleavage site permitted efficient cleavage of the VP1/2A junction, consistent with analyses of diverse FMDV genome sequences. Interestingly, in contrast to the serotype O virus results, no second site mutations occurred within the VP1 coding region of serotype A viruses with the blocked VP1/2A cleavage site. However, some of these viruses acquired changes in the 2C protein that is involved in enterovirus morphogenesis. These results have implications for the testing of potential antiviral agents targeting the FMDV 3C protease.
The contribution of alu elements to mutagenic DNA double-strand break repair.
Morales, Maria E; White, Travis B; Streva, Vincent A; DeFreece, Cecily B; Hedges, Dale J; Deininger, Prescott L
2015-03-01
Alu elements make up the largest family of human mobile elements, numbering 1.1 million copies and comprising 11% of the human genome. As a consequence of evolution and genetic drift, Alu elements of various sequence divergence exist throughout the human genome. Alu/Alu recombination has been shown to cause approximately 0.5% of new human genetic diseases and contribute to extensive genomic structural variation. To begin understanding the molecular mechanisms leading to these rearrangements in mammalian cells, we constructed Alu/Alu recombination reporter cell lines containing Alu elements ranging in sequence divergence from 0%-30% that allow detection of both Alu/Alu recombination and large non-homologous end joining (NHEJ) deletions that range from 1.0 to 1.9 kb in size. Introduction of as little as 0.7% sequence divergence between Alu elements resulted in a significant reduction in recombination, which indicates even small degrees of sequence divergence reduce the efficiency of homology-directed DNA double-strand break (DSB) repair. Further reduction in recombination was observed in a sequence divergence-dependent manner for diverged Alu/Alu recombination constructs with up to 10% sequence divergence. With greater levels of sequence divergence (15%-30%), we observed a significant increase in DSB repair due to a shift from Alu/Alu recombination to variable-length NHEJ which removes sequence between the two Alu elements. This increase in NHEJ deletions depends on the presence of Alu sequence homeology (similar but not identical sequences). Analysis of recombination products revealed that Alu/Alu recombination junctions occur more frequently in the first 100 bp of the Alu element within our reporter assay, just as they do in genomic Alu/Alu recombination events. This is the first extensive study characterizing the influence of Alu element sequence divergence on DNA repair, which will inform predictions regarding the effect of Alu element sequence divergence on both the rate and nature of DNA repair events.
Beck, Markus H.; Zhang, Shu; Bitra, Kavita; Burke, Gaelen R.; Strand, Michael R.
2011-01-01
Polydnaviruses (PDVs) are symbionts of parasitoid wasps that function as gene delivery vehicles in the insects (hosts) that the wasps parasitize. PDVs persist in wasps as integrated proviruses but are packaged as circularized and segmented double-stranded DNAs into the virions that wasps inject into hosts. In contrast, little is known about how PDV genomic DNAs persist in host cells. Microplitis demolitor carries Microplitis demolitor bracovirus (MdBV) and parasitizes the host Pseudoplusia includens. MdBV infects primarily host hemocytes and also infects a hemocyte-derived cell line from P. includens called CiE1 cells. Here we report that all 15 genomic segments of the MdBV encapsidated genome exhibited long-term persistence in CiE1 cells. Most MdBV genes expressed in hemocytes were persistently expressed in CiE1 cells, including members of the glc gene family whose products transformed CiE1 cells into a suspension culture. PCR-based integration assays combined with cloning and sequencing of host-virus junctions confirmed that genomic segments J and C persisted in CiE1 cells by integration. These genomic DNAs also rapidly integrated into parasitized P. includens. Sequence analysis of wasp-viral junction clones showed that the integration of proviral segments in M. demolitor was associated with a wasp excision/integration motif (WIM) known from other bracoviruses. However, integration into host cells occurred in association with a previously unknown domain that we named the host integration motif (HIM). The presence of HIMs in most MdBV genomic DNAs suggests that the integration of each genomic segment into host cells occurs through a shared mechanism. PMID:21880747
Mutation testing in Treacher Collins Syndrome.
Ellis, P E; Dawson, M; Dixon, M J
2002-12-01
To report on a study where 97 subjects were screened for mutations in the Treacher Collins syndrome (TCS) gene TCOF1. Ninety-seven subjects with a clinical diagnosis of TCS were screened for potential mutations in TCOF1, by means of single strand conformation polymorphism (SSCP) analysis. In those subjects where potential mutations were detected, sequence analysis was performed to determine the site and type of mutation present. Thirty-six TCS-specific mutations are reported including 27 deletions, six point mutations, two splice junction mutations, and one insertion/deletion. This brings the total number of mutations reported to date to 105. The importance of detection of these mutations is mainly in postnatal diagnosis and genetic counselling. Knowledge of the family specific mutation may also be used in prenatal diagnosis to confirm whether the foetus is affected or not, and give the parents the choice of whether to continue with the pregnancy.
PLEKHA7 Recruits PDZD11 to Adherens Junctions to Stabilize Nectins.
Guerrera, Diego; Shah, Jimit; Vasileva, Ekaterina; Sluysmans, Sophie; Méan, Isabelle; Jond, Lionel; Poser, Ina; Mann, Matthias; Hyman, Anthony A; Citi, Sandra
2016-05-20
PLEKHA7 is a junctional protein implicated in stabilization of the cadherin protein complex, hypertension, cardiac contractility, glaucoma, microRNA processing, and susceptibility to bacterial toxins. To gain insight into the molecular basis for the functions of PLEKHA7, we looked for new PLEKHA7 interactors. Here, we report the identification of PDZ domain-containing protein 11 (PDZD11) as a new interactor of PLEKHA7 by yeast two-hybrid screening and by mass spectrometry analysis of PLEKHA7 immunoprecipitates. We show that PDZD11 (17 kDa) is expressed in epithelial and endothelial cells, where it forms a complex with PLEKHA7, as determined by co-immunoprecipitation analysis. The N-terminal Trp-Trp (WW) domain of PLEKHA7 interacts directly with the N-terminal 44 amino acids of PDZD11, as shown by GST-pulldown assays. Immunofluorescence analysis shows that PDZD11 is localized at adherens junctions in a PLEKHA7-dependent manner, because its junctional localization is abolished by knock-out of PLEKHA7, and is rescued by re-expression of exogenous PLEKHA7. The junctional recruitment of nectin-1 and nectin-3 and their protein levels are decreased via proteasome-mediated degradation in epithelial cells where either PDZD11 or PLEKHA7 have been knocked-out. PDZD11 forms a complex with nectin-1 and nectin-3, and its PDZ domain interacts directly with the PDZ-binding motif of nectin-1. PDZD11 is required for the efficient assembly of apical junctions of epithelial cells at early time points in the calcium-switch model. These results show that the PLEKHA7-PDZD11 complex stabilizes nectins to promote efficient early junction assembly and uncover a new molecular mechanism through which PLEKHA7 recruits PDZ-binding membrane proteins to epithelial adherens junctions. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
NASA Astrophysics Data System (ADS)
Essig, Stephanie; Allebé, Christophe; Remo, Timothy; Geisz, John F.; Steiner, Myles A.; Horowitz, Kelsey; Barraud, Loris; Ward, J. Scott; Schnabel, Manuel; Descoeudres, Antoine; Young, David L.; Woodhouse, Michael; Despeisse, Matthieu; Ballif, Christophe; Tamboli, Adele
2017-09-01
Today's dominant photovoltaic technologies rely on single-junction devices, which are approaching their practical efficiency limit of 25-27%. Therefore, researchers are increasingly turning to multi-junction devices, which consist of two or more stacked subcells, each absorbing a different part of the solar spectrum. Here, we show that dual-junction III-V//Sidevices with mechanically stacked, independently operated III-V and Si cells reach cumulative one-sun efficiencies up to 32.8%. Efficiencies up to 35.9% were achieved when combining a GaInP/GaAs dual-junction cell with a Si single-junction cell. These efficiencies exceed both the theoretical 29.4% efficiency limit of conventional Si technology and the efficiency of the record III-V dual-junction device (32.6%), highlighting the potential of Si-based multi-junction solar cells. However, techno-economic analysis reveals an order-of-magnitude disparity between the costs for III-V//Si tandem cells and conventional Si solar cells, which can be reduced if research advances in low-cost III-V growth techniques and new substrate materials are successful.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Essig, Stephanie; Allebé, Christophe; Remo, Timothy
Today's dominant photovoltaic technologies rely on single-junction devices, which are approaching their practical efficiency limit of 25-27%. Therefore, researchers are increasingly turning to multi-junction devices, which consist of two or more stacked subcells, each absorbing a different part of the solar spectrum. Here, we show that dual-junction III-V//Sidevices with mechanically stacked, independently operated III-V and Si cells reach cumulative one-sun efficiencies up to 32.8%. Efficiencies up to 35.9% were achieved when combining a GaInP/GaAs dual-junction cell with a Si single-junction cell. These efficiencies exceed both the theoretical 29.4% efficiency limit of conventional Si technology and the efficiency of the recordmore » III-V dual-junction device (32.6%), highlighting the potential of Si-based multi-junction solar cells. However, techno-economic analysis reveals an order-of-magnitude disparity between the costs for III-V//Si tandem cells and conventional Si solar cells, which can be reduced if research advances in low-cost III-V growth techniques and new substrate materials are successful.« less
AMP-forming acetyl-CoA synthetases in Archaea show unexpected diversity in substrate utilization
Ingram-Smith, Cheryl; Smith, Kerry S.
2007-01-01
Adenosine monophosphate (AMP)-forming acetyl-CoA synthetase (ACS; acetate:CoA ligase (AMP-forming), EC 6.2.1.1) is a key enzyme for conversion of acetate to acetyl-CoA, an essential intermediate at the junction of anabolic and catabolic pathways. Phylogenetic analysis of putative short and medium chain acyl-CoA synthetase sequences indicates that the ACSs form a distinct clade from other acyl-CoA synthetases. Within this clade, the archaeal ACSs are not monophyletic and fall into three groups composed of both bacterial and archaeal sequences. Kinetic analysis of two archaeal enzymes, an ACS from Methanothermobacter thermautotrophicus (designated as MT-ACS1) and an ACS from Archaeoglobus fulgidus (designated as AF-ACS2), revealed that these enzymes have very different properties. MT-ACS1 has nearly 11-fold higher affinity and 14-fold higher catalytic efficiency with acetate than with propionate, a property shared by most ACSs. However, AF-ACS2 has only 2.3-fold higher affinity and catalytic efficiency with acetate than with propionate. This enzyme has an affinity for propionate that is almost identical to that of MT-ACS1 for acetate and nearly tenfold higher than the affinity of MT-ACS1 for propionate. Furthermore, MT-ACS1 is limited to acetate and propionate as acyl substrates, whereas AF-ACS2 can also utilize longer straight and branched chain acyl substrates. Phylogenetic analysis, sequence alignment and structural modeling suggest a molecular basis for the altered substrate preference and expanded substrate range of AF-ACS2 versus MT-ACS1. PMID:17350930
Kikuchi, T; Adams, J C; Paul, D L; Kimura, R S
1994-09-01
The distribution of gap junctions within the vestibular labyrinth was investigated using immunohistochemistry and transmission electron microscopy. Connexin26-like immunoreactivity was observed among supporting cells in each vestibular sensory epithelium. Reaction product was also present in the transitional epithelium of each vestibular endorgan and in the planum semilunatum of crista ampullaris. No connexin26-like immunoreactivity was observed among thin wall epithelial cells or among vestibular dark cells. In addition, fibrocytes within vestibular connective tissue were positively immunostained. Reaction product was also detected in the melanocyte area just beneath dark cells. Ultrastructural observations indicated that a gap junction network of vestibular supporting cells extends to the transitional epithelium and planum semilunatum and forms an isolated epithelial cell gap junction system in each vestibular endorgan. In contrast, no gap junctions were found among wall epithelial cells or among dark cells. Fibrocytes and melanocytes were coupled by gap junctions and belong to the connective tissue cell gap junction system, which is continuous throughout the vestibular system and the cochlea. The possible functional significance of these gap junction systems is discussed.
New high-efficiency silicon solar cells
NASA Technical Reports Server (NTRS)
Daud, T.; Crotty, G. T.
1985-01-01
A design for silicon solar cells was investigated as an approach to increasing the cell open-circuit voltage and efficiency for flat-plate terrestrial photovoltaic applications. This deviates from past designs, where either the entire front surface of the cell is covered by a planar junction or the surface is textured before junction formation, which results in an even greater (up to 70%) junction area. The heavily doped front region and the junction space charge region are potential areas of high recombination for generated and injected minority carriers. The design presented reduces junction area by spreading equidiameter dot junctions across the surface of the cell, spaced about a diffusion length or less from each other. Various dot diameters and spacings allowed variations in total junction area. A simplified analysis was done to obtain a first-order design optimization. Efficiencies of up to 19% can be obtained. Cell fabrication involved extra masking steps for selective junction diffusion, and made surface passivation a key element in obtaining good collection. It also involved photolithography, with line widths down to microns. A method is demonstrated for achieving potentially high open-circuit voltages and solar-cell efficiencies.
Identification of the genomic locus for the human Rieske Fe-S Protein gene on Chromosome 19q12
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pennacchio, L.A.
1994-05-06
We have identified the chromosomal location of the human Rieske Iron-Sulfur Protein (UQCRFS1) gene. Mapping by hybridization to a panel of monochromosomal hybrid cell lines indicated that the gene was either on chromosome 19 or 22. By screening a human chromosome 19 specific genomic cosmid library with an oligonucleotide probe made from the published Rieske cDNA sequence, we identified a corresponding cosmid. Portions of this cosmid were sequenced directly. The exon, exon:intron junction, and flanking sequences verified that this cosmid contains the genomic locus. Fluorescent in situ hybridization (FISH) was performed to localize this cosmid to chromosome band 19q12.
Bannwarth, Markus B; Utech, Stefanie; Ebert, Sandro; Weitz, David A; Crespy, Daniel; Landfester, Katharina
2015-03-24
The assembly of nanoparticles into polymer-like architectures is challenging and usually requires highly defined colloidal building blocks. Here, we show that the broad size-distribution of a simple dispersion of magnetic nanocolloids can be exploited to obtain various polymer-like architectures. The particles are assembled under an external magnetic field and permanently linked by thermal sintering. The remarkable variety of polymer-analogue architectures that arises from this simple process ranges from statistical and block copolymer-like sequencing to branched chains and networks. This library of architectures can be realized by controlling the sequencing of the particles and the junction points via a size-dependent self-assembly of the single building blocks.
Reasoning on the Self-Organizing Incremental Associative Memory for Online Robot Path Planning
NASA Astrophysics Data System (ADS)
Kawewong, Aram; Honda, Yutaro; Tsuboyama, Manabu; Hasegawa, Osamu
Robot path-planning is one of the important issues in robotic navigation. This paper presents a novel robot path-planning approach based on the associative memory using Self-Organizing Incremental Neural Networks (SOINN). By the proposed method, an environment is first autonomously divided into a set of path-fragments by junctions. Each fragment is represented by a sequence of preliminarily generated common patterns (CPs). In an online manner, a robot regards the current path as the associative path-fragments, each connected by junctions. The reasoning technique is additionally proposed for decision making at each junction to speed up the exploration time. Distinct from other methods, our method does not ignore the important information about the regions between junctions (path-fragments). The resultant number of path-fragments is also less than other method. Evaluation is done via Webots physical 3D-simulated and real robot experiments, where only distance sensors are available. Results show that our method can represent the environment effectively; it enables the robot to solve the goal-oriented navigation problem in only one episode, which is actually less than that necessary for most of the Reinforcement Learning (RL) based methods. The running time is proved finite and scales well with the environment. The resultant number of path-fragments matches well to the environment.
Parker, K A; Steitz, J A
1987-01-01
The human U3 ribonucleoprotein (RNP) has been analyzed to determine its protein constituents, sites of protein-RNA interaction, and RNA secondary structure. By using anti-U3 RNP antibodies and extracts prepared from HeLa cells labeled in vivo, the RNP was found to contain four nonphosphorylated proteins of 36, 30, 13, and 12.5 kilodaltons and two phosphorylated proteins of 74 and 59 kilodaltons. U3 nucleotides 72-90, 106-121, 154-166, and 190-217 must contain sites that interact with proteins since these regions are immunoprecipitated after treatment of the RNP with RNase A or T1. The secondary structure was probed with specific nucleases and by chemical modification with single-strand-specific reagents that block subsequent reverse transcription. Regions that are single stranded (and therefore potentially able to interact with a substrate RNA) include an evolutionarily conserved sequence at nucleotides 104-112 and nonconserved sequences at nucleotides 65-74, 80-84, and 88-93. Nucleotides 159-168 do not appear to be highly accessible, thus making it unlikely that this U3 sequence base pairs with sequences near the 5.8S rRNA-internal transcribed spacer II junction, as previously proposed. Alternative functions of the U3 RNP are discussed, including the possibility that U3 may participate in a processing event near the 3' end of 28S rRNA. Images PMID:2959855
Triptycene: A Nucleic Acid Three-Way Junction Binder Scaffold
NASA Astrophysics Data System (ADS)
Yoon, Ina
Nucleic acids play a critical role in many biological processes such as gene regulation and replication. The development of small molecules that modulate nucleic acids with sequence or structure specificity would provide new strategies for regulating disease states at the nucleic acid level. However, this remains challenging mainly because of the nonspecific interactions between nucleic acids and small molecules. Three-way junctions are critical structural elements of nucleic acids. They are present in many important targets such as trinucleotide repeat junctions related to Huntington's disease, a temperature sensor sigma32 in E. coli, Dengue virus, and HIV. Triptycene-derived small molecules have been shown to bind to nucleic acid three-way junctions, resulting from their shape complementary. To develop a better understanding of designing molecules for targeting different junctions, a rapid screening of triptycene-based small molecules is needed. We envisioned that the installation of a linker at C9 position of the bicyclic core would allow for a rapid solid phase diversification. To achieve this aim, we synthesized 9-substituted triptycene scaffolds by using two different synthetic routes. The first synthetic route installed the linker from the amidation reaction between carboxylic acid at C9 position of the triptycene and an amine linker, beta-alanine ethyl ester. This new 9-substituted triptycene scaffold was then attached to a 2-chlorotrityl chloride resin for solid-phase diversification. This enabled a rapid diversification and an easy purification of mono-, di-, and tri-peptide triptycene derivatives. The binding affinities of these compounds were investigated towards a (CAG)˙(CTG) trinucleotide repeat junction. In the modified second synthetic route, we utilized a combined Heck coupling/benzyne Diels-Alder strategy. This improved synthetic strategy reduced the number of steps and total reaction times, increased the overall yield, improved solubilities of intermediates, and provided a new regioisomer that was not observed in the previous synthesis. Through this investigation, we discovered new high-affinity lead compounds towards a d(CAG)·(CTG) trinucleotide repeat junction. In addition, we turned our attention to sigma 32 mRNA, which contains a RNA three-way junction in E. coli. We demonstrated that triptycene-based small molecules can modulate the heat shock response in E. coli..
Structure–property relationships in atomic-scale junctions: Histograms and beyond
Mark S. Hybertsen; Venkataraman, Latha
2016-03-03
Over the past 10 years, there has been tremendous progress in the measurement, modeling and understanding of structure–function relationships in single molecule junctions. Numerous research groups have addressed significant scientific questions, directed both to conductance phenomena at the single molecule level and to the fundamental chemistry that controls junction functionality. Many different functionalities have been demonstrated, including single-molecule diodes, optically and mechanically activated switches, and, significantly, physical phenomena with no classical analogues, such as those based on quantum interference effects. Experimental techniques for reliable and reproducible single molecule junction formation and characterization have led to this progress. In particular, themore » scanning tunneling microscope based break-junction (STM-BJ) technique has enabled rapid, sequential measurement of large numbers of nanoscale junctions allowing a statistical analysis to readily distinguish reproducible characteristics. Furthermore, harnessing fundamental link chemistry has provided the necessary chemical control over junction formation, enabling measurements that revealed clear relationships between molecular structure and conductance characteristics.« less
Structure–property relationships in atomic-scale junctions: Histograms and beyond
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mark S. Hybertsen; Venkataraman, Latha
Over the past 10 years, there has been tremendous progress in the measurement, modeling and understanding of structure–function relationships in single molecule junctions. Numerous research groups have addressed significant scientific questions, directed both to conductance phenomena at the single molecule level and to the fundamental chemistry that controls junction functionality. Many different functionalities have been demonstrated, including single-molecule diodes, optically and mechanically activated switches, and, significantly, physical phenomena with no classical analogues, such as those based on quantum interference effects. Experimental techniques for reliable and reproducible single molecule junction formation and characterization have led to this progress. In particular, themore » scanning tunneling microscope based break-junction (STM-BJ) technique has enabled rapid, sequential measurement of large numbers of nanoscale junctions allowing a statistical analysis to readily distinguish reproducible characteristics. Furthermore, harnessing fundamental link chemistry has provided the necessary chemical control over junction formation, enabling measurements that revealed clear relationships between molecular structure and conductance characteristics.« less
Cingulin Contains Globular and Coiled-Coil Domains and Interacts with Zo-1, Zo-2, Zo-3, and Myosin
Cordenonsi, Michelangelo; D'Atri, Fabio; Hammar, Eva; Parry, David A.D.; Kendrick-Jones, John; Shore, David; Citi, Sandra
1999-01-01
We characterized the sequence and protein interactions of cingulin, an M r 140–160-kD phosphoprotein localized on the cytoplasmic surface of epithelial tight junctions (TJ). The derived amino acid sequence of a full-length Xenopus laevis cingulin cDNA shows globular head (residues 1–439) and tail (1,326–1,368) domains and a central α-helical rod domain (440–1,325). Sequence analysis, electron microscopy, and pull-down assays indicate that the cingulin rod is responsible for the formation of coiled-coil parallel dimers, which can further aggregate through intermolecular interactions. Pull-down assays from epithelial, insect cell, and reticulocyte lysates show that an NH2-terminal fragment of cingulin (1–378) interacts in vitro with ZO-1 (K d ∼5 nM), ZO-2, ZO-3, myosin, and AF-6, but not with symplekin, and a COOH-terminal fragment (377–1,368) interacts with myosin and ZO-3. ZO-1 and ZO-2 immunoprecipitates contain cingulin, suggesting in vivo interactions. Full-length cingulin, but not NH2-terminal and COOH-terminal fragments, colocalizes with endogenous cingulin in transfected MDCK cells, indicating that sequences within both head and rod domains are required for TJ localization. We propose that cingulin is a functionally important component of TJ, linking the submembrane plaque domain of TJ to the actomyosin cytoskeleton. PMID:10613913
Dupont, L; Boizet-Bonhoure, B; Coddeville, M; Auvray, F; Ritzenthaler, P
1995-01-01
Temperate phage mv4 integrates its DNA into the chromosome of Lactobacillus delbrueckii subsp. bulgaricus strains via site-specific recombination. Nucleotide sequencing of a 2.2-kb attP-containing phage fragment revealed the presence of four open reading frames. The larger open reading frame, close to the attP site, encoded a 427-amino-acid polypeptide with similarity in its C-terminal domain to site-specific recombinases of the integrase family. Comparison of the sequences of attP, bacterial attachment site attB, and host-phage junctions attL and attR identified a 17-bp common core sequence, where strand exchange occurs during recombination. Analysis of the attB sequence indicated that the core region overlaps the 3' end of a tRNA(Ser) gene. Phage mv4 DNA integration into the tRNA(Ser) gene preserved an intact tRNA(Ser) gene at the attL site. An integration vector based on the mv4 attP site and int gene was constructed. This vector transforms a heterologous host, L. plantarum, through site-specific integration into the tRNA(Ser) gene of the genome and will be useful for development of an efficient integration system for a number of additional bacterial species in which an identical tRNA gene is present. PMID:7836291
Laffitte, Marie-Claude N.; Leprohon, Philippe; Hainse, Maripier; Légaré, Danielle; Masson, Jean-Yves; Ouellette, Marc
2016-01-01
The parasite Leishmania often relies on gene rearrangements to survive stressful environments. However, safeguarding a minimum level of genome integrity is important for cell survival. We hypothesized that maintenance of genomic integrity in Leishmania would imply a leading role of the MRE11 and RAD50 proteins considering their role in DNA repair, chromosomal organization and protection of chromosomes ends in other organisms. Attempts to generate RAD50 null mutants in a wild-type background failed and we provide evidence that this gene is essential. Remarkably, inactivation of RAD50 was possible in a MRE11 null mutant that we had previously generated, providing good evidence that RAD50 may be dispensable in the absence of MRE11. Inactivation of the MRE11 and RAD50 genes led to a decreased frequency of homologous recombination and analysis of the null mutants by whole genome sequencing revealed several chromosomal translocations. Sequencing of the junction between translocated chromosomes highlighted microhomology sequences at the level of breakpoint regions. Sequencing data also showed a decreased coverage at subtelomeric locations in many chromosomes in the MRE11-/-RAD50-/- parasites. This study demonstrates an MRE11-independent microhomology-mediated end-joining mechanism and a prominent role for MRE11 and RAD50 in the maintenance of genomic integrity. Moreover, we suggest the possible involvement of RAD50 in subtelomeric regions stability. PMID:27314941
Wu, Tonghua; Yin, Biao; Zhu, Yuanchang; Li, Guangui; Ye, Lijun; Liang, Desheng; Zeng, Yong
2017-12-01
To investigate the etiology of X-linked hypohidrotic ectodermal dysplasia (XLHED) in a family with an inversion of the X chromosome [inv(X)(p21q13)] and to achieve a healthy birth following preimplantation genetic diagnosis (PGD). Next generation sequencing (NGS) and Sanger sequencing analysis were carried out to define the inversion breakpoint. Multiple displacement amplification, amplification of breakpoint junction fragments, Sanger sequencing of exon 1 of ED1, haplotyping of informative short tandem repeat markers and gender determination were performed for PGD. NGS data of the proband sample revealed that the size of the possible inverted fragment was over 42Mb, spanning from position 26, 814, 206 to position 69, 231, 915 on the X chromosome. The breakpoints were confirmed by Sanger sequencing. A total of 5 blastocyst embryos underwent trophectoderm biopsy. Two embryos were diagnosed as carriers and three were unaffected. Two unaffected blastocysts were transferred and a singleton pregnancy was achieved. Following confirmation by prenatal diagnosis, a healthy baby was delivered. This is the first report of an XLHED family with inv(X). ED1 is disrupted by the X chromosome inversion in this XLHED family and embryos with the X chromosomal abnormality can be accurately identified by means of PGD. Copyright © 2017. Published by Elsevier B.V.
Øvergård, Aina-Cathrine; Eichner, Christiane; Nilsen, Frank; Dalvin, Sussie
2017-04-01
Heme peroxidases are the most abundant type of peroxidase catalyzing a H 2 O 2 -dependent oxidation of a wide variety of substrates. They are involved in numerous processes like the innate immune response, hormone and prostaglandin synthesis and crosslinking of proteins within extracellular matrixes (ECM) as well as molecules within the cuticle and chorion of arthropods and nematodes. In the present study, a Lepeophtheirus salmonis heme peroxidase (LsHPX) 1 was characterized. Amino acids in the active site of heme peroxidases were conserved, and the predicted protein sequence showed the highest similarity to genes annotated as chorion peroxidases and genes suggested to be involved in cuticle hardening or adhesion. LsHPX1 exhibited a dynamic expression during ontogenesis and during the nauplius molting cycle. Transcripts were localized to muscle cells near the muscle-tendon junction, in nerve tissue especially at neuromuscular junctions, subcuticular epithelium, subepithelial cells facing the hemolymph, exocrine glands within the subepithelial tissue and in isolated cells within the testis. Knock-down of LsHPX1 in nauplius larvae decreased the swimming activity of emerging copepodids. Histological analysis of knock-down animals revealed increased spacing between myofibers and changes in subepithelial and exocrine gland tissue. Considering these results, the potential role of LsHPX1 in crosslinking molecules of salmon louse ECMs is discussed. Copyright © 2017 Elsevier Inc. All rights reserved.
Wistow, Graeme; Bernstein, Steven L; Wyatt, M Keith; Fariss, Robert N; Behal, Amita; Touchman, Jeffrey W; Bouffard, Gerald; Smith, Don; Peterson, Katherine
2002-06-15
The retinal pigment epithelium (RPE) and choroid comprise a functional unit of the eye that is essential to normal retinal health and function. Here we describe expressed sequence tag (EST) analysis of human RPE/choroid as part of a project for ocular bioinformatics. A cDNA library (cs) was made from human RPE/choroid and sequenced. Data were analyzed and assembled using the program GRIST (GRouping and Identification of Sequence Tags). Complete sequencing, Northern and Western blots, RH mapping, peptide antibody synthesis and immunofluorescence (IF) have been used to examine expression patterns and genome location for selected transcripts and proteins. Ten thousand individual sequence reads yield over 6300 unique gene clusters of which almost half have no matches with named genes. One of the most abundant transcripts is from a gene (named "alpha") that maps to the BBS1 region of chromosome 11. A number of tissue preferred transcripts are common to both RPE/choroid and iris. These include oculoglycan/opticin, for which an alternative splice form is detected in RPE/choroid, and "oculospanin" (Ocsp), a novel tetraspanin that maps to chromosome 17q. Antiserum to Ocsp detects expression in RPE, iris, ciliary body, and retinal ganglion cells by IF. A newly identified gene for a zinc-finger protein (TIRC) maps to 19q13.4. Variant transcripts of several genes were also detected. Most notably, the predominant form of Bestrophin represented in cs contains a longer open reading frame as a result of splice junction skipping. The unamplified cs library gives a view of the transcriptional repertoire of the adult RPE/choroid. A large number of potentially novel genes and splice forms and candidates for genetic diseases are revealed. Clones from this collection are being included in a large, nonredundant set for cDNA microarray construction.
Identifying single bases in a DNA oligomer with electron tunnelling.
Huang, Shuo; He, Jin; Chang, Shuai; Zhang, Peiming; Liang, Feng; Li, Shengqin; Tuchband, Michael; Fuhrmann, Alexander; Ros, Robert; Lindsay, Stuart
2010-12-01
It has been proposed that single molecules of DNA could be sequenced by measuring the physical properties of the bases as they pass through a nanopore. Theoretical calculations suggest that electron tunnelling can identify bases in single-stranded DNA without enzymatic processing, and it was recently experimentally shown that tunnelling can sense individual nucleotides and nucleosides. Here, we report that tunnelling electrodes functionalized with recognition reagents can identify a single base flanked by other bases in short DNA oligomers. The residence time of a single base in a recognition junction is on the order of a second, but pulling the DNA through the junction with a force of tens of piconewtons would yield reading speeds of tens of bases per second.
Connexin mutations in X-linked Charcot-Marie-Tooth disease
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bergoffen, J.; Scherer, S.S.; Wang, S.
1993-12-24
X-linked Charcot-Marie-Tooth disease (CMTX) is a form of hereditary neuropathy with demyelination. Recently, this disorder was mapped to chromosome Xq13.1. The gene for the gap junction protein connexin32 is located in the same chromosomal segment, which led to its consideration as a candidate gene for CMTX. With the use of Northern (RNA) blot and immunohistochemistry techniques, it was found that connexin32 is normally expressed in myelinated peripheral nerve. Direct sequencing of the connexin32 gene showed seven different mutations in affected persons from eight CMTX families. These findings, a demonstration of inherited defects in a gap junction protein, suggest that connexin32more » plays an important role in peripheral nerve.« less
Expertise-related deactivation of the right temporoparietal junction during musical improvisation.
Berkowitz, Aaron L; Ansari, Daniel
2010-01-01
Musical training has been associated with structural changes in the brain as well as functional differences in brain activity when musicians are compared to nonmusicians on both perceptual and motor tasks. Previous neuroimaging comparisons of musicians and nonmusicians in the motor domain have used tasks involving prelearned motor sequences or synchronization with an auditorily presented sequence during the experiment. Here we use functional magnetic resonance imaging (fMRI) to examine expertise-related differences in brain activity between musicians and nonmusicians during improvisation--the generation of novel musical-motor sequences--using a paradigm that we previously used in musicians alone. Despite behaviorally matched performance, the two groups showed significant differences in functional brain activity during improvisation. Specifically, musicians deactivated the right temporoparietal junction (rTPJ) during melodic improvisation, while nonmusicians showed no change in activity in this region. The rTPJ is thought to be part of a ventral attentional network for bottom-up stimulus-driven processing, and it has been postulated that deactivation of this region occurs in order to inhibit attentional shifts toward task-irrelevant stimuli during top-down, goal-driven behavior. We propose that the musicians' deactivation of the rTPJ during melodic improvisation may represent a training-induced shift toward inhibition of stimulus-driven attention, allowing for a more goal-directed performance state that aids in creative thought.
Experimental single-strain mobilomics reveals events that shape pathogen emergence.
Schoeniger, Joseph S; Hudson, Corey M; Bent, Zachary W; Sinha, Anupama; Williams, Kelly P
2016-08-19
Virulence genes on mobile DNAs such as genomic islands (GIs) and plasmids promote bacterial pathogen emergence. Excision is an early step in GI mobilization, producing a circular GI and a deletion site in the chromosome; circular forms are also known for some bacterial insertion sequences (ISs). The recombinant sequence at the junctions of such circles and deletions can be detected sensitively in high-throughput sequencing data, using new computational methods that enable empirical discovery of mobile DNAs. For the rich mobilome of a hospital Klebsiella pneumoniae strain, circularization junctions (CJs) were detected for six GIs and seven IS types. Our methods revealed differential biology of multiple mobile DNAs, imprecision of integrases and transposases, and differential activity among identical IS copies for IS26, ISKpn18 and ISKpn21 Using the resistance of circular dsDNA molecules to exonuclease, internally calibrated with the native plasmids, showed that not all molecules bearing GI CJs were circular. Transpositions were also detected, revealing replicon preference (ISKpn18 prefers a conjugative IncA/C2 plasmid), local action (IS26), regional preferences, selection (against capsule synthesis) and IS polarity inversion. Efficient discovery and global characterization of numerous mobile elements per experiment improves accounting for the new gene combinations that arise in emerging pathogens. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Xu, Qin; Xiong, Guanjun; Li, Pengbo; He, Fei; Huang, Yi; Wang, Kunbo; Li, Zhaohu; Hua, Jinping
2012-01-01
Background Cotton (Gossypium spp.) is a model system for the analysis of polyploidization. Although ascertaining the donor species of allotetraploid cotton has been intensively studied, sequence comparison of Gossypium chloroplast genomes is still of interest to understand the mechanisms underlining the evolution of Gossypium allotetraploids, while it is generally accepted that the parents were A- and D-genome containing species. Here we performed a comparative analysis of 13 Gossypium chloroplast genomes, twelve of which are presented here for the first time. Methodology/Principal Findings The size of 12 chloroplast genomes under study varied from 159,959 bp to 160,433 bp. The chromosomes were highly similar having >98% sequence identity. They encoded the same set of 112 unique genes which occurred in a uniform order with only slightly different boundary junctions. Divergence due to indels as well as substitutions was examined separately for genome, coding and noncoding sequences. The genome divergence was estimated as 0.374% to 0.583% between allotetraploid species and A-genome, and 0.159% to 0.454% within allotetraploids. Forty protein-coding genes were completely identical at the protein level, and 20 intergenic sequences were completely conserved. The 9 allotetraploids shared 5 insertions and 9 deletions in whole genome, and 7-bp substitutions in protein-coding genes. The phylogenetic tree confirmed a close relationship between allotetraploids and the ancestor of A-genome, and the allotetraploids were divided into four separate groups. Progenitor allotetraploid cotton originated 0.43–0.68 million years ago (MYA). Conclusion Despite high degree of conservation between the Gossypium chloroplast genomes, sequence variations among species could still be detected. Gossypium chloroplast genomes preferred for 5-bp indels and 1–3-bp indels are mainly attributed to the SSR polymorphisms. This study supports that the common ancestor of diploid A-genome species in Gossypium is the maternal source of extant allotetraploid species and allotetraploids have a monophyletic origin. G. hirsutum AD1 lineages have experienced more sequence variations than other allotetraploids in intergenic regions. The available complete nucleotide sequences of 12 Gossypium chloroplast genomes should facilitate studies to uncover the molecular mechanisms of compartmental co-evolution and speciation of Gossypium allotetraploids. PMID:22876273
Force and Conductance Spectroscopy of Single Molecule Junctions
NASA Astrophysics Data System (ADS)
Frei, Michael
Investigation of mechanical properties of single molecule junctions is crucial to develop an understanding and enable control of single molecular junctions. This work presents an experimental and analytical approach that enables the statistical evaluation of force and simultaneous conductance data of metallic atomic point contacts and molecular junctions. A conductive atomic force microscope based break junction technique is developed to form single molecular junctions and collect conductance and force data simultaneously. Improvements of the optical components have been achieved through the use of a super-luminescent diode, enabling tremendous increases in force resolution. An experimental procedure to collect data for various molecular junctions has been developed and includes deposition, calibration, and analysis methods. For the statistical analysis of force, novel approaches based on two dimensional histograms and a direct force identification method are presented. The two dimensional method allows for an unbiased evaluation of force events that are identified using corresponding conductance signatures. This is not always possible however, and in these situations, the force based identification of junction rearrangement events is an attractive alternative method. This combined experimental and analytical approach is then applied to three studies: First, the impact of molecular backbones to the mechanical behavior of single molecule junctions is investigated and it is found that junctions formed with identical linkers but different backbone structure result in junctions with varying breaking forces. All molecules used show a clear molecular signature and force data can be evaluated using the 2D method. Second, the effects of the linker group used to attach molecules to gold electrodes are investigated. A study of four alkane molecules with different linkers finds a drastic difference in the evolution of donor-acceptor and covalently bonded molecules respectively. In fact, the covalent bond is found to significantly distort the metal electrode rearrangement such that junction rearrangement events can no longer be identified with a clean and well defined conductance signature. For this case, the force based identification process is used. Third, results for break junction measurements with different metals are presented. It is found that silver and palladium junctions rupture with forces different from those of gold contacts. In the case of silver experiments in ambient conditions, we can also identify oxygen impurities in the silver contact formation process, leading to force and conductance measurements of silver-oxygen structures. For the future, this work provides an experimental and analytical foundation that will enable insights into single molecule systems not previously accessible.
