Noise, gain, and capture probability of p-type InAs-GaAs quantum-dot and quantum dot-in-well infrared photodetectors

NASA Astrophysics Data System (ADS)

Wolde, Seyoum; Lao, Yan-Feng; Unil Perera, A. G.; Zhang, Y. H.; Wang, T. M.; Kim, J. O.; Schuler-Sandy, Ted; Tian, Zhao-Bing; Krishna, S.

2017-06-01

We report experimental results showing how the noise in a Quantum-Dot Infrared photodetector (QDIP) and Quantum Dot-in-a-well (DWELL) varies with the electric field and temperature. At lower temperatures (below ˜100 K), the noise current of both types of detectors is dominated by generation-recombination (G-R) noise which is consistent with a mechanism of fluctuations driven by the electric field and thermal noise. The noise gain, capture probability, and carrier life time for bound-to-continuum or quasi-bound transitions in DWELL and QDIP structures are discussed. The capture probability of DWELL is found to be more than two times higher than the corresponding QDIP. Based on the analysis, structural parameters such as the numbers of active layers, the surface density of QDs, and the carrier capture or relaxation rate, type of material, and electric field are some of the optimization parameters identified to improve the gain of devices.

Cryo-Scanning Electron Microscopy of Captured Cirrus Ice Particles

NASA Astrophysics Data System (ADS)

Magee, N. B.; Boaggio, K.; Bandamede, M.; Bancroft, L.; Hurler, K.

2016-12-01

We present the latest collection of high-resolution cryo-scanning electron microscopy images and microanalysis of cirrus ice particles captured by high-altitude balloon (ICE-Ball, see abstracts by K. Boaggio and M. Bandamede). Ice particle images and sublimation-residues are derived from particles captured during approximately 15 balloon flights conducted in Pennsylvania and New Jersey over the past 12 months. Measurements include 3D digital elevation model reconstructions of ice particles, and associated statistical analyses of entire particles and particle sub-facets and surfaces. This 3D analysis reveals that morphologies of most ice particles captured deviate significantly from ideal habits, and display geometric complexity and surface roughness at multiple measureable scales, ranging from 100's nanometers to 100's of microns. The presentation suggests potential a path forward for representing scattering from a realistically complex array of ice particle shapes and surfaces.

Isomer depletion as experimental evidence of nuclear excitation by electron capture

NASA Astrophysics Data System (ADS)

Chiara, C. J.; Carroll, J. J.; Carpenter, M. P.; Greene, J. P.; Hartley, D. J.; Janssens, R. V. F.; Lane, G. J.; Marsh, J. C.; Matters, D. A.; Polasik, M.; Rzadkiewicz, J.; Seweryniak, D.; Zhu, S.; Bottoni, S.; Hayes, A. B.; Karamian, S. A.

2018-02-01

The atomic nucleus and its electrons are often thought of as independent systems that are held together in the atom by their mutual attraction. Their interaction, however, leads to other important effects, such as providing an additional decay mode for excited nuclear states, whereby the nucleus releases energy by ejecting an atomic electron instead of by emitting a γ-ray. This ‘internal conversion’ has been known for about a hundred years and can be used to study nuclei and their interaction with their electrons. In the inverse process—nuclear excitation by electron capture (NEEC)—a free electron is captured into an atomic vacancy and can excite the nucleus to a higher-energy state, provided that the kinetic energy of the free electron plus the magnitude of its binding energy once captured matches the nuclear energy difference between the two states. NEEC was predicted in 1976 and has not hitherto been observed. Here we report evidence of NEEC in molybdenum-93 and determine the probability and cross-section for the process in a beam-based experimental scenario. Our results provide a standard for the assessment of theoretical models relevant to NEEC, which predict cross-sections that span many orders of magnitude. The greatest practical effect of the NEEC process may be on the survival of nuclei in stellar environments, in which it could excite isomers (that is, long-lived nuclear states) to shorter-lived states. Such excitations may reduce the abundance of the isotope after its production. This is an example of ‘isomer depletion’, which has been investigated previously through other reactions, but is used here to obtain evidence for NEEC.

A comparison of conventional capture versus PIT reader techniques for estimating survival and capture probabilities of big brown bats (Eptesicus fuscus)

USGS Publications Warehouse

Ellison, L.E.; O'Shea, T.J.; Neubaum, D.J.; Neubaum, M.A.; Pearce, R.D.; Bowen, R.A.

2007-01-01

We compared conventional capture (primarily mist nets and harp traps) and passive integrated transponder (PIT) tagging techniques for estimating capture and survival probabilities of big brown bats (Eptesicus fuscus) roosting in buildings in Fort Collins, Colorado. A total of 987 female adult and juvenile bats were captured and marked by subdermal injection of PIT tags during the summers of 2001-2005 at five maternity colonies in buildings. Openings to roosts were equipped with PIT hoop-style readers, and exit and entry of bats were passively monitored on a daily basis throughout the summers of 2002-2005. PIT readers 'recaptured' adult and juvenile females more often than conventional capture events at each roost. Estimates of annual capture probabilities for all five colonies were on average twice as high when estimated from PIT reader data (P?? = 0.93-1.00) than when derived from conventional techniques (P?? = 0.26-0.66), and as a consequence annual survival estimates were more precisely estimated when using PIT reader encounters. Short-term, daily capture estimates were also higher using PIT readers than conventional captures. We discuss the advantages and limitations of using PIT tags and passive encounters with hoop readers vs. conventional capture techniques for estimating these vital parameters in big brown bats. ?? Museum and Institute of Zoology PAS.

Identifying sources of heterogeneity in capture probabilities: An example using the Great Tit Parus major

USGS Publications Warehouse

Senar, J.C.; Conroy, M.J.; Carrascal, L.M.; Domenech, J.; Mozetich, I.; Uribe, F.

1999-01-01

Heterogeneous capture probabilities are a common problem in many capture-recapture studies. Several methods of detecting the presence of such heterogeneity are currently available, and stratification of data has been suggested as the standard method to avoid its effects. However, few studies have tried to identify sources of heterogeneity, or whether there are interactions among sources. The aim of this paper is to suggest an analytical procedure to identify sources of capture heterogeneity. We use data on the sex and age of Great Tits captured in baited funnel traps, at two localities differing in average temperature. We additionally use 'recapture' data obtained by videotaping at feeder (with no associated trap), where the tits ringed with different colours were recorded. This allowed us to test whether individuals in different classes (age, sex and condition) are not trapped because of trap shyness or because o a reduced use of the bait. We used logistic regression analysis of the capture probabilities to test for the effects of age, sex, condition, location and 'recapture method. The results showed a higher recapture probability in the colder locality. Yearling birds (either males or females) had the highest recapture prob abilities, followed by adult males, while adult females had the lowest recapture probabilities. There was no effect of the method of 'recapture' (trap or video tape), which suggests that adult females are less often captured in traps no because of trap-shyness but because of less dependence on supplementary food. The potential use of this methodological approach in other studies is discussed.

Orbital Electron Capture Rates in Extreme Astrophysical Environments

NASA Astrophysics Data System (ADS)

Martin, Matthew; McDonald, William; Leach, Kyle

2017-09-01

In an attempt to better understand EC decay rates in hot environments, we have developed a program to examine and parse all evaluated atomic and nuclear data. Taking into account the effects of ionization on accessible decay states and electron capture probabilities, half lives across the nuclear chart can be investigated without the need for theoretical estimates. Part of the ongoing project will include isolating stable isotopes that become unstable due to ionization and estimating their stability in these new environments. In addition, we hope to account for a thermal population of excited states to better simulate these environments. This should aide in the complete understanding of nuclear processes in these extreme astrophysical environments. This work is supported in part by the U.S. Department of Energy, Office of Science, Office of Nuclear Physics.

Study of photon emission by electron capture during solar nuclei acceleration. 3: Photon production evaluations

NASA Technical Reports Server (NTRS)

Perez-Peraza, J.; Alvarez, M.; Gallegos, A.

1985-01-01

Lower limits of photon fluxes were evaluated from electron capture during acceleration in solar flares, because the arbitrary q sub c asterisk assumed in this work evolves very slow with velocity, probably much more slowly than the physical actual situation: in fact, more emission is expected toward the IR region. Nevertheless the authors claim to show that the factibility of sounding acceleration processes, charge evolution processes and physical parameters of the source itself, by the observational analysis of this kind of emissions. For instance, it would be interesting to search observationally, for the predicted flux and energy drift of F sub e ions interacting with the atomic 0 and F sub e of the source matter, or, even more feasible for the X-ray lines at 4.2 keV and 2.624 + 0.003 KeV from Fe and S ions in ionized Fe at T = 10 to the 7th power K respectively, the 418 + or - 2 eV and 20 + or - 4 eV lines of Fe and S in ionized Fe at 5 x 10 to the 6th power K, which are predicted from Fermi acceleration.

Estimating state-transition probabilities for unobservable states using capture-recapture/resighting data

USGS Publications Warehouse

Kendall, W.L.; Nichols, J.D.

2002-01-01

Temporary emigration was identified some time ago as causing potential problems in capture-recapture studies, and in the last five years approaches have been developed for dealing with special cases of this general problem. Temporary emigration can be viewed more generally as involving transitions to and from an unobservable state, and frequently the state itself is one of biological interest (e.g., 'nonbreeder'). Development of models that permit estimation of relevant parameters in the presence of an unobservable state requires either extra information (e.g., as supplied by Pollock's robust design) or the following classes of model constraints: reducing the order of Markovian transition probabilities, imposing a degree of determinism on transition probabilities, removing state specificity of survival probabilities, and imposing temporal constancy of parameters. The objective of the work described in this paper is to investigate estimability of model parameters under a variety of models that include an unobservable state. Beginning with a very general model and no extra information, we used numerical methods to systematically investigate the use of ancillary information and constraints to yield models that are useful for estimation. The result is a catalog of models for which estimation is possible. An example analysis of sea turtle capture-recapture data under two different models showed similar point estimates but increased precision for the model that incorporated ancillary data (the robust design) when compared to the model with deterministic transitions only. This comparison and the results of our numerical investigation of model structures lead to design suggestions for capture-recapture studies in the presence of an unobservable state.

Estimating the population size and colony boundary of subterranean termites by using the density functions of directionally averaged capture probability.

PubMed

Su, Nan-Yao; Lee, Sang-Hee

2008-04-01

Marked termites were released in a linear-connected foraging arena, and the spatial heterogeneity of their capture probabilities was averaged for both directions at distance r from release point to obtain a symmetrical distribution, from which the density function of directionally averaged capture probability P(x) was derived. We hypothesized that as marked termites move into the population and given sufficient time, the directionally averaged capture probability may reach an equilibrium P(e) over the distance r and thus satisfy the equal mixing assumption of the mark-recapture protocol. The equilibrium capture probability P(e) was used to estimate the population size N. The hypothesis was tested in a 50-m extended foraging arena to simulate the distance factor of field colonies of subterranean termites. Over the 42-d test period, the density functions of directionally averaged capture probability P(x) exhibited four phases: exponential decline phase, linear decline phase, equilibrium phase, and postequilibrium phase. The equilibrium capture probability P(e), derived as the intercept of the linear regression during the equilibrium phase, correctly projected N estimates that were not significantly different from the known number of workers in the arena. Because the area beneath the probability density function is a constant (50% in this study), preequilibrium regression parameters and P(e) were used to estimate the population boundary distance 1, which is the distance between the release point and the boundary beyond which the population is absent.

Electronic case report forms and electronic data capture within clinical trials and pharmacoepidemiology

PubMed Central

Flynn, Robert W. V.; Grieve, Kerr; Doney, Alexander; Mackenzie, Isla; MacDonald, Thomas M.; Rogers, Amy

2017-01-01

Aims Researchers in clinical and pharmacoepidemiology fields have adopted information technology (IT) and electronic data capture, but these remain underused despite the benefits. This review discusses electronic case report forms and electronic data capture, specifically within pharmacoepidemiology and clinical research. Methods The review used PubMed and the Institute of Electrical and Electronic Engineers library. Search terms used were agreed by the authors and documented. PubMed is medical and health based, whereas Institute of Electrical and Electronic Engineers is technology based. The review focuses on electronic case report forms and electronic data capture, but briefly considers other relevant topics; consent, ethics and security. Results There were 1126 papers found using the search terms. Manual filtering and reviewing of abstracts further condensed this number to 136 relevant manuscripts. The papers were further categorized: 17 contained study data; 40 observational data; 27 anecdotal data; 47 covering methodology or design of systems; one case study; one literature review; two feasibility studies; and one cost analysis. Conclusion Electronic case report forms, electronic data capture and IT in general are viewed with enthusiasm and are seen as a cost‐effective means of improving research efficiency, educating participants and improving trial recruitment, provided concerns about how data will be protected from misuse can be addressed. Clear operational guidelines and best practises are key for healthcare providers, and researchers adopting IT, and further work is needed on improving integration of new technologies with current systems. A robust method of evaluation for technical innovation is required. PMID:28276585

Elastic K-means using posterior probability

PubMed Central

Zheng, Aihua; Jiang, Bo; Li, Yan; Zhang, Xuehan; Ding, Chris

2017-01-01

The widely used K-means clustering is a hard clustering algorithm. Here we propose a Elastic K-means clustering model (EKM) using posterior probability with soft capability where each data point can belong to multiple clusters fractionally and show the benefit of proposed Elastic K-means. Furthermore, in many applications, besides vector attributes information, pairwise relations (graph information) are also available. Thus we integrate EKM with Normalized Cut graph clustering into a single clustering formulation. Finally, we provide several useful matrix inequalities which are useful for matrix formulations of learning models. Based on these results, we prove the correctness and the convergence of EKM algorithms. Experimental results on six benchmark datasets demonstrate the effectiveness of proposed EKM and its integrated model. PMID:29240756

Elastic K-means using posterior probability.

PubMed

Zheng, Aihua; Jiang, Bo; Li, Yan; Zhang, Xuehan; Ding, Chris

2017-01-01

The widely used K-means clustering is a hard clustering algorithm. Here we propose a Elastic K-means clustering model (EKM) using posterior probability with soft capability where each data point can belong to multiple clusters fractionally and show the benefit of proposed Elastic K-means. Furthermore, in many applications, besides vector attributes information, pairwise relations (graph information) are also available. Thus we integrate EKM with Normalized Cut graph clustering into a single clustering formulation. Finally, we provide several useful matrix inequalities which are useful for matrix formulations of learning models. Based on these results, we prove the correctness and the convergence of EKM algorithms. Experimental results on six benchmark datasets demonstrate the effectiveness of proposed EKM and its integrated model.

Search for two-neutrino double electron capture of 124Xe with XENON100

NASA Astrophysics Data System (ADS)

Aprile, E.; Aalbers, J.; Agostini, F.; Alfonsi, M.; Amaro, F. D.; Anthony, M.; Arneodo, F.; Barrow, P.; Baudis, L.; Bauermeister, B.; Benabderrahmane, M. L.; Berger, T.; Breur, P. A.; Brown, A.; Brown, E.; Bruenner, S.; Bruno, G.; Budnik, R.; Bütikofer, L.; Calvén, J.; Cardoso, J. M. R.; Cervantes, M.; Cichon, D.; Coderre, D.; Colijn, A. P.; Conrad, J.; Cussonneau, J. P.; Decowski, M. P.; de Perio, P.; di Gangi, P.; di Giovanni, A.; Diglio, S.; Duchovni, E.; Fei, J.; Ferella, A. D.; Fieguth, A.; Franco, D.; Fulgione, W.; Gallo Rosso, A.; Galloway, M.; Gao, F.; Garbini, M.; Geis, C.; Goetzke, L. W.; Greene, Z.; Grignon, C.; Hasterok, C.; Hogenbirk, E.; Itay, R.; Kaminsky, B.; Kessler, G.; Kish, A.; Landsman, H.; Lang, R. F.; Lellouch, D.; Levinson, L.; Le Calloch, M.; Levy, C.; Lin, Q.; Lindemann, S.; Lindner, M.; Lopes, J. A. M.; Manfredini, A.; Marrodán Undagoitia, T.; Masbou, J.; Massoli, F. V.; Masson, D.; Mayani, D.; Meng, Y.; Messina, M.; Micheneau, K.; Miguez, B.; Molinario, A.; Murra, M.; Naganoma, J.; Ni, K.; Oberlack, U.; Orrigo, S. E. A.; Pakarha, P.; Pelssers, B.; Persiani, R.; Piastra, F.; Pienaar, J.; Piro, M.-C.; Plante, G.; Priel, N.; Rauch, L.; Reichard, S.; Reuter, C.; Rizzo, A.; Rosendahl, S.; Rupp, N.; Dos Santos, J. M. F.; Sartorelli, G.; Scheibelhut, M.; Schindler, S.; Schreiner, J.; Schumann, M.; Scotto Lavina, L.; Selvi, M.; Shagin, P.; Silva, M.; Simgen, H.; Sivers, M. V.; Stein, A.; Thers, D.; Tiseni, A.; Trinchero, G.; Tunnell, C. D.; Wall, R.; Wang, H.; Weber, M.; Wei, Y.; Weinheimer, C.; Wulf, J.; Zhang, Y.; Xenon Collaboration

2017-02-01

Two-neutrino double electron capture is a rare nuclear decay where two electrons are simultaneously captured from the atomic shell. For 124Xe this process has not yet been observed and its detection would provide a new reference for nuclear matrix element calculations. We have conducted a search for two-neutrino double electron capture from the K shell of 124Xe using 7636 kg d of data from the XENON100 dark matter detector. Using a Bayesian analysis we observed no significant excess above background, leading to a lower 90% credibility limit on the half-life T1 /2>6.5 ×1020 yr. We have also evaluated the sensitivity of the XENON1T experiment, which is currently being commissioned, and found a sensitivity of T1 /2>6.1 ×1022 yr after an exposure of 2 t yr .

Electronic case report forms and electronic data capture within clinical trials and pharmacoepidemiology.

PubMed

Rorie, David A; Flynn, Robert W V; Grieve, Kerr; Doney, Alexander; Mackenzie, Isla; MacDonald, Thomas M; Rogers, Amy

2017-09-01

Researchers in clinical and pharmacoepidemiology fields have adopted information technology (IT) and electronic data capture, but these remain underused despite the benefits. This review discusses electronic case report forms and electronic data capture, specifically within pharmacoepidemiology and clinical research. The review used PubMed and the Institute of Electrical and Electronic Engineers library. Search terms used were agreed by the authors and documented. PubMed is medical and health based, whereas Institute of Electrical and Electronic Engineers is technology based. The review focuses on electronic case report forms and electronic data capture, but briefly considers other relevant topics; consent, ethics and security. There were 1126 papers found using the search terms. Manual filtering and reviewing of abstracts further condensed this number to 136 relevant manuscripts. The papers were further categorized: 17 contained study data; 40 observational data; 27 anecdotal data; 47 covering methodology or design of systems; one case study; one literature review; two feasibility studies; and one cost analysis. Electronic case report forms, electronic data capture and IT in general are viewed with enthusiasm and are seen as a cost-effective means of improving research efficiency, educating participants and improving trial recruitment, provided concerns about how data will be protected from misuse can be addressed. Clear operational guidelines and best practises are key for healthcare providers, and researchers adopting IT, and further work is needed on improving integration of new technologies with current systems. A robust method of evaluation for technical innovation is required. © 2017 The Authors. British Journal of Clinical Pharmacology published by John Wiley & Sons Ltd on behalf of British Pharmacological Society.

Single and double capture in F9+ + Ar collisions: Comparison of total capture with capture occurring from the Ar K shell

NASA Astrophysics Data System (ADS)

La Mantia, David; Kumara, Nuwan; Kayani, Asghar; Simon, Anna; Tanis, John

2016-05-01

Total cross sections for single and double capture, as well as the corresponding cross sections for capture resulting in the emission of an Ar K x ray, were measured. This work was performed at Western Michigan University with the use of the tandem Van de Graaff accelerator. A 45 MeV beam of fully-stripped fluorine ions was collided with argon gas molecules in a differentially pumped cell. Surface barrier detectors were used to observe the charge changed projectiles and a Si(Li) x-ray detector, placed at 90o to the incident beam, were used to measure coincidences with Ar K x rays. The total capture cross sections are compared to previously measured cross sections in the existing literature. The coincidence cross sections, considerably smaller than the total cross sections, are found to be nearly equal for single and double capture in contrast to the total cross sections, which vary by about an order of magnitude. Possible reasons for this behavior are discussed. Supported in part by the NSF.

Measuring double-electron capture with liquid xenon experiments

NASA Astrophysics Data System (ADS)

Mei, D.-M.; Marshall, I.; Wei, W.-Z.; Zhang, C.

2014-01-01

We investigate the possibilities of observing the decay mode for 124Xe in which two electrons are captured, two neutrinos are emitted, and the final daughter nucleus is in its ground state, using dark matter experiments with liquid xenon. The first upper limit of the decay half-life is calculated to be 1.66 × 1021 years at a 90% confidence level (C.L.) obtained with the published background data from the XENON100 experiment. Employing a known background model from the large underground xenon (LUX) experiment, we predict that the detection of double-electron capture of 124Xe to the ground state of 124Te with LUX will have approximately 115 events, assuming a half-life of 2.9 × 1021 years. We conclude that measuring 124Xe 2ν double-electron capture to the ground state of 124Te can be performed more precisely with the proposed LUX-Zeplin (LZ) experiment.

Image charge effects on electron capture by dust grains in dusty plasmas.

PubMed

Jung, Y D; Tawara, H

2001-07-01

Electron-capture processes by negatively charged dust grains from hydrogenic ions in dusty plasmas are investigated in accordance with the classical Bohr-Lindhard model. The attractive interaction between the electron in a hydrogenic ion and its own image charge inside the dust grain is included to obtain the total interaction energy between the electron and the dust grain. The electron-capture radius is determined by the total interaction energy and the kinetic energy of the released electron in the frame of the projectile dust grain. The classical straight-line trajectory approximation is applied to the motion of the ion in order to visualize the electron-capture cross section as a function of the impact parameter, kinetic energy of the projectile ion, and dust charge. It is found that the image charge inside the dust grain plays a significant role in the electron-capture process near the surface of the dust grain. The electron-capture cross section is found to be quite sensitive to the collision energy and dust charge.

Development of Holmium-163 electron-capture spectroscopy with transition-edge sensors

DOE PAGES

Croce, Mark Philip; Rabin, Michael W.; Mocko, Veronika; ...

2016-08-01

Calorimetric decay energy spectroscopy of electron-capture-decaying isotopes is a promising method to achieve the sensitivity required for electron neutrino mass measurement. The very low total nuclear decay energy (Q EC < 3 keV) and short half-life (4570 years) of 163Ho make it attractive for high-precision electron-capture spectroscopy (ECS) near the kinematic endpoint, where the neutrino momentum goes to zero. In the ECS approach, an electron-capture-decaying isotope is embedded inside a microcalorimeter designed to capture and measure the energy of all the decay radiation except that of the escaping neutrino. We have developed a complete process for proton irradiation-based isotope production,more » isolation, and purification of 163Ho. We have developed transition-edge sensors for this measurement and methods for incorporating 163Ho into high-resolution microcalorimeters, and have measured the electron-capture spectrum of 163Ho. Finally, we present our work in these areas and discuss the measured spectrum and its comparison to current theory.« less

Development of Holmium-163 electron-capture spectroscopy with transition-edge sensors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Croce, Mark Philip; Rabin, Michael W.; Mocko, Veronika

Calorimetric decay energy spectroscopy of electron-capture-decaying isotopes is a promising method to achieve the sensitivity required for electron neutrino mass measurement. The very low total nuclear decay energy (Q EC < 3 keV) and short half-life (4570 years) of 163Ho make it attractive for high-precision electron-capture spectroscopy (ECS) near the kinematic endpoint, where the neutrino momentum goes to zero. In the ECS approach, an electron-capture-decaying isotope is embedded inside a microcalorimeter designed to capture and measure the energy of all the decay radiation except that of the escaping neutrino. We have developed a complete process for proton irradiation-based isotope production,more » isolation, and purification of 163Ho. We have developed transition-edge sensors for this measurement and methods for incorporating 163Ho into high-resolution microcalorimeters, and have measured the electron-capture spectrum of 163Ho. Finally, we present our work in these areas and discuss the measured spectrum and its comparison to current theory.« less

Calculated gadolinium atomic electron energy levels and Auger electron emission probability as a function of atomic number Z

NASA Astrophysics Data System (ADS)

Miloshevsky, G. V.; Tolkach, V. I.; Shani, Gad; Rozin, Semion

2002-06-01

Auger electron interaction with matter is gaining importance in particular in medical application of radiation. The production probability and energy spectrum is therefore of great importance. A good source of Auger electrons is the 157Gd(n,γ) 158Gd reaction. The present article describes calculations of electron levels in Gd atoms and provides missing data of outer electron energy levels. The energy of these electron levels missing in published tables, was found to be in the 23-24 and 6-7 eV energy ranges respectively. The probability of Auger emission was calculated as an interaction of wave function of the initial and final electron states. The wave functions were calculated using the Hartree-Fock-Slater approximation with relativistic correction. The equations were solved using a spherical symmetry potential. The error for inner shell level is less than 10%, it is increased to the order of 10-15% for the outer shells. The width of the Auger process changes from 0.1 to 1.2 eV for atomic number Z from 5 to 70. The fluorescence yield width changes five orders of magnitude in this range. Auger electron emission width from the K shell changes from 10 -2 to ˜1 eV with Z changing from 10 to 64, depending on the final state. For the L shell it changes from 0 to 0.25 when it Z changes from 20 to 64.

Electron number probability distributions for correlated wave functions.

PubMed

Francisco, E; Martín Pendás, A; Blanco, M A

2007-03-07

Efficient formulas for computing the probability of finding exactly an integer number of electrons in an arbitrarily chosen volume are only known for single-determinant wave functions [E. Cances et al., Theor. Chem. Acc. 111, 373 (2004)]. In this article, an algebraic method is presented that extends these formulas to the case of multideterminant wave functions and any number of disjoint volumes. The derived expressions are applied to compute the probabilities within the atomic domains derived from the space partitioning based on the quantum theory of atoms in molecules. Results for a series of test molecules are presented, paying particular attention to the effects of electron correlation and of some numerical approximations on the computed probabilities.

Ultralow energy calibration of LUX detector using Xe 127 electron capture

DOE PAGES

Akerib, D. S.; Alsum, S.; Araújo, H. M.; ...

2017-12-01

We report an absolute calibration of the ionization yields(more » $$\\textit{Q$$_y$})$ and fluctuations for electronic recoil events in liquid xenon at discrete energies between 186 eV and 33.2 keV. The average electric field applied across the liquid xenon target is 180 V/cm. The data are obtained using low energy $$^{127}$$Xe electron capture decay events from the 95.0-day first run from LUX (WS2013) in search of Weakly Interacting Massive Particles (WIMPs). The sequence of gamma-ray and X-ray cascades associated with $$^{127}$$I de-excitations produces clearly identified 2-vertex events in the LUX detector. We observe the K- (binding energy, 33.2 keV), L- (5.2 keV), M- (1.1 keV), and N- (186 eV) shell cascade events and verify that the relative ratio of observed events for each shell agrees with calculations. The N-shell cascade analysis includes single extracted electron (SE) events and represents the lowest-energy electronic recoil $$\\textit{in situ}$$ measurements that have been explored in liquid xenon.« less

Ultralow energy calibration of LUX detector using Xe 127 electron capture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akerib, D. S.; Alsum, S.; Araújo, H. M.

We report an absolute calibration of the ionization yields (Q y) and fluctuations for electronic recoil events in liquid xenon at discrete energies between 186 eV and 33.2 keV. The average electric field applied across the liquid xenon target is 180 V/cm. The data are obtained using low energy 127Xe electron capture decay events from the 95.0-day first run from LUX (WS2013) in search of weakly interacting massive particles. The sequence of gamma-ray and x-ray cascades associated with 127I deexcitations produces clearly identified two-vertex events in the LUX detector. We observe the K-(binding energy, 33.2 keV), L-(5.2 keV), M-(1.1 keV),more » and N-(186 eV) shell cascade events and verify that the relative ratio of observed events for each shell agrees with calculations. In conclusion, the N-shell cascade analysis includes single extracted electron (SE) events and represents the lowest-energy electronic recoil in situ measurements that have been explored in liquid xenon.« less

Ultralow energy calibration of LUX detector using Xe 127 electron capture

DOE PAGES

Akerib, D. S.; Alsum, S.; Araújo, H. M.; ...

2017-12-28

We report an absolute calibration of the ionization yields (Q y) and fluctuations for electronic recoil events in liquid xenon at discrete energies between 186 eV and 33.2 keV. The average electric field applied across the liquid xenon target is 180 V/cm. The data are obtained using low energy 127Xe electron capture decay events from the 95.0-day first run from LUX (WS2013) in search of weakly interacting massive particles. The sequence of gamma-ray and x-ray cascades associated with 127I deexcitations produces clearly identified two-vertex events in the LUX detector. We observe the K-(binding energy, 33.2 keV), L-(5.2 keV), M-(1.1 keV),more » and N-(186 eV) shell cascade events and verify that the relative ratio of observed events for each shell agrees with calculations. In conclusion, the N-shell cascade analysis includes single extracted electron (SE) events and represents the lowest-energy electronic recoil in situ measurements that have been explored in liquid xenon.« less

K β to K α X-ray intensity ratios and K to L shell vacancy transfer probabilities of Co, Ni, Cu, and Zn

NASA Astrophysics Data System (ADS)

Anand, L. F. M.; Gudennavar, S. B.; Bubbly, S. G.; Kerur, B. R.

2015-12-01

The K to L shell total vacancy transfer probabilities of low Z elements Co, Ni, Cu, and Zn are estimated by measuring the K β to K α intensity ratio adopting the 2π-geometry. The target elements were excited by 32.86 keV barium K-shell X-rays from a weak 137Cs γ-ray source. The emitted K-shell X-rays were detected using a low energy HPGe X-ray detector coupled to a 16 k MCA. The measured intensity ratios and the total vacancy transfer probabilities are compared with theoretical results and others' work, establishing a good agreement.

Search for neutrinoless double-electron capture of 156Dy

NASA Astrophysics Data System (ADS)

Finch, S. W.; Tornow, W.

2015-12-01

Background: Multiple large collaborations are currently searching for neutrinoless double-β decay, with the ultimate goal of differentiating the Majorana-Dirac nature of the neutrino. Purpose: Investigate the feasibility of resonant neutrinoless double-electron capture, an experimental alternative to neutrinoless double-β decay. Method: Two clover germanium detectors were operated underground in coincidence to search for the de-excitation γ rays of 156Gd following the neutrinoless double-electron capture of 156Dy. 231.95 d of data were collected at the Kimballton underground research facility with a 231.57 mg enriched 156Dy sample. Results: No counts were seen above background and half-life limits are set at O (1016-1018) yr for the various decay modes of 156Dy. Conclusion: Low background spectra were efficiently collected in the search for neutrinoless double-electron capture of 156Dy, although the low natural abundance and associated lack of large quantities of enriched samples hinders the experimental reach.

Analytical expressions for the closure probability of a stiff wormlike chain for finite capture radius.

PubMed

Guérin, T

2017-08-01

Estimating the probability that two monomers of the same polymer chain are close together is a key ingredient to characterize intramolecular reactions and polymer looping. In the case of stiff wormlike polymers (rigid fluctuating elastic rods), for which end-to-end encounters are rare events, we derive an explicit analytical formula for the probability η(r_{c}) that the distance between the chain extremities is smaller than some capture radius r_{c}. The formula is asymptotically exact in the limit of stiff chains, and it leads to the identification of two distinct scaling regimes for the closure factor, originating from a strong variation of the fluctuations of the chain orientation at closure. Our theory is compatible with existing analytical results from the literature that cover the cases of a vanishing capture radius and of nearly fully extended chains.

Electron capture into large-l Rydberg states of multiply charged ions escaping from solid surfaces

NASA Astrophysics Data System (ADS)

Nedeljković, N.; Nedeljković, Lj.; Mirković, M.

2003-07-01

We have investigated the electron capture into large-l Rydberg states of multiply charged ionic projectiles (e.g., the core charges Z=6, 7, and 8) escaping solid surfaces with intermediate velocities (v≈1 a.u.) in the normal emergence geometry. A model of the nonresonant electron capture from the solid conduction band into the moving large angular-momentum Rydberg states of the ions is developed through a generalization of our results obtained previously for the low-l cases (l=0, 1, and 2). The model is based on the two-wave-function dynamics of the Demkov-Ostrovskii type. The electron exchange process is described by a mixed flux through a moving plane (“Firsov plane”), placed between the solid surface and the ionic projectile. Due to low eccentricities of the large-l Rydberg systems, the mixed flux must be evaluated through the whole Firsov plane. It is for this purpose that a suitable asymptotic method is developed. For intermediate ionic velocities and for all relevant values of the principal quantum number n≈Z, the population probability Pnl is obtained as a nonlinear l distribution. The theoretical predictions concerning the ions S VI, Cl VII, and Ar VIII are compared with the available results of the beam-foil experiments.

Radiative one- and two-electron transitions into the empty K shell of He-like ions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kadrekar, Riddhi; Natarajan, L.

2011-12-15

The branching ratios between the single and double electron radiative transitions to empty K shell in He-like ions with 2s2p configuration are evaluated for 15 ions with 4{<=}Z{<=}26 using fully relativistic multiconfiguration Dirac-Fock wavefunctions in the active space approximation. The effects of configuration interaction and Breit contributions on the transition parameters have been analyzed in detail. Though the influence of Breit interaction on the electric dipole allowed one-electron radiative transitions is negligible, it substantially changes the spin-forbidden rates and the two-electron one-photon transition probabilities. Also, while the single electron transition rates are gauge independent, the correlated double-electron probabilities are foundmore » to be gauge sensitive. The probable uncertainties in the computed transition rates have been evaluated by considering the line strengths and the differences between the calculated and experimental transition energies as accuracy indicators. The present results are compared with other available experimental and theoretical data.« less

Rank-k Maximal Statistics for Divergence and Probability of Misclassification

NASA Technical Reports Server (NTRS)

Decell, H. P., Jr.

1972-01-01

A technique is developed for selecting from n-channel multispectral data some k combinations of the n-channels upon which to base a given classification technique so that some measure of the loss of the ability to distinguish between classes, using the compressed k-dimensional data, is minimized. Information loss in compressing the n-channel data to k channels is taken to be the difference in the average interclass divergences (or probability of misclassification) in n-space and in k-space.

Determination of the electron-capture coefficients and the concentration of free electrons in GaN from time-resolved photoluminescence

PubMed Central

Reshchikov, M. A.; McNamara, J. D.; Toporkov, M.; Avrutin, V.; Morkoç, H.; Usikov, A.; Helava, H.; Makarov, Yu.

2016-01-01

Point defects in high-purity GaN layers grown by hydride vapor phase epitaxy are studied by steady-state and time-resolved photoluminescence (PL). The electron-capture coefficients for defects responsible for the dominant defect-related PL bands in this material are found. The capture coefficients for all the defects, except for the green luminescence (GL1) band, are independent of temperature. The electron-capture coefficient for the GL1 band significantly changes with temperature because the GL1 band is caused by an internal transition in the related defect, involving an excited state acting as a giant trap for electrons. By using the determined electron-capture coefficients, the concentration of free electrons can be found at different temperatures by a contactless method. A new classification system is suggested for defect-related PL bands in undoped GaN. PMID:27901025

2013 R&D 100 Award: Movie-mode electron microscope captures nanoscale

ScienceCinema

Lagrange, Thomas; Reed, Bryan

2018-01-26

A new instrument developed by LLNL scientists and engineers, the Movie Mode Dynamic Transmission Electron Microscope (MM-DTEM), captures billionth-of-a-meter-scale images with frame rates more than 100,000 times faster than those of conventional techniques. The work was done in collaboration with a Pleasanton-based company, Integrated Dynamic Electron Solutions (IDES) Inc. Using this revolutionary imaging technique, a range of fundamental and technologically important material and biological processes can be captured in action, in complete billionth-of-a-meter detail, for the first time. The primary application of MM-DTEM is the direct observation of fast processes, including microstructural changes, phase transformations and chemical reactions, that shape real-world performance of nanostructured materials and potentially biological entities. The instrument could prove especially valuable in the direct observation of macromolecular interactions, such as protein-protein binding and host-pathogen interactions. While an earlier version of the technology, Single Shot-DTEM, could capture a single snapshot of a rapid process, MM-DTEM captures a multiframe movie that reveals complex sequences of events in detail. It is the only existing technology that can capture multiple electron microscopy images in the span of a single microsecond.

Investigation of the Mechanism of Electron Capture and Electron Transfer Dissociation of Peptides with a Covalently Attached Free Radical Hydrogen Atom Scavenger.

PubMed

Sohn, Chang Ho; Yin, Sheng; Peng, Ivory; Loo, Joseph A; Beauchamp, J L

2015-11-15

The mechanisms of electron capture and electron transfer dissociation (ECD and ETD) are investigated by covalently attaching a free-radical hydrogen atom scavenger to a peptide. The 2,2,6,6-tetramethylpiperidin-l-oxyl (TEMPO) radical was chosen as the scavenger due to its high hydrogen atom affinity (ca. 280 kJ/mol) and low electron affinity (ca. 0.45 ev), and was derivatized to the model peptide, FQX TEMPO EEQQQTEDELQDK. The X TEMPO residue represents a cysteinyl residue derivatized with an acetamido-TEMPO group. The acetamide group without TEMPO was also examined as a control. The gas phase proton affinity (882 kJ/mol) of TEMPO is similar to backbone amide carbonyls (889 kJ/mol), minimizing perturbation to internal solvation and sites of protonation of the derivatized peptides. Collision induced dissociation (CID) of the TEMPO tagged peptide dication generated stable odd-electron b and y type ions without indication of any TEMPO radical induced fragmentation initiated by hydrogen abstraction. The type and abundance of fragment ions observed in the CID spectra of the TEMPO and acetamide tagged peptides are very similar. However, ECD of the TEMPO labeled peptide dication yielded no backbone cleavage. We propose that a labile hydrogen atom in the charge reduced radical ions is scavenged by the TEMPO radical moiety, resulting in inhibition of N-C α backbone cleavage processes. Supplemental activation after electron attachment (ETcaD) and CID of the charge-reduced precursor ion generated by electron transfer of the TEMPO tagged peptide dication produced a series of b + H (b H ) and y + H (y H ) ions along with some c ions having suppressed intensities, consistent with stable O-H bond formation at the TEMPO group. In summary, the results indicate that ECD and ETD backbone cleavage processes are inhibited by scavenging of a labile hydrogen atom by the localized TEMPO radical moiety. This observation supports the conjecture that ECD and ETD processes involve long

Resonant electron capture by aspartame and aspartic acid molecules.

PubMed

Muftakhov, M V; Shchukin, P V

2016-12-30

The processes for dissociative electron capture are the key mechanisms for decomposition of biomolecules, proteins in particular, under interaction with low-energy electrons. Molecules of aspartic acid and aspartame, i.e. modified dipeptides, were studied herein to define the impact of the side functional groups on peptide chain decomposition in resonant electron-molecular reactions. The processes of formation and decomposition of negative ions of both aspartame and aspartic acid were studied by mass spectrometry of negative ions under resonant electron capture. The obtained mass spectra were interpreted under thermochemical analysis by quantum chemical calculations. Main channels of negative molecular ions fragmentation were found and characteristic fragment ions were identified. The СООН fragment of the side chain in aspartic acid is shown to play a key role like the carboxyl group in amino acids and aliphatic oligopeptides. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

K{sub β} to K{sub α} X-ray intensity ratios and K to L shell vacancy transfer probabilities of Co, Ni, Cu, and Zn

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anand, L. F. M.; Gudennavar, S. B., E-mail: shivappa.b.gudennavar@christuniversity.in; Bubbly, S. G.

The K to L shell total vacancy transfer probabilities of low Z elements Co, Ni, Cu, and Zn are estimated by measuring the K{sub β} to K{sub α} intensity ratio adopting the 2π-geometry. The target elements were excited by 32.86 keV barium K-shell X-rays from a weak {sup 137}Cs γ-ray source. The emitted K-shell X-rays were detected using a low energy HPGe X-ray detector coupled to a 16 k MCA. The measured intensity ratios and the total vacancy transfer probabilities are compared with theoretical results and others’ work, establishing a good agreement.

2013 R&D 100 Award: Movie-mode electron microscope captures nanoscale

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lagrange, Thomas; Reed, Bryan

2014-04-03

A new instrument developed by LLNL scientists and engineers, the Movie Mode Dynamic Transmission Electron Microscope (MM-DTEM), captures billionth-of-a-meter-scale images with frame rates more than 100,000 times faster than those of conventional techniques. The work was done in collaboration with a Pleasanton-based company, Integrated Dynamic Electron Solutions (IDES) Inc. Using this revolutionary imaging technique, a range of fundamental and technologically important material and biological processes can be captured in action, in complete billionth-of-a-meter detail, for the first time. The primary application of MM-DTEM is the direct observation of fast processes, including microstructural changes, phase transformations and chemical reactions, that shapemore » real-world performance of nanostructured materials and potentially biological entities. The instrument could prove especially valuable in the direct observation of macromolecular interactions, such as protein-protein binding and host-pathogen interactions. While an earlier version of the technology, Single Shot-DTEM, could capture a single snapshot of a rapid process, MM-DTEM captures a multiframe movie that reveals complex sequences of events in detail. It is the only existing technology that can capture multiple electron microscopy images in the span of a single microsecond.« less

Impact of electron-captures on nuclei near N = 50 on core-collapse supernovae

NASA Astrophysics Data System (ADS)

Titus, R.; Sullivan, C.; Zegers, R. G. T.; Brown, B. A.; Gao, B.

2018-01-01

The sensitivity of the late stages of stellar core collapse to electron-capture rates on nuclei is investigated, with a focus on electron-capture rates on 74 nuclei with neutron number close to 50, just above doubly magic 78Ni. It is demonstrated that variations in key characteristics of the evolution, such as the lepton fraction, electron fraction, entropy, stellar density, and in-fall velocity are about 50% due to uncertainties in the electron-capture rates on nuclei in this region, although thousands of nuclei are included in the simulations. The present electron-capture rate estimates used for the nuclei in this high-sensitivity region of the chart of isotopes are primarily based on a simple approximation, and it is shown that the estimated rates are likely too high, by an order of magnitude or more. Electron-capture rates based on Gamow-Teller strength distributions calculated in microscopic theoretical models will be required to obtain better estimates. Gamow-Teller distributions extracted from charge-exchange experiments performed at intermediate energies serve to guide the development and benchmark the models. A previously compiled weak-rate library that is used in the astrophysical simulations was updated as part of the work presented here, by adding additional rate tables for nuclei near stability for mass numbers between 60 and 110.

Electron Capture in Proton Collisions with CO.

NASA Astrophysics Data System (ADS)

Stancil, P. C.; Schultz, D. R.; Kimura, M.; Gu, J.-P.; Hirsch, G.; Buenker, R. J.; Li, Y.

1999-10-01

Electron capture by protons following collisions with carbon monoxide is studied with a variety of theoretical approaches including quantal and semiclassical molecular-orbital close-coupling (MOCC) and classical trajectory Monte Carlo (CTMC) techniques. The MOCC treatments utilize potential surfaces and couplings computed for a range of H^+-CO orientation angles and C-O separations. Results including integral, differential, electronic state-selective, and vibrational state-selective cross sections will be presented for low- to intermediate-energies. Comparison with experiment will be made where possible and the relevance of the reaction in astrophysics and atmospheric physics will be discussed.

A first-principles density functional theory study of the electronic structural and thermodynamic properties of M2ZrO3 and M2CO3 (M=Na, K) and their capabilities for CO2 capture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yuhua Duan

2012-01-01

Alkali metal zirconates could be used as solid sorbents for CO{sub 2} capture. The structural, electronic, and phonon properties of Na{sub 2}ZrO{sub 3}, K{sub 2}ZrO{sub 3}, Na{sub 2}CO{sub 3}, and K{sub 2}CO{sub 3} are investigated by combining the density functional theory with lattice phonon dynamics. The thermodynamics of CO{sub 2} absorption/desorption reactions of these two zirconates are analyzed. The calculated results show that their optimized structures are in a good agreement with experimental measurements. The calculated band gaps are 4.339 eV (indirect), 3.641 eV (direct), 3.935 eV (indirect), and 3.697 eV (direct) for Na{sub 2}ZrO{sub 3}, K{sub 2}ZrO{sub 3}, Na{submore » 2}CO{sub 3}, and K{sub 2}CO{sub 3}, respectively.The calculated phonon dispersions and phonon density of states for M{sub 2}ZrO{sub 3} and M{sub 2}CO{sub 3} (M = K, Na, Li) revealed that from K to Na to Li, their frequency peaks are shifted to high frequencies due to the molecular weight decreased from K to Li. From the calculated reaction heats and relationships of free energy change versus temperatures and CO{sub 2} pressures of the M{sub 2}ZrO{sub 3} (M = K, Na, Li) reacting with CO{sub 2}, we found that the performance of Na{sub 2}ZrO{sub 3} capturing CO{sub 2} is similar to that of Li{sub 2}ZrO{sub 3} and is better than that of K{sub 2}ZrO{sub 3}. Therefore, Na{sub 2}ZrO{sub 3} and Li{sub 2}ZrO{sub 3} are good candidates of high temperature CO{sub 2} sorbents and could be used for post combustion CO{sub 2} capture technologies.« less

78 FR 16531 - Certain Electronic Devices for Capturing and Transmitting Images, and Components Thereof...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-03-15

... INTERNATIONAL TRADE COMMISSION [Investigation No. 337-TA-831] Certain Electronic Devices for Capturing and Transmitting Images, and Components Thereof; Commission Determination Not To Review an Initial... certain electronic devices for capturing and transmitting images, and components thereof. The complaint...

Stellar neutron capture cross sections of 41K and 45Sc

NASA Astrophysics Data System (ADS)

Heil, M.; Plag, R.; Uberseder, E.; Bisterzo, S.; Käppeler, F.; Mengoni, A.; Pignatari, M.

2016-05-01

The neutron capture cross sections of light nuclei (A <56 ) are important for s -process scenarios since they act as neutron poisons. We report on measurements of the neutron capture cross sections of 41K and 45Sc, which were performed at the Karlsruhe 3.7 MV Van de Graaff accelerator via the activation method in a quasistellar neutron spectrum corresponding to a thermal energy of k T =25 keV. Systematic effects were controlled by repeated irradiations, resulting in overall uncertainties of less than 3%. The measured spectrum-averaged data have been used to normalize the energy-dependent (n ,γ ) cross sections from the main data libraries JEFF-3.2, JENDL-4.0, and ENDF/B-VII.1, and a set of Maxwellian averaged cross sections was calculated for improving the s -process nucleosynthesis yields in AGB stars and in massive stars. At k T =30 keV, the new Maxwellian averaged cross sections of 41K and 45Sc are 19.2 ±0.6 mb and 61.3 ±1.8 mb, respectively. Both values are 20% lower than previously recommended. The effect of neutron poisons is discussed for nuclei with A <56 in general and for the investigated isotopes in particular.

Improved search for two-neutrino double electron capture on 124Xe and 126Xe using particle identification in XMASS-I

NASA Astrophysics Data System (ADS)

Xmass Collaboration; Abe, K.; Hiraide, K.; Ichimura, K.; Kishimoto, Y.; Kobayashi, K.; Kobayashi, M.; Moriyama, S.; Nakahata, M.; Norita, T.; Ogawa, H.; Sato, K.; Sekiya, H.; Takachio, O.; Takeda, A.; Tasaka, S.; Yamashita, M.; Yang, B. S.; Kim, N. Y.; Kim, Y. D.; Itow, Y.; Kanzawa, K.; Kegasa, R.; Masuda, K.; Takiya, H.; Fushimi, K.; Kanzaki, G.; Martens, K.; Suzuki, Y.; Xu, B. D.; Fujita, R.; Hosokawa, K.; Miuchi, K.; Oka, N.; Takeuchi, Y.; Kim, Y. H.; Lee, K. B.; Lee, M. K.; Fukuda, Y.; Miyasaka, M.; Nishijima, K.; Nakamura, S.

2018-05-01

We conducted an improved search for the simultaneous capture of two K-shell electrons on the ^{124}Xe and ^{126}Xe nuclei with emission of two neutrinos using 800.0 days of data from the XMASS-I detector. A novel method to discriminate γ-ray/X-ray or double electron capture signals from β-ray background using scintillation time profiles was developed for this search. No significant signal was found when fitting the observed energy spectra with the expected signal and background. Therefore, we set the most stringent lower limits on the half-lives at 2.1 × 10^{22} and 1.9 × 10^{22} years for ^{124}Xe and ^{126}Xe, respectively, with 90% confidence level. These limits improve upon previously reported values by a factor of 4.5.

Evidence for endohedral muonium in K(x) C60 and consequences for electronic structure

NASA Technical Reports Server (NTRS)

Kiefl, R. F.; Duty, T. L.; Schneider, J. W.; Macfarlane, A.; Chow, K.; Elzey, J. W.; Mendels, P.; Morris, G. D.; Brewer, J. H.; Ansaldo, E. J.

1992-01-01

Positive muons injected into solid C60, K4C60, and K6C60 form vacuumlike muonium with a (6-12) percent probability. Observation of coherent spin precession of muonium establishes that all three materials are nonmagnetic and nonconducting at low temperatures. From the temperature dependence of the signals we estimate the electronic band gaps in K4C60 and K6C60 to be considerably smaller than in C60. The similarity of the muonium centers supports a model in which a muonium atom is caged inside the C60 molecule in pure C60 or the C60 exp -x molecular ion in K(x)C60.

A Benign, Low Z Electron Capture Agent for Negative Ion TPCs

NASA Technical Reports Server (NTRS)

Martoff, C. J.; Dion, M. P.; Hosack, M.; Barton, D.; Black, J. K.

2008-01-01

We have identified nitromethane (CH3NO2) as an effective electron capture agent for negative ion TPCs (NITPCs). We present drift velocity and longitudinal diffusion measurements for negative ion gas mixtures using nitromethane as the capture agent. Not only is nitromethane substantially more benign than the only other identified capture agent, CS2, but its low atomic number will enable the use of the NITPC as a photoelectric X-ray polarimeter in the 1-10 keV band.

Accelerated Electron-Beam Formation with a High Capture Coefficient in a Parallel Coupled Accelerating Structure

NASA Astrophysics Data System (ADS)

Chernousov, Yu. D.; Shebolaev, I. V.; Ikryanov, I. M.

2018-01-01

An electron beam with a high (close to 100%) coefficient of electron capture into the regime of acceleration has been obtained in a linear electron accelerator based on a parallel coupled slow-wave structure, electron gun with microwave-controlled injection current, and permanent-magnet beam-focusing system. The high capture coefficient was due to the properties of the accelerating structure, beam-focusing system, and electron-injection system. Main characteristics of the proposed systems are presented.

Electron capture in collisions of Al2+ ions with He atoms at intermediate energies

NASA Astrophysics Data System (ADS)

Watanabe, A.; Sato, H.; Gu, J. P.; Hirsch, G.; Buenker, R. J.; Kimura, M.

2001-09-01

Electron capture resulting from collisions of Al2+ ions with He atoms from 0.15 to 1000 keV/u is investigated using a molecular-orbital representation within a semiclassical frame. Molecular electronic states and corresponding couplings are determined by the ALCHEMY program. Sixteen molecular states all connecting to single-electron-capture processes are included, and hence radial and rotational couplings among these channels are fully considered. The trajectory effect arising from the straight-line, Coulomb, and ground-state potential trajectories for electron-capture and excitation processes is carefully assessed. The electron-capture cross section by ground-state Al2+(2S) ions slowly increases before it reaches a maximum of 1.3×10-16 cm2 at 100 keV/u. Those for metastable Al2+(2P) ions sharply increase with increasing energy, and reach a peak at 1 keV/u with a value of 1.5×10-16 cm2. The earlier experimental data are found to be larger by an order of magnitude although their energy dependence is in good accord with the present result. Excitation cross sections for both the ground and metastable states are found to be much larger by a factor of 2-3 than corresponding capture cross sections above 1 keV/u although they become comparable below this energy.

Probability of detection of defects in coatings with electronic shearography

NASA Astrophysics Data System (ADS)

Maddux, Gary A.; Horton, Charles M.; Lansing, Matthew D.; Gnacek, William J.; Newton, Patrick L.

1994-07-01

The goal of this research was to utilize statistical methods to evaluate the probability of detection (POD) of defects in coatings using electronic shearography. The coating system utilized in the POD studies was to be the paint system currently utilized on the external casings of the NASA Space Transportation System (STS) Revised Solid Rocket Motor (RSRM) boosters. The population of samples was to be large enough to determine the minimum defect size for 90 percent probability of detection of 95 percent confidence POD on these coatings. Also, the best methods to excite coatings on aerospace components to induce deformations for measurement by electronic shearography were to be determined.

Probability of detection of defects in coatings with electronic shearography

NASA Technical Reports Server (NTRS)

Maddux, Gary A.; Horton, Charles M.; Lansing, Matthew D.; Gnacek, William J.; Newton, Patrick L.

1994-01-01

The goal of this research was to utilize statistical methods to evaluate the probability of detection (POD) of defects in coatings using electronic shearography. The coating system utilized in the POD studies was to be the paint system currently utilized on the external casings of the NASA Space Transportation System (STS) Revised Solid Rocket Motor (RSRM) boosters. The population of samples was to be large enough to determine the minimum defect size for 90 percent probability of detection of 95 percent confidence POD on these coatings. Also, the best methods to excite coatings on aerospace components to induce deformations for measurement by electronic shearography were to be determined.

Effective pore size and radius of capture for K+ ions in K-channels

PubMed Central

Moldenhauer, Hans; Díaz-Franulic, Ignacio; González-Nilo, Fernando; Naranjo, David

2016-01-01

Reconciling protein functional data with crystal structure is arduous because rare conformations or crystallization artifacts occur. Here we present a tool to validate the dimensions of open pore structures of potassium-selective ion channels. We used freely available algorithms to calculate the molecular contour of the pore to determine the effective internal pore radius (rE) in several K-channel crystal structures. rE was operationally defined as the radius of the biggest sphere able to enter the pore from the cytosolic side. We obtained consistent rE estimates for MthK and Kv1.2/2.1 structures, with rE = 5.3–5.9 Å and rE = 4.5–5.2 Å, respectively. We compared these structural estimates with functional assessments of the internal mouth radii of capture (rC) for two electrophysiological counterparts, the large conductance calcium activated K-channel (rC = 2.2 Å) and the Shaker Kv-channel (rC = 0.8 Å), for MthK and Kv1.2/2.1 structures, respectively. Calculating the difference between rE and rC, produced consistent size radii of 3.1–3.7 Å and 3.6–4.4 Å for hydrated K+ ions. These hydrated K+ estimates harmonize with others obtained with diverse experimental and theoretical methods. Thus, these findings validate MthK and the Kv1.2/2.1 structures as templates for open BK and Kv-channels, respectively. PMID:26831782

Effective pore size and radius of capture for K(+) ions in K-channels.

PubMed

Moldenhauer, Hans; Díaz-Franulic, Ignacio; González-Nilo, Fernando; Naranjo, David

2016-02-02

Reconciling protein functional data with crystal structure is arduous because rare conformations or crystallization artifacts occur. Here we present a tool to validate the dimensions of open pore structures of potassium-selective ion channels. We used freely available algorithms to calculate the molecular contour of the pore to determine the effective internal pore radius (r(E)) in several K-channel crystal structures. r(E) was operationally defined as the radius of the biggest sphere able to enter the pore from the cytosolic side. We obtained consistent r(E) estimates for MthK and Kv1.2/2.1 structures, with r(E) = 5.3-5.9 Å and r(E) = 4.5-5.2 Å, respectively. We compared these structural estimates with functional assessments of the internal mouth radii of capture (r(C)) for two electrophysiological counterparts, the large conductance calcium activated K-channel (r(C) = 2.2 Å) and the Shaker Kv-channel (r(C) = 0.8 Å), for MthK and Kv1.2/2.1 structures, respectively. Calculating the difference between r(E) and r(C), produced consistent size radii of 3.1-3.7 Å and 3.6-4.4 Å for hydrated K(+) ions. These hydrated K(+) estimates harmonize with others obtained with diverse experimental and theoretical methods. Thus, these findings validate MthK and the Kv1.2/2.1 structures as templates for open BK and Kv-channels, respectively.

Ultralow energy calibration of LUX detector using Xe 127 electron capture

NASA Astrophysics Data System (ADS)

Akerib, D. S.; Alsum, S.; Araújo, H. M.; Bai, X.; Bailey, A. J.; Balajthy, J.; Beltrame, P.; Bernard, E. P.; Bernstein, A.; Biesiadzinski, T. P.; Boulton, E. M.; Brás, P.; Byram, D.; Cahn, S. B.; Carmona-Benitez, M. C.; Chan, C.; Currie, A.; Cutter, J. E.; Davison, T. J. R.; Dobi, A.; Druszkiewicz, E.; Edwards, B. N.; Fallon, S. R.; Fan, A.; Fiorucci, S.; Gaitskell, R. J.; Genovesi, J.; Ghag, C.; Gilchriese, M. G. D.; Hall, C. R.; Hanhardt, M.; Haselschwardt, S. J.; Hertel, S. A.; Hogan, D. P.; Horn, M.; Huang, D. Q.; Ignarra, C. M.; Jacobsen, R. G.; Ji, W.; Kamdin, K.; Kazkaz, K.; Khaitan, D.; Knoche, R.; Larsen, N. A.; Lenardo, B. G.; Lesko, K. T.; Lindote, A.; Lopes, M. I.; Manalaysay, A.; Mannino, R. L.; Marzioni, M. F.; McKinsey, D. N.; Mei, D.-M.; Mock, J.; Moongweluwan, M.; Morad, J. A.; Murphy, A. St. J.; Nehrkorn, C.; Nelson, H. N.; Neves, F.; O'Sullivan, K.; Oliver-Mallory, K. C.; Palladino, K. J.; Pease, E. K.; Rhyne, C.; Shaw, S.; Shutt, T. A.; Silva, C.; Solmaz, M.; Solovov, V. N.; Sorensen, P.; Sumner, T. J.; Szydagis, M.; Taylor, D. J.; Taylor, W. C.; Tennyson, B. P.; Terman, P. A.; Tiedt, D. R.; To, W. H.; Tripathi, M.; Tvrznikova, L.; Uvarov, S.; Velan, V.; Verbus, J. R.; Webb, R. C.; White, J. T.; Whitis, T. J.; Witherell, M. S.; Wolfs, F. L. H.; Xu, J.; Yazdani, K.; Young, S. K.; Zhang, C.

2017-12-01

We report an absolute calibration of the ionization yields (Qy ) and fluctuations for electronic recoil events in liquid xenon at discrete energies between 186 eV and 33.2 keV. The average electric field applied across the liquid xenon target is 180 V /cm . The data are obtained using low energy Xe 127 electron capture decay events from the 95.0-day first run from LUX (WS2013) in search of weakly interacting massive particles. The sequence of gamma-ray and x-ray cascades associated with I 127 deexcitations produces clearly identified two-vertex events in the LUX detector. We observe the K-(binding energy, 33.2 keV), L-(5.2 keV), M-(1.1 keV), and N-(186 eV) shell cascade events and verify that the relative ratio of observed events for each shell agrees with calculations. The N-shell cascade analysis includes single extracted electron (SE) events and represents the lowest-energy electronic recoil in situ measurements that have been explored in liquid xenon.

Strong-potential Born calculations for electron capture

DOE Office of Scientific and Technical Information (OSTI.GOV)

McGuire, J.H.; Sil, N.C.

