Sample records for ka 14c bp

  1. Marine04 Marine radiocarbon age calibration, 26 ? 0 ka BP

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hughen, K; Baille, M; Bard, E

    2004-11-01

    New radiocarbon calibration curves, IntCal04 and Marine04, have been constructed and internationally ratified to replace the terrestrial and marine components of IntCal98. The new calibration datasets extend an additional 2000 years, from 0-26 ka cal BP (Before Present, 0 cal BP = AD 1950), and provide much higher resolution, greater precision and more detailed structure than IntCal98. For the Marine04 curve, dendrochronologically dated tree-ring samples, converted with a box-diffusion model to marine mixed-layer ages, cover the period from 0-10.5 ka cal BP. Beyond 10.5 ka cal BP, high-resolution marine data become available from foraminifera in varved sediments and U/Th-dated corals.more » The marine records are corrected with site-specific {sup 14}C reservoir age information to provide a single global marine mixed-layer calibration from 10.5-26.0 ka cal BP. A substantial enhancement relative to IntCal98 is the introduction of a random walk model, which takes into account the uncertainty in both the calendar age and the radiocarbon age to calculate the underlying calibration curve. The marine datasets and calibration curve for marine samples from the surface mixed layer (Marine04) are discussed here. The tree-ring datasets, sources of uncertainty, and regional offsets are presented in detail in a companion paper by Reimer et al.« less

  2. Sediment record of environmental change at Lake Lop Nur (Xinjiang, NW China) from 13.0 to 5.6 cal ka BP

    NASA Astrophysics Data System (ADS)

    Wang, Jingzhong; Jia, Hongjuan

    2017-09-01

    Lake Lop Nur is located in the eastern part of the Tarim Basin in Xinjiang, northwestern China. A 220-cm-long sediment core was collected from the center of the ear-shaped depression forming the basin and dated with AMS14C. Grain size, total organic matter (TOC), total nitrogen (TN), and TOC/TN (C/N) analyses were used to reconstruct climatic conditions from 13.0 to 5.6 cal ka BP. The results showed five main climatic stages. Zone I (13.0-11.3 cal ka BP) was a wet-dry environment, whereas Zone II (11.3-8.9 cal ka BP) consisted of a primarily wet environment. Zone III (8.9-7.7 cal ka BP) was subdivided into Zone IIIa (8.9-8.2 cal ka BP) that indicated lake constriction and dry climate, and Zone IIIb (8.2-7.7 cal ka BP) in which the proxies indicated wet conditions. In Zone IV (7.7-6.6 cal ka BP), the climate presented a bit wet conditions. In Zone V (6.6-5.6 cal ka BP), abundant glauberite is present in the sediment and silt dominates the lithology; these results indicate the lake shrank and the overall climate was dry. Abrupt environmental events were also identified, including six dry events at 11.0, 10.5, 9.3, 8.6, 8.2, and 7.6 cal ka BP and one flood event from 7.8 to 7.7 cal ka BP in the Early-Middle Holocene.

  3. Use of natural diamonds to monitor 14C AMS instrument backgrounds

    NASA Astrophysics Data System (ADS)

    Taylor, R. E.; Southon, John

    2007-06-01

    To examine one component of the instrument-based background in the University of California Keck Carbon Cycle AMS spectrometer, we have obtained measurements on a set of natural diamonds pressed into sample holders. Natural diamond samples (N = 14) from different sources within rock formations with geological ages greatly in excess of 100 Ma yielded a range of currents (∼110-250 μA 12C- where filamentous graphite typically yields ∼150 μA 12C-) and apparent 14C ages (64.9 ± 0.4 ka BP [0.00031 ± 0.00002 fm] to 80.0 ± 1.1 ka BP [0.00005 ± 0.00001 fm]). Six fragments cut from a single diamond exhibited essentially identical 14C values - 69.3 ± 0.5 ka-70.6 ± 0.5 ka BP. The oldest 14C age equivalents were measured on natural diamonds which exhibited the highest current yields.

  4. At the end of the 14C time scale--the Middle to Upper Paleolithic record of western Eurasia.

    PubMed

    Jöris, Olaf; Street, Martin

    2008-11-01

    The dynamics of change underlying the demographic processes that led to the replacement of Neandertals by Anatomically Modern Humans (AMH) and the emergence of what are recognized as Upper Paleolithic technologies and behavior can only be understood with reference to the underlying chronological framework. This paper examines the European chronometric (mainly radiocarbon-based) record for the period between ca. 40 and 30 ka 14C BP and proposes a relatively rapid transition within some 2,500 years. This can be summarized in the following falsifiable hypotheses: (1) final Middle Paleolithic (FMP) "transitional" industries (Uluzzian, Chatelperronian, leaf-point industries) were made by Neandertals and date predominantly to between ca. 41 and 38 ka 14C BP, but not younger than 35/34 ka 14C BP; (2) initial (IUP) and early (EUP) Upper Paleolithic "transitional" industries (Bachokirian, Bohunician, Protoaurignacian, Kostenki 14) will date to between ca. 39/38 and 35 ka 14C BP and document the appearance of AMH in Europe; (3) the earliest Aurignacian (I) appears throughout Europe quasi simultaneously at ca. 35 ka 14C BP. The earliest appearance of figurative art is documented only for a later phase ca. 33.0/32.5-29.2 ka 14C BP. Taken together, the Middle to Upper Paleolithic transition appears to be a cumulative process involving the acquisition of different elements of "behavioral modernity" through several "stages of innovation."

  5. Chronostratigraphy in karst records from the Epipaleolithic to the Mid/Early Neolithic (c. 13.0-6.0 cal ka BP) in the Catalan Coastal Ranges of NE Iberia: environmental changes, sedimentary processes and human activity

    NASA Astrophysics Data System (ADS)

    Bergadà, M. Mercè; Cervelló, Josep M.; Edo, Manel; Cebrià, Artur; Oms, F. Xavier; Martínez, Pablo; Antolín, Ferran; Morales, Juan Ignacio; Pedro, Mireia

    2018-03-01

    The stratigraphic, sedimentary and palaeoenvironmental features reflected in cavities in the Catalan Coastal Ranges of NE Iberia (Can Sadurní and Guineu caves) characterize the periods of pronounced climatic and human complexity that occurred c. 13.0-6.0 cal ka BP. This includes the stages of the Younger Dryas and Mid/Early Holocene, the latter being one of the periods of so-called Rapid Climatic Changes (RCCs). These caves, like others in Mediterranean contexts, are the result of an old duct originating in the saturated zone of the karst system and open to the outside; recording a succession of different detrital and anthropic episodes of the Epipaleolithic, Mesolithic and Neolithic communities. From this study it can be seen that paleoclimatic events do not always present clear signals in the karst records, especially c. 12.7-7.4 cal ka BP, corresponding to the Epipaleolithic and Mesolithic. It is characterized by a stratigraphic discontinuity in which there are phases with predominantly detrital sedimentation alternating with hiatus intervals. Detrital sedimentation formed by fine material colluvium with gravitational movements or solifluction processes in fresh and humid conditions. It appears in the following chronological intervals: 12.7-12.2 cal ka BP, 11.5/11.1-10.7/10.4 cal ka BP and 8.2-8.0 cal ka BP (less humid). Hiatus phases are represented in the rest of the sequence up to c. 7.4 cal ka BP. From the sedimentary point of view these stages of hiatus are indicative of phases of stability or lack of episodes with seasonal contrasts; a fact that would cause interruptions to detrital deposition in the interior of the caves. In contrast, in the period c. 7.4 to 6.0 cal ka BP, attributed to the Middle and Early Neolithic, there is a certain stratigraphic continuity. From the sedimentary point of view it is distinguished by a variability of processes that responds to accumulative episodes of short duration characteristic of morphogenesis of the slopes in an

  6. AMS radiocarbon dating and varve chronology of Lake Soppensee: 6000 to 12000 14C years BP

    NASA Astrophysics Data System (ADS)

    Hajdas, Irena; Ivy, Susan D.; Beer, Jürg; Bonani, Georges; Imboden, Dieter; Lotted, André F.; Sturm, Michael; Suter, Martin

    1993-12-01

    For the extension of the radiocarbon calibration curve beyond 10000 14C y BP, laminated sediment from Lake Soppensee (central Switzerland) was dated. The radiocarbon time scale was obtained using accelerator mass spectrometry (AMS) dating of terrestrial macrofossils selected from the Soppensee sediment. Because of an unlaminated sediment section during the Younger Dryas (10000 11000 14C y BP), the absolute time scale, based on counting annual layers (varves), had to be corrected for missing varves. The Soppensee radiocarbon-verve chronology covers the time period from 6000 to 12000 14C y BP on the radiocarbon time scale and 7000 to 13000 calendar y BP on the absolute time scale. The good agreement with the tree ring curve in the interval from 7000 to 11450 cal y BP (cal y indicates calendar year) proves the annual character of the laminations. The ash layer of the Vasset/Killian Tephra (Massif Central, France) is dated at 8230±140 14C y BP and 9407±44 cal y BP. The boundaries of the Younger Dryas biozone are placed at 10986±69 cal y BP (Younger Dryas/Preboreal) and 1212±86 cal y BP (Alleröd/Younger Dryas) on the absolute time scale. The absolute age of the Laacher See Tephra layer, dated with the radiocarbon method at 10 800 to 11200 14C y BP, is estimated at 12350 ± 135 cal y BP. The oldest radiocarbon age of 14190±120 14C y BP was obtained on macrofossils of pioneer vegetation which were found in the lowermost part of the sediment profile. For the late Glacial, the offset between the radiocarbon (10000 12000 14C y BP) and the absolute time scale (11400 13000 cal y BP) in the Soppensee chronology is not greater than 1000 years, which differs from the trend of the U/Th-radiocarbon curve derived from corals.

  7. High-precision 14C and 40Ar/39Ar dating of the Campanian Ignimbrite (Y-5) reconciles the time-scales of climatic-cultural processes at 40 ka.