Thieme, Frank; Marillonnet, Sylvestre
2014-01-01
Identification of unknown sequences that flank known sequences of interest requires PCR amplification of DNA fragments that contain the junction between the known and unknown flanking sequences. Since amplified products often contain a mixture of specific and nonspecific products, the quick and clean (QC) cloning procedure was developed to clone specific products only. QC cloning is a ligation-independent cloning procedure that relies on the exonuclease activity of T4 DNA polymerase to generate single-stranded extensions at the ends of the vector and insert. A specific feature of QC cloning is the use of vectors that contain a sequence called catching sequence that allows cloning specific products only. QC cloning is performed by a one-pot incubation of insert and vector in the presence of T4 DNA polymerase at room temperature for 10 min followed by direct transformation of the incubation mix in chemo-competent Escherichia coli cells.
Photoresponse in graphene induced by defect engineering
NASA Astrophysics Data System (ADS)
Du, Ruxia; Wang, Wenhui; Du, Jianxin; Guo, Xitao; Liu, Er; Bing, Dan; Bai, Jing
2016-11-01
We present a photoresponse study on a lateral defect/pristine graphene junction device fabricated by a simple plasma irradiation method. The junction between pristine graphene and plasma-modified graphene was created by controlling the location of Ar+ plasma treatment. We found that a distinct photocurrent was generated at the junction by photocurrent line scanning measurements, and further analysis reveals that the photo-thermoelectric (PTE) effect, instead of the photovoltaic (PV) effect, dominates the photocurrent generation at the interface. Additionally, the obtained results suggest that tuning the defect density could be effective in modulating the optoelectronic performance of junctions in our device.
Epithelial junctions, cytoskeleton, and polarity.
Pásti, Gabriella; Labouesse, Michel
2014-11-04
A distinctive feature of polarized epithelial cells is their specialized junctions, which contribute to cell integrity and provide platforms to orchestrate cell shape changes. This chapter discusses the composition, assembly and remodeling of C. elegans cell-cell (CeAJ) and hemidesmosome-like cell-extracellular matrix junctions (CeHD), proteins that anchor the cytoskeleton, and mechanisms involved in establishing epithelial polarity. Major recent progress in this area has come from the analysis of mechanisms that maintain cell polarity, which involve lipids and trafficking, and on the impact of mechanical forces on junction remodeling. This chapter focuses on cellular, rather than developmental, aspects of epithelial cells.
NASA Astrophysics Data System (ADS)
Shukrinov, Yu. M.; Hamdipour, M.; Kolahchi, M. R.
2009-07-01
Charge formations on superconducting layers and creation of the longitudinal plasma wave in the stack of intrinsic Josephson junctions change crucially the superconducting current through the stack. Investigation of the correlations of superconducting currents in neighboring Josephson junctions and the charge correlations in neighboring superconducting layers allows us to predict the additional features in the current-voltage characteristics. The charge autocorrelation functions clearly demonstrate the difference between harmonic and chaotic behavior in the breakpoint region. Use of the correlation functions gives us a powerful method for the analysis of the current-voltage characteristics of coupled Josephson junctions.
Gatto, Alberto; Torroja-Fungairiño, Carlos; Mazzarotto, Francesco; Cook, Stuart A; Barton, Paul J R; Sánchez-Cabo, Fátima; Lara-Pezzi, Enrique
2014-04-01
Alternative splicing is the main mechanism governing protein diversity. The recent developments in RNA-Seq technology have enabled the study of the global impact and regulation of this biological process. However, the lack of standardized protocols constitutes a major bottleneck in the analysis of alternative splicing. This is particularly important for the identification of exon-exon junctions, which is a critical step in any analysis workflow. Here we performed a systematic benchmarking of alignment tools to dissect the impact of design and method on the mapping, detection and quantification of splice junctions from multi-exon reads. Accordingly, we devised a novel pipeline based on TopHat2 combined with a splice junction detection algorithm, which we have named FineSplice. FineSplice allows effective elimination of spurious junction hits arising from artefactual alignments, achieving up to 99% precision in both real and simulated data sets and yielding superior F1 scores under most tested conditions. The proposed strategy conjugates an efficient mapping solution with a semi-supervised anomaly detection scheme to filter out false positives and allows reliable estimation of expressed junctions from the alignment output. Ultimately this provides more accurate information to identify meaningful splicing patterns. FineSplice is freely available at https://sourceforge.net/p/finesplice/.
The complete chloroplast genome sequence of date palm (Phoenix dactylifera L.).
Yang, Meng; Zhang, Xiaowei; Liu, Guiming; Yin, Yuxin; Chen, Kaifu; Yun, Quanzheng; Zhao, Duojun; Al-Mssallem, Ibrahim S; Yu, Jun
2010-09-15
Date palm (Phoenix dactylifera L.), a member of Arecaceae family, is one of the three major economically important woody palms--the two other palms being oil palm and coconut tree--and its fruit is a staple food among Middle East and North African nations, as well as many other tropical and subtropical regions. Here we report a complete sequence of the data palm chloroplast (cp) genome based on pyrosequencing. After extracting 369,022 cp sequencing reads from our whole-genome-shotgun data, we put together an assembly and validated it with intensive PCR-based verification, coupled with PCR product sequencing. The date palm cp genome is 158,462 bp in length and has a typical quadripartite structure of the large (LSC, 86,198 bp) and small single-copy (SSC, 17,712 bp) regions separated by a pair of inverted repeats (IRs, 27,276 bp). Similar to what has been found among most angiosperms, the date palm cp genome harbors 112 unique genes and 19 duplicated fragments in the IR regions. The junctions between LSC/IRs and SSC/IRs show different features of sequence expansion in evolution. We identified 78 SNPs as major intravarietal polymorphisms within the population of a specific cp genome, most of which were located in genes with vital functions. Based on RNA-sequencing data, we also found 18 polycistronic transcription units and three highly expression-biased genes--atpF, trnA-UGC, and rrn23. Unlike most monocots, date palm has a typical cp genome similar to that of tobacco--with little rearrangement and gene loss or gain. High-throughput sequencing technology facilitates the identification of intravarietal variations in cp genomes among different cultivars. Moreover, transcriptomic analysis of cp genes provides clues for uncovering regulatory mechanisms of transcription and translation in chloroplasts.
Genetic heterogeneity in patients with Bartter syndrome type 1
Sun, Mingran; Ning, Jing; Xu, Weihong; Zhang, Han; Zhao, Kaishu; Li, Wenfu; Li, Guiying; Li, Shibo
2017-01-01
Bartter syndrome (BS) type 1 is an autosomal recessive kidney disorder caused by loss-of-function mutations in the solute carrier family 12 member 1 (SLC12A1) gene. To date, 72 BS type 1 patients harboring SLC12A1 mutations have been documented. Of these 144 alleles studied, 68 different disease-causing mutations have been detected in 129 alleles, and no mutation was detected in the remaining 15 alleles. The mutation types included missense/nonsense mutations, splicing mutations and small insertions and deletions ranging from 1 to 4 nucleotides. A large deletion encompassing a whole exon in the SLC12A1 gene has not yet been reported. The current study initially identified an undocumented homozygous frameshift mutation (c.1833delT) by Sanger sequencing analysis of a single infant with BS type 1. However, in a subsequent analysis, the mutation was detected only in the father's DNA. Upon further investigation using a next-generation sequencing approach, a deletion in exons 14 and 15 in both the patient and patient's mother was detected. The deletion was subsequently confirmed by use of a long-range polymerase chain reaction and was determined to be 3.16 kb in size based on sequencing of the junction fragment. The results of the present study demonstrated that pathogenic variants of SLC12A1 are heterogeneous. Large deletions appear to serve an etiological role in BS type 1, and may be more prevalent than previously thought. PMID:28000888
Genetic heterogeneity in patients with Bartter syndrome type 1.
Sun, Mingran; Ning, Jing; Xu, Weihong; Zhang, Han; Zhao, Kaishu; Li, Wenfu; Li, Guiying; Li, Shibo
2017-02-01
Bartter syndrome (BS) type 1 is an autosomal recessive kidney disorder caused by loss‑of‑function mutations in the solute carrier family 12 member 1 (SLC12A1) gene. To date, 72 BS type 1 patients harboring SLC12A1 mutations have been documented. Of these 144 alleles studied, 68 different disease‑causing mutations have been detected in 129 alleles, and no mutation was detected in the remaining 15 alleles. The mutation types included missense/nonsense mutations, splicing mutations and small insertions and deletions ranging from 1 to 4 nucleotides. A large deletion encompassing a whole exon in the SLC12A1 gene has not yet been reported. The current study initially identified an undocumented homozygous frameshift mutation (c.1833delT) by Sanger sequencing analysis of a single infant with BS type 1. However, in a subsequent analysis, the mutation was detected only in the father's DNA. Upon further investigation using a next‑generation sequencing approach, a deletion in exons 14 and 15 in both the patient and patient's mother was detected. The deletion was subsequently confirmed by use of a long‑range polymerase chain reaction and was determined to be 3.16 kb in size based on sequencing of the junction fragment. The results of the present study demonstrated that pathogenic variants of SLC12A1 are heterogeneous. Large deletions appear to serve an etiological role in BS type 1, and may be more prevalent than previously thought.
Isolated familial somatotropinomas: clinical features and analysis of the MEN1 gene.
De Menis, Ernesto; Prezant, Toni R
2002-01-01
Isolated familial somatotropinomas (IFS) rarely occurs in the absence of multiple endocrine neoplasia type I (MEN1) or the Carney complex. In the present study we report two Italian siblings affected by GH-secreting adenomas. There was no history of parental consanguinity. The sister presented at 18 years of age with secondary amenorrhea and acromegalic features and one of her two brothers presented with gigantism at the same age. Endocrinological investigations confirmed GH hypersecretion in both cases. Although a pituitary microadenoma was detected in both patients, transsphenoidal surgery was not successful. The sister received conventional radiotherapy and acromegaly is now considered controlled; the brother is being treated with octreotide LAR 30 mg monthly and the disease is considered clinically active. Patients, their parents and the unaffected brother underwent extensive evaluation, and no features of MEN1 or Carney complex were found. Analysis of polymorphic microsatellite markers from chromosome 11q13 (D11S599, D11S4945, D11S4939, D11S4938 and D11S987) showed that the acromegalic siblings had inherited different maternal chromosomes and shared the paternal chromosome. No pathogenic MEN1 sequence changes were detected by sequencing or dideoxy fingerprinting of the coding sequence (exons 2-10) and exon/intron junctions. Although mutations in the promoter, introns or untranslated regions of the MEN1 gene cannot be excluded, germline mutations within the coding region of this gene do not appear responsible for IFS in this family.
Proteins in Load-Bearing Junctions: The Histidine-Rich Metal-Binding Protein of Mussel Byssus†,‡
Zhao, Hua; Waite, J. Herbert
2007-01-01
Building complex load-bearing scaffolds depends on effective ways of joining functionally different biomacromolecules. The junction between collagen fibers and foamlike adhesive plaques in mussel byssus is robust despite the strikingly dissimilar connected structures. mcfp-4, the matrix protein from this junction, and its presecreted form from the foot tissue of Mytilus californianus were isolated and characterized. mcfp-4 has a mass of ∼93 kDa as determined by MALDI-TOF mass spectrometry. Its composition is dominated by histidine (22 mol %), but levels of lysine, arginine, and aspartate are also significant. A small amount of 3,4-dihydroxyphenyl-L-alanine (2 mol %) can be detected by amino acid analysis and redox cycling assays. The cDNA-deduced sequence of mcfp-4 reveals multiple variants with highly repetitive internal structures, including ∼36 tandemly repeated His-rich decapeptides (e.g., HVHTHRVLHK) in the N-terminal half and 16 somewhat more degenerate aspartate-rich undecapeptides (e.g., DDHVNDIAQTA) in the C-terminal half. Incubation of a synthetic peptide based on the His-rich decapeptide with Fe3+, Co2+, Ni2+, Zn2+, and Cu2+ indicates that only Cu is strongly bound. MALDI-TOF mass spectrometry of the peptide modified with diethyl pyrocarbonate before and after Cu binding suggests that histidine residues dominate Cu binding. In contrast, the aspartate-rich undecapeptides preferentially bind Ca2+. mcfp-4 is strategically positioned to function as a macromolecular bifunctional linker by using metal ions to couple its own His-rich domains to the His-rich termini of the preCOLs. Ca2+ may mediate coupling of the C-terminus to other calcium-binding plaque proteins. PMID:17115717
Genetics Home Reference: junctional epidermolysis bullosa
... PubMed Pulkkinen L, Uitto J. Mutation analysis and molecular genetics of epidermolysis bullosa. Matrix Biol. 1999 Feb;18( ... Sadowski S, Pfendner E, Uitto J. Epidermolysis bullosa. I. Molecular genetics of the junctional and hemidesmosomal variants. J Med ...
Facile fabrication and electrical investigations of nanostructured p-Si/n-TiO2 hetero-junction diode
NASA Astrophysics Data System (ADS)
Kumar, Arvind; Mondal, Sandip; Rao, K. S. R. Koteswara
2018-05-01
In this work, we have fabricated the nanostructured p-Si/n-TiO2 hetero-junction diode by using a facile spin-coating method. The XRD analysis suggests the presence of well crystalline anatase TiO2 film on Si with small grain size (˜16 nm). We have drawn the band alignment using Anderson model to understand the electrical transport across the junction. The current-voltage (J-V) characteristics analysis reveals the good rectification ratio (103 at ± 3 V) and slightly higher ideality factor (4.7) of our device. The interface states are responsible for the large ideality factor as Si/TiO2 form a dissimilar interface and possess a large number of dangling bonds. The study reveals the promises to be used Si/TiO2 diode as an alternative to the traditional p-n homo-junction diode, which typically require high budget.
Huang, X C; Maimaiti, X Y M; Huang, C W; Zhang, L; Li, Z B; Chen, Z G; Gao, X; Chen, T Y
2014-01-01
To further understand the synergistic mechanism of As2O3 and asscorbic acid (AA) in human osteosarcoma MG-63 cells by systems biology analysis. Human osteosarcoma MG-63 cells were treated by As2O3 (1 µmol/L), AA (62.5 µmol/L) and combined drugs (1 µmol/L As2O3 plus 62.5 µmol/L AA). Dynamic morphological characteristics were recorded by Cell-IQ system, and growth rate was calculated. Illumina beadchip assay was used to analyze the differential expression genes in different groups. Synergic effects on differential expression genes (DEGs) were analyzed by mixture linear model and singular value decomposition model. KEGG pathway annotations and GO enrichment analysis were performed to figure out the pathways involved in the synergic effects. We captured 1987 differential expression genes in combined therapy MG-63 cells. FAT1 gene was significantly upregulated in all three groups, which is a promising drug target as an important tumor suppressor analogue; meanwhile, HIST1H2BD gene was markedly downregulated in the As2O3 monotherapy group and the combined therapy group, which was found to be upregulated in prostatic cancer. These two genes might play critical roles in synergetic effects of AA and As2O3, although the exact mechanism needs further investigation. KEGG pathway analysis showed many DEGs were related with tight junction, and GO analysis also indicated that DEGs in the combined therapy cells gathered in occluding junction, apical junction complex, cell junction, and tight junction. AA potentiates the efficacy of As2O3 in MG-63 cells. Systems biology analysis showed the synergic effect on the DEGs.
Eibach, Sebastian; Moes, Greg; Hou, Yong Jin; Zovickian, John; Pang, Dachling
2017-10-01
Primary and secondary neurulation are the two known processes that form the central neuraxis of vertebrates. Human phenotypes of neural tube defects (NTDs) mostly fall into two corresponding categories consistent with the two types of developmental sequence: primary NTD features an open skin defect, an exposed, unclosed neural plate (hence an open neural tube defect, or ONTD), and an unformed or poorly formed secondary neural tube, and secondary NTD with no skin abnormality (hence a closed NTD) and a malformed conus caudal to a well-developed primary neural tube. We encountered three cases of a previously unrecorded form of spinal dysraphism in which the primary and secondary neural tubes are individually formed but are physically separated far apart and functionally disconnected from each other. One patient was operated on, in whom both the lumbosacral spinal cord from primary neurulation and the conus from secondary neurulation are each anatomically complete and endowed with functioning segmental motor roots tested by intraoperative triggered electromyography and direct spinal cord stimulation. The remarkable feature is that the two neural tubes are unjoined except by a functionally inert, probably non-neural band. The developmental error of this peculiar malformation probably occurs during the critical transition between the end of primary and the beginning of secondary neurulation, in a stage aptly called junctional neurulation. We describe the current knowledge concerning junctional neurulation and speculate on the embryogenesis of this new class of spinal dysraphism, which we call junctional neural tube defect.
Inhibitors of connexin and pannexin channels as potential therapeutics
Willebrords, Joost; Maes, Michaël; Crespo Yanguas, Sara; Vinken, Mathieu
2018-01-01
While gap junctions support the exchange of a number of molecules between neighboring cells, connexin hemichannels provide communication between the cytosol and the extracellular environment of an individual cell. The latter equally holds true for channels composed of pannexin proteins, which display an architecture reminiscent of connexin hemichannels. In physiological conditions, gap junctions are usually open, while connexin hemichannels and, to a lesser extent, pannexin channels are typically closed, yet they can be activated by a number of pathological triggers. Several agents are available to inhibit channels built up by connexin and pannexin proteins, including alcoholic substances, glycyrrhetinic acid, anesthetics and fatty acids. These compounds not always strictly distinguish between gap junctions, connexin hemichannels and pannexin channels, and may have effects on other targets as well. An exception lies with mimetic peptides, which reproduce specific amino acid sequences in connexin or pannexin primary protein structure. In this paper, a state-of-the-art overview is provided on inhibitors of cellular channels consisting of connexins and pannexins with specific focus on their mode-of-action and therapeutic potential. PMID:28720428
Beyer, Eric C; Lipkind, Gregory M; Kyle, John W; Berthoud, Viviana M
2012-08-01
The amino terminal domain (NT) of the connexins consists of their first 22-23 amino acids. Site-directed mutagenesis studies have demonstrated that NT amino acids are determinants of gap junction channel properties including unitary conductance, permeability/selectivity, and gating in response to transjunctional voltage. The importance of this region has also been emphasized by the identification of multiple disease-associated connexin mutants affecting amino acid residues in the NT region. The first part of the NT is α-helical. The structure of the Cx26 gap junction channel shows that the NT α-helix localizes within the channel, and lines the wall of the pore. Interactions of the amino acid residues in the NT with those in the transmembrane helices may be critical for holding the channel open. The predicted sites of these interactions and the applicability of the Cx26 structure to the NT of other connexins are considered. This article is part of a Special Issue entitled: The Communicating junctions, composition, structure and characteristics. Copyright © 2011. Published by Elsevier B.V.
RadNet Air Data From Grand Junction, CO
This page presents radiation air monitoring and air filter analysis data for Grand Junction, CO from EPA's RadNet system. RadNet is a nationwide network of monitoring stations that measure radiation in air, drinking water and precipitation.
Spinelli, Roberta; Pirola, Alessandra; Redaelli, Sara; Sharma, Nitesh; Raman, Hima; Valletta, Simona; Magistroni, Vera; Piazza, Rocco; Gambacorti-Passerini, Carlo
2013-11-01
Point mutations in intronic regions near mRNA splice junctions can affect the splicing process. To identify novel splicing variants from exome sequencing data, we developed a bioinformatics splice-site prediction procedure to analyze next-generation sequencing (NGS) data (SpliceFinder). SpliceFinder integrates two functional annotation tools for NGS, ANNOVAR and MutationTaster and two canonical splice site prediction programs for single mutation analysis, SSPNN and NetGene2. By SpliceFinder, we identified somatic mutations affecting RNA splicing in a colon cancer sample, in eight atypical chronic myeloid leukemia (aCML), and eight CML patients. A novel homozygous splicing mutation was found in APC (NM_000038.4:c.1312+5G>A) and six heterozygous in GNAQ (NM_002072.2:c.735+1C>T), ABCC 3 (NM_003786.3:c.1783-1G>A), KLHDC 1 (NM_172193.1:c.568-2A>G), HOOK 1 (NM_015888.4:c.1662-1G>A), SMAD 9 (NM_001127217.2:c.1004-1C>T), and DNAH 9 (NM_001372.3:c.10242+5G>A). Integrating whole-exome and RNA sequencing in aCML and CML, we assessed the phenotypic effect of mutations on mRNA splicing for GNAQ, ABCC 3, HOOK 1. In ABCC 3 and HOOK 1, RNA-Seq showed the presence of aberrant transcripts with activation of a cryptic splice site or intron retention, validated by the reverse transcription-polymerase chain reaction (RT-PCR) in the case of HOOK 1. In GNAQ, RNA-Seq showed 22% of wild-type transcript and 78% of mRNA skipping exon 5, resulting in a 4-6 frameshift fusion confirmed by RT-PCR. The pipeline can be useful to identify intronic variants affecting RNA sequence by complementing conventional exome analysis.
PathwaySplice: An R package for unbiased pathway analysis of alternative splicing in RNA-Seq data.
Yan, Aimin; Ban, Yuguang; Gao, Zhen; Chen, Xi; Wang, Lily
2018-04-24
Pathway analysis of alternative splicing would be biased without accounting for the different number of exons or junctions associated with each gene, because genes with higher number of exons or junctions are more likely to be included in the "significant" gene list in alternative splicing. We present PathwaySplice, an R package that (1) Performs pathway analysis that explicitly adjusts for the number of exons or junctions associated with each gene; (2) Visualizes selection bias due to different number of exons or junctions for each gene and formally tests for presence of bias using logistic regression; (3) Supports gene sets based on the Gene Ontology terms, as well as more broadly defined gene sets (e.g. MSigDB) or user defined gene sets; (4) Identifies the significant genes driving pathway significance and (5) Organizes significant pathways with an enrichment map, where pathways with large number of overlapping genes are grouped together in a network graph. https://bioconductor.org/packages/release/bioc/html/PathwaySplice.html. lily.wangg@gmail.com, xi.steven.chen@gmail.com.
Turbulent boundary layers subjected to multiple curvatures and pressure gradients
NASA Technical Reports Server (NTRS)
Bandyopadhyay, Promode R.; Ahmed, Anwar
1993-01-01
The effects of abruptly applied cycles of curvatures and pressure gradients on turbulent boundary layers are examined experimentally. Two two-dimensional curved test surfaces are considered: one has a sequence of concave and convex longitudinal surface curvatures and the other has a sequence of convex and concave curvatures. The choice of the curvature sequences were motivated by a desire to study the asymmetric response of turbulent boundary layers to convex and concave curvatures. The relaxation of a boundary layer from the effects of these two opposite sequences has been compared. The effect of the accompaying sequences of pressure gradient has also been examined but the effect of curvature dominates. The growth of internal layers at the curvature junctions have been studied. Measurements of the Gortler and corner vortex systems have been made. The boundary layer recovering from the sequence of concave to convex curvature has a sustained lower skin friction level than in that recovering from the sequence of convex to concave curvature. The amplification and suppression of turbulence due to the curvature sequences have also been studied.
A HIV-1 heterosexual transmission chain in Guangzhou, China: a molecular epidemiological study.
Han, Zhigang; Leung, Tommy W C; Zhao, Jinkou; Wang, Ming; Fan, Lirui; Li, Kai; Pang, Xinli; Liang, Zhenbo; Lim, Wilina W L; Xu, Huifang
2009-09-25
We conducted molecular analyses to confirm four clustering HIV-1 infections (Patient A, B, C & D) in Guangzhou, China. These cases were identified by epidemiological investigation and suspected to acquire the infection through a common heterosexual transmission chain. Env C2V3V4 region, gag p17/p24 junction and partial pol gene of HIV-1 genome from serum specimens of these infected cases were amplified by reverse transcription polymerase chain reaction (RT-PCR) and nucleotide sequenced. Phylogenetic analyses indicated that their viral nucleotide sequences were significantly clustered together (bootstrap value is 99%, 98% and 100% in env, gag and pol tree respectively). Evolutionary distance analysis indicated that their genetic diversities of env, gag and pol genes were significantly lower than non-clustered controls, as measured by unpaired t-test (env gene comparison: p < 0.005; gag gene comparison: p < 0.005; pol gene comparison: p < 0.005). Epidemiological results and molecular analyses consistently illustrated these four cases represented a transmission chain which dispersed in the locality through heterosexual contact involving commercial sex worker.
Combined deficiency of MSH2 and Sμ region abolishes class switch recombination.
Leduc, Claire; Haddad, Dania; Laviolette-Malirat, Nathalie; Nguyen Huu, Ngoc-Sa; Khamlichi, Ahmed Amine
2010-10-01
Class switch recombination (CSR) is mediated by G-rich tandem repeated sequences termed switch regions. Transcription of switch regions generates single-stranded R loops that provide substrates for activation-induced cytidine deaminase. Mice deficient in MSH2 have a mild defect in CSR and analysis of their switch junctions has led to a model in which MSH2 is more critical for switch recombination events outside than within the tandem repeats. It is also known that deletion of the whole Sμ region severely impairs but does not abrogate CSR despite the lack of detectable R loops. Here, we demonstrate that deficiency of both MSH2 and the Sμ region completely abolishes CSR and that the abrogation occurs at the genomic level. This finding further supports the crucial role of MSH2 outside the tandem repeats. It also indicates that during CSR, MSH2 has access to activation-induced cytidine deaminase targets in R-loop-deficient Iμ-Cμ sequences rarely used in CSR, suggesting an MSH2-dependent DNA processing activity at the Iμ exon that may decrease with transcription elongation across the Sμ region.
Calcium-Dependent Protein Kinase Genes in Corn Roots
NASA Technical Reports Server (NTRS)
Takezawa, D.; Patil, S.; Bhatia, A.; Poovaiah, B. W.
1996-01-01
Two cDNAs encoding Ca-2(+) - Dependent Protein Kinases (CDPKs), Corn Root Protein Kinase 1 and 2 (CRPK 1, CRPK 2) were isolated from the root tip library of corn (Zea mays L., cv. Merit) and their nucleotide sequences were determined. Deduced amino acid sequences of both the clones have features characteristic of plant CDPKS, including all 11 conserved serine/threonine kinase subdomains, a junction domain and a calmodulin-like domain with four Ca-2(+), -binding sites. Northern analysis revealed that CRPKI mRNA is preferentially expressed in roots, especially in the root tip; whereas, the expression of CRPK2 mRNA was very low in all the tissues tested. In situ hybridization experiments revealed that CRPKI mRNA is highly expressed in the root apex, as compared to other parts of the root. Partially purified CDPK from the root tip phosphorylates syntide-2, a common peptide substrate for plant CDPKs, and the phosphorylation was stimulated 7-fold by the addition of Ca-2(+). Our results show that two CDPK isoforms are expressed in corn roots and they may be involved in the Ca-2(+)-dependent signal transduction process.
Serrano-Ahumada, Ana Silvia; Cortes-González, Vianney; González-Huerta, Luz María; Cuevas, Sergio; Aguilar-Lozano, Luis; Villanueva-Mendoza, Cristina
2018-02-01
The aim of this study was to describe a case of severe keratitis-ichthyosis-deafness (KID) syndrome with ocular surface squamous neoplasia. The affected patient underwent complete ocular and systemic examinations. The molecular studies included polymerase chain reaction amplification and automated DNA sequencing of the complete gap junction beta-2 (GJB2) gene coding sequence. A 30-year-old man presented with generalized erythro-hyperkeratosis and deafness and complaints of decreased visual acuity, tearing, and photophobia. Ophthalmic examination showed corneal erosion, vascularization, and a gray gelatinous lesion partially covering the right cornea, suggestive of squamous neoplasia. The clinical features were characteristic of KID syndrome. This diagnosis was confirmed with a DNA analysis showing the pathogenic variant p.D50N in the GJB2 gene. Presumed squamous neoplasia was treated with topical interferon α2b. KID syndrome is a very rare disease that has been reported with an incremental incidence of squamous cell carcinoma of the mucous membranes and skin (12%-15%). Here, we presented a case of severe systemic KID syndrome with ocular surface squamous neoplasia.
Sugai, Akihiro; Sato, Hiroki; Yoneda, Misako; Kai, Chieko
2017-08-01
The regulation of transcription during Nipah virus (NiV) replication is poorly understood. Using a bicistronic minigenome system, we investigated the involvement of non-coding regions (NCRs) in the transcriptional re-initiation efficiency of NiV RNA polymerase. Reporter assays revealed that attenuation of NiV gene expression was not constant at each gene junction, and that the attenuating property was controlled by the 3' NCR. However, this regulation was independent of the gene-end, gene-start and intergenic regions. Northern blot analysis indicated that regulation of viral gene expression by the phosphoprotein (P) and large protein (L) 3' NCRs occurred at the transcription level. We identified uridine-rich tracts within the L 3' NCR that are similar to gene-end signals. These gene-end-like sequences were recognized as weak transcription termination signals by the viral RNA polymerase, thereby reducing downstream gene transcription. Thus, we suggest that NiV has a unique mechanism of transcriptional regulation. Copyright © 2017 Elsevier Inc. All rights reserved.
Genomic organization and expression of the human MSH3 gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Watanabe, Atsushi; Ikejima, Miyoko; Suzuki, Noriko
1996-02-01
We have studied the expression and genomic organization of the human MSH3 gene, which encodes a human homologue of the bacterial DNA mismatch repair protein MutS. This gene is located upstream of the dihydrofolate reductase (DHFR) gene. Northern analysis has demonstrated that the hMSH3 gene is expressed in a variety of human tissues at low levels, like the DHFR gene. Characterization of cosmid clones has shown that the hMSH3 gene consists of 24 exons spanning at least 160 kb. All exon-intron junction sequences match the classical GT/AG rule, except that intron 6 has AT and AA at the ends. Twomore » major transcripts of 5.0 and 3.8 kb have been shown to be derived from the differential use of two polyadenylation sites. Elucidation of the complete genomic organization and the nucleotide sequences of the introns of the hMSH3 gene should be useful for studying the function of this gene and the possible involvement of specific mutations of the hMSH3 gene in some diseases. 34 refs., 5 figs., 1 tab.« less
NASA Astrophysics Data System (ADS)
Cui, B.; Song, C.; Li, F.; Zhong, X. Y.; Wang, Z. C.; Werner, P.; Gu, Y. D.; Wu, H. Q.; Saleem, M. S.; Parkin, S. S. P.; Pan, F.
2017-10-01
Manipulation of oxygen vacancies (VO ) in single oxide layers by varying the electric field can result in significant modulation of the ground state. However, in many oxide multilayers with strong application potentials, e.g., ferroelectric tunnel junctions and solid-oxide fuel cells, understanding VO behavior in various layers under an applied electric field remains a challenge, owing to complex VO transport between different layers. By sweeping the external voltage, a reversible manipulation of VO and a corresponding fixed magnetic phase transition sequence in cobaltite/manganite (SrCoO3 -x/La0.45Sr0.55MnO3 -y ) heterostructures are reported. The magnetic phase transition sequence confirms that the priority of electric-field-induced VO formation or annihilation in the complex bilayer system is mainly determined by the VO formation energies and Gibbs free-energy differences, which is supported by theoretical analysis. We not only realize a reversible manipulation of the magnetic phase transition in an oxide bilayer but also provide insight into the electric-field control of VO engineering in heterostructures.
Ma, Nina S; Malloy, Peter J; Pitukcheewanont, Pisit; Dreimane, Daina; Geffner, Mitchell E; Feldman, David
2009-10-01
To study the vitamin D receptor (VDR) gene in a young girl with severe rickets and clinical features of hereditary vitamin D resistant rickets, including hypocalcemia, hypophosphatemia, partial alopecia, and elevated serum levels of 1,25-dihydroxyvitamin D. We amplified and sequenced DNA samples from blood from the patient, her mother, and the patient's two siblings. We also amplified and sequenced the VDR cDNA from RNA isolated from the patient's blood. DNA sequence analyses of the VDR gene showed that the patient was homozygous for a novel guanine to thymine substitution in the 5'-splice site in the exon 8-intron J junction. Analysis of the VDR cDNA using reverse transcriptase-polymerase chain reaction showed that exons 7 and 9 were fused, and that exon 8 was skipped. The mother was heterozygous for the mutation and the two siblings were unaffected. A novel splice site mutation was identified in the VDR gene that caused exon 8 to be skipped. The mutation deleted amino acids 303-341 in the VDR ligand-binding domain, which is expected to render the VDR non-functional. Nevertheless, successful outpatient treatment was achieved with frequent high doses of oral calcium.
Lamm, Ayelet T; Stadler, Michael R; Zhang, Huibin; Gent, Jonathan I; Fire, Andrew Z
2011-02-01
We have used a combination of three high-throughput RNA capture and sequencing methods to refine and augment the transcriptome map of a well-studied genetic model, Caenorhabditis elegans. The three methods include a standard (non-directional) library preparation protocol relying on cDNA priming and foldback that has been used in several previous studies for transcriptome characterization in this species, and two directional protocols, one involving direct capture of single-stranded RNA fragments and one involving circular-template PCR (CircLigase). We find that each RNA-seq approach shows specific limitations and biases, with the application of multiple methods providing a more complete map than was obtained from any single method. Of particular note in the analysis were substantial advantages of CircLigase-based and ssRNA-based capture for defining sequences and structures of the precise 5' ends (which were lost using the double-strand cDNA capture method). Of the three methods, ssRNA capture was most effective in defining sequences to the poly(A) junction. Using data sets from a spectrum of C. elegans strains and stages and the UCSC Genome Browser, we provide a series of tools, which facilitate rapid visualization and assignment of gene structures.
Prospective in (Primate) Dental Analysis through Tooth 3D Topographical Quantification
Guy, Franck; Gouvard, Florent; Boistel, Renaud; Euriat, Adelaïde; Lazzari, Vincent
2013-01-01
The occlusal morphology of the teeth is mostly determined by the enamel-dentine junction morphology; the enamel-dentine junction plays the role of a primer and conditions the formation of the occlusal enamel reliefs. However, the accretion of the enamel cap yields thickness variations that alter the morphology and the topography of the enamel–dentine junction (i.e., the differential deposition of enamel by the ameloblasts create an external surface that does not necessarily perfectly parallel the enamel–dentine junction). This self-reliant influence of the enamel on tooth morphology is poorly understood and still under-investigated. Studies considering the relationship between enamel and dentine morphologies are rare, and none of them tackled this relationship in a quantitative way. Major limitations arose from: (1) the difficulties to characterize the tooth morphology in its comprehensive tridimensional aspect and (2) practical issues in relating enamel and enamel–dentine junction quantitative traits. We present new aspects of form representation based exclusively on 3D analytical tools and procedures. Our method is applied to a set of 21 unworn upper second molars belonging to eight extant anthropoid genera. Using geometrical analysis of polygonal meshes representatives of the tooth form, we propose a 3D dataset that constitutes a detailed characterization of the enamel and of the enamel–dentine junction morphologies. Also, for the first time, to our knowledge, we intend to establish a quantitative method for comparing enamel and enamel–dentine junction surfaces descriptors (elevation, inclination, orientation, etc.). New indices that allow characterizing the occlusal morphology are proposed and discussed. In this note, we present technical aspects of our method with the example of anthropoid molars. First results show notable individual variations and taxonomic heterogeneities for the selected topographic parameters and for the pattern and strength of association between enamel–dentine junction and enamel, the enamel cap altering in different ways the “transcription” of the enamel–dentine junction morphology. PMID:23826088
DOE Office of Scientific and Technical Information (OSTI.GOV)
Saleh, H; Ferjani, S; Masssey, V
Purpose: Perform dosimetric comparison between planned and delivered dose in the junction area, measure daily dose variation in the arc junction area for pediatric patients treated for medulloblastoma using Craniospinal axis irradiation(CSI) Material and methods Dose comparison in the junction area, daily dose variation in the arc junction area for a Rando Phantom and 5 pediatric patients treated using CSI technique were analyzed. Plans were created using the Eclipse treatment planning system. Two arcs for cranium and 1 arc for spine region were used. Planar dose matrix was created by projecting phantom and patient plan into the ArcCheck phantom. EBT3more » film was placed in the middle of ArcCheck plug to measure dose distribution in the junction areaDuring patient treatment, strip of EBT3 film was placed daily at each junction area for verification. EBT3 films were scanned using a flatbed scanner, Epson Expression 10000 XL. Film QA pro software was used to analyze film. Scanning and analysis was performed according to vendor recommendations and AAPM TG-55 report. Films were scanned and analyzed daily after each treatment and at the end of treatment course. Planar dose distributions from films were compared with planar dose distribution from treatment planning system. Results: Comparison of planned vs. measured dose distributions for patients have passing rates of 90%–100% with 3% and 3 mm gamma analysis. In some of the treatment fractions, daily setup film showed variation in dose distribution in the junction area. Conclusion: It is critical to measure dose distribution in the arc junction area and use additional quality assurance measures to verify daily setup for CSI patient where one or more junctions are present. EBT3 film prove to be a good tool to achieve this task considering flexibility associated with the film such as symmetry, self-developing and ease of use.« less
RAP: RNA-Seq Analysis Pipeline, a new cloud-based NGS web application
2015-01-01
Background The study of RNA has been dramatically improved by the introduction of Next Generation Sequencing platforms allowing massive and cheap sequencing of selected RNA fractions, also providing information on strand orientation (RNA-Seq). The complexity of transcriptomes and of their regulative pathways make RNA-Seq one of most complex field of NGS applications, addressing several aspects of the expression process (e.g. identification and quantification of expressed genes and transcripts, alternative splicing and polyadenylation, fusion genes and trans-splicing, post-transcriptional events, etc.). Moreover, the huge volume of data generated by NGS platforms introduces unprecedented computational and technological challenges to efficiently analyze and store sequence data and results. Methods In order to provide researchers with an effective and friendly resource for analyzing RNA-Seq data, we present here RAP (RNA-Seq Analysis Pipeline), a cloud computing web application implementing a complete but modular analysis workflow. This pipeline integrates both state-of-the-art bioinformatics tools for RNA-Seq analysis and in-house developed scripts to offer to the user a comprehensive strategy for data analysis. RAP is able to perform quality checks (adopting FastQC and NGS QC Toolkit), identify and quantify expressed genes and transcripts (with Tophat, Cufflinks and HTSeq), detect alternative splicing events (using SpliceTrap) and chimeric transcripts (with ChimeraScan). This pipeline is also able to identify splicing junctions and constitutive or alternative polyadenylation sites (implementing custom analysis modules) and call for statistically significant differences in genes and transcripts expression, splicing pattern and polyadenylation site usage (using Cuffdiff2 and DESeq). Results Through a user friendly web interface, the RAP workflow can be suitably customized by the user and it is automatically executed on our cloud computing environment. This strategy allows to access to bioinformatics tools and computational resources without specific bioinformatics and IT skills. RAP provides a set of tabular and graphical results that can be helpful to browse, filter and export analyzed data, according to the user needs. PMID:26046471
Predominant expansion of V gamma 9/V delta 2 T cells in a tularemia patient.