1983-12-01

A closed-form expression for 1s-1s electron capture has been developed in the strong-potential Born (SPB) approximation. Terms of the order (Z/sub p//v)/sup 2/ are ignored in our expression, where Z/sub p/ is the charge of the projectile and v is the collision velocity. Our errors of order (Z/sub p//v)/sup 2/ are within the accuracy of the SPB approximation itself, which is valid to first order in the projectile-electron interaction V/sub p/ (and all orders in the stronger target potential V/sub T/). Calculations using our expression are in better agreement with experimental observations of the shape of the Thomas peak thanmore » are other calculations.« less

Limit on the radiative neutrinoless double electron capture of ^{36}Ar from GERDA Phase I

NASA Astrophysics Data System (ADS)

Agostini, M.; Allardt, M.; Bakalyarov, A. M.; Balata, M.; Barabanov, I.; Barros, N.; Baudis, L.; Bauer, C.; Bellotti, E.; Belogurov, S.; Belyaev, S. T.; Benato, G.; Bettini, A.; Bezrukov, L.; Bode, T.; Borowicz, D.; Brudanin, V.; Brugnera, R.; Caldwell, A.; Cattadori, C.; Chernogorov, A.; D'Andrea, V.; Demidova, E. V.; di Vacri, A.; Domula, A.; Doroshkevich, E.; Egorov, V.; Falkenstein, R.; Fedorova, O.; Freund, K.; Frodyma, N.; Gangapshev, A.; Garfagnini, A.; Gooch, C.; Grabmayr, P.; Gurentsov, V.; Gusev, K.; Hakenmüller, J.; Hegai, A.; Heisel, M.; Hemmer, S.; Heusser, G.; Hofmann, W.; Hult, M.; Inzhechik, L. V.; Csáthy, J. Janicskó; Jochum, J.; Junker, M.; Kazalov, V.; Kihm, T.; Kirpichnikov, I. V.; Kirsch, A.; Kish, A.; Klimenko, A.; Kneißl, R.; Knöpfle, K. T.; Kochetov, O.; Kornoukhov, V. N.; Kuzminov, V. V.; Laubenstein, M.; Lazzaro, A.; Lebedev, V. I.; Lehnert, B.; Liao, H. Y.; Lindner, M.; Lippi, I.; Lubashevskiy, A.; Lubsandorzhiev, B.; Lutter, G.; Macolino, C.; Majorovits, B.; Maneschg, W.; Medinaceli, E.; Miloradovic, M.; Mingazheva, R.; Misiaszek, M.; Moseev, P.; Nemchenok, I.; Palioselitis, D.; Panas, K.; Pandola, L.; Pelczar, K.; Pullia, A.; Riboldi, S.; Rumyantseva, N.; Sada, C.; Salamida, F.; Salathe, M.; Schmitt, C.; Schneider, B.; Schönert, S.; Schreiner, J.; Schütz, A.-K.; Schulz, O.; Schwingenheuer, B.; Selivanenko, O.; Shirchenko, M.; Simgen, H.; Smolnikov, A.; Stanco, L.; Stepaniuk, M.; Vanhoefer, L.; Vasenko, A. A.; Veresnikova, A.; von Sturm, K.; Wagner, V.; Walter, M.; Wegmann, A.; Wester, T.; Wiesinger, C.; Wilsenach, H.; Wojcik, M.; Yanovich, E.; Zhitnikov, I.; Zhukov, S. V.; Zinatulina, D.; Zuber, K.; Zuzel, G.

2016-12-01

Neutrinoless double electron capture is a process that, if detected, would give evidence of lepton number violation and the Majorana nature of neutrinos. A search for neutrinoless double electron capture of ^{36}Ar has been performed with germanium detectors installed in liquid argon using data from Phase I of the GERmanium Detector Array ( Gerda) experiment at the Gran Sasso Laboratory of INFN, Italy. No signal was observed and an experimental lower limit on the half-life of the radiative neutrinoless double electron capture of ^{36}Ar was established: T_{1/2} > 3.6 × 10^{21} years at 90% CI.

Development of an Electron-capture Technique Specific for Explosives Detection

DOT National Transportation Integrated Search

1974-07-01

This document contains information on the design, fabrication, and testing of a prototype detector specific for explosives which employs electron-capture sensors. The technique used exploits the observation that the electronegative vapors from explos...

ELECTRONIC STRUCTURE AND LINEAR OPTICAL PROPERTIES OF MIXED ALKALI-METAL BOROPHOSPHATES (LiK2BP2O8, Li3K2BP4O14): A FIRST-PRINCIPLES STUDY

NASA Astrophysics Data System (ADS)

Zhang, Bei; Jing, Qun; Yang, Zhihua; Wang, Ying; Su, Xin; Pan, Shilie; Zhang, Jun

2013-07-01

LiK2BP2O8 and Li3K2BP4O14 are synthesized by high-temperature solution method with the same elements, while contain different fundamental building units. Li3K2BP4O14 is a novel P-O-P linking structure which gives a rare example of violation of Pauling's fourth rule. The electronic structures of LiK2BP2O8 and Li3K2BP4O14 are investigated by density functional calculations. Direct gaps of 5.038 eV (LiK2BP2O8) and 5.487 eV (Li3K2BP4O14) are obtained. By analyzing the density of states (DOS) of LiK2BP2O8 and Li3K2BP4O14, the P-O-P linking in fundamental building units of Li3K2BP4O14 crystal is proved theoretically. Based on the electronic properties, the linear optical information is captured.

Scalable sensing electronics towards a motion capture suit

NASA Astrophysics Data System (ADS)

Xu, Daniel; Gisby, Todd A.; Xie, Shane; Anderson, Iain A.

2013-04-01

Being able to accurately record body motion allows complex movements to be characterised and studied. This is especially important in the film or sport coaching industry. Unfortunately, the human body has over 600 skeletal muscles, giving rise to multiple degrees of freedom. In order to accurately capture motion such as hand gestures, elbow or knee flexion and extension, vast numbers of sensors are required. Dielectric elastomer (DE) sensors are an emerging class of electroactive polymer (EAP) that is soft, lightweight and compliant. These characteristics are ideal for a motion capture suit. One challenge is to design sensing electronics that can simultaneously measure multiple sensors. This paper describes a scalable capacitive sensing device that can measure up to 8 different sensors with an update rate of 20Hz.

Radiative double electron capture in collisions of fully-stripped fluorine ions with thin carbon foils

NASA Astrophysics Data System (ADS)

Elkafrawy, Tamer Mohammad Samy

Radiative double electron capture (RDEC) is a one-step process in ion-atom collisions occurring when two target electrons are captured to a bound state of the projectile simultaneously with the emission of a single photon. The emitted photon has approximately double the energy of the photon emitted due to radiative electron capture (REC), which occurs when a target electron is captured to a projectile bound state with simultaneous emission of a photon. REC and RDEC can be treated as time-reversed photoionization (PI) and double photoionization (DPI), respectively, if loosely-bound target electrons are captured. This concept can be formulated with the principle of detailed balance, in which the processes of our interest can be described in terms of their time-reversed ones. Fully-stripped ions were used as projectiles in the performed RDEC experiments, providing a recipient system free of electron-related Coulomb fields. This allows the target electrons to be transferred without interaction with any of the projectile electrons, enabling accurate investigation of the electron-electron interaction in the vicinity of electromagnetic field. In this dissertation, RDEC was investigated during the collision of fully-stripped fluorine ions with a thin carbon foil and the results are compared with the recent experimental and theoretical studies. In the current work, x rays associated with projectile charge-changing by single and double electron capture and no charge change by F9+ ions were observed and compared with recent work for O8+ ions and with theory. Both the F 9+ and O8+ ions had energies in the ˜MeV/u range. REC, in turn, was investigated as a means to compare with the theoretical predictions of the RDEC/REC cross section ratio. The most significant background processes including various mechanisms of x-ray emission that may interfere with the energy region of interest are addressed in detail. This enables isolation of the contributions of REC and RDEC from the

Semiclassical analysis of angular differential cross sections for single-electron capture in 250-eV H++H collisions

NASA Astrophysics Data System (ADS)

Frémont, F.

2015-05-01

A classical model based on the resolution of Hamilton equations of motion is used to determine the angular distribution of H projectiles following single-electron capture in H++H collisions at an incident projectile energy of 250 eV. At such low energies, the experimental charge-exchange probability and angular differential cross sections exhibit oscillatory structures that are classically related to the number of swaps the electron experiences between the target and the projectile during the collision. These oscillations are well reproduced by models based on quantum mechanics. In the present paper, the angular distribution of H projectiles is determined classically, at angles varying from 0.1° up to 7°. The variation in intensity due to interferences caused by the indiscernibility between different trajectories is calculated, and the role of these interferences is discussed.

Electron Capture Supernovae from Close Binary Systems

NASA Astrophysics Data System (ADS)

Poelarends, Arend J. T.; Wurtz, Scott; Tarka, James; Cole Adams, L.; Hills, Spencer T.

2017-12-01

We present the first detailed study of the Electron Capture Supernova Channel (ECSN Channel) for a primary star in a close binary star system. Progenitors of ECSN occupy the lower end of the mass spectrum of supernova progenitors and are thought to form the transition between white dwarf progenitors and core-collapse progenitors. The mass range for ECSN from close binary systems is thought to be wider than the range for single stars, because of the effects of mass transfer on the helium core. Using the MESA stellar evolution code, we explored the parameter space of initial primary masses between 8 and 17 {M}⊙ , using a large grid of models. We find that the initial primary mass and the mass transfer evolution are important factors in the final fate of stars in this mass range. Mass transfer due to Roche lobe overflow during and after carbon burning causes the core to cool down so that it avoids neon ignition, even in helium-free cores with masses up to 1.52 {M}⊙ , which in single stars would ignite neon. If the core is able to contract to high enough densities for electron captures to commence, we find that, for the adopted Ledoux convection criterion, the initial mass range for the primary to evolve into an ECSN is between 13.5 and 17.6 {M}⊙ . The mass ratio, initial period, and mass-loss efficiency only marginally affect the predicted ranges.

Ab initio investigation of electron capture by Cl{sup 7+} ions from H

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, L. B.; Stancil, P. C.; Watanabe, A.

2007-08-15

An investigation of charge transfer in collisions of ground-state Cl{sup 7+} with H has been conducted based on a fully quantum-mechanical molecular-orbital close-coupling (QMOCC) approach. The charge-transfer process Cl{sup 7+}({sup 1}S)+H{yields}Cl{sup 6+}(2p{sup 6}nl {sup 2}S,{sup 2}P{sup o},{sup 2}D,{sup 2}F{sup o},{sup 2}G)+H{sup +} with n=5 and 6 is taken into account for collision energies between 10{sup -4} eV/u and 1 keV/u. The relevant adiabatic potentials and nonadiabatic coupling matrix elements for the ClH{sup 7+} system are evaluated with the configuration-interaction method. The investigation shows that electron capture into the 5d, 5f, 5g, and 6p states dominates for collision energies less thanmore » {approx}1 eV/u, while above 100 eV/u the 5s, 5p, 5d, and 6p are the primary capture channels. Comparison with experimental data for collisions of Cl{sup 7+}({sup 1}S) with D reveals a discrepancy over the full range of measured energies (5-430 eV/u), while no significant isotope effect is found for QMOCC calculations with deuterium. Furthermore, comparison with a previous calculation of the one-electron N{sup 7+}+H system, as well as measurements of the multielectron Al{sup 7+}+H and Fe{sup 7+}+H systems, suggests that the electronic structure of the core has a non-negligible effect on the charge-transfer process. A one-electron model for relative l distributions is found to agree with the QMOCC results for n=5 between 100 and 1000 eV/u, but fails at lower collision energies. Finally, state-selective and total rate coefficients are given for temperatures between 10 and 200 000 K.« less

Limit on the radiative neutrinoless double electron capture of 36Ar from GERDA Phase I

DOE PAGES

Agostini, M.; Allardt, M.; Bakalyarov, A. M.; ...

2016-11-28

Neutrinoless double electron capture is a process that, if detected, would give evidence of lepton number violation and the Majorana nature of neutrinos. Here, a search for neutrinoless double electron capture of 36Ar has been performed with germanium detectors installed in liquid argon using data from Phase I of the GERmanium Detector Array (Gerda) experiment at the Gran Sasso Laboratory of INFN, Italy. No signal was observed and an experimental lower limit on the half-life of the radiative neutrinoless double electron capture of 36 Ar was established: T 1/2 > 3.6 × 10 21 years at 90% CI.

Electron Beam Analysis of Micrometeoroids Captured in Aerogel as Stardust Analogues

NASA Technical Reports Server (NTRS)

Graham, G. A.; Sheffield-Parker, J.; Bradley, P.; Kearsley, A. T.; Dai, Z. R.; Mayo, S. C.; Teslich, N.; Snead, C.; Westphal, A. J.; Ishii, H.

2005-01-01

In January 2004, NASA s Stardust spacecraft passed through the tail of Comet 81P/Wild-2. The on-board dust flux monitor instrument indicated that numerous micro- and nano-meter sized cometary dust particles were captured by the dedicated silica aerogel capture cell. The collected cometary particles will be returned to Earth in January 2006. Current Stardust analogues are: (i) Light-gas-gun accelerated individual mineral grains and carbonaceous meteoritic material in aerogels at the Stardust encounter velocity ca.approximately 6 kilometers per second. (ii) Aerogels exposed in low-Earth orbit (LEO) containing preserved cosmic dust grains. Studies of these impacts offer insight into the potential state of the captured cometary dust by Stardust and the suitability of various analytical techniques. A number of papers have discussed the application of sophisticated synchrotron analytical techniques to analyze Stardust particles. Yet much of the understanding gained on the composition and mineralogy of interplanetary dust particles (IDPs) has come from electron microscopy studies. Here we discuss the application of scanning electron microscopy (SEM) for Stardust during the preliminary phase of post-return investigations.

Electron capture and transport mediated by lattice solitons

NASA Astrophysics Data System (ADS)

Hennig, D.; Chetverikov, A.; Velarde, M. G.; Ebeling, W.

2007-10-01

We study electron transport in a one-dimensional molecular lattice chain. The molecules are linked by Morse interaction potentials. The electronic degree of freedom, expressed in terms of a tight binding system, is coupled to the longitudinal displacements of the molecules from their equilibrium positions along the axis of the lattice. More specifically, the distance between two sites influences in an exponential fashion the corresponding electronic transfer matrix element. We demonstrate that when an electron is injected in the undistorted lattice it causes a local deformation such that a compression results leading to a lowering of the electron’s energy below the lower edge of the band of linear states. This corresponds to self-localization of the electron due to a polaronlike effect. Then, if a traveling soliton lattice deformation is launched a distance apart from the electron’s position, upon encountering the polaronlike state it captures the latter dragging it afterwards along its path. Strikingly, even when the electron is initially uniformly distributed over the lattice sites a traveling soliton lattice deformation gathers the electronic amplitudes during its traversing of the lattice. Eventually, the electron state is strongly localized and moves coherently in unison with the soliton lattice deformation. This shows that for the achievement of coherent electron transport we need not start with the polaronic effect.

Comparative analysis of the effects of electron and hole capture on the power characteristics of a semiconductor quantum-well laser

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sokolova, Z. N., E-mail: Zina.Sokolova@mail.ioffe.ru; Pikhtin, N. A.; Tarasov, I. S.

The operating characteristics of a semiconductor quantum-well laser calculated using three models are compared. These models are (i) a model not taking into account differences between the electron and hole parameters and using the electron parameters for both types of charge carriers; (ii) a model, which does not take into account differences between the electron and hole parameters and uses the hole parameters for both types of charge carriers; and (iii) a model taking into account the asymmetry between the electron and hole parameters. It is shown that, at the same velocity of electron and hole capture into an unoccupiedmore » quantum well, the laser characteristics, obtained using the three models, differ considerably. These differences are due to a difference between the filling of the electron and hole subbands in a quantum well. The electron subband is more occupied than the hole subband. As a result, at the same velocities of electron and hole capture into an empty quantum well, the effective electron-capture velocity is lower than the effective hole-capture velocity. Specifically, it is shown that for the laser structure studied the hole-capture velocity of 5 × 10{sup 5} cm/s into an empty quantum well and the corresponding electron-capture velocity of 3 × 10{sup 6} cm/s into an empty quantum well describe the rapid capture of these carriers, at which the light–current characteristic of the laser remains virtually linear up to high pump-current densities. However, an electron-capture velocity of 5 × 10{sup 5} cm/s and a corresponding hole-capture velocity of 8.4 × 10{sup 4} cm/s describe the slow capture of these carriers, causing significant sublinearity in the light–current characteristic.« less

Electron capture in collisions of S4+ with helium

NASA Astrophysics Data System (ADS)

Wang, J. G.; Turner, A. R.; Cooper, D. L.; Schultz, D. R.; Rakovic, M. J.; Fritsch, W.; Stancil, P. C.; Zygelman, B.

2002-07-01

Charge transfer due to collisions of ground-state S4+(3s2 1S) ions with helium is investigated for energies between 0.1 meV u-1 and 10 MeV u-1. Total and state-selective single electron capture (SEC) cross sections and rate coefficients are obtained utilizing the quantum mechanical molecular-orbital close-coupling (MOCC), atomic-orbital close-coupling (AOCC), classical trajectory Monte Carlo (CTMC) and continuum distorted wave methods. The MOCC calculations utilize ab initio adiabatic potentials and nonadiabatic radial coupling matrix elements obtained with the spin-coupled valence-bond approach. Previous data are limited to a calculation of the total SEC rate coefficient using the Landau-Zener model that is, in comparison to the results presented here, three orders of magnitude smaller. The MOCC SEC cross sections at low energy reveal a multichannel interference effect. True double capture is also investigated with the AOCC and CTMC approaches while autoionizing double capture and transfer ionization (TI) is explored with CTMC. SEC is found to be the dominant process except for E>200 keV u-1 when TI becomes the primary capture channel. Astrophysical implications are briefly discussed.

Eikonal approximation for proton-helium electron-capture processes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kobayashi, K.; Toshima, N.; Ishihara, T.

1985-09-01

We calculate the capture cross sections for H/sup +/+He..-->..H+He/sup +/, treating the passive electron explicitly in a distorted-wave formalism based on the eikonal approximation. It is found that the shape of the differential cross sections is influenced considerably by the interaction between the passive electron and the incident proton, while the integrated cross sections are much less sensitive to that. The differential cross section at 293 keV agrees well with the experimental data except at extremely small scattering angles. The forward peak is reproduced well at higher energies. The integrated cross sections are in excellent agreement with experiments for themore » incident energy above 250 keV.« less

Dipole-Guided Electron Capture Causes Abnormal Dissociations of Phosphorylated Pentapeptides

NASA Astrophysics Data System (ADS)

Moss, Christopher L.; Chung, Thomas W.; Wyer, Jean A.; Nielsen, Steen Brøndsted; Hvelplund, Preben; Tureček, František

2011-04-01

Electron transfer and capture mass spectra of a series of doubly charged ions that were phosphorylated pentapeptides of a tryptic type (pS,A,A,A,R) showed conspicuous differences in dissociations of charge-reduced ions. Electron transfer from both gaseous cesium atoms at 100 keV kinetic energies and fluoranthene anion radicals in an ion trap resulted in the loss of a hydrogen atom, ammonia, and backbone cleavages forming complete series of sequence z ions. Elimination of phosphoric acid was negligible. In contrast, capture of low-energy electrons by doubly charged ions in a Penning ion trap induced loss of a hydrogen atom followed by elimination of phosphoric acid as the dominant dissociation channel. Backbone dissociations of charge-reduced ions also occurred but were accompanied by extensive fragmentation of the primary products. z-Ions that were terminated with a deaminated phosphoserine radical competitively eliminated phosphoric acid and H2PO4 radicals. A mechanism is proposed for this novel dissociation on the basis of a computational analysis of reaction pathways and transition states. Electronic structure theory calculations in combination with extensive molecular dynamics mapping of the potential energy surface provided structures for the precursor phosphopeptide dications. Electron attachment produces a multitude of low lying electronic states in charge-reduced ions that determine their reactivity in backbone dissociations and H- atom loss. The predominant loss of H atoms in ECD is explained by a distortion of the Rydberg orbital space by the strong dipolar field of the peptide dication framework. The dipolar field steers the incoming electron to preferentially attach to the positively charged arginine side chain to form guanidinium radicals and trigger their dissociations.

Resonances in the cumulative reaction probability for a model electronically nonadiabatic reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qi, J.; Bowman, J.M.

1996-05-01

The cumulative reaction probability, flux{endash}flux correlation function, and rate constant are calculated for a model, two-state, electronically nonadiabatic reaction, given by Shin and Light [S. Shin and J. C. Light, J. Chem. Phys. {bold 101}, 2836 (1994)]. We apply straightforward generalizations of the flux matrix/absorbing boundary condition approach of Miller and co-workers to obtain these quantities. The upper adiabatic electronic potential supports bound states, and these manifest themselves as {open_quote}{open_quote}recrossing{close_quote}{close_quote} resonances in the cumulative reaction probability, at total energies above the barrier to reaction on the lower adiabatic potential. At energies below the barrier, the cumulative reaction probability for themore » coupled system is shifted to higher energies relative to the one obtained for the ground state potential. This is due to the effect of an additional effective barrier caused by the nuclear kinetic operator acting on the ground state, adiabatic electronic wave function, as discussed earlier by Shin and Light. Calculations are reported for five sets of electronically nonadiabatic coupling parameters. {copyright} {ital 1996 American Institute of Physics.}« less

Urban stormwater capture curve using three-parameter mixed exponential probability density function and NRCS runoff curve number method.

PubMed

Kim, Sangdan; Han, Suhee

2010-01-01

Most related literature regarding designing urban non-point-source management systems assumes that precipitation event-depths follow the 1-parameter exponential probability density function to reduce the mathematical complexity of the derivation process. However, the method of expressing the rainfall is the most important factor for analyzing stormwater; thus, a better mathematical expression, which represents the probability distribution of rainfall depths, is suggested in this study. Also, the rainfall-runoff calculation procedure required for deriving a stormwater-capture curve is altered by the U.S. Natural Resources Conservation Service (Washington, D.C.) (NRCS) runoff curve number method to consider the nonlinearity of the rainfall-runoff relation and, at the same time, obtain a more verifiable and representative curve for design when applying it to urban drainage areas with complicated land-use characteristics, such as occurs in Korea. The result of developing the stormwater-capture curve from the rainfall data in Busan, Korea, confirms that the methodology suggested in this study provides a better solution than the pre-existing one.

Electron Impact K-shell Ionization of Atomic Targets

NASA Astrophysics Data System (ADS)

Saha, Bidhan; Basak, Arun K.; Alfaz Uddin, M.; Patoary, A. A. R.

2008-05-01

In spite of considerable progress -both theoretically and experimentally- recently in evaluating accurate K-shell ionization cross sections that play a decisive role for quantitative analyses using (i) electron probe microanalysis, (ii) Auger electron spectroscopy and (iii) electron energy loss spectra, attempts are still continuing to search for a model that can easily generate reliable cross sections for a wide range of energies and for various targets needed for plasma modeling code We report few modifications of the widely used binary encounter approximation (BEA) [1,2] and have tested by evaluating the electron impact K-shell ionization of few neutral targets at various projectile energies. Details will be presented at the meeting. [1] M. Gryziniski, Phys. Rev. A 138, 336 (1965); [2] L. Vriens, Proc. Phys. Soc. (London) 89, 13, (1966). [3M. A. Uddin , A. K. F. Haque, M. M. Billah, A. K. Basak, K, R, Karim and B. C. Saha, ,Phys. Rev. A 71,032715 (2005); [4] M. A. Uddin, A. K. Basak, and B. C. Saha, Int. J. Quan. Chem 100, 184 (2004).

Gene-specific characterization of human histone H2B by electron capture dissociation.

PubMed

Siuti, Nertila; Roth, Michael J; Mizzen, Craig A; Kelleher, Neil L; Pesavento, James J

2006-02-01

The basis set of protein forms expressed by human cells from the H2B gene family was determined by Top Down Mass Spectrometry. Using Electron Capture Dissociation for MS/MS of H2B isoforms, direct evidence for the expression of unmodified H2B.Q, H2B.A, H2B.K/T, H2B.J, H2B.E, H2B.B, H2B.F, and monoacetylated H2B.A was obtained from asynchronous HeLa cells. H2B.A was the most abundant form, with the overall expression profile not changing significantly in cells arrested in mitosis by colchicine or during mid-S, mid-G2, G2/M, and mid-G1 phases of the cell cycle. Modest hyperacetylation of H2B family members was observed after sodium butyrate treatment.

Real-time capture and reconstruction system with multiple GPUs for a 3D live scene by a generation from 4K IP images to 8K holograms.

PubMed

Ichihashi, Yasuyuki; Oi, Ryutaro; Senoh, Takanori; Yamamoto, Kenji; Kurita, Taiichiro

2012-09-10

We developed a real-time capture and reconstruction system for three-dimensional (3D) live scenes. In previous research, we used integral photography (IP) to capture 3D images and then generated holograms from the IP images to implement a real-time reconstruction system. In this paper, we use a 4K (3,840 × 2,160) camera to capture IP images and 8K (7,680 × 4,320) liquid crystal display (LCD) panels for the reconstruction of holograms. We investigate two methods for enlarging the 4K images that were captured by integral photography to 8K images. One of the methods increases the number of pixels of each elemental image. The other increases the number of elemental images. In addition, we developed a personal computer (PC) cluster system with graphics processing units (GPUs) for the enlargement of IP images and the generation of holograms from the IP images using fast Fourier transform (FFT). We used the Compute Unified Device Architecture (CUDA) as the development environment for the GPUs. The Fast Fourier transform is performed using the CUFFT (CUDA FFT) library. As a result, we developed an integrated system for performing all processing from the capture to the reconstruction of 3D images by using these components and successfully used this system to reconstruct a 3D live scene at 12 frames per second.

Location Prediction Based on Transition Probability Matrices Constructing from Sequential Rules for Spatial-Temporal K-Anonymity Dataset

PubMed Central

Liu, Zhao; Zhu, Yunhong; Wu, Chenxue

2016-01-01

Spatial-temporal k-anonymity has become a mainstream approach among techniques for protection of users’ privacy in location-based services (LBS) applications, and has been applied to several variants such as LBS snapshot queries and continuous queries. Analyzing large-scale spatial-temporal anonymity sets may benefit several LBS applications. In this paper, we propose two location prediction methods based on transition probability matrices constructing from sequential rules for spatial-temporal k-anonymity dataset. First, we define single-step sequential rules mined from sequential spatial-temporal k-anonymity datasets generated from continuous LBS queries for multiple users. We then construct transition probability matrices from mined single-step sequential rules, and normalize the transition probabilities in the transition matrices. Next, we regard a mobility model for an LBS requester as a stationary stochastic process and compute the n-step transition probability matrices by raising the normalized transition probability matrices to the power n. Furthermore, we propose two location prediction methods: rough prediction and accurate prediction. The former achieves the probabilities of arriving at target locations along simple paths those include only current locations, target locations and transition steps. By iteratively combining the probabilities for simple paths with n steps and the probabilities for detailed paths with n-1 steps, the latter method calculates transition probabilities for detailed paths with n steps from current locations to target locations. Finally, we conduct extensive experiments, and correctness and flexibility of our proposed algorithm have been verified. PMID:27508502

Measurement of the beta+ and orbital electron-capture decay rates in fully ionized, hydrogenlike, and heliumlike 140Pr ions.

PubMed

Litvinov, Yu A; Bosch, F; Geissel, H; Kurcewicz, J; Patyk, Z; Winckler, N; Batist, L; Beckert, K; Boutin, D; Brandau, C; Chen, L; Dimopoulou, C; Fabian, B; Faestermann, T; Fragner, A; Grigorenko, L; Haettner, E; Hess, S; Kienle, P; Knöbel, R; Kozhuharov, C; Litvinov, S A; Maier, L; Mazzocco, M; Montes, F; Münzenberg, G; Musumarra, A; Nociforo, C; Nolden, F; Pfützner, M; Plass, W R; Prochazka, A; Reda, R; Reuschl, R; Scheidenberger, C; Steck, M; Stöhlker, T; Torilov, S; Trassinelli, M; Sun, B; Weick, H; Winkler, M

2007-12-31

We report on the first measurement of the beta+ and orbital electron-capture decay rates of 140Pr nuclei with the simplest electron configurations: bare nuclei, hydrogenlike, and heliumlike ions. The measured electron-capture decay constant of hydrogenlike 140Pr58+ ions is about 50% larger than that of heliumlike 140Pr57+ ions. Moreover, 140Pr ions with one bound electron decay faster than neutral 140Pr0+ atoms with 59 electrons. To explain this peculiar observation one has to take into account the conservation of the total angular momentum, since only particular spin orientations of the nucleus and of the captured electron can contribute to the allowed decay.

Electron capture and excitation processes in H+-H collisions in dense quantum plasmas

NASA Astrophysics Data System (ADS)

Jakimovski, D.; Markovska, N.; Janev, R. K.

2016-10-01

Electron capture and excitation processes in proton-hydrogen atom collisions taking place in dense quantum plasmas are studied by employing the two-centre atomic orbital close-coupling (TC-AOCC) method. The Debye-Hückel cosine (DHC) potential is used to describe the plasma screening effects on the Coulomb interaction between charged particles. The properties of a hydrogen atom with DHC potential are investigated as a function of the screening strength of the potential. It is found that the decrease in binding energy of nl levels with increasing screening strength is considerably faster than in the case of the Debye-Hückel (DH) screening potential, appropriate for description of charged particle interactions in weakly coupled classical plasmas. This results in a reduction in the number of bound states in the DHC potential with respect to that in the DH potential for the same plasma screening strength, and is reflected in the dynamics of excitation and electron capture processes for the two screened potentials. The TC-AOCC cross sections for total and state-selective electron capture and excitation cross sections with the DHC potential are calculated for a number of representative screening strengths in the 1-300 keV energy range and compared with those for the DH and pure Coulomb potential. The total capture cross sections for a selected number of screening strengths are compared with the available results from classical trajectory Monte Carlo calculations.

Super-AGB Stars and their Role as Electron Capture Supernova Progenitors

NASA Astrophysics Data System (ADS)

Doherty, Carolyn L.; Gil-Pons, Pilar; Siess, Lionel; Lattanzio, John C.

2017-11-01

We review the lives, deaths and nucleosynthetic signatures of intermediate-mass stars in the range ≈6-12 M⊙, which form super-AGB stars near the end of their lives. The critical mass boundaries both between different types of massive white dwarfs (CO, CO-Ne, ONe), and between white dwarfs and supernovae, are examined along with the relative fraction of super-AGB stars that end life either as an ONe white dwarf or as a neutron star (or an ONeFe white dwarf), after undergoing an electron capture supernova event. The contribution of the other potential single-star channel to electron-capture supernovae, that of the failed massive stars, is also discussed. The factors that influence these different final fates and mass limits, such as composition, rotation, the efficiency of convection, the nuclear reaction rates, mass-loss rates, and third dredge-up efficiency, are described. We stress the importance of the binary evolution channels for producing electron-capture supernovae. Recent nucleosynthesis calculations and elemental yield results are discussed and a new set of s-process heavy element yields is presented. The contribution of super-AGB star nucleosynthesis is assessed within a Galactic perspective, and the (super-)AGB scenario is considered in the context of the multiple stellar populations seen in globular clusters. A brief summary of recent works on dust production is included. Last, we conclude with a discussion of the observational constraints and potential future advances for study into these stars on the low mass/high mass star boundary.

Electron capture dissociation in a branched radio-frequency ion trap.

PubMed

Baba, Takashi; Campbell, J Larry; Le Blanc, J C Yves; Hager, James W; Thomson, Bruce A

2015-01-06

We have developed a high-throughput electron capture dissociation (ECD) device coupled to a quadrupole time-of-flight mass spectrometer using novel branched radio frequency ion trap architecture. With this device, a low-energy electron beam can be injected orthogonally into the analytical ion beam with independent control of both the ion and electron beams. While ions and electrons can interact in a "flow-through" mode, we observed a large enhancement in ECD efficiency by introducing a short ion trapping period at the region of ion and electron beam intersection. This simultaneous trapping mode still provides up to five ECD spectra per second while operating in an information-dependent acquisition workflow. Coupled to liquid chromatography (LC), this LC-ECD workflow provides good sequence coverage for both trypsin and Lys C digests of bovine serum albumin, providing ECD spectra for doubly charged precursor ions with very good efficiency.

Kinetic energy spectra in thermionic emission from small tungsten cluster anions: evidence for nonclassical electron capture.

PubMed

Concina, Bruno; Baguenard, Bruno; Calvo, Florent; Bordas, Christian

2010-03-14

The delayed electron emission from small mass-selected anionic tungsten clusters W(n)(-) has been studied for sizes in the range 9 < or = n < or = 21. Kinetic energy spectra have been measured for delays of about 100 ns after laser excitation by a velocity-map imaging spectrometer. They are analyzed in the framework of microreversible statistical theories. The low-energy behavior shows some significant deviations with respect to the classical Langevin capture model, which we interpret as possibly due to the influence of quantum dynamical effects such as tunneling through the centrifugal barrier, rather than shape effects. The cluster temperature has been extracted from both the experimental kinetic energy spectrum and the absolute decay rate. Discrepancies between the two approaches suggest that the sticking probability can be as low as a few percent for the smallest clusters.

77 FR 4059 - Certain Electronic Devices for Capturing and Transmitting Images, and Components Thereof; Receipt...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-01-26

... Images, and Components Thereof; Receipt of Complaint; Solicitation of Comments Relating to the Public... Devices for Capturing and Transmitting Images, and Components Thereof, DN 2869; the Commission is... importation of certain electronic devices for capturing and transmitting images, and components thereof. The...

Angular Distributions of Differential Electron Capture Cross Sections in Collisions Between Low-Velocity Highly-Charged Ions and Neutral Targets.

NASA Astrophysics Data System (ADS)

Waggoner, William Tracy

1990-01-01

Experimental capture cross sections d sigma / dtheta versus theta , are presented for various ions incident on neutral targets. First, distributions are presented for Ar ^{rm 8+} ions incident on H_{rm 2}, D _{rm 2}, and Ar targets. Energy gain studies indicate that capture occurs to primarily a 5d,f final state of Ar^{rm 7+} with some contributions from transfer ionization (T.I.) channels. Angular distribution spectra for all three targets are similar, with spectra having a main peak located at forward angles which is attributed to single capture events, and a secondary structure occurring at large angles which is attributed to T.I. contributions. A series of Ar^{rm 8+} on Ar spectra were collected using a retarding grid system as a low resolution energy spectrometer to resolve single capture events from T.I. events. The resulting single capture and T.I. angular distributions are presented. Results are discussed in terms of a classical deflection function employing a simple two state curve crossing model. Angular distributions for electron capture from He by C, N, O, F, and Ne ions with charge states from 5 ^+-8^+ are presented for projectile energies between 1.2 and 2.0 kV. Distributions for the same charge state but different ion species are simlar, but not identical with distributions for the 5 ^+ and 7^+ ions being strongly forward peaked, the 6^+ distributions are much less forward peaked with the O^{6+} distributions showing structure, the Ne^{8+} ion distribution appears to be an intermediate case between forward peaking and large angle scattering. These results are discussed in terms of classical deflection functions which utilize two state Coulomb diabatic curve crossing models. Finally, angular distributions are presented for electron capture from He by Ar^{rm 6+} ions at energies between 1287 eV and 296 eV. At large projectile energies the distribution is broad. As the energy decreases below 523 eV, distributions shift to forward angles with a second

Half-life of the electron-capture decay of {sup 97}Ru: Precision measurement shows no temperature dependence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goodwin, J. R.; Golovko, V. V.; Iacob, V. E.

2009-10-15

We have measured the half-life of the electron-capture (ec) decay of {sup 97}Ru in a metallic environment, both at low temperature (19 K), and also at room temperature. We find the half-lives at both temperatures to be the same within 0.1%. This demonstrates that a recent claim that the ec decay half-life for {sup 7}Be changes by 0.9%{+-}0.2% under similar circumstances certainly cannot be generalized to other ec decays. Our results for the half-life of {sup 97}Ru, 2.8370(14) d at room temperature and 2.8382(14) d at 19 K, are consistent with, but much more precise than, previous room-temperature measurements. Inmore » addition, we have also measured the half-lives of the {beta}{sup -}-emitters {sup 103}Ru and {sup 105}Rh at both temperatures, and found them also to be unchanged.« less

Probable interaction between an oral vitamin K antagonist and turmeric (Curcuma longa).

PubMed

Daveluy, Amélie; Géniaux, Hélène; Thibaud, Lucile; Mallaret, Michel; Miremont-Salamé, Ghada; Haramburu, Françoise

2014-01-01

We report a probable interaction between a vitamin K antagonist, fluindione, and the herbal medicine turmeric that resulted in the elevation of the international normalized ratio (INR). The case presented here underlines the importance of considering potential exposure to herbal medications when assessing adverse effects. © 2014 Société Française de Pharmacologie et de Thérapeutique.

The use of an in situ portable flume to examine the effect of flow properties on the capture probability of juvenile Atlantic salmon

NASA Astrophysics Data System (ADS)

Roy, M. L.; Roy, A. G.; Grant, J. W.

2013-12-01

For stream fish, flow properties have been shown to influence energy expenses and habitat selection. Furthermore, flow properties directly influence the velocity of drifting prey items, therefore influencing the probability of fish at catch prey. Flow properties might also have an effect on prey trajectories that can become more unpredictable with increased turbulence. In this study, we combined field and experimental approaches to examine the foraging behaviour and position choice of juvenile Atlantic salmon in various flow conditions. We used an in situ portable flume, which consists in a transparent enclosure (observation section) equipped with hinged doors upstream allowing to funnel the water inside and modify flow properties. Portable flumes have been developed and used to simulate benthic invertebrate drift and sediment transport, but have not been previously been used to examine fish behaviour. Specifically, we tested the predictions that 1) capture probability declined with turbulence, 2) the number of attacks and the proportion of time spent on the substrate decreased with turbulence and 3) parr will preferably selected focal positions with lower turbulence than random locations across the observation section. The portable flume allowed creating four flow treatments on a gradient of mean downstream velocity and turbulence. Fish were fed with brine shrimps and filmed through translucent panels using a submerged camera. Twenty-three juvenile salmon were captured and submitted to each flow treatment for 20 minutes feeding trials. Our results showed high inter-individual variability in the foraging success and time budget within each flow treatment associated to levels of velocity and turbulence. However, the average prey capture probability for the two lower velocity treatments was higher than that for the two higher velocity treatments. An inverse relationship between flow velocity and prey capture probability was observed and might have resulted from a

Exact Time-Dependent Exchange-Correlation Potential in Electron Scattering Processes

NASA Astrophysics Data System (ADS)

Suzuki, Yasumitsu; Lacombe, Lionel; Watanabe, Kazuyuki; Maitra, Neepa T.

2017-12-01

We identify peak and valley structures in the exact exchange-correlation potential of time-dependent density functional theory that are crucial for time-resolved electron scattering in a model one-dimensional system. These structures are completely missed by adiabatic approximations that, consequently, significantly underestimate the scattering probability. A recently proposed nonadiabatic approximation is shown to correctly capture the approach of the electron to the target when the initial Kohn-Sham state is chosen judiciously, and it is more accurate than standard adiabatic functionals but ultimately fails to accurately capture reflection. These results may explain the underestimation of scattering probabilities in some recent studies on molecules and surfaces.

Electronic data capture and DICOM data management in multi-center clinical trials

NASA Astrophysics Data System (ADS)

Haak, Daniel; Page, Charles-E.; Deserno, Thomas M.

2016-03-01

Providing eligibility, efficacy and security evaluation by quantitative and qualitative disease findings, medical imaging has become increasingly important in clinical trials. Here, subject's data is today captured in electronic case reports forms (eCRFs), which are offered by electronic data capture (EDC) systems. However, integration of subject's medical image data into eCRFs is insufficiently supported. Neither integration of subject's digital imaging and communications in medicine (DICOM) data, nor communication with picture archiving and communication systems (PACS), is possible. This aggravates the workflow of the study personnel, in special regarding studies with distributed data capture in multiple sites. Hence, in this work, a system architecture is presented, which connects an EDC system, a PACS and a DICOM viewer via the web access to DICOM objects (WADO) protocol. The architecture is implemented using the open source tools OpenClinica, DCM4CHEE and Weasis. The eCRF forms the primary endpoint for the study personnel, where subject's image data is stored and retrieved. Background communication with the PACS is completely hidden for the users. Data privacy and consistency is ensured by automatic de-identification and re-labelling of DICOM data with context information (e.g. study and subject identifiers), respectively. The system is exemplarily demonstrated in a clinical trial, where computer tomography (CT) data is de-centrally captured from the subjects and centrally read by a chief radiologists to decide on inclusion of the subjects in the trial. Errors, latency and costs in the EDC workflow are reduced, while, a research database is implicitly built up in the background.

Probability of detection of defects in coatings with electronic shearography

NASA Technical Reports Server (NTRS)

Russell, S. S.; Lansing, M. D.; Horton, C. M.; Gnacek, W. J.

1995-01-01

The goal of this research was to utilize statistical methods to evaluate the probability of detection (POD) of defects in coatings using electronic shearography. The coating system utilized in the POD studies was to be the paint system currently utilized on the external casings of the NASA space transportation system reusable solid rocket motor boosters. The population of samples was to be large enough to determine the minimum defect size for 90-percent POD of 95-percent confidence POD on these coatings. Also, the best methods to excite coatings on aerospace components to induce deformations for measurement by electronic shearography were to be determined.

Theory of electron capture from a hydrogen-like ion by a bare ion with extensions to inner-shell capture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alston, S.G.

1982-01-01

A complete systematic derivation is given of a new approximation for the calculation of the cross section for electron capture from a hydrogen-like ion of large nuclear charge Z/sub T/e by a bare ion of charge Z/sub p/e moving with speed v. The amplitude in the wave treatment is obtained through consistent expansion in the small parameters Z/sub p//Z/sub T/ and Z/sub p/e/sup 2//hv; however, the ratio Z/sub T/e/sup 2//hv is not assumed small. Electron-target nucleus interactions are included to all orders and electron-projectile interactions were included consistently to first order so that the theory is called the strong potentialmore » Born (SPB). Following a careful analysis of the approach to the energy shell, an off-shell factor is seen to arise which does not appear in the impulse approximation (IA). The effects of this factor on the capture amplitude are explored. It is shown that, in comparison with the IA, the correct weighting of the target spectrum of intermediate states in the SPB significantly alters the 1s ..-->.. ns cross section and at the same time makes peaking approximations to the amplitude more realistic, even for intermediate velocity Z/sub p/e/sup 2//h<« less

Electron capture in collisions of Si3+ ions with atomic hydrogen from low to intermediate energies

NASA Astrophysics Data System (ADS)

Liu, C. H.; Liu, L.; Wang, J. G.

2014-07-01

The electron capture process for the Si3+(3s) + H(1s) collisions is investigated by the quantum-mechanical molecular orbital close-coupling (MOCC) method and by the two-center atomic orbital close-coupling (AOCC) method in the energy range of 10-5-10 keV/u and 0.8-200 keV/u, respectively. Total and state-selective cross sections are presented and compared with the available theoretical and experimental results. The present MOCC and AOCC results agree well with the experimental measurements, but show some discrepancy with the calculations of Wang et al. [Phys. Rev. A 74, 052709 (2006), 10.1103/PhysRevA.74.052709] at E > 40 eV/u because of the inclusion of rotational couplings, which play important roles in the electron capture process. At lower energies, the present results are about three to five times smaller than those of Wang et al. due to the difference in the molecular data at large internuclear distances. The energy behaviors of the electron capture cross sections are discussed on the basis of identified reaction mechanisms.

The first experimental investigation of the KLL Auger spectrum of Ni generated in the electron capture decay of radioactive 64Cu in a solid state matrix

NASA Astrophysics Data System (ADS)

Inoyatov, A. Kh.; Perevoshchikov, L. L.; Kovalík, A.; Filosofov, D. V.; Gorozhankin, V. M.; Ryšavý, M.

2012-09-01

The KLL Auger spectrum of Ni generated in the electron capture decay of radioactive 64Cu in a solid state matrix was measured for the first time using a combined electrostatic electron spectrometer adjusted to a 7 eV instrumental resolution. Energies and relative intensities of the all nine basic spectrum components were determined and compared with data obtained from X-ray induced spectra of metallic Ni and with theoretical results as well. Absolute energy of 6562.5 ± 1.3 eV (related to the Fermi level) measured for the dominant KL2L3(1D2) than a value obtained from the X-ray induced spectra which is probably caused by the effects of chemical bonding and physico-chemical environment. Moreover, it is higher by 20.4 eV (16 σ) than a prediction of the semi-empirical calculations by Larkins which indicates an influence of the "atomic structure effect" on absolute energies of the Auger transitions following the electron capture decay and, possibly, some imperfections in the calculations. Good agreement of the measured and predicted KL1L2(3P0/1P1) transition intensity ratios indicates perceptible influence of the relativistic effects on the KLL Auger spectrum even at Z = 28.

Identification and measurement of chlorinated organic pesticides in water by electron-capture gas chromatography

USGS Publications Warehouse

Lamar, William L.; Goerlitz, Donald F.; Law, LeRoy M.

1965-01-01

Pesticides, in minute quantities, may affect the regimen of streams, and because they may concentrate in sediments, aquatic organisms, and edible aquatic foods, their detection and their measurement in the parts-per-trillion range are considered essential. In 1964 the U.S. Geological Survey at Menlo Park, Calif., began research on methods for monitoring pesticides in water. Two systems were selected--electron-capture gas chromatography and microcoulometric-titration gas chromatography. Studies on these systems are now in progress. This report provides current information on the development and application of an electron-capture gas chromatographic procedure. This method is a convenient and extremely sensitive procedure for the detection and measurement of organic pesticides having high electron affinities, notably the chlorinated organic pesticides. The electron-affinity detector is extremely sensitive to these substances but it is not as sensitive to many other compounds. By this method, the chlorinated organic pesticide may be determined on a sample of convenient size in concentrations as low as the parts-per-trillion range. To insure greater accuracy in the identifications, the pesticides reported were separated and identified by their retention times on two different types of gas chromatographic columns.

Doping Li and K into Na2ZrO3 Sorbent to Improve Its CO2 Capture Capability

NASA Astrophysics Data System (ADS)

Duan, Yuhua

Carbon dioxide is one of the major combustion products which once released into the air can contribute to global climate change. Solid sorbents have been reported in several previous studies to be promising candidates for CO2 sorbent applications due to their high CO2 absorption capacities at moderate working temperatures. However, at a given CO2 pressure, the turnover temperature (Tt) of an individual solid capture CO2 reaction is fixed and may be outside the operating temperature range (ΔTo) for a particularly capture technology. In order to shift such Tt for a solid into the range of ΔTo, its corresponding thermodynamic property must be changed by changing its structure by reacting (mixing) with other materials or doping with other elements. As an example, by combining thermodynamic database searching with ab initio thermodynamics calculations, in this work, we explored the Li- and K-doping effects on the Tt shifts of Na2ZrO3 at different doping levels. The obtained results showed that compared to pure Na2ZrO3, the Li- and K-doped mixtures Na2-αMαZrO3 (M =Li, K) have lower Tt and higher CO2 capture capacities.

Electron Capture in Slow Collision of He^2++H : Revisited

NASA Astrophysics Data System (ADS)

Krstic, Ps

2003-05-01

Very early experimental data (Fite et al. al., Proc. R. Soc. A 268, 527 (1962)) for He^2++H, recent ORNL measurements for Ne^2+ + H and our theoretical estimates suggest that the electron capture cross sections for these strongly exoergic collision systems drop slower toward low collision energies than expected from previous theories. We perform a theoretical study to establish and understand the true nature of this controversy. The calculations are based on the Hidden Crossings MOCC method, augmented with rotational and turning point effects.

Measurement of K to L shell vacancy transfer probabilities for the elements 46≤ Z≤55 by photoionization

NASA Astrophysics Data System (ADS)

Şimşek, Ö.; Karagöz, D.; Ertugrul, M.

2003-10-01

The K to L shell vacancy transfer probabilities for nine elements in the atomic region 46≤ Z≤55 were determined by measuring the L X-ray yields from targets excited by 5.96 and 59.5 keV photons and using the theoretical K and L shell photoionization cross-sections. The L X-rays from different targets were detected with an Ultra-LEGe detector with very thin polymer window. Present experimental results were compared with the semi empirical values tabulated by Rao et al. [Atomic vacancy distributions product by inner shellionization, Phys. Rev. A 5 (1972) 997-1002] and theoretically calculated values using radiative and radiationless transitions. The radiative transitions of these elements were observed from the relativistic Hartree-Slater model, which was proposed by Scofield [Relativistic Hartree-Slater values for K and L shell X-ray emission rates, At. Data Nucl. Data Tables 14 (1974) 121-137]. The radiationless transitions were observed from the Dirac-Hartree-Slater model, which was proposed by Chen et al. [Relativistic radiationless transition probabilities for atomic K- and L-shells, At. Data Nucl. Data Tables 24 (1979) 13-37]. To the best of our knowledge, these vacancy transfer probabilities are reported for the first time.

Current oscillations in semi-insulating GaAs associated with field-enhanced capture of electrons by the major deep donor EL2

NASA Technical Reports Server (NTRS)

Kaminska, M.; Parsey, J. M.; Lagowski, J.; Gatos, H. C.

1982-01-01

Current oscillations thermally activated by the release of electrons from deep levels in undoped semiinsulating GaAs were observed for the first time. They were attributed to electric field-enhanced capture of electrons by the dominant deep donor EL2 (antisite AsGa defect). This enhanced capture is due to the configurational energy barrier of EL2, which is readily penetrated by hot electrons.

Scanning electron microscopy of Ancylostoma spp. dog infective larvae captured and destroyed by the nematophagous fungus Duddingtonia flagrans.

PubMed

Maciel, A S; Araújo, J V; Campos, A K; Benjamin, L A; Freitas, L G

2009-06-01

The interaction between the nematode-trapping fungus Duddingtonia flagrans (isolate CG768) against Ancylostoma spp. dog infective larvae (L(3)) was evaluated by means of scanning electron microscopy. Adhesive network trap formation was observed 6h after the beginning of the interaction, and the capture of Ancylostoma spp. L(3) was observed 8h after the inoculation these larvae on the cellulose membranes colonized by the fungus. Scanning electron micrographs were taken at 0, 12, 24, 36 and 48 h, where 0 is the time when Ancylostoma spp. L(3) was first captured by the fungus. Details of the capture structure formed by the fungus were described. Nematophagous Fungus Helper Bacteria (NHB) were found at interactions points between the D. flagrans and Ancylostoma spp. L(3). The cuticle penetration by the differentiated fungal hyphae with the exit of nematode internal contents was observed 36 h after the capture. Ancylostoma spp. L(3) were completely destroyed after 48 h of interaction with the fungus. The scanning electron microscopy technique was efficient on the study of this interaction, showing that the nematode-trapping fungus D. flagrans (isolate CG768) is a potential exterminator of Ancylostoma spp. L(3).

The 5-kW arcjet power electronics

NASA Technical Reports Server (NTRS)

Gruber, R. P.; Gott, R. W.; Haag, T. W.

1989-01-01

The initial design and evaluation of a 5 kW arcjet power electronics breadboard which as been integrated with a modified 1 kW design laboratory arcjet is presented. A single stage, 5 kW full bridge, pulse width modulated (PWM), power converter was developed which was phase shift regulated. The converter used metal oxide semiconductor field effect transistor (MOSFET) power switches and incorporated current mode control and an integral arcjet pulse ignition circuit. The unoptimized power efficiency was 93.5 and 93.9 percent at 5 kW and 50A output at input voltages of 130 and 150V, respectively. Line and load current regulation at 50A output was within one percent. The converter provided up to 6.6 kW to the arcjet with simulated ammonia used as a propellant.

The 10 kW power electronics for hydrogen arcjets

NASA Technical Reports Server (NTRS)

Hamley, John A.; Pinero, Luis R.; Hill, Gerald M.

1992-01-01

A combination of emerging mission considerations such as 'launch on schedule', resource limitations, and the development of higher power spacecraft busses has resulted in renewed interest in high power hydrogen arcjet systems with specific impulses greater than 1000 s for Earth-space orbit transfer and maneuver applications. Solar electric propulsion systems with about 10 kW of power appear to offer payload benefits at acceptable trip times. This work outlines the design and development of 10 kW hydrogen arcjet power electronics and results of arcjet integration testing. The power electronics incorporated a full bridge switching topology similar to that employed in state of the art 5 kW power electronics, and the output filter included an output current averaging inductor with an integral pulse generation winding for arcjet ignition. Phase shifted, pulse width modulation with current mode control was used to regulate the current delivered to arcjet, and a low inductance power stage minimized switching transients. Hybrid power Metal Oxide Semiconductor Field Effect Transistors were used to minimize conduction losses. Switching losses were minimized using a fast response, optically isolated, totem-pole gate drive circuit. The input bus voltage for the unit was 150 V, with a maximum output voltage of 225 V. The switching frequency of 20 kHz was a compromise between mass savings and higher efficiency. Power conversion efficiencies in excess of 0.94 were demonstrated, along with steady state load current regulation of 1 percent. The power electronics were successfully integrated with a 10 kW laboratory hydrogen arcjet, and reliable, nondestructive starts and transitions to steady state operation were demonstrated. The estimated specific mass for a flight packaged unit was 2 kg/kW.

Hydrogen/deuterium exchange mass spectrometry with top-down electron capture dissociation for characterizing structural transitions of a 17 kDa protein.

PubMed

Pan, Jingxi; Han, Jun; Borchers, Christoph H; Konermann, Lars

2009-09-09

Amide H/D exchange (HDX) mass spectrometry (MS) is widely used for protein structural studies. Traditionally, this technique involves protein labeling in D(2)O, followed by acid quenching, proteolytic digestion, and analysis of peptide deuteration levels by HPLC/MS. There is great interest in the development of alternative HDX approaches involving the top-down fragmentation of electrosprayed protein ions, instead of relying on enzymatic cleavage and solution-phase separations. A number of recent studies have demonstrated that electron capture dissociation (ECD) results in fragmentation of gaseous protein ions with little or no H/D scrambling. However, the successful application of this approach for in-depth protein conformational studies has not yet been demonstrated. The current work uses horse myoglobin as a model system for assessing the suitability of HDX-MS with top-down ECD for experiments of this kind. It is found that ECD can pinpoint the locations of protected amides with an average resolution of less than two residues for this 17 kDa protein. Native holo-myoglobin (hMb) shows considerable protection from exchange in all of its helices, whereas loops are extensively deuterated. Fraying is observable at some helix termini. Removal of the prosthetic heme group from hMb produces apo-myoglobin (aMb). Both hMb and aMb share virtually the same HDX protection pattern in helices A-E, whereas helix F is unfolded in aMb. In addition, destabilization is evident for some residues close to the beginning of helix G, the end of helix H, and the C-terminus of the protein. The structural changes reported herein are largely consistent with earlier NMR data for sperm whale myoglobin, although small differences between the two systems are evident. Our findings demonstrate that the level of structural information obtainable with top-down ECD for small to medium-sized proteins considerably surpasses that of traditional HDX-MS experiments, while at the same time greatly reducing

Density functional calculations of multiphonon capture cross sections at defects in semiconductors

NASA Astrophysics Data System (ADS)

Barmparis, Georgios D.; Puzyrev, Yevgeniy S.; Zhang, X.-G.; Pantelides, Sokrates T.

2014-03-01

The theory of electron capture cross sections by multiphonon processes in semiconductors has a long and controversial history. Here we present a comprehensive theory and describe its implementation for realistic calculations. The Born-Oppenheimer and the Frank-Condon approximations are employed. The transition probability of an incoming electron is written as a product of an instantaneous electronic transition in the initial defect configuration and the line shape function (LSF) that describes the multiphonon processes that lead to lattice relaxation. The electronic matrix elements are calculated using the Projector Augmented Wave (PAW) method which yields the true wave functions while still employing a plane-wave basis. The LSF is calculated by employing a Monte Carlo method and the real phonon modes of the defect, calculated using density functional theory in the PAW scheme. Initial results of the capture cross section for a prototype system, namely a triply hydrogenated vacancy in Si are presented. The results are relevant for modeling device degradation by hot electron effects. This work is supported in part by the Samsung Advanced Institute of Technology (SAIT)'s Global Research Outreach (GRO) Program and by the LDRD program at ORNL.

Electron-capture Isotopes Could Constrain Cosmic-Ray Propagation Models

NASA Astrophysics Data System (ADS)

Benyamin, David; Shaviv, Nir J.; Piran, Tsvi

2017-12-01

Electron capture (EC) isotopes are known to provide constraints on the low-energy behavior of cosmic rays (CRs), such as reacceleration. Here, we study the EC isotopes within the framework of the dynamic spiral-arms CR propagation model in which most of the CR sources reside in the galactic spiral arms. The model was previously used to explain the B/C and sub-Fe/Fe ratios. We show that the known inconsistency between the 49Ti/49V and 51V/51Cr ratios remains also in the spiral-arms model. On the other hand, unlike the general wisdom that says the isotope ratios depend primarily on reacceleration, we find here that the ratio also depends on the halo size (Z h) and, in spiral-arms models, also on the time since the last spiral-arm passage ({τ }{arm}). Namely, EC isotopes can, in principle, provide interesting constraints on the diffusion geometry. However, with the present uncertainties in the lab measurements of both the electron attachment rate and the fragmentation cross sections, no meaningful constraint can be placed.

Non-Maxwellian electron energy probability functions in the plume of a SPT-100 Hall thruster

NASA Astrophysics Data System (ADS)

Giono, G.; Gudmundsson, J. T.; Ivchenko, N.; Mazouffre, S.; Dannenmayer, K.; Loubère, D.; Popelier, L.; Merino, M.; Olentšenko, G.

2018-01-01

We present measurements of the electron density, the effective electron temperature, the plasma potential, and the electron energy probability function (EEPF) in the plume of a 1.5 kW-class SPT-100 Hall thruster, derived from cylindrical Langmuir probe measurements. The measurements were taken on the plume axis at distances between 550 and 1550 mm from the thruster exit plane, and at different angles from the plume axis at 550 mm for three operating points of the thruster, characterized by different discharge voltages and mass flow rates. The bulk of the electron population can be approximated as a Maxwellian distribution, but the measured distributions were seen to decline faster at higher energy. The measured EEPFs were best modelled with a general EEPF with an exponent α between 1.2 and 1.5, and their axial and angular characteristics were studied for the different operating points of the thruster. As a result, the exponent α from the fitted distribution was seen to be almost constant as a function of the axial distance along the plume, as well as across the angles. However, the exponent α was seen to be affected by the mass flow rate, suggesting a possible relationship with the collision rate, especially close to the thruster exit. The ratio of the specific heats, the γ factor, between the measured plasma parameters was found to be lower than the adiabatic value of 5/3 for each of the thruster settings, indicating the existence of non-trivial kinetic heat fluxes in the near collisionless plume. These results are intended to be used as input and/or testing properties for plume expansion models in further work.

Introducing electron capture into the unitary-convolution-approximation energy-loss theory at low velocities

NASA Astrophysics Data System (ADS)

Schiwietz, G.; Grande, P. L.

2011-11-01

Recent developments in the theoretical treatment of electronic energy losses of bare and screened ions in gases are presented. Specifically, the unitary-convolution-approximation (UCA) stopping-power model has proven its strengths for the determination of nonequilibrium effects for light as well as heavy projectiles at intermediate to high projectile velocities. The focus of this contribution will be on the UCA and its extension to specific projectile energies far below 100 keV/u, by considering electron-capture contributions at charge-equilibrium conditions.

Capturing structured, pulmonary disease-specific data elements in electronic health records.

PubMed

Gronkiewicz, Cynthia; Diamond, Edward J; French, Kim D; Christodouleas, John; Gabriel, Peter E

2015-04-01

Electronic health records (EHRs) have the potential to improve health-care quality by allowing providers to make better decisions at the point of care based on electronically aggregated data and by facilitating clinical research. These goals are easier to achieve when key, disease-specific clinical information is documented as structured data elements (SDEs) that computers can understand and process, rather than as free-text/natural-language narrative. This article reviews the benefits of capturing disease-specific SDEs. It highlights several design and implementation considerations, including the impact on efficiency and expressivity of clinical documentation and the importance of adhering to data standards when available. Pulmonary disease-specific examples of collection instruments are provided from two commonly used commercial EHRs. Future developments that can leverage SDEs to improve clinical quality and research are discussed.

M-shell electron capture and direct ionization of gold by 25-MeV carbon and 32-MeV oxygen ions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andrews, M.C.; McDaniel, F.D.; Duggan, J.L.

1984-01-01

M-shell x-ray production cross sections have been measured for thin solid targets of Au for 25 MeV /sup 12/C/sup q+/ (q = 4, 5, 6) and for 32 MeV /sup 16/O/sup q+/ (q = 5, 7, 8). The microscopic cross sections were determined from measurements made with targets ranging in thickness from 0.5 to 100 ..mu..g/cm/sup 2/. For projectiles with one or two K-shell vacancies, the M-shell x-ray production cross sections are found to be enhanced over those by projectiles without a K-shell vacancy. The sum of direct ionization to the continuum (DI) and electron capture (EC) to the L,more » M, N ... shells and EC to the K-shell of the projectile have been extracted from the data. The results are compared to the predictions of first Born theories i.e. PWBA for DI and OBK of Nikolaev for EC and the ECPSSR approach that accounts for energy loss, Coulomb deflection and relativistic effects in the perturbed stationary state theory. 25 references, 3 figures, 1 table.« less

Evaluation of the 1077 keV γ-ray emission probability from 68Ga decay

NASA Astrophysics Data System (ADS)

Huang, Xiao-Long; Jiang, Li-Yang; Chen, Xiong-Jun; Chen, Guo-Chang

2014-04-01

68Ga decays to the excited states of 68Zn through the electron capture decay mode. New recommended values for the emission probability of 1077 keV γ-ray given by the ENSDF and DDEP databases all use data from absolute measurements. In 2011, JIANG Li-Yang deduced a new value for 1077 keV γ-ray emission probability by measuring the 69Ga(n,2n) 68Ga reaction cross section. The new value is about 20% lower than values obtained from previous absolute measurements and evaluations. In this paper, the discrepancies among the measurements and evaluations are analyzed carefully and the new values are re-recommended. Our recommended value for the emission probability of 1077 keV γ-ray is (2.72±0.16)%.