    PubMed

    Giaccio, Biagio; Hajdas, Irka; Isaia, Roberto; Deino, Alan; Nomade, Sebastien

    2017-04-06

    The Late Pleistocene Campanian Ignimbrite (CI) super-eruption (Southern Italy) is the largest known volcanic event in the Mediterranean area. The CI tephra is widely dispersed through western Eurasia and occurs in close stratigraphic association with significant palaeoclimatic and Palaeolithic cultural events. Here we present new high-precision 14 C (34.29 ± 0.09 14 C kyr BP, 1σ) and 40 Ar/ 39 Ar (39.85 ± 0.14 ka, 95% confidence level) dating results for the age of the CI eruption, which substantially improve upon or augment previous age determinations and permit fuller exploitation of the chronological potential of the CI tephra marker. These results provide a robust pair of 14 C and 40 Ar/ 39 Ar ages for refining both the radiocarbon calibration curve and the Late Pleistocene time-scale at ca. 40 ka. In addition, these new age constraints provide compelling chronological evidence for the significance of the combined influence of the CI eruption and Heinrich Event 4 on European climate and potentially evolutionary processes of the Early Upper Palaeolithic.

  8. High-precision 14C and 40Ar/39Ar dating of the Campanian Ignimbrite (Y-5) reconciles the time-scales of climatic-cultural processes at 40 ka

    PubMed Central

    Giaccio, Biagio; Hajdas, Irka; Isaia, Roberto; Deino, Alan; Nomade, Sebastien

    2017-01-01

    The Late Pleistocene Campanian Ignimbrite (CI) super-eruption (Southern Italy) is the largest known volcanic event in the Mediterranean area. The CI tephra is widely dispersed through western Eurasia and occurs in close stratigraphic association with significant palaeoclimatic and Palaeolithic cultural events. Here we present new high-precision 14C (34.29 ± 0.09 14C kyr BP, 1σ) and 40Ar/39Ar (39.85 ± 0.14 ka, 95% confidence level) dating results for the age of the CI eruption, which substantially improve upon or augment previous age determinations and permit fuller exploitation of the chronological potential of the CI tephra marker. These results provide a robust pair of 14C and 40Ar/39Ar ages for refining both the radiocarbon calibration curve and the Late Pleistocene time-scale at ca. 40 ka. In addition, these new age constraints provide compelling chronological evidence for the significance of the combined influence of the CI eruption and Heinrich Event 4 on European climate and potentially evolutionary processes of the Early Upper Palaeolithic. PMID:28383570

  9. Beringian Megafaunal Extinctions at ~37 ka B.P.: Do Micrometeorites Embedded in Fossil Tusks and Skulls Indicate an Extraterrestial Precursor to the Younger Dryas Event?

    NASA Astrophysics Data System (ADS)

    Hagstrum, J. T.; Firestone, R. B.; West, A.

    2009-12-01

    Studies of Late Pleistocene megafaunal fossils and their ancient DNA from Beringia (eastern Siberia, Alaska, and the emerged Bering Strait) indicate sharp declines in steppe bison population diversity and horse body size, extinction of the Alaskan wild ass, and local extinctions of brown bear and woolly mammoth genetic lines beginning at about 37 ka B.P. Beringia is also well known for its remarkably preserved Late Pleistocene frozen animal mummies. 14C ages of these mummies are bimodally distributed, having peaks coincident with the earlier ~37 ka B.P., and ~13 ka B.P. Younger Dryas, onset extinction events. Associated with the ~37 ka B.P. event are, for example, the Berezovka mammoth, headless Selerikan horse, steppe bison “Blue Babe”, and baby mammoths “Dima” and “Lyuba”. Analyses of these and other mummies indicate that they died instantly, in mostly healthy condition, with gut contents and high fat reserves indicative of a late summer to autumn season. An assortment of uneaten limbs and other body parts from a variety of species have also been found. Uniformitarian death scenarios inadequately account for the lack of evidence of normal predation and scavenging. Extensive internal injuries (e.g. large bone fractures, hemorrhaging) and apparent rapid burial of the mummies also indicate that something truly unusual happened at the time of these extinction events. We have discovered what appear to be micrometeorites embedded in seven Alaskan mammoth tusks and a Siberian bison skull acquired from commercial sources. 14C ages for five of these fossils have a weighted mean age of 33 ± 2 ka B.P. Laser ablation ICP-MS and XRF analyses of the particles indicate high Fe contents with compositions enriched in Ni and depleted in Ti, similar to Fe meteorites and unlike any natural terrestrial sources. Microprobe analyses of a Fe-Ni sulfide grain from tusk 2 also show that it contains between 3 and 20 weight percent Ni. SEM images and XRF analyses of a bison

  10. Abrupt climate change around 4 ka BP: Role of the Thermohaline circulation as indicated by a GCM experiment

    NASA Astrophysics Data System (ADS)

    Wang, Shaowu; Zhou, Tianjun; Cai, Jingning; Zhu, Jinhong; Xie, Zhihui; Gong, Daoyi

    2004-04-01

    A great deal of palaeoenvironmental and palaeoclimatic evidence suggests that a predominant temperature drop and an aridification occurred at ca. 4.0 ka BP. Palaeoclimate studies in China support this dedution. The collapse of ancient civilizations at ca. 4.0 ka BP in the Nile Valley and Mesopotamia has been attributed to climate-induced aridification. A widespread alternation of the ancient cultures was also found in China at ca. 4.0 ka BP in concert with the collapse of the civilizations in the Old World. Palaeoclimatic studies indicate that the abrupt climate change at 4.0 ka BP is one of the realizations of the cold phase in millennial scale climate oscillations, which may be related to the modulation of the Thermohaline Circulation (THC) over the Atlantic Ocean. Therefore, this study conducts a numerical experiment of a GCM with SST forcing to simulate the impact of the weakening of the THC. Results show a drop in temperature from North Europe, the northern middle East Asia, and northern East Asia and a significant reduction of precipitation in East Africa, the Middle East, the Indian Peninsula, and the Yellow River Valley. This seems to support the idea that coldness and aridification at ca. 4.0 ka BP was caused by the weakening of the THC.

  11. Pollen-based biomes for Beringia 18,000, 6000 and 0 14C yr BP

    USGS Publications Warehouse

    Edwards, M.E.; Anderson, P.M.; Brubaker, L.B.; Ager, T.A.; Andreev, A.A.; Bigelow, N.H.; Cwynar, L.C.; Eisner, Wendy R.; Harrison, S.P.; Hu, F.-S.; Jolly, D.; Lozhkin, A.V.; MacDonald, G.M.; Mock, Cary J.; Ritchie, J.C.; Sher, A.V.; Spear, R.W.; Williams, J.W.; Yu, G.

    2000-01-01

    The objective biomization method developed by Prentice et al. (1996) for Europe was extended using modern pollen samples from Beringia and then applied to fossil pollen data to reconstruct palaeovegetation patterns at 6000 and 18,000 14C yr BP. The predicted modern distribution of tundra, taiga and cool conifer forests in Alaska and north-western Canada generally corresponds well to actual vegetation patterns, although sites in regions characterized today by a mosaic of forest and tundra vegetation tend to be preferentially assigned to tundra. Siberian larch forests are delimited less well, probably due to the extreme under-representation of Larix in pollen spectra. The biome distribution across Beringia at 6000 14C yr BP was broadly similar to today, with little change in the northern forest limit, except for a possible northward-advance in the Mackenzie delta region. The western forest limit in Alaska was probably east of its modern position. At 18,000 14C yr BP the whole of Beringia was covered by tundra. However, the importance of the various plant functional types varied from site to site, supporting the idea that the vegetation cover was a mosaic of different tundra types.

  12. Influence of Monsoon variations on ecosystem changes on the Central Tibetan Plateau during the last 24 ka cal BP (Invited)

    NASA Astrophysics Data System (ADS)

    Kasper, T.; Haberzettl, T.; Zhu, L.; Maeusbacher, R.

    2013-12-01

    Lakes as archives of climate and environmental change are well known and well investigated all over the world, also in high mountain areas such as the Tibetan Plateau (TP) which is one of the most important key players in global climate circulation. Lake sediment records in this area, which were subject to lots of paleoenvironmental investigations, are mostly focused on the Holocene, often showing discontinuities due to desiccation or are located at the margin of the TP, such as Lake Qinghai. Here we present the first continuous lake sediment record from the southern central TP from Lake Nam Co, comprising ~24 ka cal BP, i.e., the LGM, the post-Glacial and the entire Holocene. The record reveals environmental changes with varying intensities. Extraordinary high sediment accumulation rates (SAR = 1.3 mm a-1) and quite large quantities of minerogenic input associated with the absence of ostracods during the LGM point to a small lake within a cold and dry environment. Around 19 ka cal BP reduced SAR (~0.3 mm a-1) and the occurrence of ostracods refer to a rising lake level in a moister environment. During the post-Glacial (~16 ka cal BP) changes in the geochemical composition of the sediments and a shift in the pollen composition suggests a change in summer precipitation and wind direction associated with a stronger Indian Ocean Summer Monsoon (IOSM). Major variations in the geochemical parameters between ~12.6 and ~11.6 ka cal BP may reflect the Younger Dryas climate oscillation of the Northern Hemisphere with cool and arid environmental conditions. The most striking hydrological variation within this record occurs at ~9.5 ka cal BP in the early Holocene. A rise in TOC points to enhanced bio-productivity within the lake and the catchment as well as to hampered decomposition of organic matter at the lake floor. Pollen composition refers to alpine meadow vegetation assemblages during this time. This may reflect moist and warm conditions probably associated with a

  13. Stratigraphic reconstruction of the 13 ka BP debris avalanche deposit at Colima volcano (Mexico): effect of climatic conditions on the flow mobility

    NASA Astrophysics Data System (ADS)

    Roverato, M.; Capra, L.