Sumida, T; Maeda, T; Takahashi, H; Yoshida, S; Yonaha, F; Sakamoto, A; Tomioka, H; Koike, T; Yoshida, S
1992-01-01
We describe a 58-year-old man with tularemia and expanding gamma delta T cells in his peripheral blood lymphocytes (PBL) (32.7% of total PBL). In the present work, we analyzed the T-cell receptor V gamma/V delta repertoire of these cells by making use of the polymerase chain reaction and flow cytometry and found that they were mostly CD4- CD8- CD3+ V gamma 9/V delta 2+. The sequence analysis of 16 cDNA clones encoding the V gamma 9-J region revealed that the V gamma 9-Jp combination was strikingly overrepresented but that the junctional (N) region was heterogeneous. This suggested that the gamma delta T cells in PBL from a patient with tularemia were polyclonally expanded. Images PMID:1534075
Rathinasabapathi, Pasupathi; Purushothaman, Natarajan; Parani, Madasamy
2016-05-01
Although rice genome was sequenced in the year 2002, efforts in resequencing the large number of available accessions, landraces, traditional cultivars, and improved varieties of this important food crop are limited. We have initiated resequencing of the traditional cultivars from India. Kavuni is an important traditional rice cultivar from South India that attracts premium price for its nutritional and therapeutic properties. Whole-genome sequencing of Kavuni using Illumina platform and SNPs analysis using Nipponbare reference genome identified 1 150 711 SNPs of which 377 381 SNPs were located in the genic regions. Non-synonymous SNPs (62 708) were distributed in 19 251 genes, and their number varied between 1 and 115 per gene. Large-effect DNA polymorphisms (7769) were present in 3475 genes. Pathway mapping of these polymorphisms revealed the involvement of genes related to carbohydrate metabolism, translation, protein-folding, and cell death. Analysis of the starch biosynthesis related genes revealed that the granule-bound starch synthase I gene had T/G SNPs at the first intron/exon junction and a two-nucleotide combination, which were reported to favour high amylose content and low glycemic index. The present study provided a valuable genomics resource to study the rice varieties with nutritional and medicinal properties.
Synchronization of a Josephson junction array in terms of global variables
NASA Astrophysics Data System (ADS)
Vlasov, Vladimir; Pikovsky, Arkady
2013-08-01
We consider an array of Josephson junctions with a common LCR load. Application of the Watanabe-Strogatz approach [Physica DPDNPDT0167-278910.1016/0167-2789(94)90196-1 74, 197 (1994)] allows us to formulate the dynamics of the array via the global variables only. For identical junctions this is a finite set of equations, analysis of which reveals the regions of bistability of the synchronous and asynchronous states. For disordered arrays with distributed parameters of the junctions, the problem is formulated as an integro-differential equation for the global variables; here stability of the asynchronous states and the properties of the transition synchrony-asynchrony are established numerically.
Kjær, Jonas; Belsham, Graham J
2018-04-15
Foot-and-mouth disease virus (FMDV) has a positive-sense single-stranded RNA (ssRNA) genome that includes a single, large open reading frame encoding a polyprotein. The cotranslational "cleavage" of this polyprotein at the 2A/2B junction is mediated by the 2A peptide (18 residues in length) using a nonproteolytic mechanism termed "ribosome skipping" or "StopGo." Multiple variants of the 2A polypeptide with this property among the picornaviruses share a conserved C-terminal motif [D(V/I)E(S/T)NPG↓P]. The impact of 2A modifications within this motif on FMDV protein synthesis, polyprotein processing, and virus viability were investigated. Amino acid substitutions are tolerated at residues E 14 , S 15 , and N 16 within the 2A sequences of infectious FMDVs despite their reported "cleavage" efficiencies at the 2A/2B junction of only ca. 30 to 50% compared to that of the wild type (wt). In contrast, no viruses containing substitutions at residue P 17 , G 18 , or P 19 , which displayed little or no "cleavage" activity in vitro , were rescued, but wt revertants were obtained. The 2A substitutions impaired the replication of an FMDV replicon. Using transient-expression assays, it was shown that certain amino acid substitutions at residues E 14 , S 15 , N 16 , and P 19 resulted in partial "cleavage" of a protease-free polyprotein, indicating that these specific residues are not essential for cotranslational "cleavage." Immunofluorescence studies, using full-length FMDV RNA transcripts encoding mutant 2A peptides, indicated that the 2A peptide remained attached to adjacent proteins, presumably 2B. These results show that efficient "cleavage" at the 2A/2B junction is required for optimal virus replication. However, maximal StopGo activity does not appear to be essential for the viability of FMDV. IMPORTANCE Foot-and-mouth disease virus (FMDV) causes one of the most economically important diseases of farm animals. Cotranslational "cleavage" of the FMDV polyprotein precursor at the 2A/2B junction, termed StopGo, is mediated by the short 2A peptide through a nonproteolytic mechanism which leads to release of the nascent protein and continued translation of the downstream sequence. Improved understanding of this process will not only give a better insight into how this peptide influences the FMDV replication cycle but may also assist the application of this sequence in biotechnology for the production of multiple proteins from a single mRNA. Our data show that single amino acid substitutions in the 2A peptide can have a major influence on viral protein synthesis, virus viability, and polyprotein processing. They also indicate that efficient "cleavage" at the 2A/2B junction is required for optimal virus replication. However, maximal StopGo activity is not essential for the viability of FMDV. Copyright © 2018 American Society for Microbiology.
Campbell, Jacquelyn A.; Schelling, Pierre; Wetzel, J. Denise; Johnson, Elizabeth M.; Forrest, J. Craig; Wilson, Greame A. R.; Aurrand-Lions, Michel; Imhof, Beat A.; Stehle, Thilo; Dermody, Terence S.
2005-01-01
Reovirus infections are initiated by the binding of viral attachment protein σ1 to receptors on the surface of host cells. The σ1 protein is an elongated fiber comprised of an N-terminal tail that inserts into the virion and a C-terminal head that extends from the virion surface. The prototype reovirus strains type 1 Lang/53 (T1L/53) and type 3 Dearing/55 (T3D/55) use junctional adhesion molecule A (JAM-A) as a receptor. The C-terminal half of the T3D/55 σ1 protein interacts directly with JAM-A, but the determinants of receptor-binding specificity have not been identified. In this study, we investigated whether JAM-A also mediates the attachment of the prototype reovirus strain type 2 Jones/55 (T2J/55) and a panel of field-isolate strains representing each of the three serotypes. Antibodies specific for JAM-A were capable of inhibiting infections of HeLa cells by T1L/53, T2J/55, and T3D/55, demonstrating that strains of all three serotypes use JAM-A as a receptor. To corroborate these findings, we introduced JAM-A or the structurally related JAM family members JAM-B and JAM-C into Chinese hamster ovary cells, which are poorly permissive for reovirus infection. Both prototype and field-isolate reovirus strains were capable of infecting cells transfected with JAM-A but not those transfected with JAM-B or JAM-C. A sequence analysis of the σ1-encoding S1 gene segment of the strains chosen for study revealed little conservation in the deduced σ1 amino acid sequences among the three serotypes. This contrasts markedly with the observed sequence variability within each serotype, which is confined to a small number of amino acids. Mapping of these residues onto the crystal structure of σ1 identified regions of conservation and variability, suggesting a likely mode of JAM-A binding via a conserved surface at the base of the σ1 head domain. PMID:15956543
Weissella confusa: a rare cause of vancomycin-resistant Gram-positive bacteraemia.
Kumar, Anil; Augustine, Deepthi; Sudhindran, S; Kurian, Anu M; Dinesh, Kavitha R; Karim, Shamsul; Philip, Rosamma
2011-10-01
We describe a case of bacteraemia caused by Weissella confusa in a 48-year-old male who was operated on for adenocarcinoma of the gastro-oesophageal junction and maintained on total parenteral nutrition. Blood cultures were positive for a vancomycin-resistant streptococcus-like organism which was identified as W. confusa by 16S rRNA gene sequencing.
Development of Pulsed Processes for the Manufacture of Solar Cells
NASA Technical Reports Server (NTRS)
1979-01-01
The development status of the process based upon ion implantation for the introduction of junctions and back surface fields is described. A process sequence is presented employing ion implantation and pulse processing. Efforts to improve throughout and descrease process element costs for furnace annealing are described. Design studies for a modular 3,000 wafer per hour pulse processor are discussed.
Application of hidden Markov models to biological data mining: a case study
NASA Astrophysics Data System (ADS)
Yin, Michael M.; Wang, Jason T.
2000-04-01
In this paper we present an example of biological data mining: the detection of splicing junction acceptors in eukaryotic genes. Identification or prediction of transcribed sequences from within genomic DNA has been a major rate-limiting step in the pursuit of genes. Programs currently available are far from being powerful enough to elucidate the gene structure completely. Here we develop a hidden Markov model (HMM) to represent the degeneracy features of splicing junction acceptor sites in eukaryotic genes. The HMM system is fully trained using an expectation maximization (EM) algorithm and the system performance is evaluated using the 10-way cross- validation method. Experimental results show that our HMM system can correctly classify more than 94% of the candidate sequences (including true and false acceptor sites) into right categories. About 90% of the true acceptor sites and 96% of the false acceptor sites in the test data are classified correctly. These results are very promising considering that only the local information in DNA is used. The proposed model will be a very important component of an effective and accurate gene structure detection system currently being developed in our lab.
Vandergaast, Rianna; Hoover, Lisa I; Zheng, Kang; Fredericksen, Brenda L
2014-04-09
West Nile virus (WNV) is a positive-sense RNA arbovirus responsible for recent outbreaks of severe neurological disease within the US and Europe. Large-scale analyses of antiviral compounds that inhibit virus replication have been limited due to the lack of an adequate WN reporter virus. Previous attempts to insert a reporter into the 3' untranslated region of WNV generated unstable viruses, suggesting that this region does not accommodate additional nucleotides. Here, we engineered two WNV infectious clones containing insertions at the Capsid (C)/Capsid Anchor (CA) junction of the viral polyprotein. Recombinant viruses containing a TAT(1-67) or Gaussia Luciferase (GLuc) gene at this location were successfully recovered. However, rapid loss of most, if not all, of the reporter sequence occurred for both viruses, indicating that the reporter viruses were not stable. While the GLuc viruses predominantly reverted back to wild-type WNV length, the TAT viruses retained up to 75 additional nucleotides of the reporter sequence. These additional nucleotides were stable over at least five passages and did not significantly alter WNV fitness. Thus, the C/CA junction of WNV can tolerate additional nucleotides, though insertions are subject to certain constraints.
Vandergaast, Rianna; Hoover, Lisa I.; Zheng, Kang; Fredericksen, Brenda L.
2014-01-01
West Nile virus (WNV) is a positive-sense RNA arbovirus responsible for recent outbreaks of severe neurological disease within the US and Europe. Large-scale analyses of antiviral compounds that inhibit virus replication have been limited due to the lack of an adequate WN reporter virus. Previous attempts to insert a reporter into the 3’ untranslated region of WNV generated unstable viruses, suggesting that this region does not accommodate additional nucleotides. Here, we engineered two WNV infectious clones containing insertions at the Capsid (C)/Capsid Anchor (CA) junction of the viral polyprotein. Recombinant viruses containing a TAT(1-67) or Gaussia Luciferase (GLuc) gene at this location were successfully recovered. However, rapid loss of most, if not all, of the reporter sequence occurred for both viruses, indicating that the reporter viruses were not stable. While the GLuc viruses predominantly reverted back to wild-type WNV length, the TAT viruses retained up to 75 additional nucleotides of the reporter sequence. These additional nucleotides were stable over at least five passages and did not significantly alter WNV fitness. Thus, the C/CA junction of WNV can tolerate additional nucleotides, though insertions are subject to certain constraints. PMID:24721788
The Reduction of TED in Ion Implanted Silicon
NASA Astrophysics Data System (ADS)
Jain, Amitabh
2008-11-01
The leading challenge in the continued scaling of junctions made by ion implantation and annealing is the control of the undesired transient enhanced diffusion (TED) effect. Spike annealing has been used as a means to reduce this effect and has proven successful in previous nodes. The peak temperature in this process is typically 1050 °C and the time spent within 50 °C of the peak is of the order of 1.5 seconds. As technology advances along the future scaling roadmap, further reduction or elimination of the enhanced diffusion effect is necessary. We have shown that raising the peak temperature to 1175 °C or more and reduction of the anneal time at peak temperature to less than a millisecond is effective in eliminating enhanced diffusion. We show that it is possible to employ a sequence of millisecond anneal followed by spike anneal to obtain profiles that do not exhibit gradient degradation at the junction and have junction depth and sheet resistance appropriate to the needs of future technology nodes. We have implemented millisecond annealing using a carbon dioxide laser to support high-volume manufacturing of 65 nm microprocessors and system-on-chip products. We further show how the use of molecular ion implantation to produce amorphousness followed by laser annealing to produce solid phase epitaxial regrowth results in junctions that meet the shallow depth and abruptness requirements of the 32 nm node.
NASA Technical Reports Server (NTRS)
Shepard, N. F., Jr.
1981-01-01
Protective bypass diodes and mounting configurations which are applicable for use with photovoltaic modules having power dissipation requirements in the 5 to 50 watt range were investigated. Using PN silicon and Schottky diode characterization data on packaged diodes and diode chips, typical diodes were selected as representative for each range of current carrying capacity, an appropriate heat dissipating mounting concept along with its environmental enclosure was defined, and a thermal analysis relating junction temperature as a function of power dissipation was performed. In addition, the heat dissipating mounting device dimensions were varied to determine the effect on junction temperature. The results of the analysis are presented as a set of curves indicating junction temperature as a function of power dissipation for each diode package.
Spinella, Jean-François; Healy, Jasmine; Saillour, Virginie; Richer, Chantal; Cassart, Pauline; Ouimet, Manon; Sinnett, Daniel
2015-07-23
Acute lymphoblastic leukemia (ALL) is the most common pediatric cancer. While the multi-step model of pediatric leukemogenesis suggests interplay between constitutional and somatic genomes, the role of inherited genetic variability remains largely undescribed. Nonsyndromic familial ALL, although extremely rare, provides the ideal setting to study inherited contributions to ALL. Toward this goal, we sequenced the exomes of a childhood ALL family consisting of mother, father and two non-twinned siblings diagnosed with concordant pre-B hyperdiploid ALL and previously shown to have inherited a rare form of PRDM9, a histone H3 methyltransferase involved in crossing-over at recombination hotspots and Holliday junctions. We postulated that inheritance of additional rare disadvantaging variants in predisposing cancer genes could affect genomic stability and lead to increased risk of hyperdiploid ALL within this family. Whole exomes were captured using Agilent's SureSelect kit and sequenced on the Life Technologies SOLiD System. We applied a data reduction strategy to identify candidate variants shared by both affected siblings. Under a recessive disease model, we focused on rare non-synonymous or frame-shift variants in leukemia predisposing pathways. Though the family was nonsyndromic, we identified a combination of rare variants in Fanconi anemia (FA) genes FANCP/SLX4 (compound heterozygote - rs137976282/rs79842542) and FANCA (rs61753269) and a rare homozygous variant in the Holliday junction resolvase GEN1 (rs16981869). These variants, predicted to affect protein function, were previously identified in familial breast cancer cases. Based on our in-house database of 369 childhood ALL exomes, the sibs were the only patients to carry this particularly rare combination and only a single hyperdiploid patient was heterozygote at both FANCP/SLX4 positions, while no FANCA variant allele carriers were identified. FANCA is the most commonly mutated gene in FA and is essential for resolving DNA interstrand cross-links during replication. FANCP/SLX4 and GEN1 are involved in the cleavage of Holliday junctions and their mutated forms, in combination with the rare allele of PRDM9, could alter Holliday junction resolution leading to nondisjunction of chromosomes and segregation defects. Taken together, these results suggest that concomitant inheritance of rare variants in FANCA, FANCP/SLX4 and GEN1 on the specific genetic background of this familial case, could lead to increased genomic instability, hematopoietic dysfunction, and higher risk of childhood leukemia.
Whish, Sophie; Dziegielewska, Katarzyna M.; Møllgård, Kjeld; Noor, Natassya M.; Liddelow, Shane A.; Habgood, Mark D.; Richardson, Samantha J.; Saunders, Norman R.
2015-01-01
In the adult the interface between the cerebrospinal fluid and the brain is lined by the ependymal cells, which are joined by gap junctions. These intercellular connections do not provide a diffusional restrain between the two compartments. However, during development this interface, initially consisting of neuroepithelial cells and later radial glial cells, is characterized by “strap” junctions, which limit the exchange of different sized molecules between cerebrospinal fluid and the brain parenchyma. Here we provide a systematic study of permeability properties of this inner cerebrospinal fluid-brain barrier during mouse development from embryonic day, E17 until adult. Results show that at fetal stages exchange across this barrier is restricted to the smallest molecules (286Da) and the diffusional restraint is progressively removed as the brain develops. By postnatal day P20, molecules the size of plasma proteins (70 kDa) diffuse freely. Transcriptomic analysis of junctional proteins present in the cerebrospinal fluid-brain interface showed expression of adherens junctional proteins, actins, cadherins and catenins changing in a development manner consistent with the observed changes in the permeability studies. Gap junction proteins were only identified in the adult as was claudin-11. Immunohistochemistry was used to localize at the cellular level some of the adherens junctional proteins of genes identified from transcriptomic analysis. N-cadherin, β - and α-catenin immunoreactivity was detected outlining the inner CSF-brain interface from E16; most of these markers were not present in the adult ependyma. Claudin-5 was present in the apical-most part of radial glial cells and in endothelial cells in embryos, but only in endothelial cells including plexus endothelial cells in adults. Claudin-11 was only immunopositive in the adult, consistent with results obtained from transcriptomic analysis. These results provide information about physiological, molecular and morphological-related permeability changes occurring at the inner cerebrospinal fluid-brain barrier during brain development. PMID:25729345
A novel reduced symmetry oxide (Mg3B2O6) for magnetic tunnel junctions based on FeCo or Fe leads
NASA Astrophysics Data System (ADS)
Stewart, Derek
2010-03-01
Magnetic tunnel junctions with high TMR values, such as FeMgOFe, capitalize on spin filtering in the oxide due to the band symmetry of incident electrons. However, these structures rely on magnetic leads and oxide regions of the same cubic symmetry class. This raises the question of whether reducing the oxide symmetry can enhance spin filtering. A new magnetic tunnel junction (FeCoMg3B2O6FeCo) is presented that uses a reduced symmetry oxide region (orthorhombic) to filter spins between two cubic magnetic leads. Symmetry analysis of coupling between states in the cubic leads and the orthorhombic oxide indicates that majority carrier tunneling through the oxide should be favored over minority carriers. Complex band structure analysis of Mg3B2O6 shows that the relevant evanescent states in the band gap are due to boron p states and that there is sufficient difference in the decay rates of the imaginary bands for spin filtering to occur. Electronic transport calculations through a FeMg3B2O6Fe magnetic tunnel junction are also performed to address the possible influence of interface states. Some recent experimental studies of FeCoBMgOFeCoB junctions, with B diffusion into the MgO region, indicate that this new type of junction may have already been fabricated. The prospect of developing a general class of magnetic tunnel junctions based on reduced symmetry oxides is also examined.
Fast electric control of the droplet size in a microfluidic T-junction droplet generator
NASA Astrophysics Data System (ADS)
Shojaeian, Mostafa; Hardt, Steffen
2018-05-01
The effect of DC electric fields on the generation of droplets of water and xanthan gum solutions in sunflower oil at a microfluidic T-junction is experimentally studied. The electric field leads to a significant reduction of the droplet diameter, by about a factor of 2 in the case of water droplets. The droplet size can be tuned by varying the electric field strength, an effect that can be employed to produce a stream of droplets with a tailor-made size sequence. Compared to the case of purely hydrodynamic droplet production without electric fields, the electric control has about the same effect on the droplet size if the electric stress at the liquid/liquid interface is the same as the hydrodynamic stress.
Chang, Wei-Pang; Wu, José Jiun-Shian; Shyu, Bai-Chuang
2013-01-01
The thalamus is an important target for deep brain stimulation in the treatment of seizures. However, whether the modulatory effect of thalamic inputs on cortical seizures occurs through the modulation of gap junctions has not been previously studied. Therefore, we tested the effects of different gap junction blockers and couplers in a drug-resistant seizure model and studied the role of gap junctions in the thalamic modulation on cortical seizures. Multielectrode array and calcium imaging were used to record the cortical seizures induced by 4-aminopyridine (250 µM) and bicuculline (5-50 µM) in a novel thalamocingulate slice preparation. Seizure-like activity was significantly attenuated by the pan-gap junction blockers carbenoxolone and octanol and specific neuronal gap junction blocker mefloquine. The gap junction coupler trimethylamine significantly enhanced seizure-like activity. Gap junction blockers did not influence the initial phase of seizure-like activity, but they significantly decreased the amplitude and duration of the maintenance phase. The development of seizures is regulated by extracellular potassium concentration. Carbenoxolone partially restored the amplitude and duration after removing the thalamic inputs. A two-dimensional current source density analysis showed that the sink and source signals shifted to deeper layers after removing the thalamic inputs during the clonic phase. These results indicate that the regulatory mechanism of deep brain stimulation in the thalamus occurs partially though gap junctions.
Chang, Wei-Pang; Wu, José Jiun-Shian; Shyu, Bai-Chuang
2013-01-01
The thalamus is an important target for deep brain stimulation in the treatment of seizures. However, whether the modulatory effect of thalamic inputs on cortical seizures occurs through the modulation of gap junctions has not been previously studied. Therefore, we tested the effects of different gap junction blockers and couplers in a drug-resistant seizure model and studied the role of gap junctions in the thalamic modulation on cortical seizures. Multielectrode array and calcium imaging were used to record the cortical seizures induced by 4-aminopyridine (250 µM) and bicuculline (5–50 µM) in a novel thalamocingulate slice preparation. Seizure-like activity was significantly attenuated by the pan-gap junction blockers carbenoxolone and octanol and specific neuronal gap junction blocker mefloquine. The gap junction coupler trimethylamine significantly enhanced seizure-like activity. Gap junction blockers did not influence the initial phase of seizure-like activity, but they significantly decreased the amplitude and duration of the maintenance phase. The development of seizures is regulated by extracellular potassium concentration. Carbenoxolone partially restored the amplitude and duration after removing the thalamic inputs. A two-dimensional current source density analysis showed that the sink and source signals shifted to deeper layers after removing the thalamic inputs during the clonic phase. These results indicate that the regulatory mechanism of deep brain stimulation in the thalamus occurs partially though gap junctions. PMID:23690968
Fykerud, Tone Aase; Kjenseth, Ane; Schink, Kay Oliver; Sirnes, Solveig; Bruun, Jarle; Omori, Yasufumi; Brech, Andreas; Rivedal, Edgar; Leithe, Edward
2012-09-01
Gap junctions consist of arrays of intercellular channels that enable adjacent cells to communicate both electrically and metabolically. Gap junction channels are made of a family of integral membrane proteins called connexins, of which the best-studied member is connexin43. Gap junctions are dynamic plasma membrane domains, and connexin43 has a high turnover rate in most tissue types. However, the mechanisms involved in the regulation of connexin43 endocytosis and transport to lysosomes are still poorly understood. Here, we demonstrate by live-cell imaging analysis that treatment of cells with 12-O-tetradecanoylphorbol 13-acetate (TPA) induces endocytosis of subdomains of connexin43 gap junctions. The internalized, connexin43-enriched vesicles were found to fuse with early endosomes, which was followed by transport of connexin43 to the lumen of early endosomes. The HECT E3 ubiquitin ligase smad ubiquitination regulatory factor-2 (Smurf2) was found to be recruited to connexin43 gap junctions in response to TPA treatment. Depletion of Smurf2 by small interfering RNA resulted in enhanced levels of connexin43 gap junctions between adjacent cells and increased gap junction intercellular communication. Smurf2 depletion also counteracted the TPA-induced endocytosis and degradation of connexin43. Collectively, these data identify Smurf2 as a novel regulator of connexin43 gap junctions.
Cao, Jingyuan; Zhou, Wenting; Yi, Yao; Jia, Zhiyuan; Bi, Shengli
2013-01-01
Hepatitis A virus (HAV) is the most common cause of infectious hepatitis throughout the world, spread largely by the fecal-oral route. To characterize the genetic diversity of the virus circulating in China where HAV in endemic, we selected the outbreak cases with identical sequences in VP1-2A junction region and compiled a panel of 42 isolates. The VP3-VP1-2A regions of the HAV capsid-coding genes were further sequenced and analyzed. The quasispecies distribution was evaluated by cloning the VP3 and VP1-2A genes in three clinical samples. Phylogenetic analysis demonstrated that the same genotyping results could be obtained whether using the complete VP3, VP1, or partial VP1-2A genes for analysis in this study, although some differences did exist. Most isolates clustered in sub-genotype IA, and fewer in sub-genotype IB. No amino acid mutations were found at the published neutralizing epitope sites, however, several unique amino acid substitutions in the VP3 or VP1 region were identified, with two amino acid variants closely located to the immunodominant site. Quasispecies analysis showed the mutation frequencies were in the range of 7.22x10-4 -2.33x10-3 substitutions per nucleotide for VP3, VP1, or VP1-2A. When compared with the consensus sequences, mutated nucleotide sites represented the minority of all the analyzed sequences sites. HAV replicated as a complex distribution of closely genetically related variants referred to as quasispecies, and were under negative selection. The results indicate that diverse HAV strains and quasispecies inside the viral populations are presented in China, with unique amino acid substitutions detected close to the immunodominant site, and that the possibility of antigenic escaping mutants cannot be ruled out and needs to be further analyzed. PMID:24069343
Mechanical break junctions: enormous information in a nanoscale package.
Natelson, Douglas
2012-04-24
Mechanical break junctions, particularly those in which a metal tip is repeatedly moved in and out of contact with a metal film, have provided many insights into electronic conduction at the atomic and molecular scale, most often by averaging over many possible junction configurations. This averaging throws away a great deal of information, and Makk et al. in this issue of ACS Nano demonstrate that, with both simulated and real experimental data, more sophisticated two-dimensional analysis methods can reveal information otherwise obscured in simple histograms. As additional measured quantities come into play in break junction experiments, including thermopower, noise, and optical response, these more sophisticated analytic approaches are likely to become even more powerful. While break junctions are not directly practical for useful electronic devices, they are incredibly valuable tools for unraveling the electronic transport physics relevant for ultrascaled nanoelectronics.
Mechanism of chimera formation during the Multiple Displacement Amplification reaction.
Lasken, Roger S; Stockwell, Timothy B
2007-04-12
Multiple Displacement Amplification (MDA) is a method used for amplifying limiting DNA sources. The high molecular weight amplified DNA is ideal for DNA library construction. While this has enabled genomic sequencing from one or a few cells of unculturable microorganisms, the process is complicated by the tendency of MDA to generate chimeric DNA rearrangements in the amplified DNA. Determining the source of the DNA rearrangements would be an important step towards reducing or eliminating them. Here, we characterize the major types of chimeras formed by carrying out an MDA whole genome amplification from a single E. coli cell and sequencing by the 454 Life Sciences method. Analysis of 475 chimeras revealed the predominant reaction mechanisms that create the DNA rearrangements. The highly branched DNA synthesized in MDA can assume many alternative secondary structures. DNA strands extended on an initial template can be displaced becoming available to prime on a second template creating the chimeras. Evidence supports a model in which branch migration can displace 3'-ends freeing them to prime on the new templates. More than 85% of the resulting DNA rearrangements were inverted sequences with intervening deletions that the model predicts. Intramolecular rearrangements were favored, with displaced 3'-ends reannealing to single stranded 5'-strands contained within the same branched DNA molecule. In over 70% of the chimeric junctions, the 3' termini had initiated priming at complimentary sequences of 2-21 nucleotides (nts) in the new templates. Formation of chimeras is an important limitation to the MDA method, particularly for whole genome sequencing. Identification of the mechanism for chimera formation provides new insight into the MDA reaction and suggests methods to reduce chimeras. The 454 sequencing approach used here will provide a rapid method to assess the utility of reaction modifications.
Complete genome sequence of Fer-de-Lance Virus reveals a novel gene in reptilian Paramyxoviruses
Kurath, G.; Batts, W.N.; Ahne, W.; Winton, J.R.
2004-01-01
The complete RNA genome sequence of the archetype reptilian paramyxovirus, Fer-de-Lance virus (FDLV), has been determined. The genome is 15,378 nucleotides in length and consists of seven nonoverlapping genes in the order 3??? N-U-P-M-F-HN-L 5???, coding for the nucleocapsid, unknown, phospho-, matrix, fusion, hemagglutinin-neuraminidase, and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and tri-nucleotide intergenic regions similar to those of other Paramyxoviridae. The FDLV P gene expression strategy is like that of rubulaviruses, which express the accessory V protein from the primary transcript and edit a portion of the mRNA to encode P and I proteins. There is also an overlapping open reading frame potentially encoding a small basic protein in the P gene. The gene designated U (unknown), encodes a deduced protein of 19.4 kDa that has no counterpart in other paramyxoviruses and has no similarity with sequences in the National Center for Biotechnology Information database. Active transcription of the U gene in infected cells was demonstrated by Northern blot analysis, and bicistronic N-U mRNA was also evident. The genomes of two other snake paramyxovirus genotypes were also found to have U genes, with 11 to 16% nucleotide divergence from the FDLV U gene. Pairwise comparisons of amino acid identities and phylogenetic analyses of all deduced FDLV protein sequences with homologous sequences from other Paramyxoviridae indicate that FDLV represents a new genus within the subfamily Paramyxovirinae. We suggest the name Ferlavirus for the new genus, with FDLV as the type species.
Mechanism of chimera formation during the Multiple Displacement Amplification reaction
Lasken, Roger S; Stockwell, Timothy B
2007-01-01
Background Multiple Displacement Amplification (MDA) is a method used for amplifying limiting DNA sources. The high molecular weight amplified DNA is ideal for DNA library construction. While this has enabled genomic sequencing from one or a few cells of unculturable microorganisms, the process is complicated by the tendency of MDA to generate chimeric DNA rearrangements in the amplified DNA. Determining the source of the DNA rearrangements would be an important step towards reducing or eliminating them. Results Here, we characterize the major types of chimeras formed by carrying out an MDA whole genome amplification from a single E. coli cell and sequencing by the 454 Life Sciences method. Analysis of 475 chimeras revealed the predominant reaction mechanisms that create the DNA rearrangements. The highly branched DNA synthesized in MDA can assume many alternative secondary structures. DNA strands extended on an initial template can be displaced becoming available to prime on a second template creating the chimeras. Evidence supports a model in which branch migration can displace 3'-ends freeing them to prime on the new templates. More than 85% of the resulting DNA rearrangements were inverted sequences with intervening deletions that the model predicts. Intramolecular rearrangements were favored, with displaced 3'-ends reannealing to single stranded 5'-strands contained within the same branched DNA molecule. In over 70% of the chimeric junctions, the 3' termini had initiated priming at complimentary sequences of 2–21 nucleotides (nts) in the new templates. Conclusion Formation of chimeras is an important limitation to the MDA method, particularly for whole genome sequencing. Identification of the mechanism for chimera formation provides new insight into the MDA reaction and suggests methods to reduce chimeras. The 454 sequencing approach used here will provide a rapid method to assess the utility of reaction modifications. PMID:17430586
Identification and analysis of pig chimeric mRNAs using RNA sequencing data
2012-01-01
Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs. PMID:22925561
NASA Astrophysics Data System (ADS)
Xia, Ying; Fripp, Jurgen; Chandra, Shekhar S.; Walker, Duncan; Crozier, Stuart; Engstrom, Craig
2015-10-01
To develop an automated approach for 3D quantitative assessment and measurement of alpha angles from the femoral head-neck (FHN) junction using bone models derived from magnetic resonance (MR) images of the hip joint. Bilateral MR images of the hip joints were acquired from 30 male volunteers (healthy active individuals and high-performance athletes, aged 18-49 years) using a water-excited 3D dual echo steady state (DESS) sequence. In a subset of these subjects (18 water-polo players), additional True Fast Imaging with Steady-state Precession (TrueFISP) images were acquired from the right hip joint. For both MR image sets, an active shape model based algorithm was used to generate automated 3D bone reconstructions of the proximal femur. Subsequently, a local coordinate system of the femur was constructed to compute a 2D shape map to project femoral head sphericity for calculation of alpha angles around the FHN junction. To evaluate automated alpha angle measures, manual analyses were performed on anterosuperior and anterior radial MR slices from the FHN junction that were automatically reformatted using the constructed coordinate system. High intra- and inter-rater reliability (intra-class correlation coefficients > 0.95) was found for manual alpha angle measurements from the auto-extracted anterosuperior and anterior radial slices. Strong correlations were observed between manual and automatic measures of alpha angles for anterosuperior (r = 0.84) and anterior (r = 0.92) FHN positions. For matched DESS and TrueFISP images, there were no significant differences between automated alpha angle measures obtained from the upper anterior quadrant of the FHN junction (two-way repeated measures ANOVA, F < 0.01, p = 0.98). Our automatic 3D method analysed MR images of the hip joints to generate alpha angle measures around the FHN junction circumference with very good reliability and reproducibility. This work has the potential to improve analyses of cam-type lesions of the FHN junction for large-scale morphometric and clinical MR investigations of the human hip region.
Optimized efficiency in InP nanowire solar cells with accurate 1D analysis
NASA Astrophysics Data System (ADS)
Chen, Yang; Kivisaari, Pyry; Pistol, Mats-Erik; Anttu, Nicklas
2018-01-01
Semiconductor nanowire arrays are a promising candidate for next generation solar cells due to enhanced absorption and reduced material consumption. However, to optimize their performance, time consuming three-dimensional (3D) opto-electronics modeling is usually performed. Here, we develop an accurate one-dimensional (1D) modeling method for the analysis. The 1D modeling is about 400 times faster than 3D modeling and allows direct application of concepts from planar pn-junctions on the analysis of nanowire solar cells. We show that the superposition principle can break down in InP nanowires due to strong surface recombination in the depletion region, giving rise to an IV-behavior similar to that with low shunt resistance. Importantly, we find that the open-circuit voltage of nanowire solar cells is typically limited by contact leakage. Therefore, to increase the efficiency, we have investigated the effect of high-bandgap GaP carrier-selective contact segments at the top and bottom of the InP nanowire and we find that GaP contact segments improve the solar cell efficiency. Next, we discuss the merit of p-i-n and p-n junction concepts in nanowire solar cells. With GaP carrier selective top and bottom contact segments in the InP nanowire array, we find that a p-n junction design is superior to a p-i-n junction design. We predict a best efficiency of 25% for a surface recombination velocity of 4500 cm s-1, corresponding to a non-radiative lifetime of 1 ns in p-n junction cells. The developed 1D model can be used for general modeling of axial p-n and p-i-n junctions in semiconductor nanowires. This includes also LED applications and we expect faster progress in device modeling using our method.
Weltert, Luca; de Tullio, Marco D.; Afferrante, Luciano; Salica, Andrea; Scaffa, Raffaele; Maselli, Daniele; Verzicco, Roberto; De Paulis, Ruggero
2013-01-01
OBJECTIVES In the belief that stress is the main determinant of leaflet quality deterioration, we sought to evaluate the effect of annular and/or sino-tubular junction dilatation on leaflet stress. A finite element computer-assisted stress analysis was used to model four different anatomic conditions and analyse the consequent stress pattern on the aortic valve. METHODS Theoretical models of four aortic root configurations (normal, with dilated annulus, with loss of sino-tubular junction and with both dilatation simultaneously) were created with computer-aided design technique. The pattern of stress and strain was then analysed by means of finite elements analysis, when a uniform pressure of 100 mmHg was applied to the model. Analysis produced von Mises charts (colour-coded, computational, three-dimensional stress-pattern graphics) and bidimensional plots of compared stress on arc-linear line, which allowed direct comparison of stress in the four different conditions. RESULTS Stresses both on the free margin and on the ‘belly’ of the leaflet rose from 0.28 MPa (normal conditions) to 0.32 MPa (+14%) in case of isolated dilatation of the sino-tubular junction, while increased to 0.42 MPa (+67%) in case of isolated annular dilatation, with no substantial difference whether sino-tubular junction dilatation was present or not. CONCLUSIONS Annular dilatation is the key element determining an increased stress on aortic leaflets independently from an associated sino-tubular junction dilatation. The presence of annular dilatation associated with root aneurysm greatly decreases the chance of performing a valve sparing procedure without the need for additional manoeuvres on leaflet tissue. This information may lead to a refinement in the optimal surgical strategy. PMID:23536020
Optimized efficiency in InP nanowire solar cells with accurate 1D analysis.