A technique for searching for the 2 K capture in 124Xe with a copper proportional counter

NASA Astrophysics Data System (ADS)

Gavrilyuk, Yu. M.; Gangapshev, A. M.; Kazalov, V. V.; Kuzminov, V. V.; Panasenko, S. I.; Ratkevich, S. S.; Tekueva, D. A.; Yakimenko, S. P.

2015-12-01

An experimental technique for searching for the 2 K capture in 124Xe with a large low-background copper proportional counter is described. Such an experiment is conducted at the Baksan Neutrino Observatory of the Institute for Nuclear Research of the Russian Academy of Sciences. The experimental setup is located in the Low-Background Deep-Level Laboratory at a depth of 4900 m.w.e., where the flux of muons of cosmic rays is suppressed by a factor of 107 relative to that at the Earth's surface. The setup incorporates a proportional counter and low-background shielding (18 cm of copper, 15 cm of lead, and 8 cm of borated polyethylene). The results of processing the data obtained in 5 months of live measurement time are presented. A new limit on the half-life of 124Xe with respect to the 2 K capture is set at the level of 2.5 × 1021 years.

Multiple electron processes of He and Ne by proton impact

NASA Astrophysics Data System (ADS)

Terekhin, Pavel Nikolaevich; Montenegro, Pablo; Quinto, Michele; Monti, Juan; Fojon, Omar; Rivarola, Roberto

2016-05-01

A detailed investigation of multiple electron processes (single and multiple ionization, single capture, transfer-ionization) of He and Ne is presented for proton impact at intermediate and high collision energies. Exclusive absolute cross sections for these processes have been obtained by calculation of transition probabilities in the independent electron and independent event models as a function of impact parameter in the framework of the continuum distorted wave-eikonal initial state theory. A binomial analysis is employed to calculate exclusive probabilities. The comparison with available theoretical and experimental results shows that exclusive probabilities are needed for a reliable description of the experimental data. The developed approach can be used for obtaining the input database for modeling multiple electron processes of charged particles passing through the matter.

Vanadium fine-structure K-shell electron impact ionization cross sections for fast-electron diagnostic in laser–solid experiments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Palmeri, P., E-mail: patrick.palmeri@umons.ac.be; Quinet, P., E-mail: pascal.quinet@umons.ac.be; IPNAS, Université de Liège, B-4000 Liège

2015-09-15

The K-shell electron impact ionization (EII) cross section, along with the K-shell fluorescence yield, is one of the key atomic parameters for fast-electron diagnostic in laser–solid experiments through the K-shell emission cross section. In addition, in a campaign dedicated to the modeling of the K lines of astrophysical interest (Palmeri et al. (2012)), the K-shell fluorescence yields for the K-vacancy fine-structure atomic levels of all the vanadium isonuclear ions have been calculated. In this study, the K-shell EII cross sections connecting the ground and the metastable levels of the parent vanadium ions to the daughter ions K-vacancy levels considered in Palmerimore » et al. (2012) have been determined. The relativistic distorted-wave (DW) approximation implemented in the FAC atomic code has been used for the incident electron kinetic energies up to 20 times the K-shell threshold energies. Moreover, the resulting DW cross sections have been extrapolated at higher energies using the asymptotic behavior of the modified relativistic binary encounter Bethe model (MRBEB) of Guerra et al. (2012) with the density-effect correction proposed by Davies et al. (2013)« less

NOR-DMARD data management: implementation of data capture from electronic health records.

PubMed

Olsen, I C; Haavardsholm, E A; Moholt, E; Kvien, T K; Lie, E

2014-01-01

The use of electronic health records (EHR) is an essential part of modern health care, and electronic data capture (EDC) has become essential for managing clinical trials. Usually, these two entities are independent of each other, and transfer from one system to another is done manually. Our aim was to develop a method to capture data directly from the EHR system and transfer them into an EDC system for the NORwegian Disease-Modifying Anti-Rheumatic Drugs (NOR-DMARD) registry. All rheumatology departments contributing to NOR-DMARD had implemented a structured EHR system. Data are extracted locally and securely transferred to the study data management once a month. The study data management then parse the data into a readable format for the EDC and import the data. Once the data is in the EDC, they are available to all authorized researchers and downloadable in a preferred format. From May 2012 to August 2014 almost 6400 visits in 3400 patients treated with biologics have been successfully registered in the EDC system. Previously, NOR-DMARD used standard paper-based case report forms (CRFs), with a substantial cost for data entry. Setting up and maintaining the EDC system required some investments, but the amount saved from avoiding paper handling has made the shift into EDC profitable. In addition to this, gains have been made in administration and data quality. The transition from paper and pencil format to a fully electronic data management system in NOR-DMARD has had obvious advantages regarding feasibility, cost, data quality and accessibility of the data.

Procurement of Shared Data Instruments for Research Electronic Data Capture (REDCap)

PubMed Central

Obeid, Jihad S; McGraw, Catherine A; Minor, Brenda L; Conde, José G; Pawluk, Robert; Lin, Michael; Wang, Janey; Banks, Sean R; Hemphill, Sheree A; Taylor, Rob; Harris, Paul A

2012-01-01

REDCap (Research Electronic Data Capture) is a web-based software solution and tool set that allows biomedical researchers to create secure online forms for data capture, management and analysis with minimal effort and training. The Shared Data Instrument Library (SDIL) is a relatively new component of REDCap that allows sharing of commonly used data collection instruments for immediate study use by 3 research teams. Objectives of the SDIL project include: 1) facilitating reuse of data dictionaries and reducing duplication of effort; 2) promoting the use of validated data collection instruments, data standards and best practices; and 3) promoting research collaboration and data sharing. Instruments submitted to the library are reviewed by a library oversight committee, with rotating membership from multiple institutions, which ensures quality, relevance and legality of shared instruments. The design allows researchers to download the instruments in a consumable electronic format in the REDCap environment. At the time of this writing, the SDIL contains over 128 data collection instruments. Over 2500 instances of instruments have been downloaded by researchers at multiple institutions. In this paper we describe the library platform, provide detail about experience gained during the first 25 months of sharing public domain instruments and provide evidence of impact for the SDIL across the REDCap consortium research community. We postulate that the shared library of instruments reduces the burden of adhering to sound data collection principles while promoting best practices. PMID:23149159

Copper fine-structure K-shell electron impact ionization cross sections for fast-electron diagnostic in laser-solid experiments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Palmeri, P., E-mail: patrick.palmeri@umons.ac.be; Quinet, P., E-mail: pascal.quinet@umons.ac.be; IPNAS, Université de Liège, B-4000 Liège

2015-03-15

The K-shell electron impact ionization (EII) cross section, along with the K-shell fluorescence yield, is one of the key atomic parameters for fast-electron diagnostic in laser-solid experiments through the K-shell emission cross section. In addition, copper is a material that has been often used in those experiments because it has a maximum total K-shell emission yield. Furthermore, in a campaign dedicated to the modeling of the K lines of astrophysical interest (Palmeri et al., 2012), the K-shell fluorescence yields for the K-vacancy fine-structure atomic levels of all the copper isonuclear ions have been calculated. In this study, the K-shell EII crossmore » sections connecting the ground and the metastable levels of the parent copper ions to the daughter ions K-vacancy levels considered in Palmeri et al. (2012) have been determined. The relativistic distorted-wave (DW) approximation implemented in the FAC atomic code has been used for the incident electron kinetic energies up to 10 times the K-shell threshold energies. Moreover, the resulting DW cross sections have been extrapolated at higher energies using the asymptotic form proposed by Davies et al. (2013)« less

A generalized electron energy probability function for inductively coupled plasmas under conditions of nonlocal electron kinetics

NASA Astrophysics Data System (ADS)

Mouchtouris, S.; Kokkoris, G.

2018-01-01

A generalized equation for the electron energy probability function (EEPF) of inductively coupled Ar plasmas is proposed under conditions of nonlocal electron kinetics and diffusive cooling. The proposed equation describes the local EEPF in a discharge and the independent variable is the kinetic energy of electrons. The EEPF consists of a bulk and a depleted tail part and incorporates the effect of the plasma potential, Vp, and pressure. Due to diffusive cooling, the break point of the EEPF is eVp. The pressure alters the shape of the bulk and the slope of the tail part. The parameters of the proposed EEPF are extracted by fitting to measure EEPFs (at one point in the reactor) at different pressures. By coupling the proposed EEPF with a hybrid plasma model, measurements in the gaseous electronics conference reference reactor concerning (a) the electron density and temperature and the plasma potential, either spatially resolved or at different pressure (10-50 mTorr) and power, and (b) the ion current density of the electrode, are well reproduced. The effect of the choice of the EEPF on the results is investigated by a comparison to an EEPF coming from the Boltzmann equation (local electron kinetics approach) and to a Maxwellian EEPF. The accuracy of the results and the fact that the proposed EEPF is predefined renders its use a reliable alternative with a low computational cost compared to stochastic electron kinetic models at low pressure conditions, which can be extended to other gases and/or different electron heating mechanisms.

Collective acceleration of ions in picosecond pinched electron beams

NASA Astrophysics Data System (ADS)

Baryshnikov, V. I.; Paperny, V. L.; Shipayev, I. V.

2017-10-01

Сharacteristics of intense electron-ion beams emitted by a high-voltage (280 kV) electron accelerator with a pulse duration of 200 ps and current 5 kA are studied. The capture phenomena and the subsequent collective acceleration of multi charged ions of the cathode material by the electric field of the electron beam are observed. It is shown that the electron-ion beam diameter does not exceed 30 µm therein in the case of lighter ions, and the decay of the pinched beam occurs at a shorter distance from the cathode. It is established that the ions of the cathode material Tin+ captured by the electron beam are accelerated up to an energy of  ⩽10 MeV, and the ion fluence reaches 1017 ion cm-2 in the pulse. These ions are effectively embedded into the lattice sites of the irradiated substrate (sapphire crystal), forming the luminescent areas of the micron scale.

Dynamics of the cascade capture of electrons by charged donors in GaAs and InP

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aleshkin, V. Ya., E-mail: aleshkin@ipmras.ru; Gavrilenko, L. V.

2016-08-15

The times for the cascade capture of an electron by a charged impurity have been calculated for pulsed and stationary excitations of impurity photoconductivity in GaAs and InP. The characteristic capture times under pulsed and continuous excitations are shown to differ noticeably both from each other and from the value given by the Abakumov–Perel–Yassievich formula for a charged impurity concentration greater than 10{sup 10} cm{sup –3}. The cause of this difference has been established. The Abakumov–Perel–Yassievich formula for the cascade capture cross section in the case of stationary excitation has been generalized. The dependences of the cascade capture rate onmore » the charged impurity concentration in GaAs and InP have been found for three temperatures in the case of pulsed excitation.« less

An iterative algorithm for determining depth profiles of collection probability by electron-beam-induced current

NASA Astrophysics Data System (ADS)

Konovalov, Igor; Breitenstein, Otwin

2001-01-01

An iterative algorithm for the derivation of depth profiles of the minority carrier collection probability in a semiconductor with or without a coating on the top is presented using energy-resolved electron-beam-induced current measurements in planar geometry. The calculation is based on the depth-dose function of Everhart and Hoff (Everhart T E and Hoff P H 1971 J. Appl. Phys. 42 5837) and on the penetration-range function of Kanaya and Okayama (Kanaya K and Okayama S 1972 J. Phys. D: Appl. Phys. 5 43) or on that of Fitting (Fitting H-J 1974 Phys. Status Solidi/ a 26 525). It can also be performed with any other depth-dose functions. Using this algorithm does not require us to make any assumptions on the shape of the collection profile within the depth of interest. The influence of an absorbing top contact and/or a limited thickness of the semiconductor layer appear in the result, but can also be taken explicitly into account. Examples using silicon and CIS solar cells as well as a GaAs LED are presented.

Evaluation of a mandatory quality assurance data capture in anesthesia: a secure electronic system to capture quality assurance information linked to an automated anesthesia record.

PubMed

Peterfreund, Robert A; Driscoll, William D; Walsh, John L; Subramanian, Aparna; Anupama, Shaji; Weaver, Melissa; Morris, Theresa; Arnholz, Sarah; Zheng, Hui; Pierce, Eric T; Spring, Stephen F

2011-05-01

Efforts to assure high-quality, safe, clinical care depend upon capturing information about near-miss and adverse outcome events. Inconsistent or unreliable information capture, especially for infrequent events, compromises attempts to analyze events in quantitative terms, understand their implications, and assess corrective efforts. To enhance reporting, we developed a secure, electronic, mandatory system for reporting quality assurance data linked to our electronic anesthesia record. We used the capabilities of our anesthesia information management system (AIMS) in conjunction with internally developed, secure, intranet-based, Web application software. The application is implemented with a backend allowing robust data storage, retrieval, data analysis, and reporting capabilities. We customized a feature within the AIMS software to create a hard stop in the documentation workflow before the end of anesthesia care time stamp for every case. The software forces the anesthesia provider to access the separate quality assurance data collection program, which provides a checklist for targeted clinical events and a free text option. After completing the event collection program, the software automatically returns the clinician to the AIMS to finalize the anesthesia record. The number of events captured by the departmental quality assurance office increased by 92% (95% confidence interval [CI] 60.4%-130%) after system implementation. The major contributor to this increase was the new electronic system. This increase has been sustained over the initial 12 full months after implementation. Under our reporting criteria, the overall rate of clinical events reported by any method was 471 events out of 55,382 cases or 0.85% (95% CI 0.78% to 0.93%). The new system collected 67% of these events (95% confidence interval 63%-71%). We demonstrate the implementation in an academic anesthesia department of a secure clinical event reporting system linked to an AIMS. The system enforces

Mechanistic Study on Electron Capture Dissociation of the Oligosaccharide-Mg2+ Complex

NASA Astrophysics Data System (ADS)

Huang, Yiqun; Pu, Yi; Yu, Xiang; Costello, Catherine E.; Lin, Cheng

2014-08-01

Electron capture dissociation (ECD) has shown great potential in structural characterization of glycans. However, our current understanding of the glycan ECD process is inadequate for accurate interpretation of the complex glycan ECD spectra. Here, we present the first comprehensive theoretical investigation on the ECD fragmentation behavior of metal-adducted glycans, using the cellobiose-Mg2+ complex as the model system. Molecular dynamics simulation was carried out to determine the typical glycan-Mg2+ binding patterns and the lowest-energy conformer identified was used as the initial geometry for density functional theory-based theoretical modeling. It was found that the electron is preferentially captured by Mg2+ and the resultant Mg+• can abstract a hydroxyl group from the glycan moiety to form a carbon radical. Subsequent radical migration and α-cleavage(s) result in the formation of a variety of product ions. The proposed hydroxyl abstraction mechanism correlates well with the major features in the ECD spectrum of the Mg2+-adducted cellohexaose. The mechanism presented here also predicts the presence of secondary, radical-induced fragmentation pathways. These secondary fragment ions could be misinterpreted, leading to erroneous structural determination. The present study highlights an urgent need for continuing investigation of the glycan ECD mechanism, which is imperative for successful development of bioinformatics tools that can take advantage of the rich structural information provided by ECD of metal-adducted glycans.

Comparison of electronic data capture (EDC) with the standard data capture method for clinical trial data.

PubMed

Walther, Brigitte; Hossin, Safayet; Townend, John; Abernethy, Neil; Parker, David; Jeffries, David

2011-01-01

Traditionally, clinical research studies rely on collecting data with case report forms, which are subsequently entered into a database to create electronic records. Although well established, this method is time-consuming and error-prone. This study compares four electronic data capture (EDC) methods with the conventional approach with respect to duration of data capture and accuracy. It was performed in a West African setting, where clinical trials involve data collection from urban, rural and often remote locations. Three types of commonly available EDC tools were assessed in face-to-face interviews; netbook, PDA, and tablet PC. EDC performance during telephone interviews via mobile phone was evaluated as a fourth method. The Graeco Latin square study design allowed comparison of all four methods to standard paper-based recording followed by data double entry while controlling simultaneously for possible confounding factors such as interview order, interviewer and interviewee. Over a study period of three weeks the error rates decreased considerably for all EDC methods. In the last week of the study the data accuracy for the netbook (5.1%, CI95%: 3.5-7.2%) and the tablet PC (5.2%, CI95%: 3.7-7.4%) was not significantly different from the accuracy of the conventional paper-based method (3.6%, CI95%: 2.2-5.5%), but error rates for the PDA (7.9%, CI95%: 6.0-10.5%) and telephone (6.3%, CI95% 4.6-8.6%) remained significantly higher. While EDC-interviews take slightly longer, data become readily available after download, making EDC more time effective. Free text and date fields were associated with higher error rates than numerical, single select and skip fields. EDC solutions have the potential to produce similar data accuracy compared to paper-based methods. Given the considerable reduction in the time from data collection to database lock, EDC holds the promise to reduce research-associated costs. However, the successful implementation of EDC requires adjustment of

Comparison of Electronic Data Capture (EDC) with the Standard Data Capture Method for Clinical Trial Data

PubMed Central

Walther, Brigitte; Hossin, Safayet; Townend, John; Abernethy, Neil; Parker, David; Jeffries, David

2011-01-01

Background Traditionally, clinical research studies rely on collecting data with case report forms, which are subsequently entered into a database to create electronic records. Although well established, this method is time-consuming and error-prone. This study compares four electronic data capture (EDC) methods with the conventional approach with respect to duration of data capture and accuracy. It was performed in a West African setting, where clinical trials involve data collection from urban, rural and often remote locations. Methodology/Principal Findings Three types of commonly available EDC tools were assessed in face-to-face interviews; netbook, PDA, and tablet PC. EDC performance during telephone interviews via mobile phone was evaluated as a fourth method. The Graeco Latin square study design allowed comparison of all four methods to standard paper-based recording followed by data double entry while controlling simultaneously for possible confounding factors such as interview order, interviewer and interviewee. Over a study period of three weeks the error rates decreased considerably for all EDC methods. In the last week of the study the data accuracy for the netbook (5.1%, CI95%: 3.5–7.2%) and the tablet PC (5.2%, CI95%: 3.7–7.4%) was not significantly different from the accuracy of the conventional paper-based method (3.6%, CI95%: 2.2–5.5%), but error rates for the PDA (7.9%, CI95%: 6.0–10.5%) and telephone (6.3%, CI95% 4.6–8.6%) remained significantly higher. While EDC-interviews take slightly longer, data become readily available after download, making EDC more time effective. Free text and date fields were associated with higher error rates than numerical, single select and skip fields. Conclusions EDC solutions have the potential to produce similar data accuracy compared to paper-based methods. Given the considerable reduction in the time from data collection to database lock, EDC holds the promise to reduce research-associated costs

High- k Gate Dielectrics for Emerging Flexible and Stretchable Electronics.

PubMed

Wang, Binghao; Huang, Wei; Chi, Lifeng; Al-Hashimi, Mohammed; Marks, Tobin J; Facchetti, Antonio

2018-05-22

Recent advances in flexible and stretchable electronics (FSE), a technology diverging from the conventional rigid silicon technology, have stimulated fundamental scientific and technological research efforts. FSE aims at enabling disruptive applications such as flexible displays, wearable sensors, printed RFID tags on packaging, electronics on skin/organs, and Internet-of-things as well as possibly reducing the cost of electronic device fabrication. Thus, the key materials components of electronics, the semiconductor, the dielectric, and the conductor as well as the passive (substrate, planarization, passivation, and encapsulation layers) must exhibit electrical performance and mechanical properties compatible with FSE components and products. In this review, we summarize and analyze recent advances in materials concepts as well as in thin-film fabrication techniques for high- k (or high-capacitance) gate dielectrics when integrated with FSE-compatible semiconductors such as organics, metal oxides, quantum dot arrays, carbon nanotubes, graphene, and other 2D semiconductors. Since thin-film transistors (TFTs) are the key enablers of FSE devices, we discuss TFT structures and operation mechanisms after a discussion on the needs and general requirements of gate dielectrics. Also, the advantages of high- k dielectrics over low- k ones in TFT applications were elaborated. Next, after presenting the design and properties of high- k polymers and inorganic, electrolyte, and hybrid dielectric families, we focus on the most important fabrication methodologies for their deposition as TFT gate dielectric thin films. Furthermore, we provide a detailed summary of recent progress in performance of FSE TFTs based on these high- k dielectrics, focusing primarily on emerging semiconductor types. Finally, we conclude with an outlook and challenges section.

Atypical behavior in the electron capture induced dissociation of biologically relevant transition metal ion complexes of the peptide hormone oxytocin

NASA Astrophysics Data System (ADS)

Kleinnijenhuis, Anne J.; Mihalca, Romulus; Heeren, Ron M. A.; Heck, Albert J. R.

2006-07-01

Doubly protonated ions of the disulfide bond containing nonapeptide hormone oxytocin and oxytocin complexes with different transition metal ions, that have biological relevance under physiological conditions, were subjected to electron capture dissociation (ECD) to probe their structural features in the gas phase. Although, all the ECD spectra were strikingly different, typical ECD behavior was observed for complexes of the nonapeptide hormone oxytocin with Ni2+, Co2+ and Zn2+, i.e., abundant c/z' and a'/y backbone cleavages and ECD characteristic S-S and S-C bond cleavages were observed. We propose that, although in the oxytocin-transition metal ion complexes the metal ions serve as the main initial capture site, the captured electron is transferred to other sites in the complex to form a hydrogen radical, which drives the subsequent typical ECD fragmentations. The complex of oxytocin with Cu2+ displayed noticeably different ECD behavior. The fragment ions were similar to fragment ions typically observed with low-energy collision induced dissociation (CID). We propose that the electrons captured by the oxytocin-Cu2+ complex might be favorably involved in reducing the Cu2+ metal ion to Cu+. Subsequent energy redistribution would explain the observed low-energy CID-type fragmentations. Electron capture resulted also in quite different specific cleavage sites for the complexes of oxytocin with Ni2+, Co2+ and Zn2+. This is an indication for structural differences in these complexes possibly linked to their significantly different biological effects on oxytocin-receptor binding, and suggests that ECD may be used to study subtle structural differences in transition metal ion-peptide complexes.

Differential cross sections for electron capture in p + H2 collisions

NASA Astrophysics Data System (ADS)

Igarashi, Akinori; Gulyás, Laszlo; Ohsaki, Akihiko

2017-11-01

Projectile angular distributions for electron capture in p + H2 collisions at 25 and 75 keV impact energies, measured by Sharma et al. [Phys. Rev. A 86, 022706 (2012)], are calculated using the CDW-EIS and eikonal approximations. Angular distributions evaluated in the CDW-EIS approximation are in good agreement with the experimental data measured for coherent projectile beams. Incoherent projectile scatterings are also considered by folding the coherent angular distributions over the transverse momentum distribution of the projectile wave-packet. Reasonable agreements with the measurements are obtained only with coherence parameters very different from those reported in the experiments.

Neutrino signal of electron-capture supernovae from core collapse to cooling.

PubMed

Hüdepohl, L; Müller, B; Janka, H-T; Marek, A; Raffelt, G G

2010-06-25

An 8.8M{⊙} electron-capture supernova was simulated in spherical symmetry consistently from collapse through explosion to essentially complete deleptonization of the forming neutron star. The evolution time (∼9  s) is short because high-density effects suppress our neutrino opacities. After a short phase of accretion-enhanced luminosities (∼200  ms), luminosity equipartition among all species becomes almost perfect and the spectra of ν{e} and ν{μ,τ} very similar, ruling out the neutrino-driven wind as r-process site. We also discuss consequences for neutrino flavor oscillations.

Energy of atomic shakeoff electrons from positron decay of 37K

NASA Astrophysics Data System (ADS)

Behr, John; Fenker, Benjamin; Gorelov, Alexandre; Anholm, Melissa; Behling, Spencer; Mehlman, Michael; Melconian, Dan; Ashery, Danny; Gwinner, Gerald

2015-10-01

We have measured the low-energy atomic shakeoff electron spectrum from the β+ decay of 37K. We collect atomic electrons emitted from laser-cooled 37K using a nearly uniform electric field at low magnetic field into a position-sensitive microchannel plate. A coincidence with energetic β+s removes background. The differential position information translates to a differential electron energy spectrum. The energy spectrum from 1-100 eV is reproduced well by an analytic calculation for hydrogenic wavefunctions [Levinger PR 90 11 (1953)] using potassium quantum defects. Less than one percent of the electrons have energies higher than the 25 eV threshold for double DNA strand breaks, so relative biological effectiveness would not be altered by including these electrons. The average energy carried off by these electrons (a few eV) is smaller than expected from simple Thomas-Fermi estimates (65eV). Supported by NSERC, NRC through TRIUMF, U.S. D.O.E., State of Texas, Israel Science Foundation

Probability and shape of the spectral line of a single bulk characteristic energy loss of a fast electron in a medium with electron absorption and strong spatial dispersion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Libenson, B. N., E-mail: libenson-b@yandex.ru

2011-10-15

The probability of single characteristic energy loss of a fast electron in a reflection experiment has been calculated. Unlike many works concerning this subject, the bremsstrahlung of bulk plasmons in the non- Cherenkov ranges of frequencies and wavevectors of a plasmon has been taken into account. The contributions to the probability of single loss and to the shape of the spectral line from a quantum correction that is due to the interference of elastic and inelastic electron scattering events have been determined. The probability has been calculated in the kinetic approximation for the relative permittivity, where the short-wavelength range ofmore » the plasmon spectrum is correctly taken into account. In view of these circumstances, the expression for the mean free path of the electron with respect to the emission of a bulk plasmon that was obtained by Pines [D. Pines, Elementary Excitations in Solids (Benjamin, New York, 1963)] has been refined. The coherence length of the fast electron in the medium-energy range under consideration has been estimated. The shape of the spectral line of energy losses in the non-Cherenkov frequency range has been determined. It has been shown that the probability of the single emission of the bulk plasmon incompletely corresponds to the Poisson statistics.« less

Case A and B evolution towards electron capture supernova

NASA Astrophysics Data System (ADS)

Siess, L.; Lebreuilly, U.

2018-06-01

Context. Most super-asymptotic giant branch (SAGB) stars are expected to end their life as oxygen-neon white dwarfs rather than electron capture supernovae (ECSN). The reason is ascribed to the ability of the second dredge-up to significantly reduce the mass of the He core and of the efficient AGB winds to remove the stellar envelope before the degenerate core reaches the critical mass for the activation of electron capture reactions. Aims: In this study, we investigate the formation of ECSN through case A and case B mass transfer. In these scenarios, when Roche lobe overflow stops, the primary has become a helium star. With a small envelope left, the second dredge-up is prevented, potentially opening new paths to ECSN. Methods: We compute binary models using our stellar evolution code BINSTAR. We consider three different secondary masses of 8, 9, and 10 M⊙ and explore the parameter space, varying the companion mass, orbital period, and input physics. Results: Assuming conservative mass transfer, with our choice of secondary masses all case A systems enter contact either during the main sequence or as a consequence of reversed mass transfer when the secondary overtakes its companion during core helium burning. Case B systems are able to produce ECSN progenitors in a relatively small range of periods (3 ≲ P(d) ≤ 30) and primary masses (10.9 ≤ M/M⊙≤ 11.5). Changing the companion mass has little impact on the primary's fate as long as the mass ratio M1/M2 remains less than 1.4-1.5, above which evolution to contact becomes unavoidable. We also find that allowing for systemic mass loss substantially increases the period interval over which ECSN can occur. This change in the binary physics does not however affect the primary mass range. We finally stress that the formation of ECSN progenitors through case A and B mass transfer is very sensitive to adopted binary and stellar physics. Conclusions: Close binaries provide additional channels for ECSN but the

Midwife to the greens: the electron capture detector.

PubMed

Lovelock, J E

1997-03-01

James E. Lovelock makes an account of the path he has followed since he started his scientific research at the National Institute for Medical Research (NIMR) in London in the 1940s, emphasizing the aspects related to environmental sciences. Lovelock explains the origins of the electron capture detector (ECD). So far, the ECD is the most sensitive, easily portable and inexpensive analytical apparatus capable of detecting substances present in the atmosphere at concentrations as low as parts per trillion (10(-12)). It has been the first device specifically sensitive to pollutants, and its use has provided the grounds for the development of environmental sciences, and green politics. The data gathered by the ECD about the persistence of pesticides in the environment led American biologist Rachel Carson to write her seminal book Silent Spring; data regarding the global presence of chlorofluorocarbons (CFC) in the atmosphere led Sherwood Rowland and Mario Molina to develop their theory of ozone depletion. The results of his research over the years led Lovelock himself to the development of the Gaia theory.

In this medium close-up view, captured by an Electronic Still Camera (ESC), the Spartan 207

NASA Technical Reports Server (NTRS)

1996-01-01

STS-77 ESC VIEW --- In this medium close-up view, captured by an Electronic Still Camera (ESC), the Spartan 207 free-flyer is held in the grasp of the Space Shuttle Endeavour's Remote Manipulator System (RMS) following its re-capture on May 21, 1996. The six-member crew has spent a portion of the early stages of the mission in various activities involving the Spartan 207 and the related Inflatable Antenna Experiment (IAE). The Spartan project is managed by NASA's Goddard Space Flight Center (GSFC) for NASA's Office of Space Science, Washington, D.C. GMT: 09:38:05.

Transit probabilities for debris around white dwarfs in Kepler/K2 up to C13

NASA Astrophysics Data System (ADS)

Lewis, John Arban; Johnson, John Asher

2018-01-01

WD 1145+017 (Vanderburg et al. 2015), a metal-polluted white dwarf with an infrared-excess and transits confirmed the long held theory that at least some metal-polluted white dwarfs are actively accreting material from crushed up planetesimals. A statistical understanding of WD 1145-like systems would inform us on the various pathways for metal-pollution and the end states of planetary systems around medium- to high-mass stars. At present, there is a single example. We study all white dwarfs observed during the K2 mission to identify white dwarfs with either transits or light curve features similar to WD 1145+017. We correct for contamination using J.J. Hermes' list of high probability white dwarfs (available at k2wd.org ).

Dipole and Coulomb forces in electron capture dissociation and electron transfer dissociation mass spectroscopy.

PubMed

Świerszcz, Iwona; Skurski, Piotr; Simons, Jack

2012-02-23

Ab initio electronic structure calculations were performed on a doubly charged polypeptide model H(+)-Lys(Ala)(19)-CO-CH(NH(2))-CH(2)-SS-CH(2)-(NH(2))CH-CO-(Ala)(19)-Lys-H(+) consisting of a C-terminal protonated Lys followed by a 19-Ala α-helix with a 20th Ala-like unit whose side chain is linked by a disulfide bond to a corresponding Ala-like unit connected to a second 19-Ala α-helix terminated by a second C-terminal-protonated Lys. The Coulomb potentials arising from the two charged Lys residues and dipole potentials arising from the two oppositely directed 72 D dipoles of the α-helices act to stabilize the SS bond's σ* orbital. The Coulomb potentials provide stabilization of 1 eV, while the two large dipoles generate an additional 4 eV. Such stabilization allows the SS σ* orbital to attach an electron and thereby generate disulfide bond cleavage products. Although calculations are performed only on SS bond cleavage, discussion of N-C(α) bond cleavage caused by electron attachment to amide π* orbitals is also presented. The magnitudes of the stabilization energies as well as the fact that they arise from Coulomb and dipole potentials are supported by results on a small model system consisting of a H(3)C-SS-CH(3) molecule with positive and negative fractional point charges to its left and right designed to represent (i) two positive charges ca. 32 Å distant (i.e., the two charged Lys sites of the peptide model) and (ii) two 72 D dipoles (i.e., the two α-helices). Earlier workers suggested that internal dipole forces in polypeptides could act to guide incoming free electrons (i.e., in electron capture dissociation (ECD)) toward the positive end of the dipole and thus affect the branching ratios for cleaving various bonds. Those workers argued that, because of the huge mass difference between an anion donor and a free electron, internal dipole forces would have a far smaller influence over the trajectory of a donor (i.e., in electron transfer dissociation

Electron capture by Ne3+ ions from atomic hydrogen

NASA Astrophysics Data System (ADS)

Rejoub, R.; Bannister, M. E.; Havener, C. C.; Savin, D. W.; Verzani, C. J.; Wang, J. G.; Stancil, P. C.

2004-05-01

Using the Oak Ridge National Laboratory ion-atom merged-beam apparatus, absolute total electron-capture cross sections have been measured for collisions of Ne3+ ions with hydrogen (deuterium) atoms at energies between 0.07 and 826 eV/u . Comparison to previous measurements shows large discrepancies between 50 and 400 eV/u . Previously published molecular-orbital close-coupling (MOCC) calculations were performed over limited energy ranges, but show good agreement with the present measurements. Here MOCC calculations are presented for energies between 0.01 and 1000 eV/u for collisions with both H and D. For energies below ˜1 eV/u , an enhancement in the magnitude of both the experimental and theoretical cross sections is observed which is attributed to the ion-induced dipole attraction between the reactants. Below ˜4 eV/u , the present calculations show a significant target isotope effect.

Vortices for K-shell ionization of carbon by electron impact

NASA Astrophysics Data System (ADS)

Ward, S. J.; Macek, J. H.

2014-05-01

Using the Coulomb-Born approximation, we obtained a deep minimum in the TDCS for K-shell ionization of carbon by electron impact. The minimum is due to a vortex in the velocity field. We considered the electron to be ejected in the scattering plane, which we took to be the xz -plane. The minimum was obtained for the kinematics of an incident energy Ei = 1801 . 2 eV , scattering angle θf =4° , energy of ejected electron Ek = 5 . 5 eV , and angle of the ejected electron θk =239° . We analyzed the importance of various multipole components in an expansion of the Coulomb-Born T-matrix. We also considered the electron ejected out of the scattering plane for Ei = 1801 . 2 eV and θf =4° and located the positions of vortices for small but nonzero values of ky, the y - component of the momentum of the ejected electron. We constructed the vortex line for the kinematics of Ei = 1801 . 2 eV and θf =4° . S. J. W. and J. H. M. acknowledge support from NSF under grant no. PHYS- 0968638 and from D.O.E. under grant number DE-FG02-02ER15283, respectively.

ELECTRON-CAPTURE AND β-DECAY RATES FOR sd-SHELL NUCLEI IN STELLAR ENVIRONMENTS RELEVANT TO HIGH-DENSITY O–NE–MG CORES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suzuki, Toshio; Toki, Hiroshi; Nomoto, Ken’ichi, E-mail: suzuki@phys.chs.nihon-u.ac.jp

Electron-capture and β-decay rates for nuclear pairs in the sd-shell are evaluated at high densities and high temperatures relevant to the final evolution of electron-degenerate O–Ne–Mg cores of stars with initial masses of 8–10 M{sub ⊙}. Electron capture induces a rapid contraction of the electron-degenerate O–Ne–Mg core. The outcome of rapid contraction depends on the evolutionary changes in the central density and temperature, which are determined by the competing processes of contraction, cooling, and heating. The fate of the stars is determined by these competitions, whether they end up with electron-capture supernovae or Fe core-collapse supernovae. Since the competing processes aremore » induced by electron capture and β-decay, the accurate weak rates are crucially important. The rates are obtained for pairs with A = 20, 23, 24, 25, and 27 by shell-model calculations in the sd-shell with the USDB Hamiltonian. Effects of Coulomb corrections on the rates are evaluated. The rates for pairs with A = 23 and 25 are important for nuclear Urca processes that determine the cooling rate of the O–Ne–Mg core, while those for pairs with A = 20 and 24 are important for the core contraction and heat generation rates in the core. We provide these nuclear rates at stellar environments in tables with fine enough meshes at various densities and temperatures for studies of astrophysical processes sensitive to the rates. In particular, the accurate rate tables are crucially important for the final fates of not only O–Ne–Mg cores but also a wider range of stars, such as C–O cores of lower-mass stars.« less

Ambient Carbon Dioxide Capture Using Boron-Rich Porous Boron Nitride: A Theoretical Study.

PubMed

Li, Lanlan; Liu, Yan; Yang, Xiaojing; Yu, Xiaofei; Fang, Yi; Li, Qiaoling; Jin, Peng; Tang, Chengchun

2017-05-10

The development of highly efficient sorbent materials for CO 2 capture under ambient conditions is of great importance for reducing the impact of CO 2 on the environment and climate change. In this account, strong CO 2 adsorption on a boron antisite (B N ) in boron-rich porous boron nitrides (p-BN) was developed and studied. The results indicated that the material achieved larger adsorption energies of 2.09 eV (201.66 kJ/mol, PBE-D). The electronic structure calculations suggested that the introduction of B N in p-BN induced defect electronic states in the energy gap region, which strongly impacted the adsorption properties of the material. The bonding between the B N defect and the CO 2 molecule was clarified, and it was found that the electron donation first occurred from CO 2 to the B N double-acceptor state then, followed by electron back-donation from B N to CO 2 accompanied by the formation of a B N -C bond. The thermodynamic properties indicated that the adsorption of CO 2 on the B N defect to form anionic CO 2 δ- species was spontaneous at temperatures below 350 K. Both the large adsorption energies and the thermodynamic properties ensured that p-BN with a B N defect could effectively capture CO 2 under ambient conditions. Finally, to evaluate the energetic stability, the defect formation energies were estimated. The formation energy of the B N defects was found to strongly depend on the chemical environment, and the selection of different reactants (B or N sources) would achieve the goal of reducing the formation energy. These findings provided a useful guidance for the design and fabrication of a porous BN sorbent for CO 2 capture.

Individual heterogeneity and identifiability in capture-recapture models

USGS Publications Warehouse

Link, W.A.

2004-01-01

Individual heterogeneity in detection probabilities is a far more serious problem for capture-recapture modeling than has previously been recognized. In this note, I illustrate that population size is not an identifiable parameter under the general closed population mark-recapture model Mh. The problem of identifiability is obvious if the population includes individuals with pi = 0, but persists even when it is assumed that individual detection probabilities are bounded away from zero. Identifiability may be attained within parametric families of distributions for pi, but not among parametric families of distributions. Consequently, in the presence of individual heterogeneity in detection probability, capture-recapture analysis is strongly model dependent.

Measurement of the intensity ratio of Auger and conversion electrons for the electron capture decay of 125I.

PubMed

Alotiby, M; Greguric, I; Kibédi, T; Lee, B Q; Roberts, M; Stuchbery, A E; Tee, Pi; Tornyi, T; Vos, M

2018-03-21

Auger electrons emitted after nuclear decay have potential application in targeted cancer therapy. For this purpose it is important to know the Auger electron yield per nuclear decay. In this work we describe a measurement of the ratio of the number of conversion electrons (emitted as part of the nuclear decay process) to the number of Auger electrons (emitted as part of the atomic relaxation process after the nuclear decay) for the case of 125 I. Results are compared with Monte-Carlo type simulations of the relaxation cascade using the BrIccEmis code. Our results indicate that for 125 I the calculations based on rates from the Evaluated Atomic Data Library underestimate the K Auger yields by 20%.

Measurement of the intensity ratio of Auger and conversion electrons for the electron capture decay of 125I

NASA Astrophysics Data System (ADS)

Alotiby, M.; Greguric, I.; Kibédi, T.; Lee, B. Q.; Roberts, M.; Stuchbery, A. E.; Tee, Pi; Tornyi, T.; Vos, M.

2018-03-01

Auger electrons emitted after nuclear decay have potential application in targeted cancer therapy. For this purpose it is important to know the Auger electron yield per nuclear decay. In this work we describe a measurement of the ratio of the number of conversion electrons (emitted as part of the nuclear decay process) to the number of Auger electrons (emitted as part of the atomic relaxation process after the nuclear decay) for the case of 125I. Results are compared with Monte-Carlo type simulations of the relaxation cascade using the BrIccEmis code. Our results indicate that for 125I the calculations based on rates from the Evaluated Atomic Data Library underestimate the K Auger yields by 20%.

Monoclonal antibody passive hemagglutination and capture enzyme-linked immunosorbent assays for direct detection and quantitation of F41 and K99 fimbrial antigens in enterotoxigenic Escherichia coli.

PubMed Central

Raybould, T J; Crouch, C F; Acres, S D

1987-01-01

Production of diarrhea in neonatal calves by enterotoxigenic Escherichia coli depends on its ability to attach to the epithelial cells of the intestine via surface adhesins called pili or fimbriae and to secrete enterotoxins. The most important of these fimbriae are designated K99 and F41. We produced and characterized a murine monoclonal antibody specific to F41. This monoclonal antibody and a K99-specific monoclonal antibody were used to develop sensitive and specific passive hemagglutination and capture enzyme-linked immunosorbent assays (ELISAs) for detection and quantitation of F41 and K99 antigens in E. coli cultures and culture supernatants. The capture ELISA systems exhibited excellent sensitivity and specificity, whereas the passive hemagglutination systems appeared to be oversensitive. The ability of the capture ELISAs to detect K99 and F41 fimbrial antigens in fecal specimens from calves was evaluated. Fimbrial antigens were detected in six of six specimens from scouring calves but not in four of four specimens from nonscouring calves. PMID:2880866

Shannon entropies and Fisher information of K-shell electrons of neutral atoms

NASA Astrophysics Data System (ADS)

Sekh, Golam Ali; Saha, Aparna; Talukdar, Benoy

2018-02-01

We represent the two K-shell electrons of neutral atoms by Hylleraas-type wave function which fulfils the exact behavior at the electron-electron and electron-nucleus coalescence points and, derive a simple method to construct expressions for single-particle position- and momentum-space charge densities, ρ (r) and γ (p) respectively. We make use of the results for ρ (r) and γ (p) to critically examine the effect of correlation on bare (uncorrelated) values of Shannon information entropies (S) and of Fisher information (F) for the K-shell electrons of atoms from helium to neon. Due to inter-electronic repulsion the values of the uncorrelated Shannon position-space entropies are augmented while those of the momentum-space entropies are reduced. The corresponding Fisher information are found to exhibit opposite behavior in respect of this. Attempts are made to provide some plausible explanation for the observed response of S and F to electronic correlation.

Capture of shrinking targets with realistic shrink patterns.

PubMed

Hoffmann, Errol R; Chan, Alan H S; Dizmen, Coskun

2013-01-01

Previous research [Hoffmann, E. R. 2011. "Capture of Shrinking Targets." Ergonomics 54 (6): 519-530] reported experiments for capture of shrinking targets where the target decreased in size at a uniform rate. This work extended this research for targets having a shrink-size versus time pattern that of an aircraft receding from an observer. In Experiment 1, the time to capture the target in this case was well correlated in terms of Fitts' index of difficulty, measured at the time of capture of the target, a result that is in agreement with the 'balanced' model of Johnson and Hart [Johnson, W. W., and Hart, S. G. 1987. "Step Tracking Shrinking Targets." Proceedings of the human factors society 31st annual meeting, New York City, October 1987, 248-252]. Experiment 2 measured the probability of target capture for varying initial target sizes and target shrink rates constant, defined as the time for the target to shrink to half its initial size. Data of shrink time constant for 50% probability of capture were related to initial target size but did not greatly affect target capture as the rate of target shrinking decreased rapidly with time.

A Bayesian, combinatorial approach to capture-recapture.

PubMed

García-Pelayo, Ricardo

2006-11-01

It is shown that, in the capture-recapture method, the widely used formulae of Bailey or Chapman-Seber give the most likely value for the size of the population, but systematically underestimate the probability that the population is larger than any given size. We take here a first step in a combinatorial approach which does not suffer from this flaw: formulae are given which can be used in the closed case (no birth, death or migrations between captures) when at least two animals have been recaptured and when there is homogeneity with regard to capture probability. Numerical and heuristic evidence is presented pointing to the fact that the error incurred when using the formulae of Bailey or Chapman-Seber depends asymptotically only on the number of recaptured animals, and will not diminish if the number of captured animals becomes large while the number of recaptured animals remains constant. A result that was stated and left unproven by Darroch is proven here.

A 120kV IGBT modulator for driving a pierce electron gun

DOE Office of Scientific and Technical Information (OSTI.GOV)

Earley, L. M.; Brown, R. W.; Carlson, R. L.

2004-01-01

An IGBT modulator has been developed to drive a 120 kV, 23 A Pierce electron gun. The modulator is capable of producing pulses up to 10 {mu}s in width at repetition rates up to 10Hz with no active reset. The pulse rise time on the electron gun will be approximately 2 {mu}s and the remaining 8 {mu}s of flattop is tuned to have a ripple of less than 1 percent rms. The modulator technology was developed from a previous 50 kV prototype. The modulator consists of six boards, each with one EUPEC IGBT that drives a single common step-up transformermore » wound on METGLAS 2605SC cores. The six transformer cores share a common bi-filar output secondary winding. The modulator uses a fiber optic trigger system and has a high voltage cable output with an epoxy receptacle on the oil end and a ceramic receptacle on the vacuum end. The 120 kV electron gun was manufactured by MDS Co. and will be used to generate sheet electron beams from the standard pencil beam produced by the Pierce electron gun.« less

Electron-capture Rates for pf-shell Nuclei in Stellar Environments and Nucleosynthesis

NASA Astrophysics Data System (ADS)

Suzuki, Toshio; Honma, Michio; Mori, Kanji; Famiano, Michael A.; Kajino, Toshitaka; Hidakai, Jun; Otsuka, Takaharu

Gamow-Teller strengths in pf-shell nuclei obtained by a new shell-model Hamltonian, GXPF1J, are used to evaluate electron-capture rates in pf-shell nuclei at stellar environments. The nuclear weak rates with GXPF1J, which are generally smaller than previous evaluations for proton-rich nuclei, are applied to nucleosynthesis in type Ia supernova explosions. The updated rates are found to lead to less production of neutron-rich nuclei such as 58Ni and 54Cr, thus toward a solution of the problem of over-production of neutron-rich isotopes of iron-group nuclei compared to the solar abundance.

Simulation of K-α Emission from Highly Charged Cu ions for Pinches on ZR

NASA Astrophysics Data System (ADS)

Dasgupta, A.; Giuliani, J. L.; Clark, R. W.; Ouart, N. D.; Jones, B.; Ampleford, D. J.

2012-10-01

Recent spectral data of Cu shots Z1975 and Z2122 from Sandia's ZR machine are believed to show strong K-α emissions. As these K-α lines provide good diagnostics, a detailed spectral model will be developed to investigate these line emissions for analyzing the data. In a Z pinch plasma, K-α emission can occur due to e-beams, hot electrons at the tail of a Maxwellian and also pumping from hot photons emitted near the axis. K-α emission that originates from collisional processes involving hot electrons in the final phase of the pinching plasmas are associated with radiationless electron capture, inner-shell electron collisional excitation and ionization. K-α lines from various ionization stages of various materials such as Fe, Cr, Ni, and Mn were also observed in the ZR data. Contributions from ions with strong K-α transitions will be included for this study which is a preliminary attempt to investigate Cu K-α lines due to hot electrons and photons. Photo-pumped K-α emission from an outer shell is spatially distinguishable from that produced by e-beam on axis.

On the use of secondary capture-recapture samples to estimate temporary emigration and breeding proportions

USGS Publications Warehouse

Kendall, W.L.; Nichols, J.D.; North, P.M.; Nichols, J.D.

1995-01-01

The use of the Cormack- Jolly-Seber model under a standard sampling scheme of one sample per time period, when the Jolly-Seber assumption that all emigration is permanent does not hold, leads to the confounding of temporary emigration probabilities with capture probabilities. This biases the estimates of capture probability when temporary emigration is a completely random process, and both capture and survival probabilities when there is a temporary trap response in temporary emigration, or it is Markovian. The use of secondary capture samples over a shorter interval within each period, during which the population is assumed to be closed (Pollock's robust design), provides a second source of information on capture probabilities. This solves the confounding problem, and thus temporary emigration probabilities can be estimated. This process can be accomplished in an ad hoc fashion for completely random temporary emigration and to some extent in the temporary trap response case, but modelling the complete sampling process provides more flexibility and permits direct estimation of variances. For the case of Markovian temporary emigration, a full likelihood is required.

Probing Protein Structure and Folding in the Gas Phase by Electron Capture Dissociation

NASA Astrophysics Data System (ADS)

Schennach, Moritz; Breuker, Kathrin

2015-07-01

The established methods for the study of atom-detailed protein structure in the condensed phases, X-ray crystallography and nuclear magnetic resonance spectroscopy, have recently been complemented by new techniques by which nearly or fully desolvated protein structures are probed in gas-phase experiments. Electron capture dissociation (ECD) is unique among these as it provides residue-specific, although indirect, structural information. In this Critical Insight article, we discuss the development of ECD for the structural probing of gaseous protein ions, its potential, and limitations.

Electronic propensity rules in Li-H+ collisions involving initial and/or final oriented states

NASA Astrophysics Data System (ADS)

Salas, P. J.

2000-12-01

Electronic excitation and capture processes are studied in collisions involving systems with only one active electron such as the alkaline (Li)-proton in the medium-energy region (0.1-15 keV). Using the semiclassical impact parameter method, the probabilities and the orientation parameter are calculated for transitions between initial and/or final oriented states. The results show a strong asymmetry in the probabilities depending on the orientation of the initial and/or final states. An intuitive view of the processes, by means of the concepts of propensity and velocity matching rules, is provided.

Correlation between Na/K ratio and electron densities in blood samples of breast cancer patients.

PubMed

Topdağı, Ömer; Toker, Ozan; Bakırdere, Sezgin; Bursalıoğlu, Ertuğrul Osman; Öz, Ersoy; Eyecioğlu, Önder; Demir, Mustafa; İçelli, Orhan

2018-05-31

The main purpose of this study was to investigate the relationship between the electron densities and Na/K ratio which has important role in breast cancer disease. Determinations of sodium and potassium concentrations in blood samples performed with inductive coupled plasma-atomic emission spectrometry. Electron density values of blood samples were determined via ZXCOM. Statistical analyses were performed for electron densities and Na/K ratio including Kolmogorov-Smirnov normality tests, Spearman's rank correlation test and Mann-Whitney U test. It was found that the electron densities significantly differ between control and breast cancer groups. In addition, statistically significant positive correlation was found between the electron density and Na/K ratios in breast cancer group.

High-voltage testing of a 500-kV dc photocathode electron gun.

PubMed

Nagai, Ryoji; Hajima, Ryoichi; Nishimori, Nobuyuki; Muto, Toshiya; Yamamoto, Masahiro; Honda, Yosuke; Miyajima, Tsukasa; Iijima, Hokuto; Kuriki, Masao; Kuwahara, Makoto; Okumi, Shoji; Nakanishi, Tsutomu

2010-03-01

A high-voltage dc photocathode electron gun was successfully conditioned up to a voltage of 550 kV and a long-time holding test for 8 h was demonstrated at an acceleration voltage of 500 kV. The dc photocathode electron gun is designed for future light sources based on energy-recovery linac and consists of a Cockcroft-Walton generator, a segmented cylindrical ceramic insulator, guard-ring electrodes, a support-rod electrode, a vacuum chamber, and a pressurized insulating gas tank. The segmented cylindrical ceramic insulator and the guard-ring electrodes were utilized to prevent any damage to the insulator from electrons emitted by the support-rod electrode.

Design and development of a 40 kV pierce electron gun

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bhattacharjee, D.; Tiwari, R.; Jayaprakash, D., E-mail: dhruva.bhattacharjee@gmail.com

A 40 kV electron gun is designed and developed using the Pierce configuration for the focusing electrode. Simulations were carried out using CST Particle Studio. The Gun is a thermionic type electron gun with indirect heating of the LaB6 cathode. The gun is capable of delivering a beam current of more than 500 mA at 40 kV with a beam size of less than 5 mm. The cathode assembly consists of cups and heat shields made out of Tantalum and Rhenium sheets. The cathode assembly and the electron gun was fabricated, assembled and tested on test bench for cathode conditioning,more » HV conditioning and beam characterization. This paper presents the gun design, particle simulations study, testing of the gun on test bench. (author)« less

EDF: Computing electron number probability distribution functions in real space from molecular wave functions

NASA Astrophysics Data System (ADS)

Francisco, E.; Pendás, A. Martín; Blanco, M. A.

2008-04-01

Given an N-electron molecule and an exhaustive partition of the real space ( R) into m arbitrary regions Ω,Ω,…,Ω ( ⋃i=1mΩ=R), the edf program computes all the probabilities P(n,n,…,n) of having exactly n electrons in Ω, n electrons in Ω,…, and n electrons ( n+n+⋯+n=N) in Ω. Each Ω may correspond to a single basin (atomic domain) or several such basins (functional group). In the later case, each atomic domain must belong to a single Ω. The program can manage both single- and multi-determinant wave functions which are read in from an aimpac-like wave function description ( .wfn) file (T.A. Keith et al., The AIMPAC95 programs, http://www.chemistry.mcmaster.ca/aimpac, 1995). For multi-determinantal wave functions a generalization of the original .wfn file has been introduced. The new format is completely backwards compatible, adding to the previous structure a description of the configuration interaction (CI) coefficients and the determinants of correlated wave functions. Besides the .wfn file, edf only needs the overlap integrals over all the atomic domains between the molecular orbitals (MO). After the P(n,n,…,n) probabilities are computed, edf obtains from them several magnitudes relevant to chemical bonding theory, such as average electronic populations and localization/delocalization indices. Regarding spin, edf may be used in two ways: with or without a splitting of the P(n,n,…,n) probabilities into α and β spin components. Program summaryProgram title: edf Catalogue identifier: AEAJ_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEAJ_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 5387 No. of bytes in distributed program, including test data, etc.: 52 381 Distribution format: tar.gz Programming language: Fortran 77 Computer

Demonstration of charge breeding in a compact room temperature electron beam ion trap

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vorobjev, G.; Sokolov, A.; Herfurth, F.

2012-05-15

For the first time, a small room-temperature electron beam ion trap (EBIT), operated with permanent magnets, was successfully used for charge breeding experiments. The relatively low magnetic field of this EBIT does not contribute to the capture of the ions; single-charged ions are only caught by the space charge potential of the electron beam. An over-barrier injection method was used to fill the EBIT's electrostatic trap with externally produced, single-charged potassium ions. Charge states as high as K{sup 19+} were reached after about a 3 s breeding time. The capture and breeding efficiencies up to 0.016(4)% for K{sup 17+} havemore » been measured.« less

Electron capture in collisions of S4+ with atomic hydrogen

NASA Astrophysics Data System (ADS)

Stancil, P. C.; Turner, A. R.; Cooper, D. L.; Schultz, D. R.; Rakovic, M. J.; Fritsch, W.; Zygelman, B.

2001-06-01

Charge transfer processes due to collisions of ground state S4+(3s2 1S) ions with atomic hydrogen are investigated for energies between 1 meV u-1 and 10 MeV u-1 using the quantum mechanical molecular-orbital close-coupling (MOCC), atomic-orbital close-coupling, classical trajectory Monte Carlo (CTMC) and continuum distorted wave methods. The MOCC calculations utilize ab initio adiabatic potentials and nonadiabatic radial coupling matrix elements obtained with the spin-coupled valence-bond approach. A number of variants of the CTMC approach were explored, including different momentum and radial distributions for the initial state, as well as effective charge and quantum-defect models to determine the corresponding quantum state after capture into final partially stripped S3+ excited classical states. Hydrogen target isotope effects are explored and rate coefficients for temperatures between 100 and 106 K are also presented.

1 MeV, 10 kW DC electron accelerator for industrial applications

NASA Astrophysics Data System (ADS)

Nayak, B.; Acharya, S.; Bhattacharjee, D.; Bakhtsingh, R. I.; Rajan, R.; Sharma, D. K.; Dewangan, S.; Sharma, V.; Patel, R.; Tiwari, R.; Benarjee, S.; Srivastava, S. K.

2016-03-01

Several modern applications of radiation processing like medical sterilization, rubber vulcanization, polymerization, cross-linking and pollution control from thermal power stations etc. require D.C. electron accelerators of energy ranging from a few hundred keVs to few MeVs and power from a few kilowatts to hundreds of kilowatts. To match these requirements, a 3 MeV, 30 kW DC electron linac has been developed at BARC, Mumbai and current operational experience of 1 MeV, 10 kW beam power will be described in this paper. The LINAC composed mainly of Electron Gun, Accelerating Tubes, Magnets, High Voltage source and provides 10 kW beam power at the Ti beam window stably after the scanning section. The control of the LINAC is fully automated. Here Beam Optics study is carried out to reach the preferential parameters of Accelerating as well as optical elements. Beam trials have been conducted to find out the suitable operation parameters of the system.

Survival Mediated Heavy Element Capture Cross Sections

NASA Astrophysics Data System (ADS)

Loveland, Walter; Yao, Larry

2017-11-01

Formally, the cross section for producing a heavy evaporation residue, σEVR, in a fusion reaction can be written as where E is the center of mass energy, and T is the probability of the colliding nuclei to overcome the potential barrier in the entrance channel and reach the contact point. PCN is the probability that the projectile-target system will evolve from the contact point to the compound nucleus. Wsur is the probability that the compound nucleus will decay to produce an evaporation residue rather than fissioning. However, one must remember that the Wsur term effectively sets the allowed values of the spin, which in turn, restricts the values of the capture and fusion cross sections. We point out the implications of this fact for capture cross sections for heavy element formation reactions.

Electron capture activation of the disulfide bond. The role of the asymmetry and electronegativity.

PubMed

Gámez, José A; Serrano-Andrés, Luis; Yáñez, Manuel

2010-02-07

The effects of electron capture on the structure of XSSX' disulfide derivatives in which the substituents attached to the sulfur atoms have different electronegativites have been investigated at different levels of theory, namely DFT, MP2, QCISD and CASSCF/CASPT2. Although it has been generally assumed that electron attachment to disulfide derivatives leads to a systematic and significant activation of the S-S bond, our results show that this is the case only when the substituents X or X' have low electronegativity. Otherwise, the S-S bond in the anion remains practically unperturbed and only the S-X bond is largely activated or even broken, because the extra electron occupies the sigma*(S-X) rather than the sigma*(S-S) antibonding orbital. Our results also show that S-S activation yields a system with a unique anion, whereas when the S-X activation is significant, two stable anionic species, stretched and bent, are formed.

Photon escape probabilities in a semi-infinite plane-parallel medium. [from electron plasma surrounding galactic X-ray sources

NASA Technical Reports Server (NTRS)

Williams, A. C.; Elsner, R. F.; Weisskopf, M. C.; Darbro, W.

1984-01-01

It is shown in this work how to obtain the probabilities of photons escaping from a cold electron plasma environment after having undergone an arbitrary number of scatterings. This is done by retaining the exact differential cross section for Thomson scattering as opposed to using its polarization and angle averaged form. The results are given in the form of recursion relations. The geometry used is the semi-infinite plane-parallel geometry witlh a photon source located on a plane at an arbitrary optical depth below the surface. Analytical expressions are given for the probabilities which are accurate over a wide range of initial optical depth. These results can be used to model compact X-ray galactic sources which are surrounded by an electron-rich plasma.

Electron Impact K-shell Ionization Cross Sections at high energies

NASA Astrophysics Data System (ADS)

Haque, A. K. F.; Sarker, M. S. I.; Patoary, M. A. R.; Shahjahan, M.; Ismail Hossain, M.; Alfaz Uddin, M.; Basak, A. K.; Saha, Bidhan

2008-10-01

A simple modification of the empirical model of Deutsh et. al. [1] by incorporating both the ionic [2] and relativistic corrections [3] is proposed for evaluating the electron impact K -shell ionization cross sections of neutral atomic targets. Present results for 30 atomic targets with atomic number Z=1 -- 92 for incident energies up to E=2 GeV, agree well with available experimental cross sections. Comparisons with other theoretical findings will also be presented at the conference. [1] H. Deutsh, K. Becker, T. D. Mark, Int. J. Mass Spect. 177, 47 (1998). [2] M. A. Uddin, A. K. F. Haque, M. M. Billah, A. K. Basak, K. R. Karim, B. C. Saha, Phys. Rev. A 71, 032715 (2005).; Phys. Rev. A 73, 012708 (2006). [3] M. Gryzinski, Phys. Rev 138, 336 (1965).

Electron capture dissociation of polypeptides using a 3 Tesla Fourier transform ion cyclotron resonance mass spectrometer.