    2010-12-01

    Colima volcano is an andesitic stratovolcano located in the western part of the Trans-Mexican Volcanic Belt (TMVB) and at the southern end of the N-S trending Colima graben, about 70 km from the Pacific Ocean coast. It is probably the most active Mexican volcano in historic time and one of the most active of North America. Colima volcano yielded numerous partial edifice collapses with emplacement of debris avalanche deposits (DADs) of contrasting volume, morphology, texture and origin. This work has the aim to provide the evidences of how the climatic condition during the 13 ka flank collapse of the Colima volcano affected the textural characteristic and the mobility of the debris avalanche and debris flow originated from this event that occurred just after the Last Glacial Maximum in Mexico (18.4-14.5 ka 14C BP with snow line at 3600 m a.s.l. up to 13 ka BP). The 13,000 yrs old debris avalanche deposit, here named Tonila (TDAD) presents the typical debris avalanche textural characteristics (angular to sub-angular clasts, coarse matrix, jigsaw fit) but at approximately 13 km from the source, the deposit transforms to an hybrid phase with debris avalanche fragments imbedded in a finer, homogenous and indurated matrix more similar to a debris flow deposit. The debris avalanche deposit is directly overly by debris flows, often more than 10 m thick that contains large amount of logs from pine tree, mostly accumulated toward the base and imbricated down flow. Fluvial deposits also occur throughout all successions, representing periods of stream and river reworking highly localized and re-establishment. All these evidences point to the presence of water in the mass previous to the failure. The event here described represent an anomalous event between the previously described deposit associated to volcanic complex, and evidence as climatic condition can alter and modifies the depositional sequences incrementing the hazard.

  14. Stalagmite-inferred centennial variability of the Asian summer monsoon in southwest China between 58 and 79 ka BP

    NASA Astrophysics Data System (ADS)

    Zhang, Tao-Tao; Li, Ting-Yong; Cheng, Hai; Edwards, R. Lawrence; Shen, Chuan-Chou; Spötl, Christoph; Li, Hong-Chun; Han, Li-Yin; Li, Jun-Yun; Huang, Chun-Xia; Zhao, Xin

    2017-03-01

    We use a new spliced stalagmite oxygen isotope record from Yangkou Cave and Xinya Cave, Chongqing, southwest China, to reconstruct the centennial-millennial-scale changes in Asian Summer Monsoon (ASM) intensity between 58.0 and 79.3 thousand years before present (ka BP, before AD 1950). This multidecadally resolved record shows four strong ASM periods, corresponding to Greenland Interstadials (GIS) 17-20, and three weak ASM episodes, among which, the one starting at 61.5 ± 0.2 ka BP and ending at 59.4 ± 0.2 ka BP that may correlate with Heinrich Event 6. The close agreement of climate events between China and Greenland supports the notion that the ASM is dominantly governed by high-latitude forcings in the Northern Hemisphere. The short-lived interstadial GIS 18, however, lasted for over 3 kyr in the records derived from ASM region, reflecting a gradual decline of ASM intensity, which coincides with a millennial-scale warming trend in Antarctica. This suggests an additional forcing of the ASM by the Southern Hemisphere, which also affected GIS 8-12, H4 and H5, as shown by previous speleothem studies from the ASM region.

  15. A Storegga age turbidite at Eirik Drift, South Greenland: evidence for synchronous turbidite deposition at 8.2 ka BP in the North Atlantic?

    NASA Astrophysics Data System (ADS)

    Watts, Millie; Taylor, Vicki; Talling, Peter; Hunt, James; Stanford, Jennifer

    2016-04-01

    Eirik Drift contains a high-resolution record of climatic and oceanic variability. In addition, it records several submarine landslides throughout the Holocene. Submarine landslides and associated tsunamis are potentially damaging, and have the potential to travel significant distances across the North Atlantic. Two cores taken from Eirik Drift (D298-P2) show an expanded Holocene section of hemipelagite and contain a fine grained turbidite dated to 8.17 ka BP (+/- 200 years). This event is coincident with both the 8.2 ka BP climatic anomaly, and the Storegga Slide. Paleoenvironmental proxies suggest this 8.2 ka BP turbidite was deposited during the coldest part of the 8.2 ka BP event, interpreted here as a longer duration cooling. This Holocene Storegga Slide triggered a major tsunami, evidence of which has been found across Northern European coastlines and the East Greenland coast. Here we show that the 8.2 ka BP turbidite has a different provenance both to other turbidites within the D298 core, and the main body of the Storegga Slide turbidite, and is unique within the Eirik Drift sequence. We interpret this event within the core as a distal deposit of a turbidite transported within the Western boundary Under Current, potentially related to a more northerly Greenland impact of the Storegga Tsunami. The fine-grained nature of the deposit suggests significant transport, supporting the hypothesis this event relates to a Greenland impact of the Storegga Tsunami.

  16. Work More? The 8.2 kaBP Abrupt Climate Change Event and the Origins of Irrigation Agriculture and Surplus Agro-Production in Mesopotamia

    NASA Astrophysics Data System (ADS)

    Weiss, H.

    2003-12-01

    The West Asian archaeological record is of sufficient transparency and resolution to permit observation of the social responses to the major Holocene abrupt climate change events at 8.2, 5.2 and 4.2 kaBP. The 8.2kaBP abrupt climate change event in West Asia was a three hundred year aridification and cooling episode. During this period rain-fed agriculture, established for over a millennium in northern Mesopotamia, suddenly collapsed. Irrigation agriculture, pastoral nomadism, or migration were the only subsistence alternatives for populations previously supported by cereal dry-farming. Irrigation agriculture was not, however, possible along the northern alluvial plains of the Tigris and Euphrates Rivers, where incised riverbeds were several meters below plain level. Exploitable plain-level levees were only accessible in southern-most alluvial plain, at the head of the present-day Persian Gulf. The archaeological data from this region documents the first irrigation agriculture settlement of the plain during the 8.2 kaBP event. Irrigation agriculture provides about twice the yield of dry-farming in Mesopotamia, but at considerable labor costs relative to dry-farming. With irrigation agriculture surplus production was now available for deployment. But why work more? The 8.2 kaBP event provided the natural force for Mesopotamian irrigation agriculture and surplus production that were essential for the earliest class-formation and urban life.

  17. Continuous lake-sediment records of glaciation in the Sierra Nevada between 52,600 and 12,500 14C yr B.P.

    USGS Publications Warehouse

    Benson, L.V.; May, Howard M.; Antweiler, Ronald C.; Brinton, T.I.; Kashgarian, Michaele; Smoot, J.P.; Lund, S.P.

    1998-01-01

    The chemistry of the carbonate-free clay-size fraction of Owens Lake sediments supports the use of total organic carbon and magnetic susceptibility as indicators of stadial-interstadial oscillations. Owens Lake records of total organic carbon, magnetic susceptibility, and chemical composition of the carbonate-free, clay-size fraction indicate that Tioga glaciation began ~24,500 and ended by ~13,600 14C yr B.P. Many of the components of glacial rock flour (e.g., TiO2, MnO, BaO) found in Owens Lake sediments achieved maximum values during the Tioga glaciation when valley glaciers reached their greatest extent. Total organic carbon and SiO2 (amorphous) concentrations reached minimum values during Tioga glaciation, resulting from decreases in productivity that accompanied the introduction of rock flour into the surface waters of Owens Lake. At least 20 stadial-interstadial oscillations occurred in the Sierra Nevada between 52,600 and 14,000 14C yr B.P. Total organic carbon data from a Pyramid Lake sediment core also indicate oscillations in glacier activity between >39,500 and ~13,600 14C yr B.P. Alpine glacier oscillations occurred on a frequency of ???1900 yr in both basins, suggesting that millennial-scale oscillations occurred in California and Nevada during most of the past 52,600 yr.

  18. Continuous Lake-Sediment Records of Glaciation in the Sierra Nevada between 52,600 and 12,500 14C yr B.P

    NASA Astrophysics Data System (ADS)

    Benson, Larry V.; May, Howard M.; Antweiler, Ronald C.; Brinton, Terry I.; Kashgarian, Michaele; Smoot, Joseph P.; Lund, Steve P.

    1998-09-01

    The chemistry of the carbonate-free clay-size fraction of Owens Lake sediments supports the use of total organic carbon and magnetic susceptibility as indicators of stadial-interstadial oscillations. Owens Lake records of total organic carbon, magnetic susceptibility, and chemical composition of the carbonate-free, clay-size fraction indicate that Tioga glaciation began ˜24,500 and ended by ˜13,600 14C yr B.P. Many of the components of glacial rock flour (e.g., TiO 2, MnO, BaO) found in Owens Lake sediments achieved maximum values during the Tioga glaciation when valley glaciers reached their greatest extent. Total organic carbon and SiO 2(amorphous) concentrations reached minimum values during Tioga glaciation, resulting from decreases in productivity that accompanied the introduction of rock flour into the surface waters of Owens Lake. At least 20 stadial-interstadial oscillations occurred in the Sierra Nevada between 52,600 and 14,000 14C yr B.P. Total organic carbon data from a Pyramid Lake sediment core also indicate oscillations in glacier activity between >39,500 and ˜13,600 14C yr B.P. Alpine glacier oscillations occurred on a frequency of ≤1900 yr in both basins, suggesting that millennial-scale oscillations occurred in California and Nevada during most of the past 52,600 yr.