Chen, Yang; Kivisaari, Pyry; Pistol, Mats-Erik; Anttu, Nicklas
2018-01-26
Semiconductor nanowire arrays are a promising candidate for next generation solar cells due to enhanced absorption and reduced material consumption. However, to optimize their performance, time consuming three-dimensional (3D) opto-electronics modeling is usually performed. Here, we develop an accurate one-dimensional (1D) modeling method for the analysis. The 1D modeling is about 400 times faster than 3D modeling and allows direct application of concepts from planar pn-junctions on the analysis of nanowire solar cells. We show that the superposition principle can break down in InP nanowires due to strong surface recombination in the depletion region, giving rise to an IV-behavior similar to that with low shunt resistance. Importantly, we find that the open-circuit voltage of nanowire solar cells is typically limited by contact leakage. Therefore, to increase the efficiency, we have investigated the effect of high-bandgap GaP carrier-selective contact segments at the top and bottom of the InP nanowire and we find that GaP contact segments improve the solar cell efficiency. Next, we discuss the merit of p-i-n and p-n junction concepts in nanowire solar cells. With GaP carrier selective top and bottom contact segments in the InP nanowire array, we find that a p-n junction design is superior to a p-i-n junction design. We predict a best efficiency of 25% for a surface recombination velocity of 4500 cm s -1 , corresponding to a non-radiative lifetime of 1 ns in p-n junction cells. The developed 1D model can be used for general modeling of axial p-n and p-i-n junctions in semiconductor nanowires. This includes also LED applications and we expect faster progress in device modeling using our method.
Tripathi, Pankaj; Anuradha, S; Ghosal, Gargi; Muniyappa, K
2006-12-08
Saccharomyces cerevisiae HOP1, which encodes a component of synaptonemal complex (SC), plays an important role in both gene conversion and crossing over between homologs, as well as enforces meiotic recombination checkpoint control over the progression of recombination intermediates. In hop1Delta mutants, meiosis-specific double-strand breaks (DSBs) are reduced to 10% of the wild-type level, and at aberrantly late times, these DSBs are processed into inter-sister recombination intermediates. However, the underlying mechanism by which Hop1 protein regulates these nuclear events remains obscure. Here we show that Hop1 protein interacts selectively with the Holliday junction, changes its global conformation and blocks the dissolution of the junction by a RecQ helicase. The Holliday junction-Hop1 protein complexes are significantly more stable at higher ionic strengths and molar excess of unlabeled competitor DNA than complexes containing other recombination intermediates. Structural analysis of the Holliday junction using 2-aminopurine fluorescence emission, DNase I footprinting and KMnO4 probing provide compelling evidence that Hop1 protein binding induces significant distortion at the center of the Holliday junction. We propose that Hop1 protein might coordinate the physical monitoring of meiotic recombination intermediates with the process of branch migration of Holliday junction.
Li, Xinbo; Olson, Carl; Lu, Shijun; Kamasawa, Naomi; Yasumura, Thomas; Rash, John E.; Nagy, James I.
2007-01-01
Among the 20 members in the connexin family of gap junction proteins, only connexin36 (Cx36) is firmly established to be expressed in neurons and to form electrical synapses at widely distributed interneuronal gap junctions in mammalian brain. Several connexins have recently been reported to interact with the PDZ domain-containing protein zonula occludens-1 (ZO-1), which was originally considered to be associated only with tight junctions, but has recently been reported to associate with other structures including gap junctions in various cell types. Based on the presence of sequence corresponding to a putative PDZ binding motif in Cx36, we investigated anatomical relationships and molecular association of Cx36 with ZO-1. By immunofluorescence, punctate Cx36/ZO-1 colocalization was observed throughout the central nervous system of wild-type mice, whereas labelling for Cx36 was absent in Cx36 knockout mice, confirming the specificity of the anti-Cx36 antibodies employed. By freeze-fracture replica immunogold labelling, Cx36 and ZO-1 in brain were found colocalized within individual ultrastructurally identified gap junction plaques, although some plaques contained only Cx36 whereas others contained only ZO-1. Cx36 from mouse brain and Cx36-transfected HeLa cells was found to coimmunoprecipitate with ZO-1. Unlike other connexins that bind the second of the three PDZ domains in ZO-1, glutathione S-transferase-PDZ pull-down and mutational analyses indicated Cx36 interaction with the first PDZ domain of ZO-1, which required at most the presence of the four c-terminus amino acids of Cx36. These results demonstrating a Cx36/ZO-1 association suggest a regulatory and/or scaffolding role of ZO-1 at gap junctions that form electrical synapses between neurons in mammalian brain. PMID:15090040
Kim, Hyoung Tae; Kim, Jung Sung; Moore, Michael J; Neubig, Kurt M; Williams, Norris H; Whitten, W Mark; Kim, Joo-Hwan
2015-01-01
Earlier research has revealed that the ndh loci have been pseudogenized, truncated, or deleted from most orchid plastomes sequenced to date, including in all available plastomes of the two most species-rich subfamilies, Orchidoideae and Epidendroideae. This study sought to resolve deeper-level phylogenetic relationships among major orchid groups and to refine the history of gene loss in the ndh loci across orchids. The complete plastomes of seven orchids, Oncidium sphacelatum (Epidendroideae), Masdevallia coccinea (Epidendroideae), Sobralia callosa (Epidendroideae), Sobralia aff. bouchei (Epidendroideae), Elleanthus sodiroi (Epidendroideae), Paphiopedilum armeniacum (Cypripedioideae), and Phragmipedium longifolium (Cypripedioideae) were sequenced and analyzed in conjunction with all other available orchid and monocot plastomes. Most ndh loci were found to be pseudogenized or lost in Oncidium, Paphiopedilum and Phragmipedium, but surprisingly, all ndh loci were found to retain full, intact reading frames in Sobralia, Elleanthus and Masdevallia. Character mapping suggests that the ndh genes were present in the common ancestor of orchids but have experienced independent, significant losses at least eight times across four subfamilies. In addition, ndhF gene loss was correlated with shifts in the position of the junction of the inverted repeat (IR) and small single-copy (SSC) regions. The Orchidaceae have unprecedented levels of homoplasy in ndh gene presence/absence, which may be correlated in part with the unusual life history of orchids. These results also suggest that ndhF plays a role in IR/SSC junction stability.
Interaction of Chemical Agents with Nanoscale Molecular Junctions
2011-08-01
thiS burden to Department of Defense. Washilgton Headqualters Services. Directorate for lnformatie~n Operations and Reports (07()4.()188), 1215...The source of these contaminants were determined to be coming from the glovebox auxiliary vacuum pump, which normally operates continuously for...SAM- NHi NH2-SAM-Gold] molecular junction for analysis. In order to perform electron transport analysis of our nanoscale devices in a "real world
Transistor-like behavior of single metalloprotein junctions.
Artés, Juan M; Díez-Pérez, Ismael; Gorostiza, Pau
2012-06-13
Single protein junctions consisting of azurin bridged between a gold substrate and the probe of an electrochemical tunneling microscope (ECSTM) have been obtained by two independent methods that allowed statistical analysis over a large number of measured junctions. Conductance measurements yield (7.3 ± 1.5) × 10(-6)G(0) in agreement with reported estimates using other techniques. Redox gating of the protein with an on/off ratio of 20 was demonstrated and constitutes a proof-of-principle of a single redox protein field-effect transistor.
Structural landscape of base pairs containing post-transcriptional modifications in RNA
Seelam, Preethi P.; Sharma, Purshotam
2017-01-01
Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. PMID:28341704
Zhu, Ruo-Lin; Lei, Xiao-Ying; Ke, Fei; Yuan, Xiu-Ping; Zhang, Qi-Ya
2011-02-01
Genomic sequence of Scophthalmus maximus rhabdovirus (SMRV) isolated from diseased turbot has been characterized. The complete genome of SMRV comprises 11,492 nucleotides and encodes five typical rhabdovirus genes N, P, M, G and L. In addition, two open reading frames (ORF) are predicted overlapping with P gene, one upstream of P and smaller than P (temporarily called Ps), and another in P gene which may encodes a protein similar to the vesicular stomatitis virus C protein. The C ORF is contained within the P ORF. The five typical proteins share the highest sequence identities (48.9%) with the corresponding proteins of rhabdoviruses in genus Vesiculovirus. Phylogenetic analysis of partial L protein sequence indicates that SMRV is close to genus Vesiculovirus. The first 13 nucleotides at the ends of the SMRV genome are absolutely inverse complementarity. The gene junctions between the five genes show conserved polyadenylation signal (CATGA(7)) and intergenic dinucleotide (CT) followed by putative transcription initiation sequence A(A/G)(C/G)A(A/G/T), which are different from known rhabdoviruses. The entire Ps ORF was cloned and expressed, and used to generate polyclonal antibody in mice. One obvious band could be detected in SMRV-infected carp leucocyte cells (CLCs) by anti-Ps/C serum via Western blot, and the subcellular localization of Ps-GFP fusion protein exhibited cytoplasm distribution as multiple punctuate or doughnut shaped foci of uneven size. Copyright © 2010 Elsevier B.V. All rights reserved.
Zipper plot: visualizing transcriptional activity of genomic regions.
Avila Cobos, Francisco; Anckaert, Jasper; Volders, Pieter-Jan; Everaert, Celine; Rombaut, Dries; Vandesompele, Jo; De Preter, Katleen; Mestdagh, Pieter
2017-05-02
Reconstructing transcript models from RNA-sequencing (RNA-seq) data and establishing these as independent transcriptional units can be a challenging task. Current state-of-the-art tools for long non-coding RNA (lncRNA) annotation are mainly based on evolutionary constraints, which may result in false negatives due to the overall limited conservation of lncRNAs. To tackle this problem we have developed the Zipper plot, a novel visualization and analysis method that enables users to simultaneously interrogate thousands of human putative transcription start sites (TSSs) in relation to various features that are indicative for transcriptional activity. These include publicly available CAGE-sequencing, ChIP-sequencing and DNase-sequencing datasets. Our method only requires three tab-separated fields (chromosome, genomic coordinate of the TSS and strand) as input and generates a report that includes a detailed summary table, a Zipper plot and several statistics derived from this plot. Using the Zipper plot, we found evidence of transcription for a set of well-characterized lncRNAs and observed that fewer mono-exonic lncRNAs have CAGE peaks overlapping with their TSSs compared to multi-exonic lncRNAs. Using publicly available RNA-seq data, we found more than one hundred cases where junction reads connected protein-coding gene exons with a downstream mono-exonic lncRNA, revealing the need for a careful evaluation of lncRNA 5'-boundaries. Our method is implemented using the statistical programming language R and is freely available as a webtool.
Graph representation of hepatic vessel based on centerline extraction and junction detection
NASA Astrophysics Data System (ADS)
Zhang, Xing; Tian, Jie; Deng, Kexin; Li, Xiuli; Yang, Fei
2012-02-01
In the area of computer-aided diagnosis (CAD), segmentation and analysis of hepatic vessel is a prerequisite for hepatic diseases diagnosis and surgery planning. For liver surgery planning, it is crucial to provide the surgeon with a patient-individual three-dimensional representation of the liver along with its vasculature and lesions. The representation allows an exploration of the vascular anatomy and the measurement of vessel diameters, following by intra-patient registration, as well as the analysis of the shape and volume of vascular territories. In this paper, we present an approach for generation of hepatic vessel graph based on centerline extraction and junction detection. The proposed approach involves the following concepts and methods: 1) Flux driven automatic centerline extraction; 2) Junction detection on the centerline using hollow sphere filtering; 3) Graph representation of hepatic vessel based on the centerline and junction. The approach is evaluated on contrast-enhanced liver CT datasets to demonstrate its availability and effectiveness.
Functional analysis of tight junction organization.
DiBona, D R
1985-01-01
The functional basis of tight junction design has been examined from the point of view that this rate-limiting barrier to paracellular transport is a multicompartment system. Review of the osmotic sensitivity of these structures points to the need for this sort of analysis for meaningful correlation of structure and function under a range of conditions. A similar conclusion is drawn with respect to results from voltage-clamping protocols where reversal of spontaneous transmural potential difference elicits parallel changes in both structure and function in much the same way as does reversal of naturally occurring osmotic gradients. In each case, it becomes necessary to regard the junction as a functionally polarized structure to account for observations of its rectifying properties. Lastly, the details of experimentally-induced junction deformation are examined in light of current theories of its organization; arguments are presented in favor of the view that the primary components of intramembranous organization (as viewed with freeze-fracture techniques) are lipidic rather than proteinaceous.
Detection of Hepatocyte Clones Containing Integrated Hepatitis B Virus DNA Using Inverse Nested PCR.
Tu, Thomas; Jilbert, Allison R
2017-01-01
Chronic hepatitis B virus (HBV) infection is a major cause of liver cirrhosis and hepatocellular carcinoma (HCC), leading to ~600,000 deaths per year worldwide. Many of the steps that occur during progression from the normal liver to cirrhosis and/or HCC are unknown. Integration of HBV DNA into random sites in the host cell genome occurs as a by-product of the HBV replication cycle and forms a unique junction between virus and cellular DNA. Analyses of integrated HBV DNA have revealed that HCCs are clonal and imply that they develop from the transformation of hepatocytes, the only liver cell known to be infected by HBV. Integrated HBV DNA has also been shown, at least in some tumors, to cause insertional mutagenesis in cancer driver genes, which may facilitate the development of HCC. Studies of HBV DNA integration in the histologically normal liver have provided additional insight into HBV-associated liver disease, suggesting that hepatocytes with a survival or growth advantage undergo high levels of clonal expansion even in the absence of oncogenic transformation. Here we describe inverse nested PCR (invPCR), a highly sensitive method that allows detection, sequencing, and enumeration of virus-cell DNA junctions formed by the integration of HBV DNA. The invPCR protocol is composed of two major steps: inversion of the virus-cell DNA junction and single-molecule nested PCR. The invPCR method is highly specific and inexpensive and can be tailored to DNA extracted from large or small amounts of liver. This procedure also allows detection of genome-wide random integration of any known DNA sequence and is therefore a useful technique for molecular biology, virology, and genetic research.
A Mutant Connexin50 with Enhanced Hemichannel Function Leads to Cell Death
Minogue, Peter J.; Tong, Jun-Jie; Arora, Anita; Russell-Eggitt, Isabelle; Hunt, David M.; Moore, Anthony T.; Ebihara, Lisa; Beyer, Eric C.; Berthoud, Viviana M.
2009-01-01
PURPOSE To determine the consequences of expression of a novel connexin50 (CX50) mutant identified in a child with congenital total cataracts. METHODS The GJA8 gene was directly sequenced. Formation of functional channels was assessed by two-microelectrode voltage-clamp. Connexin protein levels and distribution were assessed by immunoblotting and immunofluorescence. The proportion of apoptotic cells was determined by flow cytometry. RESULTS Direct sequencing of the GJA8 gene identified a 137 G>T transition that resulted in the replacement of glycine by valine at position 46 of the coding region of CX50 (CX50G46V). Both CX50 and CX50G46V induced gap junctional currents in pairs of Xenopus oocytes. In single Xenopus oocytes, CX50G46V induced connexin hemichannel currents that were activated by removal of external calcium; their magnitudes were much higher than those in oocytes injected with similar amounts of CX50 cRNA. When expressed in HeLa cells under the control of an inducible promoter, both CX50 and CX50G46V formed gap junctional plaques. Induction of CX50G46V expression led to a decrease in cell number and an increase in the proportion of apoptotic cells. CX50G46V-induced cell death was prevented by high concentrations of extracellular calcium ions. CONCLUSIONS Unlike previously characterized CX50 mutants that exhibit impaired trafficking and/or lack of function, CX50G46V traffics properly to the plasma membrane and forms functional hemichannels and gap junction channels; however, it causes cell death even when expressed at minute levels. The biochemical results indirectly suggest a potential novel mechanism by which connexin mutants could lead to cataracts: cytotoxicity due to enhanced hemichannel function. PMID:19684000
The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate
Mooers, Blaine H.M.; Singh, Amritanshu
2011-01-01
Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548
RNA circularization reveals terminal sequence heterogeneity in a double-stranded RNA virus.
Widmer, G
1993-03-01
Double-stranded RNA viruses (dsRNA), termed LRV1, have been found in several strains of the protozoan parasite Leishmania. With the aim of constructing a full-length cDNA copy of the viral genome, including its terminal sequences, a protocol based on PCR amplification across the 3'-5' junction of circularized RNA was developed. This method proved to be applicable to dsRNA. It provided a relatively simple alternative to one-sided PCR, without loss of specificity inherent in the use of generic primers. LRV1 terminal nucleotide sequences obtained by this method showed a considerable variation in length, particularly at the 5' end of the positive strand, as well as the potential for forming 3' overhangs. The opposite genomic end terminates in 0, 1, or 2 TCA trinucleotide repeats. These results are compared with terminal sequences derived from one-sided PCR experiments.
Increase of gap junction activities in SW480 human colorectal cancer cells.
Bigelow, Kristina; Nguyen, Thu A
2014-07-09
Colorectal cancer is one of the most common cancers in the United States with an early detection rate of only 39%. Colorectal cancer cells along with other cancer cells exhibit many deficiencies in cell-to-cell communication, particularly gap junctional intercellular communication (GJIC). GJIC has been reported to diminish as cancer cells progress. Gap junctions are intercellular channels composed of connexin proteins, which mediate the direct passage of small molecules from one cell to the next. They are involved in the regulation of the cell cycle, cell differentiation, and cell signaling. Since the regulation of gap junctions is lost in colorectal cancer cells, the goal of this study is to determine the effect of GJIC restoration in colorectal cancer cells. Gap Junction Activity Assay and protein analysis were performed to evaluate the effects of overexpression of connexin 43 (Cx43) and treatment of PQ1, a small molecule, on GJIC. Overexpression of Cx43 in SW480 colorectal cancer cells causes a 6-fold increase of gap junction activity compared to control. This suggests that overexpressing Cx43 can restore GJIC. Furthermore, small molecule like PQ1 directly targeting gap junction channel was used to increase GJIC. Gap junction enhancers, PQ1, at 200 nM showed a 4-fold increase of gap junction activity in SW480 cells. A shift from the P0 to the P2 isoform of Cx43 was seen after 1 hour treatment with 200 nM PQ1. Overexpression of Cx43 and treatment of PQ1 can directly increase gap junction activity. The findings provide an important implication in which restoration of gap junction activity can be targeted for drug development.
Gap junctions in Malpighian tubules of Aedes aegypti.
Weng, Xing-He; Piermarini, Peter M; Yamahiro, Atsuko; Yu, Ming-Jiun; Aneshansley, Daniel J; Beyenbach, Klaus W
2008-02-01
We present electrical, physiological and molecular evidence for substantial electrical coupling of epithelial cells in Malpighian tubules via gap junctions. Current was injected into one principal cell of the isolated Malpighian tubule and membrane voltage deflections were measured in that cell and in two neighboring principal cells. By short-circuiting the transepithelial voltage with the diuretic peptide leucokinin-VIII we largely eliminated electrical coupling of principal cells through the tubule lumen, thereby allowing coupling through gap junctions to be analyzed. The analysis of an equivalent electrical circuit of the tubule yielded an average gap-junction resistance (R(gj)) of 431 kOmega between two cells. This resistance would stem from 6190 open gap-junctional channels, assuming the high single gap-junction conductance of 375 pS found in vertebrate tissues. The addition of the calcium ionophore A23187 (2 micromol l(-1)) to the peritubular Ringer bath containing 1.7 mmol l(-1) Ca(2+) did not affect the gap-junction resistance, but metabolic inhibition of the tubule with dinitrophenol (0.5 mmol l(-1)) increased the gap-junction resistance 66-fold, suggesting the regulation of gap junctions by ATP. Lucifer Yellow injected into a principal cell did not appear in neighboring principal cells. Thus, gap junctions allow the passage of current but not Lucifer Yellow. Using RT-PCR we found evidence for the expression of innexins 1, 2, 3 and 7 (named after their homologues in Drosophila) in Malpighian tubules. The physiological demonstration of gap junctions and the molecular evidence for innexin in Malpighian tubules of Aedes aegypti call for the double cable model of the tubule, which will improve the measurement and the interpretation of electrophysiological data collected from Malpighian tubules.
The Afar Depression: Was There a Triple Junction Above the Mantle Plume?
NASA Astrophysics Data System (ADS)
Ebinger, C.; Wolfenden, E.; Yirgu, G.; Ayalew, D.; Eagles, G.; Gloaguen, R.; Tiberi, C.; Rowland, J. R.; Deino, A.; Tesfaye, A.; Tesfaye, S.
2002-12-01
The Red Sea - Gulf of Aden- Main Ethiopian rift systems (Afar Depression) have served as the textbook example of a R-R-R triple junction zone which formed above a mantle plume (Ethiopia-Yemen flood basalt province, 31-28 Ma). Recent work has documented the onset and propagation of seafloor along the length of the Gulf of Aden and Red Sea arms, but the timing of continental rifting had been poorly constrained. Our aims were to constrain the timing of rift initiation in each arm of the rift near the proposed Oligocene triple junction and to re-assess models for break-up above a mantle plume. Although much of the early history of rifting is deeply buried by Pliocene-Recent lavas, erosional dissection of the rift margins provides windows into the early rift history. Along the southernmost Red Sea, faults commonly marked by eruptive centers initiated at about 26 Ma, coincident with rifting along the easternmost Gulf of Aden. New data from the rift immediately south of the southernmost Red Sea basin (ca.10N) constrain the earliest rift sequences in the northern Main Ethiopian rift (MER). Field and Ar-Ar data from sequences overlying the pre-rift flood basalts show that extension in the northern MER commenced at 12-10 Ma when the two rift systems were finally linked. The active zone of extension and magmatism in the southern Red Sea and eastern Gulf of Aden, however, had migrated east and north, respectively. Summarising, rifting in southern Ethiopia had commenced by 16-18 Ma, and had propagated northward to cut across Oligo-Miocene rift structures of the Red Sea and Gulf of Aden by 10 Ma, consistent with plate kinematic data. A triple junction could have developed only during the past 10 My, long after flood basaltic magmatism. Inverse models of gravity data predict a significant step (2-4 km) in the Moho where the youthful, less extended MER breaks into the Afar Depression. Project EAGLE (UK-US-Ethiopia) is now acquiring seismic data across and along this zone to evaluate mechanisms for rift segmentation and propagation prior to breakup.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zonana, J.; Gault, J.; Jones, M.
1993-01-01
X-linked hypohidrotic ectodermal dysplasia (EDA) has been localized to the Xq12-q13.1. A panel of genomic DNA samples from 80 unrelated males with EDA has been screened for deletions at seven genetic loci within the Xq12-13 region. A single individual was identified with a deletion at the DXS732 locus by hybridization with the mouse genomic probe pcos169E/4. This highly conserved DNA probe is from locus DXCrc169, which is tightly linked to the Ta locus, the putative mouse homologue of EDA. The proband had the classical phenotype of EDA, with no other phenotypic abnormalities, and a normal cytogenetic analysis. A human genomicmore » DNA clone, homologous to pcos169E/4, was isolated from a human X-chromosome cosmid library. On hybridization with the cosmid, the proband was found to be only partially deleted at the DXS732 locus, with a unique junctional fragment identified in the proband and in three of his maternal relatives. This is the first determination of carrier status for EDA in females, by direct mutation analysis. Failure to detect deletion of the other loci tested in the proband suggests that the DXS732 locus is the closest known locus to the EDA gene. Since the DXS732 locus contains a highly conserved sequence, it must be considered to be a candidate locus for the EDA gene itself. 18 refs., 3 figs., 1 tab.« less
Sequence Ready Characterization of the Pericentromeric Region of 19p12
DOE Office of Scientific and Technical Information (OSTI.GOV)
Evan E. Eichler
2006-08-31
Current mapping and sequencing strategies have been inadequate within the proximal portion of 19p12 due, in part, to the presence of a recently expanded ZNF (zinc-finger) gene family and the presence of large (25-50 kb) inverted beta-satellite repeat structures which bracket this tandemly duplicated gene family. The virtual of absence of classically defined “unique” sequence within the region has hampered efforts to identify and characterize a suitable minimal tiling path of clones which can be used as templates required for finished sequencing of the region. The goal of this proposal is to develop and implement a novel sequence-anchor strategy tomore » generate a contiguous BAC map of the most proximal portion of chromosome 19p12 for the purpose of complete sequence characterization. The target region will be an estimated 4.5 Mb of DNA extending from STS marker D19S450 (the beginning of the ZNF gene cluster) to the centromeric (alpha-satellite) junction of 19p11. The approach will entail 1) pre-selection of 19p12 BAC and cosmid clones (NIH approved library) utilizing both 19p12 -unique and 19p12-SPECIFIC repeat probes (Eichler et al., 1998); 2) the generation of a BAC/cosmid end-sequence map across the region with a density of one marker every 8kb; 3) the development of a second-generation of STS (sequence tagged sites) which will be used to identify and verify clonal overlap at the level of the sequence; 4) incorporation of these sequence-anchored overlapping clones into existing cosmid/BAC restriction maps developed at Livermore National Laboratory; and 5) validation of the organization of this region utilizing high-resolution FISH techniques (extended chromatin analysis) on monochromosomal 19 somatic cell hybrids and parental cell lines of source material. The data generated will be used in the selection of the most parsimonious tiling path of BAC clones to be sequenced as part of the JGI effort on chromosome 19 and should serve as a model for the sequence characterization of other difficult regions of the human genome« less
Experimental testing and modeling analysis of solute mixing at water distribution pipe junctions.
Shao, Yu; Jeffrey Yang, Y; Jiang, Lijie; Yu, Tingchao; Shen, Cheng
2014-06-01
Flow dynamics at a pipe junction controls particle trajectories, solute mixing and concentrations in downstream pipes. The effect can lead to different outcomes of water quality modeling and, hence, drinking water management in a distribution network. Here we have investigated solute mixing behavior in pipe junctions of five hydraulic types, for which flow distribution factors and analytical equations for network modeling are proposed. First, based on experiments, the degree of mixing at a cross is found to be a function of flow momentum ratio that defines a junction flow distribution pattern and the degree of departure from complete mixing. Corresponding analytical solutions are also validated using computational-fluid-dynamics (CFD) simulations. Second, the analytical mixing model is further extended to double-Tee junctions. Correspondingly the flow distribution factor is modified to account for hydraulic departure from a cross configuration. For a double-Tee(A) junction, CFD simulations show that the solute mixing depends on flow momentum ratio and connection pipe length, whereas the mixing at double-Tee(B) is well represented by two independent single-Tee junctions with a potential water stagnation zone in between. Notably, double-Tee junctions differ significantly from a cross in solute mixing and transport. However, it is noted that these pipe connections are widely, but incorrectly, simplified as cross junctions of assumed complete solute mixing in network skeletonization and water quality modeling. For the studied pipe junction types, analytical solutions are proposed to characterize the incomplete mixing and hence may allow better water quality simulation in a distribution network. Published by Elsevier Ltd.
Starich, Todd A.; Hall, David H.; Greenstein, David
2014-01-01
In all animals examined, somatic cells of the gonad control multiple biological processes essential for germline development. Gap junction channels, composed of connexins in vertebrates and innexins in invertebrates, permit direct intercellular communication between cells and frequently form between somatic gonadal cells and germ cells. Gap junctions comprise hexameric hemichannels in apposing cells that dock to form channels for the exchange of small molecules. Here we report essential roles for two classes of gap junction channels, composed of five innexin proteins, in supporting the proliferation of germline stem cells and gametogenesis in the nematode Caenorhabditis elegans. Transmission electron microscopy of freeze-fracture replicas and fluorescence microscopy show that gap junctions between somatic cells and germ cells are more extensive than previously appreciated and are found throughout the gonad. One class of gap junctions, composed of INX-8 and INX-9 in the soma and INX-14 and INX-21 in the germ line, is required for the proliferation and differentiation of germline stem cells. Genetic epistasis experiments establish a role for these gap junction channels in germline proliferation independent of the glp-1/Notch pathway. A second class of gap junctions, composed of somatic INX-8 and INX-9 and germline INX-14 and INX-22, is required for the negative regulation of oocyte meiotic maturation. Rescue of gap junction channel formation in the stem cell niche rescues germline proliferation and uncovers a later channel requirement for embryonic viability. This analysis reveals gap junctions as a central organizing feature of many soma–germline interactions in C. elegans. PMID:25195067
Spliced RNA of woodchuck hepatitis virus.
Ogston, C W; Razman, D G
1992-07-01
Polymerase chain reaction was used to investigate RNA splicing in liver of woodchucks infected with woodchuck hepatitis virus (WHV). Two spliced species were detected, and the splice junctions were sequenced. The larger spliced RNA has an intron of 1300 nucleotides, and the smaller spliced sequence shows an additional downstream intron of 1104 nucleotides. We did not detect singly spliced sequences from which the smaller intron alone was removed. Control experiments showed that spliced sequences are present in both RNA and DNA in infected liver, showing that the viral reverse transcriptase can use spliced RNA as template. Spliced sequences were detected also in virion DNA prepared from serum. The upstream intron produces a reading frame that fuses the core to the polymerase polypeptide, while the downstream intron causes an inframe deletion in the polymerase open reading frame. Whereas the splicing patterns in WHV are superficially similar to those reported recently in hepatitis B virus, we detected no obvious homology in the coding capacity of spliced RNAs from these two viruses.
Chromosome rearrangements via template switching between diverged repeated sequences
Anand, Ranjith P.; Tsaponina, Olga; Greenwell, Patricia W.; Lee, Cheng-Sheng; Du, Wei; Petes, Thomas D.
2014-01-01
Recent high-resolution genome analyses of cancer and other diseases have revealed the occurrence of microhomology-mediated chromosome rearrangements and copy number changes. Although some of these rearrangements appear to involve nonhomologous end-joining, many must have involved mechanisms requiring new DNA synthesis. Models such as microhomology-mediated break-induced replication (MM-BIR) have been invoked to explain these rearrangements. We examined BIR and template switching between highly diverged sequences in Saccharomyces cerevisiae, induced during repair of a site-specific double-strand break (DSB). Our data show that such template switches are robust mechanisms that give rise to complex rearrangements. Template switches between highly divergent sequences appear to be mechanistically distinct from the initial strand invasions that establish BIR. In particular, such jumps are less constrained by sequence divergence and exhibit a different pattern of microhomology junctions. BIR traversing repeated DNA sequences frequently results in complex translocations analogous to those seen in mammalian cells. These results suggest that template switching among repeated genes is a potent driver of genome instability and evolution. PMID:25367035
Martin, Guillaume; Baurens, Franc-Christophe; Droc, Gaëtan; Rouard, Mathieu; Cenci, Alberto; Kilian, Andrzej; Hastie, Alex; Doležel, Jaroslav; Aury, Jean-Marc; Alberti, Adriana; Carreel, Françoise; D'Hont, Angélique
2016-03-16
Recent advances in genomics indicate functional significance of a majority of genome sequences and their long range interactions. As a detailed examination of genome organization and function requires very high quality genome sequence, the objective of this study was to improve reference genome assembly of banana (Musa acuminata). We have developed a modular bioinformatics pipeline to improve genome sequence assemblies, which can handle various types of data. The pipeline comprises several semi-automated tools. However, unlike classical automated tools that are based on global parameters, the semi-automated tools proposed an expert mode for a user who can decide on suggested improvements through local compromises. The pipeline was used to improve the draft genome sequence of Musa acuminata. Genotyping by sequencing (GBS) of a segregating population and paired-end sequencing were used to detect and correct scaffold misassemblies. Long insert size paired-end reads identified scaffold junctions and fusions missed by automated assembly methods. GBS markers were used to anchor scaffolds to pseudo-molecules with a new bioinformatics approach that avoids the tedious step of marker ordering during genetic map construction. Furthermore, a genome map was constructed and used to assemble scaffolds into super scaffolds. Finally, a consensus gene annotation was projected on the new assembly from two pre-existing annotations. This approach reduced the total Musa scaffold number from 7513 to 1532 (i.e. by 80%), with an N50 that increased from 1.3 Mb (65 scaffolds) to 3.0 Mb (26 scaffolds). 89.5% of the assembly was anchored to the 11 Musa chromosomes compared to the previous 70%. Unknown sites (N) were reduced from 17.3 to 10.0%. The release of the Musa acuminata reference genome version 2 provides a platform for detailed analysis of banana genome variation, function and evolution. Bioinformatics tools developed in this work can be used to improve genome sequence assemblies in other species.
An investigation of the SNS Josephson junction as a three-terminal device. Ph.D. Thesis
NASA Technical Reports Server (NTRS)
Meissner, H.; Prans, G. P.
1973-01-01
A particular phenomenon of the SNS Josephson junction was investigated; i.e., control by a current entering the normal region and leaving through one of the superconducting regions. The effect of the control current on the junction was found to be dependent upon the ration of the resistances of the two halves of the N layer. A low frequency, lumped, nonlinear model was proposed to describe the electrical characteristics of the device, and a method was developed to plot the dynamic junction resistance as a function of junction current. The effective thermal noise temperature of the sample was determined. Small signal linearized analysis of the device suggests its use as an impedance transformer, although geometric limitations must be overcome. Linear approximation indicates that it is reciprocal and no power gain is possible. It is felt that, with suitable metallurgical and geometrical improvements, the device has promise to become a superconducting transistor.
Nanoscale imaging of the photoresponse in PN junctions of InGaAs infrared detector
Xia, Hui; Li, Tian-Xin; Tang, Heng-Jing; Zhu, Liang; Li, Xue; Gong, Hai-Mei; Lu, Wei
2016-01-01
Electronic layout, such as distributions of charge carriers and electric field, in PN junction is determinant for the photovoltaic devices to realize their functionality. Considerable efforts have been dedicated to the carrier profiling of this specific region with Scanning Probe Microscope, yet reliable analysis was impeded by the difficulty in resolving carriers with high mobility and the unclear surface effect, particularly on compound semiconductors. Here we realize nanometer Scanning Capacitance Microscopic study on the cross-section of InGaAs/InP photodetctors with the featured dC/dV layout of PN junction unveiled for the first time. It enables us to probe the photo-excited minority carriers in junction region and diagnose the performance deficiency of the diode devices. This work provides an illuminating insight into the PN junction for assessing its basic capability of harvesting photo-carriers as well as blocking leakage current in nanoscopic scale. PMID:26892069
Monolithic stacked blue light-emitting diodes with polarization-enhanced tunnel junctions.
Kuo, Yen-Kuang; Shih, Ya-Hsuan; Chang, Jih-Yuan; Lai, Wei-Chih; Liu, Heng; Chen, Fang-Ming; Lee, Ming-Lun; Sheu, Jinn-Kong
2017-08-07
Monolithic stacked InGaN light-emitting diode (LED) connected by a polarization-enhanced GaN/AlN-based tunnel junction is demonstrated experimentally in this study. The typical stacked LEDs exhibit 80% enhancement in output power compared with conventional single LEDs because of the repeated use of electrons and holes for photon generation. The typical operation voltage of stacked LEDs is higher than twice the operation voltage of single LEDs. This high operation voltage can be attributed to the non-optimal tunneling junction in stacked LEDs. In addition to the analyses of experimental results, theoretical analysis of different schemes of tunnel junctions, including diagrams of energy bands, diagrams of electric fields, and current-voltage relation curves, are investigated using numerical simulation. The results shown in this paper demonstrate the feasibility in developing cost-effective and highly efficient tunnel-junction LEDs.
Development and fabrication of a solar cell junction processing system
NASA Technical Reports Server (NTRS)
Banker, S.
1982-01-01
Development of a pulsed electron beam subsystem, wafer transport system, and ion implanter are discussed. A junction processing system integration and cost analysis are reviewed. Maintenance of the electron beam processor and the experimental test unit of the non-mass analyzed ion implanter is reviewed.
MicroRNA-205 targets tight junction-related proteins during urothelial cellular differentiation.
Chung, Pei-Jung Katy; Chi, Lang-Ming; Chen, Chien-Lun; Liang, Chih-Lung; Lin, Chung-Tzu; Chang, Yu-Xun; Chen, Chun-Hsien; Chang, Yu-Sun
2014-09-01
The mammalian bladder urothelium classified as basal, intermediate, and terminally differentiated umbrella cells offers one of the most effective permeability barrier functions known to exist in nature because of the formation of apical uroplakin plaques and tight junctions. To improve our understanding of urothelial differentiation, we analyzed the microRNA (miRNA) expression profiles of mouse urinary tissues and by TaqMan miRNA analysis of microdissected urothelial layers and in situ miRNA-specific hybridization to determine the dependence of these miRNAs on the differentiation stage. Our in situ hybridization studies revealed that miR-205 was enriched in the undifferentiated basal and intermediate cell layers. We then used a quantitative proteomics approach to identify miR-205 target genes in primary cultured urothelial cells subjected to antagomir-mediated knockdown of specific miRNAs. Twenty-four genes were reproducibly regulated by miR-205; eleven of them were annotated as cell junction- and tight junction-related molecules. Western blot analysis demonstrated that antagomir-induced silencing of miR-205 in primary cultured urothelial cells elevated the expression levels of Tjp1, Cgnl1, and Cdc42. Ectopic expression of miR-205 in MDCK cells inhibited the expression of tight junction proteins and the formation of tight junctions. miR-205- knockdown urothelial cells showed alterations in keratin synthesis and increases of uroplakin Ia and Ib, which are the urothelial differentiation products. These results suggest that miR-205 may contribute a role in regulation of urothelial differentiation by modulating the expression of tight junction-related molecules. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R
1994-05-01
Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.