PubMed

Polfer, Nicolas C; Haselmann, Kim F; Zubarev, Roman A; Langridge-Smith, Pat R R

2002-01-01

Electron capture dissociation (ECD) of polypeptides has been demonstrated using a commercially available 3 Tesla Fourier transform ion cyclotron resonance (FTICR) instrument. A conventional rhenium filament, designed for high-energy electron impact ionisation, was used to effect ECD of substance P, bee venom melittin and bovine insulin, oxidised B chain. A retarding field analysis of the effective electron kinetic energy distribution entering the ICR cell suggests that one of the most important parameters governing ECD for this particular instrument is the need to employ low trapping plate voltages. This is shown to maximise the abundance of low-energy electrons. The demonstration of ECD at this relatively low magnetic field strength could offer the prospect of more routine ECD analysis for the wider research community, given the reduced cost of such magnets and (at least theoretically) the greater ease of electron/ion cloud overlap at lower field. Copyright 2002 John Wiley & Sons, Ltd.

Topics in electron capture by fast ions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hsin, S.H.

1987-01-01

The post-collision interaction (PCI) model was applied, together with the eikonal approximation, to study the (n = 2,3) capture cross sections in p + H(ls) collisions. The results indeed improve the previous eikonal calculations for l = 0 cases, and agree quite well with present experimental data. Calculations using the strong-potential Born (SPB) approximation, with the Sil and McGuire technique, for capture into the np, nd levels are also presented. While these cross sections are smaller than cross sections for capture into the ns levels at high velocities, nevertheless the Thomas peak is clearly evident in both the absolute valuemore » m = 2, absolute value m = 1 and m = 0 magnetic substates in p + H(ls) collisions. Also calculated were corrections to the SPB using the Distorted-Wave Born formalism of Taulbjerg and Briggs. In the sense of a plane-wave Born expansion, all terms of the third Born approximation and all single switching fourth Born terms are included, but a peaking approximation is needed to reduce the calculation to tractable form. Effects of the higher terms are most visible in the valley between the Thomas peak and the forward peak. The Thomas peak is visible in the correction term, even though it includes no second Born contributions.« less

Electronic Procedures for Medical Operations

NASA Technical Reports Server (NTRS)

2015-01-01

Electronic procedures are replacing text-based documents for recording the steps in performing medical operations aboard the International Space Station. S&K Aerospace, LLC, has developed a content-based electronic system-based on the Extensible Markup Language (XML) standard-that separates text from formatting standards and tags items contained in procedures so they can be recognized by other electronic systems. For example, to change a standard format, electronic procedures are changed in a single batch process, and the entire body of procedures will have the new format. Procedures can be quickly searched to determine which are affected by software and hardware changes. Similarly, procedures are easily shared with other electronic systems. The system also enables real-time data capture and automatic bookmarking of current procedure steps. In Phase II of the project, S&K Aerospace developed a Procedure Representation Language (PRL) and tools to support the creation and maintenance of electronic procedures for medical operations. The goal is to develop these tools in such a way that new advances can be inserted easily, leading to an eventual medical decision support system.

Rare targets are less susceptible to attention capture once detection has begun.

PubMed

Hon, Nicholas; Ng, Gavin; Chan, Gerald

2016-04-01

Rare or low probability targets are detected more slowly and/ or less accurately than higher probability counterparts. Various proposals have implicated perceptual and response-based processes in this deficit. Recent evidence, however, suggests that it is attentional in nature, with low probability targets requiring more attentional resources than high probability ones to detect. This difference in attentional requirements, in turn, suggests the possibility that low and high probability targets may have different susceptibilities to attention capture, which is also known to be resource-dependent. Supporting this hypothesis, we found that, once attentional resources have begun to be engaged by detection processes, low, but not high, probability targets have a reduced susceptibility to capture. Our findings speak to several issues. First, they indicate that the likelihood of attention capture occurring when a given task-relevant stimulus is being processed is dependent, to some extent, on how said stimulus is represented within mental task sets. Second, they provide added support for the idea that the behavioural deficit associated with low probability targets is attention-based. Finally, the current data point to reduced top-down biasing of target templates as a likely mechanism underlying the attentional locus of the deficit in question.

Electron diffraction using ultrafast electron bunches from a laser-wakefield accelerator at kHz repetition rate

NASA Astrophysics Data System (ADS)

He, Z.-H.; Thomas, A. G. R.; Beaurepaire, B.; Nees, J. A.; Hou, B.; Malka, V.; Krushelnick, K.; Faure, J.

2013-02-01

We show that electron bunches in the 50-100 keV range can be produced from a laser wakefield accelerator using 10 mJ, 35 fs laser pulses operating at 0.5 kHz. It is shown that using a solenoid magnetic lens, the electron bunch distribution can be shaped. The resulting transverse and longitudinal coherence is suitable for producing diffraction images from a polycrystalline 10 nm aluminum foil. The high repetition rate, the stability of the electron source, and the fact that its uncorrelated bunch duration is below 100 fs make this approach promising for the development of sub-100 fs ultrafast electron diffraction experiments.

The problem of latent attentional capture: Easy visual search conceals capture by task-irrelevant abrupt onsets.

PubMed

Gaspelin, Nicholas; Ruthruff, Eric; Lien, Mei-Ching

2016-08-01

Researchers are sharply divided regarding whether irrelevant abrupt onsets capture spatial attention. Numerous studies report that they do and a roughly equal number report that they do not. This puzzle has inspired numerous attempts at reconciliation, none gaining general acceptance. The authors propose that abrupt onsets routinely capture attention, but the size of observed capture effects depends critically on how long attention dwells on distractor items which, in turn, depends critically on search difficulty. In a series of spatial cuing experiments, the authors show that irrelevant abrupt onsets produce robust capture effects when visual search is difficult, but not when search is easy. Critically, this effect occurs even when search difficulty varies randomly across trials, preventing any strategic adjustments of the attentional set that could modulate probability of capture by the onset cue. The authors argue that easy visual search provides an insensitive test for stimulus-driven capture by abrupt onsets: even though onsets truly capture attention, the effects of capture can be latent. This observation helps to explain previous failures to find capture by onsets, nearly all of which used an easy visual search. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

The Problem of Latent Attentional Capture: Easy Visual Search Conceals Capture by Task-Irrelevant Abrupt Onsets

PubMed Central

Gaspelin, Nicholas; Ruthruff, Eric; Lien, Mei-Ching

2016-01-01

Researchers are sharply divided regarding whether irrelevant abrupt onsets capture spatial attention. Numerous studies report that they do and a roughly equal number report that they do not. This puzzle has inspired numerous attempts at reconciliation, none gaining general acceptance. We propose that abrupt onsets routinely capture attention, but the size of observed capture effects depends critically on how long attention dwells on distractor items which, in turn, depends critically on search difficulty. In a series of spatial cuing experiments, we show that irrelevant abrupt onsets produce robust capture effects when visual search is difficult, but not when search is easy. Critically, this effect occurs even when search difficulty varies randomly across trials, preventing any strategic adjustments of the attentional set that could modulate probability of capture by the onset cue. We argue that easy visual search provides an insensitive test for stimulus-driven capture by abrupt onsets: even though onsets truly capture attention, the effects of capture can be latent. This observation helps to explain previous failures to find capture by onsets, nearly all of which employed an easy visual search. PMID:26854530

Cross sections of relativistic radiative electron capture by use of the strong-potential Born calculation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hino, K.; Watanabe, T.

1987-07-15

The relativistically extended strong-potential Born (SPB) formalism is applied to the radiative electron capture process caused by the bombardment of a heavy and highly stripped charged particle with relativistically high velocity. The results are compared with those by use of nonrelativistic SPB calculations and with those by use of the relativistic Born calculation (Sauter's formula), which includes no distortion effects between a heavy projectile ion and an active electron. Even if the strong distortion effects are taken into consideration, the shapes of photon angular distributions in the laboratory frame still nearly depend on sin/sup 2/theta/sub L/(theta/sub L/ is the anglemore » of the emitted photon) in the vicinity of the angle of 90/sup 0/, which is the same as the results by use of Sauter's formula. The higher the charge of a projectile ion becomes, however, the greater the discrepancy between the angular shape of our results and that of Sauter's becomes at both smaller and larger angles than at 90/sup 0/. As is expected, the magnitudes of the differential and the total cross sections are drastically influenced by the distortion effects ascribable to a large charge of a heavy projectile ion such as U/sup 92+/. Our results are in good agreement with recent experiments. In addition, the Coulomb off-shell factor introduced by the SPB theory is found playing important roles in the case of the relativistic radiative electron capture process because the results calculated by using the relativistic impulse approximation are too underestimated.« less

Mechanism of 'GSI oscillations' in electron capture by highly charged hydrogen-like atomic ions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krainov, V. P., E-mail: vpkrainov@mail.ru

2012-07-15

We suggest a qualitative explanation of oscillations in electron capture decays of hydrogen-like {sup 140}Pr and {sup 142}Pm ions observed recently in an ion experimental storage ring (ESR) of Gesellschaft fuer Schwerionenforschung (GSI) mbH, Darmstadt, Germany. This explanation is based on the electron multiphoton Rabi oscillations between two Zeeman states of the hyperfine ground level with the total angular momentum F = 1/2. The Zeeman splitting is produced by a constant magnetic field in the ESR. Transitions between these states are produced by the second, sufficiently strong alternating magnetic field that approximates realistic fields in the GSI ESR. The Zeemanmore » splitting amounts to only about 10{sup -5} eV. This allows explaining the observed quantum beats with the period 7 s.« less

Electron capture in collisions of ? with H and ? with C

NASA Astrophysics Data System (ADS)

Stancil, P. C.; Gu, J.-P.; Havener, C. C.; Krstic, P. S.; Schultz, D. R.; Kimura, M.; Zygelman, B.; Hirsch, G.; Buenker, R. J.; Bannister, M. E.

1998-08-01

A comprehensive theoretical and experimental study of electron capture in collisions of 0953-4075/31/16/017/img15 with H and 0953-4075/31/16/017/img16 with C extending over the energy range 0953-4075/31/16/017/img17 to 0953-4075/31/16/017/img18 is presented. A variety of theoretical approaches were used including those based on quantal molecular-orbital close-coupling (MOCC), multielectron hidden crossings (MEHC), quantal decay and classical trajectory Monte Carlo techniques. Radiative charge transfer cross sections were computed using the optical potential/distorted wave (OPDW) and fully quantal (FQ) approaches. The MOCC, OPDW and FQ calculations incorporated ab initio potentials, nonadiabatic coupling matrix elements and transition moments computed at the configuration-interaction level. Ab initio potential surfaces in the plane of complex internuclear distance were obtained for the MEHC calculations. Merged-beam measurements were performed between 0953-4075/31/16/017/img19 and 0953-4075/31/16/017/img20 for the 0953-4075/31/16/017/img21 collision system. Diagnostics of the 0953-4075/31/16/017/img15 beam with a crossed electron beam could find no presence of a 0953-4075/31/16/017/img15 metastable component. The current results, in conjunction with previous measurements, are used to deduce a set of recommended cross sections.

Survival-mediated capture and fusion cross sections for heavy-element synthesis

NASA Astrophysics Data System (ADS)

Yao, L.; Loveland, W.

2018-01-01

The cross section for producing a heavy evaporation residue σEVR in a fusion reaction can be written as a product of three nonseparable factors, i.e., the capture cross section, the fusion probability PCN, and the survival probability Wsur. Each of these factors is dependent on the spin. However, one must remember that the Wsur term is zero or very small for higher spin values, thus effectively limiting the capture and fusion terms. For a series of ˜287 reactions leading to heavy evaporation residues with ZCN≤110 , we point out the implications of this fact for capture cross sections for heavy element formation reactions. From a comparison of calculated and measured evaporation residue cross sections we deduce values of the fusion probability PCN for some of these reactions.

A 6 kV arbitrary waveform generator for the Tevatron Electron Lens

DOE PAGES

Pfeffer, H.; Saewert, G.

2011-11-09

This paper reports on a 6 kV modulator built and installed at Fermilab to drive the electron gun anode for the Tevatron Electron Lens (TEL). The TEL was built with the intention of shifting the individual (anti)proton bunch tunes to even out the tune spread among all 36 bunches with the desire of improving Tevatron integrated luminosity. This modulator is essentially a 6 kV arbitrary waveform generator that enables the TEL to define the electron beam intensity on a bunch-by-bunch basis. A voltage waveform is constructed having a 7 μs duration that corresponds to the tune shift requirements of amore » 12-bunch (anti)proton beam pulse train. This waveform is played out for any one or all three bunch trains in the Tevatron. The programmed waveform voltages transition to different levels at time intervals corresponding to the 395 ns bunch spacing. In addition, complex voltage waveforms can be played out at a sustained rate of 143 kHz over the full 6 kV output range. This paper describes the novel design of the inductive adder topology employing five transformers. It describes the design aspects that minimize switching losses for this multi-kilovolt, high repetition rate and high duty factor application.« less

Theoretical investigation of the electron capture and loss processes in the collisions of He2+ + Ne.

PubMed

Hong, Xuhai; Wang, Feng; Jiao, Yalong; Su, Wenyong; Wang, Jianguo; Gou, Bingcong

2013-08-28

Based on the time-dependent density functional theory, a method is developed to study ion-atom collision dynamics, which self-consistently couples the quantum mechanical description of electron dynamics with the classical treatment of the ion motion. Employing real-time and real-space method, the coordinate space translation technique is introduced to allow one to focus on the region of target or projectile depending on the actual concerned process. The benchmark calculations are performed for the collisions of He(2+) + Ne, and the time evolution of electron density distribution is monitored, which provides interesting details of the interaction dynamics between the electrons and ion cores. The cross sections of single and many electron capture and loss have been calculated in the energy range of 1-1000 keV/amu, and the results show a good agreement with the available experiments over a wide range of impact energies.

Electron capture rates in stars studied with heavy ion charge exchange reactions

NASA Astrophysics Data System (ADS)

Bertulani, C. A.

2018-01-01

Indirect methods using nucleus-nucleus reactions at high energies (here, high energies mean ~ 50 MeV/nucleon and higher) are now routinely used to extract information of interest for nuclear astrophysics. This is of extreme relevance as many of the nuclei involved in stellar evolution are short-lived. Therefore, indirect methods became the focus of recent studies carried out in major nuclear physics facilities. Among such methods, heavy ion charge exchange is thought to be a useful tool to infer Gamow-Teller matrix elements needed to describe electron capture rates in stars and also double beta-decay experiments. In this short review, I provide a theoretical guidance based on a simple reaction model for charge exchange reactions.

Electron affinities of the alkali dimers - Na2, K2, and Rb2

NASA Technical Reports Server (NTRS)

Partridge, H.; Dixon, D. A.; Walch, S. P.; Bauschlicher, C. W., Jr.; Gole, J. L.

1983-01-01

Ab initio calculations on the ground states of the alkali dimers, Na2, K2, and Rb2, and their anions are reported. The calculations employ large Gaussian basis sets and account for nearly all of the valence correlation energy. The calculated atomic electron affinities are within 0.02 eV of experiment and the calculated adiabatic electron affinities for Na2, K2, and Rb2 are, respectively, 0.470, 0.512, and 0.513 eV.

Density functional theory studies on the electronic, structural, phonon dynamical and thermo-stability properties of bicarbonates MHCO3, M = Li, Na, K

NASA Astrophysics Data System (ADS)

Duan, Yuhua; Zhang, Bo; Sorescu, Dan C.; Johnson, J. Karl; Majzoub, Eric H.; Luebke, David R.

2012-08-01

The structural, electronic, phonon dispersion and thermodynamic properties of MHCO3 (M = Li, Na, K) solids were investigated using density functional theory. The calculated bulk properties for both their ambient and the high-pressure phases are in good agreement with available experimental measurements. Solid phase LiHCO3 has not yet been observed experimentally. We have predicted several possible crystal structures for LiHCO3 using crystallographic database searching and prototype electrostatic ground state modeling. Our total energy and phonon free energy (FPH) calculations predict that LiHCO3 will be stable under suitable conditions of temperature and partial pressures of CO2 and H2O. Our calculations indicate that the {{HCO}}_{3}^{-} groups in LiHCO3 and NaHCO3 form an infinite chain structure through O⋯H⋯O hydrogen bonds. In contrast, the {{HCO}}_{3}^{-} anions form dimers, ({{HCO}}_{3}^{-})_{2}, connected through double hydrogen bonds in all phases of KHCO3. Based on density functional perturbation theory, the Born effective charge tensor of each atom type was obtained for all phases of the bicarbonates. Their phonon dispersions with the longitudinal optical-transverse optical splitting were also investigated. Based on lattice phonon dynamics study, the infrared spectra and the thermodynamic properties of these bicarbonates were obtained. Over the temperature range 0-900 K, the FPH and the entropies (S) of MHCO3 (M =Li, Na, K) systems vary as FPH(LiHCO3) > FPH(NaHCO3) > FPH(KHCO3) and S(KHCO3) > S(NaHCO3) > S(LiHCO3), respectively, in agreement with the available experimental data. Analysis of the predicted thermodynamics of the CO2 capture reactions indicates that the carbonate/bicarbonate transition reactions for Na and K could be used for CO2 capture technology, in agreement with experiments.

Electron-phonon relaxation and excited electron distribution in gallium nitride

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhukov, V. P.; Donostia International Physics Center; Tyuterev, V. G., E-mail: valtyut00@mail.ru

2016-08-28

We develop a theory of energy relaxation in semiconductors and insulators highly excited by the long-acting external irradiation. We derive the equation for the non-equilibrium distribution function of excited electrons. The solution for this function breaks up into the sum of two contributions. The low-energy contribution is concentrated in a narrow range near the bottom of the conduction band. It has the typical form of a Fermi distribution with an effective temperature and chemical potential. The effective temperature and chemical potential in this low-energy term are determined by the intensity of carriers' generation, the speed of electron-phonon relaxation, rates ofmore » inter-band recombination, and electron capture on the defects. In addition, there is a substantial high-energy correction. This high-energy “tail” largely covers the conduction band. The shape of the high-energy “tail” strongly depends on the rate of electron-phonon relaxation but does not depend on the rates of recombination and trapping. We apply the theory to the calculation of a non-equilibrium distribution of electrons in an irradiated GaN. Probabilities of optical excitations from the valence to conduction band and electron-phonon coupling probabilities in GaN were calculated by the density functional perturbation theory. Our calculation of both parts of distribution function in gallium nitride shows that when the speed of the electron-phonon scattering is comparable with the rate of recombination and trapping then the contribution of the non-Fermi “tail” is comparable with that of the low-energy Fermi-like component. So the high-energy contribution can essentially affect the charge transport in the irradiated and highly doped semiconductors.« less

Insights into the mechanism of the capture of CO2 by K2CO3 sorbent: a DFT study.

PubMed

Liu, Hongyan; Qin, Qiaoyun; Zhang, Riguang; Ling, Lixia; Wang, Baojun

2017-09-13

The adsorption and reactions of CO 2 and H 2 O on both monoclinic and hexagonal crystal K 2 CO 3 were investigated using the density functional theory (DFT) approach. The calculated adsorption energies showed that adsorption of H 2 O molecules was clearly substantially stronger on the K 2 CO 3 surface than the adsorption of CO 2 , except on the (001)-1 surface of hexagonal K 2 CO 3 , where CO 2 is competitively adsorbed with H 2 O. Carbonation reactions easily occur on pure K 2 CO 3 and involve two parallel paths: one is where adsorbed H 2 O reacts with molecular CO 2 in gas to form the bicarbonate, while the other is where H 2 O dissociates into OH and H before bicarbonate formation, and then OH reacts with gaseous CO 2 to form a bicarbonate. Our results indicate that adding a support or promoter or using a special technique to expose more (001)-1 surfaces in hexagonal K 2 CO 3 may improve the conversion of CO 2 to the bicarbonate, which provides a theoretical direction for the experimental preparation of the K 2 CO 3 sorbent to capture CO 2 .

Electron capture strength for Ni60,62 and Ni58,60,62,64(p, n)Cu58,60,62,64 reactions at 134.3 MeV

NASA Astrophysics Data System (ADS)

Anantaraman, N.; Austin, Sam M.; Brown, B. A.; Crawley, G. M.; Galonsky, A.; Zegers, R. G. T.; Anderson, B. D.; Baldwin, A. R.; Flanders, B. S.; Madey, R.; Watson, J. W.; Foster, C. C.

2008-12-01

Background: The strength of electron capture for medium mass nuclei has a significant effect on the evolution of supernovae. There is insufficient knowledge of these strengths and very little data for important radioactive nuclei. Purpose: Determine whether it is feasible to obtain EC strength from studies of To+1 excitations in (p, n) reactions, and whether this might yield information for radioactive nuclei. Methods: Cross sections for the Ni58,60,62,64(p, n)Cu58,60,62,64 reactions were measured over the angular range of 0.3∘ to 11.6∘ at 134.3 MeV using the IUCF neutron time-of-flight facility. Results: The To+1 excitations in Ni60,62 were identified by comparison with inelastic proton scattering spectra, their B(GT) were extracted, and the corresponding electron capture rates in supernovae were calculated. Data from the TRIUMF (n, p) experiments at 198 MeV were reanalyzed; the electron capture rates for the reanalyzed data are in moderately good agreement with the higher resolution (p, n) results, but differ in detail. The possibility of future measurements with radioactive nuclei was considered. Conclusions: It may be possible to obtain low-lying electron capture strength for radioactive nuclei by studying (p, n) reactions in inverse kinematics.

Strong-potential Born calculations for 1s-1s electron capture from atoms by protons

DOE Office of Scientific and Technical Information (OSTI.GOV)

McGuire, J.H.; Kletke, R.E.; Sil, N.C.

1985-08-01

The strong-potential Born (SPB) approximation is examined by comparing various SPB calculations of high-velocity 1s-1s electron capture cross sections with one another and with experimental data. Above about 1 MeV, calculations using the SPB method of McGuire and Sil (SPMS) (Phys. Rev. A 28, 3679 (1983)) are in good agreement with total-cross-section observations for protons on H, He, C, Ne, and Ar as expected. For p+H and p+He, the SPB full-peaking (SPB-FP) approximation of Macek and Alston (Phys. Rev. A 26, 250 (1982)) and the SPB transverse-peaking (SPB-TP) approximation of Alston (Phys. Rev. A 27, 2342 (1982)) differ from ourmore » SPMS total cross sections by typically a factor of 2, as expected from general validity criteria. However, the differential cross sections at very forward angles (well within the Thomas angle) are the same in SPMS, SPB-FP, and SPB-TP methods in all cases. Below 1 MeV, cross sections obtained with use of various SPB methods differ considerably from one another, placing a limit of validity for these SPB calculations. We also suggest that in the gap between those energies where continuum intermediate states simply dominate, and above those energies where bound intermediate states simply dominate, detailed conceptual understanding of electron capture is incomplete.« less

Single-electron thermal noise

NASA Astrophysics Data System (ADS)

Nishiguchi, Katsuhiko; Ono, Yukinori; Fujiwara, Akira

2014-07-01

We report the observation of thermal noise in the motion of single electrons in an ultimately small dynamic random access memory (DRAM). The nanometer-scale transistors that compose the DRAM resolve the thermal noise in single-electron motion. A complete set of fundamental tests conducted on this single-electron thermal noise shows that the noise perfectly follows all the aspects predicted by statistical mechanics, which include the occupation probability, the law of equipartition, a detailed balance, and the law of kT/C. In addition, the counting statistics on the directional motion (i.e., the current) of the single-electron thermal noise indicate that the individual electron motion follows the Poisson process, as it does in shot noise.

Single-electron thermal noise.

PubMed

Nishiguchi, Katsuhiko; Ono, Yukinori; Fujiwara, Akira

2014-07-11

We report the observation of thermal noise in the motion of single electrons in an ultimately small dynamic random access memory (DRAM). The nanometer-scale transistors that compose the DRAM resolve the thermal noise in single-electron motion. A complete set of fundamental tests conducted on this single-electron thermal noise shows that the noise perfectly follows all the aspects predicted by statistical mechanics, which include the occupation probability, the law of equipartition, a detailed balance, and the law of kT/C. In addition, the counting statistics on the directional motion (i.e., the current) of the single-electron thermal noise indicate that the individual electron motion follows the Poisson process, as it does in shot noise.

Electronic capture of patient-reported and clinician-reported outcome measures in an elective orthopaedic setting: a retrospective cohort analysis.

PubMed

Malhotra, Karan; Buraimoh, Olatunbosun; Thornton, James; Cullen, Nicholas; Singh, Dishan; Goldberg, Andrew J

2016-06-20

To determine whether an entirely electronic system can be used to capture both patient-reported outcomes (electronic Patient-Reported Outcome Measures, ePROMs) as well as clinician-validated diagnostic and complexity data in an elective surgical orthopaedic outpatient setting. To examine patients' experience of this system and factors impacting their experience. Retrospective analysis of prospectively collected data. Single centre series. Outpatient clinics at an elective foot and ankle unit in the UK. All new adult patients attending elective orthopaedic outpatient clinics over a 32-month period. All patients were invited to complete ePROMs prior to attending their outpatient appointment. At their appointment, those patients who had not completed ePROMs were offered the opportunity to complete it on a tablet device with technical support. Matched diagnostic and complexity data were captured by the treating consultant during the appointment. Capture rates of patient-reported and clinician-reported data. All information and technology (IT) failures, language and disability barriers were captured. Patients were asked to rate their experience of using ePROMs. The scoring systems used included EQ-5D-5L, the Manchester-Oxford Foot Questionnaire (MOxFQ) and the Visual Analogue Scale (VAS) pain score. Out of 2534 new patients, 2176 (85.9%) completed ePROMs, of whom 1090 (50.09%) completed ePROMs at home/work prior to their appointment. 31.5% used a mobile (smartphone/tablet) device. Clinician-reported data were captured on 2491 patients (98.3%). The mean patient experience score of using Patient-Reported Outcome Measures (PROMs) was 8.55±1.85 out of 10 and 666 patients (30.61%) left comments. Of patients leaving comments, 214 (32.13%) felt ePROMs did not adequately capture their symptoms and these patients had significantly lower patient experience scores (p<0.001). This study demonstrates the successful implementation of technology into a service improvement programme

Case Report Form Reporter: A Key Component for the Integration of Electronic Medical Records and the Electronic Data Capture System.

PubMed

Matsumura, Yasushi; Hattori, Atsushi; Manabe, Shiro; Takahashi, Daiyo; Yamamoto, Yuichiro; Murata, Taizo; Nakagawa, Akito; Mihara, Naoki; Takeda, Toshihiro

2017-01-01

To improve the efficiency of clinical research, we developed a system to integrate electronic medical records (EMRs) and the electronic data capture system (EDC). EDC is divided into case report form (CRF) reporter and CDMS with CRF receiver with data communication using the operational data model (ODM). The CRF reporter is incorporated into the EMR to share data witth the EMR. In the data transcription type, doctors enter data using a progress note template, which are transmitted to the reporter template. It then generates the ODM. In the direct record type, reporter templates open from the progress note and generate narrative text to make record in the progress note. The configuration files for a study are delivered from the contents server to minimize the setup. This system has been used for 15 clinical studies including 3 clinical trials. This system can save labor and financial costs in clinical research.

Design knowledge capture for the space station

NASA Technical Reports Server (NTRS)

Crouse, K. R.; Wechsler, D. B.

1987-01-01

The benefits of design knowledge availability are identifiable and pervasive. The implementation of design knowledge capture and storage using current technology increases the probability for success, while providing for a degree of access compatibility with future applications. The space station design definition should be expanded to include design knowledge. Design knowledge should be captured. A critical timing relationship exists between the space station development program, and the implementation of this project.

Energy-filtered real- and k-space secondary and energy-loss electron imaging with Dual Emission Electron spectro-Microscope: Cs/Mo(110).

PubMed

Grzelakowski, Krzysztof P

2016-05-01

Since its introduction the importance of complementary k||-space (LEED) and real space (LEEM) information in the investigation of surface science phenomena has been widely demonstrated over the last five decades. In this paper we report the application of a novel kind of electron spectromicroscope Dual Emission Electron spectroMicroscope (DEEM) with two independent electron optical channels for reciprocal and real space quasi-simultaneous imaging in investigation of a Cs covered Mo(110) single crystal by using the 800eV electron beam from an "in-lens" electron gun system developed for the sample illumination. With the DEEM spectromicroscope it is possible to observe dynamic, irreversible processes at surfaces in the energy-filtered real space and in the corresponding energy-filtered kǁ-space quasi-simultaneously in two independent imaging columns. The novel concept of the high energy electron beam sample illumination in the cathode lens based microscopes allows chemically selective imaging and analysis under laboratory conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

The K+/site and H+/site stoichiometry of mitochondrial electron transport.

PubMed

Reynafarje, B; Lehninger, A L

1978-09-25

Electrode measurements of the average number of H+ ejected and K+ taken up (in the presence of valinomycin) per pair of electrons passing the energy-conserving sites of the respiratory chain of rat liver and rat heart mitochondria have given identical values of the H+/site and 5+/site ratios very close to 4 in the presence of N-ethylmaleimide, an inhibitor of interfering respiration-coupled uptake of H+ + H2PO4-. The K+/site uptake ratio of 4 not only shows that inward movement of K+ provides quantitative charge-compensation for the 4 H+ ejected, but also confirms that 4 charges are separated per pair of electrons per site. When N-ethylmaleimide is omitted, the H+/site ejection ratio is depressed, because of the interfering secondary uptake of H/+ with H2PO4- on the phosphate carrier, but the K+/site uptake ratio remains at 4.0. Addition of phosphate or acetate, which can carry H+ into respiring mitochondria, further depresses the H+/site ratio, but does not affect the K+/site ratio, which remains at 4.0. These and other considerations thus confirm our earlier stoichiometric measurements that the average H+/site ratio is 4.0 and also show that the K+/site uptake ratio can be used as a measure of the intrinsic H+/site ratio, regardless of the presence of phosphate in the medium and without the necessity of adding N-ethylmaleimide or other inhibitors of H+ + H2PO4- transport.

Estimating breeding proportions and testing hypotheses about costs of reproduction with capture-recapture data

USGS Publications Warehouse

Nichols, James D.; Hines, James E.; Pollock, Kenneth H.; Hinz, Robert L.; Link, William A.

1994-01-01

The proportion of animals in a population that breeds is an important determinant of population growth rate. Usual estimates of this quantity from field sampling data assume that the probability of appearing in the capture or count statistic is the same for animals that do and do not breed. A similar assumption is required by most existing methods used to test ecologically interesting hypotheses about reproductive costs using field sampling data. However, in many field sampling situations breeding and nonbreeding animals are likely to exhibit different probabilities of being seen or caught. In this paper, we propose the use of multistate capture-recapture models for these estimation and testing problems. This methodology permits a formal test of the hypothesis of equal capture/sighting probabilities for breeding and nonbreeding individuals. Two estimators of breeding proportion (and associated standard errors) are presented, one for the case of equal capture probabilities and one for the case of unequal capture probabilities. The multistate modeling framework also yields formal tests of hypotheses about reproductive costs to future reproduction or survival or both fitness components. The general methodology is illustrated using capture-recapture data on female meadow voles, Microtus pennsylvanicus. Resulting estimates of the proportion of reproductively active females showed strong seasonal variation, as expected, with low breeding proportions in midwinter. We found no evidence of reproductive costs extracted in subsequent survival or reproduction. We believe that this methodological framework has wide application to problems in animal ecology concerning breeding proportions and phenotypic reproductive costs.

Measurement of Plutonium-240 Angular Momentum Dependent Fission Probabilities Using the Alpha-Alpha' Reaction

NASA Astrophysics Data System (ADS)

Koglin, Johnathon

Accurate nuclear reaction data from a few keV to tens of MeV and across the table of nuclides is essential to a number of applications of nuclear physics, including national security, nuclear forensics, nuclear astrophysics, and nuclear energy. Precise determination of (n, f) and neutron capture cross sections for reactions in high- ux environments are particularly important for a proper understanding of nuclear reactor performance and stellar nucleosynthesis. In these extreme environments reactions on short-lived and otherwise difficult-to-produce isotopes play a significant role in system evolution and provide insights into the types of nuclear processes taking place; a detailed understanding of these processes is necessary to properly determine cross sections far from stability. Indirect methods are often attempted to measure cross sections on isotopes that are difficult to separate in a laboratory setting. Using the surrogate approach, the same compound nucleus from the reaction of interest is created through a "surrogate" reaction on a different isotope and the resulting decay is measured. This result is combined with appropriate reaction theory for compound nucleus population, from which the desired cross sections can be inferred. This method has shown promise, but the theoretical framework often lacks necessary experimental data to constrain models. In this work, dual arrays of silicon telescope particle identification detectors and photovoltaic (solar) cell fission fragment detectors have been used to measure the fission probability of the 240Pu(alpha, alpha'f) reaction - a surrogate for the 239Pu(n, f) - and fission of 35.9(2)MeV at eleven scattering angles from 40° to 140° in 10° intervals and at nuclear excitation energies up to 16MeV. Within experimental uncertainty, the maximum fission probability was observed at the neutron separation energy for each alpha scattering angle. Fission probabilities were separated into five 500 keV bins from 5:5MeV to

Augmenting superpopulation capture-recapture models with population assignment data

USGS Publications Warehouse

Wen, Zhi; Pollock, Kenneth; Nichols, James; Waser, Peter

2011-01-01

Ecologists applying capture-recapture models to animal populations sometimes have access to additional information about individuals' populations of origin (e.g., information about genetics, stable isotopes, etc.). Tests that assign an individual's genotype to its most likely source population are increasingly used. Here we show how to augment a superpopulation capture-recapture model with such information. We consider a single superpopulation model without age structure, and split each entry probability into separate components due to births in situ and immigration. We show that it is possible to estimate these two probabilities separately. We first consider the case of perfect information about population of origin, where we can distinguish individuals born in situ from immigrants with certainty. Then we consider the more realistic case of imperfect information, where we use genetic or other information to assign probabilities to each individual's origin as in situ or outside the population. We use a resampling approach to impute the true population of origin from imperfect assignment information. The integration of data on population of origin with capture-recapture data allows us to determine the contributions of immigration and in situ reproduction to the growth of the population, an issue of importance to ecologists. We illustrate our new models with capture-recapture and genetic assignment data from a population of banner-tailed kangaroo rats Dipodomys spectabilis in Arizona.

Predicting non-square 2D dice probabilities

NASA Astrophysics Data System (ADS)

Pender, G. A. T.; Uhrin, M.

2014-07-01

The prediction of the final state probabilities of a general cuboid randomly thrown onto a surface is a problem that naturally arises in the minds of men and women familiar with regular cubic dice and the basic concepts of probability. Indeed, it was considered by Newton in 1664 (Newton 1967 The Mathematical Papers of Issac Newton vol I (Cambridge: Cambridge University Press) pp 60-1). In this paper we make progress on the 2D problem (which can be realized in 3D by considering a long cuboid, or alternatively a rectangular cross-sectioned dreidel). For the two-dimensional case we suggest that the ratio of the probabilities of landing on each of the two sides is given by \\frac{\\sqrt{{{k}^{2}}+{{l}^{2}}}-k}{\\sqrt{{{k}^{2}}+{{l}^{2}}}-l}\\frac{arctan \\frac{l}{k}}{arctan \\frac{k}{l}} where k and l are the lengths of the two sides. We test this theory both experimentally and computationally, and find good agreement between our theory, experimental and computational results. Our theory is known, from its derivation, to be an approximation for particularly bouncy or ‘grippy’ surfaces where the die rolls through many revolutions before settling. On real surfaces we would expect (and we observe) that the true probability ratio for a 2D die is a somewhat closer to unity than predicted by our theory. This problem may also have wider relevance in the testing of physics engines.

Feasibility of real-time capture of routine clinical data in the electronic health record: a hospital-based, observational service-evaluation study

PubMed Central

Archbold, R Andrew; Weerackody, Roshan; Barnes, Michael R; Lee, Aaron M; Janjuha, Surjeet; Gutteridge, Charles; Robson, John; Timmis, Adam

2018-01-01

Objectives The electronic health record (EHR) is underused in the hospital setting. The aim of this service evaluation study was to respond to National Health Service (NHS) Digital’s ambition for a paperless NHS by capturing routinely collected cardiac outpatient data in the EHR to populate summary patient reports and provide a resource for audit and research. Design A PowerForm template was developed within the Cerner EHR, for real-time entry of routine clinical data by clinicians attending a cardiac outpatient clinic. Data captured within the PowerForm automatically populated a SmartTemplate to generate a view-only report that was immediately available for the patient and for electronic transmission to the referring general practitioner (GP). Results During the first 8 months, the PowerForm template was used in 61% (360/594) of consecutive outpatient referrals increasing from 42% to 77% during the course of the study. Structured patient reports were available for immediate sharing with the referring GP using Cerner Health Information Exchange technology while electronic transmission was successfully developed in a substudy of 64 cases, with direct delivery by the NHS Data Transfer Service in 29 cases and NHS mail in the remainder. In feedback, the report’s immediate availability was considered very or extremely important by >80% of the patients and GPs who were surveyed. Both groups reported preference of the patient report to the conventional typed letter. Deidentified template data for all 360 patients were successfully captured within the Trust system, confirming availability of these routinely collected outpatient data for audit and research. Conclusion Electronic template development tailored to the requirements of a specialist outpatient clinic facilitates capture of routinely collected data within the Cerner EHR. These data can be made available for audit and research. They can also be used to enhance communication by populating structured reports

On the universality of knot probability ratios

NASA Astrophysics Data System (ADS)

Janse van Rensburg, E. J.; Rechnitzer, A.

2011-04-01

Let pn denote the number of self-avoiding polygons of length n on a regular three-dimensional lattice, and let pn(K) be the number which have knot type K. The probability that a random polygon of length n has knot type K is pn(K)/pn and is known to decay exponentially with length (Sumners and Whittington 1988 J. Phys. A: Math. Gen. 21 1689-94, Pippenger 1989 Discrete Appl. Math. 25 273-8). Little is known rigorously about the asymptotics of pn(K), but there is substantial numerical evidence (Orlandini et al 1988 J. Phys. A: Math. Gen. 31 5953-67, Marcone et al 2007 Phys. Rev. E 75 41105, Rawdon et al 2008 Macromolecules 41 4444-51, Janse van Rensburg and Rechnitzer 2008 J. Phys. A: Math. Theor. 41 105002) that pn(K) grows as p_n(K) \\simeq C_K \\mu _\\emptyset ^n n^{\\alpha -3+N_K}, \\qquad as\\quad n \\rightarrow \\infty, where NK is the number of prime components of the knot type K. It is believed that the entropic exponent, α, is universal, while the exponential growth rate, μ∅, is independent of the knot type but varies with the lattice. The amplitude, CK, depends on both the lattice and the knot type. The above asymptotic form implies that the relative probability of a random polygon of length n having prime knot type K over prime knot type L is \\frac{p_n(K)/p_n}{p_n(L)/p_n} = \\frac{p_n(K)}{p_n(L)} \\simeq \\left[ \\frac{C_K}{C_L} \\right].\\\\[-8pt] In the thermodynamic limit this probability ratio becomes an amplitude ratio; it should be universal and depend only on the knot types K and L. In this communication we examine the universality of these probability ratios for polygons in the simple cubic, face-centred cubic and body-centred cubic lattices. Our results support the hypothesis that these are universal quantities. For example, we estimate that a long random polygon is approximately 28 times more likely to be a trefoil than be a figure-eight, independent of the underlying lattice, giving an estimate of the intrinsic entropy associated with knot

Polyethylenimine-incorporated zeolite 13X with mesoporosity for post-combustion CO2 capture

NASA Astrophysics Data System (ADS)

Chen, Chao; Kim, Su-Sung; Cho, Won-Seung; Ahn, Wha-Seung

2015-03-01

X-type zeolite with mesoporosity (Meso-13X) was prepared by using dimethyloctadecyl[3-(trimethoxysilyl)propyl]ammonium chloride as a mesopore-generating agent, and then modified with polyethylenimine (PEI) through a physical impregnation method to form a hybrid material (Meso-13X-PEI). Meso-13X with and without PEI was characterized by X-ray powder diffraction (XRD), N2 adsorption-desorption isotherm at 77 K, scanning electron microscopy (SEM), and thermogravimetric analysis (TGA). Meso-13X-PEI exhibited higher CO2 capture capacity than PEI-modified zeolite 13X owing to its larger pore volume that accommodates more amine species inside the pore structure, and the mesoporosity also can facilitate dispersion of PEI molecules inside the pore channels. Compared to zeolite 13X, Meso-13X-PEI showed much higher CO2 capture selectivity (against N2) as well as higher CO2 capture capacity at relatively high temperature (e.g. 100 °C) and dilute CO2 concentration relevant to post-combustion conditions.

Zero field reversal probability in thermally assisted magnetization reversal

NASA Astrophysics Data System (ADS)

Prasetya, E. B.; Utari; Purnama, B.

2017-11-01

This paper discussed about zero field reversal probability in thermally assisted magnetization reversal (TAMR). Appearance of reversal probability in zero field investigated through micromagnetic simulation by solving stochastic Landau-Lifshitz-Gibert (LLG). The perpendicularly anisotropy magnetic dot of 50×50×20 nm3 is considered as single cell magnetic storage of magnetic random acces memory (MRAM). Thermally assisted magnetization reversal was performed by cooling writing process from near/almost Curie point to room temperature on 20 times runs for different randomly magnetized state. The results show that the probability reversal under zero magnetic field decreased with the increase of the energy barrier. The zero-field probability switching of 55% attained for energy barrier of 60 k B T and the reversal probability become zero noted at energy barrier of 2348 k B T. The higest zero-field switching probability of 55% attained for energy barrier of 60 k B T which corespond to magnetif field of 150 Oe for switching.

Direct Observation of Electron Capture and Reemission by the Divacancy via Charge Transient Positron Spectroscopy

NASA Astrophysics Data System (ADS)

Edwardson, C. J.; Coleman, P. G.; Paez, D. J.; Doylend, J. K.; Knights, A. P.

2013-03-01

Electron capture during forward bias and reemission at zero bias by divacancies in the depletion region of a silicon diode structure at room temperature have been studied for the first time using monoenergetic positrons. The positron response increases essentially linearly with electron current, as a result of increased positron trapping by negatively charged divacancies. The measurements indicate that ≤1% of the divacancies become negatively charged in the steady state at a forward bias of 1 V. Changes in the mean positron response when applying a square wave bias to the sample (1 V forward bias and 0 V, duty cycle 1∶4, times at 0 V in the range 0.1-100μs), were consistent with a rapid conversion of doubly to singly charged divacancies (in ˜101ns), followed by slower defilling of the singly charged divacancies with a time constant of ˜101μs. These ac measurements allow determination of the relative populations of singly and doubly charged divacancies. The results provide confirmation of consistency between the positron’s response to the silicon divacancy and previously extracted capture and emission kinetics determined through charge transient measurements and assigned to the same defect. The possibility of combining these two, orthogonal techniques suggest a promising new and powerful approach to defect spectroscopy in which the structure and electrical properties of a defect may be determined in a single measurement.

Sufficient Statistics for Divergence and the Probability of Misclassification

NASA Technical Reports Server (NTRS)

Quirein, J.

1972-01-01

One particular aspect is considered of the feature selection problem which results from the transformation x=Bz, where B is a k by n matrix of rank k and k is or = to n. It is shown that in general, such a transformation results in a loss of information. In terms of the divergence, this is equivalent to the fact that the average divergence computed using the variable x is less than or equal to the average divergence computed using the variable z. A loss of information in terms of the probability of misclassification is shown to be equivalent to the fact that the probability of misclassification computed using variable x is greater than or equal to the probability of misclassification computed using variable z. First, the necessary facts relating k-dimensional and n-dimensional integrals are derived. Then the mentioned results about the divergence and probability of misclassification are derived. Finally it is shown that if no information is lost (in x = Bz) as measured by the divergence, then no information is lost as measured by the probability of misclassification.

Tests for senescent decline in annual survival probabilities of common pochards, Aythya ferina

USGS Publications Warehouse

Nichols, J.D.; Hines, J.E.; Blums, P.

1997-01-01

Senescent decline in survival probabilities of animals is a topic about which much has been written but little is known. Here, we present formal tests of senescence hypotheses, using 1373 recaptures from 8877 duckling (age 0) and 504 yearling Common Pochards (Aythya ferina) banded at a Latvian study site, 1975-1992. The tests are based on capture-recapture models that explicitly incorporate sampling probabilities that, themselves, may exhibit timeand age-specific variation. The tests provided no evidence of senescent decline in survival probabilities for this species. Power of the most useful test was low for gradual declines in annual survival probability with age, but good for steeper declines. We recommend use of this type of capture-recapture modeling and analysis for other investigations of senescence in animal survival rates.

Stability of a slotted ALOHA system with capture effect

NASA Astrophysics Data System (ADS)

Onozato, Yoshikuni; Liu, Jin; Noguchi, Shoichi

1989-02-01

The stability of a slotted ALOHA system with capture effect is investigated under a general communication environment where terminals are divided into two groups (low-power and high-power) and the capture effect is modeled by capture probabilities. An approximate analysis is developed using catastrophe theory, in which the effects of system and user parameters on the stability are characterized by the cusp catastrophe. Particular attention is given to the low-power group, since it must bear the strain under the capture effect. The stability conditions of the two groups are given explicitly by bifurcation sets.

PROBING ELECTRON-CAPTURE SUPERNOVAE: X-RAY BINARIES IN STARBURSTS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Linden, T.; Sepinsky, J. F.; Kalogera, V.

We develop population models of high-mass X-ray binaries (HMXBs) formed after bursts of star formation and we investigate the effect of electron-capture supernovae (ECS) of massive ONeMg white dwarfs and the hypothesis that ECS events are associated with typically low supernova kicks imparted to the nascent neutron stars. We identify an interesting ECS bump in the time evolution of HMXB numbers; this bump is caused by significantly increased production of wind-fed HMXBs 20-60 Myr post-starburst. The amplitude and age extent of the ECS bump depend on the strength of ECS kicks and the mass range of ECS progenitors. We alsomore » find that ECS-HMXBs form through a specific evolutionary channel that is expected to lead to binaries with Be donors in wide orbits. These characteristics, along with their sensitivity to ECS properties, provide us with an intriguing opportunity to probe ECS physics and progenitors through studies of starbursts of different ages. Specifically, the case of the Small Magellanic Cloud, with a significant observed population of Be-HMXBs and starburst activity 30-60 Myr ago, arises as a promising laboratory for understanding the role of ECS in neutron star formation.« less

Modification of electronic properties of graphene by using low-energy K{sup +} ions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Jingul; Lee, Paengro; Ryu, Mintae

2016-05-02

Despite its superb electronic properties, the semi-metallic nature of graphene with no band gap (E{sub g}) at the Dirac point has been a stumbling block for its industrial application. We report an improved means of producing a tunable band gap over other schemes by doping low energy (10 eV) potassium ions (K{sup +}) on single layer graphene formed on 6H-SiC(0001) surface, where the noble Dirac nature of the π-band remains almost unaltered. The changes in the π-band induced by K{sup +} ions reveal that the band gap increases gradually with increasing dose (θ) of the ions up to E{sub g} = 0.65 eV atmore » θ = 1.10 monolayers, demonstrating the tunable character of the band gap. Our core level data for C 1s, Si 2p, and K 2p suggest that the K{sup +}-induced asymmetry in charge distribution among carbon atoms drives the opening of band gap, which is in sharp contrast with no band gap when neutral K atoms are adsorbed on graphene. This tunable K{sup +}-induced band gap in graphene illustrates its potential application in graphene-based nano-electronics.« less

Estimating temporary emigration and breeding proportions using capture-recapture data with Pollock's robust design

USGS Publications Warehouse

Kendall, W.L.; Nichols, J.D.; Hines, J.E.

1997-01-01

Statistical inference for capture-recapture studies of open animal populations typically relies on the assumption that all emigration from the studied population is permanent. However, there are many instances in which this assumption is unlikely to be met. We define two general models for the process of temporary emigration, completely random and Markovian. We then consider effects of these two types of temporary emigration on Jolly-Seber (Seber 1982) estimators and on estimators arising from the full-likelihood approach of Kendall et al. (1995) to robust design data. Capture-recapture data arising from Pollock's (1982) robust design provide the basis for obtaining unbiased estimates of demographic parameters in the presence of temporary emigration and for estimating the probability of temporary emigration. We present a likelihood-based approach to dealing with temporary emigration that permits estimation under different models of temporary emigration and yields tests for completely random and Markovian emigration. In addition, we use the relationship between capture probability estimates based on closed and open models under completely random temporary emigration to derive three ad hoc estimators for the probability of temporary emigration, two of which should be especially useful in situations where capture probabilities are heterogeneous among individual animals. Ad hoc and full-likelihood estimators are illustrated for small mammal capture-recapture data sets. We believe that these models and estimators will be useful for testing hypotheses about the process of temporary emigration, for estimating demographic parameters in the presence of temporary emigration, and for estimating probabilities of temporary emigration. These latter estimates are frequently of ecological interest as indicators of animal movement and, in some sampling situations, as direct estimates of breeding probabilities and proportions.

Formation of negative hydrogen ion: polarization electron capture and nonthermal shielding.

PubMed

Ki, Dae-Han; Jung, Young-Dae

2012-09-07

The influence of the nonthermal shielding on the formation of the negative hydrogen ion (H(-)) by the polarization electron capture are investigated in partially ionized generalized Lorentzian plasmas. The Bohr-Lindhard method has been applied to obtain the negative hydrogen formation radius and cross section as functions of the collision energy, de Broglie wave length, Debye length, impact parameter, and spectral index of the plasma. The result shows that the nonthermal character of the plasma enhances the formation radius of the negative hydrogen, especially, for small Debye radii. It is found that the nonthermal effect increases the formation cross section of the negative hydrogen. It is also found that the maximum position of the formation cross section approaches to the collision center with an increase of the spectral index. In addition, it is found that the formation cross section significantly decreases with an increase of the Debye length, especially, for small spectral indices.

Diagnostics for a 1.2 kA, 1 MeV, electron induction injector

NASA Astrophysics Data System (ADS)

Houck, T. L.; Anderson, D. E.; Eylon, S.; Henestroza, E.; Lidia, S. M.; Vanecek, D. L.; Westenskow, G. A.; Yu, S. S.

1998-12-01

We are constructing a 1.2 kA, 1 MeV, electron induction injector as part of the RTA program, a collaborative effort between LLNL and LBNL to develop relativistic klystrons for Two-Beam Accelerator applications. The RTA injector will also be used in the development of a high-gradient, low-emittance, electron source and beam diagnostics for the second axis of the Dual Axis Radiographic Hydrodynamic Test (DARHT) Facility. The electron source will be a 3.5″-diameter, thermionic, flat-surface, m-type cathode with a maximum shroud field stress of approximately 165 kV/cm. Additional design parameters for the injector include a pulse length of over 150 ns flat top (1% energy variation), and a normalized edge emittance of less than 200 π-mm-mr. Precise measurement of the beam parameters is required so that performance of the RTA injector can be confidently scaled to the 4 kA, 3 MeV, and 2-microsecond pulse parameters of the DARHT injector. Planned diagnostics include an isolated cathode with resistive divider for direct measurement of current emission, resistive wall and magnetic probe current monitors for measuring beam current and centroid position, capacitive probes for measuring A-K gap voltage, an energy spectrometer, and a pepperpot emittance diagnostic. Details of the injector, beam line, and diagnostics are presented.

The use of auxiliary variables in capture-recapture and removal experiments

USGS Publications Warehouse

Pollock, K.H.; Hines, J.E.; Nichols, J.D.

1984-01-01

The dependence of animal capture probabilities on auxiliary variables is an important practical problem which has not been considered in the development of estimation procedures for capture-recapture and removal experiments. In this paper the linear logistic binary regression model is used to relate the probability of capture to continuous auxiliary variables. The auxiliary variables could be environmental quantities such as air or water temperature, or characteristics of individual animals, such as body length or weight. Maximum likelihood estimators of the population parameters are considered for a variety of models which all assume a closed population. Testing between models is also considered. The models can also be used when one auxiliary variable is a measure of the effort expended in obtaining the sample.

Study of inelastic processes in Li+-Ar, K+-Ar, and Na+-He collisions in the energy range 0.5-10 keV

NASA Astrophysics Data System (ADS)

Lomsadze, Ramaz A.; Gochitashvili, Malkhaz R.; Kezerashvili, Roman Ya; Schulz, Michael

2017-11-01

Absolute cross sections are measured for charge-exchange, ionization, and excitation processes within the same experimental setup for the Li{}+-Ar, K{}+-Ar, and Na{}+-He collisions in the ion energy range of 0.5-10 keV. The results of the measurements and schematic correlation diagrams are used to analyze and determine the mechanisms for these processes. The experimental results show that the charge-exchange processes occur with high probabilities and electrons are predominantly captured in ground states. The contributions of various partial inelastic channels to the total ionization cross section are estimated, and a primary mechanism for the process is identified. In addition, the energy-loss spectrum is applied in order to estimate the relative contribution of different inelastic channels, and to determine the mechanisms for the ionization and for some excitation processes of Ar resonance lines for the {{{K}}}+-Ar collision system. The excitation cross sections for the helium and for the sodium doublet lines for the Na{}+-He collision system both reveal some unexpected features. A mechanism to explain this observation is suggested.

K-band single-chip electron spin resonance detector.

PubMed

Anders, Jens; Angerhofer, Alexander; Boero, Giovanni

2012-04-01

We report on the design, fabrication, and characterization of an integrated detector for electron spin resonance spectroscopy operating at 27 GHz. The microsystem, consisting of an LC-oscillator and a frequency division module, is integrated onto a single silicon chip using a conventional complementary metal-oxide-semiconductor technology. The achieved room temperature spin sensitivity is about 10(8)spins/G Hz(1/2), with a sensitive volume of about (100 μm)(3). Operation at 77K is also demonstrated. Copyright © 2012 Elsevier Inc. All rights reserved.

DETECTION OF K-RAS AND P53 MUTATIONS IN SPUTUM SAMPLES OF LUNG CANCER PATIENTS USING LASER CAPTURE MICRODISSECTION MICROSCOPE AND MUTATION ANALYSIS

EPA Science Inventory

Detection of K-ras and p53 Mutations in Sputum Samples of Lung Cancer Patients Using Laser Capture Microdissection Microscope and Mutation Analysis

Phouthone Keohavong a,*, Wei-Min Gao a, Kui-Cheng Zheng a, Hussam Mady b, Qing Lan c, Mona Melhem b, and Judy Mumford d.
<...

The perception of probability.

PubMed

Gallistel, C R; Krishan, Monika; Liu, Ye; Miller, Reilly; Latham, Peter E

2014-01-01

We present a computational model to explain the results from experiments in which subjects estimate the hidden probability parameter of a stepwise nonstationary Bernoulli process outcome by outcome. The model captures the following results qualitatively and quantitatively, with only 2 free parameters: (a) Subjects do not update their estimate after each outcome; they step from one estimate to another at irregular intervals. (b) The joint distribution of step widths and heights cannot be explained on the assumption that a threshold amount of change must be exceeded in order for them to indicate a change in their perception. (c) The mapping of observed probability to the median perceived probability is the identity function over the full range of probabilities. (d) Precision (how close estimates are to the best possible estimate) is good and constant over the full range. (e) Subjects quickly detect substantial changes in the hidden probability parameter. (f) The perceived probability sometimes changes dramatically from one observation to the next. (g) Subjects sometimes have second thoughts about a previous change perception, after observing further outcomes. (h) The frequency with which they perceive changes moves in the direction of the true frequency over sessions. (Explaining this finding requires 2 additional parametric assumptions.) The model treats the perception of the current probability as a by-product of the construction of a compact encoding of the experienced sequence in terms of its change points. It illustrates the why and the how of intermittent Bayesian belief updating and retrospective revision in simple perception. It suggests a reinterpretation of findings in the recent literature on the neurobiology of decision making. (PsycINFO Database Record (c) 2014 APA, all rights reserved).

Formation of S-type planets in close binaries: scattering induced tidal capture of circumbinary planets

NASA Astrophysics Data System (ADS)

Gong, Yan-Xiang; Ji, Jianghui

2018-05-01

Although several S-type and P-type planets in binary systems were discovered in past years, S-type planets have not yet been found in close binaries with an orbital separation not more than 5 au. Recent studies suggest that S-type planets in close binaries may be detected through high-accuracy observations. However, nowadays planet formation theories imply that it is difficult for S-type planets in close binaries systems to form in situ. In this work, we extensively perform numerical simulations to explore scenarios of planet-planet scattering among circumbinary planets and subsequent tidal capture in various binary configurations, to examine whether the mechanism can play a part in producing such kind of planets. Our results show that this mechanism is robust. The maximum capture probability is ˜10%, which can be comparable to the tidal capture probability of hot Jupiters in single star systems. The capture probability is related to binary configurations, where a smaller eccentricity or a low mass ratio of the binary will lead to a larger probability of capture, and vice versa. Furthermore, we find that S-type planets with retrograde orbits can be naturally produced via capture process. These planets on retrograde orbits can help us distinguish in situ formation and post-capture origin for S-type planet in close binaries systems. The forthcoming missions (PLATO) will provide the opportunity and feasibility to detect such planets. Our work provides several suggestions for selecting target binaries in search for S-type planets in the near future.

Ion dipole capture cross sections at low ion and rotational energies - Comparison of integrated capture cross sections with reaction cross sections for NH3 and H2O parent-ion collisions.

NASA Technical Reports Server (NTRS)

Dugan, J. V., Jr.; Canright, R. B., Jr.

1972-01-01

The numerical capture cross section is calculated from the capture ratio, defined as the fraction of trajectories reaching a prescribed minimum separation of 3 A. The calculated capture cross sections for a rotational temperature of 77 K suggest large reaction cross sections in 80 K experiments for the large dipole-moment target, methyl cyanide.

Soybean P34 Probable Thiol Protease Probably Has Proteolytic Activity on Oleosins.

PubMed

Zhao, Luping; Kong, Xiangzhen; Zhang, Caimeng; Hua, Yufei; Chen, Yeming

2017-07-19

P34 probable thiol protease (P34) and Gly m Bd 30K (30K) show high relationship with the protease of 24 kDa oleosin of soybean oil bodies. In this study, 9 day germinated soybean was used to separate bioprocessed P34 (P32) from bioprocessed 30K (28K). Interestingly, P32 existed as dimer, whereas 28K existed as monomer; a P32-rich sample had proteolytic activity and high cleavage site specificity (Lys-Thr of 24 kDa oleosin), whereas a 28K-rich sample showed low proteolytic activity; the P32-rich sample contained one thiol protease. After mixing with purified oil bodies, all P32 dimers were dissociated and bound to 24 kDa oleosins to form P32-24 kDa oleosin complexes. By incubation, 24 kDa oleosin was preferentially hydrolyzed, and two hydrolyzed products (HPs; 17 and 7 kDa) were confirmed. After most of 24 kDa oleosin was hydrolyzed, some P32 existed as dimer, and the other as P32-17 kDa HP. It was suggested that P32 was the protease.

Mapping a Noncovalent Protein-Peptide Interface by Top-Down FTICR Mass Spectrometry Using Electron Capture Dissociation

NASA Astrophysics Data System (ADS)

Clarke, David J.; Murray, Euan; Hupp, Ted; Mackay, C. Logan; Langridge-Smith, Pat R. R.

2011-08-01

Noncovalent protein-ligand and protein-protein complexes are readily detected using electrospray ionization mass spectrometry (ESI MS). Furthermore, recent reports have demonstrated that careful use of electron capture dissociation (ECD) fragmentation allows covalent backbone bonds of protein complexes to be dissociated without disruption of noncovalent protein-ligand interactions. In this way the site of protein-ligand interfaces can be identified. To date, protein-ligand complexes, which have proven tractable to this technique, have been mediated by ionic electrostatic interactions, i.e., ion pair interactions or salt bridging. Here we extend this methodology by applying ECD to study a protein-peptide complex that contains no electrostatics interactions. We analyzed the complex between the 21 kDa p53-inhibitor protein anterior gradient-2 and its hexapeptide binding ligand (PTTIYY). ECD fragmentation of the 1:1 complex occurs with retention of protein-peptide binding and analysis of the resulting fragments allows the binding interface to be localized to a C-terminal region between residues 109 and 175. These finding are supported by a solution-phase competition assay, which implicates the region between residues 108 and 122 within AGR2 as the PTTIYY binding interface. Our study expands previous findings by demonstrating that top-down ECD mass spectrometry can be used to determine directly the sites of peptide-protein interfaces. This highlights the growing potential of using ECD and related top-down fragmentation techniques for interrogation of protein-protein interfaces.