  19. Molecular Paleoclimate Reconstructions over the Last 9 ka from a Peat Sequence in South China

    PubMed Central

    Wang, Xinxin; Huang, Xianyu; Sachse, Dirk; Ding, Weihua; Xue, Jiantao

    2016-01-01

    To achieve a better understanding of Holocene climate change in the monsoon regions of China, we investigated the molecular distributions and carbon and hydrogen isotope compositions (δ13C and δD values) of long-chain n-alkanes in a peat core from the Shiwangutian (SWGT) peatland, south China over the last 9 ka. By comparisons with other climate records, we found that the δ13C values of the long-chain n-alkanes can be a proxy for humidity, while the δD values of the long-chain n-alkanes primarily recorded the moisture source δD signal during 9–1.8 ka BP and responded to the dry climate during 1.8–0.3 ka BP. Together with the average chain length (ACL) and the carbon preference index (CPI) data, the climate evolution over last 9 ka in the SWGT peatland can be divided into three stages. During the first stage (9–5 ka BP), the δ13C values were depleted and CPI and Paq values were low, while ACL values were high. They reveal a period of warm and wet climate, which is regarded as the Holocene optimum. The second stage (5–1.8 ka BP) witnessed a shift to relatively cool and dry climate, as indicated by the more positive δ13C values and lower ACL values. During the third stage (1.8–0.3 ka BP), the δ13C, δD, CPI and Paq values showed marked increase and ACL values varied greatly, implying an abrupt change to cold and dry conditions. This climate pattern corresponds to the broad decline in Asian monsoon intensity through the latter part of the Holocene. Our results do not support a later Holocene optimum in south China as suggested by previous studies. PMID:27505008

  20. Accelerator 14C dates for early upper paleolithic (basal Aurignacian) at El Castillo Cave (Spain)

    USGS Publications Warehouse

    Valdes, V.C.; Bischoff, J.L.

    1989-01-01

    Three fragments of charcoal taken from different parts of the lowermost bed containing Aurignacian artifacts at El Castillo Cave yielded AMS dates of 37??7 (?? 1??8) ka bp, 38??5 (?? 1??8) ka bp, and 40??0 (?? 2??1) ka bp (average 38??7 ?? 1??9 ka bp). These dates are almost identical to new AMS dates from l'Arbreda cave in Catalunya on the same cultural horizon (average 38??5 ?? 1??0 ka bp) and are significantly older than the earliest dates for Aurignacian industries in the Aquitaine and in other parts of Central and Western Europe. ?? 1989.

  1. 14C ages and activity for the past 50 ka at Volcán Galeras, Colombia

    USGS Publications Warehouse

    Banks, N.G.; Calvache, V.M.L.; Williams, S.N.

    1997-01-01

    Volcán Galeras is the southernmost Colombian volcano with well-recorded historic activity. The volcano is part of a large and complex volcanic center upon which 400,000 people live. Historic activity has centered on a small-volume cone inside the youngest of several large amphitheaters that breach the west flank of the volcano, away from the city of Pasto (population 300,000). Lava flows (SiO2 between 54.6 and 64.7 wt.%) have dominated activity for more than 1 Ma, but explosive events have also occurred. Joint studies by volcanologists from Colombia, Ecuador, Peru, Bolivia, Argentina, and the United States produced 24 new14C ages and more than 100 stratigraphic sections to interpret the past 50 ka of activity at Galeras, including sector collapse events. The youngest collapse event truncated 12.8 ka lava flows and may have occurred as recently as 8 to 10 ka. Tephra-fall material rapidly thins and becomes finer away from the vent area. The only widespread marker in the < 10 ka section is a biotite-bearing tephra deposited between 4.1 and 4.5 ka from a source south of Galeras. It separates cryoturbated from largely undisturbed layers on Galeras, and thus dates a stratigraphic horizon which is useful in the interpretation of other volcanoes and geotectonics in the equatorial Andes. Pyroclastic flows during the past 50 ka have been small to moderate in volume, but they have left numerous thin deposits on the north and east flanks where lava flows have been impeded by crater and amphitheater walls. Many of the pyroclastic-flow deposits are lithic rich, with fines and clasts so strongly altered by hydrothermal action before eruption that they, as well as the sector collapse deposits, resemble waste dumps of leached cappings from disseminated sulfide deposits more than volcanogenic deposits. This evidence of a long-lived hydrothermal system indicates susceptibility to mass failure and explosive events higher than expected for a volcano built largely by lava flows and

  2. 14C ages and activity for the past 50 ka at Volcán Galeras, Colombia

    NASA Astrophysics Data System (ADS)

    Banks, N. G.; Calvache V, M. L.; Williams, S. N.

    1997-05-01

    Volcán Galeras is the southernmost Colombian volcano with well-recorded historic activity. The volcano is part of a large and complex volcanic center upon which 400,000 people live. Historic activity has centered on a small-volume cone inside the youngest of several large amphitheaters that breach the west flank of the volcano, away from the city of Pasto (population 300,000). Lava flows (SiO 2 between 54.6 and 64.7 wt.%) have dominated activity for more than 1 Ma, but explosive events have also occurred. Joint studies by volcanologists from Colombia, Ecuador, Peru, Bolivia, Argentina, and the United States produced 24 new 14C ages and more than 100 stratigraphic sections to interpret the past 50 ka of activity at Galeras, including sector collapse events. The youngest collapse event truncated 12.8 ka lava flows and may have occurred as recently as 8 to 10 ka. Tephra-fall material rapidly thins and becomes finer away from the vent area. The only widespread marker in the < 10 ka section is a biotite-bearing tephra deposited between 4.1 and 4.5 ka from a source south of Galeras. It separates cryoturbated from largely undisturbed layers on Galeras, and thus dates a stratigraphic horizon which is useful in the interpretation of other volcanoes and geotectonics in the equatorial Andes. Pyroclastic flows during the past 50 ka have been small to moderate in volume, but they have left numerous thin deposits on the north and east flanks where lava flows have been impeded by crater and amphitheater walls. Many of the pyroclastic-flow deposits are lithic rich, with fines and clasts so strongly altered by hydrothermal action before eruption that they, as well as the sector collapse deposits, resemble waste dumps of leached cappings from disseminated sulfide deposits more than volcanogenic deposits. This evidence of a long-lived hydrothermal system indicates susceptibility to mass failure and explosive events higher than expected for a volcano built largely by lava flows and

  3. A ~25 ka Indian Ocean monsoon variability record from the Andaman Sea

    USGS Publications Warehouse

    Rashid, H.; Flower, B.P.; Poore, R.Z.; Quinn, T.M.

    2007-01-01

    Recent paleoclimatic work on terrestrial and marine deposits from Asia and the Indian Ocean has indicated abrupt changes in the strength of the Asian monsoon during the last deglaciation. Comparison of marine paleoclimate records that track salinity changes from Asian rivers can help evaluate the coherence of the Indian Ocean monsoon (IOM) with the larger Asian monsoon. Here we present paired Mg/Ca and δ18O data on the planktic foraminifer Globigerinoides ruber (white) from Andaman Sea core RC12-344 that provide records of sea-surface temperature (SST) and δ18O of seawater (δ18Osw) over the past 25,000 years (ka) before present (BP). Age control is based on nine accelerator mass spectrometry (AMS) dates on mixed planktic foraminifera. Mg/Ca-SST data indicate that SST was ∼3 °C cooler during the last glacial maximum (LGM) than the late Holocene. Andaman Sea δ18Osw exhibited higher than present values during the Lateglacial interval ca 19–15 ka BP and briefly during the Younger Dryas ca 12 ka BP. Lower than present δ18Osw values during the BØlling/AllerØd ca 14.5–12.6 ka BP and during the early Holocene ca 10.8–5.5 ka BP are interpreted to indicate lower salinity, reflect some combination of decreased evaporation–precipitation (E–P) over the Andaman Sea and increased Irrawaddy River outflow. Our results are consistent with the suggestion that IOM intensity was stronger than present during the BØlling/AllerØd and early Holocene, and weaker during the late glaciation, Younger Dryas, and the late Holocene. These findings support the hypothesis that rapid climate change during the last deglaciation and Holocene included substantial hydrologic changes in the IOM system that were coherent with the larger Asian monsoon.

  4. The 9.2 ka event in Asian summer monsoon area: the strongest millennial scale collapse of the monsoon during the Holocene

    NASA Astrophysics Data System (ADS)

    Zhang, Wenchao; Yan, Hong; Dodson, John; Cheng, Peng; Liu, Chengcheng; Li, Jianyong; Lu, Fengyan; Zhou, Weijian; An, Zhisheng

    2018-04-01

    Numerous Holocene paleo-proxy records exhibit a series of centennial-millennial scale rapid climatic events. Unlike the widely acknowledged 8.2 ka climate anomaly, the likelihood of a significant climate excursion at around 9.2 cal ka BP, which has been notably recognized in some studies, remains to be fully clarified in terms of its magnitude and intensity, as well as its characteristics and spatial distributions in a range of paleoclimatic records. In this study, a peat sediment profile from the Dajiuhu Basin in central China was collected with several geochemical proxies and a pollen analysis carried out to help improve understanding of the climate changes around 9.2 cal ka BP. The results show that the peat development was interrupted abruptly at around 9.2 cal ka BP, when the chemical weathering strength decreased and the tree-pollen declined. This suggests that a strong drier regional climatic event occurred at around 9.2 cal ka BP in central China, which was, in turn, probably connected to the rapid 9.2 ka climate event co-developing worldwide. In addition, based on the synthesis of our peat records and the other Holocene hydrological records from Asian summer monsoon (ASM) region, we further found that the 9.2 ka event probably constituted the strongest abrupt collapse of the Asian monsoon system during the full Holocene interval. The correlations between ASM and the atmospheric 14C production rate, the North Atlantic drift ice records and Greenland temperature indicated that the weakened ASM event at around 9.2 cal ka BP could be interpreted by the co-influence of external and internal factors, related to the changes of the solar activity and the Atlantic Meridional Overturning Circulation (AMOC).