Analysis of the Gap Junction-dependent Transfer of miRNA with 3D-FRAP Microscopy.
Lemcke, Heiko; Voronina, Natalia; Steinhoff, Gustav; David, Robert
2017-06-19
Small antisense RNAs, like miRNA and siRNA, play an important role in cellular physiology and pathology and, moreover, can be used as therapeutic agents in the treatment of several diseases. The development of new, innovative strategies for miRNA/siRNA therapy is based on an extensive knowledge of the underlying mechanisms. Recent data suggest that small RNAs are exchanged between cells in a gap junction-dependent manner, thereby inducing gene regulatory effects in the recipient cell. Molecular biological techniques and flow cytometric analysis are commonly used to study the intercellular exchange of miRNA. However, these methods do not provide high temporal resolution, which is necessary when studying the gap junctional flux of molecules. Therefore, to investigate the impact of miRNA/siRNA as intercellular signaling molecules, novel tools are needed that will allow for the analysis of these small RNAs at the cellular level. The present protocol describes the application of three-dimensional fluorescence recovery after photobleaching (3D-FRAP) microscopy to elucidating the gap junction-dependent exchange of miRNA molecules between cardiac cells. Importantly, this straightforward and non-invasive live-cell imaging approach allows for the visualization and quantification of the gap junctional shuttling of fluorescently labeled small RNAs in real time, with high spatio-temporal resolution. The data obtained by 3D-FRAP confirm a novel pathway of intercellular gene regulation, where small RNAs act as signaling molecules within the intercellular network.
Tong, Xuhui; Han, Xi; Yu, Binbin; Yu, Meiling; Jiang, Guojun; Ji, Jie; Dong, Shuying
2015-01-01
Platinum agents are widely used in the chemotherapy of testicular cancer. However, adverse reactions and resistance to such agents have limited their application in antineoplastic treatment. The aim of the present study was to determine the role of gap junction intercellular communication (GJIC) composed of Cx43 on oxaliplatin‑induced survival/apoptosis in mouse leydig normal and cancer cells using MTT, Annexin V/PI double staining assays and western blot analysis. The results showed that GJIC exerted opposite effects on the mouse leydig cancer (I-10) and normal (TM3) cell apoptosis induced by oxaliplatin. In leydig cancer cells, survival of cells exposed to oxaliplatin was substantially reduced when gap junctions formed as compared to no gap junctions. Pharmacological inhibition of gap junctions by oleamide and 18-α-glycyrrhetinic acid resulted in enhanced survival/decreased apoptosis while enhancement of gap junctions by retinoic acid led to decreased survival/increased apoptosis. These effects occurred only in high‑density cultures (gap junction formed), while the pharmacological modulations had no effects when there was no opportunity for gap junction formation. Notably, GJIC played an opposite (protective) role in normal leydig cells survival/apoptosis following exposure to oxaliplatin. Furthermore, this converse oxaliplatin‑inducing apoptosis exerted through the functional gap junction was correlated with the mitochondrial pathway‑related protein Bcl-2/Bax and caspase‑3/9. These results suggested that in testicular leydig normal/cancer cells, GJIC plays an opposite role in oxaliplatin‑induced apoptosis via the mitochondrial pathway.
Burdon, Kathryn P.; Dave, Alpana; Jamieson, Robyn V.; Yaron, Yuval; Billson, Frank; Van Maldergem, Lionel; Lorenz, Birgit; Gécz, Jozef; Craig, Jamie E.
2008-01-01
Purpose Nance-Horan syndrome is typically characterized by severe bilateral congenital cataracts and dental abnormalities. Truncating mutations in the Nance-Horan syndrome (NHS) gene cause this X-linked genetic disorder. NHS encodes two isoforms, NHS-A and NHS-1A. The ocular lens expresses NHS-A, the epithelial and neuronal cell specific isoform. The NHS-A protein localizes in the lens epithelium at the cellular periphery. The data to date suggest a role for this isoform at cell-cell junctions in epithelial cells. This study aimed to identify the causative mutations in new patients diagnosed with Nance-Horan syndrome and to investigate the effect of mutations on subcellular localization of the NHS-A protein. Methods All coding exons of NHS were screened for mutations by polymerase chain reaction (PCR) and sequencing. PCR-based mutagenesis was performed to introduce three independent mutations in the NHS-A cDNA. Expression and localization of the mutant proteins was determined in mammalian epithelial cells. Results Truncating mutations were found in 6 out of 10 unrelated patients from four countries. Each of four patients carried a novel mutation (R248X, P264fs, K1198fs, and I1302fs), and each of the two other patients carried two previously reported mutations (R373X and R879X). No mutation was found in the gene in four patients. Two disease-causing mutations (R134fs and R901X) and an artificial mutation (T1357fs) resulted in premature truncation of the NHS-A protein. All three mutant proteins failed to localize to the cellular periphery in epithelial cells and instead were found in the cytoplasm. Conclusions This study brings the total number of mutations identified in NHS to 18. The mislocalization of the mutant NHS-A protein, revealed by mutation analysis, is expected to adversely affect cell-cell junctions in epithelial cells such as the lens epithelium, which may explain cataractogenesis in Nance-Horan syndrome patients. Mutation analysis also shed light on the significance of NHS-A regions for its localization and, hence, its function at epithelial cell junctions. PMID:18949062
Sharma, Shiwani; Burdon, Kathryn P; Dave, Alpana; Jamieson, Robyn V; Yaron, Yuval; Billson, Frank; Van Maldergem, Lionel; Lorenz, Birgit; Gécz, Jozef; Craig, Jamie E
2008-01-01
Nance-Horan syndrome is typically characterized by severe bilateral congenital cataracts and dental abnormalities. Truncating mutations in the Nance-Horan syndrome (NHS) gene cause this X-linked genetic disorder. NHS encodes two isoforms, NHS-A and NHS-1A. The ocular lens expresses NHS-A, the epithelial and neuronal cell specific isoform. The NHS-A protein localizes in the lens epithelium at the cellular periphery. The data to date suggest a role for this isoform at cell-cell junctions in epithelial cells. This study aimed to identify the causative mutations in new patients diagnosed with Nance-Horan syndrome and to investigate the effect of mutations on subcellular localization of the NHS-A protein. All coding exons of NHS were screened for mutations by polymerase chain reaction (PCR) and sequencing. PCR-based mutagenesis was performed to introduce three independent mutations in the NHS-A cDNA. Expression and localization of the mutant proteins was determined in mammalian epithelial cells. Truncating mutations were found in 6 out of 10 unrelated patients from four countries. Each of four patients carried a novel mutation (R248X, P264fs, K1198fs, and I1302fs), and each of the two other patients carried two previously reported mutations (R373X and R879X). No mutation was found in the gene in four patients. Two disease-causing mutations (R134fs and R901X) and an artificial mutation (T1357fs) resulted in premature truncation of the NHS-A protein. All three mutant proteins failed to localize to the cellular periphery in epithelial cells and instead were found in the cytoplasm. This study brings the total number of mutations identified in NHS to 18. The mislocalization of the mutant NHS-A protein, revealed by mutation analysis, is expected to adversely affect cell-cell junctions in epithelial cells such as the lens epithelium, which may explain cataractogenesis in Nance-Horan syndrome patients. Mutation analysis also shed light on the significance of NHS-A regions for its localization and, hence, its function at epithelial cell junctions.
Genome, Integration, and Transduction of a Novel Temperate Phage of Helicobacter pylori
Luo, Cheng-Hung; Chiou, Pei-Yu; Yang, Chiou-Ying
2012-01-01
Helicobacter pylori is a common human pathogen that has been identified to be carcinogenic. This study isolated the temperate bacteriophage 1961P from the lysate of a clinical strain of H. pylori isolated in Taiwan. The bacteriophage has an icosahedral head and a short tail, typical of the Podoviridae family. Its double-stranded DNA genome is 26,836 bp long and has 33 open reading frames. Only 9 of the predicted proteins have homologs of known functions, while the remaining 24 are only similar to unknown proteins encoded by Helicobacter prophages and remnants. Analysis of sequences proximal to the phage-host junctions suggests that 1961P may integrate into the host chromosome via a mechanism similar to that of bacteriophage lambda. In addition, 1961P is capable of generalized transduction. To the best of our knowledge, this is the first report of the isolation, characterization, genome analysis, integration, and transduction of a Helicobacter pylori phage. PMID:22696647
Ehrenstein, Michael R.; Rada, Cristina; Jones, Anne-Marie; Milstein, César; Neuberger, Michael S.
2001-01-01
Isotype switching involves a region-specific, nonhomologous recombinational deletion that has been suggested to occur by nonhomologous joining of broken DNA ends. Here, we find increased donor/acceptor homology at switch junctions from PMS2-deficient mice and propose that class switching can occur by microhomology-mediated end-joining. Interestingly, although isotype switching and somatic hypermutation show many parallels, we confirm that PMS2 deficiency has no major effect on the pattern of nucleotide substitutions generated during somatic hypermutation. This finding is in contrast to MSH2 deficiency. With MSH2, the altered pattern of switch recombination and hypermutation suggests parallels in the mechanics of the two processes, whereas the fact that PMS2 deficiency affects only switch recombination may reflect differences in the pathways of break resolution. PMID:11717399
Intercellular ice propagation: experimental evidence for ice growth through membrane pores.
Acker, J P; Elliott, J A; McGann, L E
2001-01-01
Propagation of intracellular ice between cells significantly increases the prevalence of intracellular ice in confluent monolayers and tissues. It has been proposed that gap junctions facilitate ice propagation between cells. This study develops an equation for capillary freezing-point depression to determine the effect of temperature on the equilibrium radius of an ice crystal sufficiently small to grow through gap junctions. Convection cryomicroscopy and video image analysis were used to examine the incidence and pattern of intracellular ice formation (IIF) in the confluent monolayers of cell lines that do (MDCK) and do not (V-79W) form gap junctions. The effect of gap junctions on intracellular ice propagation was strongly temperature-dependent. For cells with gap junctions, IIF occurred in a directed wave-like pattern in 100% of the cells below -3 degrees C. At temperatures above -3 degrees C, there was a marked drop in the incidence of IIF, with isolated individual cells initially freezing randomly throughout the sample. This random pattern of IIF was also observed in the V-79W monolayers and in MDCK monolayers treated to prevent gap junction formation. The significant change in the low temperature behavior of confluent MDCK monolayers at -3 degrees C is likely the result of the inhibition of gap junction-facilitated ice propagation, and supports the theory that gap junctions facilitate ice nucleation between cells. PMID:11509353
NASA Astrophysics Data System (ADS)
Hamdipour, Mohammad
2018-04-01
We study an array of coupled Josephson junction of superconductor/insulator/superconductor type (SIS junction) as a model for high temperature superconductors with layered structure. In the current-voltage characteristics of this system there is a breakpoint region in which a net electric charge appear on superconducting layers, S-layers, of junctions which motivate us to study the charge dynamics in this region. In this paper first of all we show a current voltage characteristics (CVC) of Intrinsic Josephson Junctions (IJJs) with N=3 Junctions, then we show the breakpoint region in that CVC, then we try to investigate the chaos in this region. We will see that at the end of the breakpoint region, behavior of the system is chaotic and Lyapunov exponent become positive. We also study the route by which the system become chaotic and will see this route is bifurcation. Next goal of this paper is to show the self similarity in the bifurcation diagram of the system and detailed analysis of bifurcation diagram.
Rectifying and photovoltaic properties of the heterojunction composed of CaMnO3 and Nb-doped SrTiO3
NASA Astrophysics Data System (ADS)
Sun, J. R.; Zhang, S. Y.; Shen, B. G.; Wong, H. K.
2005-01-01
A heterojunction composed of CaMnO3 (CMO) and Nb-doped SrTiO3 (STON) was fabricated and its properties were studied and compared with La0.67Ca0.33MnO3/STON and LaMnO3+δ/STON p-n, junctions. This CMO/STON junction exhibits an asymmetric current-voltage relation similar to a p-n junction. The most remarkable discovery is that the magnetic state of the manganites has a strong impact on the rectifying behaviors. The diffusion voltage, which is the critical voltage for the current rush, shows a tendency to decrease/increase with the establishment of the antiferromagnetic/ferromagnetic order in the manganites of the junction. Similar to other manganite p-n junctions, CMO/STON also exhibits a significant photovoltaic effect, and the maximum photovoltage is ˜2.2mV under the illumination of ˜7mW light (λ=460nm). A qualitative explanation is given based on an analysis on the band diagram of the junctions.
Single-Molecule Electronics: Chemical and Analytical Perspectives.
Nichols, Richard J; Higgins, Simon J
2015-01-01
It is now possible to measure the electrical properties of single molecules using a variety of techniques including scanning probe microcopies and mechanically controlled break junctions. Such measurements can be made across a wide range of environments including ambient conditions, organic liquids, ionic liquids, aqueous solutions, electrolytes, and ultra high vacuum. This has given new insights into charge transport across molecule electrical junctions, and these experimental methods have been complemented with increasingly sophisticated theory. This article reviews progress in single-molecule electronics from a chemical perspective and discusses topics such as the molecule-surface coupling in electrical junctions, chemical control, and supramolecular interactions in junctions and gating charge transport. The article concludes with an outlook regarding chemical analysis based on single-molecule conductance.
Sample injector for high pressure liquid chromatography
Paul, Phillip H.; Arnold, Don W.; Neyer, David W.
2001-01-01
Apparatus and method for driving a sample, having a well-defined volume, under pressure into a chromatography column. A conventional high pressure sampling valve is replaced by a sample injector composed of a pair of injector components connected in series to a common junction. The injector components are containers of porous dielectric material constructed so as to provide for electroosmotic flow of a sample into the junction. At an appropriate time, a pressure pulse from a high pressure source, that can be an electrokinetic pump, connected to the common junction, drives a portion of the sample, whose size is determined by the dead volume of the common junction, into the chromatographic column for subsequent separation and analysis. The apparatus can be fabricated on a substrate for microanalytical applications.
Microwave Frequency Comb from a Semiconductor in a Scanning Tunneling Microscope.
Hagmann, Mark J; Yarotski, Dmitry A; Mousa, Marwan S
2017-04-01
Quasi-periodic excitation of the tunneling junction in a scanning tunneling microscope, by a mode-locked ultrafast laser, superimposes a regular sequence of 15 fs pulses on the DC tunneling current. In the frequency domain, this is a frequency comb with harmonics at integer multiples of the laser pulse repetition frequency. With a gold sample the 200th harmonic at 14.85 GHz has a signal-to-noise ratio of 25 dB, and the power at each harmonic varies inversely with the square of the frequency. Now we report the first measurements with a semiconductor where the laser photon energy must be less than the bandgap energy of the semiconductor; the microwave frequency comb must be measured within 200 μm of the tunneling junction; and the microwave power is 25 dB below that with a metal sample and falls off more rapidly at the higher harmonics. Our results suggest that the measured attenuation of the microwave harmonics is sensitive to the semiconductor spreading resistance within 1 nm of the tunneling junction. This approach may enable sub-nanometer carrier profiling of semiconductors without requiring the diamond nanoprobes in scanning spreading resistance microscopy.
Snaptron: querying splicing patterns across tens of thousands of RNA-seq samples
Wilks, Christopher; Gaddipati, Phani; Nellore, Abhinav
2018-01-01
Abstract Motivation As more and larger genomics studies appear, there is a growing need for comprehensive and queryable cross-study summaries. These enable researchers to leverage vast datasets that would otherwise be difficult to obtain. Results Snaptron is a search engine for summarized RNA sequencing data with a query planner that leverages R-tree, B-tree and inverted indexing strategies to rapidly execute queries over 146 million exon-exon splice junctions from over 70 000 human RNA-seq samples. Queries can be tailored by constraining which junctions and samples to consider. Snaptron can score junctions according to tissue specificity or other criteria, and can score samples according to the relative frequency of different splicing patterns. We describe the software and outline biological questions that can be explored with Snaptron queries. Availability and implementation Documentation is at http://snaptron.cs.jhu.edu. Source code is at https://github.com/ChristopherWilks/snaptron and https://github.com/ChristopherWilks/snaptron-experiments with a CC BY-NC 4.0 license. Contact chris.wilks@jhu.edu or langmea@cs.jhu.edu Supplementary information Supplementary data are available at Bioinformatics online. PMID:28968689
Snaptron: querying splicing patterns across tens of thousands of RNA-seq samples.
Wilks, Christopher; Gaddipati, Phani; Nellore, Abhinav; Langmead, Ben
2018-01-01
As more and larger genomics studies appear, there is a growing need for comprehensive and queryable cross-study summaries. These enable researchers to leverage vast datasets that would otherwise be difficult to obtain. Snaptron is a search engine for summarized RNA sequencing data with a query planner that leverages R-tree, B-tree and inverted indexing strategies to rapidly execute queries over 146 million exon-exon splice junctions from over 70 000 human RNA-seq samples. Queries can be tailored by constraining which junctions and samples to consider. Snaptron can score junctions according to tissue specificity or other criteria, and can score samples according to the relative frequency of different splicing patterns. We describe the software and outline biological questions that can be explored with Snaptron queries. Documentation is at http://snaptron.cs.jhu.edu. Source code is at https://github.com/ChristopherWilks/snaptron and https://github.com/ChristopherWilks/snaptron-experiments with a CC BY-NC 4.0 license. chris.wilks@jhu.edu or langmea@cs.jhu.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
Conserved DNA motifs in the type II-A CRISPR leader region.
Van Orden, Mason J; Klein, Peter; Babu, Kesavan; Najar, Fares Z; Rajan, Rakhi
2017-01-01
The Clustered Regularly Interspaced Short Palindromic Repeats associated (CRISPR-Cas) systems consist of RNA-protein complexes that provide bacteria and archaea with sequence-specific immunity against bacteriophages, plasmids, and other mobile genetic elements. Bacteria and archaea become immune to phage or plasmid infections by inserting short pieces of the intruder DNA (spacer) site-specifically into the leader-repeat junction in a process called adaptation. Previous studies have shown that parts of the leader region, especially the 3' end of the leader, are indispensable for adaptation. However, a comprehensive analysis of leader ends remains absent. Here, we have analyzed the leader, repeat, and Cas proteins from 167 type II-A CRISPR loci. Our results indicate two distinct conserved DNA motifs at the 3' leader end: ATTTGAG (noted previously in the CRISPR1 locus of Streptococcus thermophilus DGCC7710) and a newly defined CTRCGAG, associated with the CRISPR3 locus of S. thermophilus DGCC7710. A third group with a very short CG DNA conservation at the 3' leader end is observed mostly in lactobacilli. Analysis of the repeats and Cas proteins revealed clustering of these CRISPR components that mirrors the leader motif clustering, in agreement with the coevolution of CRISPR-Cas components. Based on our analysis of the type II-A CRISPR loci, we implicate leader end sequences that could confer site-specificity for the adaptation-machinery in the different subsets of type II-A CRISPR loci.
Jue, Dengwei; Sang, Xuelian; Shu, Bo; Liu, Liqin; Wang, Yicheng; Jia, Zhiwei; Zou, Yu; Shi, Shengyou
2017-01-01
Ripening affects the quality and nutritional contents of fleshy fruits and is a crucial process of fruit development. Although several studies have suggested that ubiquitin-conjugating enzyme (E2s or UBC enzymes) are involved in the regulation of fruit ripening, little is known about the function of E2s in papaya (Carica papaya). In the present study, we searched the papaya genome and identified 34 putative UBC genes, which were clustered into 17 phylogenetic subgroups. We also analyzed the nucleotide sequences of the papaya UBC (CpUBC) genes and found that both exon-intron junctions and sequence motifs were highly conserved among the phylogenetic subgroups. Using real-time PCR analysis, we also found that all the CpUBC genes were expressed in roots, stems, leaves, male and female flowers, and mature fruit, although the expression of some of the genes was increased or decreased in one or several specific organs. We also found that the expression of 13 and two CpUBC genes were incresesd or decreased during one and two ripening stages, respectively. Expression analyses indicates possible E2s playing a more significant role in fruit ripening for further studies. To the best of our knowledge, this is the first reported genome-wide analysis of the papaya UBC gene family, and the results will facilitate further investigation of the roles of UBC genes in fruit ripening and will aide in the functional validation of UBC genes in papaya.
Conserved DNA motifs in the type II-A CRISPR leader region
Babu, Kesavan; Najar, Fares Z.
2017-01-01
The Clustered Regularly Interspaced Short Palindromic Repeats associated (CRISPR-Cas) systems consist of RNA-protein complexes that provide bacteria and archaea with sequence-specific immunity against bacteriophages, plasmids, and other mobile genetic elements. Bacteria and archaea become immune to phage or plasmid infections by inserting short pieces of the intruder DNA (spacer) site-specifically into the leader-repeat junction in a process called adaptation. Previous studies have shown that parts of the leader region, especially the 3′ end of the leader, are indispensable for adaptation. However, a comprehensive analysis of leader ends remains absent. Here, we have analyzed the leader, repeat, and Cas proteins from 167 type II-A CRISPR loci. Our results indicate two distinct conserved DNA motifs at the 3′ leader end: ATTTGAG (noted previously in the CRISPR1 locus of Streptococcus thermophilus DGCC7710) and a newly defined CTRCGAG, associated with the CRISPR3 locus of S. thermophilus DGCC7710. A third group with a very short CG DNA conservation at the 3′ leader end is observed mostly in lactobacilli. Analysis of the repeats and Cas proteins revealed clustering of these CRISPR components that mirrors the leader motif clustering, in agreement with the coevolution of CRISPR-Cas components. Based on our analysis of the type II-A CRISPR loci, we implicate leader end sequences that could confer site-specificity for the adaptation-machinery in the different subsets of type II-A CRISPR loci. PMID:28392985
RAP: RNA-Seq Analysis Pipeline, a new cloud-based NGS web application.
D'Antonio, Mattia; D'Onorio De Meo, Paolo; Pallocca, Matteo; Picardi, Ernesto; D'Erchia, Anna Maria; Calogero, Raffaele A; Castrignanò, Tiziana; Pesole, Graziano
2015-01-01
The study of RNA has been dramatically improved by the introduction of Next Generation Sequencing platforms allowing massive and cheap sequencing of selected RNA fractions, also providing information on strand orientation (RNA-Seq). The complexity of transcriptomes and of their regulative pathways make RNA-Seq one of most complex field of NGS applications, addressing several aspects of the expression process (e.g. identification and quantification of expressed genes and transcripts, alternative splicing and polyadenylation, fusion genes and trans-splicing, post-transcriptional events, etc.). In order to provide researchers with an effective and friendly resource for analyzing RNA-Seq data, we present here RAP (RNA-Seq Analysis Pipeline), a cloud computing web application implementing a complete but modular analysis workflow. This pipeline integrates both state-of-the-art bioinformatics tools for RNA-Seq analysis and in-house developed scripts to offer to the user a comprehensive strategy for data analysis. RAP is able to perform quality checks (adopting FastQC and NGS QC Toolkit), identify and quantify expressed genes and transcripts (with Tophat, Cufflinks and HTSeq), detect alternative splicing events (using SpliceTrap) and chimeric transcripts (with ChimeraScan). This pipeline is also able to identify splicing junctions and constitutive or alternative polyadenylation sites (implementing custom analysis modules) and call for statistically significant differences in genes and transcripts expression, splicing pattern and polyadenylation site usage (using Cuffdiff2 and DESeq). Through a user friendly web interface, the RAP workflow can be suitably customized by the user and it is automatically executed on our cloud computing environment. This strategy allows to access to bioinformatics tools and computational resources without specific bioinformatics and IT skills. RAP provides a set of tabular and graphical results that can be helpful to browse, filter and export analyzed data, according to the user needs.
Starich, Todd A; Hall, David H; Greenstein, David
2014-11-01
In all animals examined, somatic cells of the gonad control multiple biological processes essential for germline development. Gap junction channels, composed of connexins in vertebrates and innexins in invertebrates, permit direct intercellular communication between cells and frequently form between somatic gonadal cells and germ cells. Gap junctions comprise hexameric hemichannels in apposing cells that dock to form channels for the exchange of small molecules. Here we report essential roles for two classes of gap junction channels, composed of five innexin proteins, in supporting the proliferation of germline stem cells and gametogenesis in the nematode Caenorhabditis elegans. Transmission electron microscopy of freeze-fracture replicas and fluorescence microscopy show that gap junctions between somatic cells and germ cells are more extensive than previously appreciated and are found throughout the gonad. One class of gap junctions, composed of INX-8 and INX-9 in the soma and INX-14 and INX-21 in the germ line, is required for the proliferation and differentiation of germline stem cells. Genetic epistasis experiments establish a role for these gap junction channels in germline proliferation independent of the glp-1/Notch pathway. A second class of gap junctions, composed of somatic INX-8 and INX-9 and germline INX-14 and INX-22, is required for the negative regulation of oocyte meiotic maturation. Rescue of gap junction channel formation in the stem cell niche rescues germline proliferation and uncovers a later channel requirement for embryonic viability. This analysis reveals gap junctions as a central organizing feature of many soma-germline interactions in C. elegans. Copyright © 2014 by the Genetics Society of America.
Sukhanova, Maria V; D'Herin, Claudine; Boiteux, Serge; Lavrik, Olga I
2014-10-01
To characterize proteins that interact with single-stranded/double-stranded (ss/ds) DNA junctions in whole cell free extracts of Saccharomyces cerevisiae, we used [(32)P]-labeled photoreactive partial DNA duplexes containing a 3'-ss/ds-junction (3'-junction) or a 5'-ss/ds-junction (5'-junction). Identification of labeled proteins was achieved by MALDI-TOF mass spectrometry peptide mass fingerprinting and genetic analysis. In wild-type extract, one of the components of the Ddc1-Rad17-Mec3 complex, Ddc1, was found to be preferentially photocrosslinked at a 3'-junction. On the other hand, RPAp70, the large subunit of the replication protein A (RPA), was the predominant crosslinking product at a 5'-junction. Interestingly, ddc1Δ extracts did not display photocrosslinking of RPAp70 at a 5'-junction. The results show that RPAp70 crosslinked to DNA with a 5'-junction is subject to limited proteolysis in ddc1Δ extracts, whereas it is stable in WT, rad17Δ, mec3Δ and mec1Δ extracts. The degradation of the RPAp70-DNA adduct in ddc1Δ extract is strongly reduced in the presence of the proteasome inhibitor MG 132. We also addressed the question of the stability of free RPA, using anti-RPA antibodies. The results show that RPAp70 is also subject to proteolysis without photocrosslinking to DNA upon incubation in ddc1Δ extract. The data point to a novel property of Ddc1, modulating the turnover of DNA binding proteins such as RPAp70 by the proteasome. Copyright © 2014 Elsevier B.V. All rights reserved.
Do, Hoang Dang Khoa; Kim, Joo-Hwan
2017-01-01
Chloroplast genomes (cpDNA) are highly valuable resources for evolutionary studies of angiosperms, since they are highly conserved, are small in size, and play critical roles in plants. Slipped-strand mispairing (SSM) was assumed to be a mechanism for generating repeat units in cpDNA. However, research on the employment of different small repeated sequences through SSM events, which may induce the accumulation of distinct types of repeats within the same region in cpDNA, has not been documented. Here, we sequenced two chloroplast genomes from the endemic species Heloniopsis tubiflora (Korea) and Xerophyllum tenax (USA) to cover the gap between molecular data and explore "hot spots" for genomic events in Melanthiaceae. Comparative analysis of 23 complete cpDNA sequences revealed that there were different stages of deletion in the rps16 region across the Melanthiaceae. Based on the partial or complete loss of rps16 gene in cpDNA, we have firstly reported potential molecular markers for recognizing two sections ( Veratrum and Fuscoveratrum ) of Veratrum . Melathiaceae exhibits a significant change in the junction between large single copy and inverted repeat regions, ranging from trnH_GUG to a part of rps3 . Our results show an accumulation of tandem repeats in the rpl23-ycf2 regions of cpDNAs. Small conserved sequences exist and flank tandem repeats in further observation of this region across most of the examined taxa of Liliales. Therefore, we propose three scenarios in which different small repeated sequences were used during SSM events to generate newly distinct types of repeats. Occasionally, prior to the SSM process, point mutation event and double strand break repair occurred and induced the formation of initial repeat units which are indispensable in the SSM process. SSM may have likely occurred more frequently for short repeats than for long repeat sequences in tribe Parideae (Melanthiaceae, Liliales). Collectively, these findings add new evidence of dynamic results from SSM in chloroplast genomes which can be useful for further evolutionary studies in angiosperms. Additionally, genomics events in cpDNA are potential resources for mining molecular markers in Liliales.
Automatic recognition and analysis of synapses. [in brain tissue
NASA Technical Reports Server (NTRS)
Ungerleider, J. A.; Ledley, R. S.; Bloom, F. E.
1976-01-01
An automatic system for recognizing synaptic junctions would allow analysis of large samples of tissue for the possible classification of specific well-defined sets of synapses based upon structural morphometric indices. In this paper the three steps of our system are described: (1) cytochemical tissue preparation to allow easy recognition of the synaptic junctions; (2) transmitting the tissue information to a computer; and (3) analyzing each field to recognize the synapses and make measurements on them.
A physicochemical mechanism of chemical gas sensors using an AC analysis.
Moon, Jaehyun; Park, Jin-Ah; Lee, Su-Jae; Lee, Jeong-Ik; Zyung, Taehyong; Shin, Eui-Chol; Lee, Jong-Sook
2013-06-21
Electrical modeling of the chemical gas sensors was successfully applied to TiO2 nanofiber gas sensors by developing an equivalent circuit model where the junction capacitance as well as the resistance can be separated from the comparable stray capacitance. The Schottky junction impedance exhibited a characteristic skewed arc described by a Cole-Davidson function, and the variation of the fit and derived parameters with temperature, bias, and NO2 gas concentration indicated definitely a physicochemical sensing mechanism based on the Pt|TiO2 Schottky junctions against the conventional supposition of the enhanced sensitivity in nanostructured gas sensors with high grain boundary/surface area. Analysis on a model Pt|TiO2|Pt structure also confirmed the characteristic impedance response of TiO2 nanofiber sensors.
Shark Ig light chain junctions are as diverse as in heavy chains.
Fleurant, Marshall; Changchien, Lily; Chen, Chin-Tung; Flajnik, Martin F; Hsu, Ellen
2004-11-01
We have characterized a small family of four genes encoding one of the three nurse shark Ig L chain isotypes, called NS5. All NS5 cDNA sequences are encoded by three loci, of which two are organized as conventional clusters, each consisting of a V and J gene segment that can recombine and one C region exon; the third contains a germline-joined VJ in-frame and the fourth locus is a pseudogene. This is the second nurse shark L chain type where both germline-joined and split V-J organizations have been found. Since there are only two rearranging Ig loci, it was possible for the first time to examine junctional diversity in defined fish Ig genes, comparing productive vs nonproductive rearrangements. N region addition was found to be considerably more extensive in length and in frequency than any other vertebrate L chain so far reported and rivals that in H chain. We put forth the speculation that the unprecedented efficiency of N region addition (87-93% of NS5 sequences) may be a result not only of simultaneous H and L chain rearrangement in the shark but also of processing events that afford greater accessibility of the V or J gene coding ends to terminal deoxynucleotidyltransferase.
Chaotic Behaviour of a Driven P-N Junction
NASA Astrophysics Data System (ADS)
Perez, Jose Maria
The chaotic behavior of a driven p-n junction is experimentally examined. Bifurcation diagrams for the system are measured, showing period doubling bifurcations up to f/32, onset of chaos, reverse bifurcations of chaotic bands, and periodic windows. Some of the measured bifurcation diagrams are similar to the bifurcation diagram of the logistic map x(,n+1) = (lamda)x(,n)(1 - x(,n)). A return map is also measured showing approximately a one-dimensional map with a single extremum at low driving voltages. The intermittency route to chaos is experimentally observed to occur near a tangent bifurcation as the system approaches a period 5 window at (lamda) = (lamda)(,5). Data are presented for the dependence of the average laminar length
NASA Astrophysics Data System (ADS)
Benichou, Jennifer I. C.; van Heijst, Jeroen W. J.; Glanville, Jacob; Louzoun, Yoram
2017-08-01
T and B cell receptor (TCR and BCR) complementarity determining region 3 (CDR3) genetic diversity is produced through multiple diversification and selection stages. Potential holes in the CDR3 repertoire were argued to be linked to immunodeficiencies and diseases. In contrast with BCRs, TCRs have practically no Dβ germline genetic diversity, and the question emerges as to whether they can produce a diverse CDR3 repertoire. In order to address the genetic diversity of the adaptive immune system, appropriate quantitative measures for diversity and large-scale sequencing are required. Such a diversity method should incorporate the complex diversification mechanisms of the adaptive immune response and the BCR and TCR loci structure. We combined large-scale sequencing and diversity measures to show that TCRs have a near maximal CDR3 genetic diversity. Specifically, TCR have a larger junctional and V germline diversity, which starts more 5‧ in Vβ than BCRs. Selection decreases the TCR repertoire diversity, but does not affect BCR repertoire. As a result, TCR is as diverse as BCR repertoire, with a biased CDR3 length toward short TCRs and long BCRs. These differences suggest parallel converging evolutionary tracks to reach the required diversity to avoid holes in the CDR3 repertoire.
Lim, Byung Chan; Lee, Seungbok; Shin, Jong-Yeon; Kim, Jong-Il; Hwang, Hee; Kim, Ki Joong; Hwang, Yong Seung; Seo, Jeong-Sun; Chae, Jong Hee
2011-11-01
Duchenne muscular dystrophy or Becker muscular dystrophy might be a suitable candidate disease for application of next-generation sequencing in the genetic diagnosis because the complex mutational spectrum and the large size of the dystrophin gene require two or more analytical methods and have a high cost. The authors tested whether large deletions/duplications or small mutations, such as point mutations or short insertions/deletions of the dystrophin gene, could be predicted accurately in a single platform using next-generation sequencing technology. A custom solution-based target enrichment kit was designed to capture whole genomic regions of the dystrophin gene and other muscular-dystrophy-related genes. A multiplexing strategy, wherein four differently bar-coded samples were captured and sequenced together in a single lane of the Illumina Genome Analyser, was applied. The study subjects were 25 16 with deficient dystrophin expression without a large deletion/duplication and 9 with a known large deletion/duplication. Nearly 100% of the exonic region of the dystrophin gene was covered by at least eight reads with a mean read depth of 107. Pathogenic small mutations were identified in 15 of the 16 patients without a large deletion/duplication. Using these 16 patients as the standard, the authors' method accurately predicted the deleted or duplicated exons in the 9 patients with known mutations. Inclusion of non-coding regions and paired-end sequence analysis enabled accurate identification by increasing the read depth and providing information about the breakpoint junction. The current method has an advantage for the genetic diagnosis of Duchenne muscular dystrophy and Becker muscular dystrophy wherein a comprehensive mutational search may be feasible using a single platform.
Yang, Ming-ming; Ho, Mary; Lau, Henry H W; Tam, Pancy O S; Young, Alvin L; Pang, Chi Pui; Yip, Wilson W K; Chen, LiJia
2013-01-01
To determine the underlying genetic cause of Duane retraction syndrome (DRS) in a non-consanguineous Chinese Han family. Detailed ophthalmic and physical examinations were performed on all members from a pedigree with DRS. All exons and their adjacent splicing junctions of the sal-like 4 (SALL4) gene were amplified with polymerase chain reaction and analyzed with direct sequencing in all the recruited family members and 200 unrelated control subjects. Clinical examination revealed a broad spectrum of phenotypes in the DRS family. Mutation analysis of SALL4 identified a novel heterozygous duplication mutation, c.1919dupT, which was completely cosegregated with the disease in the family and absent in controls. This mutation was predicted to cause a frameshift, introducing a premature stop codon, when translated, resulting in a truncated SALL4 protein, i.e., p.Met640IlefsX25. Bioinformatics analysis showed that the affected region of SALL4 shared a highly conserved sequence across different species. Diversified clinical manifestations were observed in the c.1919dupT carriers of the family. We identified a novel truncating mutation in the SALL4 gene that leads to diversified clinical features of DRS in a Chinese family. This mutation is predicted to result in a truncated SALL4 protein affecting two functional domains and cause disease development due to haploinsufficiency through nonsense-mediated mRNA decay.
Analysis of the site-specific integration system of the Streptomyces aureofaciens phage μ1/6.
Farkašovská, Jarmila; Godány, Andrej
2012-03-01
The bacteriophage μ1/6 integrates its DNA into the chromosome of tetracycline producing strains of Streptomyces aureofaciens by a site-specific recombination process. A bioinformatic analysis of the μ1/6 genome revealed that orf5 encodes a putative integrase, a basic protein of 416 amino acids. The μ1/6 integrase was found to belong to the integrase family of site-specific tyrosine recombinases. The phage attachment site (attP) was localized downstream of the int gene. The attachment junctions (attL and attR) were determined, allowing identification of the bacterial attachment site (attB). All attachment sites shared a 46-bp common core sequence within which a site-specific recombination occurs. This core sequence comprises the 3' end of a putative tRNA(Thr) gene (anticodon TGT) which is completely restored in attL after integration of the phage into the host genome. An integration vector containing μ1/6 int-attP region was inserted stably into the S. aureofaciens B96, S. lividans TK24, and S. coelicolor A3. The μ1/6 integrase was shown to be functional in vivo in heterologous Escherichia coli without any other factors encoded by Streptomyces. In vitro recombination assay using purified μ1/6 integrase demonstrated its ability to catalyze integrative recombination in the presence of a crude extract of E. coli cells.