Monitoring Species of Concern Using Noninvasive Genetic Sampling and Capture-Recapture Methods

DTIC Science & Technology

2016-11-01

ABBREVIATIONS AICc Akaike’s Information Criterion with small sample size correction AZGFD Arizona Game and Fish Department BMGR Barry M. Goldwater...MNKA Minimum Number Known Alive N Abundance Ne Effective Population Size NGS Noninvasive Genetic Sampling NGS-CR Noninvasive Genetic...parameter estimates from capture-recapture models require sufficient sample sizes , capture probabilities and low capture biases. For NGS-CR, sample

Influence of trap modifications and environmental predictors on capture success of southern flying squirrels

USGS Publications Warehouse

Jacques, Christopher N.; Zweep, James S.; Scheihing, Mary E.; Rechkemmer, Will T.; Jenkins, Sean E.; Klaver, Robert W.; Dubay, Shelli A.

2017-01-01

Sherman traps are the most commonly used live traps in studies of small mammals and have been successfully used in the capture of arboreal species such as the southern flying squirrel (Glaucomys volans). However, southern flying squirrels spend proportionately less time foraging on the ground, which necessitates above-ground trapping methods and modifications of capture protocols. Further, quantitative estimates of the factors affecting capture success of flying squirrel populations have focused solely on effects of trapping methodologies. We developed and evaluated the efficacy of a portable Sherman trap design for capturing southern flying squirrels during 2015–2016 at the Alice L. Kibbe Field Station, Illinois, USA. Additionally, we used logistic regression to quantify potential effects of time-dependent (e.g., weather) and time-independent (e.g., habitat, extrinsic) factors on capture success of southern flying squirrels. We recorded 165 capture events (119 F, 44 M, 2 unknown) using our modified Sherman trap design. Probability of capture success decreased 0.10/1° C increase in daily maximum temperature and by 0.09/unit increase (km/hr) in wind speed. Conversely, probability of capture success increased by 1.2/1° C increase in daily minimum temperature. The probability of capturing flying squirrels was negatively associated with trap orientation. When tree-mounted traps are required, our modified trap design is a safe, efficient, and cost-effective method of capturing animals when moderate weather (temp and wind speed) conditions prevail. Further, we believe that strategic placement of traps (e.g., northeast side of tree) and quantitative information on site-specific (e.g., trap location) characteristics (e.g., topographical features, slope, aspect, climatologic factors) could increase southern flying squirrel capture success. © 2017 The Wildlife Society.

Probability shapes perceptual precision: A study in orientation estimation.

PubMed

Jabar, Syaheed B; Anderson, Britt

2015-12-01

Probability is known to affect perceptual estimations, but an understanding of mechanisms is lacking. Moving beyond binary classification tasks, we had naive participants report the orientation of briefly viewed gratings where we systematically manipulated contingent probability. Participants rapidly developed faster and more precise estimations for high-probability tilts. The shapes of their error distributions, as indexed by a kurtosis measure, also showed a distortion from Gaussian. This kurtosis metric was robust, capturing probability effects that were graded, contextual, and varying as a function of stimulus orientation. Our data can be understood as a probability-induced reduction in the variability or "shape" of estimation errors, as would be expected if probability affects the perceptual representations. As probability manipulations are an implicit component of many endogenous cuing paradigms, changes at the perceptual level could account for changes in performance that might have traditionally been ascribed to "attention." (c) 2015 APA, all rights reserved).

Collimated electron beam accelerated at 12 kV from a Penning discharge.

PubMed

Toader, D; Oane, M; Ticoş, C M

2015-01-01

A pulsed electron beam accelerated at 12 kV with a duration of 40 μs per pulse is obtained from a Penning discharge with a hollow anode and two cathodes. The electrons are extracted through a hole in one of the cathodes and focused by a pair of coils. The electron beam has a diameter of a few mm in the cross section, while the beam current reaches peak values of 400 mA, depending on the magnetic field inside the focussing coils. This relatively inexpensive and compact device is suitable for the irradiation of small material samples placed in high vacuum.

Electron emission from transfer ionization reaction in 30 keV amu‑1 He 2+ on Ar collision

NASA Astrophysics Data System (ADS)

Amaya-Tapia, A.; Antillón, A.; Estrada, C. D.

2018-06-01

A model is presented that describes the transfer ionization process in H{e}2++Ar collision at a projectile energy of 30 keV amu‑1. It is based on a semiclassical independent-particle close-coupling method that yields a reasonable agreement between calculated and experimental values of the total single-ionization and single-capture cross sections. It is found that the transfer ionization reaction is predominantly carried out through simultaneous capture and ionization, rather than by sequential processes. The transfer-ionization differential cross section in energy that is obtained satisfactorily reproduces the global behavior of the experimental data. Additionally, the probabilities of capture and ionization as function of the impact parameter for H{e}2++A{r}+ and H{e}++A{r}+ collisions are calculated, as far as we know, for the first time. The results suggest that the model captures essential elements that describe the two-electron transfer ionization process and could be applied to systems and processes of two electrons.

PbSnTe:In compound: Electron capture levels, galvanomagnetic properties, and THz sensitivity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ishchenko, D. V., E-mail: miracle4348@gmail.com; Klimov, A. E.; Shumsky, V. N.

A model of the Pb{sub 1–x}Sn{sub x}Te:In compound, based on concepts of the theory of disordered systems is considered. The temperature dependences of the Fermi-level position and carrier concentration are calculated depending on the indium doping level and are compared with experimental data. The transient current–voltage characteristics are calculated in the mode of injection from the contact and current limitation by space charge at various voltage-variation rates. The data obtained are compared with the experiments. It is demonstrated that the shape of the characteristics is controlled by the parameters of electron capture at localized states. Photocurrent relaxation in a magneticmore » field is studied, and the mechanism of such relaxation is discussed under the assumption of the magnetic freezing of carriers.« less

Quantitative Detection of Trace Explosive Vapors by Programmed Temperature Desorption Gas Chromatography-Electron Capture Detector

PubMed Central

Field, Christopher R.; Lubrano, Adam; Woytowitz, Morgan; Giordano, Braden C.; Rose-Pehrsson, Susan L.

2014-01-01

The direct liquid deposition of solution standards onto sorbent-filled thermal desorption tubes is used for the quantitative analysis of trace explosive vapor samples. The direct liquid deposition method yields a higher fidelity between the analysis of vapor samples and the analysis of solution standards than using separate injection methods for vapors and solutions, i.e., samples collected on vapor collection tubes and standards prepared in solution vials. Additionally, the method can account for instrumentation losses, which makes it ideal for minimizing variability and quantitative trace chemical detection. Gas chromatography with an electron capture detector is an instrumentation configuration sensitive to nitro-energetics, such as TNT and RDX, due to their relatively high electron affinity. However, vapor quantitation of these compounds is difficult without viable vapor standards. Thus, we eliminate the requirement for vapor standards by combining the sensitivity of the instrumentation with a direct liquid deposition protocol to analyze trace explosive vapor samples. PMID:25145416

Quantitative detection of trace explosive vapors by programmed temperature desorption gas chromatography-electron capture detector.

PubMed

Field, Christopher R; Lubrano, Adam; Woytowitz, Morgan; Giordano, Braden C; Rose-Pehrsson, Susan L

2014-07-25

The direct liquid deposition of solution standards onto sorbent-filled thermal desorption tubes is used for the quantitative analysis of trace explosive vapor samples. The direct liquid deposition method yields a higher fidelity between the analysis of vapor samples and the analysis of solution standards than using separate injection methods for vapors and solutions, i.e., samples collected on vapor collection tubes and standards prepared in solution vials. Additionally, the method can account for instrumentation losses, which makes it ideal for minimizing variability and quantitative trace chemical detection. Gas chromatography with an electron capture detector is an instrumentation configuration sensitive to nitro-energetics, such as TNT and RDX, due to their relatively high electron affinity. However, vapor quantitation of these compounds is difficult without viable vapor standards. Thus, we eliminate the requirement for vapor standards by combining the sensitivity of the instrumentation with a direct liquid deposition protocol to analyze trace explosive vapor samples.

Characteristic length of the knotting probability revisited

NASA Astrophysics Data System (ADS)

Uehara, Erica; Deguchi, Tetsuo

2015-09-01

We present a self-avoiding polygon (SAP) model for circular DNA in which the radius of impermeable cylindrical segments corresponds to the screening length of double-stranded DNA surrounded by counter ions. For the model we evaluate the probability for a generated SAP with N segments having a given knot K through simulation. We call it the knotting probability of a knot K with N segments for the SAP model. We show that when N is large the most significant factor in the knotting probability is given by the exponentially decaying part exp(-N/NK), where the estimates of parameter NK are consistent with the same value for all the different knots we investigated. We thus call it the characteristic length of the knotting probability. We give formulae expressing the characteristic length as a function of the cylindrical radius rex, i.e. the screening length of double-stranded DNA.

Capturing relativistic wakefield structures in plasmas using ultrashort high-energy electrons as a probe

DOE PAGES

Zhang, C. J.; Hua, J. F.; Xu, X. L.; ...

2016-07-11

A new method capable of capturing coherent electric field structures propagating at nearly the speed of light in plasma with a time resolution as small as a few femtoseconds is proposed. This method uses a few femtoseconds long relativistic electron bunch to probe the wake produced in a plasma by an intense laser pulse or an ultra-short relativistic charged particle beam. As the probe bunch traverses the wake, its momentum is modulated by the electric field of the wake, leading to a density variation of the probe after free-space propagation. This variation of probe density produces a snapshot of themore » wake that can directly give many useful information of the wake structure and its evolution. Furthermore, this snapshot allows detailed mapping of the longitudinal and transverse components of the wakefield. We develop a theoretical model for field reconstruction and verify it using 3-dimensional particle-in-cell (PIC) simulations. This model can accurately reconstruct the wakefield structure in the linear regime, and it can also qualitatively map the major features of nonlinear wakes. As a result, the capturing of the injection in a nonlinear wake is demonstrated through 3D PIC simulations as an example of the application of this new method.« less

Assessing tiger population dynamics using photographic capture-recapture sampling

USGS Publications Warehouse

Karanth, K.U.; Nichols, J.D.; Kumar, N.S.; Hines, J.E.

2006-01-01

Although wide-ranging, elusive, large carnivore species, such as the tiger, are of scientific and conservation interest, rigorous inferences about their population dynamics are scarce because of methodological problems of sampling populations at the required spatial and temporal scales. We report the application of a rigorous, noninvasive method for assessing tiger population dynamics to test model-based predictions about population viability. We obtained photographic capture histories for 74 individual tigers during a nine-year study involving 5725 trap-nights of effort. These data were modeled under a likelihood-based, ?robust design? capture?recapture analytic framework. We explicitly modeled and estimated ecological parameters such as time-specific abundance, density, survival, recruitment, temporary emigration, and transience, using models that incorporated effects of factors such as individual heterogeneity, trap-response, and time on probabilities of photo-capturing tigers. The model estimated a random temporary emigration parameter of =K' =Y' 0.10 ? 0.069 (values are estimated mean ? SE). When scaled to an annual basis, tiger survival rates were estimated at S = 0.77 ? 0.051, and the estimated probability that a newly caught animal was a transient was = 0.18 ? 0.11. During the period when the sampled area was of constant size, the estimated population size Nt varied from 17 ? 1.7 to 31 ? 2.1 tigers, with a geometric mean rate of annual population change estimated as = 1.03 ? 0.020, representing a 3% annual increase. The estimated recruitment of new animals, Bt, varied from 0 ? 3.0 to 14 ? 2.9 tigers. Population density estimates, D, ranged from 7.33 ? 0.8 tigers/100 km2 to 21.73 ? 1.7 tigers/100 km2 during the study. Thus, despite substantial annual losses and temporal variation in recruitment, the tiger density remained at relatively high levels in Nagarahole. Our results are consistent with the hypothesis that protected wild tiger populations can remain

Low-temperature electronic transport in single K(0.27)MnO(2)·0.5H(2)O nanowires: enhanced electron-electron interaction.

PubMed

Long, Y Z; Yin, Z H; Chen, Z J; Jin, A Z; Gu, C Z; Zhang, H T; Chen, X H

2008-05-28

The current-voltage (I-V) characteristics and electrical resistivity of isolated potassium manganese oxide (K(0.27)MnO(2)·0.5H(2)O) nanowires prepared by a simple hydrothermal method were investigated over a wide temperature range from 300 to 4 K. With lowering temperature, a transition from linear to nonlinear I-V curves was observed around 50 K, and a clear zero bias anomaly (i.e., Coulomb gap-like structure) appeared on the differential conductance (dI/dV) curves, possibly due to enhanced electron-electron interaction at low temperatures. The temperature dependence of resistivity, [Formula: see text], follows the Efros-Shklovskii (ES) law, as expected in the presence of a Coulomb gap. Here we note that both the ES law and Coulomb blockade can in principle lead to a reduced zero bias conductance at low temperatures; in this study we cannot exclude the possibility of Coulomb-blockade transport in the measured nanowires, especially in the low-temperature range. It is still an open question how to pin down the origin of the observed reduction to a Coulomb gap (ES law) or Coulomb blockade.

Capture and Emission of Charge Carriers by Quantum Well

NASA Astrophysics Data System (ADS)

Davydov, V. N.; Karankevich, O. A.

2018-06-01

The interaction of electrons from the conduction band of the barrier layer of a LED heterostructure with the quantum well size-quantization level described by the capture time and emission time of charge carriers is considered. Relaxation of an excess energy upon capture and emission of charge carriers occurs as a result of their collisions with phonons of the quantum well substance and the "barrier layer-quantum well" interface. Analytical expressions are obtained for the interaction times, taking into account the depth of the sizequantization level, involved in the interaction with electrons, and the width of the well. Numerical estimates show that in real conditions, the capture time is shorter than the emission time, and this difference increases with increasing depth of the level. At shallow depths, the capture and emission times are comparable.

A vortex line for K-shell ionization of a carbon atom by electron impact

NASA Astrophysics Data System (ADS)

Ward, S. J.; Macek, J. H.

2014-10-01

We obtained using the Coulomb-Born approximation a deep minimum in the TDCS for K-shell ionization of a carbon atom by electron impact for the electron ejected in the scattering plane. The minimum is obtained for the kinematics of the energy of incident electron Ei = 1801.2 eV, the scattering angle θf = 4°, the energy of the ejected electron Ek = 5 . 5 eV, and the angle for the ejected electron θk = 239°. This minimum is due to a vortex in the velocity field. At the position of the vortex, the nodal lines of Re [ T ] and Im [ T ] intersect. We decomposed the CB1 T-matrix into its multipole components for the kinematics of a vortex, taking the z'-axis parallel to the direction of the momentum transfer vector. The m = +/- 1 dipole components are necessary to obtain a vortex. We also considered the electron to be ejected out of the scattering plane and obtained the positions of the vortex for different values of the y-component of momentum of the ejected electron, ky. We constructed the vortex line for the kinematics of Ei = 1801.2 eV and θf = 4°. S.J.W. and J.H.M. acknowledge support from NSF under Grant No. PHYS- 0968638 and from D.O.E. under Grant Number DE-FG02-02ER15283, respectively.

Brick tunnel randomization and the momentum of the probability mass.

PubMed

Kuznetsova, Olga M

2015-12-30

The allocation space of an unequal-allocation permuted block randomization can be quite wide. The development of unequal-allocation procedures with a narrower allocation space, however, is complicated by the need to preserve the unconditional allocation ratio at every step (the allocation ratio preserving (ARP) property). When the allocation paths are depicted on the K-dimensional unitary grid, where allocation to the l-th treatment is represented by a step along the l-th axis, l = 1 to K, the ARP property can be expressed in terms of the center of the probability mass after i allocations. Specifically, for an ARP allocation procedure that randomizes subjects to K treatment groups in w1 :⋯:wK ratio, w1 +⋯+wK =1, the coordinates of the center of the mass are (w1 i,…,wK i). In this paper, the momentum with respect to the center of the probability mass (expected imbalance in treatment assignments) is used to compare ARP procedures in how closely they approximate the target allocation ratio. It is shown that the two-arm and three-arm brick tunnel randomizations (BTR) are the ARP allocation procedures with the tightest allocation space among all allocation procedures with the same allocation ratio; the two-arm BTR is the minimum-momentum two-arm ARP allocation procedure. Resident probabilities of two-arm and three-arm BTR are analytically derived from the coordinates of the center of the probability mass; the existence of the respective transition probabilities is proven. Probability of deterministic assignments with BTR is found generally acceptable. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

Pulsed electron beam propagation in gases under pressure of 6.6 kPa in drift tube

NASA Astrophysics Data System (ADS)

Kholodnaya, G. E.; Sazonov, R. V.; Ponomarev, D. V.; Remnev, G. E.; Poloskov, A. V.

2017-02-01

This paper presents the results of an investigation of pulsed electron beam transport propagated in a drift tube filled with different gases (He, H2, N2, Ar, SF6, and CO2). The total pressure in the drift tube was 6.6 kPa. The experiments were carried out using a TEA-500 pulsed electron accelerator. The electron beam was propagated in the drift tube composed of two sections equipped with reverse current shunts. Under a pressure of 6.6 kPa, the maximum value of the electron beam charge closed on the walls of the drift tube was recorded when the beam was propagated in hydrogen and carbon dioxide. The minimum value of the electron beam charge closed on the walls of the drift tube was recorded for sulfur hexafluoride. The visualization of the pulsed electron beam energy losses onto the walls of the drift chamber was carried out using radiation-sensitive film.

The Knowledge Program: an Innovative, Comprehensive Electronic Data Capture System and Warehouse

PubMed Central

Katzan, Irene; Speck, Micheal; Dopler, Chris; Urchek, John; Bielawski, Kay; Dunphy, Cheryl; Jehi, Lara; Bae, Charles; Parchman, Alandra

2011-01-01

Data contained in the electronic health record (EHR) present a tremendous opportunity to improve quality-of-care and enhance research capabilities. However, the EHR is not structured to provide data for such purposes: most clinical information is entered as free text and content varies substantially between providers. Discrete information on patients’ functional status is typically not collected. Data extraction tools are often unavailable. We have developed the Knowledge Program (KP), a comprehensive initiative to improve the collection of discrete clinical information into the EHR and the retrievability of data for use in research, quality, and patient care. A distinct feature of the KP is the systematic collection of patient-reported outcomes, which is captured discretely, allowing more refined analyses of care outcomes. The KP capitalizes on features of the Epic EHR and utilizes an external IT infrastructure distinct from Epic for enhanced functionality. Here, we describe the development and implementation of the KP. PMID:22195124

Kinetic energy of shakeoff atomic electrons from 37K β+ decay

NASA Astrophysics Data System (ADS)

Behr, J. A.; Gorelov, A.; Farfan, C.; Smale, S.; Olchanski, K.; Kurchananov, L.; Anholm, M.; Behling, R. S.; Fenker, B.; Shidling, P. D.; Mehlman, M.; Melconian, D.; Ashery, D.; Gwinner, G.; Trinat Collaboration

2013-10-01

We have measured the kinetic energies from 0 to 30 eV of atomic shakeoff electrons from the β+ decay of 37K. Despite much experimental and theoretical work on the distribution of final ion charge states, shakeoff electrons from β- decay have only been measured with energies above 150 eV [Mitrokhovich, Nucl. Phys. Atom. Energy, 11, 125 (2010)]. We use our magneto-optical trap's time-varying magnetic quadrupole field combined with a uniform electric field as a spectrometer. Our result has more 15 eV electrons than a model using the sudden approximation and hydrogenic wavefunctions [Levinger, Phys. Rev. 90, 11 (1958)]. The total energy carried away by electrons is, as expected, a negligible correction to superallowed Ft values. Understanding the energy of these low-energy electrons is important for their use in precision β decay to select events coming from trapped atoms and start time-of-flight for the recoil ions. Our results could provide a benchmark for shakeoff electron calculations used for biological radiation damage [Lee, Comp. Math. Meth in Medicine doi:10.1155/2012/651475]. Support: NSERC, NRC through TRIUMF, DOE ER41747 ER40773, State of Texas, Israel Science Foundation.

Probability Theory Plus Noise: Descriptive Estimation and Inferential Judgment.

PubMed

Costello, Fintan; Watts, Paul

2018-01-01

We describe a computational model of two central aspects of people's probabilistic reasoning: descriptive probability estimation and inferential probability judgment. This model assumes that people's reasoning follows standard frequentist probability theory, but it is subject to random noise. This random noise has a regressive effect in descriptive probability estimation, moving probability estimates away from normative probabilities and toward the center of the probability scale. This random noise has an anti-regressive effect in inferential judgement, however. These regressive and anti-regressive effects explain various reliable and systematic biases seen in people's descriptive probability estimation and inferential probability judgment. This model predicts that these contrary effects will tend to cancel out in tasks that involve both descriptive estimation and inferential judgement, leading to unbiased responses in those tasks. We test this model by applying it to one such task, described by Gallistel et al. ). Participants' median responses in this task were unbiased, agreeing with normative probability theory over the full range of responses. Our model captures the pattern of unbiased responses in this task, while simultaneously explaining systematic biases away from normatively correct probabilities seen in other tasks. Copyright © 2018 Cognitive Science Society, Inc.

Distorted-wave methods for electron capture in ion-atom collisions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burgdoerfer, J.; Taulbjerg, K.

1986-05-01

Distorted-wave methods for electron capture are discussed with emphasis on the surface term in the T matrix and on the properties of the associated integral equations. The surface term is generally nonvanishing if the distorted waves are sufficiently accurate to include parts of the considered physical process. Two examples are considered in detail. If distorted waves of the strong-potential Born-approximation (SPB) type are employed the surface term supplies the first-Born-approximation part of the T matrix. The surface term is shown to vanish in the continuum-distorted-wave (CDW) method. The integral kernel is in either case free of the dangerous disconnected termsmore » discussed by Greider and Dodd but the CDW theory is peculiar in the sense that its first-order approximation (CDW1) excludes a specific on-shell portion of the double-scattering term that is closely connected with the classical Thomas process. The latter is described by the second-order term in the CDW series. The distorted-wave Born approximation with SPB waves is shown to be free of divergences. In the limit of asymmetric collisions the DWB suggests a modification of the SPB approximation to avoid the divergence problem recently identified by Dewangan and Eichler.« less

A goodness-of-fit test for capture-recapture model M(t) under closure

USGS Publications Warehouse

Stanley, T.R.; Burnham, K.P.

1999-01-01

A new, fully efficient goodness-of-fit test for the time-specific closed-population capture-recapture model M(t) is presented. This test is based on the residual distribution of the capture history data given the maximum likelihood parameter estimates under model M(t), is partitioned into informative components, and is based on chi-square statistics. Comparison of this test with Leslie's test (Leslie, 1958, Journal of Animal Ecology 27, 84- 86) for model M(t), using Monte Carlo simulations, shows the new test generally outperforms Leslie's test. The new test is frequently computable when Leslie's test is not, has Type I error rates that are closer to nominal error rates than Leslie's test, and is sensitive to behavioral variation and heterogeneity in capture probabilities. Leslie's test is not sensitive to behavioral variation in capture probabilities but, when computable, has greater power to detect heterogeneity than the new test.

Quantum probability and conceptual combination in conjunctions.

PubMed

Hampton, James A

2013-06-01

I consider the general problem of category conjunctions in the light of Pothos & Busemeyer (P&B)'s quantum probability (QP) account of the conjunction fallacy. I argue that their account as presented cannot capture the "guppy effect" - the case in which a class is a better member of a conjunction A^B than it is of either A or B alone.

Modelling the probability of ionospheric irregularity occurrence over African low latitude region

NASA Astrophysics Data System (ADS)

Mungufeni, Patrick; Jurua, Edward; Bosco Habarulema, John; Anguma Katrini, Simon

2015-06-01

This study presents models of geomagnetically quiet time probability of occurrence of ionospheric irregularities over the African low latitude region. GNSS-derived ionospheric total electron content data from Mbarara, Uganda (0.60°S, 30.74°E, geographic, 10.22°S, magnetic) and Libreville, Gabon (0.35°N, 9.68°E, geographic, 8.05°S, magnetic) during the period 2001-2012 were used. First, we established the rate of change of total electron content index (ROTI) value associated with background ionospheric irregularity over the region. This was done by analysing GNSS carrier-phases at L-band frequencies L1 and L2 with the aim of identifying cycle slip events associated with ionospheric irregularities. We identified at both stations a total of 699 events of cycle slips. The corresponding median ROTI value at the epochs of the cycle slip events was 0.54 TECU/min. The probability of occurrence of ionospheric irregularities associated with ROTI ≥ 0.5 TECU / min was then modelled by fitting cubic B-splines to the data. The aspects the model captured included diurnal, seasonal, and solar flux dependence patterns of the probability of occurrence of ionospheric irregularities. The model developed over Mbarara was validated with data over Mt. Baker, Uganda (0.35°N, 29.90°E, geographic, 9.25°S, magnetic), Kigali, Rwanda (1.94°S, 30.09°E, geographic, 11.62°S, magnetic), and Kampala, Uganda (0.34°N, 32.60°E, geographic, 9.29°S, magnetic). For the period validated at Mt. Baker (approximately, 137.64 km, north west), Kigali (approximately, 162.42 km, south west), and Kampala (approximately, 237.61 km, north east) the percentages of the number of errors (difference between the observed and the modelled probability of occurrence of ionospheric irregularity) less than 0.05 are 97.3, 89.4, and 81.3, respectively.

Capture-recapture studies for multiple strata including non-markovian transitions

USGS Publications Warehouse

Brownie, C.; Hines, J.E.; Nichols, J.D.; Pollock, K.H.; Hestbeck, J.B.

1993-01-01

We consider capture-recapture studies where release and recapture data are available from each of a number of strata on every capture occasion. Strata may, for example, be geographic locations or physiological states. Movement of animals among strata occurs with unknown probabilities, and estimation of these unknown transition probabilities is the objective. We describe a computer routine for carrying out the analysis under a model that assumes Markovian transitions and under reduced parameter versions of this model. We also introduce models that relax the Markovian assumption and allow 'memory' to operate (i.e., allow dependence of the transition probabilities on the previous state). For these models, we sugg st an analysis based on a conditional likelihood approach. Methods are illustrated with data from a large study on Canada geese (Branta canadensis) banded in three geographic regions. The assumption of Markovian transitions is rejected convincingly for these data, emphasizing the importance of the more general models that allow memory.

Hydrogeologic Unit Flow Characterization Using Transition Probability Geostatistics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jones, N L; Walker, J R; Carle, S F

2003-11-21

This paper describes a technique for applying the transition probability geostatistics method for stochastic simulation to a MODFLOW model. Transition probability geostatistics has several advantages over traditional indicator kriging methods including a simpler and more intuitive framework for interpreting geologic relationships and the ability to simulate juxtapositional tendencies such as fining upwards sequences. The indicator arrays generated by the transition probability simulation are converted to layer elevation and thickness arrays for use with the new Hydrogeologic Unit Flow (HUF) package in MODFLOW 2000. This makes it possible to preserve complex heterogeneity while using reasonably sized grids. An application of themore » technique involving probabilistic capture zone delineation for the Aberjona Aquifer in Woburn, Ma. is included.« less

Estimating survival and breeding probability for pond-breeding amphibians: a modified robust design

USGS Publications Warehouse

Bailey, L.L.; Kendall, W.L.; Church, D.R.; Wilbur, H.M.

2004-01-01

Many studies of pond-breeding amphibians involve sampling individuals during migration to and from breeding habitats. Interpreting population processes and dynamics from these studies is difficult because (1) only a proportion of the population is observable each season, while an unknown proportion remains unobservable (e.g., non-breeding adults) and (2) not all observable animals are captured. Imperfect capture probability can be easily accommodated in capture?recapture models, but temporary transitions between observable and unobservable states, often referred to as temporary emigration, is known to cause problems in both open- and closed-population models. We develop a multistate mark?recapture (MSMR) model, using an open-robust design that permits one entry and one exit from the study area per season. Our method extends previous temporary emigration models (MSMR with an unobservable state) in two ways. First, we relax the assumption of demographic closure (no mortality) between consecutive (secondary) samples, allowing estimation of within-pond survival. Also, we add the flexibility to express survival probability of unobservable individuals (e.g., ?non-breeders?) as a function of the survival probability of observable animals while in the same, terrestrial habitat. This allows for potentially different annual survival probabilities for observable and unobservable animals. We apply our model to a relictual population of eastern tiger salamanders (Ambystoma tigrinum tigrinum). Despite small sample sizes, demographic parameters were estimated with reasonable precision. We tested several a priori biological hypotheses and found evidence for seasonal differences in pond survival. Our methods could be applied to a variety of pond-breeding species and other taxa where individuals are captured entering or exiting a common area (e.g., spawning or roosting area, hibernacula).

Domestic wells have high probability of pumping septic tank leachate

NASA Astrophysics Data System (ADS)

Horn, J. E.; Harter, T.

2011-06-01

Onsite wastewater treatment systems such as septic systems are common in rural and semi-rural areas around the world; in the US, about 25-30 % of households are served by a septic system and a private drinking water well. Site-specific conditions and local groundwater flow are often ignored when installing septic systems and wells. Particularly in areas with small lots, thus a high septic system density, these typically shallow wells are prone to contamination by septic system leachate. Typically, mass balance approaches are used to determine a maximum septic system density that would prevent contamination of the aquifer. In this study, we estimate the probability of a well pumping partially septic system leachate. A detailed groundwater and transport model is used to calculate the capture zone of a typical drinking water well. A spatial probability analysis is performed to assess the probability that a capture zone overlaps with a septic system drainfield depending on aquifer properties, lot and drainfield size. We show that a high septic system density poses a high probability of pumping septic system leachate. The hydraulic conductivity of the aquifer has a strong influence on the intersection probability. We conclude that mass balances calculations applied on a regional scale underestimate the contamination risk of individual drinking water wells by septic systems. This is particularly relevant for contaminants released at high concentrations, for substances which experience limited attenuation, and those being harmful even in low concentrations.

Exploratory investigations of hypervelocity intact capture spectroscopy

NASA Technical Reports Server (NTRS)

Tsou, P.; Griffiths, D. J.

1993-01-01

The ability to capture hypervelocity projectiles intact opens a new technique available for hypervelocity research. A determination of the reactions taking place between the projectile and the capture medium during the process of intact capture is extremely important to an understanding of the intact capture phenomenon, to improving the capture technique, and to developing a theory describing the phenomenon. The intact capture of hypervelocity projectiles by underdense media generates spectra, characteristic of the material species of projectile and capture medium involved. Initial exploratory results into real-time characterization of hypervelocity intact capture techniques by spectroscopy include ultra-violet and visible spectra obtained by use of reflecting gratings, transmitting gratings, and prisms, and recorded by photographic and electronic means. Spectrometry proved to be a valuable real-time diagnostic tool for hypervelocity intact capture events, offering understanding of the interactions of the projectile and the capture medium during the initial period and providing information not obtainable by other characterizations. Preliminary results and analyses of spectra produced by the intact capture of hypervelocity aluminum spheres in polyethylene (PE), polystyrene (PS), and polyurethane (PU) foams are presented. Included are tentative emission species identifications, as well as gray body temperatures produced in the intact capture process.

Water Capture Device Signal Integration Board

NASA Technical Reports Server (NTRS)

Chamberlin, Kathryn J.; Hartnett, Andrew J.

2018-01-01

I am a junior in electrical engineering at Arizona State University, and this is my second internship at Johnson Space Center. I am an intern in the Command and Data Handling Branch of Avionics Division (EV2), my previous internship was also in EV2. During my previous internship I was assigned to the Water Capture Device payload, where I designed a prototype circuit board for the electronics system of the payload. For this internship, I have come back to the Water Capture Device project to further the work on the electronics design I completed previously. The Water Capture Device is an experimental payload to test the functionality of two different phase separators aboard the International Space Station (ISS). A phase separator sits downstream of a condensing heat exchanger (CHX) and separates the water from the air particles for environmental control on the ISS. With changing CHX technology, new phase separators are required. The goal of the project is to develop a test bed for the two phase separators to determine the best solution.

Electron capture by U(91+) and U(92+) and ionization of U(90+) and U(91+)

NASA Technical Reports Server (NTRS)

Gould, H.; Greiner, D.; Lindstrom, P.; Symons, T. J. M.; Crawford, H.

1984-01-01

U(92+)/U(91+) and U(91+)/U(90+) electron-capture and ionization cross sections and equilibrium charge-state distributions are measured experimentally in mylar, Cu and Ta of varying thickness. Relativistic U(68+) ions at 437 or 962 MeV/nucleon are produced by a heavy-ion linear accelerator and synchrotron in tandem and passed through the target material into a magnetic specrometer and position-sensitive proportional counter for evaluation of charge states. The results are presented graphically and discussed. At 962 MeV/nucleon, beams containing 85 percent bare U(92+) nuclei are obtained using 150-mg/sq cm Cu or 85-mg/sq cm Ta; at 437 MeV/nucleon, 50 percent bare U(92+) nuclei are obtained with 90-mg/sq cm Cu. The techniques decribed can be applied to produce beams of bare U nuclei for acceleration to ultrarelativistic speeds or beams of few-electron U for atomic-physics experiments on quantum electrodynamics.

High Dynamic Range Pixel Array Detector for Scanning Transmission Electron Microscopy.

PubMed

Tate, Mark W; Purohit, Prafull; Chamberlain, Darol; Nguyen, Kayla X; Hovden, Robert; Chang, Celesta S; Deb, Pratiti; Turgut, Emrah; Heron, John T; Schlom, Darrell G; Ralph, Daniel C; Fuchs, Gregory D; Shanks, Katherine S; Philipp, Hugh T; Muller, David A; Gruner, Sol M

2016-02-01

We describe a hybrid pixel array detector (electron microscope pixel array detector, or EMPAD) adapted for use in electron microscope applications, especially as a universal detector for scanning transmission electron microscopy. The 128×128 pixel detector consists of a 500 µm thick silicon diode array bump-bonded pixel-by-pixel to an application-specific integrated circuit. The in-pixel circuitry provides a 1,000,000:1 dynamic range within a single frame, allowing the direct electron beam to be imaged while still maintaining single electron sensitivity. A 1.1 kHz framing rate enables rapid data collection and minimizes sample drift distortions while scanning. By capturing the entire unsaturated diffraction pattern in scanning mode, one can simultaneously capture bright field, dark field, and phase contrast information, as well as being able to analyze the full scattering distribution, allowing true center of mass imaging. The scattering is recorded on an absolute scale, so that information such as local sample thickness can be directly determined. This paper describes the detector architecture, data acquisition system, and preliminary results from experiments with 80-200 keV electron beams.

Examination of the possible enhancement of neutrinoless double-electron capture in 78Kr

NASA Astrophysics Data System (ADS)

Bustabad, S.; Bollen, G.; Brodeur, M.; Lincoln, D. L.; Novario, S. J.; Redshaw, M.; Ringle, R.; Schwarz, S.

2013-09-01

Penning-trap mass spectrometry was used at the Low-Energy Beam and Ion Trap (LEBIT) facility at the National Superconducting Cyclotron Laboratory (NSCL) to investigate 78Kr, a candidate for resonantly enhanced neutrinoless double-electron capture (0νECEC). The newly determined Q value of 2847.75 (27) keV is 1.4 keV greater than the value from the most recent atomic mass evaluation [Chin. Phys. C1674-113710.1088/1674-1137/36/12/003 36, 1603 (2012)], a change of two sigma, and the uncertainty has been reduced by a factor of three. The change in the Q value shifts allowed 0νECEC in 78Kr further from resonant enhancement. With the improved determination of the Q value, all known excited states can now be confidently excluded from possible 78Se candidates that could lead to resonantly enhanced 0νECEC.

fatalityCMR: capture-recapture software to correct raw counts of wildlife fatalities using trial experiments for carcass detection probability and persistence time

USGS Publications Warehouse

Peron, Guillaume; Hines, James E.

2014-01-01

Many industrial and agricultural activities involve wildlife fatalities by collision, poisoning or other involuntary harvest: wind turbines, highway network, utility network, tall structures, pesticides, etc. Impacted wildlife may benefit from official protection, including the requirement to monitor the impact. Carcass counts can often be conducted to quantify the number of fatalities, but they need to be corrected for carcass persistence time (removal by scavengers and decay) and detection probability (searcher efficiency). In this article we introduce a new piece of software that fits a superpopulation capture-recapture model to raw count data. It uses trial data to estimate detection and daily persistence probabilities. A recurrent issue is that fatalities of rare, protected species are infrequent, in which case the software offers the option to switch to an ‘evidence of absence’ mode, i.e., estimate the number of carcasses that may have been missed by field crews. The software allows distinguishing between different turbine types (e.g. different vegetation cover under turbines, or different technical properties), as well between two carcass age-classes or states, with transition between those classes (e.g, fresh and dry). There is a data simulation capacity that may be used at the planning stage to optimize sampling design. Resulting mortality estimates can be used 1) to quantify the required amount of compensation, 2) inform mortality projections for proposed development sites, and 3) inform decisions about management of existing sites.

Capillary atmospheric pressure electron capture ionization (cAPECI): a highly efficient ionization method for nitroaromatic compounds.

PubMed

Derpmann, Valerie; Mueller, David; Bejan, Iustinian; Sonderfeld, Hannah; Wilberscheid, Sonja; Koppmann, Ralf; Brockmann, Klaus J; Benter, Thorsten

2014-03-01

We report on a novel method for atmospheric pressure ionization of compounds with elevated electron affinity (e.g., nitroaromatic compounds) or gas phase acidity (e.g., phenols), respectively. The method is based on the generation of thermal electrons by the photo-electric effect, followed by electron capture of oxygen when air is the gas matrix yielding O2(-) or of the analyte directly with nitrogen as matrix. Charge transfer or proton abstraction by O2(-) leads to the ionization of the analytes. The interaction of UV-light with metals is a clean method for the generation of thermal electrons at atmospheric pressure. Furthermore, only negative ions are generated and neutral radical formation is minimized, in contrast to discharge- or dopant assisted methods. Ionization takes place inside the transfer capillary of the mass spectrometer leading to comparably short transfer times of ions to the high vacuum region of the mass spectrometer. This strongly reduces ion transformation processes, resulting in mass spectra that more closely relate to the neutral analyte distribution. cAPECI is thus a soft and selective ionization method with detection limits in the pptV range. In comparison to standard ionization methods (e.g., PTR), cAPECI is superior with respect to both selectivity and achievable detection limits. cAPECI demonstrates to be a promising ionization method for applications in relevant fields as, for example, explosives detection and atmospheric chemistry.

Methods of analysis by the U.S. Geological Survey National Water Quality Laboratory; determination of chlorinated pesticides in aquatic tissue by capillary-column gas chromatography with electron-capture detection

USGS Publications Warehouse

Leiker, Thomas J.; Madsen, J.E.; Deacon, J.R.; Foreman, W.T.

1995-01-01

A method for the determination of chlorinated organic compounds in aquatic tissue by dual capillary-column gas chromatography with electron-capture detection is described. Whole-body-fish or corbicula tissue is homogenized, Soxhlet extracted, lipid removed by gel permeation chromatography, and fractionated using alumina/silica adsorption chromatography. The extracts are analyzed by dissimilar capillary-column gas chromatography with electron-capture detection. The method reporting limits are 5 micrograms per kilogram (μg/kg) for chlorinated compounds, 50 μg/kg for polychlorinated biphenyls, and 200 μg/kg for toxaphene.

The Role of Electronic Portfolios in the Hiring of K-12 Teachers

ERIC Educational Resources Information Center

Strawhecker, Jane; Messersmith, Ken; Balcom, Amanda

2008-01-01

This mixed-method study explored the perspectives of principals involved in the hiring process of K-12 teachers in one Midwestern state. Participants' survey data was used to examine the pros and cons of portfolios, to determine preferences in portfolio contents and electronic delivery method, and to investigate what predictors significantly…

Gamow-Teller strength and lepton captures rates on 66-71Ni in stellar matter

NASA Astrophysics Data System (ADS)

Nabi, Jameel-Un; Majid, Muhammad

Charge-changing transitions play a significant role in stellar weak-decay processes. The fate of the massive stars is decided by these weak-decay rates including lepton (positron and electron) captures rates, which play a consequential role in the dynamics of core collapse. As per previous simulation results, weak interaction rates on nickel (Ni) isotopes have significant influence on the stellar core vis-à-vis controlling the lepton content of stellar matter throughout the silicon shell burning phases of high mass stars up to the presupernova stages. In this paper, we perform a microscopic calculation of Gamow-Teller (GT) charge-changing transitions, in the β-decay and electron capture (EC) directions, for neutron-rich Ni isotopes (66-71Ni). We further compute the associated weak-decay rates for these selected Ni isotopes in stellar environment. The computations are accomplished by employing the deformed proton-neutron quasiparticle random phase approximation (pn-QRPA) model. A recent study showed that the deformed pn-QRPA theory is well suited for the estimation of GT transitions. The astral weak-decay rates are determined over densities in the range of 10-1011g/cm3 and temperatures in the range of 0.01 × 109-30 × 109K. The calculated lepton capture rates are compared with the previous calculation of Pruet and Fuller (PF). The overall comparison demonstrates that, at low stellar densities and high temperatures, our EC rates are bigger by as much as two orders of magnitude. Our results show that, at higher temperatures, the lepton capture rates are the dominant mode for the stellar weak rates and the corresponding lepton emission rates may be neglected.

Pre-combustion CO2 capture by transition metal ions embedded in phthalocyanine sheets

NASA Astrophysics Data System (ADS)

Lü, Kun; Zhou, Jian; Zhou, Le; Chen, X. S.; Chan, Siew Hwa; Sun, Qiang

2012-06-01

Transition metal (TM) embedded two-dimensional phthalocyanine (Pc) sheets have been recently synthesized in experiments [M. Abel, S. Clair, O. Ourdjini, M. Mossoyan, and L. Porte, J. Am. Chem. Soc. 133, 1203 (2010)], 10.1021/ja108628r, where the transition metal ions are uniformly distributed in porous structures, providing the possibility of capturing gas molecules. Using first principles and grand canonical Monte Carlo simulations, TMPc sheets (TM = Sc, Ti, and Fe) are studied for pre-combustion CO2 capture by considering the adsorptions of H2/CO2 gas mixtures. It is found that ScPc sheet shows a good selectivity for CO2, and the excess uptake capacity of single-component CO2 on ScPc sheet at 298 K and 50 bar is found to be 2949 mg/g, larger than that of any other reported porous materials. Furthermore, electrostatic potential and natural bond orbital analyses are performed to reveal the underlying interaction mechanisms, showing that electrostatic interactions as well as the donation and back donation of electrons between the transition metal ions and the CO2 molecules play a key role in the capture.

Electron-beam induced amorphization of stishovite: Silicon-coordination change observed using Si K-edge extended electron energy-loss fine structure

NASA Astrophysics Data System (ADS)

van Aken, P. A.; Sharp, T. G.; Seifert, F.

The analysis of the extended energy-loss fine structure (EXELFS) of the Si K-edge for sixfold-coordinated Si in synthetic stishovite and fourfold-coordinated Si in natural α-quartz is reported by using electron energy-loss spectroscopy (EELS) in combination with transmission electron microscopy (TEM). The stishovite Si K-edge EXELFS spectra were measured as a time-dependent series to document irradiation-induced amorphization. The amorphization was also investigated through the change in Si K- and O K-edge energy-loss near edge structure (ELNES). For α-quartz, in contrast to stishovite, electron irradiation-induced vitrification, verified by selected area electron diffraction (SAED), produced no detectable changes of the EXELFS. The Si K-edge EXELFS were analysed with the classical extended X-ray absorption fine structure (EXAFS) treatment and compared to ab initio curve-waved multiple-scattering (MS) calculations of EXAFS spectra for stishovite and α-quartz. Highly accurate information on the local atomic environment of the silicon atoms during the irradiation-induced amorphization of stishovite is obtained from the EXELFS structure parameters (Si-O bond distances, coordination numbers and Debye-Waller factors). The mean Si-O bond distance R and mean Si coordination number N changes from R=0.1775 nm and N=6 for stishovite through a disordered intermediate state (R 0.172 nm and N 5) to R 0.167 nm and N 4.5 for a nearly amorphous state similar to α-quartz (R=0.1609 nm and N=4). During the amorphization process, the Debye-Waller factor (DWF) passes through a maximum value of as it changes from for sixfold to for fourfold coordination of Si. This increase in Debye-Waller factor indicates an increase in mean-square relative displacement (MSRD) between the central silicon atom and its oxygen neighbours that is consistent with the presence of an intermediate structural state with fivefold coordination of Si. The distribution of coordination states can be estimated by

A mobile trauma database with charge capture.

PubMed

Moulton, Steve; Myung, Dan; Chary, Aron; Chen, Joshua; Agarwal, Suresh; Emhoff, Tim; Burke, Peter; Hirsch, Erwin

2005-11-01

Charge capture plays an important role in every surgical practice. We have developed and merged a custom mobile database (DB) system with our trauma registry (TRACS), to better understand our billing methods, revenue generators, and areas for improved revenue capture. The mobile database runs on handheld devices using the Windows Compact Edition platform. The front end was written in C# and the back end is SQL. The mobile database operates as a thick client; it includes active and inactive patient lists, billing screens, hot pick lists, and Current Procedural Terminology and International Classification of Diseases, Ninth Revision code sets. Microsoft Information Internet Server provides secure data transaction services between the back ends stored on each device. Traditional, hand written billing information for three of five adult trauma surgeons was averaged over a 5-month period. Electronic billing information was then collected over a 3-month period using handheld devices and the subject software application. One surgeon used the software for all 3 months, and two surgeons used it for the latter 2 months of the electronic data collection period. This electronic billing information was combined with TRACS data to determine the clinical characteristics of the trauma patients who were and were not captured using the mobile database. Total charges increased by 135%, 148%, and 228% for each of the three trauma surgeons who used the mobile DB application. The majority of additional charges were for evaluation and management services. Patients who were captured and billed at the point of care using the mobile DB had higher Injury Severity Scores, were more likely to undergo an operative procedure, and had longer lengths of stay compared with those who were not captured. Total charges more than doubled using a mobile database to bill at the point of care. A subsequent comparison of TRACS data with billing information revealed a large amount of uncaptured patient

Time-resolved K α spectroscopy measurements of hot-electron equilibration dynamics in thin-foil solid targets: collisional and collective effects

NASA Astrophysics Data System (ADS)

Nilson, P. M.; Solodov, A. A.; Davies, J. R.; Theobald, W.; Mileham, C.; Stoeckl, C.; Begishev, I. A.; Zuegel, J. D.; Froula, D. H.; Betti, R.; Meyerhofer, D. D.

2015-11-01

Time-resolved K α spectroscopy measurements from high-intensity laser interactions with thin-foil solid targets are reviewed. Thin Cu foils were irradiated with 1-10 J, 1 ps pulses at focused intensities from 1018 to 1019 W cm-2. The experimental data show K α -emission pulse widths from 3 to 6 ps, increasing with laser intensity. The time-resolved K α -emission data are compared to a hot-electron transport and K α -production model that includes collisional electron-energy coupling, resistive heating, and electromagnetic field effects. The experimental data show good agreement with the model when a reduced ponderomotive scaling is used to describe the initial mean hot-electron energy over the relevant intensity range.

Improving inferences from fisheries capture-recapture studies through remote detection of PIT tags

USGS Publications Warehouse

Hewitt, David A.; Janney, Eric C.; Hayes, Brian S.; Shively, Rip S.

2010-01-01

Models for capture-recapture data are commonly used in analyses of the dynamics of fish and wildlife populations, especially for estimating vital parameters such as survival. Capture-recapture methods provide more reliable inferences than other methods commonly used in fisheries studies. However, for rare or elusive fish species, parameter estimation is often hampered by small probabilities of re-encountering tagged fish when encounters are obtained through traditional sampling methods. We present a case study that demonstrates how remote antennas for passive integrated transponder (PIT) tags can increase encounter probabilities and the precision of survival estimates from capture-recapture models. Between 1999 and 2007, trammel nets were used to capture and tag over 8,400 endangered adult Lost River suckers (Deltistes luxatus) during the spawning season in Upper Klamath Lake, Oregon. Despite intensive sampling at relatively discrete spawning areas, encounter probabilities from Cormack-Jolly-Seber models were consistently low (< 0.2) and the precision of apparent annual survival estimates was poor. Beginning in 2005, remote PIT tag antennas were deployed at known spawning locations to increase the probability of re-encountering tagged fish. We compare results based only on physical recaptures with results based on both physical recaptures and remote detections to demonstrate the substantial improvement in estimates of encounter probabilities (approaching 100%) and apparent annual survival provided by the remote detections. The richer encounter histories provided robust inferences about the dynamics of annual survival and have made it possible to explore more realistic models and hypotheses about factors affecting the conservation and recovery of this endangered species. Recent advances in technology related to PIT tags have paved the way for creative implementation of large-scale tagging studies in systems where they were previously considered impracticable.

Short-term capture of the Earth-Moon system

NASA Astrophysics Data System (ADS)

Qi, Yi; de Ruiter, Anton

2018-06-01

In this paper, the short-term capture (STC) of an asteroid in the Earth-Moon system is proposed and investigated. First, the space condition of STC is analysed and five subsets of the feasible region are defined and discussed. Then, the time condition of STC is studied by parameter scanning in the Sun-Earth-Moon-asteroid restricted four-body problem. Numerical results indicate that there is a clear association between the distributions of the time probability of STC and the five subsets. Next, the influence of the Jacobi constant on STC is examined using the space and time probabilities of STC. Combining the space and time probabilities of STC, we propose a STC index to evaluate the probability of STC comprehensively. Finally, three potential STC asteroids are found and analysed.

Double electron capture of {sup 106}Cd in the TGV-2 experiment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rukhadze, N. I.; Egorov, V. G.; Kovalik, A.

2015-10-28

A new experimental run of searching for EC/EC decay of {sup 106}Cd was performed at the Modane underground laboratory (4800 m w.e.) using the TGV-2 spectrometer and ∼23.2 g {sup 106}Cd with enrichment of 99.57%. The limit on 2νEC/EC decay of {sup 106}Cd - T{sub 1/2}(2νEC/EC) > 3.1×10{sup 20} y, at 90% C.L was obtained from the preliminary calculation of experimental data accumulated for 7018 h of measurement. The limits on the resonance neutrino-less double electron capture decay of {sup 106}Cd were obtained from the measurement of ∼23.2 g of {sup 106}Cd with the low-background HPGe spectrometer OBELIX lasted 395more » h - T{sub 1/2}(KL, 2741 keV) > 0.9×10{sup 20} y and T{sub 1/2}(KK, 2718 keV) > 1.4×10{sup 20} y at 90% C.L.« less

High-power electron beam tests of a liquid-lithium target and characterization study of (7)Li(p,n) near-threshold neutrons for accelerator-based boron neutron capture therapy.

PubMed

Halfon, S; Paul, M; Arenshtam, A; Berkovits, D; Cohen, D; Eliyahu, I; Kijel, D; Mardor, I; Silverman, I

2014-06-01

A compact Liquid-Lithium Target (LiLiT) was built and tested with a high-power electron gun at Soreq Nuclear Research Center (SNRC). The target is intended to demonstrate liquid-lithium target capabilities to constitute an accelerator-based intense neutron source for Boron Neutron Capture Therapy (BNCT) in hospitals. The lithium target will produce neutrons through the (7)Li(p,n)(7)Be reaction and it will overcome the major problem of removing the thermal power >5kW generated by high-intensity proton beams, necessary for sufficient therapeutic neutron flux. In preliminary experiments liquid lithium was flown through the target loop and generated a stable jet on the concave supporting wall. Electron beam irradiation demonstrated that the liquid-lithium target can dissipate electron power densities of more than 4kW/cm(2) and volumetric power density around 2MW/cm(3) at a lithium flow of ~4m/s, while maintaining stable temperature and vacuum conditions. These power densities correspond to a narrow (σ=~2mm) 1.91MeV, 3mA proton beam. A high-intensity proton beam irradiation (1.91-2.5MeV, 2mA) is being commissioned at the SARAF (Soreq Applied Research Accelerator Facility) superconducting linear accelerator. In order to determine the conditions of LiLiT proton irradiation for BNCT and to tailor the neutron energy spectrum, a characterization of near threshold (~1.91MeV) (7)Li(p,n) neutrons is in progress based on Monte-Carlo (MCNP and Geant4) simulation and on low-intensity experiments with solid LiF targets. In-phantom dosimetry measurements are performed using special designed dosimeters based on CR-39 track detectors. © 2013 Elsevier Ltd. All rights reserved.

Large Quantum Probability Backflow and the Azimuthal Angle-Angular Momentum Uncertainty Relation for an Electron in a Constant Magnetic Field

ERIC Educational Resources Information Center

Strange, P.

2012-01-01

In this paper we demonstrate a surprising aspect of quantum mechanics that is accessible to an undergraduate student. We discuss probability backflow for an electron in a constant magnetic field. It is shown that even for a wavepacket composed entirely of states with negative angular momentum the effective angular momentum can take on positive…

Time-resolved K α spectroscopy measurements of hot-electron equilibration dynamics in thin-foil solid targets: Collisional and collective effects

DOE PAGES

Nilson, P. M.; Solodov, A. A.; Davies, J. R.; ...

2015-09-25

Time-resolved K α spectroscopy measurements from high-intensity laser interactions with thin-foil solid targets are reviewed. Thin Cu foils were irradiated with 1- to 10-J, 1-ps pulses at focused intensities from 10 18 to 10 19 W/cm 2. The experimental data show K α-emission pulse widths from 3 to 6 ps, increasing with laser intensity. The time-resolved K α-emission data are compared to a hot-electron transport and K α-production model that includes collisional electron-energy coupling, resistive heating, and electromagnetic field effects. The experimental data show good agreement with the model when a reduced ponderomotive scaling is used to describe the initialmore » mean hot-electron energy over the relevant intensity range.« less

An asteroid breakup 160 Myr ago as the probable source of the K/T impactor.

PubMed

Bottke, William F; Vokrouhlický, David; Nesvorný, David

2007-09-06

The terrestrial and lunar cratering rate is often assumed to have been nearly constant over the past 3 Gyr. Different lines of evidence, however, suggest that the impact flux from kilometre-sized bodies increased by at least a factor of two over the long-term average during the past approximately 100 Myr. Here we argue that this apparent surge was triggered by the catastrophic disruption of the parent body of the asteroid Baptistina, which we infer was a approximately 170-km-diameter body (carbonaceous-chondrite-like) that broke up 160(-20)+30Myr ago in the inner main asteroid belt. Fragments produced by the collision were slowly delivered by dynamical processes to orbits where they could strike the terrestrial planets. We find that this asteroid shower is the most likely source (>90 per cent probability) of the Chicxulub impactor that produced the Cretaceous/Tertiary (K/T) mass extinction event 65 Myr ago.

Determination of nitrosourea compounds in brain tissue by gas chromatography and electron capture detection.

PubMed

Hassenbusch, S J; Colvin, O M; Anderson, J H

1995-07-01

A relatively simple, high-sensitivity gas chromatographic assay is described for nitrosourea compounds, such as BCNU [1,3-bis(2-chloroethyl)-1-nitrosourea] and MeCCNU [1-(2-chloroethyl)-3-(trans-4-methylcyclohexyl)-1-nitrosourea], in small biopsy samples of brain and other tissues. After extraction with ethyl acetate, secondary amines in BCNU and MeCCNU are derivatized with trifluoroacetic anhydride. Compounds are separated and quantitated by gas chromatography using a capillary column with temperature programming and an electron capture detector. Standard curves of BCNU indicate a coefficient of variance of 0.066 +/- 0.018, a correlation coefficient of 0.929, and an extraction efficiency from whole brain of 68% with a minimum detectable amount of 20 ng in 5-10 mg samples. The assay has been facile and sensitive in over 1000 brain biopsy specimens after intravenous and intraarterial infusions of BCNU.

Captures of Boll Weevils (Coleoptera: Curculionidae) in Relation to Trap Orientation and Distance From Brush Lines.

PubMed

Spurgeon, Dale W

2016-04-01

Eradication programs for the boll weevil (Anthonomus grandis grandis Boheman) rely on pheromone-baited traps to trigger insecticide treatments and monitor program progress. A key objective of monitoring in these programs is the timely detection of incipient weevil populations to limit or prevent re-infestation. Therefore, improvements in the effectiveness of trapping would enhance efforts to achieve and maintain eradication. Association of pheromone traps with woodlots and other prominent vegetation are reported to increase captures of weevils, but the spatial scale over which this effect occurs is unknown. The influences of trap distance (0, 10, and 20 m) and orientation (leeward or windward) to brush lines on boll weevil captures were examined during three noncropping seasons (October to February) in the Rio Grande Valley of Texas. Differences in numbers of captured weevils and in the probability of capture between traps at 10 or 20 m from brush, although often statistically significant, were generally small and variable. Variations in boll weevil population levels, wind directions, and wind speeds apparently contributed to this variability. In contrast, traps closely associated with brush (0 m) generally captured larger numbers of weevils, and offered a higher probability of weevil capture compared with traps away from brush. These increases in the probability of weevil capture were as high as 30%. Such increases in the ability of traps to detect low-level boll weevil populations indicate trap placement with respect to prominent vegetation is an important consideration in maximizing the effectiveness of trap-based monitoring for the boll weevil.

An RFID Indoor Positioning Algorithm Based on Bayesian Probability and K-Nearest Neighbor.

PubMed

Xu, He; Ding, Ye; Li, Peng; Wang, Ruchuan; Li, Yizhu

2017-08-05

The Global Positioning System (GPS) is widely used in outdoor environmental positioning. However, GPS cannot support indoor positioning because there is no signal for positioning in an indoor environment. Nowadays, there are many situations which require indoor positioning, such as searching for a book in a library, looking for luggage in an airport, emergence navigation for fire alarms, robot location, etc. Many technologies, such as ultrasonic, sensors, Bluetooth, WiFi, magnetic field, Radio Frequency Identification (RFID), etc., are used to perform indoor positioning. Compared with other technologies, RFID used in indoor positioning is more cost and energy efficient. The Traditional RFID indoor positioning algorithm LANDMARC utilizes a Received Signal Strength (RSS) indicator to track objects. However, the RSS value is easily affected by environmental noise and other interference. In this paper, our purpose is to reduce the location fluctuation and error caused by multipath and environmental interference in LANDMARC. We propose a novel indoor positioning algorithm based on Bayesian probability and K -Nearest Neighbor (BKNN). The experimental results show that the Gaussian filter can filter some abnormal RSS values. The proposed BKNN algorithm has the smallest location error compared with the Gaussian-based algorithm, LANDMARC and an improved KNN algorithm. The average error in location estimation is about 15 cm using our method.

Electron microprobe evaluation of terrestrial basalts for whole-rock K-Ar dating

USGS Publications Warehouse

Mankinen, E.A.; Brent, Dalrymple G.

1972-01-01

Four basalt samples for whole-rock K-Ar dating were analyzed with an electron microprobe to locate potassium concentrations. Highest concentrations of potassium were found in those mineral phases which were the last to crystallize. The two reliable samples had potassium concentrated in fine-grained interstitial feldspar and along grain boundaries of earlier formed plagioclase crystals. The two unreliable samples had potassium concentrated in the glassy matrix, demonstrating the ineffectiveness of basaltic glass as a retainer of radiogenic argon. In selecting basalt samples for whole-rock K-Ar dating, particular emphasis should be placed on determining the nature and condition of the fine-grained interstitial phases. ?? 1972.

Estimating reach-specific fish movement probabilities in rivers with a Bayesian state-space model: application to sea lamprey passage and capture at dams

USGS Publications Warehouse

Holbrook, Christopher M.; Johnson, Nicholas S.; Steibel, Juan P.; Twohey, Michael B.; Binder, Thomas R.; Krueger, Charles C.; Jones, Michael L.

2014-01-01

Improved methods are needed to evaluate barriers and traps for control and assessment of invasive sea lamprey (Petromyzon marinus) in the Great Lakes. A Bayesian state-space model provided reach-specific probabilities of movement, including trap capture and dam passage, for 148 acoustic tagged invasive sea lamprey in the lower Cheboygan River, Michigan, a tributary to Lake Huron. Reach-specific movement probabilities were combined to obtain estimates of spatial distribution and abundance needed to evaluate a barrier and trap complex for sea lamprey control and assessment. Of an estimated 21 828 – 29 300 adult sea lampreys in the river, 0%–2%, or 0–514 untagged lampreys, could have passed upstream of the dam, and 46%–61% were caught in the trap. Although no tagged lampreys passed above the dam (0/148), our sample size was not sufficient to consider the lock and dam a complete barrier to sea lamprey. Results also showed that existing traps are in good locations because 83%–96% of the population was vulnerable to existing traps. However, only 52%–69% of lampreys vulnerable to traps were caught, suggesting that traps can be improved. The approach used in this study was a novel use of Bayesian state-space models that may have broader applications, including evaluation of barriers for other invasive species (e.g., Asian carp (Hypophthalmichthys spp.)) and fish passage structures for other diadromous fishes.