  5. Evaluation of HLA-G 14-bp ins/del and +3142G>C polymorphisms with susceptibility to recurrent spontaneous abortion.

    PubMed

    Hashemi, Mohammad; Mokhtari, Mojgan; Khazaeian, Safura; Bahari, Gholamreza; Rezaei, Maryam; Nakhaee, Alireza; Taheri, Mohsen

    2017-06-01

    HLA-G is critically important for successful implantation during pregnancy. Increasing evidence supposed that HLA-G plays a key role in tolerance of the semi-allogeneic graft in pregnancy by inhibiting the cytotoxic functions of T and NK cells. The present study aimed to evaluate the impact of HLA-G rs1063320 (+3142G>C) and 14-bp insertion (ins)/deletion (del) polymorphisms on recurrent spontaneous abortion (RSA). Genomic DNA from 93 RSA patients and 93 normal fertile women was isolated using the salting out method. Genotyping of HLA-G +3142G>C and 14-bp ins/del variants was done by polymerase chain reaction restriction fragment length polymorphism (PCR-RFP) and PCR method, respectively. The HLA-G +3142G>C polymorphism increased the risk of RSA in codominant (OR = 2.39, 95%CI = 1.27-4.49, p = 0.010, GC vs GG; OR = 3.28, 95%CI = 1.16-9.72, p = 0.040, CC vs GG) and dominant (OR = 2.52, 95%CI = 1.37-4.64, p = 0.004, GC + CC vs GG) tested inheritance models. HLA-G rs1063320 C allele was associated with increased risk of RSA (OR = 1.84, 95%CI = 1.20-2.83, p = 0.007). The del/del genotype as well as del allele of 14-bp ins/del variant increased that risk of RSA (OR = 3.02, 95%CI = 1.23-7.41, p = 0.025 and OR = 1.65, 95%CI = 1.09-2.50, p = 0.022, respectively). In summary, our results showed that HLA-G gene polymorphisms significantly increased the risk of RSA in a sample of the Iranian population. Copyright © 2017. Published by Elsevier B.V.

  6. Biomes of western North America at 18,000, 6000 and 0 14C yr BP reconstructed from pollen and packrat midden data

    USGS Publications Warehouse

    Thompson, R.S.; Anderson, K.H.

    2000-01-01

    A new compilation of pollen and packrat midden data from western North America provides a refined reconstruction of the composition and distribution of biomes in western North America for today and for 6000 and 18,000 radiocarbon years before present (14C yr BP). Modern biomes in western North America are adequately portrayed by pollen assemblages from lakes and bogs. Forest biomes in western North America share many taxa in their pollen spectra and it can be difficult to discriminate among these biomes. Plant macrofossils from packrat middens provide reliable identification of modern biomes from arid and semiarid regions, and this may also be true in similar environments in other parts of the world. However, a weighting factor for trees and shrubs must be used to reliably reconstruct modern biomes from plant macrofossils. A new biome, open conifer woodland, which includes eurythermic conifers and steppe plants, was defined to categorize much of the current and past vegetation of the semiarid interior of western North America. At 6000 14C yr BP, the forest biomes of the coastal Pacific North-west and the desert biomes of the South-west were in near-modern positions. Biomes in the interior Pacific North-west differed from those of today in that taiga prevailed in modern cool/cold mixed forests. Steppe was present in areas occupied today by open conifer woodland in the northern Great Basin, while in the central and southern Rocky Mountains forests grew where steppe grows today. During the mid-Holocene, cool conifer forests were expanded in the Rocky Mountains (relative to today) but contracted in the Sierra Nevada. These differences from the forests of today imply different climatic histories in these two regions between 6000 14C yr BP and today. At 18,000 14C yr BP, deserts were absent from the South-west and the coverage of open conifer woodland was greatly expanded relative to today. Steppe and tundra were present in much of the region now covered by forests in

  7. Ostracods and sediment geochemistry as indicators of hydrologic and climatic variability in the central part of the Mexican Chihuahuan Desert over the last 27 ka cal BP

    NASA Astrophysics Data System (ADS)

    Chávez Lara, C. M.; Roy, P. D.; Lozano Santa Cruz, R.; López Balbiaux, N.

    2013-12-01

    The paleolake Santiaguillo (Durango State) is located in the central part of the Chihuahuan Desert (Mexico). The lacustrine basin covers an area of approximately 1,964 km2 and is surrounded by mountains up to ca. 2,700 masl. This basin was formed by tectonic processes and the basement is formed by volcanic felsic rocks of Tertiary age. Four sediment cores were obtained from central and western part of the basin to reconstruct hydrologic and climate variability during the late Pleistocene and Holocene. In this work, we present paleo-ecology of ostracods and sedimentary geochemistry from two sediment cores (300 cm and 200 cm long) collected from the western basin margin. The age model was constructed from 8 AMS radiocarbon dates and the longest profile represents the last 27 cal ka BP. The ostracode faunal content consists of 4 different species: Limnocythere bradburyi, Cadona patzcuaro, Cypridopsis vidua and Limnocythere ceriotuberosa (listed from highest to lowest abundance) and total abundance varies between 0 and 125 valves/g. Paleo-environmental conditions were reconstructed from the Total Organic Carbon (TOC), Total Inorganic Carbon (TIC), Carbon/Nitrogen ratios (C/N), Chemical Index of Alteration (CIA) and concentrations of Ti, Ca, Si and Al. The results were divided into two zones for interpretation. Zone 1 covers ca. 27-17 cal ka BP (300-191 cm) and is characterized by higher Ti concentrations and above average CIA values. This suggests greater interaction between water and sediment, lower evaporation and relatively higher lake level in the basin. During this interval of higher lakestand, the deposited organic matter was autochthonous (lacustrine origin) and ostracodes suggest presence of a warm and dilute water column (>13 °C and >100 ppm). Sediments of the last 17 cal ka BP (191-0 cm) (Zone 2) are characterized by below average water-sediment interaction, higher carbonate precipitation and deposition of allochthonous organic matter (terrestrial origin

  8. Diatom-based inference of Asian monsoon precipitation from a volcanic lake in southwest China for the last 18.5 ka

    NASA Astrophysics Data System (ADS)

    Li, Yanling; Chen, Xu; Xiao, Xiayun; Zhang, Hucai; Xue, Bin; Shen, Ji; Zhang, Enlou

    2018-02-01

    Diatom in the volcanic lake provides proxy evidence for pH changes that are characterized by variations in the percentage of acidophilous diatom species. The information regarding the hydrology of the lake, derived from a previous publication and survey of one year on the lake, indicate that pH is low during the wet season and higher during the dry season. Therefore, variations in lake water pH may be considered as a proxy record for past changes in precipitation. In the sediment, high/low relative abundance of acidophilous diatom species indicates high/low precipitation. The diatom record of the past 18.5 ka BP shows that precipitation decrease during the periods 17.0-15.0, 13.3-11.3, and 0.7-0.3 ka BP corresponding to the Heinrich Event 1 (H1), the Younger Dryas cold event (YD), and the Little Ice Age (LA). A marked precipitation increase between 15.0 and 14.5 ka BP occurred at the end of H1 and before the Bølling-Allerød (BA), which indicates a strong pre-Bølling wetting. The start of the Holocene is recorded at 11.3 ka BP. The climate was the wettest between 11.3 and 7.5 ka BP., then the wetter between 7.5 and 3.4 ka BP. Between 3.4 and 0.7 ka BP, the precipitation decrease in general, but in the period from 1.3 to 0.8 ka BP the precipitation was higher corresponding to the Medieval Warm Period (MWP). Our results support the hypothes that the Indian Summer Monsoon (ISM) was strongest during the Early Holocene.

  9. Post-glacial flooding of the Bering Land Bridge dated to 11 cal ka BP based on new geophysical and sediment records

    NASA Astrophysics Data System (ADS)

    Jakobsson, Martin; Pearce, Christof; Cronin, Thomas M.; Backman, Jan; Anderson, Leif G.; Barrientos, Natalia; Björk, Göran; Coxall, Helen; de Boer, Agatha; Mayer, Larry A.; Mörth, Carl-Magnus; Nilsson, Johan; Rattray, Jayne E.; Stranne, Christian; Semiletov, Igor; O'Regan, Matt

    2017-08-01

    The Bering Strait connects the Arctic and Pacific oceans and separates the North American and Asian landmasses. The presently shallow ( ˜ 53 m) strait was exposed during the sea level lowstand of the last glacial period, which permitted human migration across a land bridge today referred to as the Bering Land Bridge. Proxy studies (stable isotope composition of foraminifera, whale migration into the Arctic Ocean, mollusc and insect fossils and paleobotanical data) have suggested a range of ages for the Bering Strait reopening, mainly falling within the Younger Dryas stadial (12.9-11.7 cal ka BP). Here we provide new information on the deglacial and post-glacial evolution of the Arctic-Pacific connection through the Bering Strait based on analyses of geological and geophysical data from Herald Canyon, located north of the Bering Strait on the Chukchi Sea shelf region in the western Arctic Ocean. Our results suggest an initial opening at about 11 cal ka BP in the earliest Holocene, which is later than in several previous studies. Our key evidence is based on a well-dated core from Herald Canyon, in which a shift from a near-shore environment to a Pacific-influenced open marine setting at around 11 cal ka BP is observed. The shift corresponds to meltwater pulse 1b (MWP1b) and is interpreted to signify relatively rapid breaching of the Bering Strait and the submergence of the large Bering Land Bridge. Although the precise rates of sea level rise cannot be quantified, our new results suggest that the late deglacial sea level rise was rapid and occurred after the end of the Younger Dryas stadial.