Ibebunjo, Chikwendu; Chick, Joel M.; Kendall, Tracee; Eash, John K.; Li, Christine; Zhang, Yunyu; Vickers, Chad; Wu, Zhidan; Clarke, Brian A.; Shi, Jun; Cruz, Joseph; Fournier, Brigitte; Brachat, Sophie; Gutzwiller, Sabine; Ma, QiCheng; Markovits, Judit; Broome, Michelle; Steinkrauss, Michelle; Skuba, Elizabeth; Galarneau, Jean-Rene; Gygi, Steven P.
2013-01-01
Molecular mechanisms underlying sarcopenia, the age-related loss of skeletal muscle mass and function, remain unclear. To identify molecular changes that correlated best with sarcopenia and might contribute to its pathogenesis, we determined global gene expression profiles in muscles of rats aged 6, 12, 18, 21, 24, and 27 months. These rats exhibit sarcopenia beginning at 21 months. Correlation of the gene expression versus muscle mass or age changes, and functional annotation analysis identified gene signatures of sarcopenia distinct from gene signatures of aging. Specifically, mitochondrial energy metabolism (e.g., tricarboxylic acid cycle and oxidative phosphorylation) pathway genes were the most downregulated and most significantly correlated with sarcopenia. Also, perturbed were genes/pathways associated with neuromuscular junction patency (providing molecular evidence of sarcopenia-related functional denervation and neuromuscular junction remodeling), protein degradation, and inflammation. Proteomic analysis of samples at 6, 18, and 27 months confirmed the depletion of mitochondrial energy metabolism proteins and neuromuscular junction proteins. Together, these findings suggest that therapeutic approaches that simultaneously stimulate mitochondrogenesis and reduce muscle proteolysis and inflammation have potential for treating sarcopenia. PMID:23109432
The Complete Chloroplast Genome Sequence of Date Palm (Phoenix dactylifera L.)
Yang, Meng; Zhang, Xiaowei; Liu, Guiming; Yin, Yuxin; Chen, Kaifu; Yun, Quanzheng; Zhao, Duojun; Al-Mssallem, Ibrahim S.; Yu, Jun
2010-01-01
Background Date palm (Phoenix dactylifera L.), a member of Arecaceae family, is one of the three major economically important woody palms—the two other palms being oil palm and coconut tree—and its fruit is a staple food among Middle East and North African nations, as well as many other tropical and subtropical regions. Here we report a complete sequence of the data palm chloroplast (cp) genome based on pyrosequencing. Methodology/Principal Findings After extracting 369,022 cp sequencing reads from our whole-genome-shotgun data, we put together an assembly and validated it with intensive PCR-based verification, coupled with PCR product sequencing. The date palm cp genome is 158,462 bp in length and has a typical quadripartite structure of the large (LSC, 86,198 bp) and small single-copy (SSC, 17,712 bp) regions separated by a pair of inverted repeats (IRs, 27,276 bp). Similar to what has been found among most angiosperms, the date palm cp genome harbors 112 unique genes and 19 duplicated fragments in the IR regions. The junctions between LSC/IRs and SSC/IRs show different features of sequence expansion in evolution. We identified 78 SNPs as major intravarietal polymorphisms within the population of a specific cp genome, most of which were located in genes with vital functions. Based on RNA-sequencing data, we also found 18 polycistronic transcription units and three highly expression-biased genes—atpF, trnA-UGC, and rrn23. Conclusions Unlike most monocots, date palm has a typical cp genome similar to that of tobacco—with little rearrangement and gene loss or gain. High-throughput sequencing technology facilitates the identification of intravarietal variations in cp genomes among different cultivars. Moreover, transcriptomic analysis of cp genes provides clues for uncovering regulatory mechanisms of transcription and translation in chloroplasts. PMID:20856810
Measurement and control of detailed electronic properties in a single molecule break junction.
Wang, Kun; Hamill, Joseph; Zhou, Jianfeng; Guo, Cunlan; Xu, Bingqian
2014-01-01
The lack of detailed experimental controls has been one of the major obstacles hindering progress in molecular electronics. While large fluctuations have been occurring in the experimental data, specific details, related mechanisms, and data analysis techniques are in high demand to promote our physical understanding at the single-molecule level. A series of modulations we recently developed, based on traditional scanning probe microscopy break junctions (SPMBJs), have helped to discover significant properties in detail which are hidden in the contact interfaces of a single-molecule break junction (SMBJ). For example, in the past we have shown that the correlated force and conductance changes under the saw tooth modulation and stretch-hold mode of PZT movement revealed inherent differences in the contact geometries of a molecular junction. In this paper, using a bias-modulated SPMBJ and utilizing emerging data analysis techniques, we report on the measurement of the altered alignment of the HOMO of benzene molecules with changing the anchoring group which coupled the molecule to metal electrodes. Further calculations based on Landauer fitting and transition voltage spectroscopy (TVS) demonstrated the effects of modulated bias on the location of the frontier molecular orbitals. Understanding the alignment of the molecular orbitals with the Fermi level of the electrodes is essential for understanding the behaviour of SMBJs and for the future design of more complex devices. With these modulations and analysis techniques, fruitful information has been found about the nature of the metal-molecule junction, providing us insightful clues towards the next step for in-depth study.
Chromosomal translocations and palindromic AT-rich repeats
Kato, Takema; Kurahashi, Hiroki; Emanuel1, Beverly S.
2012-01-01
Repetitive DNA sequences constitute 30% of the human genome, and are often sites of genomic rearrangement. Recently, it has been found that several constitutional translocations, especially those that involve chromosome 22, take place utilizing palindromic sequences on 22q11 and on the partner chromosome. Analysis of translocation junction fragments shows that the breakpoints of such palindrome-mediated translocations are localized at the center of palindromic AT-rich repeats (PATRRs). The presence of PATRRs at the breakpoints, indicates a palindrome-mediated mechanism involved in the generation of these constitutional translocations. Identification of these PATRR-mediated translocations suggests a universal pathway for gross chromosomal rearrangement in the human genome. De novo occurrences of PATRR-mediated translocations can be detected by PCR in normal sperm samples but not somatic cells. Polymorphisms of various PATRRs influence their propensity for adopting a secondary structure, which in turn affects de novo translocation frequency. We propose that the PATRRs form an unstable secondary structure, which leads to double-strand breaks at the center of the PATRR. The double-strand breaks appear to be followed by a non-homologous end-joining repair pathway, ultimately leading to the translocations. This review considers recent findings concerning the mechanism of meiosis-specific, PATRR-mediated translocations. PMID:22402448
Molecular epidemiology of dengue fever cases imported into Romania between 2008 and 2013.
Dinu, Sorin; Pănculescu-Gătej, Ioana R; Florescu, Simin A; Popescu, Corneliu P; Sîrbu, Anca; Oprişan, Gabriela; Bădescu, Daniela; Franco, Leticia; Ceianu, Cornelia S
2015-01-01
Dengue fever is the commonest arthropod-borne infection worldwide. In recent years, rapid growth in global air travel has resulted in a considerable increase in the incidence of imported cases. In Romania it is now the second most frequent cause for hospitalization (after malaria) in patients arriving from tropical regions. Serological and molecular diagnostics were applied to samples obtained between 2008 and 2013 from travelers with suspected dengue. Molecular typing was performed by RT-PCR followed by sequencing of the E-NS1 junction. Twelve of 37 suspected cases were confirmed and three remained probable. The infections were acquired in endemic regions in Asia, Africa and in Europe (Madeira Island). Dengue virus nucleic acid was detected and sequenced in nine cases. Phylogenetic analysis indicated that the viruses were of genotypes I and V of serotype 1, cosmopolitan genotype of serotype 2 and genotypes I and III of serotype 3. Romanian tourists traveling to dengue-endemic countries are at risk of acquiring dengue infection. Appropriate prevention measures prior to travel and upon return should be taken, particularly as the dengue secondary vector Aedes albopictus is now established in Bucharest. Copyright © 2014 Elsevier Ltd. All rights reserved.
Balsamo, Michele; Mondal, Chandrani; Carmona, Guillaume; McClain, Leslie M.; Riquelme, Daisy N.; Tadros, Jenny; Ma, Duan; Vasile, Eliza; Condeelis, John S.; Lauffenburger, Douglas A.; Gertler, Frank B.
2016-01-01
During tumor progression, alternative splicing gives rise to different Mena protein isoforms. We analyzed how Mena11a, an isoform enriched in epithelia and epithelial-like cells, affects Mena-dependent regulation of actin dynamics and cell behavior. While other Mena isoforms promote actin polymerization and drive membrane protrusion, we find that Mena11a decreases actin polymerization and growth factor-stimulated membrane protrusion at lamellipodia. Ectopic Mena11a expression slows mesenchymal-like cell motility, while isoform-specific depletion of endogenous Mena11a in epithelial-like tumor cells perturbs cell:cell junctions and increases membrane protrusion and overall cell motility. Mena11a can dampen membrane protrusion and reduce actin polymerization in the absence of other Mena isoforms, indicating that it is not simply an inactive Mena isoform. We identify a phosphorylation site within 11a that is required for some Mena11a-specific functions. RNA-seq data analysis from patient cohorts demonstrates that the difference between mRNAs encoding constitutive Mena sequences and those containing the 11a exon correlates with metastasis in colorectal cancer, suggesting that 11a exon exclusion contributes to invasive phenotypes and leads to poor clinical outcomes. PMID:27748415
Balsamo, Michele; Mondal, Chandrani; Carmona, Guillaume; McClain, Leslie M; Riquelme, Daisy N; Tadros, Jenny; Ma, Duan; Vasile, Eliza; Condeelis, John S; Lauffenburger, Douglas A; Gertler, Frank B
2016-10-17
During tumor progression, alternative splicing gives rise to different Mena protein isoforms. We analyzed how Mena11a, an isoform enriched in epithelia and epithelial-like cells, affects Mena-dependent regulation of actin dynamics and cell behavior. While other Mena isoforms promote actin polymerization and drive membrane protrusion, we find that Mena11a decreases actin polymerization and growth factor-stimulated membrane protrusion at lamellipodia. Ectopic Mena11a expression slows mesenchymal-like cell motility, while isoform-specific depletion of endogenous Mena11a in epithelial-like tumor cells perturbs cell:cell junctions and increases membrane protrusion and overall cell motility. Mena11a can dampen membrane protrusion and reduce actin polymerization in the absence of other Mena isoforms, indicating that it is not simply an inactive Mena isoform. We identify a phosphorylation site within 11a that is required for some Mena11a-specific functions. RNA-seq data analysis from patient cohorts demonstrates that the difference between mRNAs encoding constitutive Mena sequences and those containing the 11a exon correlates with metastasis in colorectal cancer, suggesting that 11a exon exclusion contributes to invasive phenotypes and leads to poor clinical outcomes.
Guo, Shaoyin; Hihath, Joshua; Díez-Pérez, Ismael; Tao, Nongjian
2011-11-30
We report on the measurement and statistical study of thousands of current-voltage characteristics and transition voltage spectra (TVS) of single-molecule junctions with different contact geometries that are rapidly acquired using a new break junction method at room temperature. This capability allows one to obtain current-voltage, conductance voltage, and transition voltage histograms, thus adding a new dimension to the previous conductance histogram analysis at a fixed low-bias voltage for single molecules. This method confirms the low-bias conductance values of alkanedithiols and biphenyldithiol reported in literature. However, at high biases the current shows large nonlinearity and asymmetry, and TVS allows for the determination of a critically important parameter, the tunneling barrier height or energy level alignment between the molecule and the electrodes of single-molecule junctions. The energy level alignment is found to depend on the molecule and also on the contact geometry, revealing the role of contact geometry in both the contact resistance and energy level alignment of a molecular junction. Detailed statistical analysis further reveals that, despite the dependence of the energy level alignment on contact geometry, the variation in single-molecule conductance is primarily due to contact resistance rather than variations in the energy level alignment.
Moore, Michael J.; Neubig, Kurt M.; Williams, Norris H.; Whitten, W. Mark; Kim, Joo-Hwan
2015-01-01
Earlier research has revealed that the ndh loci have been pseudogenized, truncated, or deleted from most orchid plastomes sequenced to date, including in all available plastomes of the two most species-rich subfamilies, Orchidoideae and Epidendroideae. This study sought to resolve deeper-level phylogenetic relationships among major orchid groups and to refine the history of gene loss in the ndh loci across orchids. The complete plastomes of seven orchids, Oncidium sphacelatum (Epidendroideae), Masdevallia coccinea (Epidendroideae), Sobralia callosa (Epidendroideae), Sobralia aff. bouchei (Epidendroideae), Elleanthus sodiroi (Epidendroideae), Paphiopedilum armeniacum (Cypripedioideae), and Phragmipedium longifolium (Cypripedioideae) were sequenced and analyzed in conjunction with all other available orchid and monocot plastomes. Most ndh loci were found to be pseudogenized or lost in Oncidium, Paphiopedilum and Phragmipedium, but surprisingly, all ndh loci were found to retain full, intact reading frames in Sobralia, Elleanthus and Masdevallia. Character mapping suggests that the ndh genes were present in the common ancestor of orchids but have experienced independent, significant losses at least eight times across four subfamilies. In addition, ndhF gene loss was correlated with shifts in the position of the junction of the inverted repeat (IR) and small single-copy (SSC) regions. The Orchidaceae have unprecedented levels of homoplasy in ndh gene presence/absence, which may be correlated in part with the unusual life history of orchids. These results also suggest that ndhF plays a role in IR/SSC junction stability. PMID:26558895
Modeling the integration of bacterial rRNA fragments into the human cancer genome.
Sieber, Karsten B; Gajer, Pawel; Dunning Hotopp, Julie C
2016-03-21
Cancer is a disease driven by the accumulation of genomic alterations, including the integration of exogenous DNA into the human somatic genome. We previously identified in silico evidence of DNA fragments from a Pseudomonas-like bacteria integrating into the 5'-UTR of four proto-oncogenes in stomach cancer sequencing data. The functional and biological consequences of these bacterial DNA integrations remain unknown. Modeling of these integrations suggests that the previously identified sequences cover most of the sequence flanking the junction between the bacterial and human DNA. Further examination of these reads reveals that these integrations are rich in guanine nucleotides and the integrated bacterial DNA may have complex transcript secondary structures. The models presented here lay the foundation for future experiments to test if bacterial DNA integrations alter the transcription of the human genes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Cheng-Han; Wu, Chao-Hsin, E-mail: chaohsinwu@ntu.edu.tw; Graduate Institute of Photonics and Optoelectronics, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei 106, Taiwan
The electrical and optical characteristics of tunnel junction light-emitting transistors (TJLETs) with different indium mole fractions (x = 5% and 2.5%) of the In{sub x}Ga{sub 1−x}As base-collector tunnel junctions have been investigated. Two electron tunneling mechanisms (photon-assisted or direct tunneling) provide additional currents to electrical output and resupply holes back to the base region, resulting in the upward slope of I-V curves and enhanced optical output under forward-active operation. The larger direct tunneling probability and stronger Franz-Keldysh absorption for 5% TJLET lead to higher collector current slope and less optical intensity enhancement when base-collector junction is under reverse-biased.
Sysoiev, Dmytro; Huhn, Thomas; Pauly, Fabian
2017-01-01
Diarylethene-derived molecules alter their electronic structure upon transformation between the open and closed forms of the diarylethene core, when exposed to ultraviolet (UV) or visible light. This transformation results in a significant variation of electrical conductance and vibrational properties of corresponding molecular junctions. We report here a combined experimental and theoretical analysis of charge transport through diarylethene-derived single-molecule devices, which are created using the mechanically controlled break-junction technique. Inelastic electron tunneling (IET) spectroscopy measurements performed at 4.2 K are compared with first-principles calculations in the two distinct forms of diarylethenes connected to gold electrodes. The combined approach clearly demonstrates that the IET spectra of single-molecule junctions show specific vibrational features that can be used to identify different isomeric molecular states by transport experiments. PMID:29259875
Cammarata, Marco; Aubin, Carl-Éric; Wang, Xiaoyu; Mac-Thiong, Jean-Marc
2014-04-15
Biomechanical analysis of proximal junctional kyphosis (PJK) through computer simulations and sensitivity analysis. To gain biomechanical knowledge on the risk of PJK and find surgical solutions to reduce the risks. PJK is a pathological kyphotic deformity adjacent to the instrumentation. Clinical studies have documented its risk factors, but still little is known on how it is correlated with various individual instrumentation variables. Biomechanical spine models of 6 patients with adult scoliosis were developed, validated, and then used to perform 576 simulations, varying the proximal dissection procedure, the implant type at the upper instrumented vertebra, the sagittal rod curvature, and the proximal diameter of the proximal transition rods. Four biomechanical indices--the proximal junctional kyphotic angle, thoracic kyphosis, proximal flexion force, and proximal flexion moment--were assessed. The bilateral complete facetectomy, the posterior ligaments resection, and the combination of both increased the proximal junctional kyphotic angle (respectively, by 10%, 28% and 53%) and the proximal flexion force (4%, 12%, and 22%) and moment (16%, 44%, and 83%). Compared with pedicle screws at upper instrumented vertebra, proximal transverse process hooks reduced the 3 biomechanical indices by approximately 26%. The use of proximal transition rods with reduced proximal diameter from 5.5 mm to 4 mm decreased the proximal junctional kyphotic angle (by 6%) and the proximal flexion force (4%) and moment (8%). The increase of the sagittal rod curvature from 10° to 20°, 30°, and 40° increased the proximal junctional kyphotic angle (by 6%, 13%, and 19%) and the proximal flexion force (3%, 7%, and 10%) and moment (9%, 18%, and 27%). Preserving more posterior proximal intervertebral elements, the use of transition rods and transverse process hooks at upper instrumented vertebra, and reducing the global sagittal rod curvature each decreased the 4 biomechanical indices that may be involved in PJK. N/A.
The physical analysis on electrical junction of junctionless FET
NASA Astrophysics Data System (ADS)
Chen, Lun-Chun; Yeh, Mu-Shih; Lin, Yu-Ru; Lin, Ko-Wei; Wu, Min-Hsin; Thirunavukkarasu, Vasanthan; Wu, Yung-Chun
2017-02-01
We propose the concept of the electrical junction in a junctionless (JL) field-effect-transistor (FET) to illustrate the transfer characteristics of the JL FET. In this work, nanowire (NW) junctionless poly-Si thin-film transistors are used to demonstrate this conception of the electrical junction. Though the dopant and the dosage of the source, of the drain, and of the channel are exactly the same in the JL FET, the transfer characteristics of the JL FET is similar to these of the conventional inversion-mode FET rather than these of a resistor, which is because of the electrical junction at the boundary of the gate and the drain in the JL FET. The electrical junction helps us to understand the JL FET, and also to explain the superior transfer characteristic of the JL FET with the gated raised S/D (Gout structure) which reveals low drain-induced-barrier-lowering (DIBL) and low breakdown voltage of ion impact ionization.
NASA Astrophysics Data System (ADS)
Shu, Guoyang; Dai, Bing; Ralchenko, V. G.; Khomich, A. A.; Ashkinazi, E. E.; Bolshakov, A. P.; Bokova-Sirosh, S. N.; Liu, Kang; Zhao, Jiwen; Han, Jiecai; Zhu, Jiaqi
2017-04-01
We studied defects and stress distributions in mosaic epitaxial diamond film using a confocal Raman spectroscopy, with a special attention to the junction area between the crystals. The mosaics was grown by microwave plasma CVD on closely arranged (1 0 0)-oriented HPHT type Ib substrates. The width of stress affected and defect enriched region around the junction show a tendency of extending with the film thickness, from ≈40 μm on the film-substrate interface to ≈250 μm in the layer 500 μm above the substrate, as found from the mosaics analysis in cross-section. The stress field around the junction demonstrates a complex pattern, with mixed domains of tensile and compressive stress, with maximum value of σ ≈ 0.6 GPa. A similar non-uniform pattern was observed for defect distribution as well. No sign of amorphous sp2 carbon in the junction zone was revealed.
Jang, Yeonsik; Kwon, Sung-Joo; Shin, Jaeho; Jeong, Hyunhak; Hwang, Wang-Taek; Kim, Junwoo; Koo, Jeongmin; Ko, Taeg Yeoung; Ryu, Sunmin; Wang, Gunuk; Lee, Tae-Woo; Lee, Takhee
2017-12-06
In this study, we fabricated and characterized vertical molecular junctions consisting of self-assembled monolayers of benzenedithiol (BDT) with a p-doped multilayer graphene electrode. The p-type doping of a graphene film was performed by treating pristine graphene (work function of ∼4.40 eV) with trifluoromethanesulfonic (TFMS) acid, producing a significantly increased work function (∼5.23 eV). The p-doped graphene-electrode molecular junctions statistically showed an order of magnitude higher current density and a lower charge injection barrier height than those of the pristine graphene-electrode molecular junctions, as a result of interface engineering. This enhancement is due to the increased work function of the TFMS-treated p-doped graphene electrode in the highest occupied molecular orbital-mediated tunneling molecular junctions. The validity of these results was proven by a theoretical analysis based on a coherent transport model that considers asymmetric couplings at the electrode-molecule interfaces.
Granato, Enzo
2008-07-11
Phase coherence and vortex order in a Josephson-junction array at irrational frustration are studied by extensive Monte Carlo simulations using the parallel-tempering method. A scaling analysis of the correlation length of phase variables in the full equilibrated system shows that the critical temperature vanishes with a power-law divergent correlation length and critical exponent nuph, in agreement with recent results from resistivity scaling analysis. A similar scaling analysis for vortex variables reveals a different critical exponent nuv, suggesting that there are two distinct correlation lengths associated with a decoupled zero-temperature phase transition.
Genetic diversity in the feline leukemia virus gag gene.
Kawamura, Maki; Watanabe, Shinya; Odahara, Yuka; Nakagawa, So; Endo, Yasuyuki; Tsujimoto, Hajime; Nishigaki, Kazuo
2015-06-02
Feline leukemia virus (FeLV) belongs to the Gammaretrovirus genus and is horizontally transmitted among cats. FeLV is known to undergo recombination with endogenous retroviruses already present in the host during FeLV-subgroup A infection. Such recombinant FeLVs, designated FeLV-subgroup B or FeLV-subgroup D, can be generated by transduced endogenous retroviral env sequences encoding the viral envelope. These recombinant viruses have biologically distinct properties and may mediate different disease outcomes. The generation of such recombinant viruses resulted in structural diversity of the FeLV particle and genetic diversity of the virus itself. FeLV env diversity through mutation and recombination has been studied, while gag diversity and its possible effects are less well understood. In this study, we investigated recombination events in the gag genes of FeLVs isolated from naturally infected cats and reference isolates. Recombination and phylogenetic analyses indicated that the gag genes often contain endogenous FeLV sequences and were occasionally replaced by entire endogenous FeLV gag genes. Phylogenetic reconstructions of FeLV gag sequences allowed for classification into three distinct clusters, similar to those previously established for the env gene. Analysis of the recombination junctions in FeLV gag indicated that these variants have similar recombination patterns within the same genotypes, indicating that the recombinant viruses were horizontally transmitted among cats. It remains to be investigated whether the recombinant sequences affect the molecular mechanism of FeLV transmission. These findings extend our understanding of gammaretrovirus evolutionary patterns in the field. Copyright © 2015 Elsevier B.V. All rights reserved.
Transport Properties of ZnSe- ITO Hetero Junction
NASA Astrophysics Data System (ADS)
Ichibakase, Tsuyoshi
In this report, ITO(Indium Tin Oxide) was used on the glass substrates as the transparent electrode, and ZnSe layer was prepared by the vacuum deposition on this ITO. Then, the electrical characteristics of this sample were investigated by mans of the electric current transport analysis. The sample that ZnSe was prepared as 3.4 μm in case of ITO-ZnSe sample, has high density level at the junction surface. The ITO-ZnSe junction has two type of diffusion current. However, the ITO-ZnSe sample that ZnSe layer was prepared as 0.1 μm can be assumed as the ohmic contact, and ITO-ZnSe(0.1μm) -CdTe sample shows the avalanche breakdown, and it is considered that the avalanche breakdown occurs in CdTe layer. It is difficult to occur the avalanche breakdown, if ZnSe-CdTe junction has high-density level and CdTe layer has high-density defect. Hence, the ZnSe-CdTe sample that CdTe layer was prepared on ITO-ZnSe(0.1μm) substrate has not high-density level at the junction surface, and the CdTe layer with little lattice imperfection can be prepared. It found that ITO-ZnSe(0.1μm) substrate is available for the II-VI compounds semiconductor device through above analysis result.
Chromosome catastrophes involve replication mechanisms generating complex genomic rearrangements
Liu, Pengfei; Erez, Ayelet; Sreenath Nagamani, Sandesh C.; Dhar, Shweta U.; Kołodziejska, Katarzyna E.; Dharmadhikari, Avinash V.; Cooper, M. Lance; Wiszniewska, Joanna; Zhang, Feng; Withers, Marjorie A.; Bacino, Carlos A.; Campos-Acevedo, Luis Daniel; Delgado, Mauricio R.; Freedenberg, Debra; Garnica, Adolfo; Grebe, Theresa A.; Hernández-Almaguer, Dolores; Immken, LaDonna; Lalani, Seema R.; McLean, Scott D.; Northrup, Hope; Scaglia, Fernando; Strathearn, Lane; Trapane, Pamela; Kang, Sung-Hae L.; Patel, Ankita; Cheung, Sau Wai; Hastings, P. J.; Stankiewicz, Paweł; Lupski, James R.; Bi, Weimin
2011-01-01
SUMMARY Complex genomic rearrangements (CGR) consisting of two or more breakpoint junctions have been observed in genomic disorders. Recently, a chromosome catastrophe phenomenon termed chromothripsis, in which numerous genomic rearrangements are apparently acquired in one single catastrophic event, was described in multiple cancers. Here we show that constitutionally acquired CGRs share similarities with cancer chromothripsis. In the 17 CGR cases investigated we observed localization and multiple copy number changes including deletions, duplications and/or triplications, as well as extensive translocations and inversions. Genomic rearrangements involved varied in size and complexities; in one case, array comparative genomic hybridization revealed 18 copy number changes. Breakpoint sequencing identified characteristic features, including small templated insertions at breakpoints and microhomology at breakpoint junctions, which have been attributed to replicative processes. The resemblance between CGR and chromothripsis suggests similar mechanistic underpinnings. Such chromosome catastrophic events appear to reflect basic DNA metabolism operative throughout an organism’s life cycle. PMID:21925314
NASA Technical Reports Server (NTRS)
1981-01-01
Liquid diffusion masks and liquid applied dopants to replace the CVD Silox masking and gaseous diffusion operations specified for forming junctions in the Westinghouse baseline process sequence for producing solar cells from dendritic web silicon were investigated. The baseline diffusion masking and drive processes were compared with those involving direct liquid applications to the dendritic web silicon strips. Attempts were made to control the number of variables by subjecting dendritic web strips cut from a single web crystal to both types of operations. Data generated reinforced earlier conclusions that efficiency levels at least as high as those achieved with the baseline back junction formation process can be achieved using liquid diffusion masks and liquid dopants. The deliveries of dendritic web sheet material and solar cells specified by the current contract were made as scheduled.
Creating complex molecular topologies by configuring DNA four-way junctions
NASA Astrophysics Data System (ADS)
Liu, Di; Chen, Gang; Akhter, Usman; Cronin, Timothy M.; Weizmann, Yossi
2016-10-01
The realization of complex topologies at the molecular level represents a grand challenge in chemistry. This necessitates the manipulation of molecular interactions with high precision. Here we show that single-stranded DNA (ssDNA) knots and links can be created by utilizing the inherent topological properties that pertain to the DNA four-way junction, at which the two helical strands form a node and can be configured conveniently and connected for complex topological construction. Using this strategy, we produced series of ssDNA topoisomers with the same sequences. By finely designing the curvature and torsion, double-stranded DNA knots were accessed by hybridizing and ligating the complementary strands with the knotted ssDNA templates. Furthermore, we demonstrate the use of a constructed ssDNA knot both to probe the topological conversion catalysed by DNA topoisomerase and to study the DNA replication under topological constraint.
Lattice-free prediction of three-dimensional structure of programmed DNA assemblies
Pan, Keyao; Kim, Do-Nyun; Zhang, Fei; Adendorff, Matthew R.; Yan, Hao; Bathe, Mark
2014-01-01
DNA can be programmed to self-assemble into high molecular weight 3D assemblies with precise nanometer-scale structural features. Although numerous sequence design strategies exist to realize these assemblies in solution, there is currently no computational framework to predict their 3D structures on the basis of programmed underlying multi-way junction topologies constrained by DNA duplexes. Here, we introduce such an approach and apply it to assemblies designed using the canonical immobile four-way junction. The procedure is used to predict the 3D structure of high molecular weight planar and spherical ring-like origami objects, a tile-based sheet-like ribbon, and a 3D crystalline tensegrity motif, in quantitative agreement with experiments. Our framework provides a new approach to predict programmed nucleic acid 3D structure on the basis of prescribed secondary structure motifs, with possible application to the design of such assemblies for use in biomolecular and materials science. PMID:25470497
Raleigh, David R; Marchiando, Amanda M; Zhang, Yong; Shen, Le; Sasaki, Hiroyuki; Wang, Yingmin; Long, Manyuan; Turner, Jerrold R
2010-04-01
In vitro studies have demonstrated that occludin and tricellulin are important for tight junction barrier function, but in vivo data suggest that loss of these proteins can be overcome. The presence of a heretofore unknown, yet related, protein could explain these observations. Here, we report marvelD3, a novel tight junction protein that, like occludin and tricellulin, contains a conserved four-transmembrane MARVEL (MAL and related proteins for vesicle trafficking and membrane link) domain. Phylogenetic tree reconstruction; analysis of RNA and protein tissue distribution; immunofluorescent and electron microscopic examination of subcellular localization; characterization of intracellular trafficking, protein interactions, dynamic behavior, and siRNA knockdown effects; and description of remodeling after in vivo immune activation show that marvelD3, occludin, and tricellulin have distinct but overlapping functions at the tight junction. Although marvelD3 is able to partially compensate for occludin or tricellulin loss, it cannot fully restore function. We conclude that marvelD3, occludin, and tricellulin define the tight junction-associated MARVEL protein family. The data further suggest that these proteins are best considered as a group with both redundant and unique contributions to epithelial function and tight junction regulation.
Coulomb blockade in a single tunnel junction directly connected to a multiwalled carbon nanotube
NASA Astrophysics Data System (ADS)
Haruyama, Junji; Takesue, Izumi; Sato, Yuki
2000-10-01
We report on Coulomb blockade in a single tunnel junction directly connected to a multiwalled carbon nanotube (MWNT) by utilizing a nanoporous alumina film. The MWNT exhibits a weak localization effect with strong spin flip scattering. Experimental results and analysis suggest that a high-impedance external environment caused by the weak localization in the MWNT can yield Coulomb blockade, in accordance with phase correlation theory in a single junction system. It is also revealed that the Coulomb blockade is very sensitive to phase modulation in the MWNT, which also acts as a high-impedance transmission line.
Anomalous tensoelectric effects in gallium arsenide tunnel diodes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Alekseeva, Z.M.; Vyatkin, A.P.; Krivorotov, N.P.
Anomalous tensoelectric phenomena induced in a tunnel p-n junction by a concentrated load and by hydrostatic compression were studied. The anomalous tensoelectric effects are caused by the action of concentrators of mechanical stresses in the vicinity of the p-n junction, giving rise to local microplastic strain. Under the conditions of hydrostatic compression prolate inclusions approx.100-200 A long play the role of concentrators. Analysis of irreversible changes in the current-voltage characteristics of tunnel p-n junctions made it possible to separate the energy levels of the defects produced with plastic strain of gallium arsenide.
Chu, Miensheng; Novak, Stefanie Mares; Cover, Cathleen; Wang, Anne A; Chinyere, Ikeotunye Royal; Juneman, Elizabeth B; Zarnescu, Daniela C; Wong, Pak Kin; Gregorio, Carol C
2018-02-06
Gap junction remodeling is well established as a consistent feature of human heart disease involving spontaneous ventricular arrhythmia. The mechanisms responsible for gap junction remodeling that include alterations in the distribution of, and protein expression within, gap junctions are still debated. Studies reveal that multiple transcriptional and posttranscriptional regulatory pathways are triggered in response to cardiac disease, such as those involving RNA-binding proteins. The expression levels of FXR1 (fragile X mental retardation autosomal homolog 1), an RNA-binding protein, are critical to maintain proper cardiac muscle function; however, the connection between FXR1 and disease is not clear. To identify the mechanisms regulating gap junction remodeling in cardiac disease, we sought to identify the functional properties of FXR1 expression, direct targets of FXR1 in human left ventricle dilated cardiomyopathy (DCM) biopsy samples and mouse models of DCM through BioID proximity assay and RNA immunoprecipitation, how FXR1 regulates its targets through RNA stability and luciferase assays, and functional consequences of altering the levels of this important RNA-binding protein through the analysis of cardiac-specific FXR1 knockout mice and mice injected with 3xMyc-FXR1 adeno-associated virus. FXR1 expression is significantly increased in tissue samples from human and mouse models of DCM via Western blot analysis. FXR1 associates with intercalated discs, and integral gap junction proteins Cx43 (connexin 43), Cx45 (connexin 45), and ZO-1 (zonula occludens-1) were identified as novel mRNA targets of FXR1 by using a BioID proximity assay and RNA immunoprecipitation. Our findings show that FXR1 is a multifunctional protein involved in translational regulation and stabilization of its mRNA targets in heart muscle. In addition, introduction of 3xMyc-FXR1 via adeno-associated virus into mice leads to the redistribution of gap junctions and promotes ventricular tachycardia, showing the functional significance of FXR1 upregulation observed in DCM. In DCM, increased FXR1 expression appears to play an important role in disease progression by regulating gap junction remodeling. Together this study provides a novel function of FXR1, namely, that it directly regulates major gap junction components, contributing to proper cell-cell communication in the heart. © 2017 American Heart Association, Inc.
Transcriptomic profile of leg muscle during early growth in chicken
Zhang, Genxi; Li, Tingting; Ling, Jiaojiao; Zhang, Xiangqian; Wang, Jinyu
2017-01-01
The early growth pattern, especially the age of peak growth, of broilers affects the time to market and slaughter weight, which in turn affect the profitability of the poultry industry. However, the underlying mechanisms regulating chicken growth and development have rarely been studied. This study aimed to identify candidate genes involved in chicken growth and investigated the potential regulatory mechanisms of early growth in chicken. RNA sequencing was applied to compare the transcriptomes of chicken muscle tissues at three developmental stages during early growth. In total, 978 differentially expressed genes (DEGs) (fold change ≥ 2; false discovery rate < 0.05) were detected by pairwise comparison. Functional analysis showed that the DEGs are mainly involved in the processes of cell growth, muscle development, and cellular activities (such as junction, migration, assembly, differentiation, and proliferation). Many of the DEGs are well known to be related to chicken growth, such as MYOD1, GH, IGF2BP2, IGFBP3, SMYD1, CEBPB, FGF2, and IGFBP5. KEGG pathway analysis identified that the DEGs were significantly enriched in five pathways (P < 0.1) related to growth and development: extracellular matrix–receptor interaction, focal adhesion, tight junction, insulin signaling pathway, and regulation of the actin cytoskeleton. A total of 42 DEGs assigned to these pathways are potential candidate genes inducing the difference in growth among the three developmental stages, such as MYH10, FGF2, FGF16, FN1, CFL2, MAPK9, IRS1, PHKA1, PHKB, and PHKG1. Thus, our study identified a series of genes and several pathways that may participate in the regulation of early growth in chicken. These results should serve as an important resource revealing the molecular basis of chicken growth and development. PMID:28291821
Nakagawa, So; Gong, Xiang-Qun; Maeda, Shoji; Dong, Yuhua; Misumi, Yuko; Tsukihara, Tomitake; Bai, Donglin
2011-06-03
The gap junction channel is formed by proper docking of two hemichannels. Depending on the connexin(s) in the hemichannels, homotypic and heterotypic gap junction channels can be formed. Previous studies suggest that the extracellular loop 2 (E2) is an important molecular domain for heterotypic compatibility. Based on the crystal structure of the Cx26 gap junction channel and homology models of heterotypic channels, we analyzed docking selectivity for several hemichannel pairs and found that the hydrogen bonds between E2 domains are conserved in a group of heterotypically compatible hemichannels, including Cx26 and Cx32 hemichannels. According to our model analysis, Cx32N175Y mutant destroys three hydrogen bonds in the E2-E2 interactions due to steric hindrance at the heterotypic docking interface, which makes it unlikely to dock with the Cx26 hemichannel properly. Our experimental data showed that Cx26-red fluorescent protein (RFP) and Cx32-GFP were able to traffic to cell-cell interfaces forming gap junction plaques and functional channels in transfected HeLa/N2A cells. However, Cx32N175Y-GFP exhibited mostly intracellular distribution and was occasionally observed in cell-cell junctions. Double patch clamp analysis demonstrated that Cx32N175Y did not form functional homotypic channels, and dye uptake assay indicated that Cx32N175Y could form hemichannels on the cell surface similar to wild-type Cx32. When Cx32N175Y-GFP- and Cx26-RFP-transfected cells were co-cultured, no colocalization was found at the cell-cell junctions between Cx32N175Y-GFP- and Cx26-RFP-expressing cells; also, no functional Cx32N175Y-GFP/Cx26-RFP heterotypic channels were identified. Both our modeling and experimental data suggest that Asn(175) of Cx32 is a critical residue for heterotypic docking and functional gap junction channel formation between the Cx32 and Cx26 hemichannels.
Behrmann, J.H.; Lewis, S.D.; Cande, S.C.