Two-photon decay of K-shell vacancies in silver atoms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mokler, P.H.; University of Giessen, Giessen; Schaeffer, H.W.

2004-09-01

The spectral distributions for the two-photon decay modes of singly K-shell ionized silver atoms are determined by x-ray-x-ray coincidence measurements. Ag K-shell vacancies were induced by nuclear electron capture decay of radioactive cadmium isotopes {sup 109}Cd and two-photon coincidences were taken back to back (180 deg.) and at a 90 deg. opening angle for the emission. Each of the two-photon transitions from the 2s, 3s, and 3d states exhibits unique angular and spectral distributions. The measurements agree nicely with relativistic self-consistent field calculations of Tong et al. Our results also confirm and extend the earlier experimental data of Ilakovac andmore » co-workers with improved accuracy.« less

Tsunami probability in the Caribbean Region

USGS Publications Warehouse

Parsons, T.; Geist, E.L.

2008-01-01

We calculated tsunami runup probability (in excess of 0.5 m) at coastal sites throughout the Caribbean region. We applied a Poissonian probability model because of the variety of uncorrelated tsunami sources in the region. Coastlines were discretized into 20 km by 20 km cells, and the mean tsunami runup rate was determined for each cell. The remarkable ???500-year empirical record compiled by O'Loughlin and Lander (2003) was used to calculate an empirical tsunami probability map, the first of three constructed for this study. However, it is unclear whether the 500-year record is complete, so we conducted a seismic moment-balance exercise using a finite-element model of the Caribbean-North American plate boundaries and the earthquake catalog, and found that moment could be balanced if the seismic coupling coefficient is c = 0.32. Modeled moment release was therefore used to generate synthetic earthquake sequences to calculate 50 tsunami runup scenarios for 500-year periods. We made a second probability map from numerically-calculated runup rates in each cell. Differences between the first two probability maps based on empirical and numerical-modeled rates suggest that each captured different aspects of tsunami generation; the empirical model may be deficient in primary plate-boundary events, whereas numerical model rates lack backarc fault and landslide sources. We thus prepared a third probability map using Bayesian likelihood functions derived from the empirical and numerical rate models and their attendant uncertainty to weight a range of rates at each 20 km by 20 km coastal cell. Our best-estimate map gives a range of 30-year runup probability from 0 - 30% regionally. ?? irkhaueser 2008.

Spatial capture--recapture models for jointly estimating population density and landscape connectivity.

PubMed

Royle, J Andrew; Chandler, Richard B; Gazenski, Kimberly D; Graves, Tabitha A

2013-02-01

Population size and landscape connectivity are key determinants of population viability, yet no methods exist for simultaneously estimating density and connectivity parameters. Recently developed spatial capture--recapture (SCR) models provide a framework for estimating density of animal populations but thus far have not been used to study connectivity. Rather, all applications of SCR models have used encounter probability models based on the Euclidean distance between traps and animal activity centers, which implies that home ranges are stationary, symmetric, and unaffected by landscape structure. In this paper we devise encounter probability models based on "ecological distance," i.e., the least-cost path between traps and activity centers, which is a function of both Euclidean distance and animal movement behavior in resistant landscapes. We integrate least-cost path models into a likelihood-based estimation scheme for spatial capture-recapture models in order to estimate population density and parameters of the least-cost encounter probability model. Therefore, it is possible to make explicit inferences about animal density, distribution, and landscape connectivity as it relates to animal movement from standard capture-recapture data. Furthermore, a simulation study demonstrated that ignoring landscape connectivity can result in negatively biased density estimators under the naive SCR model.

Nonidentifiability of population size from capture-recapture data with heterogeneous detection probabilities

USGS Publications Warehouse

Link, W.A.

2003-01-01

Heterogeneity in detection probabilities has long been recognized as problematic in mark-recapture studies, and numerous models developed to accommodate its effects. Individual heterogeneity is especially problematic, in that reasonable alternative models may predict essentially identical observations from populations of substantially different sizes. Thus even with very large samples, the analyst will not be able to distinguish among reasonable models of heterogeneity, even though these yield quite distinct inferences about population size. The problem is illustrated with models for closed and open populations.

Mercury's capture into the 3/2 spin-orbit resonance as a result of its chaotic dynamics.

PubMed

Correia, Alexandre C M; Laskar, Jacques

2004-06-24

Mercury is locked into a 3/2 spin-orbit resonance where it rotates three times on its axis for every two orbits around the sun. The stability of this equilibrium state is well established, but our understanding of how this state initially arose remains unsatisfactory. Unless one uses an unrealistic tidal model with constant torques (which cannot account for the observed damping of the libration of the planet) the computed probability of capture into 3/2 resonance is very low (about 7 per cent). This led to the proposal that core-mantle friction may have increased the capture probability, but such a process requires very specific values of the core viscosity. Here we show that the chaotic evolution of Mercury's orbit can drive its eccentricity beyond 0.325 during the planet's history, which very efficiently leads to its capture into the 3/2 resonance. In our numerical integrations of 1,000 orbits of Mercury over 4 Gyr, capture into the 3/2 spin-orbit resonant state was the most probable final outcome of the planet's evolution, occurring 55.4 per cent of the time.

K-shell X-ray transition energies of multi-electron ions of silicon and sulfur

NASA Astrophysics Data System (ADS)

Beiersdorfer, P.; Brown, G. V.; Hell, N.; Santana, J. A.

2017-10-01

Prompted by the detection of K-shell absorption or emission features in the spectra of plasma surrounding high mass X-ray binaries and black holes, recent measurements using the Livermore electron beam ion trap have focused on the energies of the n = 2 to n = 1 K-shell transitions in the L-shell ions of lithiumlike through fluorinelike silicon and sulfur. In parallel, we have made calculations of these transitions using the Flexible Atomic Code and the multi-reference Møller-Plesset (MRMP) atomic physics code. Using this code we have attempted to produce sets of theoretical atomic data with spectroscopic accuracy for all the L-shell ions of silicon and sulfur. We present results of our calculations for oxygenlike and fluorinelike silicon and compare them to the recent electron beam ion trap measurements as well as previous calculations.

Development of 50kV air-core transformer for electron gun static power source of 3MeV DC accelerator

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dewangan, S.; Bakhtsingh, R.I.; Rajan, R.N.

A 3 MeV, 10 mA DC Electron Beam Accelerator based on the capacitively coupled parallel-fed voltage multiplier in 6 kg/cm{sup 2} SF{sub 6} gas environment is under commissioning at Electron Beam Centre, Kharghar, Navi Mumbai. Electron Gun is situated at -3 MV terminal which requires a constant power for its anode and filament. Gun power source has been derived by suitably coupling the ac components present in the HV Multiplier column. An aircore step down transformer rated for 50kV/600V/120kHz floating at 3 MV to extract the required power for electron gun from high voltage column has been developed. The transformermore » has been operated for 7 kW, 1 MeV of electron beam in 6 kg/cm{sup 2} nitrogen gas environment. The paper describes briefly about the design aspects and test results. (author)« less

Resonant electron capture by orotic acid molecules

NASA Astrophysics Data System (ADS)

Muftakhov, M. V.; Shchukin, P. V.; Khatymov, R. V.

2017-09-01

Resonant electron attachment by orotic acid molecules (6-COOH-uracil) are studied in the energy range of 0-14 eV via negative ion mass spectrometry. Molecular ions, whose lifetimes relative to electron autodetachment are found to be 300 μs are recorded in the region of thermal electron energies; they form in the valence state through a vibration-excited resonance mechanism. Unlike unsubstituted uracil, most dissociative processes occur in the low-energy region of <4 eV and are due to carboxylic anions. An absolute cross section of 2.4 × 10-17 cm2 is found for the most intense fragment ions [M-H]- at an output energy of 1.33 eV. The kinetics of decarboxylation is considered for these ions. This could be a model reaction for the last stage of uridine monophosphate biosynthesis.

Estimation of population size using open capture-recapture models

USGS Publications Warehouse

McDonald, T.L.; Amstrup, Steven C.

2001-01-01

One of the most important needs for wildlife managers is an accurate estimate of population size. Yet, for many species, including most marine species and large mammals, accurate and precise estimation of numbers is one of the most difficult of all research challenges. Open-population capture-recapture models have proven useful in many situations to estimate survival probabilities but typically have not been used to estimate population size. We show that open-population models can be used to estimate population size by developing a Horvitz-Thompson-type estimate of population size and an estimator of its variance. Our population size estimate keys on the probability of capture at each trap occasion and therefore is quite general and can be made a function of external covariates measured during the study. Here we define the estimator and investigate its bias, variance, and variance estimator via computer simulation. Computer simulations make extensive use of real data taken from a study of polar bears (Ursus maritimus) in the Beaufort Sea. The population size estimator is shown to be useful because it was negligibly biased in all situations studied. The variance estimator is shown to be useful in all situations, but caution is warranted in cases of extreme capture heterogeneity.

Risk estimation using probability machines

PubMed Central

2014-01-01

Background Logistic regression has been the de facto, and often the only, model used in the description and analysis of relationships between a binary outcome and observed features. It is widely used to obtain the conditional probabilities of the outcome given predictors, as well as predictor effect size estimates using conditional odds ratios. Results We show how statistical learning machines for binary outcomes, provably consistent for the nonparametric regression problem, can be used to provide both consistent conditional probability estimation and conditional effect size estimates. Effect size estimates from learning machines leverage our understanding of counterfactual arguments central to the interpretation of such estimates. We show that, if the data generating model is logistic, we can recover accurate probability predictions and effect size estimates with nearly the same efficiency as a correct logistic model, both for main effects and interactions. We also propose a method using learning machines to scan for possible interaction effects quickly and efficiently. Simulations using random forest probability machines are presented. Conclusions The models we propose make no assumptions about the data structure, and capture the patterns in the data by just specifying the predictors involved and not any particular model structure. So they do not run the same risks of model mis-specification and the resultant estimation biases as a logistic model. This methodology, which we call a “risk machine”, will share properties from the statistical machine that it is derived from. PMID:24581306

Risk estimation using probability machines.

PubMed

Dasgupta, Abhijit; Szymczak, Silke; Moore, Jason H; Bailey-Wilson, Joan E; Malley, James D

2014-03-01

Logistic regression has been the de facto, and often the only, model used in the description and analysis of relationships between a binary outcome and observed features. It is widely used to obtain the conditional probabilities of the outcome given predictors, as well as predictor effect size estimates using conditional odds ratios. We show how statistical learning machines for binary outcomes, provably consistent for the nonparametric regression problem, can be used to provide both consistent conditional probability estimation and conditional effect size estimates. Effect size estimates from learning machines leverage our understanding of counterfactual arguments central to the interpretation of such estimates. We show that, if the data generating model is logistic, we can recover accurate probability predictions and effect size estimates with nearly the same efficiency as a correct logistic model, both for main effects and interactions. We also propose a method using learning machines to scan for possible interaction effects quickly and efficiently. Simulations using random forest probability machines are presented. The models we propose make no assumptions about the data structure, and capture the patterns in the data by just specifying the predictors involved and not any particular model structure. So they do not run the same risks of model mis-specification and the resultant estimation biases as a logistic model. This methodology, which we call a "risk machine", will share properties from the statistical machine that it is derived from.

Electron capture to the continuum manifestation in fully differential cross sections for ion impact single ionization

NASA Astrophysics Data System (ADS)

Ciappina, M. F.; Fojón, O. A.; Rivarola, R. D.

2018-04-01

We present theoretical calculations of single ionization of He atoms by protons and multiply charged ions. The kinematical conditions are deliberately chosen in such a way that the ejected electron velocity matches the projectile impact velocity. The computed fully differential cross sections (FDCS) in the scattering plane using the continuum-distorted wave-eikonal initial state show a distinct peaked structure for a polar electron emission angle θ k = 0°. This element is absent when a first order theory is employed. Consequently, we can argue that this peak is a clear manifestation of a three-body effect, not observed before in FDCS. We discuss a possible interpretation of this new feature.

Control of two-dimensional electronic states at anatase Ti O2(001 ) surface by K adsorption

NASA Astrophysics Data System (ADS)

Yukawa, R.; Minohara, M.; Shiga, D.; Kitamura, M.; Mitsuhashi, T.; Kobayashi, M.; Horiba, K.; Kumigashira, H.

2018-04-01

The nature of the intriguing metallic electronic structures appearing at the surface of anatase titanium dioxide (a-Ti O2 ) remains to be elucidated, mainly owing to the difficulty of controlling the depth distribution of the oxygen vacancies generated by photoirradiation. In this study, K atoms were adsorbed onto the (001) surface of a-Ti O2 to dope electrons into the a-Ti O2 and to confine the electrons in the surface region. The success of the electron doping and its controllability were confirmed by performing in situ angle-resolved photoemission spectroscopy as well as core-level measurements. Clear subband structures were observed in the surface metallic states, indicating the creation of quasi-two-dimensional electron liquid (q2DEL) states in a controllable fashion. With increasing electron doping (K adsorption), the q2DEL states exhibited crossover from polaronic liquid states with multiple phonon-loss structures originating from the long-range Fröhlich interaction to "weakly correlated metallic" states. In the q2DEL states in the weakly correlated metallic region, a kink due to short-range electron-phonon coupling was clearly observed at about 80 ±10 meV . The characteristic energy is smaller than that previously observed for the metallic states of a-Ti O2 with three-dimensional nature (˜110 meV ) . These results suggest that the dominant electron-phonon coupling is modulated by anisotropic carrier screening in the q2DEL states.

Origin of the moon by capture

NASA Astrophysics Data System (ADS)

Singer, S. Fred

A coherent account is presented here based on the hypothesis that the moon formed separately in a heliocentric orbit similar to the earth's and was later captured by the earth. The adoption of this hypothesis, together with the observed depletion of iron in the moon, sets some important constraints on the condensation and agglomeration phenomena in the primeval solar nebula that led to the formation of planetesimals, and ultimately to planets. Capture of the moon also defines a severe heating event whereby the earth's kinetic energy of rotation is largely dissipated internally by the mechanism of tidal friction. From this melting event dates the geologic, atmospheric, and oceanic history of the earth. An attempt is made to account for the unique development of the earth, especially in relation to Mars and Venus, its neighboring planets. A capture origin of the moon that employs a 'push-pull' tidal theory does not strain the laws of physics, involves a minimum of ad hoc assumptions, and has a probability that is commensurate with the evidence of the existence of a unique moon.

Possible combinations of electronic data capture and randomization systems. principles and the realization with RANDI2 and OpenClinica.

PubMed

Schrimpf, D; Haag, M; Pilz, L R

2014-01-01

Clinical trials (CT) are in a wider sense experiments to prove and establish clinical benefit of treatments. Nowadays electronic data capture systems (EDCS) are used more often bringing a better data management and higher data quality into clinical practice. Also electronic systems for the randomization are used to assign the patients to the treatments. If the mentioned randomization system (RS) and EDCS are used, possibly identical data are collected in both, especially by stratified randomization. This separated data storage may lead to data inconsistency and in general data samples have to be aligned. The article discusses solutions to combine RS and EDCS. In detail one approach is realized and introduced. Different possible settings of combination of EDCS and RS are determined and the pros and cons for each solution are worked out. For the combination of two independent applications the necessary interfaces for the communication are defined. Thereby, existing standards are considered. An example realization is implemented with the help of open-source applications and state-of-the-art software development procedures. Three possibilities of separate usage or combination of EDCS and RS are presented and assessed: i) the complete independent usage of both systems; ii) realization of one system with both functions; and iii) two separate systems, which communicate via defined interfaces. In addition a realization of our preferred approach, the combination of both systems, is introduced using the open source tools RANDI2 and OpenClinica. The advantage of a flexible independent development of EDCS and RS is shown based on the fact that these tool are very different featured. In our opinion the combination of both systems via defined interfaces fulfills the requirements of randomization and electronic data capture and is feasible in practice. In addition, the use of such a setting can reduce the training costs and the error-prone duplicated data entry.

Probability estimation with machine learning methods for dichotomous and multicategory outcome: theory.

PubMed

Kruppa, Jochen; Liu, Yufeng; Biau, Gérard; Kohler, Michael; König, Inke R; Malley, James D; Ziegler, Andreas

2014-07-01

Probability estimation for binary and multicategory outcome using logistic and multinomial logistic regression has a long-standing tradition in biostatistics. However, biases may occur if the model is misspecified. In contrast, outcome probabilities for individuals can be estimated consistently with machine learning approaches, including k-nearest neighbors (k-NN), bagged nearest neighbors (b-NN), random forests (RF), and support vector machines (SVM). Because machine learning methods are rarely used by applied biostatisticians, the primary goal of this paper is to explain the concept of probability estimation with these methods and to summarize recent theoretical findings. Probability estimation in k-NN, b-NN, and RF can be embedded into the class of nonparametric regression learning machines; therefore, we start with the construction of nonparametric regression estimates and review results on consistency and rates of convergence. In SVMs, outcome probabilities for individuals are estimated consistently by repeatedly solving classification problems. For SVMs we review classification problem and then dichotomous probability estimation. Next we extend the algorithms for estimating probabilities using k-NN, b-NN, and RF to multicategory outcomes and discuss approaches for the multicategory probability estimation problem using SVM. In simulation studies for dichotomous and multicategory dependent variables we demonstrate the general validity of the machine learning methods and compare it with logistic regression. However, each method fails in at least one simulation scenario. We conclude with a discussion of the failures and give recommendations for selecting and tuning the methods. Applications to real data and example code are provided in a companion article (doi:10.1002/bimj.201300077). © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A Life Cycle Assessment Case Study of Coal-Fired Electricity Generation with Humidity Swing Direct Air Capture of CO2 versus MEA-Based Postcombustion Capture.

PubMed

van der Giesen, Coen; Meinrenken, Christoph J; Kleijn, René; Sprecher, Benjamin; Lackner, Klaus S; Kramer, Gert Jan

2017-01-17

Most carbon capture and storage (CCS) envisions capturing CO 2 from flue gas. Direct air capture (DAC) of CO 2 has hitherto been deemed unviable because of the higher energy associated with capture at low atmospheric concentrations. We present a Life Cycle Assessment of coal-fired electricity generation that compares monoethanolamine (MEA)-based postcombustion capture (PCC) of CO 2 with distributed, humidity-swing-based direct air capture (HS-DAC). Given suitable temperature, humidity, wind, and water availability, HS-DAC can be largely passive. Comparing energy requirements of HS-DAC and MEA-PCC, we find that the parasitic load of HS-DAC is less than twice that of MEA-PCC (60-72 kJ/mol versus 33-46 kJ/mol, respectively). We also compare other environmental impacts as a function of net greenhouse gas (GHG) mitigation: To achieve the same 73% mitigation as MEA-PCC, HS-DAC would increase nine other environmental impacts by on average 38%, whereas MEA-PCC would increase them by 31%. Powering distributed HS-DAC with photovoltaics (instead of coal) while including recapture of all background GHG, reduces this increase to 18%, hypothetically enabling coal-based electricity with net-zero life-cycle GHG. We conclude that, in suitable geographies, HS-DAC can complement MEA-PCC to enable CO 2 capture independent of time and location of emissions and recapture background GHG from fossil-based electricity beyond flue stack emissions.

Can an Electronic Textbooks Be Part of K-12 Education?: Challenges, Technological Solutions and Open Issues

ERIC Educational Resources Information Center

Lee, HeeJeong Jasmine; Messom, Chris; Yau, Kok-Lim Alvin

2013-01-01

An electronic textbook (e-Textbook) is a digitized (or electronic) form of textbook, which normally needs an endorsement by the national or state government when it is used in the K-12 education system. E-Textbooks have been envisioned to replace existing paper-based textbooks due to its educational advantages. Hence, it is of paramount importance…

K-shell X-ray transition energies of multi-electron ions of silicon and sulfur

DOE PAGES

Beiersdorfer, P.; Brown, G. V.; Hell, N.; ...

2017-04-20

Prompted by the detection of K-shell absorption or emission features in the spectra of plasma surrounding high mass X-ray binaries and black holes, recent measurements using the Livermore electron beam ion trap have focused on the energies of the n = 2 to n = 1 K-shell transitions in the L-shell ions of lithiumlike through fluorinelike silicon and sulfur. In parallel, we have made calculations of these transitions using the Flexible Atomic Code and the multi-reference Møller-Plesset (MRMP) atomic physics code. Using this code we have attempted to produce sets of theoretical atomic data with spectroscopic accuracy for all themore » L-shell ions of silicon and sulfur. Here, we present results of our calculations for oxygenlike and fluorinelike silicon and compare them to the recent electron beam ion trap measurements as well as previous calculations.« less

Measurement of the intrinsic electron neutrino component in the T2K neutrino beam with the ND280 detector

NASA Astrophysics Data System (ADS)

Abe, K.; Adam, J.; Aihara, H.; Akiri, T.; Andreopoulos, C.; Aoki, S.; Ariga, A.; Ariga, T.; Assylbekov, S.; Autiero, D.; Barbi, M.; Barker, G. J.; Barr, G.; Bass, M.; Batkiewicz, M.; Bay, F.; Bentham, S. W.; Berardi, V.; Berger, B. E.; Berkman, S.; Bertram, I.; Bhadra, S.; Blaszczyk, F. d. M.; Blondel, A.; Bojechko, C.; Bordoni, S.; Boyd, S. B.; Brailsford, D.; Bravar, A.; Bronner, C.; Buchanan, N.; Calland, R. G.; Caravaca Rodríguez, J.; Cartwright, S. L.; Castillo, R.; Catanesi, M. G.; Cervera, A.; Cherdack, D.; Christodoulou, G.; Clifton, A.; Coleman, J.; Coleman, S. J.; Collazuol, G.; Connolly, K.; Cremonesi, L.; Dabrowska, A.; Danko, I.; Das, R.; Davis, S.; de Perio, P.; De Rosa, G.; Dealtry, T.; Dennis, S. R.; Densham, C.; Di Lodovico, F.; Di Luise, S.; Drapier, O.; Duboyski, T.; Duffy, K.; Dufour, F.; Dumarchez, J.; Dytman, S.; Dziewiecki, M.; Emery, S.; Ereditato, A.; Escudero, L.; Finch, A. J.; Floetotto, L.; Friend, M.; Fujii, Y.; Fukuda, Y.; Furmanski, A. P.; Galymov, V.; Giffin, S.; Giganti, C.; Gilje, K.; Goeldi, D.; Golan, T.; Gomez-Cadenas, J. J.; Gonin, M.; Grant, N.; Gudin, D.; Hadley, D. R.; Haesler, A.; Haigh, M. D.; Hamilton, P.; Hansen, D.; Hara, T.; Hartz, M.; Hasegawa, T.; Hastings, N. C.; Hayato, Y.; Hearty, C.; Helmer, R. L.; Hierholzer, M.; Hignight, J.; Hillairet, A.; Himmel, A.; Hiraki, T.; Hirota, S.; Holeczek, J.; Horikawa, S.; Huang, K.; Ichikawa, A. K.; Ieki, K.; Ieva, M.; Ikeda, M.; Imber, J.; Insler, J.; Irvine, T. J.; Ishida, T.; Ishii, T.; Ives, S. J.; Iwai, E.; Iyogi, K.; Izmaylov, A.; Jacob, A.; Jamieson, B.; Johnson, R. A.; Jo, J. H.; Jonsson, P.; Jung, C. K.; Kabirnezhad, M.; Kaboth, A. C.; Kajita, T.; Kakuno, H.; Kameda, J.; Kanazawa, Y.; Karlen, D.; Karpikov, I.; Kearns, E.; Khabibullin, M.; Khotjantsev, A.; Kielczewska, D.; Kikawa, T.; Kilinski, A.; Kim, J.; Kisiel, J.; Kitching, P.; Kobayashi, T.; Koch, L.; Kolaceke, A.; Konaka, A.; Kormos, L. L.; Korzenev, A.; Koseki, K.; Koshio, Y.; Kreslo, I.; Kropp, W.; Kubo, H.; Kudenko, Y.; Kumaratunga, S.; Kurjata, R.; Kutter, T.; Lagoda, J.; Laihem, K.; Lamont, I.; Larkin, E.; Laveder, M.; Lawe, M.; Lazos, M.; Lee, K. P.; Lindner, T.; Lister, C.; Litchfield, R. P.; Longhin, A.; Ludovici, L.; Macaire, M.; Magaletti, L.; Mahn, K.; Malek, M.; Manly, S.; Marino, A. D.; Marteau, J.; Martin, J. F.; Maruyama, T.; Marzec, J.; Mathie, E. L.; Matveev, V.; Mavrokoridis, K.; Mazzucato, E.; McCarthy, M.; McCauley, N.; McFarland, K. S.; McGrew, C.; Metelko, C.; Mezzetto, M.; Mijakowski, P.; Miller, C. A.; Minamino, A.; Mineev, O.; Mine, S.; Missert, A.; Miura, M.; Monfregola, L.; Moriyama, S.; Mueller, Th. A.; Murakami, A.; Murdoch, M.; Murphy, S.; Myslik, J.; Nagasaki, T.; Nakadaira, T.; Nakahata, M.; Nakai, T.; Nakamura, K.; Nakayama, S.; Nakaya, T.; Nakayoshi, K.; Naples, D.; Nielsen, C.; Nirkko, M.; Nishikawa, K.; Nishimura, Y.; O'Keeffe, H. M.; Ohta, R.; Okumura, K.; Okusawa, T.; Oryszczak, W.; Oser, S. M.; Owen, R. A.; Oyama, Y.; Palladino, V.; Palomino, J.; Paolone, V.; Payne, D.; Perevozchikov, O.; Perkin, J. D.; Petrov, Y.; Pickard, L.; Pinzon Guerra, E. S.; Pistillo, C.; Plonski, P.; Poplawska, E.; Popov, B.; Posiadala, M.; Poutissou, J.-M.; Poutissou, R.; Przewlocki, P.; Quilain, B.; Radicioni, E.; Ratoff, P. N.; Ravonel, M.; Rayner, M. A. M.; Redij, A.; Reeves, M.; Reinherz-Aronis, E.; Retiere, F.; Robert, A.; Rodrigues, P. A.; Rojas, P.; Rondio, E.; Roth, S.; Rubbia, A.; Ruterbories, D.; Sacco, R.; Sakashita, K.; Sánchez, F.; Sato, F.; Scantamburlo, E.; Scholberg, K.; Schoppmann, S.; Schwehr, J.; Scott, M.; Seiya, Y.; Sekiguchi, T.; Sekiya, H.; Sgalaberna, D.; Shiozawa, M.; Short, S.; Shustrov, Y.; Sinclair, P.; Smith, B.; Smith, R. J.; Smy, M.; Sobczyk, J. T.; Sobel, H.; Sorel, M.; Southwell, L.; Stamoulis, P.; Steinmann, J.; Still, B.; Suda, Y.; Suzuki, A.; Suzuki, K.; Suzuki, S. Y.; Suzuki, Y.; Szeglowski, T.; Tacik, R.; Tada, M.; Takahashi, S.; Takeda, A.; Takeuchi, Y.; Tanaka, H. K.; Tanaka, H. A.; Tanaka, M. M.; Terhorst, D.; Terri, R.; Thompson, L. F.; Thorley, A.; Tobayama, S.; Toki, W.; Tomura, T.; Totsuka, Y.; Touramanis, C.; Tsukamoto, T.; Tzanov, M.; Uchida, Y.; Ueno, K.; Vacheret, A.; Vagins, M.; Vasseur, G.; Wachala, T.; Waldron, A. V.; Walter, C. W.; Wark, D.; Wascko, M. O.; Weber, A.; Wendell, R.; Wilkes, R. J.; Wilking, M. J.; Wilkinson, C.; Williamson, Z.; Wilson, J. R.; Wilson, R. J.; Wongjirad, T.; Yamada, Y.; Yamamoto, K.; Yanagisawa, C.; Yen, S.; Yershov, N.; Yokoyama, M.; Yuan, T.; Yu, M.; Zalewska, A.; Zalipska, J.; Zambelli, L.; Zaremba, K.; Ziembicki, M.; Zimmerman, E. D.; Zito, M.; Żmuda, J.; T2K Collaboration

2014-05-01

The T2K experiment has reported the first observation of the appearance of electron neutrinos in a muon neutrino beam. The main and irreducible background to the appearance signal comes from the presence in the neutrino beam of a small intrinsic component of electron neutrinos originating from muon and kaon decays. In T2K, this component is expected to represent 1.2% of the total neutrino flux. A measurement of this component using the near detector (ND280), located 280 m from the target, is presented. The charged current interactions of electron neutrinos are selected by combining the particle identification capabilities of both the time projection chambers and electromagnetic calorimeters of ND280. The measured ratio between the observed electron neutrino beam component and the prediction is 1.01±0.10 providing a direct confirmation of the neutrino fluxes and neutrino cross section modeling used for T2K neutrino oscillation analyses. Electron neutrinos coming from muons and kaons decay are also separately measured, resulting in a ratio with respect to the prediction of 0.68±0.30 and 1.10±0.14, respectively.

The use of Research Electronic Data Capture (REDCap) software to create a database of librarian-mediated literature searches.

PubMed

Lyon, Jennifer A; Garcia-Milian, Rolando; Norton, Hannah F; Tennant, Michele R

2014-01-01

Expert-mediated literature searching, a keystone service in biomedical librarianship, would benefit significantly from regular methodical review. This article describes the novel use of Research Electronic Data Capture (REDCap) software to create a database of literature searches conducted at a large academic health sciences library. An archive of paper search requests was entered into REDCap, and librarians now prospectively enter records for current searches. Having search data readily available allows librarians to reuse search strategies and track their workload. In aggregate, this data can help guide practice and determine priorities by identifying users' needs, tracking librarian effort, and focusing librarians' continuing education.

The Competitive Influence of Li+, Na+, K+, Ag+, and H+ on the Fragmentation of a PEGylated Polymeric Excipient

NASA Astrophysics Data System (ADS)

Wei, Juan; Bristow, Anthony W. T.; O'Connor, Peter B.

2015-01-01

The collisionally activated dissociation (CAD) and electron capture dissociation (ECD) of doubly charged tocopheryl polyethylene glycol succinate (TPGS) have been examined. Li+, Na+, K+, Ag+, and H+ were selected in the study, and the competitive influence of each ion was investigated by fragmenting TPGS attached with two different cations, [M + X1 + X2]2+ (X1 and X2 refer to Li+, Na+, K+, Ag+, H+). For metallic adducts, CAD results show that the dissociation of ionic adducts from the precursor is most likely depending on the binding strength, where the affinity of each ion to the TPGS is in the order of Ag+ ≈ Li+ ˃ Na+ ˃ K+. Introducing more strongly bound adducts increases fragmentation. During ECD, however, the silver cation is lost most easily compared with the other alkali metal ions, but silver also shows a dominant role in producing fragmentations. Moreover, the charge carriers are lost in an order (Ag+ ˃ Na+ ˃ K+ ≥ Li+ where the loss of Ag is most easily) that appears to correlate with the standard reduction potential of the metallic ions (Ag+ ˃ Na+ ˃ K+ ˃ Li+). The ECD results suggest that the reduction potential of the charge carrier could be an important factor influencing the fragmentation, where the ion with a high reduction potential is more effective in capturing electrons, but may also be lost easily before leading to any fragmentation. Finally, a proton has the weakest binding with the TPGS according to the CAD results, and its dissociation in ECD follows the order of the reduction potential (Ag+ ˃ H+ ˃ Na+ ˃ K+ > Li+).

EVALUATION OF N-METHYL-N-TERT-BUTYLDIMETHYLSILYLTRIFLUOROACETAMIDE FOR ENVIRONMENTAL ANALYSIS UNDER BOTH EIMS AND ELECTRON CAPTURE NICIMS CONDITIONS AND COMPARISON TO TRIMETHYLSILYL REAGENTS UNDER EIMS

EPA Science Inventory

Sewage effluent was analyzed for 3,5,6-trichloropyridinol (TCP) by extracting one liter of water using liquid-liquid extraction and determined by GC/MS operated in the negative ion chemical ionization (electron capture) mode, TCP is the major metabolite of the commonly used insec...

Asymmetry and Electronegativity in the Electron Capture Activation of the Se-Se Bond: σ*(Se-Se) vs σ*(Se-X).

PubMed

Gámez, José A; Yáñez, Manuel

2010-10-12

The effects of electron capture on the structure of XSeSeX' diselenide derivatives in which the substituents attached to the selenium atoms have different electronegativities have been investigated at different levels of theory, namely, DFT, MP2, CCSD, G2, and CASSCF/CASPT2. An analysis of the bonding changes upon electron attachment shows that when the diselenides bear low-electronegativity substituents, the Se-Se bond becomes activated upon electron capture, as previous studies have shown. However, this is no longer the case for very electronegative substituents, where this bond remains practically unaltered and is the Se-X bond the one which becomes strongly activated through a preferential population of the σ*(Se-X) antibonding orbital rather than the σ*(Se-Se) one. When this is the case, several anionic species are also encountered, namely, stretched, bent, and book structures. The present findings are similar to those obtained for a series of analogous disulfide compounds, which points out that these results are not unique and could be extrapolated to a wider range of compounds than the ones covered here. The Se-Se (Se-X) linkage in CH3SeSeOH, CH3SeSeF, FSeSeOH, and FSeSeF bears some of the characteristics of the so-called charge-shift bonds, with a clear charge fluctuation between both selenium atoms. This is more evident in their anions where the bonding reflects the important contribution of the ionic resonant forms Se-Se(-) ↔ (-)Se-Se vs the covalent component Se∴Se. This resonance changes with the nature of the substituents but also depends on the asymmetry of the substitution.

AMUC: Associated Motion capture User Categories.

PubMed

Norman, Sally Jane; Lawson, Sian E M; Olivier, Patrick; Watson, Paul; Chan, Anita M-A; Dade-Robertson, Martyn; Dunphy, Paul; Green, Dave; Hiden, Hugo; Hook, Jonathan; Jackson, Daniel G

2009-07-13

The AMUC (Associated Motion capture User Categories) project consisted of building a prototype sketch retrieval client for exploring motion capture archives. High-dimensional datasets reflect the dynamic process of motion capture and comprise high-rate sampled data of a performer's joint angles; in response to multiple query criteria, these data can potentially yield different kinds of information. The AMUC prototype harnesses graphic input via an electronic tablet as a query mechanism, time and position signals obtained from the sketch being mapped to the properties of data streams stored in the motion capture repository. As well as proposing a pragmatic solution for exploring motion capture datasets, the project demonstrates the conceptual value of iterative prototyping in innovative interdisciplinary design. The AMUC team was composed of live performance practitioners and theorists conversant with a variety of movement techniques, bioengineers who recorded and processed motion data for integration into the retrieval tool, and computer scientists who designed and implemented the retrieval system and server architecture, scoped for Grid-based applications. Creative input on information system design and navigation, and digital image processing, underpinned implementation of the prototype, which has undergone preliminary trials with diverse users, allowing identification of rich potential development areas.

Rapid differentiation of rocky mountain spotted fever from chickenpox, measles, and enterovirus infections and bacterial meningitis by frequency-pulsed electron capture gas-liquid chromatographic analysis of sera.

PubMed Central

Brooks, J B; McDade, J E; Alley, C C

1981-01-01

Normal sera and sera from patients with Rocky Mountain spotted fever, chickenpox, enterovirus infections, measles, and Neisseria meningitidis infections were extracted with organic solvents under acidic and basic conditions and then derivatized with trichloroethanol or heptafluorobutyric anhydride-ethanol to form electron-capturing derivatives of organic acids, alcohols, and amines. The derivatives were analyzed by frequency-pulsed electron capture gas-liquid chromatography (FPEC-GLC). There were unique differences in the FPEC-GLC profiles of sera obtained from patients with these respective diseases. With Rocky Mountain spotted fever patients, typical profiles were detected as early as 1 day after onset of disease and before antibody could be detected in the serum. Rapid diagnosis of Rocky Mountain spotted fever by FPEC-GLC could permit early and effective therapy, thus preventing many deaths from this disease. PMID:7276147

Modulation of auroral electron fluxes in the frequency range 50 kHz to 10 MHz

NASA Technical Reports Server (NTRS)

Spiger, R. J.; Murphree, J. S.; Anderson, H. R.; Loewenstein, R. F.

1976-01-01

A sounding rocket-borne electron detector of high time resolution is used to search for modulation of auroral electron fluxes in the frequency range 50 kHz to 10 MHz and energy range 5-7 keV. Data were telemetered to ground via a 93-kHz subcarrier. A cross-correlation analysis of the data collected indicates low-level modulation near the detection threshold of the instrument. Two U-1 events are observed which are interpreted as indications of modulation. The two modulation events occur during a period of increasing flux for a region marking the boundary between two current sheets detected by the payload magnetometer. The strongest argument against interference contamination is the lack of any observable modulation at times other than those mentioned in the study.

0.25-μm lithography using a 50-kV shaped electron-beam vector scan system

NASA Astrophysics Data System (ADS)

Gesley, Mark A.; Mulera, Terry; Nurmi, C.; Radley, J.; Sagle, Allan L.; Standiford, Keith P.; Tan, Zoilo C. H.; Thomas, John R.; Veneklasen, Lee

1995-05-01

Performance data from a prototype 50 kV shaped electron-beam (e-beam) pattern generator is presented. This technology development is targeted towards 180-130 nm device design rules. It will be able to handle 1X NIST X-ray membranes, glass reduction reticles, and 4- to 8-inch wafers. The prototype system uses a planar stage adapted from the IBM EL-4 design. The electron optics is an 50 kV extension of the AEBLE%+TM) design. Lines and spaces of 0.12 micrometers with < 40 nm corner radius are resolved in 0.4 micrometers thick resist at 50 kV. This evolutionary platform will evolve further to include a new 100 kV column with telecentric deflection and a 21-bit (0.5 mm) major field for improved placement accuracy. A unique immersion shaper, faster data path electronics, and 15-bit (32 micrometers ) minor field deflection electronics will substantially increase the flash rate. To match its much finer address structure, the pattern generator figure word size will increase from 80 to 96 bits. The data path electronics uses field programmable gate array (FPGA) logic allowing writing strategy optimization via software reconfiguration. An advanced stage position control (ASPC) includes three-axis, (lambda) /1024 interferometry and a high bandwidth dynamic corrections processor (DCP). Along with its normal role of coordinate transformation and dynamic correction of deflection distortion, astigmatism, and defocus; the DCP improves accuracy by modifying deflection conditions and focus according to measured substrate height variations. It also enables yaw calibration and correction for Write-on-the FlyTM motion. The electronics incorporates JTAG components for built-in self- test (BIST), as well as syndrome checking to ensure data integrity. The design includes diagnostic capabilities from offsite as well as from the operator console. A combination of third-party software and an internal job preparation software system is used to fracture patterns. It handles tone reversal

A New Insight into Neutrino Energy Loss by Electron Capture of Iron Group Nuclei in Magnetar Surfaces

NASA Astrophysics Data System (ADS)

Liu, Jing-Jing; Gu, Wei-Min

2016-06-01

Based on the relativistic mean-field effective interactions theory, and the Lai dong model, we discuss the influences of superstrong magnetic fields (SMFs) on electron Fermi energy, nuclear blinding energy, and single-particle level structure in magnetar surfaces. Using the Shell-Model Monte Carlo method and the Random Phase Approximation theory, we analyze the neutrino energy loss rates (NELRs) by electron capture for iron group nuclei in SMFs. First, when B 12 < 100, we find that the SMFs have a slight influence on the NELRs for most nuclides at relativistic low temperatures (e.g., T 9 = 0.233); nevertheless, the NELRs increase by more than four orders of magnitude at relativistic high temperatures (e.g., T 9 = 15.53). When B 12 > 100, the NELRs decrease by more than three orders of magnitude (e.g., at T 9 = 15.53 for 52-61Fe, 55-60Co, and 56-63Ni). Second, for a certain value of magnetic field and temperature, the NELRs increase by more than four orders of magnitude when {ρ }7≤slant {10}3, but as the density increases (I.e., when {ρ }7\\gt {10}3), there is almost no influence on the density of NELRs. For the density around {ρ }7={10}2, there is an abrupt increase in NELRs when B 12 ≥ 103.5. Such jumps are an indication that the underlying shell structure has changed due to single-particle behavior by SMFs. Finally, we compare our NELRs with those of Fuller et al. (FFN) and Nabi & Klapdor-Kleingrothaus (NKK). For the case without SMFs, one finds that our rates for certain nuclei are close to about five orders of magnitude lower than FFN and NKK at relativistic low temperatures (e.g., T 9 = 1). However, at a relativistic high temperature (e.g., T 9 = 3), our results are in good agreement with NKK, but about one order of magnitude lower than FFN. For the case with SMFs, our NELRs for some iron group nuclei can be about five orders of magnitude higher than those of FFN and NKK. (Note that B 12, T 9, and ρ 7 are in units of 1012 G, 109 K, and {10}7 {{g}} {{cm

Reassessing the Efficiency Penalty from Carbon Capture in Coal-Fired Power Plants.

PubMed

Supekar, Sarang D; Skerlos, Steven J

2015-10-20

This paper examines thermal efficiency penalties and greenhouse gas as well as other pollutant emissions associated with pulverized coal (PC) power plants equipped with postcombustion CO2 capture for carbon sequestration. We find that, depending on the source of heat used to meet the steam requirements in the capture unit, retrofitting a PC power plant that maintains its gross power output (compared to a PC power plant without a capture unit) can cause a drop in plant thermal efficiency of 11.3-22.9%-points. This estimate for efficiency penalty is significantly higher than literature values and corresponds to an increase of about 5.3-7.7 US¢/kWh in the levelized cost of electricity (COE) over the 8.4 US¢/kWh COE value for PC plants without CO2 capture. The results follow from the inclusion of mass and energy feedbacks in PC power plants with CO2 capture into previous analyses, as well as including potential quality considerations for safe and reliable transportation and sequestration of CO2. We conclude that PC power plants with CO2 capture are likely to remain less competitive than natural gas combined cycle (without CO2 capture) and on-shore wind power plants, both from a levelized and marginal COE point of view.

Monitoring Chemical and Biological Electron Transfer Reactions with a Fluorogenic Vitamin K Analogue Probe.

PubMed

Belzile, Mei-Ni; Godin, Robert; Durantini, Andrés M; Cosa, Gonzalo

2016-12-21

We report herein the design, synthesis, and characterization of a two-segment fluorogenic analogue of vitamin K, B-VK Q , prepared by coupling vitamin K 3 , also known as menadione (a quinone redox center), to a boron-dipyrromethene (BODIPY) fluorophore (a lipophilic reporter segment). Oxidation-reduction reactions, spectroelectrochemical studies, and enzymatic assays conducted in the presence of DT-diaphorase illustrate that the new probe shows reversible redox behavior on par with that of vitamin K, provides a high-sensitivity fluorescence signal, and is compatible with biological conditions, opening the door to monitor remotely (i.e., via imaging) redox processes in real time. In its oxidized form, B-VK Q is non-emissive, while upon reduction to the hydroquinone form, B-VK QH 2 , BODIPY fluorescence is restored, with emission quantum yield values of ca. 0.54 in toluene. Density functional theory studies validate a photoinduced electron transfer intramolecular switching mechanism, active in the non-emissive quinone form and deactivated upon reduction to the emissive dihydroquinone form. Our results highlight the potential of B-VK Q as a fluorogenic probe to study electron transfer and transport in model systems and biological structures with optimal sensitivity and desirable chemical specificity. Use of such a probe may enable a better understanding of the role that vitamin K plays in biological redox reactions ubiquitous in key cellular processes, and help elucidate the mechanism and pathological significance of these reactions in biological systems.

High-throughput screening of metal-porphyrin-like graphenes for selective capture of carbon dioxide

PubMed Central

Bae, Hyeonhu; Park, Minwoo; Jang, Byungryul; Kang, Yura; Park, Jinwoo; Lee, Hosik; Chung, Haegeun; Chung, ChiHye; Hong, Suklyun; Kwon, Yongkyung; Yakobson, Boris I.; Lee, Hoonkyung

2016-01-01

Nanostructured materials, such as zeolites and metal-organic frameworks, have been considered to capture CO2. However, their application has been limited largely because they exhibit poor selectivity for flue gases and low capture capacity under low pressures. We perform a high-throughput screening for selective CO2 capture from flue gases by using first principles thermodynamics. We find that elements with empty d orbitals selectively attract CO2 from gaseous mixtures under low CO2 pressures (~10−3 bar) at 300 K and release it at ~450 K. CO2 binding to elements involves hybridization of the metal d orbitals with the CO2 π orbitals and CO2-transition metal complexes were observed in experiments. This result allows us to perform high-throughput screening to discover novel promising CO2 capture materials with empty d orbitals (e.g., Sc– or V–porphyrin-like graphene) and predict their capture performance under various conditions. Moreover, these findings provide physical insights into selective CO2 capture and open a new path to explore CO2 capture materials. PMID:26902156

High-throughput screening of metal-porphyrin-like graphenes for selective capture of carbon dioxide.

PubMed

Bae, Hyeonhu; Park, Minwoo; Jang, Byungryul; Kang, Yura; Park, Jinwoo; Lee, Hosik; Chung, Haegeun; Chung, ChiHye; Hong, Suklyun; Kwon, Yongkyung; Yakobson, Boris I; Lee, Hoonkyung

2016-02-23

Nanostructured materials, such as zeolites and metal-organic frameworks, have been considered to capture CO2. However, their application has been limited largely because they exhibit poor selectivity for flue gases and low capture capacity under low pressures. We perform a high-throughput screening for selective CO2 capture from flue gases by using first principles thermodynamics. We find that elements with empty d orbitals selectively attract CO2 from gaseous mixtures under low CO2 pressures (~10(-3) bar) at 300 K and release it at ~450 K. CO2 binding to elements involves hybridization of the metal d orbitals with the CO2 π orbitals and CO2-transition metal complexes were observed in experiments. This result allows us to perform high-throughput screening to discover novel promising CO2 capture materials with empty d orbitals (e.g., Sc- or V-porphyrin-like graphene) and predict their capture performance under various conditions. Moreover, these findings provide physical insights into selective CO2 capture and open a new path to explore CO2 capture materials.

High-throughput screening of metal-porphyrin-like graphenes for selective capture of carbon dioxide

NASA Astrophysics Data System (ADS)

Bae, Hyeonhu; Park, Minwoo; Jang, Byungryul; Kang, Yura; Park, Jinwoo; Lee, Hosik; Chung, Haegeun; Chung, Chihye; Hong, Suklyun; Kwon, Yongkyung; Yakobson, Boris I.; Lee, Hoonkyung

2016-02-01

Nanostructured materials, such as zeolites and metal-organic frameworks, have been considered to capture CO2. However, their application has been limited largely because they exhibit poor selectivity for flue gases and low capture capacity under low pressures. We perform a high-throughput screening for selective CO2 capture from flue gases by using first principles thermodynamics. We find that elements with empty d orbitals selectively attract CO2 from gaseous mixtures under low CO2 pressures (~10-3 bar) at 300 K and release it at ~450 K. CO2 binding to elements involves hybridization of the metal d orbitals with the CO2 π orbitals and CO2-transition metal complexes were observed in experiments. This result allows us to perform high-throughput screening to discover novel promising CO2 capture materials with empty d orbitals (e.g., Sc- or V-porphyrin-like graphene) and predict their capture performance under various conditions. Moreover, these findings provide physical insights into selective CO2 capture and open a new path to explore CO2 capture materials.

Efficacy of trap modifications for increasing capture rates of aquatic snakes in floating aquatic funnel traps

USGS Publications Warehouse

Halstead, Brian J.; Wylie, Glenn D.; Casazza, Michael L.

2013-01-01

Increasing detection and capture probabilities of rare or elusive herpetofauna of conservation concern is important to inform the scientific basis for their management and recovery. The Giant Gartersnake (Thamnophis gigas) is an example of a secretive, wary, and generally difficult-to-sample species about which little is known regarding its patterns of occurrence and demography. We therefore evaluated modifications to existing traps to increase the detection and capture probabilities of the Giant Gartersnake to improve the precision with which occurrence, abundance, survival, and other demographic parameters are estimated. We found that adding a one-way valve constructed of cable ties to the small funnel opening of traps and adding hardware cloth extensions to the wide end of funnels increased capture rates of the Giant Gartersnake by 5.55 times (95% credible interval = 2.45–10.51) relative to unmodified traps. The effectiveness of these modifications was insensitive to the aquatic habitat type in which they were deployed. The snout-vent length of the smallest and largest captured snakes did not vary among trap modifications. These trap modifications are expected to increase detection and capture probabilities of the Giant Gartersnake, and show promise for increasing the precision with which demographic parameters can be estimated for this species. We anticipate that the trap modifications found effective in this study will be applicable to a variety of aquatic and semi-aquatic reptiles and amphibians and improve conservation efforts for these species.

Electrochemical K-562 cells sensor based on origami paper device for point-of-care testing.

PubMed

Ge, Shenguang; Zhang, Lina; Zhang, Yan; Liu, Haiyun; Huang, Jiadong; Yan, Mei; Yu, Jinghua

2015-12-01

A low-cost, simple, portable and sensitive paper-based electrochemical sensor was established for the detection of K-562 cell in point-of-care testing. The hybrid material of 3D Au nanoparticles/graphene (3D Au NPs/GN) with high specific surface area and ionic liquid (IL) with widened electrochemical windows improved the good biocompatibility and high conductivity was modified on paper working electrode (PWE) by the classic assembly method and then employed as the sensing surface. IL could not only enhance the electron transfer ability but also provide sensing recognition interface for the conjugation of Con A with cells, with the cell capture efficiency and the sensitivity of biosensor strengthened simultaneously. Concanavalin A (Con A) immobilization matrix was used to capture cells. As proof-of-concept, the paper-based electrochemical sensor for the detection of K-562 cells was developed. With such sandwich-type assay format, K-562 cells as model cells were captured on the surface of Con A/IL/3D AuNPs@GN/PWE. Con A-labeled dendritic PdAg NPs were captured on the surface of K-562 cells. Such dendritic PdAg NPs worked as catalysts promoting the oxidation of thionine (TH) by H2O2 which was released from K-562 cells via the stimulation of phorbol 12-myristate-13-acetate (PMA). Therefore, the current signal response was dependent on the amount of PdAg NPs and the concentration of H2O2, the latter of which corresponded with the releasing amount from cells. So, the detection method of K-562 cell was also developed. Under optimized experimental conditions, 1.5×10(-14) mol of H2O2 releasing from each cell was calculated. The linear range and the detection limit for K-562 cells were determined to be 1.0×10(3)-5.0×10(6) cells/mL and 200 cells/mL, respectively. Such as-prepared sensor showed excellent analytical performance with good fabrication reproducibility, acceptable precision and satisfied accuracy, providing a novel protocol in point-of-care testing of cells

Electron attachment to the SF{sub 6} molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smirnov, B. M., E-mail: bmsmirnov@gmail.com; Kosarim, A. V.

Various models for transition between electron and nuclear subsystems are compared in the case of electron attachment to the SF{sub 6} molecule. Experimental data, including the cross section of electron attachment to this molecule as a function of the electron energy and vibrational temperature, the rate constants of this process in swarm experiments, and the rates of the chemionization process involving Rydberg atoms and the SF{sub 6} molecule, are collected and treated. Based on the data and on the resonant character of electron capture into an autodetachment ion state in accordance with the Breit–Wigner formula, we find that intersection ofmore » the molecule and negative ion electron terms proceeds above the potential well bottom of the molecule with the barrier height 0.05–0.1 eV, and the transition between these electron terms has both the tunnel and abovebarrier character. The limit of small electron energies e for the electron attachment cross section at room vibrational temperature takes place at ε ≪ 2 meV, while in the range 2 meV ≪ ε ≪ 80 meV, the cross section is inversely proportional to ε. In considering the attachment process as a result of the interaction between the electron and vibrational degrees of freedom, we find the coupling factor f between them to be f = aT at low vibrational temperatures T with a ≈ 3 × 10{sup −4} K{sup −1}. The coupling factor is independent of the temperature at T > 400 K.« less

A Comparison of Grizzly Bear Demographic Parameters Estimated from Non-Spatial and Spatial Open Population Capture-Recapture Models.

PubMed

Whittington, Jesse; Sawaya, Michael A

2015-01-01

Capture-recapture studies are frequently used to monitor the status and trends of wildlife populations. Detection histories from individual animals are used to estimate probability of detection and abundance or density. The accuracy of abundance and density estimates depends on the ability to model factors affecting detection probability. Non-spatial capture-recapture models have recently evolved into spatial capture-recapture models that directly include the effect of distances between an animal's home range centre and trap locations on detection probability. Most studies comparing non-spatial and spatial capture-recapture biases focussed on single year models and no studies have compared the accuracy of demographic parameter estimates from open population models. We applied open population non-spatial and spatial capture-recapture models to three years of grizzly bear DNA-based data from Banff National Park and simulated data sets. The two models produced similar estimates of grizzly bear apparent survival, per capita recruitment, and population growth rates but the spatial capture-recapture models had better fit. Simulations showed that spatial capture-recapture models produced more accurate parameter estimates with better credible interval coverage than non-spatial capture-recapture models. Non-spatial capture-recapture models produced negatively biased estimates of apparent survival and positively biased estimates of per capita recruitment. The spatial capture-recapture grizzly bear population growth rates and 95% highest posterior density averaged across the three years were 0.925 (0.786-1.071) for females, 0.844 (0.703-0.975) for males, and 0.882 (0.779-0.981) for females and males combined. The non-spatial capture-recapture population growth rates were 0.894 (0.758-1.024) for females, 0.825 (0.700-0.948) for males, and 0.863 (0.771-0.957) for both sexes. The combination of low densities, low reproductive rates, and predominantly negative population growth

A Comparison of Grizzly Bear Demographic Parameters Estimated from Non-Spatial and Spatial Open Population Capture-Recapture Models

PubMed Central

Whittington, Jesse; Sawaya, Michael A.

2015-01-01

Capture-recapture studies are frequently used to monitor the status and trends of wildlife populations. Detection histories from individual animals are used to estimate probability of detection and abundance or density. The accuracy of abundance and density estimates depends on the ability to model factors affecting detection probability. Non-spatial capture-recapture models have recently evolved into spatial capture-recapture models that directly include the effect of distances between an animal’s home range centre and trap locations on detection probability. Most studies comparing non-spatial and spatial capture-recapture biases focussed on single year models and no studies have compared the accuracy of demographic parameter estimates from open population models. We applied open population non-spatial and spatial capture-recapture models to three years of grizzly bear DNA-based data from Banff National Park and simulated data sets. The two models produced similar estimates of grizzly bear apparent survival, per capita recruitment, and population growth rates but the spatial capture-recapture models had better fit. Simulations showed that spatial capture-recapture models produced more accurate parameter estimates with better credible interval coverage than non-spatial capture-recapture models. Non-spatial capture-recapture models produced negatively biased estimates of apparent survival and positively biased estimates of per capita recruitment. The spatial capture-recapture grizzly bear population growth rates and 95% highest posterior density averaged across the three years were 0.925 (0.786–1.071) for females, 0.844 (0.703–0.975) for males, and 0.882 (0.779–0.981) for females and males combined. The non-spatial capture-recapture population growth rates were 0.894 (0.758–1.024) for females, 0.825 (0.700–0.948) for males, and 0.863 (0.771–0.957) for both sexes. The combination of low densities, low reproductive rates, and predominantly negative

Evaluation of trap capture in a geographically closed population of brown treesnakes on Guam

USGS Publications Warehouse

Tyrrell, C.L.; Christy, M.T.; Rodda, G.H.; Yackel Adams, A.A.; Ellingson, A.R.; Savidge, J.A.; Dean-Bradley, K.; Bischof, R.

2009-01-01

1. Open population mark-recapture analysis of unbounded populations accommodates some types of closure violations (e.g. emigration, immigration). In contrast, closed population analysis of such populations readily allows estimation of capture heterogeneity and behavioural response, but requires crucial assumptions about closure (e.g. no permanent emigration) that are suspect and rarely tested empirically. 2. In 2003, we erected a double-sided barrier to prevent movement of snakes in or out of a 5-ha semi-forested study site in northern Guam. This geographically closed population of >100 snakes was monitored using a series of transects for visual searches and a 13 ?? 13 trapping array, with the aim of marking all snakes within the site. Forty-five marked snakes were also supplemented into the resident population to quantify the efficacy of our sampling methods. We used the program mark to analyse trap captures (101 occasions), referenced to census data from visual surveys, and quantified heterogeneity, behavioural response, and size bias in trappability. Analytical inclusion of untrapped individuals greatly improved precision in the estimation of some covariate effects. 3. A novel discovery was that trap captures for individual snakes consisted of asynchronous bouts of high capture probability lasting about 7 days (ephemeral behavioural effect). There was modest behavioural response (trap happiness) and significant latent (unexplained) heterogeneity, with small influences on capture success of date, gender, residency status (translocated or not), and body condition. 4. Trapping was shown to be an effective tool for eradicating large brown treesnakes Boiga irregularis (>900 mm snout-vent length, SVL). 5. Synthesis and applications. Mark-recapture modelling is commonly used by ecological managers to estimate populations. However, existing models involve making assumptions about either closure violations or response to capture. Physical closure of our population on a

A New Mass Criterium for Electron Capture Supernovae

NASA Astrophysics Data System (ADS)

Poelarends, Arend

2016-06-01

Electron capture supernovae (ECSN) are thought to populate the mass range between massive white dwarf progenitors and core collapse supernovae. It is generally believed that the initial stellar mass range for ECSN from single stars is about 0.5-1.0 M⊙ wide and centered around a value of 8.5 or 9 M⊙, depending on the specifics of the physics of convection and mass loss one applies. Since mass loss in a binary system is able to delay or cancel the second dredge-up, it is also believed that the initial mass range for ECSN in binary systems is wider than in single stars, but an initial mass range has not been defined yet.The last phase of stars in this particular mass range, however, is challenging to compute, either due to recurring Helium shell flashes, or due to convectively bound flames in the degenerate interior of the star. It would be helpful, nevertheless, to know before we enter these computationally intensive phases whether a star will explode as an ECSN or not. The mass of the helium core after helium core burning is one such criterium (Nomoto, 1984), which predicts that ECSN will occur if the helium core mass is between 2.0 M⊙ and 2.5 M⊙. However, since helium cores can be subject to erosion due to mass loss — even during helium core burning, this criterium will not yield accurate predictions for stars in binary systems.We present a dense grid of stellar evolution models that allow us to put constraints on the final fate of their cores, based on a combination of Carbon/Oxygen core mass, the mass of the surrounding Helium layer and C/O abundance. We find that CO cores with masses between 1.365 and 1.420 M⊙ at the end of Carbon burning will result in ECSN, with some minor adjustments of these ranges due to the mass of the Helium layer and the C/O ratio. While detailed models of stars within the ECSN mass range remain necessary to understand the details of pre-ECSN evolution, our research refines the Helium core criterion and provides a useful way

The feasibility of using 'bring your own device' (BYOD) technology for electronic data capture in multicentre medical audit and research.

PubMed

Faulds, M C; Bauchmuller, K; Miller, D; Rosser, J H; Shuker, K; Wrench, I; Wilson, P; Mills, G H

2016-01-01

Large-scale audit and research projects demand robust, efficient systems for accurate data collection, handling and analysis. We utilised a multiplatform 'bring your own device' (BYOD) electronic data collection app to capture observational audit data on theatre efficiency across seven hospital Trusts in South Yorkshire in June-August 2013. None of the participating hospitals had a dedicated information governance policy for bring your own device. Data were collected by 17 investigators for 392 individual theatre lists, capturing 14,148 individual data points, 12, 852 (91%) of which were transmitted to a central database on the day of collection without any loss of data. BYOD technology enabled accurate collection of a large volume of secure data across multiple NHS organisations over a short period of time. Bring your own device technology provides a method for collecting real-time audit, research and quality improvement data within healthcare systems without compromising patient data protection. © 2015 The Association of Anaesthetists of Great Britain and Ireland.

Conductive Graphitic Carbon Nitride as an Ideal Material for Electrocatalytically Switchable CO2 Capture

PubMed Central

Tan, Xin; Kou, Liangzhi; Tahini, Hassan A.; Smith, Sean C.