  10. A high-resolution temporal record of environmental changes in the Eastern Caribbean (Guadeloupe) from 40 to 10 ka BP

    NASA Astrophysics Data System (ADS)

    Royer, Aurélien; Malaizé, Bruno; Lécuyer, Christophe; Queffelec, Alain; Charlier, Karine; Caley, Thibaut; Lenoble, Arnaud

    2017-01-01

    In neotropical regions, fossil bat guano accumulated over time as laminated layers in caves, hence providing a high-resolution temporal record of terrestrial environmental changes. Additionally, cave settings have the property to preserve such organic sediments from processes triggered by winds (deflation, abrasion and sandblasting) and intense rainfall (leaching away). This study reports both stable carbon and nitrogen isotope compositions of frugivorous bat guano deposited in a well-preserved stratigraphic succession of Blanchard Cave on Marie-Galante, Guadeloupe. These isotopic data are discussed with regard to climate changes and its specific impact on Eastern Caribbean vegetation during the Late Pleistocene from 40 to 10 ka cal. BP. Guano δ13C values are higher than modern ones, suggesting noticeable vegetation changes. This provides also evidence for overall drier environmental conditions during the Pleistocene compared to today. Meanwhile, within this generally drier climate, shifts between wetter and drier conditions can be observed. Large temporal amplitudes in both δ13C and δ15N variations reaching up to 5.9‰ and 16.8‰, respectively, also indicate these oceanic tropical environments have been highly sensitive to regional or global climatic forcing. Stable isotope compositions of bat guano deposited from 40 to 35 ka BP, the Last Glacial Maximum and the Younger-Dryas reveal relatively wet environmental conditions whereas, at least from the end of the Heinrich event 1 and the Bølling period the region experienced drier environmental conditions. Nevertheless, when considering uncertainties in the model age, the isotopic record of Blanchard Cave show relatively similar variations with known proxy records from the northern South America and Central America, suggesting thus that the Blanchard Cave record is a robust proxy of past ITCZ migration. Teleconnections through global atmospheric pattern suggest that islands of the eastern Caribbean Basin could

  11. Landscape transformations at the dawn of agriculture in southern Syria (10.7-9.9 ka cal. BP): Plant-specific responses to the impact of human activities and climate change

    NASA Astrophysics Data System (ADS)

    Arranz-Otaegui, Amaia; López-Sáez, José Antonio; Araus, José Luis; Portillo, Marta; Balbo, Andrea; Iriarte, Eneko; Gourichon, Lionel; Braemer, Frank; Zapata, Lydia; Ibáñez, Juan José

    2017-02-01

    In southwest Asia, the accelerated impact of human activities on the landscape has often been linked to the development of fully agricultural societies during the middle and late Pre-Pottery Neolithic B (PPNB) period (around 10.2-7.9 ka cal. BP). This work contributes to the debate on the environmental impact of the so-called Neolitisation process by identifying the climatic and anthropogenic factors that contributed to change local and regional vegetation at the time when domesticated plants appeared and developed in southern Syria (around 10.7-9.9 ka cal. BP). In this work a multidisciplinary analysis of plant microremains (pollen and phytoliths) and macroremains (wood charcoal) is carried out along with stable carbon isotope discrimination of wood charcoals in an early PPNB site (Tell Qarassa North, west of the Jabal al-Arab area). Prior to 10.5 ka cal. BP, the results indicate a dynamic equilibrium in the local and regional vegetation, which comprised woodland-steppe, Mediterranean evergreen oak-woodlands, wetland vegetation and coniferous forests. Around 10.5-9.9 ka cal. BP, the elements that regulated the vegetation system changed, resulting in reduced proportions of arboreal cover and the spread of cold-tolerant and wetlands species. Our data show that reinforcing interaction between the elements of the anthropogenic (e.g. herding, fire-related activities) and climatic systems (e.g. temperature, rainfall) contributed to the transformation of early Holocene vegetation during the emergence of fully agricultural societies in southern Syria.

  12. Inferring LGM sedimentary and climatic changes in the southern Eastern Alps foreland through the analysis of a 14C ages database (Brenta megafan, Italy)

    NASA Astrophysics Data System (ADS)

    Rossato, Sandro; Mozzi, Paolo

    2016-09-01

    The analysis of a database of radiocarbon ages is proposed as a tool for investigating major glaciofluvial systems of the Last Glacial Maximum (LGM) in the Alpine foreland, and their relations with glacier dynamics and climatic fluctuations. Our research concerns the Brenta megafan (NE Italy), where 110 radiocarbon dates integrate a robust regional stratigraphic and palaeoclimatic framework. Age-depth models allowed us to calculate sedimentation rates, while the time distribution of peat layers, which recurrently formed in this region during the LGM, were estimated through meta-analysis. The reliability of statistical results was carefully evaluated using Pearson and Spearman coefficients. Sedimentation rates in the Brenta megafan markedly fluctuated during LGM: ≈1.8 m/ka between 40 and 26.7 ka cal BP; ≈3 m/ka between 26.7 and 23.8 ka cal BP and ≈1.4 m/ka from 23.8 to 17.5 ka cal BP, when the distributary system deactivated due to fan-head trenching. This is evidence that sediment input and routing in the glaciofluvial distributary system was particularly efficient during the central part of LGM, when glaciers were stable at their outermost position. Meta-analysis indicates an increase in peat formation in correspondence with global (Heinrich Event 3 and/or the Greenland Interstadial 5.1 and 4 for the 30.5, 29.6 and 28.8 ka cal BP peaks) and regional (23.5 ka cal BP) wet events. Other peaks at 22.2, 21.8, 20.2 and 19 ka cal BP correlate with fluctuations of south-eastern Alpine glaciers. Significant peat formation continued until ≈18 ka cal BP, when the last peak occurred. A marked decrease in peat formation is recorded concomitantly with the onset of Heinrich Event 2 (i.e. the 26 ka cal BP trough). The good correspondence of sedimentary events in the Brenta glaciofluvial system with the dynamics of glaciers and glaciofluvial and lacustrine systems in the southern Eastern Alps suggests a common climatic forcing on the whole region during the LGM. Peat layer

  13. E258K HCM-causing mutation in cardiac MyBP-C reduces contractile force and accelerates twitch kinetics by disrupting the cMyBP-C and myosin S2 interaction.

    PubMed

    De Lange, Willem J; Grimes, Adrian C; Hegge, Laura F; Spring, Alexander M; Brost, Taylor M; Ralphe, J Carter

    2013-09-01

    Mutations in cardiac myosin binding protein C (cMyBP-C) are prevalent causes of hypertrophic cardiomyopathy (HCM). Although HCM-causing truncation mutations in cMyBP-C are well studied, the growing number of disease-related cMyBP-C missense mutations remain poorly understood. Our objective was to define the primary contractile effect and molecular disease mechanisms of the prevalent cMyBP-C E258K HCM-causing mutation in nonremodeled murine engineered cardiac tissue (mECT). Wild-type and human E258K cMyBP-C were expressed in mECT lacking endogenous mouse cMyBP-C through adenoviral-mediated gene transfer. Expression of E258K cMyBP-C did not affect cardiac cell survival and was appropriately incorporated into the cardiac sarcomere. Functionally, expression of E258K cMyBP-C caused accelerated contractile kinetics and severely compromised twitch force amplitude in mECT. Yeast two-hybrid analysis revealed that E258K cMyBP-C abolished interaction between the N terminal of cMyBP-C and myosin heavy chain sub-fragment 2 (S2). Furthermore, this mutation increased the affinity between the N terminal of cMyBP-C and actin. Assessment of phosphorylation of three serine residues in cMyBP-C showed that aberrant phosphorylation of cMyBP-C is unlikely to be responsible for altering these interactions. We show that the E258K mutation in cMyBP-C abolishes interaction between N-terminal cMyBP-C and myosin S2 by directly disrupting the cMyBP-C-S2 interface, independent of cMyBP-C phosphorylation. Similar to cMyBP-C ablation or phosphorylation, abolition of this inhibitory interaction accelerates contractile kinetics. Additionally, the E258K mutation impaired force production of mECT, which suggests that in addition to the loss of physiological function, this mutation disrupts contractility possibly by tethering the thick and thin filament or acting as an internal load.

  14. Decadal-scale Climate Variability on the Central Iranian Plateau Spanning the So-called 4.2 ka BP Drought Event

    NASA Astrophysics Data System (ADS)

    Carolin, S.; Walker, R. T.; Henderson, G. M.; Maxfield, L.; Ersek, V.; Sloan, A.; Talebian, M.; Fattahi, M.; Nezamdoust, J.

    2015-12-01

    The influence of climate on the growth and development of ancient civilizations throughout the Holocene remains a topic of heated debate. The 4.2 ka BP global-scale mid-to-low latitude aridification event (Walker et al., 2012) in particular has incited various correlation proposals. Some authors suggest that this event may have led to the collapse of the Akkadian empire in Mesopotamia, one of the first empires in human history, as well as to changes among other Early Bronze Age societies dependent on cereal agriculture (eg. Staubwasser and Weiss, 2006). Other authors remain doubtful of the impact of environmental factors on the collapse of past societies (eg. Middleton, 2012). While coincident timing of an environmental event with archeological evidence does not necessitate a causation, a comprehensive understanding of climate variability in the ancient Near East is nonetheless an essential component to resolving the full history of early human settlements. Paleoclimate data on the Central Iranian Plateau, a region rich with ancient history, is exceptionally sparse compared to other areas. Many karst locations are found throughout the region, however, setting the stage for the development of several high-resolution, accurate and precisely-dated climate proxy records if a correlation between the chemistry of semi-arid speleothem samples and climate is resolved. Here we present a 5.1-3.7 ka BP record of decadal-scale stalagmite stable isotope and trace metal variability. The stalagmite was collected in Gol-e zard cave (35.8oN, 52.0oE), ~100 km NE of Tehran on the southern flank of the Alborz mountain range (2530masl). The area currently receives ~270mm mean annual precipitation, with more than 90% of precipitation falling within the wet season (November-May). We use GNIP data from Tehran and local and regional meteorological data to resolve the large-scale mechanisms forcing isotopic variations in rainwater over Gol-e zard cave. We discuss possible transformation of

  15. Assessing open-system behavior of 14C in terrestrial gastropod shells

    USGS Publications Warehouse

    Rech, Jason A.; Pigati, Jeffrey S.; Lehmann, Sophie B.; McGimpsey, Chelsea N.; Grimley, David A.; Nekola, Jeffrey C.