1994-01-01
An active oceanic spreading ridge is being subducted beneath the South American continent at the Chile Triple Junction. This process has played a major part in the evolution of most of the continental margins that border the Pacific Ocean basin. A combination of high resolution swath bathymetric maps, seismic reflection profiles and drillhole and core data from five sites drilled during Ocean Drilling Program (ODP) Leg 141 provide important data that define the tectonic, structural and stratigraphic effects of this modern example of spreading ridge subduction. A change from subduction accretion to subduction erosion occurs along-strike of the South American forearc. This change is prominently expressed by normal faulting, forearc subsidence, oversteepening of topographic slopes and intensive sedimentary mass wasting, overprinted on older signatures of sediment accretion, overthrusting and uplift processes in the forearc. Data from drill sites north of the triple junction (Sites 859-861) show that after an important phase of forearc building in the early to late Pliocene, subduction accretion had ceased in the late Pliocene. Since that time sediment on the downgoing oceanic Nazca plate has been subducted. Site 863 was drilled into the forearc in the immediate vicinity of the triple junction above the subducted spreading ridge axis. Here, thick and intensely folded and faulted trench slope sediments of Pleistocene age are currently involved in the frontal deformation of the forearc. Early faults with thrust and reverse kinematics are overprinted by later normal faults. The Chile Triple Junction is also the site of apparent ophiolite emplacement into the South American forearc. Drilling at Site 862 on the Taitao Ridge revealed an offshore volcanic sequence of Plio-Pleistocene age associated with the Taitao Fracture Zone, adjacent to exposures of the Pliocene-aged Taitao ophiolite onshore. Despite the large-scale loss of material from the forearc at the triple junction, ophiolite emplacement produces a large topographic promontory in the forearc immediately after ridge subduction, and represents the first stage of forearc rebuilding. ?? 1994 Springer-Verlag.
Cheng, Catherine; Nowak, Roberta B.; Gao, Junyuan; Sun, Xiurong; Biswas, Sondip K.; Lo, Woo-Kuen; Mathias, Richard T.
2015-01-01
The eye lens consists of layers of tightly packed fiber cells, forming a transparent and avascular organ that is important for focusing light onto the retina. A microcirculation system, facilitated by a network of gap junction channels composed of connexins 46 and 50 (Cx46 and Cx50), is hypothesized to maintain and nourish lens fiber cells. We measured lens impedance in mice lacking tropomodulin 1 (Tmod1, an actin pointed-end capping protein), CP49 (a lens-specific intermediate filament protein), or both Tmod1 and CP49. We were surprised to find that simultaneous loss of Tmod1 and CP49, which disrupts cytoskeletal networks in lens fiber cells, results in increased gap junction coupling resistance, hydrostatic pressure, and sodium concentration. Protein levels of Cx46 and Cx50 in Tmod1−/−;CP49−/− double-knockout (DKO) lenses were unchanged, and electron microscopy revealed normal gap junctions. However, immunostaining and quantitative analysis of three-dimensional confocal images showed that Cx46 gap junction plaques are smaller and more dispersed in DKO differentiating fiber cells. The localization and sizes of Cx50 gap junction plaques in DKO fibers were unaffected, suggesting that Cx46 and Cx50 form homomeric channels. We also demonstrate that gap junction plaques rest in lacunae of the membrane-associated actin-spectrin network, suggesting that disruption of the actin-spectrin network in DKO fibers may interfere with gap junction plaque accretion into micrometer-sized domains or alter the stability of large plaques. This is the first work to reveal that normal gap junction plaque localization and size are associated with normal lens coupling conductance. PMID:25740157
Cheng, Catherine; Nowak, Roberta B; Gao, Junyuan; Sun, Xiurong; Biswas, Sondip K; Lo, Woo-Kuen; Mathias, Richard T; Fowler, Velia M
2015-05-15
The eye lens consists of layers of tightly packed fiber cells, forming a transparent and avascular organ that is important for focusing light onto the retina. A microcirculation system, facilitated by a network of gap junction channels composed of connexins 46 and 50 (Cx46 and Cx50), is hypothesized to maintain and nourish lens fiber cells. We measured lens impedance in mice lacking tropomodulin 1 (Tmod1, an actin pointed-end capping protein), CP49 (a lens-specific intermediate filament protein), or both Tmod1 and CP49. We were surprised to find that simultaneous loss of Tmod1 and CP49, which disrupts cytoskeletal networks in lens fiber cells, results in increased gap junction coupling resistance, hydrostatic pressure, and sodium concentration. Protein levels of Cx46 and Cx50 in Tmod1(-/-);CP49(-/-) double-knockout (DKO) lenses were unchanged, and electron microscopy revealed normal gap junctions. However, immunostaining and quantitative analysis of three-dimensional confocal images showed that Cx46 gap junction plaques are smaller and more dispersed in DKO differentiating fiber cells. The localization and sizes of Cx50 gap junction plaques in DKO fibers were unaffected, suggesting that Cx46 and Cx50 form homomeric channels. We also demonstrate that gap junction plaques rest in lacunae of the membrane-associated actin-spectrin network, suggesting that disruption of the actin-spectrin network in DKO fibers may interfere with gap junction plaque accretion into micrometer-sized domains or alter the stability of large plaques. This is the first work to reveal that normal gap junction plaque localization and size are associated with normal lens coupling conductance. Copyright © 2015 the American Physiological Society.
Identification and Characterization of Novel FMRP-Associated miRNAs
2013-10-01
Dependent Synaptic Structure at the Drosophila melanogaster Neuromuscular Junction. Plos One 8: e68385. 11. Adams CM, Anderson MG, Motto DG, Price MP...extension towards the end of the funding period in order to complete the all proposed experiments. Aim 1. Purification and deep sequencing of FMRP...First, when expression of transgenic PrA-tagged FMRP was driven in the adult Drosophila brain, we did not observe an expected shift in size when
Mixing at double-Tee junctions with unequal pipe sizes in ...
Pipe flow mixing with various solute concentrations and flow rates at pipe junctions is investigated. The degree of mixing affects the spread of contaminants in a water distribution system. Many studies have been conducted on the mixing at the cross junctions. Yet a few have focused on double-Tee junctions of unequal pipe sizes. To investigate the solute mixing at double-Tee junctions with unequal pipe sizes, a series of experiments were conducted in a turbulent regime (Re=12500–50000) with different Reynolds number ratios and connecting pipe lengths. It is shown that dimensionless outlet concentrations depended on mixing mechanism at the impinging interface of junctions. Junction with a larger pipe size ratio is associated with more complete mixing. The inlet Reynolds number ratio affects mixing more strongly than the outlet Reynolds number ratio. Furthermore, the dimensionless connecting pipe length in a double-Tee played an important and complicated role in the flow mixing. Based on these results, two-dimensional isopleth maps were developed for the calculation of normalized north outlet concentration. This journal article is to communicate the research results on pipe juncture mixing, a widespread and important phenomena in distribution system water quality analysis. The research outcome improves EPANET modeling capability for safe water supplies. In addition, the research is one of the outputs from the EPA-MOST bilateral cooperative research Project #1
Belousov, Andrei B; Wang, Yongfu; Song, Ji-Hoon; Denisova, Janna V; Berman, Nancy E; Fontes, Joseph D
2012-08-22
In the mammalian CNS, excessive release of glutamate and overactivation of glutamate receptors are responsible for the secondary (delayed) neuronal death following neuronal injury, including ischemia, traumatic brain injury (TBI) and epilepsy. Recent studies in mice showed a critical role for neuronal gap junctions in NMDA receptor-mediated excitotoxicity and ischemia-mediated neuronal death. Here, using controlled cortical impact (CCI) in adult mice, as a model of TBI, and Fluoro-Jade B staining for analysis of neuronal death, we set to determine whether neuronal gap junctions play a role in the CCI-mediated secondary neuronal death. We report that 24h post-CCI, substantial neuronal death is detected in a number of brain regions outside the injury core, including the striatum. The striatal neuronal death is reduced both in wild-type mice by systemic administration of mefloquine (a relatively selective blocker of neuronal gap junctions) and in knockout mice lacking connexin 36 (neuronal gap junction protein). It is also reduced by inactivation of group II metabotropic glutamate receptors (with LY341495) which, as reported previously, control the rapid increase in neuronal gap junction coupling following different types of neuronal injury. The results suggest that neuronal gap junctions play a critical role in the CCI-induced secondary neuronal death. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Garrigues, Alvar R.; Yuan, Li; Wang, Lejia; Mucciolo, Eduardo R.; Thompon, Damien; del Barco, Enrique; Nijhuis, Christian A.
2016-01-01
We present a theoretical analysis aimed at understanding electrical conduction in molecular tunnel junctions. We focus on discussing the validity of coherent versus incoherent theoretical formulations for single-level tunneling to explain experimental results obtained under a wide range of experimental conditions, including measurements in individual molecules connecting the leads of electromigrated single-electron transistors and junctions of self-assembled monolayers (SAM) of molecules sandwiched between two macroscopic contacts. We show that the restriction of transport through a single level in solid state junctions (no solvent) makes coherent and incoherent tunneling formalisms indistinguishable when only one level participates in transport. Similar to Marcus relaxation processes in wet electrochemistry, the thermal broadening of the Fermi distribution describing the electronic occupation energies in the electrodes accounts for the exponential dependence of the tunneling current on temperature. We demonstrate that a single-level tunnel model satisfactorily explains experimental results obtained in three different molecular junctions (both single-molecule and SAM-based) formed by ferrocene-based molecules. Among other things, we use the model to map the electrostatic potential profile in EGaIn-based SAM junctions in which the ferrocene unit is placed at different positions within the molecule, and we find that electrical screening gives rise to a strongly non-linear profile across the junction. PMID:27216489
Konishi, Tatsuya; Kiguchi, Manabu; Takase, Mai; Nagasawa, Fumika; Nabika, Hideki; Ikeda, Katsuyoshi; Uosaki, Kohei; Ueno, Kosei; Misawa, Hiroaki; Murakoshi, Kei
2013-01-23
The in situ observation of geometrical and electronic structural dynamics of a single molecule junction is critically important in order to further progress in molecular electronics. Observations of single molecular junctions are difficult, however, because of sensitivity limits. Here, we report surface-enhanced Raman scattering (SERS) of a single 4,4'-bipyridine molecule under conditions of in situ current flow in a nanogap, by using nano-fabricated, mechanically controllable break junction (MCBJ) electrodes. When adsorbed at room temperature on metal nanoelectrodes in solution to form a single molecule junction, statistical analysis showed that nontotally symmetric b(1) and b(2) modes of 4,4'-bipyridine were strongly enhanced relative to observations of the same modes in solid or aqueous solutions. Significant changes in SERS intensity, energy (wavenumber), and selectivity of Raman vibrational bands that are coincident with current fluctuations provide information on distinct states of electronic and geometrical structure of the single molecule junction, even under large thermal fluctuations occurring at room temperature. We observed the dynamics of 4,4'-bipyridine motion between vertical and tilting configurations in the Au nanogap via b(1) and b(2) mode switching. A slight increase in the tilting angle of the molecule was also observed by noting the increase in the energies of Raman modes and the decrease in conductance of the molecular junction.
Templated sequence insertion polymorphisms in the human genome
NASA Astrophysics Data System (ADS)
Onozawa, Masahiro; Aplan, Peter
2016-11-01
Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.
Analysis of Spatio-Temporal Traffic Patterns Based on Pedestrian Trajectories
NASA Astrophysics Data System (ADS)
Busch, S.; Schindler, T.; Klinger, T.; Brenner, C.
2016-06-01
For driver assistance and autonomous driving systems, it is essential to predict the behaviour of other traffic participants. Usually, standard filter approaches are used to this end, however, in many cases, these are not sufficient. For example, pedestrians are able to change their speed or direction instantly. Also, there may be not enough observation data to determine the state of an object reliably, e.g. in case of occlusions. In those cases, it is very useful if a prior model exists, which suggests certain outcomes. For example, it is useful to know that pedestrians are usually crossing the road at a certain location and at certain times. This information can then be stored in a map which then can be used as a prior in scene analysis, or in practical terms to reduce the speed of a vehicle in advance in order to minimize critical situations. In this paper, we present an approach to derive such a spatio-temporal map automatically from the observed behaviour of traffic participants in everyday traffic situations. In our experiments, we use one stationary camera to observe a complex junction, where cars, public transportation and pedestrians interact. We concentrate on the pedestrians trajectories to map traffic patterns. In the first step, we extract trajectory segments from the video data. These segments are then clustered in order to derive a spatial model of the scene, in terms of a spatially embedded graph. In the second step, we analyse the temporal patterns of pedestrian movement on this graph. We are able to derive traffic light sequences as well as the timetables of nearby public transportation. To evaluate our approach, we used a 4 hour video sequence. We show that we are able to derive traffic light sequences as well as time tables of nearby public transportation.
Yong, Rita Y Y; Gan, Linda S H; Chang, Yuet Meng; Yap, Eric P H
2007-11-01
Amelogenin paralogs on Chromosome X (AMELX) and Y (AMELY) are commonly used sexing markers. Interstitial deletion of Yp involving the AMELY locus has previously been reported. The combined frequency of the AMELY null allele in Singapore and Malaysia populations is 2.7%, 0.6% in Indian and Malay ethnic groups respectively. It is absent among 541 Chinese screened. The null allele in this study belongs to 3 Y haplogroups; J2e1 (85.7%), F* (9.5%) and D* (4.8%). Low and high-resolution STS mapping, followed by sequence analysis of breakpoint junction confirmed a large deletion of 3 to 3.7-Mb located at the Yp11.2 region. Both breakpoints were located in TSPY repeat arrays, suggesting a non-allelic homologous recombination (NAHR) mechanism of deletion. All regional null samples shared identical breakpoint sequences according to their haplogroup affiliation, providing molecular evidence of a common ancestry origin for each haplogroup, and at least 3 independent deletion events recurred in history. The estimated ages based on Y-SNP and STR analysis were approximately 13.5 +/- 3.1 kyears and approximately 0.9 +/- 0.9 kyears for the J2e1 and F* mutations, respectively. A novel polymorphism G > A at Y-GATA-H4 locus in complete linkage disequilibrium with J2e1 null mutations is a more recent event. This work re-emphasizes the need to include other sexing markers for gender determination in certain regional populations. The frequency difference among global populations suggests it constitutes another structural variation locus of human chromosome Y. The breakpoint sequences provide further information to a better understanding of the NAHR mechanism and DNA rearrangements due to higher order genomic architecture.
Park, Doori; Park, Su-Hyun; Ban, Yong Wook; Kim, Youn Shic; Park, Kyoung-Cheul; Kim, Nam-Soo; Kim, Ju-Kon; Choi, Ik-Young
2017-08-15
Genetically modified crops (GM crops) have been developed to improve the agricultural traits of modern crop cultivars. Safety assessments of GM crops are of paramount importance in research at developmental stages and before releasing transgenic plants into the marketplace. Sequencing technology is developing rapidly, with higher output and labor efficiencies, and will eventually replace existing methods for the molecular characterization of genetically modified organisms. To detect the transgenic insertion locations in the three GM rice gnomes, Illumina sequencing reads are mapped and classified to the rice genome and plasmid sequence. The both mapped reads are classified to characterize the junction site between plant and transgene sequence by sequence alignment. Herein, we present a next generation sequencing (NGS)-based molecular characterization method, using transgenic rice plants SNU-Bt9-5, SNU-Bt9-30, and SNU-Bt9-109. Specifically, using bioinformatics tools, we detected the precise insertion locations and copy numbers of transfer DNA, genetic rearrangements, and the absence of backbone sequences, which were equivalent to results obtained from Southern blot analyses. NGS methods have been suggested as an effective means of characterizing and detecting transgenic insertion locations in genomes. Our results demonstrate the use of a combination of NGS technology and bioinformatics approaches that offers cost- and time-effective methods for assessing the safety of transgenic plants.
Spinelli, Roberta; Pirola, Alessandra; Redaelli, Sara; Sharma, Nitesh; Raman, Hima; Valletta, Simona; Magistroni, Vera; Piazza, Rocco; Gambacorti-Passerini, Carlo
2013-01-01
Point mutations in intronic regions near mRNA splice junctions can affect the splicing process. To identify novel splicing variants from exome sequencing data, we developed a bioinformatics splice-site prediction procedure to analyze next-generation sequencing (NGS) data (SpliceFinder). SpliceFinder integrates two functional annotation tools for NGS, ANNOVAR and MutationTaster and two canonical splice site prediction programs for single mutation analysis, SSPNN and NetGene2. By SpliceFinder, we identified somatic mutations affecting RNA splicing in a colon cancer sample, in eight atypical chronic myeloid leukemia (aCML), and eight CML patients. A novel homozygous splicing mutation was found in APC (NM_000038.4:c.1312+5G>A) and six heterozygous in GNAQ (NM_002072.2:c.735+1C>T), ABCC3 (NM_003786.3:c.1783-1G>A), KLHDC1 (NM_172193.1:c.568-2A>G), HOOK1 (NM_015888.4:c.1662-1G>A), SMAD9 (NM_001127217.2:c.1004-1C>T), and DNAH9 (NM_001372.3:c.10242+5G>A). Integrating whole-exome and RNA sequencing in aCML and CML, we assessed the phenotypic effect of mutations on mRNA splicing for GNAQ, ABCC3, HOOK1. In ABCC3 and HOOK1, RNA-Seq showed the presence of aberrant transcripts with activation of a cryptic splice site or intron retention, validated by the reverse transcription-polymerase chain reaction (RT-PCR) in the case of HOOK1. In GNAQ, RNA-Seq showed 22% of wild-type transcript and 78% of mRNA skipping exon 5, resulting in a 4–6 frameshift fusion confirmed by RT-PCR. The pipeline can be useful to identify intronic variants affecting RNA sequence by complementing conventional exome analysis. PMID:24498620
Detection of isotype switch rearrangement in bulk culture by PCR.
Max, E E; Mills, F C; Chu, C
2001-05-01
When a B lymphocyte changes from synthesizing IgM to synthesizing IgG, IgA, or IgE, this isotype switch is generally accompanied by a unique DNA rearrangement. The protocols in this unit describe two polymerase chain reaction (PCR)-based strategies for detecting switch rearrangements in bulk culture. The first involves direct PCR across the switch junctions, providing the opportunity for characterizing the recombination products by nucleotide sequence analysis; however, because of characteristics inherent to the PCR methodology this strategy cannot easily be used as a quantitative assay for recombination. A support protocol details the preparation of the 5' Su PCR probe for this protocol. The second basic protocol describes a method known as digestion-circularization PCR (DCPCR) that is more amenable to quantitation but yields no information on structure of the recombination products. Both techniques should be capable of detecting reciprocal deletion circles as well as functional recombination products remaining on the expressed chromosome.
Li, Yifeng
2013-02-01
LL-37 is a human antimicrobial peptide that has been shown to possess multiple functions in host defense. In this report, the peptide was expressed as a fusion with a thioredoxin-SUMO dual-tag. Upon SUMO protease mediated cleavage at the SUMO/peptide junction, LL-37 with its native N-terminus was generated. The released peptide was separated from the dual-tag and cleavage enzyme by size-exclusion chromatography. Mass spectrometry analysis proves that the recombinant peptide has a molecular weight as theoretically expected for its native form. The produced peptide displayed antimicrobial activity against Escherichia coli K-12. On average, 2.4 mg peptide was obtained from one liter of bacterial culture. Thus, the described approach provides an effective alternative for producing active recombinant LL-37 with its natural amino acid sequence in E. coli. Copyright © 2012 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Chauhan, Manvendra Singh; Chauhan, R. K.
2018-04-01
This paper demonstrates a Junction-less Double Gate n-p-n Impact ionization MOS transistor (JLDG n-IMOS) on a very light doped p-type silicon body. Device structure proposed in the paper is based on charge plasma concept. There is no metallurgical junctions in the proposed device and does not need any impurity doping to create the drain and source regions. Due to doping-less nature, the fabrication process is simple for JLDG n-IMOS. The double gate engineering in proposed device leads to reduction in avalanche breakdown via impact ionization, generating large number of carriers in drain-body junction, resulting high ION current, small IOFF current and great improvement in ION/IOFF ratio. The simulation and examination of the proposed device have been performed on ATLAS device simulatorsoftware.
Tunable-φ Josephson junction with a quantum anomalous Hall insulator
NASA Astrophysics Data System (ADS)
Sakurai, Keimei; Ikegaya, Satoshi; Asano, Yasuhiro
2017-12-01
We theoretically study the Josephson current in a superconductor/quantum anomalous Hall insulator/superconductor junction by using the lattice Green function technique. When an in-plane external Zeeman field is applied to the quantum anomalous Hall insulator, the Josephson current J flows without a phase difference across the junction θ . The phase shift φ appearing in the current-phase relationship J ∝sin(θ -φ ) is proportional to the amplitude of Zeeman fields and depends on the direction of Zeeman fields. A phenomenological analysis of the Andreev reflection processes explains the physical origin of φ . In a quantum anomalous Hall insulator, time-reversal symmetry and mirror-reflection symmetry are broken simultaneously. However, magnetic mirror-reflection symmetry is preserved. Such characteristic symmetry properties enable us to have a tunable φ junction with a quantum Hall insulator.
Britz-McKibbin, Philip; Otsuka, Koji; Terabe, Shigeru
2002-08-01
Simple yet effective methods to enhance concentration sensitivity is needed for capillary electrophoresis (CE) to become a practical method to analyze trace levels of analytes in real samples. In this report, the development of a novel on-line preconcentration technique combining dynamic pH junction and sweeping modes of focusing is applied to the sensitive and selective analysis of three flavin derivatives: riboflavin, flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD). Picomolar (pM) detectability of flavins by CE with laser-induced fluorescence (LIF) detection is demonstrated through effective focusing of large sample volumes (up to 22% capillary length) using a dual pH junction-sweeping focusing mode. This results in greater than a 1,200-fold improvement in sensitivity relative to conventional injection methods, giving a limit of detection (S/N = 3) of approximately 4.0 pM for FAD and FMN. Flavin focusing is examined in terms of analyte mobility dependence on buffer pH, borate complexation and SDS interaction. Dynamic pH junction-sweeping extends on-line focusing to both neutral (hydrophobic) and weakly acidic (hydrophilic) species and is considered useful in cases when either conventional sweeping or dynamic pH junction techniques used alone are less effective for certain classes of analytes. Enhanced focusing performance by this hyphenated method was demonstrated by greater than a 4-fold reduction in flavin bandwidth, as compared to either sweeping or dynamic pH junction, reflected by analyte detector bandwidths <0.20 cm. Novel on-line focusing strategies are required to improve sensitivity in CE, which may be applied toward more effective biochemical analysis methods for diverse types of analytes.
Oshima, Atsunori; Matsuzawa, Tomohiro; Nishikawa, Kouki; Fujiyoshi, Yoshinori
2013-04-12
Innexin is the molecular component of invertebrate gap junctions. Here we successfully expressed and purified Caenorhabditis elegans innexin-6 (INX-6) gap junction channels and characterized the molecular dimensions and channel permeability using electron microscopy (EM) and microinjection of fluorescent dye tracers, respectively. Negative staining and thin-section EM of isolated INX-6 gap junction membranes revealed a loosely packed hexagonal lattice and a greater cross-sectional width than that of connexin26 and connexin43 (Cx43)-GFP. In gel filtration analysis, the elution profile of purified INX-6 channels in dodecyl maltoside solution exhibited a peak at ∼400 kDa that was shifted to ∼800 kDa in octyl glucose neopentyl glycol. We also obtained the class averages of purified INX-6 channels from these peak fractions by single particle analysis. The class average from the ∼800-kDa fraction showed features of the junction form with a longitudinal height of 220 Å, a channel diameter of 110 Å in the absence of detergent micelles, and an extracellular gap space of 60 Å, whereas the class averages from the ∼400-kDa fraction showed diameters of up to 140 Å in the presence of detergent micelles. These findings indicate that the purified INX-6 channels are predominantly hemichannels in dodecyl maltoside and docked junction channels in octyl glucose neopentyl glycol. Dye transfer experiments revealed that the INX-6-GFP-His channels are permeable to 3- and 10-kDa tracers, whereas no significant amounts of these tracers passed through the Cx43-GFP channels. Based on these findings, INX-6 channels have a larger overall structure and greater permeability than connexin channels.
Oshima, Atsunori; Matsuzawa, Tomohiro; Nishikawa, Kouki; Fujiyoshi, Yoshinori
2013-01-01
Innexin is the molecular component of invertebrate gap junctions. Here we successfully expressed and purified Caenorhabditis elegans innexin-6 (INX-6) gap junction channels and characterized the molecular dimensions and channel permeability using electron microscopy (EM) and microinjection of fluorescent dye tracers, respectively. Negative staining and thin-section EM of isolated INX-6 gap junction membranes revealed a loosely packed hexagonal lattice and a greater cross-sectional width than that of connexin26 and connexin43 (Cx43)-GFP. In gel filtration analysis, the elution profile of purified INX-6 channels in dodecyl maltoside solution exhibited a peak at ∼400 kDa that was shifted to ∼800 kDa in octyl glucose neopentyl glycol. We also obtained the class averages of purified INX-6 channels from these peak fractions by single particle analysis. The class average from the ∼800-kDa fraction showed features of the junction form with a longitudinal height of 220 Å, a channel diameter of 110 Å in the absence of detergent micelles, and an extracellular gap space of 60 Å, whereas the class averages from the ∼400-kDa fraction showed diameters of up to 140 Å in the presence of detergent micelles. These findings indicate that the purified INX-6 channels are predominantly hemichannels in dodecyl maltoside and docked junction channels in octyl glucose neopentyl glycol. Dye transfer experiments revealed that the INX-6-GFP-His channels are permeable to 3- and 10-kDa tracers, whereas no significant amounts of these tracers passed through the Cx43-GFP channels. Based on these findings, INX-6 channels have a larger overall structure and greater permeability than connexin channels. PMID:23460640
NASA Astrophysics Data System (ADS)
Xu, Fangbo; Sadrzadeh, Arta; Xu, Zhiping; Yakobson, Boris I.
2013-08-01
Recent measurements of carbon nanotube (CNT) fibers electrical conductivity still show the values lower than that of individual CNTs, by about one magnitude order. The imperfections of manufacturing process and constituent components are described as culprits. What if every segment is made perfect? In this work, we study the quantum conductance through the parallel junction of flawless armchair CNTs using tight-binding method in conjunction with non-equilibrium Green's function approach. Short-range oscillations within the long-range oscillations as well as decaying envelopes are all observed in the computed Fermi-level (low bias) conductance as a function of contact length, L. The propagation of CNTs' Bloch waves is cast in the coupled-mode formalism and helps to reveal the quantum interference nature of various behaviors of conductance. Our analysis shows that the Bloch waves at the Fermi-level propagate through a parallel junction without reflection only at an optimal value of contact length. For quite a long junction, however, the conductance at the Fermi level diminishes due to the perturbation of periodic potential field of close-packed CNTs. Thus, a macroscopic fiber, containing an infinite number of junctions, forms a filter that permits passage of electrons with specific wave vectors, and these wave vectors are determined by the collection of all the junction lengths. We also argue that the energy gap introduced by long junctions can be overcome by small voltage (˜0.04 V) across the whole fiber. Overall, developing long individual all-armchair metallic CNTs serves as a promising way to the manufacture of high-conductivity fibers.
Diao, Honglu; Xiao, Shuo; Howerth, Elizabeth W; Zhao, Fei; Li, Rong; Ard, Mary B; Ye, Xiaoqin
2013-08-01
Gap junctions have an important role in cell-to-cell communication, a process obviously required for embryo implantation. Uterine luminal epithelium (LE) is the first contact for an implanting embryo and is critical for the establishment of uterine receptivity. Microarray analysis of the LE from peri-implantation mouse uterus showed low-level expression of 19 gap junction proteins in preimplantation LE and upregulation of gap junction protein, beta 2 (GJB2, connexin 26, Cx26) in postimplantation LE. Time course study using in situ hybridization and immunofluorescence revealed upregulation of GJB2 in the LE surrounding the implantation site before decidualization. Similar dynamic expression of GJB2 was observed in the LE of artificially decidualized mice but not pseudopregnant mice. To determine the potential function of uterine gap junctions in embryo implantation, carbenoxolone (CBX), a broad gap junction blocker, was injected i.p. (100 mg/kg) or via local uterine fat pad (10 mg/kg) into pregnant mice on Gestation Day 3 at 1800 h, a few hours before embryo attachment to the LE. These CBX treatments disrupted embryo implantation, suggesting local effects of CBX in the uterus. However, i.p. injection of glycyrrhizic acid (100 mg/kg), which shares similar structure and multiple properties with CBX but is ineffective in blocking gap junctions, did not affect embryo implantation. Carbenoxolone also inhibited oil-induced artificial decidualization, concomitant with suppressed molecular changes and ultrastructural transformations associated with uterine preparation for embryo implantation, underscoring the adverse effect of CBX on uterine preparation for embryo implantation. These data demonstrate that uterine gap junctions are important for embryo implantation.
2016-01-01
The four-way (Holliday) DNA junction of homologous recombination is processed by the symmetrical cleavage of two strands by a nuclease. These junction-resolving enzymes bind to four-way junctions in dimeric form, distorting the structure of the junction in the process. Crystal structures of T7 endonuclease I have been determined as free protein, and the complex with a DNA junction. In neither crystal structure was the N-terminal 16-amino acid peptide visible, yet deletion of this peptide has a marked effect on the resolution process. Here we have investigated the N-terminal peptide by inclusion of spin-label probes at unique sites within this region, studied by electron paramagnetic resonance. Continuous wave experiments show that these labels are mobile in the free protein but become constrained on binding a DNA junction, with the main interaction occurring for residues 7–10 and 12. Distance measurements between equivalent positions within the two peptides of a dimer using PELDOR showed that the intermonomeric distances for residues 2–12 are long and broadly distributed in the free protein but are significantly shortened and become more defined on binding to DNA. These results suggest that the N-terminal peptides become more organized on binding to the DNA junction and nestle into the minor grooves at the branchpoint, consistent with the biochemical data indicating an important role in the resolution process. This study demonstrates the presence of structure within a protein region that cannot be viewed by crystallography. PMID:27387136
Fortin, F; Beaulieu Bergeron, M; Fetni, R; Lemieux, N
2009-01-01
Human telomeres play a major role in stabilizing chromosome ends and preventing fusions. Chromosomes bearing a broken end are rescued by the acquisition of a new telomeric cap without any subtelomeric sequences being present at the breakpoint, a process referred to as chromosome healing. Conversely, a loss of telomeric function or integrity can lead to the presence of interstitial telomeres at the junction site in translocations or ring chromosomes. In order to determine the frequency at which interstitial telomeres or chromosome healing events are observed in target chromosome abnormalities, we conducted a retrospective FISH study using pan-telomeric and chromosome-specific subtelomeric probes on archival material from 40 cases of terminal deletions, translocations or ring chromosomes. Of the 19 terminal deletions investigated, 17 were negative for the subtelomeric probe specific to the deleted arm despite being positive for the pan-telomeric probe. These 17 cases were thus considered as having been rescued through chromosome healing, suggesting that this process is frequent in terminal deletions. In addition, as 2 of these cases were inherited from a parent bearing the same deletion, chromosomes healed by this process are thus stable through mitosis and meiosis. Regarding the 13 cases of translocations and 8 ring chromosomes, 4 and 2 cases respectively demonstrated pan-telomeric sequences at the interstitial junction point. Furthermore, 2 cases of translocations and 1 ring chromosome had both interstitial pan-telomeres and subtelomeres, whereas 2 other cases of ring chromosomes and 1 case of translocation only showed interstitial subtelomeres. Therefore, interstitial (sub)telomeric sequences in translocations and ring chromosomes are more common than previously thought, as we found a frequency of 43% in this study. Moreover, our results illustrate the necessity of performing FISH with both subtelomeric and pan-telomeric probes when investigating these rearrangements, as the breakpoints can be either in the distal part of the pan-telomeres, or in between the 2 types of sequences. Copyright 2009 S. Karger AG, Basel.
Tree-hierarchy of DNA and distribution of Holliday junctions.
Rozikov, U A
2017-12-01
We define a DNA as a sequence of [Formula: see text]'s and embed it on a path of Cayley tree. Using group representation of the Cayley tree, we give a hierarchy of a countable set of DNAs each of which 'lives' on the same Cayley tree. This hierarchy has property that each vertex of the Cayley tree belongs only to one of DNA. Then we give a model (energy, Hamiltonian) of this set of DNAs by an analogue of Ising model with three spin values (considered as DNA base pairs) on a set of admissible configurations. To study thermodynamic properties of the model of DNAs we describe corresponding translation invariant Gibbs measures (TIGM) of the model on the Cayley tree of order two. We show that there is a critical temperature [Formula: see text] such that (i) if temperature [Formula: see text] then there exists unique TIGM; (ii) if [Formula: see text] then there are two TIGMs; (iii) if [Formula: see text] then there are three TIGMs. Each such measure describes a phase of the set of DNAs. We use these results to study distributions of Holliday junctions and branches of DNAs. In case of very high and very low temperatures we give stationary distributions and typical configurations of the Holliday junctions.
Rap1 and Rap2 Antagonistically Control Endothelial Barrier Resistance
Pannekoek, Willem-Jan; Linnemann, Jelena R.; Brouwer, Patricia M.; Bos, Johannes L.; Rehmann, Holger
2013-01-01
Rap1 and Rap2 are closely related proteins of the Ras family of small G-proteins. Rap1 is well known to regulate cell-cell adhesion. Here, we have analysed the effect of Rap-mediated signalling on endothelial permeability using electrical impedance measurements of HUVEC monolayers and subsequent determination of the barrier resistance, which is a measure for the ease with which ions can pass cell junctions. In line with its well-established effect on cell-cell junctions, depletion of Rap1 decreases, whereas activation of Rap1 increases barrier resistance. Despite its high sequence homology with Rap1, depletion of Rap2 has an opposite, enhancing, effect on barrier resistance. This effect can be mimicked by depletion of the Rap2 specific activator RasGEF1C and the Rap2 effector MAP4K4, establishing Rap2 signalling as an independent pathway controlling barrier resistance. As simultaneous depletion or activation of both Rap1 and Rap2 results in a barrier resistance comparable to control cells, Rap1 and Rap2 control barrier resistance in a reciprocal manner. This Rap1-antagonizing effect of Rap2 is established independent of junctional actin formation. These data establish that endothelial barrier resistance is determined by the combined antagonistic actions of Rap1 and Rap2. PMID:23469100
Computational Analysis of Stresses Acting on Intermodular Junctions in Thoracic Aortic Endografts
Prasad, Anamika; To, Lillian K.; Gorrepati, Madhu L.; Zarins, Christopher K.; Figueroa, C. Alberto
2011-01-01
Purpose: To evaluate the biomechanical and hemodynamic forces acting on the intermodular junctions of a multi-component thoracic endograft and elucidate their influence on the development of type III endoleak due to disconnection of stent-graft segments. Methods: Three-dimensional computer models of the thoracic aorta and a 4-component thoracic endograft were constructed using postoperative (baseline) and follow-up computed tomography (CT) data from a 69-year-old patient who developed type III endoleak 4 years after stent-graft placement. Computational fluid dynamics (CFD) techniques were used to quantitate the displacement forces acting on the device. The contact stresses between the different modules of the graft were then quantified using computational solid mechanics (CSM) techniques. Lastly, the intermodular junction frictional stability was evaluated using a Coulomb model. Results: The CFD analysis revealed that curvature and length are key determinants of the displacement forces experienced by each endograft and that the first 2 modules were exposed to displacement forces acting in opposite directions in both the lateral and longitudinal axes. The CSM analysis revealed that the highest concentration of stresses occurred at the junction between the first and second modules of the device. Furthermore, the frictional analysis demonstrated that most of the surface area (53%) of this junction had unstable contact. The predicted critical zone of intermodular stress concentration and frictional instability matched the location of the type III endoleak observed in the 4-year follow-up CT image. Conclusion: The region of larger intermodular stresses and highest frictional instability correlated with the zone where a type III endoleak developed 4 years after thoracic stent-graft placement. Computational techniques can be helpful in evaluating the risk of endograft migration and potential for modular disconnection and may be useful in improving device placement strategies and endograft design. PMID:21861748
Briechle, Bernd M; Kim, Youngsang; Ehrenreich, Philipp; Erbe, Artur; Sysoiev, Dmytro; Huhn, Thomas; Groth, Ulrich; Scheer, Elke
2012-01-01
We report on an experimental analysis of the charge transport through sulfur-free photochromic molecular junctions. The conductance of individual molecules contacted with gold electrodes and the current-voltage characteristics of these junctions are measured in a mechanically controlled break-junction system at room temperature and in liquid environment. We compare the transport properties of a series of molecules, labeled TSC, MN, and 4Py, with the same switching core but varying side-arms and end-groups designed for providing the mechanical and electrical contact to the gold electrodes. We perform a detailed analysis of the transport properties of TSC in its open and closed states. We find rather broad distributions of conductance values in both states. The analysis, based on the assumption that the current is carried by a single dominating molecular orbital, reveals distinct differences between both states. We discuss the appearance of diode-like behavior for the particular species 4Py that features end-groups, which preferentially couple to the metal electrode by physisorption. We show that the energetic position of the molecular orbital varies as a function of the transmission. Finally, we show for the species MN that the use of two cyano end-groups on each side considerably enhances the coupling strength compared to the typical behavior of a single cyano group.
Analysis of gap junctional intercellular communications using a dielectrophoresis-based microchip.