2015-01-01

Good electrical conductivity and high electron mobility of the sorbent materials are prerequisite for electrocatalytically switchable CO2 capture. However, no conductive and easily synthetic sorbent materials are available until now. Here, we examined the possibility of conductive graphitic carbon nitride (g-C4N3) nanosheets as sorbent materials for electrocatalytically switchable CO2 capture. Using first-principle calculations, we found that the adsorption energy of CO2 molecules on g-C4N3 nanosheets can be dramatically enhanced by injecting extra electrons into the adsorbent. At saturation CO2 capture coverage, the negatively charged g-C4N3 nanosheets achieve CO2 capture capacities up to 73.9 × 1013 cm−2 or 42.3 wt%. In contrast to other CO2 capture approaches, the process of CO2 capture/release occurs spontaneously without any energy barriers once extra electrons are introduced or removed, and these processes can be simply controlled and reversed by switching on/off the charging voltage. In addition, these negatively charged g-C4N3 nanosheets are highly selective for separating CO2 from mixtures with CH4, H2 and/or N2. These predictions may prove to be instrumental in searching for a new class of experimentally feasible high-capacity CO2 capture materials with ideal thermodynamics and reversibility. PMID:26621618

Survival probabilities at spherical frontiers.

PubMed

Lavrentovich, Maxim O; Nelson, David R

2015-06-01

Motivated by tumor growth and spatial population genetics, we study the interplay between evolutionary and spatial dynamics at the surfaces of three-dimensional, spherical range expansions. We consider range expansion radii that grow with an arbitrary power-law in time: R(t) = R0(1 + t/t(∗))Θ, where Θ is a growth exponent, R0 is the initial radius, and t(∗) is a characteristic time for the growth, to be affected by the inflating geometry. We vary the parameters t(∗) and Θ to capture a variety of possible growth regimes. Guided by recent results for two-dimensional inflating range expansions, we identify key dimensionless parameters that describe the survival probability of a mutant cell with a small selective advantage arising at the population frontier. Using analytical techniques, we calculate this probability for arbitrary Θ. We compare our results to simulations of linearly inflating expansions (Θ = 1 spherical Fisher-Kolmogorov-Petrovsky-Piscunov waves) and treadmilling populations (Θ = 0, with cells in the interior removed by apoptosis or a similar process). We find that mutations at linearly inflating fronts have survival probabilities enhanced by factors of 100 or more relative to mutations at treadmilling population frontiers. We also discuss the special properties of "marginally inflating" (Θ = 1/2) expansions. Copyright © 2015 Elsevier Inc. All rights reserved.

Determination of phenoxy acid herbicides in water by electron-capture and microcoulometric gas chromatography

USGS Publications Warehouse

Goerlitz, D.F.; Lamar, William L.

1967-01-01

A sensitive gas chromatographic method using microcoulometric titration and electron-capture detection for the analysis of 2,4-D, silvex, 2,4,5-T, and other phenoxy acid herbicides in water is described. The herbicides are extracted from unfiltered water samples (800-1,000 ml) by use of ethyl ether ; then the herbicides are concentrated and esterilied. To allow the analyst a choice, two esterilication procedures--using either boron trifluoride-methanol or diazomethane--are evaluated. Microcoulometric gas chromatography is specific for the detection of halogenated compounds such as the phenoxy acid herbicides whereas it does not respond to nonhalogenated components. Microcoulometric gas chromatography requires care and patience. It is not convenient for rapid screening of l-liter samples that contain less than 1 microgram of the herbicide. Although electroncapture gas chromatography is less selective and more critically affected by interfering substances, it is, nevertheless, convenient and more sensitive than microcoulometric gas chromatography. Two different liquid phases are used in the gas chromatographic columns--DC-200 silicone in one column and QF-1 silicone in the other. The performance of both columns is improved by the addition of Carbowax 20M. The Gas Chrom Q support is coated with the liquid phases by the 'frontal-analysis' technique. The practical lower limits for measurement of the phenoxy acid herbicides in water primarily depend upon the sample size, interferences present, anal instrumentation used. With l-liter samples of water, the practical lower limits of measurement are 10 ppt (parts per trillion) for 2,4-D and 2 ppt for silvex and 2,4,5-T when electron-capture detection is used, and approximately 20 ppt for each herbicide when analyzed by microcoulometric-titration gas chromatography. Recoveries of the herbicides immediately after addition to unfiltered water samples averaged 92 percent for 2,4-D, 90 percent for silvex, and 98 percent for 2

Lesser scaup breeding probability and female survival on the yukon flats, Alaska

USGS Publications Warehouse

Martin, K.H.; Lindberg, M.S.; Schmutz, J.A.; Bertram, M.R.

2009-01-01

Information on the ecology of waterfowl breeding in the boreal forest is lacking, despite the boreal region's importance to continental waterfowl populations and to duck species that are currently declining, such as lesser scaup (Aythya affinis). We estimated breeding probability and breeding season survival of female lesser scaup on the Yukon Flats National Wildlife Refuge, Alaska, USA, in 2005 and 2006. We captured and marked 93 lesser scaup with radiotransmitters during prelaying and nesting periods. Although all marked lesser scaup females were paired throughout prelaying and incubation periods, we estimated breeding probability over both years as 0.12 (SE = 0.05, n = 67) using telemetry. Proportion of lesser scaup females undergoing rapid follicle growth at capture in 2006 was 0.46 (SE = 0.11, n = 37), based on concentration of yolk precursors in blood plasma. By combining methods based on telemetry, yolk precursors, and postovulatory follicles, we estimated maximum breeding probability as 0.68 (SE = 0.08, n = 37) in 2006. Notably, breeding probability was positively related to female body mass. Survival of female lesser scaup during the nesting and brood-rearing periods was 0.92 (SE = 0.05) in 2005 and 0.86 (SE = 0.08) in 2006. Our results suggest that breeding probability is lower than expected for lesser scaup. In addition, the implicit assumption of continental duck-monitoring programs that all paired females attempt to breed should be reevaluated. Recruitment estimates based on annual breeding-pair surveys may overestimate productivity of scaup pairs in the boreal forest. ?? The Wildlife Society.

Polaron-electron assisted giant dielectric dispersion in SrZrO{sub 3} high-k dielectric

DOE Office of Scientific and Technical Information (OSTI.GOV)

Borkar, Hitesh; Barvat, Arun; Pal, Prabir

2016-06-07

The SrZrO{sub 3} is a well known high-k dielectric constant (∼22) and high optical bandgap (∼5.8 eV) material and one of the potential candidates for future generation nanoelectronic logic elements (8 nm node technology) beyond silicon. Its dielectric behavior is fairly robust and frequency independent till 470 K; however, it suffers a strong small-polaron based electronic phase transition (T{sub e}) linking 650 to 750 K. The impedance spectroscopy measurements revealed the presence of conducting grains and grain boundaries at elevated temperature which provide energetic mobile charge carriers with activation energy in the range of 0.7 to 1.2 eV supporting the oxygen ions and proton conduction.more » X-ray photoemission spectroscopy measurements suggest the presence of weak non-stoichiometric O{sup 2−} anions and hydroxyl species bound to different sites at the surface and bulk. These thermally activated charge carriers at elevated temperature significantly contribute to the polaronic based dielectric anomaly and conductivity. Our dielectric anomaly supports pseudo phase transition due to high degree of change in ZrO{sub 6} octahedral angle in the temperature range of 650–750 K, where electron density and phonon vibration affect the dielectric and conductivity properties.« less

Software Review: A program for testing capture-recapture data for closure

USGS Publications Warehouse

Stanley, Thomas R.; Richards, Jon D.

2005-01-01

Capture-recapture methods are widely used to estimate population parameters of free-ranging animals. Closed-population capture-recapture models, which assume there are no additions to or losses from the population over the period of study (i.e., the closure assumption), are preferred for population estimation over the open-population models, which do not assume closure, because heterogeneity in detection probabilities can be accounted for and this improves estimates. In this paper we introduce CloseTest, a new Microsoft® Windows-based program that computes the Otis et al. (1978) and Stanley and Burnham (1999) closure tests for capture-recapture data sets. Information on CloseTest features and where to obtain the program are provided.

Application of PIXE in the determination of the production cross section of a radionuclide decaying by electron capture

NASA Astrophysics Data System (ADS)

Morales, J. R.; Chesta, M. A.; Cancino, S. A.; Miranda, P. A.; Dinator, M. I.; Avila, M. J.

2005-01-01

Proton induced X-ray emission (PIXE) has been applied to the measurement of the production cross section of a radionuclide decaying by electron capture. By performing a PIXE type experiment on the daughter nuclide important advantages are obtained. The determination of some factors with usually large uncertainties, like solid angle and detector efficiency were avoided. The method was applied to the determination of cross section of the reaction 63Cu(d, p)64Cu at 2.4 MeV for 64Cu production. This result is in full agreement with that obtained through the decay of the 1346 keV gamma ray of 64Cu.

Thermodynamic and kinetic studies on CO2 capture with Poly[VBTMA][Arg

NASA Astrophysics Data System (ADS)

Raja Shahrom, Maisara Shahrom; Wilfred, Cecilia Devi; Chong, Fai Kait

2018-05-01

This paper discusses the technologies for capturing CO2 from the natural gas using poly[VBTMA][Arg], a type of poly(ionic liquids) with an amino acid as the anion. The results revealed that the CO2 uptake increased from 3.23 mmol/g to 7.91 mmol/g at 1-10 bar, 298 K due to both chemical absorption and physical adsorption increments. Four adsorption isotherm models were applied to study the interaction between adsorbate and adsorbent to study the physical adsorption i.e. Freundlich, Langmuir, Dubinin Raduschkevich and Temkin isotherms at 298 K, 313 K and 333 K. Promising results were obtained that suggested the Freundlich model and the pseudo-first order model are well fitted with the kinetic data at 298 K with a 0.9943 R2 value. This study has provided empirical evidence to the current body of knowledge pertaining to CO2 capture technologies.

Vitamin K 3 family members - Part II: Single crystal X-ray structures, temperature-induced packing polymorphism, magneto-structural correlations and probable anti-oncogenic candidature

NASA Astrophysics Data System (ADS)

Rane, Sandhya; Ahmed, Khursheed; Salunke-Gawali, Sunita; Zaware, Santosh B.; Srinivas, D.; Gonnade, Rajesh; Bhadbhade, Mohan

2008-12-01

Temperature-induced packing polymorphism is observed for vitamin K 3 (menadione, 3-methyl-1,4-naphthoquinone, 1). Form 1a crystallizes at 300 K and 1b at 277 K both in the same space group P2 1/ c. Form 1b contains one molecule per asymmetric unit, performing anisotropy in g-factor viz. g z = 2.0082, g y = 2.0055 and g x = 2.0025, whereas form 1a contains two molecules in its asymmetric unit. Vitamin K 3 family members 2, [2-hydroxy vitamin K 3] and 3, [2-hydroxy-1-oximino vitamin K 3] also perform intrinsic neutral active naphthosemiquinone valence tautomers even in dark having spin concentrations due to hydrogen bonding and aromatic stacking interactions which are compared to vitamin K 3. The significant lateral C-H⋯O and O-H⋯π bifurcated or π-π ∗ interactions are discussed for molecular associations and radical formations. X-ray structure of 3 revealed π-π ∗ stack dimers as radicals signatured in EPR as triplet with five hyperfine splits [ Ā( 14N) = 11.9 G]. The centrosymmetric biradicals in 3 show diamagnetism at high temperature but below 10 K it shows paramagnetism with μeff as 0.19 B.M. Vitamin K 3 and its family members inhibit biological activities of acid phosphatase ( APase), which are proportional to their spin concentrations. This may relate to their probable anti-oncogenic candidature in future.

Neural response to reward anticipation under risk is nonlinear in probabilities.

PubMed

Hsu, Ming; Krajbich, Ian; Zhao, Chen; Camerer, Colin F

2009-02-18

A widely observed phenomenon in decision making under risk is the apparent overweighting of unlikely events and the underweighting of nearly certain events. This violates standard assumptions in expected utility theory, which requires that expected utility be linear (objective) in probabilities. Models such as prospect theory have relaxed this assumption and introduced the notion of a "probability weighting function," which captures the key properties found in experimental data. This study reports functional magnetic resonance imaging (fMRI) data that neural response to expected reward is nonlinear in probabilities. Specifically, we found that activity in the striatum during valuation of monetary gambles are nonlinear in probabilities in the pattern predicted by prospect theory, suggesting that probability distortion is reflected at the level of the reward encoding process. The degree of nonlinearity reflected in individual subjects' decisions is also correlated with striatal activity across subjects. Our results shed light on the neural mechanisms of reward processing, and have implications for future neuroscientific studies of decision making involving extreme tails of the distribution, where probability weighting provides an explanation for commonly observed behavioral anomalies.

Large electron capture-cross-section of the major nonradiative recombination centers in Mg-doped GaN epilayers grown on a GaN substrate

NASA Astrophysics Data System (ADS)

Chichibu, S. F.; Shima, K.; Kojima, K.; Takashima, S.; Edo, M.; Ueno, K.; Ishibashi, S.; Uedono, A.

2018-05-01

Complementary time-resolved photoluminescence and positron annihilation measurements were carried out at room temperature on Mg-doped p-type GaN homoepitaxial films for identifying the origin and estimating the electron capture-cross-section ( σ n ) of the major nonradiative recombination centers (NRCs). To eliminate any influence by threading dislocations, free-standing GaN substrates were used. In Mg-doped p-type GaN, defect complexes composed of a Ga-vacancy (VGa) and multiple N-vacancies (VNs), namely, VGa(VN)2 [or even VGa(VN)3], are identified as the major intrinsic NRCs. Different from the case of 4H-SiC, atomic structures of intrinsic NRCs in p-type and n-type GaN are different: VGaVN divacancies are the major NRCs in n-type GaN. The σ n value approximately the middle of 10-13 cm2 is obtained for VGa(VN)n, which is larger than the hole capture-cross-section (σp = 7 × 10-14 cm2) of VGaVN in n-type GaN. Combined with larger thermal velocity of an electron, minority carrier lifetime in Mg-doped GaN becomes much shorter than that of n-type GaN.

Quantifying Data Quality for Clinical Trials Using Electronic Data Capture

PubMed Central

Nahm, Meredith L.; Pieper, Carl F.; Cunningham, Maureen M.

2008-01-01

Background Historically, only partial assessments of data quality have been performed in clinical trials, for which the most common method of measuring database error rates has been to compare the case report form (CRF) to database entries and count discrepancies. Importantly, errors arising from medical record abstraction and transcription are rarely evaluated as part of such quality assessments. Electronic Data Capture (EDC) technology has had a further impact, as paper CRFs typically leveraged for quality measurement are not used in EDC processes. Methods and Principal Findings The National Institute on Drug Abuse Treatment Clinical Trials Network has developed, implemented, and evaluated methodology for holistically assessing data quality on EDC trials. We characterize the average source-to-database error rate (14.3 errors per 10,000 fields) for the first year of use of the new evaluation method. This error rate was significantly lower than the average of published error rates for source-to-database audits, and was similar to CRF-to-database error rates reported in the published literature. We attribute this largely to an absence of medical record abstraction on the trials we examined, and to an outpatient setting characterized by less acute patient conditions. Conclusions Historically, medical record abstraction is the most significant source of error by an order of magnitude, and should be measured and managed during the course of clinical trials. Source-to-database error rates are highly dependent on the amount of structured data collection in the clinical setting and on the complexity of the medical record, dependencies that should be considered when developing data quality benchmarks. PMID:18725958

Electron spin resonance study of atomic hydrogen stabilized in solid neon below 1 K

NASA Astrophysics Data System (ADS)

Sheludiakov, S.; Ahokas, J.; Järvinen, J.; Lehtonen, L.; Vasiliev, S.; Dmitriev, Yu. A.; Lee, D. M.; Khmelenko, V. V.

2018-03-01

We report on an electron spin resonance study of atomic hydrogen stabilized in solid Ne matrices carried out at a high field of 4.6 T and temperatures below 1 K . The films of Ne, slowly deposited on the substrate at a temperature of ˜1 K , exhibited a high degree of porosity. We found that H atoms may be trapped in two different substitutional positions in the Ne lattice as well as inside clusters of pure molecular H2 in the pores of the Ne film. The latter type of atoms was very unstable against recombination at temperatures 0.3-0.6 K . Based on the observed nearly instant decays after rapid small increases of temperature, we evaluate the lower limit of the recombination rate constant kr≥5 ×10-20cm3s-1 at 0.6 K , five orders of magnitude larger than that previously found in the thin films of pure H2 at the same temperature. Such behavior assumes a very high mobility of atoms and may indicate a solid-to-liquid transition for H2 clusters of certain sizes, similar to that observed in experiments with H2 clusters inside helium droplets [Phys. Rev. Lett. 101, 205301 (2008), 10.1103/PhysRevLett.101.205301]. We found that the efficiency of dissociation of H2 in neon films is enhanced by two orders of magnitude compared to that in pure H2 as a result of the strong action of secondary electrons.

All-electron and relativistic pseudopotential studies for the group 1 element polarizabilities from K to element 119.

PubMed

Lim, Ivan S; Schwerdtfeger, Peter; Metz, Bernhard; Stoll, Hermann

2005-03-08

Two-component and scalar relativistic energy-consistent pseudopotentials for the group 1 elements from K to element 119 are presented using nine electrons for the valence space definition. The accuracy of such an approximation is discussed for dipole polarizabilities and ionization potentials obtained at the coupled-cluster level as compared to experimental and all-electron Douglas-Kroll results.

Attainment of 40.5 pm spatial resolution using 300 kV scanning transmission electron microscope equipped with fifth-order aberration corrector.

PubMed

Morishita, Shigeyuki; Ishikawa, Ryo; Kohno, Yuji; Sawada, Hidetaka; Shibata, Naoya; Ikuhara, Yuichi

2018-02-01

The achievement of a fine electron probe for high-resolution imaging in scanning transmission electron microscopy requires technological developments, especially in electron optics. For this purpose, we developed a microscope with a fifth-order aberration corrector that operates at 300 kV. The contrast flat region in an experimental Ronchigram, which indicates the aberration-free angle, was expanded to 70 mrad. By using a probe with convergence angle of 40 mrad in the scanning transmission electron microscope at 300 kV, we attained the spatial resolution of 40.5 pm, which is the projected interatomic distance between Ga-Ga atomic columns of GaN observed along [212] direction.

Hematological indicators of stress in longline-captured sharks.

PubMed

Marshall, Heather; Field, Lyndsay; Afiadata, Achankeng; Sepulveda, Chugey; Skomal, Gregory; Bernal, Diego

2012-06-01

For many shark species, little information exists about the stress response to capture and release in commercial longline fisheries. Recent studies have used hematological profiling to assess the secondary stress response, but little is known about how, and to what degree, these indicators vary interspecifically. Moreover, there is little understanding of the extent to which the level of relative swimming activity (e.g., sluggish vs. active) or the general ecological classification (e.g., coastal vs. pelagic) correlates to the magnitude of the exercise-induced (capture-related) stress response. This study compared plasma electrolytes (Na(+), Cl(-), Mg(2+), Ca(2+), and K(+)), metabolites (glucose and lactate), blood hematocrit, and heat shock protein (Hsp70) levels between 11 species of longline-captured sharks (n=164). Statistical comparison of hematological parameters revealed species-specific differences in response to longline capture, as well as differences by ecological classification. Taken together, the blood properties of longline-captured sharks appear to be useful indicators of interspecific variation in the secondary stress response to capture, and may prove useful in the future for predicting survivorship of longline-captured sharks where new technologies (i.e., pop-up satellite tags) can verify post-release mortality. Copyright © 2012 Elsevier Inc. All rights reserved.

Dynamics of Coronal Structures Captured During the 2012 and 2013 Total Solar Eclipses

NASA Astrophysics Data System (ADS)

Alzate, N.; Habbal, S. R.; Druckmuller, M.

2017-12-01

White light eclipse images taken during total solar eclipses provide a very high dynamic range spanning tens of solar radii starting from the solar surface. They capture the instantaneous state of the corona, including dynamic events. We present observations of the 2012 November 13 and 2013 November 3 total solar eclipses, taken by Constantinos Emmanouilidis, in which we captured high latitude tethered prominences accompanied by CMEs, as well as several `atypical' large scale structures, spanning a few solar radii above the solar surface. By complementing the eclipse observations with co-temporaneous SDO/AIA, STEREO/EUVI and SOHO/LASCO observations, we show how the shape of the atypical structures outlines the shape of faint CME shock fronts, driven by flaring activities. The tethered prominences were imaged from their anchor at the solar surface out to several solar radii. The SDO/AIA 30.4, 17.1 and 19.3 nm emission clearly show how a direct link between the cool (104 - 105 K) filamentary emission from prominence material, and the filamentary structures emitting at coronal temperatures (> 106 K), is unmistakably present. The observed survival of these tethered systems out to the field of view of LASCO C3, establishes the likely origin of counter-streaming electrons associated with CMEs observed in interplanetary space (ICMEs). They also provide new insights for CME-initiation models associated with prominence eruptions. Our work highlights the uniqueness of eclipse observations in identifying the impact of transit events on large-scale coronal structures.

Direct k-space mapping of the electronic structure in an oxide-oxide interface.

PubMed

Berner, G; Sing, M; Fujiwara, H; Yasui, A; Saitoh, Y; Yamasaki, A; Nishitani, Y; Sekiyama, A; Pavlenko, N; Kopp, T; Richter, C; Mannhart, J; Suga, S; Claessen, R

2013-06-14

The interface between LaAlO(3) and SrTiO(3) hosts a two-dimensional electron system of itinerant carriers, although both oxides are band insulators. Interface ferromagnetism coexisting with superconductivity has been found and attributed to local moments. Experimentally, it has been established that Ti 3d electrons are confined to the interface. Using soft x-ray angle-resolved resonant photoelectron spectroscopy we have directly mapped the interface states in k space. Our data demonstrate a charge dichotomy. A mobile fraction contributes to Fermi surface sheets, whereas a localized portion at higher binding energies is tentatively attributed to electrons trapped by O vacancies in the SrTiO(3). While photovoltage effects in the polar LaAlO(3) layers cannot be excluded, the apparent absence of surface-related Fermi surface sheets could also be fully reconciled in a recently proposed electronic reconstruction picture where the built-in potential in the LaAlO(3) is compensated by surface O vacancies serving also as a charge reservoir.

Muon capture on light isotopes in Double Chooz

NASA Astrophysics Data System (ADS)

Strait, M.; Double Chooz Collaboration

2017-09-01

Using the Double Chooz reactor neutrino detector, we have measured the products of µ - capture on 12C, 13C, 14N and 16O. Over a period of 490 days, we collected 2.3 × 106 stopping cosmic µ -, of which 1.8 × 105 captured on these nuclei in the inner detector. The resulting isotopes were tagged using prompt neutron emission (when applicable), the subsequent beta decays, and, in some cases, β-delayed neutrons. Production of these βn isotopes, primarily 9Li, which are {{{ν _e}} \\over {{ν _μ }}} backgrounds, was found at a significance of 5.5σ. The probability of 9Li production per capture on natC is (2.4 ± 0.9(stat) ± 0.1(syst)) × 10-4. We have made the most precise measurement of the rate of 12C(µ -, ν)12B to date, 6.57 - 0.21 + 0.11 × {10^3}{{ }}{{{s}} - 1},{{ or }}≤ft( {17.35 - 0.59 + 0.35} \\right)% of nuclear captures. By tagging excited states emitting gammas, the ground state transition rate to 12B is found to be 5.68 - 0.23 + 0.14 × {10^3}{{ }}{{{s}} - 1}.

Defect control of conventional and anomalous electron transport at complex oxide interfaces

DOE PAGES

Gunkel, F.; Bell, Chris; Inoue, Hisashi; ...

2016-08-30

Using low-temperature electrical measurements, the interrelation between electron transport, magnetic properties, and ionic defect structure in complex oxide interface systems is investigated, focusing on NdGaO 3/SrTiO 3 (100) interfaces. Field-dependent Hall characteristics (2–300 K) are obtained for samples grown at various growth pressures. In addition to multiple electron transport, interfacial magnetism is tracked exploiting the anomalous Hall effect (AHE). These two properties both contribute to a nonlinearity in the field dependence of the Hall resistance, with multiple carrier conduction evident below 30 K and AHE at temperatures ≲10 K. Considering these two sources of nonlinearity, we suggest a phenomenological modelmore » capturing the complex field dependence of the Hall characteristics in the low-temperature regime. Our model allows the extraction of the conventional transport parameters and a qualitative analysis of the magnetization. The electron mobility is found to decrease systematically with increasing growth pressure. This suggests dominant electron scattering by acceptor-type strontium vacancies incorporated during growth. The AHE scales with growth pressure. In conclusion, the most pronounced AHE is found at increased growth pressure and, thus, in the most defective, low-mobility samples, indicating a correlation between transport, magnetism, and cation defect concentration.« less

X-ray transitions studied for decelerated bare and H-like uranium ions at the ESR electron cooler

NASA Astrophysics Data System (ADS)

Gumberidze, A.; Stöhlker, Th.; Bednarz, G.; Beyer, H. F.; Bosch, F.; Cai, X.; Hagmann, S.; Klepper, O.; Kozhuharov, C.; Liesen, D.; Ma, X.; Mokler, P. H.; Sierpowski, D.; Stachura, Z.; Steck, M.; Toleikis, S.; Warczak, A.; Zou, Y.

2003-05-01

Here we report on X-ray spectra induced by spontaneous capture of free electrons into decelerated bare- and hydrogen-like uranium ions which we measured recently at the cooler section of the ESR storage ring. The most intense lines observed in spectra can be attributed to direct transition of electrons into the K shell of the projectile ions and to characteristic L → K (Lyα) transitions. Radiative recombination lines into the K shell of bare and H-like uranium can be exploited for measuring the two-electron contribution to the ground state binding energy in helium-like uranium. The goal is to probe for high-Z ions bound-state QED corrections which are of the order of α2. Besides the dominant characteristic L → K transitions, the strongly reduced Bremsstrahlung (due to the low cooler voltage applied to the decelerated ions) allowed us to observe for the very first time RR transitions into the L shell as well as the balmer radiation located at the low-energy part of the spectra.

Determination of methyltetrahydrophthalic anhydride in air using gas chromatography with electron-capture detection.

PubMed

Johyama, Y; Yokota, K; Fujiki, Y; Takeshita, T; Morimoto, K

1999-10-01

Methyltetrahydrophthalic anhydride (MTHPA) stimulates the production of specific IgE antibodies which can cause occupational allergy even at extremely low levels of exposure (15-22 micrograms/m3). Safe use in industry demands control of the levels of exposure causing allergic diseases. Thus, the air monitoring of MTHPA is very important, and sensitive methods are required to measure low air concentrations or short-time peak exposures. This paper outlines the use of silica-gel tubes for sampling airborne MTHPA vapour, followed by analysis using gas chromatography with electron-capture detection. No breakthrough was observed at 113, 217, 673 and 830 micrograms/m3 (sampling volume 30, 60, 60 and 20 l, respectively; relative humidity 40-55%). Concentrations > 1.0 microgram/m3 could be quantified at 20-min sampling with a sampling rate of 1 l/min. The present method can also be applied to measurements of exposure to hexahydrophthalic and methylhexahydrophthalic anhydride. The risk of MTHPA exposure in two condenser plants was also assessed by determining MTHPA levels in air of the workplace. In conclusion, our method was found to be reliable and sensitive, and can be applied to the evaluation of MTHPA exposure.

Electronic structure and bonding properties of potassium (K) on graphite under external electric field.

NASA Astrophysics Data System (ADS)

Tapia, Alejandro; Canto, Gabriel

2005-03-01

The effect of an external electric field on the potassium (K) adsorption on the graphite surface, are studied by means of first-principles total-energy calculations. The results were obtained with the pseudopotentials LCAO method (SIESTA code) and the Generalized Gradient Approximation (GGA) for the exchange-correlation potential. The structural parameters, bonding properties, and electronic structure of the K-graphite system are studied in the triangular (2x2) overlayer phase as a function of the external electric field magnitude. We find an important change in the K-graphite bonding as a consequence of the charge transfer from the adatom towards the substrate induced by the electric field. The results are discussed in the light of the experimental observed difussion of K into graphite induced by external electric fields. This work was supported by Consejo Nacional de Ciencia y Tecnolog'ia (CONACYT, M'exico) under Grants No. 43830-F and No. 44831-F.

Tables of stark level transition probabilities and branching ratios in hydrogen-like atoms

NASA Technical Reports Server (NTRS)

Omidvar, K.

1980-01-01

The transition probabilities which are given in terms of n prime k prime and n k are tabulated. No additional summing or averaging is necessary. The electric quantum number k plays the role of the angular momentum quantum number l in the presence of an electric field. The branching ratios between stark levels are also tabulated. Necessary formulas for the transition probabilities and branching ratios are given. Symmetries are discussed and selection rules are given. Some disagreements for some branching ratios are found between the present calculation and the measurement of Mark and Wierl. The transition probability multiplied by the statistical weight of the initial state is called the static intensity J sub S, while the branching ratios are called the dynamic intensity J sub D.

Arrhenius Behavior of Electron Attachment to CH3Br from 303 to 1100 K

DTIC Science & Technology

2013-12-21

Spectrometry journa l homepage: www.e lsev ier .com/ locate / i jms rrhenius behavior of electron attachment to CH3Br from 03 to 1100K homas M. Miller1...Nicholas S. Shuman, Albert A. Viggiano ∗ ir Force Research Laboratory, Space Vehicles Directorate, Kirtland Air Force Base, NM 87117-5776, USA r t i

MeV electron acceleration at 1kHz with <10 mJ laser pulses

NASA Astrophysics Data System (ADS)

Salehi, Fatholah; Goers, Andy; Hine, George; Feder, Linus; Kuk, Donghoon; Kim, Ki-Yong; Milchberg, Howard

2016-10-01

We demonstrate laser driven acceleration of electrons at 1 kHz repetition rate with pC charge above 1MeV per shot using < 10 mJ pulse energies focused on a near-critical density He or H2 gas jet. Using the H2 gas jet, electron acceleration to 0.5 MeV in 10 fC bunches was observed with laser pulse energy as low as 1.3mJ . Using a near-critical density gas jet sets the critical power required for relativistic self-focusing low enough for mJ scale laser pulses to self- focus and drive strong wakefields. Experiments and particle-in-cell simulations show that optimal drive pulse duration and chirp for maximum electron bunch charge and energy depends on the target gas species. High repetition rate, high charge, and short duration electron bunches driven by very modest pulse energies constitutes an ideal portable electron source for applications such as ultrafast electron diffraction experiments and high rep. rate γ-ray production. This work is supported by the US Department of Energy, the National Science Foundation, and the Air Force Office of Scientific Research.

Contributions of Microtubule Dynamic Instability and Rotational Diffusion to Kinetochore Capture.

PubMed

Blackwell, Robert; Sweezy-Schindler, Oliver; Edelmaier, Christopher; Gergely, Zachary R; Flynn, Patrick J; Montes, Salvador; Crapo, Ammon; Doostan, Alireza; McIntosh, J Richard; Glaser, Matthew A; Betterton, Meredith D

2017-02-07

Microtubule dynamic instability allows search and capture of kinetochores during spindle formation, an important process for accurate chromosome segregation during cell division. Recent work has found that microtubule rotational diffusion about minus-end attachment points contributes to kinetochore capture in fission yeast, but the relative contributions of dynamic instability and rotational diffusion are not well understood. We have developed a biophysical model of kinetochore capture in small fission-yeast nuclei using hybrid Brownian dynamics/kinetic Monte Carlo simulation techniques. With this model, we have studied the importance of dynamic instability and microtubule rotational diffusion for kinetochore capture, both to the lateral surface of a microtubule and at or near its end. Over a range of biologically relevant parameters, microtubule rotational diffusion decreased capture time, but made a relatively small contribution compared to dynamic instability. At most, rotational diffusion reduced capture time by 25%. Our results suggest that while microtubule rotational diffusion can speed up kinetochore capture, it is unlikely to be the dominant physical mechanism for typical conditions in fission yeast. In addition, we found that when microtubules undergo dynamic instability, lateral captures predominate even in the absence of rotational diffusion. Counterintuitively, adding rotational diffusion to a dynamic microtubule increases the probability of end-on capture. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Survival and selection of migrating salmon from capture-recapture models with individual traits

USGS Publications Warehouse

Zabel, R.W.; Wagner, T.; Congleton, J.L.; Smith, S.G.; Williams, J.G.

2005-01-01

Capture-recapture studies are powerful tools for studying animal population dynamics, providing information on population abundance, survival rates, population growth rates, and selection for phenotypic traits. In these studies, the probability of observing a tagged individual reflects both the probability of the individual surviving to the time of recapture and the probability of recapturing an animal, given that it is alive. If both of these probabilities are related to the same phenotypic trait, it can be difficult to distinguish effects on survival probabilities from effects on recapture probabilities. However, when animals are individually tagged and have multiple opportunities for recapture, we can properly partition observed trait-related variability into survival and recapture components. We present an overview of capture-recapture models that incorporate individual variability and develop methods to incorporate results from these models into estimates of population survival and selection for phenotypic traits. We conducted a series of simulations to understand the performance of these estimators and to assess the consequences of ignoring individual variability when it exists. In addition, we analyzed a large data set of > 153 000 juvenile chinook salmon (Oncorhynchus tshawytscha) and steelhead (O. mykiss) of known length that were PIT-tagged during their seaward migration. Both our simulations and the case study indicated that the ability to precisely estimate selection for phenotypic traits was greatly compromised when differential recapture probabilities were ignored. Estimates of population survival, however, were far more robust. In the chinook salmon and steelhead study, we consistently found that smaller fish had a greater probability of recapture. We also uncovered length-related survival relationships in over half of the release group/river segment combinations that we observed, but we found both positive and negative relationships between length

Probability in reasoning: a developmental test on conditionals.

PubMed

Barrouillet, Pierre; Gauffroy, Caroline

2015-04-01

Probabilistic theories have been claimed to constitute a new paradigm for the psychology of reasoning. A key assumption of these theories is captured by what they call the Equation, the hypothesis that the meaning of the conditional is probabilistic in nature and that the probability of If p then q is the conditional probability, in such a way that P(if p then q)=P(q|p). Using the probabilistic truth-table task in which participants are required to evaluate the probability of If p then q sentences, the present study explored the pervasiveness of the Equation through ages (from early adolescence to adulthood), types of conditionals (basic, causal, and inducements) and contents. The results reveal that the Equation is a late developmental achievement only endorsed by a narrow majority of educated adults for certain types of conditionals depending on the content they involve. Age-related changes in evaluating the probability of all the conditionals studied closely mirror the development of truth-value judgements observed in previous studies with traditional truth-table tasks. We argue that our modified mental model theory can account for this development, and hence for the findings related with the probability task, which do not consequently support the probabilistic approach of human reasoning over alternative theories. Copyright © 2014 Elsevier B.V. All rights reserved.

Radiobiological response of U251MG, CHO-K1 and V79 cell lines to accelerator-based boron neutron capture therapy

PubMed Central

Sato, Eisuke; Zaboronok, Alexander; Yamamoto, Tetsuya; Nakai, Kei; Taskaev, Sergey; Volkova, Olga; Mechetina, Ludmila; Taranin, Alexander; Kanygin, Vladimir; Isobe, Tomonori; Mathis, Bryan J; Matsumura, Akira

2018-01-01

Abstract In the current article, we provide in vitro efficacy evaluation of a unique accelerator-based neutron source, constructed at the Budker Institute of Nuclear Physics (Novosibirsk, Russian Federation), for boron neutron capture therapy (BNCT), which is particularly effective in the case of invasive cancers. U251MG, CHO-K1 and V79 cells were incubated and irradiated in various concentrations of boric acid with epithermal neutrons for 2–3 h in a plexiglass phantom, using 2.0 MeV proton energy and 1.5–3.0 mA proton current, resulting in a neutron fluence of 2.16 × 1012 cm−2. The survival curves of cells loaded with boron were normalized to those irradiated without boron (to exclude the influence of the fast neutron and gamma dose components) and fit to the linear–quadratic (LQ) model. Colony formation assays showed the following cell survival rates (means ± SDs): CHO-K1: 0.348 ± 0.069 (10 ppm), 0.058 ± 0.017 (20 ppm), 0.018 ± 0.005 (40 ppm); V79: 0.476 ± 0.160 (10 ppm), 0.346 ± 0.053 (20 ppm), 0.078 ± 0.015 (40 ppm); and U251MG: 0.311 ± 0.061 (10 ppm), 0.131 ± 0.022 (20 ppm), 0.020 ± 0.010 (40 ppm). The difference between treated cells and controls was significant in all cases (P < 0.01) and confirmed that the neutron source and irradiation regimen were sufficient for control over cell colony formation. We believe our study will serve as a model for ongoing in vitro experiments on neutron capture therapy to advance in this area for further development of accelerator-based BNCT into the clinical phase. PMID:29281044

Neuroinformatics Software Applications Supporting Electronic Data Capture, Management, and Sharing for the Neuroimaging Community

PubMed Central

Nichols, B. Nolan; Pohl, Kilian M.

2017-01-01

Accelerating insight into the relation between brain and behavior entails conducting small and large-scale research endeavors that lead to reproducible results. Consensus is emerging between funding agencies, publishers, and the research community that data sharing is a fundamental requirement to ensure all such endeavors foster data reuse and fuel reproducible discoveries. Funding agency and publisher mandates to share data are bolstered by a growing number of data sharing efforts that demonstrate how information technologies can enable meaningful data reuse. Neuroinformatics evaluates scientific needs and develops solutions to facilitate the use of data across the cognitive and neurosciences. For example, electronic data capture and management tools designed to facilitate human neurocognitive research can decrease the setup time of studies, improve quality control, and streamline the process of harmonizing, curating, and sharing data across data repositories. In this article we outline the advantages and disadvantages of adopting software applications that support these features by reviewing the tools available and then presenting two contrasting neuroimaging study scenarios in the context of conducting a cross-sectional and a multisite longitudinal study. PMID:26267019

The Impact of Phosphorylation on Electron Capture Dissociation of Proteins: A Top-Down Perspective

NASA Astrophysics Data System (ADS)

Chen, Bifan; Guo, Xiao; Tucholski, Trisha; Lin, Ziqing; McIlwain, Sean; Ge, Ying

2017-09-01

Electron capture dissociation (ECD) is well suited for the characterization of phosphoproteins, with which labile phosphate groups are generally preserved during the fragmentation process. However, the impact of phosphorylation on ECD fragmentation of intact proteins remains unclear. Here, we have performed a systematic investigation of the phosphorylation effect on ECD of intact proteins by comparing the ECD cleavages of mono-phosphorylated α-casein, multi-phosphorylated β-casein, and immunoaffinity-purified phosphorylated cardiac troponin I with those of their unphosphorylated counterparts, respectively. In contrast to phosphopeptides, phosphorylation has significantly reduced deleterious effects on the fragmentation of intact proteins during ECD. On a global scale, the fragmentation patterns are highly comparable between unphosphorylated and phosphorylated precursors under the same ECD conditions, despite a slight decrease in the number of fragment ions observed for the phosphorylated forms. On a local scale, single phosphorylation of intact proteins imposes minimal effects on fragmentation near the phosphorylation sites, but multiple phosphorylations in close proximity result in a significant reduction of ECD bond cleavages. [Figure not available: see fulltext.

The effects of water depth on prey detection and capture by juvenile coho salmon and steelhead

Treesearch

J.J. Piccolo; N.F. Hughes; M.D. Bryant

2007-01-01

We used three-dimensional video analysis of feeding experiments to determine the effects of water depth on prey detection and capture by drift-feeding juvenile coho salmon (Oncorhynchus kisutch) and steelhead (0. mykiss irideus). Depth treatments were 0.15, 0.30, 0.45 and 0.60 m. Mean prey capture probabilities for both species...

Two-Photon Absorption of Soft X-Ray Free Electron Laser Radiation by Graphite Near the Carbon K-Absorption Edge

DOE Office of Scientific and Technical Information (OSTI.GOV)

Christensen, Steven T; Lam, Royce K.; Raj, Sumana L.

We have examined the transmission of soft X-ray pulses from the FERMI free electron laser through carbon films of varying thickness, quantifying nonlinear effects of pulses above and below the carbon K-edge. At typical of soft X-ray free electron laser intensities, pulses exhibit linear absorption at photon energies above and below the K-edge, ~308 and ~260 eV, respectively; whereas two-photon absorption becomes significant slightly below the K-edge, ~284.2 eV. The measured two-photon absorption cross section at 284.18 eV (~6 x 10-48 cm4 s) is 7 orders of magnitude above what is expected from a simple theory based on hydrogen-like atomsmore » - a result of resonance effects.« less

Two-photon absorption of soft X-ray free electron laser radiation by graphite near the carbon K-absorption edge

NASA Astrophysics Data System (ADS)

Lam, Royce K.; Raj, Sumana L.; Pascal, Tod A.; Pemmaraju, C. D.; Foglia, Laura; Simoncig, Alberto; Fabris, Nicola; Miotti, Paolo; Hull, Christopher J.; Rizzuto, Anthony M.; Smith, Jacob W.; Mincigrucci, Riccardo; Masciovecchio, Claudio; Gessini, Alessandro; De Ninno, Giovanni; Diviacco, Bruno; Roussel, Eleonore; Spampinati, Simone; Penco, Giuseppe; Di Mitri, Simone; Trovò, Mauro; Danailov, Miltcho B.; Christensen, Steven T.; Sokaras, Dimosthenis; Weng, Tsu-Chien; Coreno, Marcello; Poletto, Luca; Drisdell, Walter S.; Prendergast, David; Giannessi, Luca; Principi, Emiliano; Nordlund, Dennis; Saykally, Richard J.; Schwartz, Craig P.

2018-07-01

We have examined the transmission of soft X-ray pulses from the FERMI free electron laser through carbon films of varying thickness, quantifying nonlinear effects of pulses above and below the carbon K-edge. At typical of soft X-ray free electron laser intensities, pulses exhibit linear absorption at photon energies above and below the K-edge, ∼308 and ∼260 eV, respectively; whereas two-photon absorption becomes significant slightly below the K-edge, ∼284.2 eV. The measured two-photon absorption cross section at 284.18 eV (∼6 × 10-48 cm4 s) is 7 orders of magnitude above what is expected from a simple theory based on hydrogen-like atoms - a result of resonance effects.

Bonding in uranium(V) hexafluoride based on the experimental electron density distribution measured at 20 K

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gianopoulos, Christopher G.; Zhurov, Vladimir V.; Minasian, Stefan G.

The electron density distribution of [PPh 4][UF 6] was obtained from high-resolution X-ray diffraction data measured at 20 K. The electron density was modeled with an augmented Hansen–Coppens multipolar formalism. Topological analysis reveals that the U–F bond is of incipient covalent nature. Theoretical calculations add further support to the bonding description gleaned from the experimental model. The impact of the uranium anomalous dispersion terms on the refinement is also discussed.

Bonding in uranium(V) hexafluoride based on the experimental electron density distribution measured at 20 K

DOE PAGES

Gianopoulos, Christopher G.; Zhurov, Vladimir V.; Minasian, Stefan G.; ...

2017-02-06

The electron density distribution of [PPh 4][UF 6] was obtained from high-resolution X-ray diffraction data measured at 20 K. The electron density was modeled with an augmented Hansen–Coppens multipolar formalism. Topological analysis reveals that the U–F bond is of incipient covalent nature. Theoretical calculations add further support to the bonding description gleaned from the experimental model. The impact of the uranium anomalous dispersion terms on the refinement is also discussed.

Modeling spatial variation in avian survival and residency probabilities

USGS Publications Warehouse

Saracco, James F.; Royle, J. Andrew; DeSante, David F.; Gardner, Beth

2010-01-01

The importance of understanding spatial variation in processes driving animal population dynamics is widely recognized. Yet little attention has been paid to spatial modeling of vital rates. Here we describe a hierarchical spatial autoregressive model to provide spatially explicit year-specific estimates of apparent survival (phi) and residency (pi) probabilities from capture-recapture data. We apply the model to data collected on a declining bird species, Wood Thrush (Hylocichla mustelina), as part of a broad-scale bird-banding network, the Monitoring Avian Productivity and Survivorship (MAPS) program. The Wood Thrush analysis showed variability in both phi and pi among years and across space. Spatial heterogeneity in residency probability was particularly striking, suggesting the importance of understanding the role of transients in local populations. We found broad-scale spatial patterning in Wood Thrush phi and pi that lend insight into population trends and can direct conservation and research. The spatial model developed here represents a significant advance over approaches to investigating spatial pattern in vital rates that aggregate data at coarse spatial scales and do not explicitly incorporate spatial information in the model. Further development and application of hierarchical capture-recapture models offers the opportunity to more fully investigate spatiotemporal variation in the processes that drive population changes.

Counterion effects on the ultrafast dynamics of charge-transfer-to-solvent electrons.

PubMed

Rivas, N; Moriena, G; Domenianni, L; Hodak, J H; Marceca, E

2017-12-06

We performed femtosecond transient absorption (TA) experiments to monitor the solvation dynamics of charge-transfer-to-solvent (CTTS) electrons originating from UV photoexcitation of ammoniated iodide in close proximity to the counterions. Solutions of KI were prepared in liquid ammonia and TA experiments were carried out at different temperatures and densities, along the liquid-gas coexistence curve of the fluid. The results complement previous femtosecond TA work by P. Vöhringer's group in neat ammonia via multiphoton ionization. The dynamics of CTTS-detached electrons in ammonia was found to be strongly affected by ion pairing. Geminate recombination time constants as well as escape probabilities were determined from the measured temporal profiles and analysed as a function of the medium density. A fast unresolved (τ < 250 fs) increase of absorption related to the creation/thermalization of solvated electron species was followed by two decay components: one with a characteristic time around 10 ps, and a slower one that remains active for hundreds of picoseconds. While the first process is attributed to an early recombination of (I, e - ) pairs, the second decay and its asymptote reflects the effect of the K + counterion on the geminate recombination dynamics, rate and yield. The cation basically acts as an electron anchor that restricts the ejection distance, leading to solvent-separated counterion-electron species. The formation of (K + , NH 3 , e - ) pairs close to the parent iodine atom brings the electron escape probability to very low values. Transient spectra of the electron species have also been estimated as a function of time by probing the temporal profiles at different wavelengths.

Studies of the oxidized Cu(100) surface using positron annihilation induced Auger electron spectroscopy

NASA Astrophysics Data System (ADS)

Maddox, W.; Fazleev, N. G.; Nadesalingam, M. P.; Weiss, A. H.

2008-03-01

We discuss recent progress in studies of an oxidized Cu(100) single crystal subjected to vacuum annealing over a temperature range from 293K to 1073K using positron annihilation induced Auger electron spectroscopy (PAES). The PAES measurements show a large monotonic increase in the intensity of the positron annihilation induced Cu M2,3 VV Auger peak as the sample is subjected to a series of isochronal anneals in vacuum up to annealing temperature 573 K. The intensity then decreases monotonically as the annealing temperature is increased to 873 K. Experimental PAES results are analyzed by performing calculations of positron surface states and annihilation probabilities of surface-trapped positrons with relevant core electrons taking into account the charge redistribution at the surface, surface reconstructions, and electron-positron correlations effects. The effects of oxygen adsorption and surface reconstruction on localization of positron surface state wave functions and annihilation characteristics are analyzed. Possible explanations are provided for the observed behavior of the intensity of positron annihilation induced Cu M2,3VV Auger peak with changes of the annealing temperature.

Rare reaction channels in real-time time-dependent density functional theory: the test case of electron attachment

NASA Astrophysics Data System (ADS)

Lacombe, Lionel; Dinh, P. Huong Mai; Reinhard, Paul-Gerhard; Suraud, Eric; Sanche, Leon

2015-08-01

We present an extension of standard time-dependent density functional theory (TDDFT) to include the evaluation of rare reaction channels, taking as an example of application the theoretical modelling of electron attachment to molecules. The latter process is of great importance in radiation-induced damage of biological tissue for which dissociative electron attachment plays a decisive role. As the attachment probability is very low, it cannot be extracted from the TDDFT propagation whose mean field provides an average over various reaction channels. To extract rare events, we augment TDDFT by a perturbative treatment to account for the occasional jumps, namely electron capture in our test case. We apply the modelling to electron attachment to H2O, H3O+, and (H2O)2. Dynamical calculations have been done at low energy (3-16 eV). We explore, in particular, how core-excited states of the targets show up as resonances in the attachment probability. Contribution to the Topical Issue "COST Action Nano-IBCT: Nano-scale Processes Behind Ion-Beam Cancer Therapy", edited by Andrey Solov'yov, Nigel Mason, Gustavo García, Eugene Surdutovich.

High Precision 40K/39K Ratio Determination

NASA Astrophysics Data System (ADS)

Naumenko, M. O.; Mezger, K.; Nagler, T. F.; Villa, I. M.

2012-12-01

Potassium is one of the eight most abundant chemical elements in the Earth's crust and a major element in many rock-forming minerals. The isotope 40K is radioactive and undergoes β- decay to 40Ca (ca. 89.3%) and electron capture to 40Ar (ca. 10.7%). Both decays can potentially be used as dating systems. The most commonly used branch is the decay of 40K to 40Ar because it can yield highly precise ages. Both decay schemes rely on the knowledge of the 40K branching ratio and the natural 40K abundance. A 40K abundance of 0.011672±41 % was measured on terrestrial material [1]. The relative uncertainty of 0.35 % has not been improved since. Recent improvements in the precision of mass spectrometric measurements have led to the situation that the uncertainties on the K decay constant and the abundance of 40K are a major source of uncertainty on the measured ages. A more precise definition of the 40K decay constant was attempted by different research groups within the last decade [2-9] but the goal of obtaining 0.1 % relative uncertainty on K-Ar ages for geological materials, as requested by the EARTHtime initiative, has not been achieved yet. In order to improve on this situation we studied the abundances of the K isotopes in terrestrial standards. A ThermoFischer Triton+ thermal ionisation mass spectrometer was used for K isotope ratio measurements of the NIST SRM 918b K standard loaded on Ta filaments with 0.1M phosphoric acid. Three techniques were applied: (A) dynamic measurement with in-run normalisation to the IUPAC value 41K/39K=0.072168; (B) a simple total evaporation procedure; (C) the "NBL-modified" total evaporation [10]. The 40K ion beam was measured in a Faraday cup with a 1E12 Ω resistor; 39K and 41K were collected in Faraday cups with 1E11 Ω resistors. Amplifier gains were intercalibrated by supplying fixed voltages off-line. Different measurement techniques were combined with different loading procedures. We also tested ionisation yields for the

On the electron affinity of cytosine in bulk water and at hydrophobic aqueous interfaces.

PubMed

Vöhringer-Martinez, Esteban; Dörner, Ciro; Abel, Bernd

2014-10-01

In the past one possible mechanism of DNA damage in bulk water has been attributed to the presence of hydrated electrons in water. Recently, one important property of hydrated electrons, namely their binding energy, was reported to be smaller at hydrophobic interfaces than in bulk aqueous solution. This possibly opens up new reaction possibilities with different solutes such as the DNA at hydrophobic, aqueous interfaces. Here, we use QM/MM molecular dynamics simulation to study how the molecular environment at the vacuum-water interface and in the bulk alters the electron affinity of cytosine being a characteristic part of the DNA. The electron affinity at the interface is closer to the corresponding binding energy of the partially hydrated electron. The increased energy resonance makes the electron capture process more probable and suggests that hydrated electrons at hydrophobic interfaces may be more reactive than the fully hydrated ones. Additionally, we found that the relaxation of the anionic form after electron attachment also induces a proton transfer from the surrounding solvent that was confirmed by comparison with the experimental reduction potential.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Two-step rapid sulfur capture. Final report

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1994-04-01

The primary goal of this program was to test the technical and economic feasibility of a novel dry sorbent injection process called the Two-Step Rapid Sulfur Capture process for several advanced coal utilization systems. The Two-Step Rapid Sulfur Capture process consists of limestone activation in a high temperature auxiliary burner for short times followed by sorbent quenching in a lower temperature sulfur containing coal combustion gas. The Two-Step Rapid Sulfur Capture process is based on the Non-Equilibrium Sulfur Capture process developed by the Energy Technology Office of Textron Defense Systems (ETO/TDS). Based on the Non-Equilibrium Sulfur Capture studies the rangemore » of conditions for optimum sorbent activation were thought to be: activation temperature > 2,200 K for activation times in the range of 10--30 ms. Therefore, the aim of the Two-Step process is to create a very active sorbent (under conditions similar to the bomb reactor) and complete the sulfur reaction under thermodynamically favorable conditions. A flow facility was designed and assembled to simulate the temperature, time, stoichiometry, and sulfur gas concentration prevalent in the advanced coal utilization systems such as gasifiers, fluidized bed combustors, mixed-metal oxide desulfurization systems, diesel engines, and gas turbines.« less

High voltage studies of inverted-geometry ceramic insulators for a 350 kV DC polarized electron gun

DOE PAGES

Hernandez-Garcia, C.; Poelker, M.; Hansknecht, J.

2016-02-01

Jefferson Lab is constructing a 350 kV direct current high voltage photoemission gun employing a compact inverted-geometry insulator. This photogun will produce polarized electron beams at an injector test facility intended for low energy nuclear physics experiments, and to assist the development of new technology for the Continuous Electron Beam Accelerator Facility. A photogun operating at 350kV bias voltage reduces the complexity of the injector design, by eliminating the need for a graded-beta radio frequency “capture” section employed to boost lower voltage beams to relativistic speed. However, reliable photogun operation at 350 kV necessitates solving serious high voltage problems relatedmore » to breakdown and field emission. This study focuses on developing effective methods to avoid breakdown at the interface between the insulator and the commercial high voltage cable that connects the photogun to the high voltage power supply. Three types of inverted insulators were tested, in combination with two electrode configurations. Our results indicate that tailoring the conductivity of the insulator material, and/or adding a cathode triple-junction screening electrode, effectively serves to increase the hold-off voltage from 300kV to more than 375kV. In conclusion, electrostatic field maps suggest these configurations serve to produce a more uniform potential gradient across the insulator.« less

High voltage studies of inverted-geometry ceramic insulators for a 350 kV DC polarized electron gun

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hernandez-Garcia, C.; Poelker, M.; Hansknecht, J.

Jefferson Lab is constructing a 350 kV direct current high voltage photoemission gun employing a compact inverted-geometry insulator. This photogun will produce polarized electron beams at an injector test facility intended for low energy nuclear physics experiments, and to assist the development of new technology for the Continuous Electron Beam Accelerator Facility. A photogun operating at 350kV bias voltage reduces the complexity of the injector design, by eliminating the need for a graded-beta radio frequency “capture” section employed to boost lower voltage beams to relativistic speed. However, reliable photogun operation at 350 kV necessitates solving serious high voltage problems relatedmore » to breakdown and field emission. This study focuses on developing effective methods to avoid breakdown at the interface between the insulator and the commercial high voltage cable that connects the photogun to the high voltage power supply. Three types of inverted insulators were tested, in combination with two electrode configurations. Our results indicate that tailoring the conductivity of the insulator material, and/or adding a cathode triple-junction screening electrode, effectively serves to increase the hold-off voltage from 300kV to more than 375kV. In conclusion, electrostatic field maps suggest these configurations serve to produce a more uniform potential gradient across the insulator.« less

Consequences of electrical conductivity in an orb spider's capture web

NASA Astrophysics Data System (ADS)

Vollrath, Fritz; Edmonds, Donald

2013-12-01

The glue-coated and wet capture spiral of the orb web of the garden cross spider Araneus diadematus is suspended between the dry silk radial and web frame threads. Here, we experimentally demonstrate that the capture spiral is electrically conductive because of necks of liquid connecting the droplets even if the thread is stretched. We examine how this conductivity of the capture spiral may lead to entrapment of charged airborne particles such as pollen, spray droplets and even insects. We further describe and model how the conducting spiral will also locally distort the Earth's ambient electric field. Finally, we examine the hypothesis that such distortion could be used by potential prey to detect the presence of a web but conclude that any effect would probably be too small to allow an insect to take evasive action.

Knotting probability of self-avoiding polygons under a topological constraint.

PubMed

Uehara, Erica; Deguchi, Tetsuo

2017-09-07

We define the knotting probability of a knot K by the probability for a random polygon or self-avoiding polygon (SAP) of N segments having the knot type K. We show fundamental and generic properties of the knotting probability particularly its dependence on the excluded volume. We investigate them for the SAP consisting of hard cylindrical segments of unit length and radius r ex . For various prime and composite knots, we numerically show that a compact formula describes the knotting probabilities for the cylindrical SAP as a function of segment number N and radius r ex . It connects the small-N to the large-N behavior and even to lattice knots in the case of large values of radius. As the excluded volume increases, the maximum of the knotting probability decreases for prime knots except for the trefoil knot. If it is large, the trefoil knot and its descendants are dominant among the nontrivial knots in the SAP. From the factorization property of the knotting probability, we derive a sum rule among the estimates of a fitting parameter for all prime knots, which suggests the local knot picture and the dominance of the trefoil knot in the case of large excluded volumes. Here we remark that the cylindrical SAP gives a model of circular DNA which is negatively charged and semiflexible, where radius r ex corresponds to the screening length.

Knotting probability of self-avoiding polygons under a topological constraint

NASA Astrophysics Data System (ADS)

Uehara, Erica; Deguchi, Tetsuo

2017-09-01

We define the knotting probability of a knot K by the probability for a random polygon or self-avoiding polygon (SAP) of N segments having the knot type K. We show fundamental and generic properties of the knotting probability particularly its dependence on the excluded volume. We investigate them for the SAP consisting of hard cylindrical segments of unit length and radius rex. For various prime and composite knots, we numerically show that a compact formula describes the knotting probabilities for the cylindrical SAP as a function of segment number N and radius rex. It connects the small-N to the large-N behavior and even to lattice knots in the case of large values of radius. As the excluded volume increases, the maximum of the knotting probability decreases for prime knots except for the trefoil knot. If it is large, the trefoil knot and its descendants are dominant among the nontrivial knots in the SAP. From the factorization property of the knotting probability, we derive a sum rule among the estimates of a fitting parameter for all prime knots, which suggests the local knot picture and the dominance of the trefoil knot in the case of large excluded volumes. Here we remark that the cylindrical SAP gives a model of circular DNA which is negatively charged and semiflexible, where radius rex corresponds to the screening length.

Large effective mass and interaction-enhanced Zeeman splitting of K -valley electrons in MoSe2

NASA Astrophysics Data System (ADS)

Larentis, Stefano; Movva, Hema C. P.; Fallahazad, Babak; Kim, Kyounghwan; Behroozi, Armand; Taniguchi, Takashi; Watanabe, Kenji; Banerjee, Sanjay K.; Tutuc, Emanuel

2018-05-01

We study the magnetotransport of high-mobility electrons in monolayer and bilayer MoSe2, which show Shubnikov-de Haas (SdH) oscillations and quantum Hall states in high magnetic fields. An electron effective mass of 0.8 me is extracted from the SdH oscillations' temperature dependence; me is the bare electron mass. At a fixed electron density the longitudinal resistance shows minima at filling factors (FFs) that are either predominantly odd, or predominantly even, with a parity that changes as the density is tuned. The SdH oscillations are insensitive to an in-plane magnetic field, consistent with an out-of-plane spin orientation of electrons at the K point. We attribute the FF parity transitions to an interaction enhancement of the Zeeman energy as the density is reduced, resulting in an increased Zeeman-to-cyclotron energy ratio.

k0-INAA for determining chemical elements in bird feathers

NASA Astrophysics Data System (ADS)

França, Elvis J.; Fernandes, Elisabete A. N.; Fonseca, Felipe Y.; Antunes, Alexsander Z.; Bardini Junior, Claudiney; Bacchi, Márcio A.; Rodrigues, Vanessa S.; Cavalca, Isabel P. O.

2010-10-01

The k0-method instrumental neutron activation analysis ( k0-INAA) was employed for determining chemical elements in bird feathers. A collection was obtained taking into account several bird species from wet ecosystems in diverse regions of Brazil. For comparison reason, feathers were actively sampled in a riparian forest from the Marins Stream, Piracicaba, São Paulo State, using mist nets specific for capturing birds. Biological certified reference materials were used for assessing the quality of analytical procedure. Quantification of chemical elements was performed using the k0-INAA Quantu Software. Sixteen chemical elements, including macro and micronutrients, and trace elements, have been quantified in feathers, in which analytical uncertainties varied from 2% to 40% depending on the chemical element mass fraction. Results indicated high mass fractions of Br (max=7.9 mg kg -1), Co (max=0.47 mg kg -1), Cr (max=68 mg kg -1), Hg (max=2.79 mg kg -1), Sb (max=0.20 mg kg -1), Se (max=1.3 mg kg -1) and Zn (max=192 mg kg -1) in bird feathers, probably associated with the degree of pollution of the areas evaluated. In order to corroborate the use of k0-INAA results in biomonitoring studies using avian community, different factor analysis methods were used to check chemical element source apportionment and locality clustering based on feather chemical composition.

Experimental investigation of a 1 kA/cm² sheet beam plasma cathode electron gun.