    2011-01-01

    In order to assess open-system behavior of radiocarbon in fossil gastropod shells, we measured the 14C activity on 10 aliquots of shell material recovered from Illinoian (~190-130 ka) and pre-Illinoian (~800 ka) loess and lacustrine deposits in the Midwestern USA. Eight of the 10 aliquots yielded measurable 14C activities that ranged from 0.25 to 0.53 percent modern carbon (pMC), corresponding to apparent 14C ages between 48.2 and 42.1 ka. This small level of open-system behavior is common in many materials that are used for 14C dating (e.g. charcoal), and typically sets the upper practical limit of the technique. Two aliquots of gastropod shells from the Illinoian-aged Petersburg Silt (Petersburg Section) in central Illinois, USA, however, yielded elevated 14C activities of 1.26 and 1.71 pMC, which correspond to apparent 14C ages of 35.1 and 32.7 ka. Together, these results suggest that while many fossil gastropods shells may not suffer from major (>1%) open-system problems, this is not always the case. We then examined the mineralogy, trace element chemistry, and physical characteristics of a suite of fossil and modern gastropod shells to identify the source of contamination in the Petersburg shells and assess the effectiveness of these screening techniques at identifying samples suitable for 14C dating. Mineralogical (XRD) and trace element analyses were inconclusive, which suggests that these techniques are not suitable for assessing open-system behavior in terrestrial gastropod shells. Analysis with scanning electron microscopy (SEM), however, identified secondary mineralization (calcium carbonate) primarily within the inner whorls of the Petersburg shells. This indicates that SEM examination, or possibly standard microscope examination, of the interior of gastropod shells should be used when selecting fossil gastropod shells for 14C dating.

  16. Late quaternary geomagnetic secular variation from historical and 14C-dated lava flows on Hawaii

    NASA Astrophysics Data System (ADS)

    Hagstrum, Jonathan T.; Champion, Duane E.

    1995-12-01

    A paleomagnetic record of geomagnetic paleosecular variation (PSV) is constructed for the last 4400 years based on 191 sites in historical and 14C-dated lava flows from Mauna Loa, Kilauea, and Hualalai Volcanoes on the island of Hawaii. The features of this new record are similar to those recorded by sediments from Lake Waiau near the summit of Mauna Kea Volcano, but overall mean inclinations for the lava flows (31° to 33°, depending on window size) are nearer the expected dipole-field value (35°) than is that for the sediments (27°). Divergence of the inclination records with increasing age suggests that the Lake Waiau values at depths below 2 m have been affected by compaction-related inclination shallowing, although magnetic terrain effects cannot be ruled out. The rate of PSV indicated by the record presented here is highly variable (<0.5°/century to >20°/century), and a pronounced shift in inclination from 25° to 40° occurred between ~1030 and ~975 years B.P. Paleomagnetic directions from undated materials can be correlated with our calibrated curve, but the resolution is largely dependent on the PSV rate and data densities for both the reference and unknown directions. The upper part of the Puna Basalt (18 lava flows), previously sampled for paleomagnetism along the northern wall of Kilauea's caldera (Uwekahuna Bluff), was likely deposited sometime between 1030 and 750 years B.P., but the lowest two flows beneath the Uwekahuna Ash (~2100 years B.P.) are correlated with an age of ~3034 years B.P. Paleomagnetic data for 54 lava flows of the Ka'u Basalt, exposed in the northwest wall of Mauna Loa's summit caldera (Mokuaweoweo), indicate that they probably accumulated over a relatively short time interval (~200+years) and are assigned to a 1000 to 1199 year B.P. time window. The mean of ages within this window is ~1030 years B.P., but mapping and other 14C dates indicate that these summit overflows are probably closer to ~1200 years B.P. in age.

  17. A 27 ka paleoenvironmental lake sediment record from Taro Co, central Tibetan Plateau: implications for the interplay between monsoon and the Westerlies

    NASA Astrophysics Data System (ADS)

    Wang, J.; Ma, Q.; Huang, L.; Ju, J.; Guo, Y.; Lin, X.; Li, Y.; Zhu, L.

    2017-12-01

    The climate of Tibetan Plateau (TP) is mainly influenced by the Indian Ocean Summer Monsoon (IOSM) and the Westerlies. The interaction of these two air masses is therefore a crucial scientific issue to understand how they impact the climate in this area, especially in the geological times. However, constrained by the available archives, researches on this topic are still very few in the hinterland of the TP, especially covering the Last Glacial Maximum (LGM) period. Here we present a new lake sediment record retrieved from Taro Co covering the last 27 ka to elucidate how the IOSM and the Westerlies interact and the possible mechanisms. Taro Co (486 km2, Dmax: 132m, 4565 m a.s.l., currently closed), located on the central TP, is a fresh lake with the major supply from glaciers. Two parallel piston cores as well as several gravity cores were retrieved from the deepest parts. These cores were correlated based on high resolution XRF scanning and a continuous 1069 cm-long core was finally integrated. Chronology was determined by 210Pb, 137Cs and AMS 14C measurements. Multidiscipline analyses including grain size, total organic carbon (TOC), total nitrogen, diatom, ostracod, pollen and n-alkanes were accomplished to reconstruct paleoenvironmental changes. The lake level of Taro Co was low since 27 cal ka BP indicated by very coarse materials and diatom assemblages with gradually increased temperature and salinity (TOC and carbonate getting higher). The terrestrial water input decreased continuously reflected by such elements as Si, Ti, Fe, K. It is likely that there was a sedimentation gap between 961-954cm, corresponding to 23.4 to 18.6 cal ka BP probably demonstrated Taro Co was very shallow at that period. The first prominent abrupt change of most proxies was observed at 14.7 cal ka BP showing a great lake deepening which likely indicated an enhancement of IOSM. There were several spells with abrupt changes of cold/warm stages before the Holocene and the Younger Dryas

  18. Assessing open-system behavior of 14C in terrestrial gastropod shells

    USGS Publications Warehouse

    Rech, J.A.; Pigati, J.S.; Lehmann, S.B.; McGimpsey, C.N.; Grimley, D.A.; Nekola, J.C.

    2011-01-01

    In order to assess open-system behavior of radiocarbon in fossil gastropod shells, we measured the 14C activity on 10 aliquots of shell material recovered from Illinoian (~190-130 ka) and pre-Illinoian (~800 ka) loess and lacustrine deposits in the Midwestern USA. Eight of the 10 aliquots yielded measurable 14C activities that ranged from 0.25 to 0.53 percent modern carbon (pMC), corresponding to apparent 14C ages between 48.2 and 42.1 ka. This small level of open-system behavior is common in many materials that are used for 14C dating (e.g. charcoal), and typically sets the upper practical limit of the technique. Two aliquots of gastropod shells from the Illinoian-aged Petersburg Silt (Petersburg Section) in central Illinois, USA, however, yielded elevated 14C activities of 1.26 and 1.71 pMC, which correspond to apparent 14C ages of 35.1 and 32.7 ka. Together, these results suggest that while many fossil gastropods shells may not suffer from major (>1%) open-system problems, this is not always the case. We then examined the mineralogy, trace element chemistry, and physical characteristics of a suite of fossil and modern gastropod shells to identify the source of contamination in the Petersburg shells and assess the effectiveness of these screening techniques at identifying samples suitable for 14C dating. Mineralogical (XRD) and trace element analyses were inconclusive, which suggests that these techniques are not suitable for assessing open-system behavior in terrestrial gastropod shells. Analysis with scanning electron microscopy (SEM), however, identified secondary mineralization (calcium carbonate) primarily within the inner whorls of the Petersburg shells. This indicates that SEM examination, or possibly standard microscope examination, of the interior of gastropod shells should be used when selecting fossil gastropod shells for 14C dating. ?? 2011 by the Arizona Board of Regents on behalf of the University of Arizona.

  19. The latest explosive eruptions of Ciomadul (Csomád) volcano, East Carpathians - A tephrostratigraphic approach for the 51-29 ka BP time interval

    NASA Astrophysics Data System (ADS)

    Karátson, D.; Wulf, S.; Veres, D.; Magyari, E. K.; Gertisser, R.; Timar-Gabor, A.; Novothny, Á.; Telbisz, T.; Szalai, Z.; Anechitei-Deacu, V.; Appelt, O.; Bormann, M.; Jánosi, Cs.; Hubay, K.; Schäbitz, F.

    2016-06-01

    The most recent, mainly explosive eruptions of Ciomadul, the youngest volcano in the Carpatho-Pannonian Region, have been constrained by detailed field volcanological studies, major element pumice glass geochemistry, luminescence and radiocarbon dating, and a critical evaluation of available geochronological data. These investigations were complemented by the first tephrostratigraphic studies of the lacustrine infill of Ciomadul's twin craters (St. Ana and Mohoş) that received tephra deposition during the last eruptions of the volcano. Our analysis shows that significant explosive activity, collectively called EPPA (Early Phreatomagmatic and Plinian Activity), started at Ciomadul in or around the present-day Mohoş, the older crater, at ≥ 51 ka BP. These eruptions resulted in a thick succession of pyroclastic-fall deposits found in both proximal and medial/distal localities around the volcano, characterized by highly silicic (rhyolitic) glass chemical compositions (ca. 75.2-79.8 wt.% SiO2). The EPPA stage was terminated by a subplinian/plinian eruption at ≥ 43 ka BP, producing pumiceous pyroclastic-fall and -flow deposits of similar glass composition, probably from a "Proto-St. Ana" vent located at or around the younger crater hosting the present-day Lake St. Ana. After a quiescent period with a proposed lava dome growth in the St. Ana crater, a new explosive stage began, defined as MPA (Middle Plinian Activity). In particular, a significant two-phase eruption occurred at 31.5 ka BP, producing pyroclastic flows from vulcanian explosions disrupting the preexisting lava dome of Sf. Ana, and followed by pumiceous fallout from a plinian eruption column. Related pyroclastic deposits show a characteristic, less evolved rhyolitic glass composition (ca. 70.2-74.5 wt.% SiO2) and occur both in proximal and medial/distal localities up to 21 km from source. The MPA eruptions, that may have pre-shaped a crater similar to, but possibly smaller than, the present-day St. Ana

  20. A multi-proxy palaeoecological and palaeoclimatic record within full glacial lacustrine deposits, western Tennessee, USA

    USGS Publications Warehouse

    Grimley, D.A.; Daniel, L.; Kaplan, S.W.; Yansa, C.H.; Curry, B. Brandon; Oches, E.A.