Tellez-Gabriel, Marta; Charrier, Céline; Brounais-Le Royer, Bénédicte; Mullard, Mathilde; Brown, Hannah K; Verrecchia, Franck; Heymann, Dominique
2017-03-01
Gap junctions are transmembrane structures that directly connect the cytoplasm of adjacent cells, making intercellular communications possible. It has been shown that the behaviour of several tumours - such as bone tumours - is related to gap junction intercellular communications (GJIC). Several methodologies are available for studying GJIC, based on measuring different parameters that are useful for multiple applications, such as the study of carcinogenesis for example. These methods nevertheless have several limitations. The present manuscript describes the setting up of a dielectrophoresis (DEP)-based lab-on-a-chip platform for the real-time study of Gap Junctional Intercellular Communication between osteosarcoma cells and the main cells accessible to their microenvironment. We conclude that using the DEParray technology for the GJIC assessment has several advantages comparing to current techniques. This methodology is less harmful for cells integrity; cells can be recovered after interaction to make further molecular analysis; it is possible to study GJIC in real time; we can promote cell interactions using up to five different populations. The setting up of this new methodology overcomes several difficulties to perform experiments for solving questions about GJIC process that we are not able to do with current technics. Copyright © 2017 Elsevier GmbH. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harvey, E.W.
Study of late Pleistocene-age sediments near the mouth of the Mad River revealed a sequence of nearshore marine and shallow bay deposits. This sequence, bounded by unconformities, is informally named the Mouth of Mad unit. The Mouth of mad unit can be divided into four distinct depositional facies at the study site. The lowest facies are the Nearshore Sand and Estuarine Mud, which lie unconformably on a paleosol. The sand facies grades upward into a high-energy, interbedded Nearshore Sand and Gravel facies containing storm and rip-channel deposits. Above the sand and gravel is a Strand-Plain Sand facies. This sand ismore » overlain by a laterally variable sequence of shell-rich Bay facies. The bay deposits can be further divided into five subfacies: (1) a Bioturbated Sand; (2) a Lower Tidal Flat Mud; (3) a Mixed Sand and Mud; (4) an oyster-rich Bay Mud; and (5) an Upper Tidal Flat Mud. The bay sequence is overlain unconformably by younger late Pleistocene-age marine terrace deposits. The depositional environments represented by these facies progress from a shoreline estuary to nearshore deposits, above storm wave base, and slowly back to shoreline and finally shallow bay conditions. The Mouth of Mad unit represents a transgressive-regressive sequence, involving the development of a protective spit. The uppermost mud within the Mouth of Mad unit has been dated, using thermoluminescence age estimation, at 176 [+-] 33 ka, placing it in the late Pleistocene. The Mouth of Mad unit appears to be younger than the fossiliferous deposits at Elk Head, Crannell Junction, Trinidad Head, Moonstone Beach, and the Falor Formation near Maple Creek, and possibly time equivalent with gravel deposits exposed at the western end of School Road in McKinleyville.« less
Niu, Zhitao; Pan, Jiajia; Zhu, Shuying; Li, Ludan; Xue, Qingyun; Liu, Wei; Ding, Xiaoyu
2017-01-01
Apostasioideae, consists of only two genera, Apostasia and Neuwiedia , which are mainly distributed in Southeast Asia and northern Australia. The floral structure, taxonomy, biogeography, and genome variation of Apostasioideae have been intensively studied. However, detailed analyses of plastome composition and structure and comparisons with those of other orchid subfamilies have not yet been conducted. Here, the complete plastome sequences of Apostasia wallichii and Neuwiedia singapureana were sequenced and compared with 43 previously published photosynthetic orchid plastomes to characterize the plastome structure and evolution in the orchids. Unlike many orchid plastomes (e.g., Paphiopedilum and Vanilla ), the plastomes of Apostasioideae contain a full set of 11 functional NADH dehydrogenase ( ndh ) genes. The distribution of repeat sequences and simple sequence repeat elements enhanced the view that the mutation rate of non-coding regions was higher than that of coding regions. The 10 loci- ndhA intron, matK-5'trnK , clpP-psbB , rps8-rpl14 , trnT-trnL , 3'trnK-matK , clpP intron , psbK-trnK , trnS-psbC , and ndhF-rpl32 -that had the highest degrees of sequence variability were identified as mutational hotspots for the Apostasia plastome. Furthermore, our results revealed that plastid genes exhibited a variable evolution rate within and among different orchid genus. Considering the diversified evolution of both coding and non-coding regions, we suggested that the plastome-wide evolution of orchid species was disproportional. Additionally, the sequences flanking the inverted repeat/small single copy (IR/SSC) junctions of photosynthetic orchid plastomes were categorized into three types according to the presence/absence of ndh genes. Different evolutionary dynamics for each of the three IR/SSC types of photosynthetic orchid plastomes were also proposed.
Niu, Zhitao; Pan, Jiajia; Zhu, Shuying; Li, Ludan; Xue, Qingyun; Liu, Wei; Ding, Xiaoyu
2017-01-01
Apostasioideae, consists of only two genera, Apostasia and Neuwiedia, which are mainly distributed in Southeast Asia and northern Australia. The floral structure, taxonomy, biogeography, and genome variation of Apostasioideae have been intensively studied. However, detailed analyses of plastome composition and structure and comparisons with those of other orchid subfamilies have not yet been conducted. Here, the complete plastome sequences of Apostasia wallichii and Neuwiedia singapureana were sequenced and compared with 43 previously published photosynthetic orchid plastomes to characterize the plastome structure and evolution in the orchids. Unlike many orchid plastomes (e.g., Paphiopedilum and Vanilla), the plastomes of Apostasioideae contain a full set of 11 functional NADH dehydrogenase (ndh) genes. The distribution of repeat sequences and simple sequence repeat elements enhanced the view that the mutation rate of non-coding regions was higher than that of coding regions. The 10 loci—ndhA intron, matK-5′trnK, clpP-psbB, rps8-rpl14, trnT-trnL, 3′trnK-matK, clpP intron, psbK-trnK, trnS-psbC, and ndhF-rpl32—that had the highest degrees of sequence variability were identified as mutational hotspots for the Apostasia plastome. Furthermore, our results revealed that plastid genes exhibited a variable evolution rate within and among different orchid genus. Considering the diversified evolution of both coding and non-coding regions, we suggested that the plastome-wide evolution of orchid species was disproportional. Additionally, the sequences flanking the inverted repeat/small single copy (IR/SSC) junctions of photosynthetic orchid plastomes were categorized into three types according to the presence/absence of ndh genes. Different evolutionary dynamics for each of the three IR/SSC types of photosynthetic orchid plastomes were also proposed. PMID:29046685
Barrick, Jeffrey E; Colburn, Geoffrey; Deatherage, Daniel E; Traverse, Charles C; Strand, Matthew D; Borges, Jordan J; Knoester, David B; Reba, Aaron; Meyer, Austin G
2014-11-29
Mutations that alter chromosomal structure play critical roles in evolution and disease, including in the origin of new lifestyles and pathogenic traits in microbes. Large-scale rearrangements in genomes are often mediated by recombination events involving new or existing copies of mobile genetic elements, recently duplicated genes, or other repetitive sequences. Most current software programs for predicting structural variation from short-read DNA resequencing data are intended primarily for use on human genomes. They typically disregard information in reads mapping to repeat sequences, and significant post-processing and manual examination of their output is often required to rule out false-positive predictions and precisely describe mutational events. We have implemented an algorithm for identifying structural variation from DNA resequencing data as part of the breseq computational pipeline for predicting mutations in haploid microbial genomes. Our method evaluates the support for new sequence junctions present in a clonal sample from split-read alignments to a reference genome, including matches to repeat sequences. Then, it uses a statistical model of read coverage evenness to accept or reject these predictions. Finally, breseq combines predictions of new junctions and deleted chromosomal regions to output biologically relevant descriptions of mutations and their effects on genes. We demonstrate the performance of breseq on simulated Escherichia coli genomes with deletions generating unique breakpoint sequences, new insertions of mobile genetic elements, and deletions mediated by mobile elements. Then, we reanalyze data from an E. coli K-12 mutation accumulation evolution experiment in which structural variation was not previously identified. Transposon insertions and large-scale chromosomal changes detected by breseq account for ~25% of spontaneous mutations in this strain. In all cases, we find that breseq is able to reliably predict structural variation with modest read-depth coverage of the reference genome (>40-fold). Using breseq to predict structural variation should be useful for studies of microbial epidemiology, experimental evolution, synthetic biology, and genetics when a reference genome for a closely related strain is available. In these cases, breseq can discover mutations that may be responsible for important or unintended changes in genomes that might otherwise go undetected.
Diekmann, S; Lilley, D M
1987-01-01
We have made an analysis of the gel electrophoretic properties of a pseudo-cruciform fragment, a linear DNA molecule containing a stable cruciform. The migration of this construct was analysed in polyacrylamide gels at a various temperatures in the range 5 degrees to 55 degrees C, and in the presence of NaCl, MgCl2 or ethidium bromide. The magnitude of the anomalous migration (retardation) was almost temperature independent up to 40 degrees C, but decreased strongly beyond this point, extrapolating to normal migration at 70 degrees C. Addition of salts reduced the anomaly. This took the form of a continuous reduction in anomalous migration with the addition of NaCl up to 60 mM, while with MgCl2 there was a sharp reduction in the anomaly to a constant value which is reached by 10 mM. Under these conditions, moreover, the migration of the fragment became almost temperature-independent over the entire range. These results have been interpreted to reflect the influence of ion binding at the four-way junction on the relative disposition of the cruciform arms. The detailed electrophoretic properties of the pseudo-cruciform are in marked contrast to those of sequence-directed curved DNA fragments. In particular, the response to the addition of 1 microgram/ml ethidium bromide offers a convenient method for distinguishing between anomalous retardation arising from curvature (greatly reduced anomaly) or a cruciform junction (enhanced anomaly). Images PMID:3039465
Romagnoli, Francesco; Colaiacomo, Maria Chiara; De Milito, Ritanna; Modini, Claudio; Gualdi, Gianfranco; Catani, Marco
2014-01-01
The sigmoidorectal junction (SRJ) has been defined as an anatomical sphincter with particular physiological behavior that regulates sigmoid and rectum evacuation. Its function in clinical conditions, such as diverticular disease has been advocated. The aim of our study is to identify the SRJ and to compare the morphometric and dynamic features of the SRJ between patients with diverticular disease and healthy subjects using MR-defecography. Sixteen individuals, eight with uncomplicated diverticular disease and eight healthy subjects, were studied using MR-defecography to identify the SRJ and to compare the morphometric and dynamic features observed. In each subject studied, MR-defecography was able to identify the SRJ. This resulted in the identification of a discrete anatomical entity with a mean length of 31.23 mm, located in front of the first sacral vertebra (S1) and at a mean distance of 15.55 cm from the anal verge, with a mean wall thickness of 4.45 mm, significantly different from the sigmoid and rectal parietal thickness. The SRJ wall was significantly thicker in patients with diverticular disease than the controls (P = 0.005), showing a unique shape and behavior in dynamic sequences. Our findings support the hypothesis that SRJ plays a critical role in patients with symptomatic diverticular disease; further investigation may clarify whether specific SRJ analysis, such as MR-defecography, would predict inflammatory complications of this diffuse and heterogenic disease.
Mutation analysis of 12 genes in Chinese families with congenital cataracts
Sun, Wenmin; Xiao, Xueshan; Li, Shiqiang; Guo, Xiangming
2011-01-01
Purpose To identify mutations in 12 genes in Chinese families with congenital cataracts. Methods Twenty five families with congenital cataracts involved in this study. The coding exons and adjacent intronic regions of 12 genes were analyzed by cycle sequencing, including the alpha A crystallin (CRYAA), alpha B crystallin (CRYAB), beta A1 crystallin (CRYBA1), beta A4 crystallin (CRYBA4), beta B1 crystallin (CRYBB1), beta B2 crystallin (CRYBB2), beta B3 crystallin (CRYBB3), gamma C crystallin (CRYGC), gamma D crystallin (CRYGD), gamma S crystallin (CRYGS), alpha 3 gap junction protein (GJA3), and alpha 8 gap junction protein (GJA8) genes. Novel variants were further evaluated in 96 normal controls. Results Nine mutations were identified in 10 of the 25 families (40%), including 5 novel (c.350_352delGCT in CRYAA, c.205C>T in CRYAB, c.106G>C in CRYGD, c.77A>G in CRYGS, c.1143_1165del23 in GJA3) and 4 known (c.292G>A in CRYAA; c.215+1G>A and c.272_274delGAG in CRYBA1, and c.176C>T in GJA3). All novel mutations were predicted to be pathogenic and were not present in 96 controls. Conclusions Mutations in the 12 genes encoding crystallins and connexins were responsible for 40% Chinese families with congenital cataracts. Our results enriched our knowledge on the molecular basis of congenital cataracts in Chinese population. PMID:21866213
Jue, Dengwei; Sang, Xuelian; Shu, Bo; Liu, Liqin; Wang, Yicheng; Jia, Zhiwei; Zou, Yu; Shi, Shengyou
2017-01-01
Background Ripening affects the quality and nutritional contents of fleshy fruits and is a crucial process of fruit development. Although several studies have suggested that ubiquitin-conjugating enzyme (E2s or UBC enzymes) are involved in the regulation of fruit ripening, little is known about the function of E2s in papaya (Carica papaya). Methodology/Principal findings In the present study, we searched the papaya genome and identified 34 putative UBC genes, which were clustered into 17 phylogenetic subgroups. We also analyzed the nucleotide sequences of the papaya UBC (CpUBC) genes and found that both exon-intron junctions and sequence motifs were highly conserved among the phylogenetic subgroups. Using real-time PCR analysis, we also found that all the CpUBC genes were expressed in roots, stems, leaves, male and female flowers, and mature fruit, although the expression of some of the genes was increased or decreased in one or several specific organs. We also found that the expression of 13 and two CpUBC genes were incresesd or decreased during one and two ripening stages, respectively. Expression analyses indicates possible E2s playing a more significant role in fruit ripening for further studies. Conclusions To the best of our knowledge, this is the first reported genome-wide analysis of the papaya UBC gene family, and the results will facilitate further investigation of the roles of UBC genes in fruit ripening and will aide in the functional validation of UBC genes in papaya. PMID:28231288
Ion implantation of solar cell junctions without mass analysis
NASA Technical Reports Server (NTRS)
Fitzgerald, D.; Tonn, D. G.
1981-01-01
This paper is a summary of an investigation to determine the feasibility of producing solar cells by means of ion implantation without the use of mass analysis. Ion implants were performed using molecular and atomic phosphorus produced by the vaporization of solid red phosphorus and ionized in an electron bombardment source. Solar cell junctions were ion implanted by mass analysis of individual molecular species and by direct unanalyzed implants from the ion source. The implant dose ranged from 10 to the 14th to 10 to the 16th atoms/sq cm and the energy per implanted atom ranged from 5 KeV to 40 KeV in this study.
Hernández-Saz, J; Herrera, M; Delgado, F J; Duguay, S; Philippe, T; Gonzalez, M; Abell, J; Walters, R J; Molina, S I
2016-07-29
The analysis by atom probe tomography (APT) of InAlAsSb layers with applications in triple junction solar cells (TJSCs) has shown the existence of In- and Sb-rich regions in the material. The composition variation found is not evident from the direct observation of the 3D atomic distribution and because of this a statistical analysis has been required. From previous analysis of these samples, it is shown that the small compositional fluctuations determined have a strong effect on the optical properties of the material and ultimately on the performance of TJSCs.
Ding, Dong; Lou, Xiaoyan; Hua, Dasong; Yu, Wei; Li, Lisha; Wang, Jun; Gao, Feng; Zhao, Na; Ren, Guoping; Li, Lanjuan; Lin, Biaoyang
2012-01-01
Integration of the viral DNA into host chromosomes was found in most of the hepatitis B virus (HBV)–related hepatocellular carcinomas (HCCs). Here we devised a massive anchored parallel sequencing (MAPS) method using next-generation sequencing to isolate and sequence HBV integrants. Applying MAPS to 40 pairs of HBV–related HCC tissues (cancer and adjacent tissues), we identified 296 HBV integration events corresponding to 286 unique integration sites (UISs) with precise HBV–Human DNA junctions. HBV integration favored chromosome 17 and preferentially integrated into human transcript units. HBV targeted genes were enriched in GO terms: cAMP metabolic processes, T cell differentiation and activation, TGF beta receptor pathway, ncRNA catabolic process, and dsRNA fragmentation and cellular response to dsRNA. The HBV targeted genes include 7 genes (PTPRJ, CNTN6, IL12B, MYOM1, FNDC3B, LRFN2, FN1) containing IPR003961 (Fibronectin, type III domain), 7 genes (NRG3, MASP2, NELL1, LRP1B, ADAM21, NRXN1, FN1) containing IPR013032 (EGF-like region, conserved site), and three genes (PDE7A, PDE4B, PDE11A) containing IPR002073 (3′, 5′-cyclic-nucleotide phosphodiesterase). Enriched pathways include hsa04512 (ECM-receptor interaction), hsa04510 (Focal adhesion), and hsa04012 (ErbB signaling pathway). Fewer integration events were found in cancers compared to cancer-adjacent tissues, suggesting a clonal expansion model in HCC development. Finally, we identified 8 genes that were recurrent target genes by HBV integration including fibronectin 1 (FN1) and telomerase reverse transcriptase (TERT1), two known recurrent target genes, and additional novel target genes such as SMAD family member 5 (SMAD5), phosphatase and actin regulator 4 (PHACTR4), and RNA binding protein fox-1 homolog (C. elegans) 1 (RBFOX1). Integrating analysis with recently published whole-genome sequencing analysis, we identified 14 additional recurrent HBV target genes, greatly expanding the HBV recurrent target list. This global survey of HBV integration events, together with recently published whole-genome sequencing analyses, furthered our understanding of the HBV–related HCC. PMID:23236287
Global-Local Finite Element Analysis of Bonded Single-Lap Joints
NASA Technical Reports Server (NTRS)
Kilic, Bahattin; Madenci, Erdogan; Ambur, Damodar R.
2004-01-01
Adhesively bonded lap joints involve dissimilar material junctions and sharp changes in geometry, possibly leading to premature failure. Although the finite element method is well suited to model the bonded lap joints, traditional finite elements are incapable of correctly resolving the stress state at junctions of dissimilar materials because of the unbounded nature of the stresses. In order to facilitate the use of bonded lap joints in future structures, this study presents a finite element technique utilizing a global (special) element coupled with traditional elements. The global element includes the singular behavior at the junction of dissimilar materials with or without traction-free surfaces.
A model for Iapetan rifting of Laurentia based on Neoproterozoic dikes and related rocks
Burton, William C.; Southworth, Scott
2010-01-01
Geologic evidence of the Neoproterozoic rifting of Laurentia during breakup of Rodinia is recorded in basement massifs of the cratonic margin by dike swarms, volcanic and plutonic rocks, and rift-related clastic sedimentary sequences. The spatial and temporal distribution of these geologic features varies both within and between the massifs but preserves evidence concerning the timing and nature of rifting. The most salient features include: (1) a rift-related magmatic event recorded in the French Broad massif and the southern and central Shenandoah massif that is distinctly older than that recorded in the northern Shenandoah massif and northward; (2) felsic volcanic centers at the north ends of both French Broad and Shenandoah massifs accompanied by dike swarms; (3) differences in volume between massifs of cover-sequence volcanic rocks and rift-related clastic rocks; and (4) WNW orientation of the Grenville dike swarm in contrast to the predominately NE orientation of other Neoproterozoic dikes. Previously proposed rifting mechanisms to explain these features include rift-transform and plume–triple-junction systems. The rift-transform system best explains features 1, 2, and 3, listed here, and we propose that it represents the dominant rifting mechanism for most of the Laurentian margin. To explain feature 4, as well as magmatic ages and geochemical trends in the Northern Appalachians, we propose that a plume–triple-junction system evolved into the rift-transform system. A ca. 600 Ma mantle plume centered east of the Sutton Mountains generated the radial dike swarm of the Adirondack massif and the Grenville dike swarm, and a collocated triple junction generated the northern part of the rift-transform system. An eastern branch of this system produced the Long Range dike swarm in Newfoundland, and a subsequent western branch produced the ca. 554 Ma Tibbit Hill volcanics and the ca. 550 Ma rift-related magmatism of Newfoundland.
Cooper, H. John; Urban, Robert M.; Wixson, Richard L.; Meneghini, R. Michael; Jacobs, Joshua J.
2013-01-01
Background: Femoral stems with dual-taper modularity were introduced to allow additional options for hip-center restoration independent of femoral fixation in total hip arthroplasty. Despite the increasing availability and use of these femoral stems, concerns exist about potential complications arising from the modular neck-body junction. Methods: This was a multicenter retrospective case series of twelve hips (eleven patients) with adverse local tissue reactions secondary to corrosion at the modular neck-body junction. The cohort included eight women and three men who together had an average age of 60.1 years (range, forty-three to seventy-seven years); all hips were implanted with a titanium-alloy stem and cobalt-chromium-alloy neck. Patients presented with new-onset and increasing pain at a mean of 7.9 months (range, five to thirteen months) following total hip arthroplasty. After serum metal-ion studies and metal artifact reduction sequence (MARS) magnetic resonance imaging (MRI) revealed abnormal results, the patients underwent hip revision at a mean of 15.2 months (range, ten to twenty-three months). Tissue specimens were examined by a single histopathologist, and the retrieved implants were studied with use of light and scanning electron microscopy. Results: Serum metal levels demonstrated greater elevation of cobalt (mean, 6.0 ng/mL) than chromium (mean, 0.6 ng/mL) or titanium (mean, 3.4 ng/mL). MRI with use of MARS demonstrated adverse tissue reactions in eight of nine patients in which it was performed. All hips showed large soft-tissue masses and surrounding tissue damage with visible corrosion at the modular femoral neck-body junction. Available histology demonstrated large areas of tissue necrosis in seven of ten cases, while remaining viable capsular tissue showed a dense lymphocytic infiltrate. Microscopic analysis was consistent with fretting and crevice corrosion at the modular neck-body interface. Conclusions: Corrosion at the modular neck-body junction in dual-tapered stems with a modular cobalt-chromium-alloy femoral neck can lead to release of metal ions and debris resulting in local soft-tissue destruction. Adverse local tissue reaction should be considered as a potential cause for new-onset pain in patients with these components, and early revision should be considered given the potentially destructive nature of these reactions. A workup including serologic studies (erythrocyte sedimentation rate and C-reactive protein), serum metal levels, and MARS MRI can be helpful in establishing this diagnosis. Level of Evidence: Therapeutic Level IV. See Instructions for Authors for a complete description of levels of evidence. PMID:23677352
pn junctions based on a single transparent perovskite semiconductor BaSnO3
NASA Astrophysics Data System (ADS)
Kim, Hoon Min; Kim, Useong; Park, Chulkwon; Kwon, Hyukwoo; Lee, Woongjae; Kim, Tai Hoon; Kim, Kee Hoon; Char, Kookrin; Mdpl, Department Of Physics; Astronomy Team; Censcmr, Department Of Physics; Astronomy Team
2014-03-01
Successful p doping of transparent oxide semiconductor will further increase its potential, especially in the area of optoelectronic applications. We will report our efforts to dope the BaSnO3 (BSO) with K by pulsed laser deposition. Although the K doped BSO exhibits rather high resistivity at room temperature, its conductivity increases dramatically at higher temperatures. Furthermore, the conductivity decreases when a small amount of oxygen was removed from the film, consistent with the behavior of p type doped oxides. We have fabricated pn junctions by using K doped BSO as a p type and La doped BSO as an n type material. I_V characteristics of these devices show the typical rectifying behavior of pn junctions. We will present the analysis of the junction properties from the temperature dependent measurement of their electrical properties, which shows that the I_V characteristics are consistent with the material parameters such as the carrier concentration, the mobility, and the bandgap. Our demonstration of pn junctions based on a single transparent perovskite semiconductor further enhances the potential of BSO system with high mobility and stability.
NASA Astrophysics Data System (ADS)
Gordon, Geoffrey; Lo, Chun-Min
2007-03-01
Both in vitro and animal studies in breast, prostate, and ovarian cancers have shown that clostridium perfringens enterotoxin (CPE), which binds to CLDN4, may have an important therapeutic benefit, as it is rapidly cytotoxic in tissues overexpressing CLDN4. This study sought to evaluate the ability of C-terminal clostridium perfringens enterotoxin (C-CPE), a CLDN4-targetting molecule, to disrupt tight junction barrier function. Electric cell-substrate impedance sensing (ECIS) was used to measure both junctional resistance and average cell-substrate separation of ovarian cancer cell lines after exposure to C-CPE. A total of 14 ovarian cancer cell lines were used, and included cell lines derived from serous, mucinous, and clear cells. Our results showed that junctional resistance increases as CLDN4 expression increases. In addition, C-CPE is non-cytotoxic in ovarian cancer cells expressing CLDN4. However, exposure to C-CPE results in a significant (p<0.05) dose- and CLDN4-dependent decrease in junctional resistance and an increase in cell-substrate separation. Treatment of ovarian cancer cell lines with C-CPE disrupts tight junction barrier function.
Direct mapping of electrical noise sources in molecular wire-based devices
Cho, Duckhyung; Lee, Hyungwoo; Shekhar, Shashank; Yang, Myungjae; Park, Jae Yeol; Hong, Seunghun
2017-01-01
We report a noise mapping strategy for the reliable identification and analysis of noise sources in molecular wire junctions. Here, different molecular wires were patterned on a gold substrate, and the current-noise map on the pattern was measured and analyzed, enabling the quantitative study of noise sources in the patterned molecular wires. The frequency spectra of the noise from the molecular wire junctions exhibited characteristic 1/f2 behavior, which was used to identify the electrical signals from molecular wires. This method was applied to analyze the molecular junctions comprising various thiol molecules on a gold substrate, revealing that the noise in the junctions mainly came from the fluctuation of the thiol bonds. Furthermore, we quantitatively compared the frequencies of such bond fluctuations in different molecular wire junctions and identified molecular wires with lower electrical noise, which can provide critical information for designing low-noise molecular electronic devices. Our method provides valuable insights regarding noise phenomena in molecular wires and can be a powerful tool for the development of molecular electronic devices. PMID:28233821
Direct mapping of electrical noise sources in molecular wire-based devices
NASA Astrophysics Data System (ADS)
Cho, Duckhyung; Lee, Hyungwoo; Shekhar, Shashank; Yang, Myungjae; Park, Jae Yeol; Hong, Seunghun
2017-02-01
We report a noise mapping strategy for the reliable identification and analysis of noise sources in molecular wire junctions. Here, different molecular wires were patterned on a gold substrate, and the current-noise map on the pattern was measured and analyzed, enabling the quantitative study of noise sources in the patterned molecular wires. The frequency spectra of the noise from the molecular wire junctions exhibited characteristic 1/f2 behavior, which was used to identify the electrical signals from molecular wires. This method was applied to analyze the molecular junctions comprising various thiol molecules on a gold substrate, revealing that the noise in the junctions mainly came from the fluctuation of the thiol bonds. Furthermore, we quantitatively compared the frequencies of such bond fluctuations in different molecular wire junctions and identified molecular wires with lower electrical noise, which can provide critical information for designing low-noise molecular electronic devices. Our method provides valuable insights regarding noise phenomena in molecular wires and can be a powerful tool for the development of molecular electronic devices.
Qureshi, Mahim I; Gohel, Manj; Wing, Louise; MacDonald, Andrew; Lim, Chung S; Ellis, Mary; Franklin, Ian J; Davies, Alun H
2015-08-01
This study assessed patterns of superficial reflux in patients with primary chronic venous disease. Retrospective review of all patient venous duplex ultrasonography reports at one institution between 2000 and 2009. Legs with secondary, deep or no superficial reflux were excluded. In total, 8654 limbs were scanned; 2559 legs from 2053 patients (mean age 52.3 years) were included for analysis. Great saphenous vein reflux predominated (68%), followed by combined great saphenous vein/small saphenous vein reflux (20%) and small saphenous vein reflux (7%). The majority of legs with competent saphenofemoral junction had below-knee great saphenous vein reflux (53%); incompetent saphenofemoral junction was associated with combined above and below-knee great saphenous vein reflux (72%). Isolated small saphenous vein reflux was associated with saphenopopliteal junction incompetence (61%), although the majority of all small saphenous vein reflux limbs had a competent saphenopopliteal junction (57%). Superficial venous reflux does not necessarily originate from a saphenous junction. Large prospective studies with interval duplex ultrasonography are required to unravel the natural history of primary chronic venous disease. © The Author(s) 2014.
Role of Gap Junctions in Early Brain Injury Following Subarachnoid Hemorrhage
Ayer, Robert; Chen, Wanqiu; Sugawara, Takashi; Suzuki, Hidenori; Zhang, John H.
2010-01-01
Gap junction inhibition has been demonstrated to reverse the vascular contraction that follows experimental subarachnoid hemorrhage. This study hypothesizes that the use of established gap junction inhibitors: octonal and carbenoxolone, to interrupt cell to cell communication will provide neuroprotection against early brain injury after SAH. The filament perforation model of SAH was performed in male Sprague–Dawley rats weighing between 300 and 380g. Octanol (260.46mg or 781.38 mg/kg), carbenoxolone (100 mg/kg), or vehicles were given via intraperitoneal injection 1 hour after SAH. Neurologic deficits and cerebral apoptosis were assessed 24 and 72 hours after SAH. In addition, Western blot analysis was performed to confirm the in vivo inhibition of CNS gap junctions. The administration of octanol and carbenoxolone both failed to attenuate the neurological deficits induced by SAH, and they did not reduce neuronal apoptosis. Additionally, carbenoloxone increased post SAH mortality and exacerbated SAH induced apoptosis. Despites previous studies that show gap junction inhibitors reverse vasospasm following experimental SAH, they failed to improve clinical outcomes or provide neuroprotection in this study. PMID:20018179
Morgan, Sarah V; Garwood, Claire J; Jennings, Luke; Simpson, Julie E; Castelli, Lydia M; Heath, Paul R; Mihaylov, Simeon R; Vaquéz-Villaseñor, Irina; Minshull, Thomas C; Ince, Paul G; Dickman, Mark J; Hautbergue, Guillaume M; Wharton, Stephen B
2018-05-08
Occludin is a component of tight junctions, which are essential structural components of the blood-brain barrier. However, occludin is expressed in cells without tight junctions, implying additional functions. We determined the expression and localisation of occludin in astrocytes in cell culture and in human brain tissue, and sought novel binding partners using a proteomic approach. Expression was investigated by immunocytochemistry and immunoblotting in the 1321N1 astrocytoma cell line and ScienCell human primary astrocytes, and by immunohistochemistry in human autopsy brain tissue. Recombinant N- and C-terminal occludin was used to pull-down proteins from 1321N1 cell lysates and protein-binding partners identified by mass spectrometry analysis. Occludin was expressed in both the cytoplasm and nucleus of astrocytes in vitro and in vivo. Mass spectrometry identified binding to nuclear and cytoplasmic proteins, particularly those related to RNA metabolism and nuclear function. Occludin is expressed in several subcellular compartments of brain cell-types that do not form tight junctions and the expression patterns in cell culture reflect those in human brain tissue, indicating they are suitable model systems. Proteomic analysis suggests that occludin has novel functions in neuroepithelial cells that are unrelated to tight junction formation. Further research will establish the roles of these functions in both cellular physiology and in disease states. © 2018 The Authors. European Journal of Neuroscience published by Federation of European Neuroscience Societies and John Wiley & Sons Ltd.
Measure Guideline: Optimizing the Configuration of Flexible Duct Junction Boxes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Beach, R.; Burdick, A.
2014-03-01
This measure guideline offers additional recommendations to heating, ventilation, and air conditioning (HVAC) system designers for optimizing flexible duct, constant-volume HVAC systems using junction boxes within Air Conditioning Contractors of America (ACCA) Manual D guidance (Rutkowski, H. Manual D -- Residential Duct Systems, 3rd edition, Version 1.00. Arlington, VA: Air Conditioning Contractors of America, 2009.). IBACOS used computational fluid dynamics software to explore and develop guidance to better control the airflow effects of factors that may impact pressure losses within junction boxes among various design configurations (Beach, R., Prahl, D., and Lange, R. CFD Analysis of Flexible Duct Junction Boxmore » Design. Golden, CO: National Renewable Energy Laboratory, submitted for publication 2013). These recommendations can help to ensure that a system aligns more closely with the design and the occupants' comfort expectations. Specifically, the recommendations described herein show how to configure a rectangular box with four outlets, a triangular box with three outlets, metal wyes with two outlets, and multiple configurations for more than four outlets. Designers of HVAC systems, contractors who are fabricating junction boxes on site, and anyone using the ACCA Manual D process for sizing duct runs will find this measure guideline invaluable for more accurately minimizing pressure losses when using junction boxes with flexible ducts.« less
Zhang, Yuan; Tan, Xiaoming; Xue, Lianfang
2018-01-01
The α2-adrenoceptor inducer dexmedetomidine protects against acute lung injury (ALI), but the mechanism of this effect is largely unknown. The present study investigated the effect of dexmedetomidine on apoptosis induced by lipopolysaccharide (LPS) and the relationship between this effect and gap junction intercellular communication in human lung fibroblast cell line. Flow cytometry was used to detect apoptosis induced by LPS. Parachute dye coupling assay was used to measure gap junction function, and western blot analysis was used to determine the expression levels of connexin43 (Cx43). The results revealed that exposure of human lung fibroblast cell line to LPS for 24 h increased the apoptosis, and pretreatment of dexmedetomidine and 18α-GA significantly reduced LPS-induced apoptosis. Dexmedetomidine exposure for 1 h inhibited gap junction function mainly via a decrease in Cx43 protein levels in human lung fibroblast cell line. These results demonstrated that the inhibition of gap junction intercellular communication by dexmedetomidine affected the LPS-induced apoptosis through inhibition of gap junction function by reducing Cx43 protein levels. The present study provides evidence of a novel mechanism underlying the effects of analgesics in counteracting ALI. Copyright © 2017 Elsevier Inc. All rights reserved.
Curzi, Davide; Baldassarri, Valentina; De Matteis, Rita; Salamanna, Francesca; Bolotta, Alessandra; Frizziero, Antonio; Fini, Milena; Marini, Marina; Falcieri, Elisabetta
2015-04-01
Myotendinous junction is the muscle-tendon interface through which the contractile force can be transferred from myofibrils to the tendon extracellular matrix. At the ultrastructural level, aerobic training can modify the distal myotendinous junction of rat gastrocnemius, increasing the contact area between tissues. The aim of this work is to investigate the correlation between morphological changes and protein modulation of the myotendinous junction following moderate training. For this reason, talin, vinculin and type IV collagen amount and spatial distribution were investigated by immunohistochemistry and confocal microscopy. The images were then digitally analyzed by evaluating fluorescence intensity. Morphometric analysis revealed a significant increased thickening of muscle basal lamina in the trained group (53.1 ± 0.4 nm) with respect to the control group (43.9 ± 0.3 nm), and morphological observation showed the presence of an electron-dense area in the exercised muscles, close to the myotendinous junction. Protein concentrations appeared significantly increased in the trained group (talin +22.2%; vinculin +22.8% and type IV collagen +11.8%) with respect to the control group. Therefore, our findings suggest that moderate aerobic training induces/causes morphological changes at the myotendinous junction, correlated to the synthesis of structural proteins of the muscular basal lamina and of the cytoskeleton.
Genetics, structure, and prevalence of FP967 (CDC Triffid) T-DNA in flax.
Young, Lester; Hammerlindl, Joseph; Babic, Vivijan; McLeod, Jamille; Sharpe, Andrew; Matsalla, Chad; Bekkaoui, Faouzi; Marquess, Leigh; Booker, Helen M
2015-01-01
The detection of T-DNA from a genetically modified flaxseed line (FP967, formally CDC Triffid) in a shipment of Canadian flaxseed exported to Europe resulted in a large decrease in the amount of flax planted in Canada. The Canadian flaxseed industry undertook major changes to ensure the removal of FP967 from the supply chain. This study aimed to resolve the genetics and structure of the FP967 transfer DNA (T-DNA). The FP967 T-DNA is thought to be inserted in at single genomic locus. The junction between the T-DNA and genomic DNA consisted of two inverted Right Borders with no Left Border (LB) flanking genomic DNA sequences recovered. This information was used to develop an event-specific quantitative PCR (qPCR) assay. This assay and an existing assay specific to the T-DNA construct were used to determine the genetics and prevalence of the FP967 T-DNA. These data supported the hypothesis that the T-DNA is present at a single location in the genome. The FP967 T-DNA is present at a low level (between 0.01 and 0.1%) in breeder seed lots from 2009 and 2010. None of the 11,000 and 16,000 lines selected for advancement through the Flax Breeding Program in 2010 and 2011, respectively, tested positive for the FP967 T-DNA, however. Most of the FP967 T-DNA sequence was resolved via PCR cloning and next generation sequencing. A 3,720 bp duplication of an internal portion of the T-DNA (including a Right Border) was discovered between the flanking genomic DNA and the LB. An event-specific assay, SAT2-LB, was developed for the junction between this repeat and the LB.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Müller, Ralph, E-mail: ralph.mueller@ise.fraunhofer.de; Schrof, Julian; Reichel, Christian
2014-09-08
The highest energy conversion efficiencies in the field of silicon-based photovoltaics have been achieved with back-junction back-contact (BJBC) silicon solar cells by several companies and research groups. One of the most complex parts of this cell structure is the fabrication of the locally doped p- and n-type regions, both on the back side of the solar cell. In this work, we introduce a process sequence based on a synergistic use of ion implantation and furnace diffusion. This sequence enables the formation of all doped regions for a BJBC silicon solar cell in only three processing steps. We observed that implantedmore » phosphorus can block the diffusion of boron atoms into the silicon substrate by nearly three orders of magnitude. Thus, locally implanted phosphorus can be used as an in-situ mask for a subsequent boron diffusion which simultaneously anneals the implanted phosphorus and forms the boron emitter. BJBC silicon solar cells produced with such an easy-to-fabricate process achieved conversion efficiencies of up to 21.7%. An open-circuit voltage of 674 mV and a fill factor of 80.6% prove that there is no significant recombination at the sharp transition between the highly doped emitter and the highly doped back surface field at the device level.« less