PubMed

Kumar, Niraj; Pal, Udit Narayan; Pal, Dharmendra Kumar; Prajesh, Rahul; Prakash, Ram

2015-01-01

In this paper, a cold cathode based sheet-beam plasma cathode electron gun is reported with achieved sheet-beam current density ∼1 kA/cm(2) from pseudospark based argon plasma for pulse length of ∼200 ns in a single shot experiment. For the qualitative assessment of the sheet-beam, an arrangement of three isolated metallic-sheets is proposed. The actual shape and size of the sheet-electron-beam are obtained through a non-conventional method by proposing a dielectric charging technique and scanning electron microscope based imaging. As distinct from the earlier developed sheet beam sources, the generated sheet-beam has been propagated more than 190 mm distance in a drift space region maintaining sheet structure without assistance of any external magnetic field.

Tuning anion-functionalized ionic liquids for improved SO2 capture.

PubMed

Cui, Guokai; Zheng, Junjie; Luo, Xiaoyan; Lin, Wenjun; Ding, Fang; Li, Haoran; Wang, Congmin

2013-09-27

You can have your cake and eat it too: A "dual-tuning" strategy for improving the capture of SO2 was developed by introducing electron-withdrawing sites on the anions to produce several kinds of functionalized ionic liquids. Those functionalized with a halogen group exhibited improved performance over their non-halogenated counterparts, leading to highly efficient and reversible capture. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Studying Electron-Capture on ^64Zn in Supernovae with the (t,^3He) Charge-Exchange Reaction

NASA Astrophysics Data System (ADS)

Hitt, G. W.; Austin, Sam M.; Bazin, D.; Gade, A.; Guess, C. J.; Galaviz-Redondo, D.; Shimbara, Y.; Tur, C.; Zegers, R. G. T.; Horoi, M.; Howard, M. E.; Smith, E. E.

2008-10-01

A secondary, 115 MeV/u triton beam has been developed at NSCL for use in (t,^3He) charge-exchange(CE) reaction studies. This (n,p)-type CE reaction is useful for extracting the full Gamow-Teller (GT) response of the nucleus, overcoming Q-value restrictions present in conventional beta-decay studies. The strength (B(GT)) in ^64Cu has been determined from the absolute cross section measurement of ^64Zn(t,^3He) near zero-degrees, exploiting an empirical proportionality between cross section and B(GT). The detailed features of the B(GT) distribution in a nucleus has an important impact on electron-capture (EC) rates in Type Ia and Core-Collapse supernovae. The measured B(GT) in ^64Cu is directly compared with the results of modern shell model interactions which are used to calculate the GT contribution to EC on nuclei in supernova simulations.

Theoretical study of LiK and LiK+ in adiabatic representation

NASA Astrophysics Data System (ADS)

Al-dossary, Omar M.; Khelifi, Neji

2014-01-01

The potential energy curves have been calculated for the electronic states of the molecule LiK within the range 3 to 300 a.u., of the internuclear distance R. Using an ab initio method, through a semiempirical spin-orbit pseudo-potential for the Li (1 s 2) and K (1 s 22 s 22 p 63 s 23 p 6) cores and core valence correlation correction added to the electrostatic Hamiltonian with Gaussian basis sets for both atoms. The core valence effects including core-polarization and core-valence correlation are taken into account by using an l-dependent core-polarization potential. The molecular orbitals have been derived from self-consistent field (SCF) calculation. The spectroscopic constants, dipole moments and vibrational levels of the lowest electronic states of the LiK molecule dissociating into K (4 s, 4 p, 5 s, 3 d, and 5 p) + Li (2 s, 2 p, 3 s, and 3 p) in 1, 3Σ, 1, 3Π, and 1, 3Δ symmetries. Adiabatic results are also reported for 2Σ, 2Π, and 2Δ electronic states of the molecular ion LiK+ dissociating into Li (2 s, 2 p, 3 s, and 3 p) + K+ and Li+ + K (4 s, 4 p, 5 s, 3 d, and 5 p). The comparison of the present results with those available in the literature shows a very good agreement in spectroscopic constants of some lowest states of the LiK and LiK+ molecules, especially with the available theoretical works. The existence of numerous avoided crossing between electronic states of 2Σ and 2Π symmetries is related to the charge transfer process between the two ionic systems Li+K and LiK+.

Thermal electron attachment to chlorinated alkenes in the gas phase

NASA Astrophysics Data System (ADS)

Wnorowski, K.; Wnorowska, J.; Michalczuk, B.; Jówko, A.; Barszczewska, W.

2017-01-01

This paper reports the measurements of the rate coefficients and the activation energies of the electron capture processes with various chlorinated alkenes. The electron attachment processes in the mixtures of chlorinated alkenes with carbon dioxide have been investigated using a Pulsed Townsend technique. This study has been performed in the temperature range (298-378) K. The obtained rate coefficients more or less depended on temperature in accordance to Arrhenius equation. The activation energies (Ea's) were determined from the fit to the experimental data points with function ln(k) = ln(A) - Ea/kBT. The rate coefficients at 298 K were equal to 1.0 × 10-10 cm3 s-1, 2.2 × 10-11 cm3 s-1, 1.6 × 10-9 cm3 s-1, 4.4 × 10-8 cm3 s-1, 2.9 × 10-12 cm3 s-1 and 7.3 × 10-12 cm3 s-1 and activation energies were: 0.27 eV, 0.26 eV, 0.25 eV, 0.21 eV, 0.55 eV and 0.42 eV, for trans-1,2-dichloroethylene, cis-1,2-dichloroethylene, trichloroethylene, tetrachloroethylene, 2-chloropropene, 3-chloropropene respectively.

The microbe capture experiment in space: Fluorescence microscopic detection of microbes captured by aerogel

NASA Astrophysics Data System (ADS)

Sugino, Tomohiro; Yokobori, Shin-Ichi; Yang, Yinjie; Kawaguchi, Yuko; Okudaira, Kyoko; Tabata, Makoto; Kawai, Hideyuki; Hasegawa, Sunao; Yamagishi, Akihiko

Microbes have been collected at the altitude up to about 70 km in the sampling experiment done by several groups[1]. We have also collected high altitude microbes, by using an airplane and balloons[2][3][4][5]. We collected new deinococcal strain (Deinococcus aetherius and Deinococ-cus aerius) and several strains of spore-forming bacilli from stratosphere[2][4][5]. However, microbe sampling in space has never been reported. On the other hand, "Panspermia" hy-pothesis, where terrestrial life is originated from outside of Earth, has been proposed[6][7][8][9]. Recent report suggesting existence of the possible microbe fossils in the meteorite of Mars origin opened the serious debate on the possibility of migration of life embedded in meteorites (and cosmic dusts)[10][11]. If we were able to find terrestrial microbes in space, it would suggest that the terrestrial life can travel between astronomical bodies. We proposed a mission "Tanpopo: Astrobiology Exposure and Micrometeoroid Capture Experiments" to examine possible inter-planetary migration of microbes, organic compounds and meteoroids on Japan Experimental Module of the International Space Station (ISS)[12]. Two of six sub themes in this mission are directly related to interplanetary migration of microbes. One is the direct capturing experi-ment of microbes (probably within the particles such as clay) in space by the exposed ultra-low density aerogel. Another is the exposure experiment to examine survivability of the microbes in harsh space environment. They will tell us the possibility of interplanetary migration of microbes (life) from Earth to outside of Earth (or vise versa). In this report, we will report whether aerogel that have been used for the collection of space debris and cosmic dusts can be used for microbe sampling in space. We will discuss how captured particles by aerogel can be detected with DNA-specific fluorescent dye, and how to distinguish microbes from other mate-rials (i.e. aerogel and

Exploration on anion ordering, optical properties and electronic structure in K3WO3F3 elpasolite

NASA Astrophysics Data System (ADS)

Atuchin, V. V.; Isaenko, L. I.; Kesler, V. G.; Lin, Z. S.; Molokeev, M. S.; Yelisseyev, A. P.; Zhurkov, S. A.

2012-03-01

Room-temperature modification of potassium oxyfluorotungstate, G2-K3WO3F3, has been prepared by low-temperature chemical route and single crystal growth. Wide optical transparency range of 0.3-9.4 μm and forbidden band gap Eg=4.32 eV have been obtained for G2-K3WO3F3 crystal. Meanwhile, its electronic structure has been calculated with the first-principles calculations. The good agreement between the theorectical and experimental results have been achieved. Furthermore, G2-K3WO3F3 is predicted to possess the relatively large nonlinear optical coefficients.

The origin of the Crab Nebula and the electron capture supernova in 8-10 M solar mass stars

NASA Technical Reports Server (NTRS)

Nomoto, K.

1981-01-01

The chemical composition of the Crab Nebula is compared with several presupernova models. The small carbon and oxygen abundances in the helium-rich nebula are consistent with only the presupernova model of the star whose main sequence mass was MMS approximately 8-9.5 M. More massive stars contain too much carbon in the helium layer and smaller mass stars do not leave neutron stars. The progenitor star of the Crab Nebula lost appreciable part of the hydrogen-rich envelope before the hydrogen-rich and helium layers were mixed by convection. Finally it exploded as the electron capture supernova; the O+Ne+Mg core collapsed to form a neutron star and only the extended helium-rich envelope was ejected by the weak shock wave.

Cross sections for the reactions e+e-→K+K-π+π-, K+K-π0π0, and K+K-K+K- measured using initial-state radiation events

NASA Astrophysics Data System (ADS)

Lees, J. P.; Poireau, V.; Prencipe, E.; Tisserand, V.; Garra Tico, J.; Grauges, E.; Martinelli, M.; Milanes, D. A.; Palano, A.; Pappagallo, M.; Eigen, G.; Stugu, B.; Sun, L.; Brown, D. N.; Kerth, L. T.; Kolomensky, Yu. G.; Lynch, G.; Koch, H.; Schroeder, T.; Asgeirsson, D. J.; Hearty, C.; Mattison, T. S.; McKenna, J. A.; Khan, A.; Blinov, V. E.; Buzykaev, A. R.; Druzhinin, V. P.; Golubev, V. B.; Kravchenko, E. A.; Onuchin, A. P.; Serednyakov, S. I.; Skovpen, Yu. I.; Solodov, E. P.; Todyshev, K. Yu.; Yushkov, A. N.; Bondioli, M.; Curry, S.; Kirkby, D.; Lankford, A. J.; Mandelkern, M.; Stoker, D. P.; Atmacan, H.; Gary, J. W.; Liu, F.; Long, O.; Vitug, G. M.; Campagnari, C.; Hong, T. M.; Kovalskyi, D.; Richman, J. D.; West, C. A.; Eisner, A. M.; Kroseberg, J.; Lockman, W. S.; Martinez, A. J.; Schalk, T.; Schumm, B. A.; Seiden, A.; Cheng, C. H.; Doll, D. A.; Echenard, B.; Flood, K. T.; Hitlin, D. G.; Ongmongkolkul, P.; Porter, F. C.; Rakitin, A. Y.; Andreassen, R.; Dubrovin, M. S.; Meadows, B. T.; Sokoloff, M. D.; Bloom, P. C.; Ford, W. T.; Gaz, A.; Nagel, M.; Nauenberg, U.; Smith, J. G.; Wagner, S. R.; Ayad, R.; Toki, W. H.; Spaan, B.; Kobel, M. J.; Schubert, K. R.; Schwierz, R.; Bernard, D.; Verderi, M.; Clark, P. J.; Playfer, S.; Watson, J. E.; Bettoni, D.; Bozzi, C.; Calabrese, R.; Cibinetto, G.; Fioravanti, E.; Garzia, I.; Luppi, E.; Munerato, M.; Negrini, M.; Piemontese, L.; Baldini-Ferroli, R.; Calcaterra, A.; de Sangro, R.; Finocchiaro, G.; Nicolaci, M.; Pacetti, S.; Patteri, P.; Peruzzi, I. M.; Piccolo, M.; Rama, M.; Zallo, A.; Contri, R.; Guido, E.; Lo Vetere, M.; Monge, M. R.; Passaggio, S.; Patrignani, C.; Robutti, E.; Bhuyan, B.; Prasad, V.; Lee, C. L.; Morii, M.; Edwards, A. J.; Adametz, A.; Marks, J.; Uwer, U.; Bernlochner, F. U.; Ebert, M.; Lacker, H. M.; Lueck, T.; Dauncey, P. D.; Tibbetts, M.; Behera, P. K.; Mallik, U.; Chen, C.; Cochran, J.; Crawley, H. B.; Meyer, W. T.; Prell, S.; Rosenberg, E. I.; Rubin, A. E.; Gritsan, A. V.; Guo, Z. J.; Arnaud, N.; Davier, M.; Derkach, D.; Grosdidier, G.; Le Diberder, F.; Lutz, A. M.; Malaescu, B.; Roudeau, P.; Schune, M. H.; Stocchi, A.; Wormser, G.; Lange, D. J.; Wright, D. M.; Bingham, I.; Chavez, C. A.; Coleman, J. P.; Fry, J. R.; Gabathuler, E.; Hutchcroft, D. E.; Payne, D. J.; Touramanis, C.; Bevan, A. J.; Di Lodovico, F.; Sacco, R.; Sigamani, M.; Cowan, G.; Paramesvaran, S.; Brown, D. N.; Davis, C. L.; Denig, A. G.; Fritsch, M.; Gradl, W.; Hafner, A.; Alwyn, K. E.; Bailey, D.; Barlow, R. J.; Jackson, G.; Lafferty, G. D.; Cenci, R.; Hamilton, B.; Jawahery, A.; Roberts, D. A.; Simi, G.; Dallapiccola, C.; Salvati, E.; Cowan, R.; Dujmic, D.; Sciolla, G.; Lindemann, D.; Patel, P. M.; Robertson, S. H.; Schram, M.; Biassoni, P.; Lazzaro, A.; Lombardo, V.; Palombo, F.; Stracka, S.; Cremaldi, L.; Godang, R.; Kroeger, R.; Sonnek, P.; Summers, D. J.; Nguyen, X.; Taras, P.; De Nardo, G.; Monorchio, D.; Onorato, G.; Sciacca, C.; Raven, G.; Snoek, H. L.; Jessop, C. P.; Knoepfel, K. J.; LoSecco, J. M.; Wang, W. F.; Honscheid, K.; Kass, R.; Brau, J.; Frey, R.; Sinev, N. B.; Strom, D.; Torrence, E.; Feltresi, E.; Gagliardi, N.; Margoni, M.; Morandin, M.; Posocco, M.; Rotondo, M.; Simonetto, F.; Stroili, R.; Ben-Haim, E.; Bomben, M.; Bonneaud, G. R.; Briand, H.; Calderini, G.; Chauveau, J.; Hamon, O.; Leruste, Ph.; Marchiori, G.; Ocariz, J.; Sitt, S.; Biasini, M.; Manoni, E.; Rossi, A.; Angelini, C.; Batignani, G.; Bettarini, S.; Carpinelli, M.; Casarosa, G.; Cervelli, A.; Forti, F.; Giorgi, M. A.; Lusiani, A.; Neri, N.; Oberhof, B.; Paoloni, E.; Perez, A.; Rizzo, G.; Walsh, J. J.; Lopes Pegna, D.; Lu, C.; Olsen, J.; Smith, A. J. S.; Telnov, A. V.; Anulli, F.; Cavoto, G.; Faccini, R.; Ferrarotto, F.; Ferroni, F.; Gaspero, M.; Li Gioi, L.; Mazzoni, M. A.; Piredda, G.; Bünger, C.; Hartmann, T.; Leddig, T.; Schröder, H.; Waldi, R.; Adye, T.; Olaiya, E. O.; Wilson, F. F.; Emery, S.; Hamel de Monchenault, G.; Vasseur, G.; Yèche, Ch.; Aston, D.; Bard, D. J.; Bartoldus, R.; Benitez, J. F.; Cartaro, C.; Convery, M. R.; Dorfan, J.; Dubois-Felsmann, G. P.; Dunwoodie, W.; Field, R. C.; Franco Sevilla, M.; Fulsom, B. G.; Gabareen, A. M.; Graham, M. T.; Grenier, P.; Hast, C.; Innes, W. R.; Kelsey, M. H.; Kim, H.; Kim, P.; Kocian, M. L.; Leith, D. W. G. S.; Lewis, P.; Li, S.; Lindquist, B.; Luitz, S.; Luth, V.; Lynch, H. L.; MacFarlane, D. B.; Muller, D. R.; Neal, H.; Nelson, S.; Ofte, I.; Perl, M.; Pulliam, T.; Ratcliff, B. N.; Roodman, A.; Salnikov, A. A.; Santoro, V.; Schindler, R. H.; Snyder, A.; Su, D.; Sullivan, M. K.; Va'vra, J.; Wagner, A. P.; Weaver, M.; Wisniewski, W. J.; Wittgen, M.; Wright, D. H.; Wulsin, H. W.; Yarritu, A. K.; Young, C. C.; Ziegler, V.; Park, W.; Purohit, M. V.; White, R. M.; Wilson, J. R.; Randle-Conde, A.; Sekula, S. J.; Bellis, M.; Burchat, P. R.; Miyashita, T. S.; Alam, M. S.; Ernst, J. A.; Gorodeisky, R.; Guttman, N.; Peimer, D. R.; Soffer, A.; Lund, P.; Spanier, S. M.; Eckmann, R.; Ritchie, J. L.; Ruland, A. M.; Schilling, C. J.; Schwitters, R. F.; Wray, B. C.; Izen, J. M.; Lou, X. C.; Bianchi, F.; Gamba, D.; Lanceri, L.; Vitale, L.; Lopez-March, N.; Martinez-Vidal, F.; Oyanguren, A.; Ahmed, H.; Albert, J.; Banerjee, Sw.; Choi, H. H. F.; King, G. J.; Kowalewski, R.; Lewczuk, M. J.; Lindsay, C.; Nugent, I. M.; Roney, J. M.; Sobie, R. J.; Gershon, T. J.; Harrison, P. F.; Latham, T. E.; Puccio, E. M. T.; Band, H. R.; Dasu, S.; Pan, Y.; Prepost, R.; Vuosalo, C. O.; Wu, S. L.

2012-07-01

We study the processes e+e-→K+K-π+π-γ, K+K-π0π0γ, and K+K-K+K-γ, where the photon is radiated from the initial state. About 84 000, 8000, and 4200 fully reconstructed events, respectively, are selected from 454fb-1 of BABAR data. The invariant mass of the hadronic final state defines the e+e- center-of-mass energy, so that the K+K-π+π-γ data can be compared with direct measurements of the e+e-→K+K-π+π- reaction. No direct measurements exist for the e+e-→K+K-π0π0 or e+e-→K+K-K+K- reactions, and we present an update of our previous result based on a data sample that is twice as large. Studying the structure of these events, we find contributions from a number of intermediate states and extract their cross sections. In particular, we perform a more detailed study of the e+e-→ϕ(1020)ππγ reaction and confirm the presence of the Y(2175) resonance in the ϕ(1020)f0(980) and K+K-f0(980) modes. In the charmonium region, we observe the J/ψ in all three final states and in several intermediate states, as well as the ψ(2S) in some modes, and measure the corresponding products of branching fraction and electron width.

Electron Beam Misalignment Study of MIG for 42 GHz, 200 kW Gyrotron

NASA Astrophysics Data System (ADS)

Sharma, S. K.; Singh, Udaybir; Kumar, Nitin; Sahu, Naveen; Shekhawat, Narendra; Srivastava, Deepak; Alaria, M. K.; Bera, A.; Jain, P. K.; Sinha, A. K.

2017-10-01

This paper presents the electron beam misalignment study with respect to cathode position and cathode magnetic field of 42 GHz, 200 kW gyrotron. The performance of gyrotron is affected with the misalignment of cathode position. The simulation results confirm the tolerance of cathode misalignment with respect to the design parameters such as the transverse-to-axial velocity ratio, the maximum transverse velocity spread, etc.

Quantum-chemical calculations and electron diffraction study of the equilibrium molecular structure of vitamin K3

NASA Astrophysics Data System (ADS)

Khaikin, L. S.; Tikhonov, D. S.; Grikina, O. E.; Rykov, A. N.; Stepanov, N. F.

2014-05-01

The equilibrium molecular structure of 2-methyl-1,4-naphthoquinone (vitamin K3) having C s symmetry is experimentally characterized for the first time by means of gas-phase electron diffraction using quantum-chemical calculations and data on the vibrational spectra of related compounds.

Thermal conductivity of electron-irradiated graphene

NASA Astrophysics Data System (ADS)

Weerasinghe, Asanka; Ramasubramaniam, Ashwin; Maroudas, Dimitrios

2017-10-01

We report results of a systematic analysis of thermal transport in electron-irradiated, including irradiation-induced amorphous, graphene sheets based on nonequilibrium molecular-dynamics simulations. We focus on the dependence of the thermal conductivity, k, of the irradiated graphene sheets on the inserted irradiation defect density, c, as well as the extent of defect passivation with hydrogen atoms. While the thermal conductivity of irradiated graphene decreases precipitously from that of pristine graphene, k0, upon introducing a low vacancy concentration, c < 1%, in the graphene lattice, further reduction of the thermal conductivity with the increasing vacancy concentration exhibits a weaker dependence on c until the amorphization threshold. Beyond the onset of amorphization, the dependence of thermal conductivity on the vacancy concentration becomes significantly weaker, and k practically reaches a plateau value. Throughout the range of c and at all hydrogenation levels examined, the correlation k = k0(1 + αc)-1 gives an excellent description of the simulation results. The value of the coefficient α captures the overall strength of the numerous phonon scattering centers in the irradiated graphene sheets, which include monovacancies, vacancy clusters, carbon ring reconstructions, disorder, and a rough nonplanar sheet morphology. Hydrogen passivation increases the value of α, but the effect becomes very minor beyond the amorphization threshold.

Physiological stress responses in big gamefish after capture: observations on plasma chemistry and blood factors.

PubMed

Wells, R M; McIntyre, R H; Morgan, A K; Davie, P S

1986-01-01

The plasma electrolytes, Na+, K+, Ca2+, Cl- and osmolarities had high values in capture-stressed big gamefish. Blood metabolites measured after stress showed glucose and lactate elevations. The activity of the plasma enzymes alkaline phosphatase, alanine aminotransferase, aspartate aminotransferase, creatine kinase and lactate dehydrogenase suggested tissue disruptions following severe capture stress. Haematocrit values and methaemoglobin were high in capture-stressed gamefish. The plasma chemistry of resting and capture-stressed snapper (Chrysophrys auratus) was studied for comparison. Specific differences in plasma biochemistry appeared to be the result of different strategies of fish behaviour during capture.

S2O - A software tool for integrating research data from general purpose statistic software into electronic data capture systems.

PubMed

Bruland, Philipp; Dugas, Martin

2017-01-07

Data capture for clinical registries or pilot studies is often performed in spreadsheet-based applications like Microsoft Excel or IBM SPSS. Usually, data is transferred into statistic software, such as SAS, R or IBM SPSS Statistics, for analyses afterwards. Spreadsheet-based solutions suffer from several drawbacks: It is generally not possible to ensure a sufficient right and role management; it is not traced who has changed data when and why. Therefore, such systems are not able to comply with regulatory requirements for electronic data capture in clinical trials. In contrast, Electronic Data Capture (EDC) software enables a reliable, secure and auditable collection of data. In this regard, most EDC vendors support the CDISC ODM standard to define, communicate and archive clinical trial meta- and patient data. Advantages of EDC systems are support for multi-user and multicenter clinical trials as well as auditable data. Migration from spreadsheet based data collection to EDC systems is labor-intensive and time-consuming at present. Hence, the objectives of this research work are to develop a mapping model and implement a converter between the IBM SPSS and CDISC ODM standard and to evaluate this approach regarding syntactic and semantic correctness. A mapping model between IBM SPSS and CDISC ODM data structures was developed. SPSS variables and patient values can be mapped and converted into ODM. Statistical and display attributes from SPSS are not corresponding to any ODM elements; study related ODM elements are not available in SPSS. The S2O converting tool was implemented as command-line-tool using the SPSS internal Java plugin. Syntactic and semantic correctness was validated with different ODM tools and reverse transformation from ODM into SPSS format. Clinical data values were also successfully transformed into the ODM structure. Transformation between the spreadsheet format IBM SPSS and the ODM standard for definition and exchange of trial data is feasible

Ensemble of electrophoretically captured gold nanoparticles as a fingerprint of Boltzmann velocity distribution

NASA Astrophysics Data System (ADS)

Hong, S. H.; Kang, M. G.; Lim, J. H.; Hwang, S. W.

2008-07-01

An ensemble of electrophoretically captured gold nanoparticles is exploited to fingerprint their velocity distribution in solution. The electrophoretic capture is performed using a dc biased nanogap electrode, and panoramic scanning electron microscopic images are inspected to obtain the regional density of the captured gold nanoparticles. The regional density profile along the surface of the electrode is in a quantitative agreement with the calculated density of the captured nanoparticles. The calculated density is obtained by counting, in the Boltzmann distribution, the number of nanoparticles whose thermal velocity is smaller than the electrophoretic velocity.

Modeling association among demographic parameters in analysis of open population capture-recapture data.

PubMed

Link, William A; Barker, Richard J

2005-03-01

We present a hierarchical extension of the Cormack-Jolly-Seber (CJS) model for open population capture-recapture data. In addition to recaptures of marked animals, we model first captures of animals and losses on capture. The parameter set includes capture probabilities, survival rates, and birth rates. The survival rates and birth rates are treated as a random sample from a bivariate distribution, thus the model explicitly incorporates correlation in these demographic rates. A key feature of the model is that the likelihood function, which includes a CJS model factor, is expressed entirely in terms of identifiable parameters; losses on capture can be factored out of the model. Since the computational complexity of classical likelihood methods is prohibitive, we use Markov chain Monte Carlo in a Bayesian analysis. We describe an efficient candidate-generation scheme for Metropolis-Hastings sampling of CJS models and extensions. The procedure is illustrated using mark-recapture data for the moth Gonodontis bidentata.

Structural, optical and electronic properties of K2Ba(NO3)4 crystal

NASA Astrophysics Data System (ADS)

Isaenko, L. I.; Korzhneva, K. E.; Goryainov, S. V.; Goloshumova, A. A.; Sheludyakova, L. A.; Bekenev, V. L.; Khyzhun, O. Y.

2018-02-01

Nitrate crystals reveal nonlinear optical properties and could be considered as converters of laser radiation in the short-wave region. The conditions for obtaining and basic properties of K2Ba(NO3)4 double nitrate crystals were investigated. Crystal growth was implemented by slow cooling in the temperature range of 72-49 °C and low rate evaporation. The structural analysis of K2Ba(NO3)4 formation on the basis of two mixed simple nitrate structures is discussed. The main groups of oscillations in K2Ba(NO3)4 crystal were revealed using Raman and IR spectroscopy, and the table of vibrations for this compound was compiled. The electronic structure of K2Ba(NO3)4 was elucidated in the present work from both experimental and theoretical viewpoints. In particular, X-ray photoelectron spectroscopy (XPS) was employed in the present work to measure binding energies of the atoms constituting the titled compound and its XPS valence-band spectrum for both pristine and Ar+ ion-bombarded surfaces. Further, total and partial densities of states of constituent atoms of K2Ba(NO3)4 have been calculated. The calculations reveal that the O 2p states dominate in the total valence-band region of K2Ba(NO3)4 except of its bottom, where K 3p and Ba 5p states are the principal contributors, while the bottom of the conduction band is composed mainly of the unoccupied O 2p states, with somewhat smaller contributions of the N 2p∗ states as well. With respect to the occupation of the valence band by the O 2p states, the present band-structure calculations are confirmed by comparison on a common energy scale of the XPS valence-band spectrum and the X-ray emission O Kα band for the K2Ba(NO3)4 crystal under study. Furthermore, the present calculations indicate that the K2Ba(NO3)4 compound is a direct-gap material.

Inland capture fisheries

PubMed Central

Welcomme, Robin L.; Cowx, Ian G.; Coates, David; Béné, Christophe; Funge-Smith, Simon; Halls, Ashley; Lorenzen, Kai

2010-01-01

The reported annual yield from inland capture fisheries in 2008 was over 10 million tonnes, although real catches are probably considerably higher than this. Inland fisheries are extremely complex, and in many cases poorly understood. The numerous water bodies and small rivers are inhabited by a wide range of species and several types of fisher community with diversified livelihood strategies for whom inland fisheries are extremely important. Many drivers affect the fisheries, including internal fisheries management practices. There are also many drivers from outside the fishery that influence the state and functioning of the environment as well as the social and economic framework within which the fishery is pursued. The drivers affecting the various types of inland water, rivers, lakes, reservoirs and wetlands may differ, particularly with regard to ecosystem function. Many of these depend on land-use practices and demand for water which conflict with the sustainability of the fishery. Climate change is also exacerbating many of these factors. The future of inland fisheries varies between continents. In Asia and Africa the resources are very intensely exploited and there is probably little room for expansion; it is here that resources are most at risk. Inland fisheries are less heavily exploited in South and Central America, and in the North and South temperate zones inland fisheries are mostly oriented to recreation rather than food production. PMID:20713391

Influence of the parent cation on the thermalization of subexcitation electrons in solid water

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goulet, T.; Jay-Gerin, J.; Patau, J.

1990-09-06

The authors report the results of their Monte Carlo simulations of the thermalization, recombination, and dissociative attachment of subexcitation electrons in solid water. A particular emphasis is placed on the description of the electrons motion in the Coulomb field of its parent cation (H{sub 2}O{sup +}) and on the effect of this positive charge on the fate of the electron. In comparing the results obtained with and without the parent cation they find on the one hand, that the dissociative attachment probability and the electron thermalization distances and times remain practically unaffected by the presence of H{sub 2}O{sup +}. Onmore » the other hand, they find that a certain proportion of subexcitation electrons can be captured, before they thermalize, by a process of dissociative recombination which yields various species such as O, H, OH, and H{sub 2}. The variation of this proportion and of the average thermalization distances and times with the energy of the subexcitation electrons is investigated.« less

Electronic data capture in a rural African setting: evaluating experiences with different systems in Malawi.

PubMed

King, Carina; Hall, Jenny; Banda, Masford; Beard, James; Bird, Jon; Kazembe, Peter; Fottrell, Ed

2014-01-01

As hardware for electronic data capture (EDC), such as smartphones or tablets, becomes cheaper and more widely available, the potential for using such hardware as data capture tools in routine healthcare and research is increasing. We aim to highlight the advantages and disadvantages of four EDC systems being used simultaneously in rural Malawi: two for Android devices (CommCare and ODK Collect), one for PALM and Windows OS (Pendragon), and a custom-built application for Android (Mobile InterVA--MIVA). We report on the personal field and development experience of fieldworkers, project managers, and EDC system developers. Fieldworkers preferred using EDC to paper-based systems, although some struggled with the technology at first. Highlighted features include in-built skip patterns for all systems, and specifically the 'case' function that CommCare offers. MIVA as a standalone app required considerably more time and expertise than the other systems to create and could not be customised for our specific research needs; however, it facilitates standardised routine data collection. CommCare and ODK Collect both have user-friendly web-interfaces for form development and good technical support. CommCare requires Internet to build an application and download it to a device, whereas all steps can be done offline with ODK Collect, a desirable feature in low connectivity settings. Pendragon required more complex programming of logic, using a Microsoft Access application, and generally had less technical support. Start-up costs varied between systems, and all were considered more expensive than setting up a paper-based system; however running costs were generally low and therefore thought to be cost-effective over the course of our projects. EDC offers many opportunities for efficient data collection, but brings some issues requiring consideration when designing a study; the decision of which hardware and software to use should be informed by the aim of data collection

Natural Language Processing–Enabled and Conventional Data Capture Methods for Input to Electronic Health Records: A Comparative Usability Study

PubMed Central

Sheehan, Barbara; Stetson, Peter; Bhatt, Ashish R; Field, Adele I; Patel, Chirag; Maisel, James Mark

2016-01-01

Background The process of documentation in electronic health records (EHRs) is known to be time consuming, inefficient, and cumbersome. The use of dictation coupled with manual transcription has become an increasingly common practice. In recent years, natural language processing (NLP)–enabled data capture has become a viable alternative for data entry. It enables the clinician to maintain control of the process and potentially reduce the documentation burden. The question remains how this NLP-enabled workflow will impact EHR usability and whether it can meet the structured data and other EHR requirements while enhancing the user’s experience. Objective The objective of this study is evaluate the comparative effectiveness of an NLP-enabled data capture method using dictation and data extraction from transcribed documents (NLP Entry) in terms of documentation time, documentation quality, and usability versus standard EHR keyboard-and-mouse data entry. Methods This formative study investigated the results of using 4 combinations of NLP Entry and Standard Entry methods (“protocols”) of EHR data capture. We compared a novel dictation-based protocol using MediSapien NLP (NLP-NLP) for structured data capture against a standard structured data capture protocol (Standard-Standard) as well as 2 novel hybrid protocols (NLP-Standard and Standard-NLP). The 31 participants included neurologists, cardiologists, and nephrologists. Participants generated 4 consultation or admission notes using 4 documentation protocols. We recorded the time on task, documentation quality (using the Physician Documentation Quality Instrument, PDQI-9), and usability of the documentation processes. Results A total of 118 notes were documented across the 3 subject areas. The NLP-NLP protocol required a median of 5.2 minutes per cardiology note, 7.3 minutes per nephrology note, and 8.5 minutes per neurology note compared with 16.9, 20.7, and 21.2 minutes, respectively, using the Standard

Quantitative screening of yeast surface-displayed polypeptide libraries by magnetic bead capture.

PubMed

Yeung, Yik A; Wittrup, K Dane

2002-01-01

Magnetic bead capture is demonstrated here to be a feasible alternative for quantitative screening of favorable mutants from a cell-displayed polypeptide library. Flow cytometric sorting with fluorescent probes has been employed previously for high throughput screening for either novel binders or improved mutants. However, many laboratories do not have ready access to this technology as a result of the limited availability and high cost of cytometers, restricting the use of cell-displayed libraries. Using streptavidin-coated magnetic beads and biotinylated ligands, an alternative approach to cell-based library screening for improved mutants was developed. Magnetic bead capture probability of labeled cells is shown to be closely correlated with the surface ligand density. A single-pass enrichment ratio of 9400 +/- 1800-fold, at the expense of 85 +/- 6% binder losses, is achieved from screening a library that contains one antibody-displaying cell (binder) in 1.1 x 10(5) nondisplaying cells. Additionally, kinetic screening for an initial high affinity to low affinity (7.7-fold lower) mutant ratio of 1:95,000, the magnetic bead capture method attains a single-pass enrichment ratio of 600 +/- 200-fold with a 75 +/- 24% probability of loss for the higher affinity mutant. The observed high loss probabilities can be straightforwardly compensated for by library oversampling, given the inherently parallel nature of the screen. Overall, these results demonstrate that magnetic beads are capable of quantitatively screening for novel binders and improved mutants. The described methods are directly analogous to procedures in common use for phage display and should lower the barriers to entry for use of cell surface display libraries.

MeV electron acceleration at 1 kHz with <10 mJ laser pulses

NASA Astrophysics Data System (ADS)

Salehi, Fatholah; Goers, Andy; Hine, George; Feder, Linus; Kuk, Donghoon; Miao, Bo; Woodbury, Daniel; Kim, Ki-Yong; Milchberg, Howard

2017-01-01

We demonstrate laser driven acceleration of electrons to MeV-scale energies at 1 kHz repetition rate using <10 mJ pulses focused on near-critical density He and H2 gas jets. Using the H2 gas jet, electron acceleration to 0.5 MeV in 10 fC bunches was observed with laser pulse energy as low as 1.3 mJ. Increasing the pulse energy to 10 mJ, we measure 1pC charge bunches with >1 MeV energy for both He and H gas jets. Such a high repetition rate, high flux ultrafast source has immediate application to time resolved probing of matter for scientific, medical, or security applications, either using the electrons directly or using a high-Z foil converter to generate ultrafast γ-rays. This work is supported by the US Department of Energy, the National Science Foundation, and the Air Force Office of Scientific Research.

Potassium-based sorbents from fly ash for high-temperature CO2 capture.

PubMed

Sanna, Aimaro; Maroto-Valer, M Mercedes

2016-11-01

Potassium-fly ash (K-FA) sorbents were investigated for high-temperature CO 2 sorption. K-FAs were synthesised using coal fly ash as source of silica and aluminium. The synthesised materials were also mixed with Li 2 CO 3 and Ca(OH) 2 to evaluate their effect on CO 2 capture. Temperature strongly affected the performance of the K-FA sorbents, resulting in a CO 2 uptake of 1.45 mmol CO 2 /g sorbent for K-FA 1:1 at 700 °C. The CO 2 sorption was enhanced by the presence of Li 2 CO 3 (10 wt%), with the K-FA 1:1 capturing 2.38 mmol CO 2 /g sorbent at 700 °C in 5 min. This sorption was found to be similar to previously developed Li-Na-FA (2.54 mmol/g) and Li-FA (2.4 mmol/g) sorbents. The presence of 10 % Li 2 CO 3 also accelerated sorption and desorption. The results suggest that the increased uptake of CO 2 and faster reaction rates in presence of K-FA can be ascribed to the formation of K-Li eutectic phase, which favours the diffusion of potassium and CO 2 in the material matrix. The cyclic experiments showed that the K-FA materials maintained stable CO 2 uptake and reaction rates over 10 cycles.

Study of electron transport in a Hall thruster by axial–radial fully kinetic particle simulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cho, Shinatora, E-mail: choh.shinatora@jaxa.jp; Kubota, Kenichi; Funaki, Ikkoh

2015-10-15

Electron transport across a magnetic field in a magnetic-layer-type Hall thruster was numerically investigated for the future predictive modeling of Hall thrusters. The discharge of a 1-kW-class magnetic-layer-type Hall thruster designed for high-specific-impulse operation was modeled using an r-z two-dimensional fully kinetic particle code with and without artificial electron-diffusion models. The thruster performance results showed that both electron transport models captured the experimental result within discrepancies less than 20% in thrust and discharge current for all the simulated operation conditions. The electron cross-field transport mechanism of the so-called anomalous diffusion was self-consistently observed in the simulation without artificial diffusion models;more » the effective electron mobility was two orders of magnitude higher than the value obtained using the classical diffusion theory. To account for the self-consistently observed anomalous transport, the oscillation of plasma properties was speculated. It was suggested that the enhanced random-walk diffusion due to the velocity oscillation of low-frequency electron flow could explain the observed anomalous diffusion within an order of magnitude. The dominant oscillation mode of the electron flow velocity was found to be 20 kHz, which was coupled to electrostatic oscillation excited by global ionization instability.« less

Dependence of Whistler-mode Wave Induced Electron Precipitation on k-vector Direction.

NASA Astrophysics Data System (ADS)

Kulkarni, P.; Inan, U. S.; Bell, T. F.; Bortnik, J.

2007-12-01

Whistler-mode waves that are either spontaneously generated in-situ (i.e., chorus), or externally injected (lightning, VLF transmitters) are known to be responsible for the loss of radiation belt electrons. An important determinant in the quantification of this loss is the dependence of the cyclotron resonant pitch angle scattering on the initial wave normal angles of the driving waves. Inan et al. (U.S. Inan et al., Controlled precipitation of radiation belt electrons, Journal of Geophysical Research-Space Physics, 108 (A5), 1186, doi: 10.1029/2002JA009580, 2003.) suggested that the lifetime of > 1 MeV electrons in the inner radiation belts might be moderated by in situ injection of VLF whistler mode waves at frequencies of a few kHz. The formulation of Wang and Bell (T.N.C. Wang and T.F. Bell, Radiation resisitance of a short dipole immersed in a cold magnetoionic medium, Radio Science, 4(2), 167-177, February 1969) for an electric dipole antenna located in the inner magnetosphere established that most of the radiated power is concentrated in waves whose wave normal angles lie near the local resonance cone. Such waves, compared to those injected at less oblique initial wave normal angles, undergo several more magnetospheric reflections, persist in the magnetospheric cavity for longer periods of time, and resonate with electrons of higher energies. Accordingly, such waves may be highly effective in contributing to the loss of electrons from the inner belt and slot regions [Inan et al., 2006]. Nevertheless, it has been noted (Inan et al. [2006], Inan and Bell [1991] and Albert [1999]) that > 1 MeV electrons may not be effectively scattered by waves propagating with very high wave normal angles, due to the generally reduced gyroresonant diffusion coefficients for wave normals near the resonance cone. We use the Stanford 2D VLF raytracing program to determine the energetic electron pitch angle scattering and the precipitated flux signatures that would be detected for

Mobile Device-Based Electronic Data Capture System Used in a Clinical Randomized Controlled Trial: Advantages and Challenges.

PubMed

Zhang, Jing; Sun, Lei; Liu, Yu; Wang, Hongyi; Sun, Ningling; Zhang, Puhong

2017-03-08

Electronic data capture (EDC) systems have been widely used in clinical research, but mobile device-based electronic data capture (mEDC) system has not been well evaluated. The aim of our study was to evaluate the feasibility, advantages, and challenges of mEDC in data collection, project management, and telemonitoring in a randomized controlled trial (RCT). We developed an mEDC to support an RCT called "Telmisartan and Hydrochlorothiazide Antihypertensive Treatment (THAT)" study, which was a multicenter, double-blinded, RCT, with the purpose of comparing the efficacy of telmisartan and hydrochlorothiazide (HCTZ) monotherapy in high-sodium-intake patients with mild to moderate hypertension during a 60 days follow-up. Semistructured interviews were conducted during and after the trial to evaluate the feasibility, advantage, and challenge of mEDC. Nvivo version 9.0 (QSR International) was used to analyze records of interviews, and a thematic framework method was used to obtain outcomes. The mEDC was successfully used to support the data collection and project management in all the 14 study hospitals. A total of 1333 patients were recruited with support of mEDC, of whom 1037 successfully completed all 4 visits. Across all visits, the average time needed for 141 questions per patient was 53 min, which were acceptable to both doctors and patients. All the interviewees, including 24 doctors, 53 patients, 1 clinical research associate (CRA), 1 project manager (PM), and 1 data manager (DM), expressed their satisfaction to nearly all the functions of the innovative mEDC in randomization, data collection, project management, quality control, and remote monitoring in real time. The average satisfaction score was 9.2 (scale, 0-10). The biggest challenge came from the stability of the mobile or Wi-Fi signal although it was not a problem in THAT study. The innovative mEDC has many merits and is well acceptable in supporting data collection and project management in a timely

Analysis of capture-recapture models with individual covariates using data augmentation

USGS Publications Warehouse

Royle, J. Andrew

2009-01-01

I consider the analysis of capture-recapture models with individual covariates that influence detection probability. Bayesian analysis of the joint likelihood is carried out using a flexible data augmentation scheme that facilitates analysis by Markov chain Monte Carlo methods, and a simple and straightforward implementation in freely available software. This approach is applied to a study of meadow voles (Microtus pennsylvanicus) in which auxiliary data on a continuous covariate (body mass) are recorded, and it is thought that detection probability is related to body mass. In a second example, the model is applied to an aerial waterfowl survey in which a double-observer protocol is used. The fundamental unit of observation is the cluster of individual birds, and the size of the cluster (a discrete covariate) is used as a covariate on detection probability.

Do different attention capture paradigms measure different types of capture?

PubMed

Roque, Nelson A; Wright, Timothy J; Boot, Walter R

2016-10-01

When something captures our attention, why does it do so? This topic has been hotly debated, with some arguing that attention is captured only by salient stimuli (bottom-up view) and others arguing capture is always due to a match between a stimulus and our goals (top-down view). Many different paradigms have provided evidence for 1 view or the other. If either of these strong views are correct, then capture represents a unitary phenomenon, and there should be a high correlation between capture in these paradigms. But if there are different types of capture (top-down, bottom-up), then some attention capture effects should be correlated and some should not. In 2 studies, we collected data from several paradigms used in support of claims of top-down and bottom-up capture in relatively large samples of participants. Contrary to either prediction, measures of capture were not strongly correlated. Results suggest that capture may in fact be strongly determined by idiosyncratic task demands and strategies. Relevant to this lack of relations among tasks, we observed that classic measures of attention capture demonstrated low reliability, especially among measures used to support bottom-up capture. Implications for the low reliability of capture measures are discussed. We also observed that the proportion of participants demonstrating a pattern of responses consistent with capture varied widely among classic measures of capture. Overall, results demonstrate that, even for relatively simple laboratory measures of attention, there are still important gaps in knowledge regarding what these paradigms measure and how they are related.

Electron cryo-tomography captures macromolecular complexes in native environments.

PubMed

Baker, Lindsay A; Grange, Michael; Grünewald, Kay

2017-10-01

Transmission electron microscopy has a long history in cellular biology. Fixed and stained samples have been used for cellular imaging for over 50 years, but suffer from sample preparation induced artifacts. Electron cryo-tomography (cryoET) instead uses frozen-hydrated samples, without chemical modification, to determine the structure of macromolecular complexes in their native environment. Recent developments in electron microscopes and associated technologies have greatly expanded our ability to visualize cellular features and determine the structures of macromolecular complexes in situ. This review highlights the technological improvements and the new areas of biology these advances have made accessible. We discuss the potential of cryoET to reveal novel and significant biological information on the nanometer or subnanometer scale, and directions for further work. Copyright © 2017. Published by Elsevier Ltd.

Electron-electron interaction in ion-atom collisions studied by projectile state-resolved Auger-electron spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dohyung Lee.

This dissertation addresses the problem of dynamic electron-electron interactions in fast ion-atom collisions using projectile Auger electron spectroscopy. The study was carried out by measuring high-resolution projectile KKL Auger electron spectra as a function of projectile energy for the various collision systems of 0.25-2 MeV/u O{sup q+} and F{sup q+} incident on H{sub 2} and He targets. The electrons were detected in the beam direction, where the kinematic broadening is minimized. A zero-degree tandem electron spectrometer system, was developed and showed the versatility of zero-degree measurements of collisionally-produced atomic states. The zero-degree binary encounter electrons (BEe), quasifree target electrons ionizedmore » by the projectiles in head-on collisions, were observed as a strong background in the KLL Auger electron spectrum. They were studied by treating the target ionization as 180{degree} Rutherford elastic scattering in the projectile frame, and resulted in a validity test of the impulse approximation (IA) and a way to determine the spectrometer efficiency. An anomalous q-dependence, in which the zero-degree BEe yields increase with decreasing projectile charge state (q), was observed. State-resolved KLL Auger cross sections were determined by using the BEe normalization and thus the cross section of the electron-electron interactions such as resonant transfer-excitation (RTE), electron-electron excitation (eeE), and electron-electron ionization (eeI) were determined. Projectile 2l capture with 1s {yields} 2p excitation by the captured target electron was observed as an RTE process with Li-like and He-like projectiles and the measured RTEA (RTE followed by Auger decay) cross sections showed good agreement with an RTE-IA treatment and RTE alignment theory.« less

Electrochemical Capture and Release of CO2 in Aqueous Electrolytes Using an Organic Semiconductor Electrode

PubMed Central

2017-01-01

Developing efficient methods for capture and controlled release of carbon dioxide is crucial to any carbon capture and utilization technology. Herein we present an approach using an organic semiconductor electrode to electrochemically capture dissolved CO2 in aqueous electrolytes. The process relies on electrochemical reduction of a thin film of a naphthalene bisimide derivative, 2,7-bis(4-(2-(2-ethylhexyl)thiazol-4-yl)phenyl)benzo[lmn][3,8]phenanthroline-1,3,6,8(2H,7H)-tetraone (NBIT). This molecule is specifically tailored to afford one-electron reversible and one-electron quasi-reversible reduction in aqueous conditions while not dissolving or degrading. The reduced NBIT reacts with CO2 to form a stable semicarbonate salt, which can be subsequently oxidized electrochemically to release CO2. The semicarbonate structure is confirmed by in situ IR spectroelectrochemistry. This process of capturing and releasing carbon dioxide can be realized in an oxygen-free environment under ambient pressure and temperature, with uptake efficiency for CO2 capture of ∼2.3 mmol g–1. This is on par with the best solution-phase amine chemical capture technologies available today. PMID:28378994

Low temperature grown photoconductive antennas for pulsed 1060 nm excitation: Influence of excess energy on the electron relaxation

NASA Astrophysics Data System (ADS)

Dietz, R. J. B.; Brahm, A.; Velauthapillai, A.; Wilms, A.; Lammers, C.; Globisch, B.; Koch, M.; Notni, G.; Tünnermann, A.; Göbel, T.; Schell, M.

2015-01-01

We investigate properties of MBE grown photoconductive terahertz (THz) antennas based on the InGaAs/InAlAs/InP material system aimed for an excitation wavelength of approx. 1060 nm. Therefore, we analyze several different approaches concerning growth parameters, layer and material compositions as well as doping. The carrier dynamics are probed via transient white-light pump-probe spectroscopy as well as THz Time Domain Spectroscopy (TDS) measurements. We find that the electron capture probability is reduced for higher electron energies. By adjusting the material band gap this can be resolved and lifetimes of 1.3 ps are obtained. These short lifetimes enable the detection of THz TDS spectra with a bandwidth exceeding 4 THz.

Estimating taxonomic diversity, extinction rates, and speciation rates from fossil data using capture-recapture models

USGS Publications Warehouse

Nichols, J.D.; Pollock, K.H.

1983-01-01

Capture-recapture models can be used to estimate parameters of interest from paleobiological data when encouter probabilities are unknown and variable over time. These models also permit estimation of sampling variances and goodness-of-fit tests are available for assessing the fit of data to most models. The authors describe capture-recapture models which should be useful in paleobiological analyses and discuss the assumptions which underlie them. They illustrate these models with examples and discuss aspects of study design.

Spectroscopic Diagnosis of Excited-State Aromaticity: Capturing Electronic Structures and Conformations upon Aromaticity Reversal.

PubMed

Oh, Juwon; Sung, Young Mo; Hong, Yongseok; Kim, Dongho

2018-03-06

scrutinize this intriguing and challenging scientific issue, expanded porphyrins have been utilized as the ideal testing platform for investigating aromaticity because they show distinct aromatic and antiaromatic characters with aromaticity-specific spectroscopic features. Expanded porphyrins exhibit perfect aromatic and antiaromatic congener pairs having the same molecular framework but different numbers of π electrons, which facilitates the study of the pure effect of aromaticity by comparative analyses. On the basis of the characteristics of expanded porphyrins, time-resolved electronic and vibrational absorption spectroscopies capture the changes in electronic structure and molecular conformations driven by the change in aromaticity and provide clear evidence for aromaticity reversal in the excited states. The approaches described in this Account pave the way for the development of new and alternative experimental indices for the evaluation of excited-state aromaticity, which will enable overarching and fundamental comprehension of the role of (anti)aromaticity in the stability, dynamics, and reactivity in the excited states with possible implications for practical applications.

Tanpopo: Astrobiology Exposure and Micrometeoroid Capture Experiments

NASA Astrophysics Data System (ADS)

Yamagishi, Akihiko; Yano, Hajime; Yamashita, Masamichi; Hashimoto, Hirofumi; Kobayashi, Kensei; Kawai, Hideyuki; Mita, Hajime; Yokobori, Shin-ichi; Tabata, Makoto; Yabuta, Hikaru

2012-07-01

There is a long history of the microbe-collection experiments at high altitude (1). Microbes have been collected using balloons, aircraft and meteorological rockets. Spore forming fungi and Bacilli, and Micrococci have been isolated in these experiments (1). It is not clear how high do microbes go up. If the microbes might have been present even at higher altitudes, the fact would endorse the possibility of interplanetary migration of life. Tanpopo, dandelion, is the name of a grass whose seeds with floss are spread by the wind. We propose the analyses of interplanetary migration of microbes, organic compounds and meteoroids on Japan Experimental Module (JEM) of the International Space Station (ISS) (2). Ultra low-density aerogel will be used to capture micrometeoroid and debris. Particles captured by aerogel will be used for several analyses after the initial inspection of the gel and tracks. Careful analysis of the tracks in the aerogel will provide the size and velocity dependence of debris flux. The particles will be analyzed for mineralogical, organic and microbiological characteristics. Aerogels are ready for production in Japan. Aerogels and trays are space proven. All the analytical techniques are ready. In this presentation, we will present the recent results related to the microbiological analyses. The results suggested that the bleaching speeds and the spectra of fluorescence are different between different origins of the fluorescence: whether it is emitted from microbe or not. It is also shown that PCR analysis of the microbe can be used to determine the species. References 1)Yang, Y., Yokobori, S. and Yamagishi, A.: Assessing panspermia hypothesis by microorganisms collected from the high altitude atmosphere. Biol. Sci. Space, 23 (2009), pp. 151-163. 2) Yamagishi, A., H. Yano, K. Kobayashi, K. Kobayashi, S. Yokobori, M. Tabata, H. Kawai, M. Yamashita, H. Hashimoto, H. Naraoka, & H. Mita (2008) TANPOPO: astrobiology exposure and micrometeoroid capture

Tanpopo: Astrobiology exposure and micrometeoroid capture experiments

NASA Astrophysics Data System (ADS)

Yamagishi, Akihiko; Yano, Hajime; Okudaira, Kyoko; Kobayashi, Kensei; Yokobori, Shin-Ichi; Kawai, Hideyuki; Yamashita, Masamichi; Hashimoto, Hirofumi; Yabuta, Hikaru

There is a long history of the microbe-collection experiments at high altitude (1). Microbes have been collected using balloons, aircraft and meteorological rockets. Spore forming fungi and Bacilli, and Micrococci have been isolated in these experiments (1). It is not clear how high do microbes go up. If the microbes might have been present even at higher altitudes, the fact would endorse the possibility of interplanetary migration of life. Tanpopo, dandelion, is the name of a grass whose seeds with floss are spread by the wind. We propose the analyses of interplanetary migration of microbes, organic compounds and meteoroids on Japan Experimental Module (JEM) of the International Space Station (ISS) (2). Ultra low-density aerogel will be used to capture micrometeoroid and debris. Particles captured by aerogel will be used for several analyses after the initial inspection of the gel and tracks. Careful analysis of the tracks in the aerogel will provide the size and velocity dependence of debris flux. The particles will be analyzed for mineralogical, organic and microbiological characteristics. Aerogels are ready for production in Japan. Aerogels and trays are space proven. All the analytical techniques are ready. In this presentation, we will present the recent results related to the microbiological analyses. The results suggested that the bleaching speeds and the spectra of fluorescence are different between different origins of the fluorescence: whether it is emitted from microbe or not. It is also shown that PCR analysis of the microbe can be used to determine the species. References 1)Yang, Y., Yokobori, S. and Yamagishi, A.: Assessing panspermia hypothesis by microorganisms collected from the high altitude atmosphere. Biol. Sci. Space, 23 (2009), pp. 151-163. 2) Yamagishi, A., H. Yano, K. Kobayashi, K. Kobayashi, S. Yokobori, M. Tabata, H. Kawai, M. Yamashita, H. Hashimoto, H. Naraoka, H. Mita (2008) TANPOPO: astrobi-ology exposure and micrometeoroid capture

Microporous polystyrene particles for selective carbon dioxide capture.

PubMed

Kaliva, Maria; Armatas, Gerasimos S; Vamvakaki, Maria

2012-02-07

This study presents the synthesis of microporous polystyrene particles and the potential use of these materials in CO(2) capture for biogas purification. Highly cross-linked polystyrene particles are synthesized by the emulsion copolymerization of styrene (St) and divinylbenzene (DVB) in water. The cross-link density of the polymer is varied by altering the St/DVB molar ratio. The size and the morphology of the particles are characterized by scanning and transmission electron microscopy. Following supercritical point drying with carbon dioxide or lyophilization from benzene, the polystyrene nanoparticles exhibit a significant surface area and permanent microporosity. The dried particles comprising 35 mol % St and 65 mol % DVB possess the largest surface area, ∼205 m(2)/g measured by Brunauer-Emmett-Teller and ∼185 m(2)/g measured by the Dubinin-Radushkevich method, and a total pore volume of 1.10 cm(3)/g. Low pressure measurements suggest that the microporous polystyrene particles exhibit a good separation performance of CO(2) over CH(4), with separation factors in the range of ∼7-13 (268 K, CO(2)/CH(4) = 5/95 gas mixture), which renders them attractive candidates for use in gas separation processes.

Increasing capture efficiency of pallid sturgeon Scaphirhynchus albus (Forbes and Richardson, 1905) and the reliability of catch rate estimates

USGS Publications Warehouse

DeVries, R. J.; Hann, D. A.; Schramm, H.L.

2015-01-01

This study evaluated the effects of environmental parameters on the probability of capturing endangered pallid sturgeon (Scaphirhynchus albus) using trotlines in the lower Mississippi River. Pallid sturgeon were sampled by trotlines year round from 2008 to 2011. A logistic regression model indicated water temperature (T; P < 0.01) and depth (D; P = 0.03) had significant effects on capture probability (Y = −1.75 − 0.06T + 0.10D). Habitat type, surface current velocity, river stage, stage change and non-sturgeon bycatch were not significant predictors (P = 0.26–0.63). Although pallid sturgeon were caught throughout the year, the model predicted that sampling should focus on times when the water temperature is less than 12°C and in deeper water to maximize capture probability; these water temperature conditions commonly occur during November to March in the lower Mississippi River. Further, the significant effect of water temperature which varies widely over time, as well as water depth indicate that any efforts to use the catch rate to infer population trends will require the consideration of temperature and depth in standardized sampling efforts or adjustment of estimates.

The reaction probability of N2O5 with sulfuric acid aerosols at stratospheric temperatures and compositions

NASA Technical Reports Server (NTRS)

Fried, Alan; Henry, Bruce E.; Calvert, Jack G.; Mozurkewich, Michael

1994-01-01

We have measured the rate of reaction of N2O5 with H2O on monodisperse, submicrometer H2SO4 particles in a low-temperature flow reactor. Measurements were carried out at temperatures between 225 K and 293 K on aerosol particles with sizes and compositions comparable to those found in the stratosphere. At 273 K, the reaction probability was found to be 0.103 +/- 0.0006, independent of H2SO4 composition from 64 to 81 wt%. At 230 K, the reaction probability increased from 0.077 for compositions near 60% H2SO4 to 0.146 for compositions near 70% H2SO4. Intermediate conditions gave intermediate results except for low reaction probabilities of about 0.045 at 260 K on aerosols with about 78% H2SO4. The reaction probability did not depend on particle size. These results imply that the reaction occurs essentially at the surface of the particle. A simple model for this type of reaction that reproduces the general trends observed is presented. the presence of formaldehyde did not affect the reaction rate.

Absolute emission cross sections for electron capture reactions of C2+, N3+, N4+ and O3+ ions in collisions with Li(2s) atoms

NASA Astrophysics Data System (ADS)

Rieger, G.; Pinnington, E. H.; Ciubotariu, C.

2000-12-01

Absolute photon emission cross sections following electron capture reactions have been measured for C2+, N3+, N4+ and O3+ ions colliding with Li(2s) atoms at keV energies. The results are compared with calculations using the extended classical over-the-barrier model by Niehaus. We explore the limits of our experimental method and present a detailed discussion of experimental errors.

Natural Language Processing-Enabled and Conventional Data Capture Methods for Input to Electronic Health Records: A Comparative Usability Study.

PubMed

Kaufman, David R; Sheehan, Barbara; Stetson, Peter; Bhatt, Ashish R; Field, Adele I; Patel, Chirag; Maisel, James Mark

2016-10-28

The process of documentation in electronic health records (EHRs) is known to be time consuming, inefficient, and cumbersome. The use of dictation coupled with manual transcription has become an increasingly common practice. In recent years, natural language processing (NLP)-enabled data capture has become a viable alternative for data entry. It enables the clinician to maintain control of the process and potentially reduce the documentation burden. The question remains how this NLP-enabled workflow will impact EHR usability and whether it can meet the structured data and other EHR requirements while enhancing the user's experience. The objective of this study is evaluate the comparative effectiveness of an NLP-enabled data capture method using dictation and data extraction from transcribed documents (NLP Entry) in terms of documentation time, documentation quality, and usability versus standard EHR keyboard-and-mouse data entry. This formative study investigated the results of using 4 combinations of NLP Entry and Standard Entry methods ("protocols") of EHR data capture. We compared a novel dictation-based protocol using MediSapien NLP (NLP-NLP) for structured data capture against a standard structured data capture protocol (Standard-Standard) as well as 2 novel hybrid protocols (NLP-Standard and Standard-NLP). The 31 participants included neurologists, cardiologists, and nephrologists. Participants generated 4 consultation or admission notes using 4 documentation protocols. We recorded the time on task, documentation quality (using the Physician Documentation Quality Instrument, PDQI-9), and usability of the documentation processes. A total of 118 notes were documented across the 3 subject areas. The NLP-NLP protocol required a median of 5.2 minutes per cardiology note, 7.3 minutes per nephrology note, and 8.5 minutes per neurology note compared with 16.9, 20.7, and 21.2 minutes, respectively, using the Standard-Standard protocol and 13.8, 21.3, and 18.7 minutes