    2009-01-01

    The Fulton Section, along the Mississippi River in western Tennessee, USA, is a 1km continuous exposure (~20m vertically) of Quaternary fluvial and lacustrine deposits, inset within Eocene sediments and buried by thick loess. Fossiliferous slackwater lake sediments record maximum aggradation during the last two major glaciations, with deposition between ca. 190-140 ka and 24-1814C ka BP, based on amino acid and radiocarbon chronology, respectively. During the onset of full glacial conditions (ca. 24-22 14C ka BP), a relatively permanent shallow lake environment is indicated by ostracods, aquatic molluscs, and both pollen and macrofossils of aquatic plants. By 21.8 14C ka BP, increasing emergent plants, amphibious gastropods (Pomatiopsis) and heavier ??18O compositions suggest marsh-like conditions in a periodically drying lake. The surrounding uplands consisted of Picea-Pinus woodlands mixed with cool-temperate hardwoods (e.g. Quercus, Populus, Carya), grasses and herbs. More open conditions ensued ca. 20 14C ka BP, with loess and slopewash gradually infilling the former lake by 18 14C ka BP. Modern analogue analyses of ostracods and palaeontological evidence imply a full glacial climate similar to today's mixed-boreal zone in central Minnesota, USA, about 98C cooler in mean annual temperature than present-day western Tennessee. Copyright ?? 2009 John Wiley & Sons, Ltd.

  1. Cryptotephra from the 74 ka BP Toba super-eruption in the Billa Surgam caves, southern India

    NASA Astrophysics Data System (ADS)

    Lane, Christine; Haslam, Michael; Petraglia, Michael; Ditchfield, Peter; Smith, Victoria; Korisettar, Ravi

    2011-07-01

    The ˜74 ka BP Youngest Toba Tuff (YTT), from the largest known Quaternary volcanic eruption, has been found for the first time as a non-visible ( crypto-) tephra layer within the Billa Surgam caves, southern India. The occurrence of the YTT layer in Charnel House Cave provides the first calendrical age estimate for this much debated Pleistocene faunal sequence and demonstrates the first successful application of cryptotephrochronology within a cave sequence. The YTT layer lies ˜50 cm below a major sedimentological change, which is related to global cooling around the MIS 5 to MIS 4 transition. Using this isochronous event layer the Billa Surgam Cave record can be directly correlated with other archaeological sites in peninsular India and palaeoenvironmental archives across southern Asia.

  2. ELECTRONIC STRUCTURE AND LINEAR OPTICAL PROPERTIES OF MIXED ALKALI-METAL BOROPHOSPHATES (LiK2BP2O8, Li3K2BP4O14): A FIRST-PRINCIPLES STUDY

    NASA Astrophysics Data System (ADS)

    Zhang, Bei; Jing, Qun; Yang, Zhihua; Wang, Ying; Su, Xin; Pan, Shilie; Zhang, Jun

    2013-07-01

    LiK2BP2O8 and Li3K2BP4O14 are synthesized by high-temperature solution method with the same elements, while contain different fundamental building units. Li3K2BP4O14 is a novel P-O-P linking structure which gives a rare example of violation of Pauling's fourth rule. The electronic structures of LiK2BP2O8 and Li3K2BP4O14 are investigated by density functional calculations. Direct gaps of 5.038 eV (LiK2BP2O8) and 5.487 eV (Li3K2BP4O14) are obtained. By analyzing the density of states (DOS) of LiK2BP2O8 and Li3K2BP4O14, the P-O-P linking in fundamental building units of Li3K2BP4O14 crystal is proved theoretically. Based on the electronic properties, the linear optical information is captured.

  3. Timing of wet episodes in Atacama Desert over the last 15 ka. The Groundwater Discharge Deposits (GWD) from Domeyko Range at 25°S.

    NASA Astrophysics Data System (ADS)

    Sáez, Alberto; Godfrey, Linda V.; Herrera, Christian; Chong, Guillermo; Pueyo, Juan J.

    2016-08-01

    A chronologically robust reconstruction of timing and dynamics of millennial time scale wet episodes encompassing the entire Atacama Desert during the last 15 ka has been constructed. To accomplish this, a new composite paleoclimatic record from Groundwater Discharge Deposits (GWD) in the Sierra de Varas (Domeyko Range, southern Atacama in Chile at 25°S) has been compiled and compared with other published paleohydrologic records from the Atacama region. In Sierra de Varas (SV), three millennial timescale wet climate phases have been characterized: around 14.5 ka cal BP, 12.2-9.8 ka cal BP, and 4.7 ka cal BP to the present day. These wet phases are interpreted from intervals of GWD facies formed during periods when the springs were active. GWD facies include: (1) black organic peat, rooted mudstones and sandstones formed in local wetland environments, and (2) gypsum-carbonate rich layers formed by interstitial growth. GWD intervals alternate with gravelly alluvial material deposited during arid phases. A trend towards less humid conditions during the Late Holocene wet episode characterizes GWD sedimentary series in Sierra the Varas, suggesting the onset of a dry episode over the last few centuries. Around 0.7 ka BP a very short wet episode is recorded in the central part of the desert suggesting this was the time of maximum humidity for the entire late Holocene wet period. A brief arid phase occurred between 1.5 and 2.0 ka BP indicated by the absence of GWD in the Domeyko Range. The paleoclimatic reconstruction encompassing the entire Atacama region shows that both the intensity and occurrence of wetter conditions were governed mainly by the distance to the source of moisture, and secondarily by the elevation of the sites. In the northern Atacama (16-20°S), four wet phases fed by N-NE summer monsoon precipitations have been proposed: Tauca phase (18-14 ka cal BP) and Coipasa phase (13-10 ka cal BP) during the Late Glacial, followed by Early Holocene and Late

  4. A 20-ka reconstruction of a Sahelo-Sudanian paleoenvironment using multi-method dating on pedogenic carbonate

    NASA Astrophysics Data System (ADS)

    Diaz, Nathalie; Dietrich, Fabienne; King, Georgina E.; Valla, Pierre G.; Sebag, David; Herman, Frédéric; Verrecchia, Eric P.

    2016-04-01

    Soils can be precious environmental archives as they are open systems resulting from external persistent disturbance, or forcing (Jenny, 1941). Pedogenic carbonate nodules associated with clay-rich soils have been investigated in the Far North region of Cameroon in non-carbonate watersheds (Chad Basin). Nodule bearing soils have mima-like mound morphologies, within stream networks. Such settings raise questions on the processes leading to carbonate precipitation as well as landscape genesis. The mima-like mounds have been identified as degraded Vertisols, resulting from differential erosion induced by a former gilgai micro-relief (Diaz et al., 2016). Non-degraded Vertisols occur in waterlogged areas, located downstream from mima-like mound locations (Braband and Gavaud, 1985). Therefore during a former wetter period Vertisols may have been extended to the mima-like mound areas, followed by a shift toward drier conditions and erosion (Diaz et al., 2016). Consequently, mima-like mounds and associated carbonate nodules are inherited from climatic changes during the Late Pleistocene-Holocene period. The aim of this study is to validate the scenario above using the carbonate nodules collected in a mima-like mound as time archives. Optically stimulated luminescence (OSL) dating of K-feldspars trapped within the nodules is used to assess the deposition time of the soil parent material, composing the mima-like mounds. The carbonate and organic nodule parts have been radiocarbon dated with the aim of assessing the carbonate precipitation age and the age range of soil formation, respectively. Results show that the soil parent material was deposited between 18 ka and 12 ka BP and that the nodules precipitated between 7 ka and 5 ka BP. These results suggest that the deposition occurred during the arid climatic period of the Bossoumian (20 ka to 15 ka BP; Hervieu, 1970) and during the first drier part of the African Humid Period (14.8 ka to 11.5 ka BP; deMenocal et al., 2000

  5. Evidence of resilience to past climate change in Southwest Asia: Early farming communities and the 9.2 and 8.2 ka events

    NASA Astrophysics Data System (ADS)

    Flohr, Pascal; Fleitmann, Dominik; Matthews, Roger; Matthews, Wendy; Black, Stuart

    2016-03-01

    Climate change is often cited as a major factor in social change. The so-called 8.2 ka event was one of the most pronounced and abrupt Holocene cold and arid events. The 9.2 ka event was similar, albeit of a smaller magnitude. Both events affected the Northern Hemisphere climate and caused cooling and aridification in Southwest Asia. Yet, the impacts of the 8.2 and 9.2 ka events on early farming communities in this region are not well understood. Current hypotheses for an effect of the 8.2 ka event vary from large-scale site abandonment and migration (including the Neolithisation of Europe) to continuation of occupation and local adaptation, while impacts of the 9.2 ka have not previously been systematically studied. In this paper, we present a thorough assessment of available, quality-checked radiocarbon (14C) dates for sites from Southwest Asia covering the time interval between 9500 and 7500 cal BP, which we interpret in combination with archaeological evidence. In this way, the synchronicity between changes observed in the archaeological record and the rapid climate events is tested. It is shown that there is no evidence for a simultaneous and widespread collapse, large-scale site abandonment, or migration at the time of the events. However, there are indications for local adaptation. We conclude that early farming communities were resilient to the abrupt, severe climate changes at 9250 and 8200 cal BP.

  6. Assessment of 14C AMS dating of phytoliths as a new paleoenvironmental and archaeological tool

    NASA Astrophysics Data System (ADS)

    Corbineau, R.; Alexandre, A. E.; Santos, G. M.; Reyerson, P. E.

    2011-12-01

    14C AMS analysis of occluded carbon in phytoliths (phytC) is a promising dating tool for palaeoenvironmental and archaeological studies. In order to assess the accuracy of this method, different tests were recently carried out on large phytolith concentrates of phytC samples extracted from soils and harvested plants, in association with blank samples of SiO2 powder to check the absence of carbon contamination during the treatments. Despite this precaution, 14C values from recent harvested plants were inexplicably old (2 - 8 ka years BP). Nevertheless, we noticed that many chemical extraction protocols that were used did not lead to samples totally free of organic matter. In order to tackle this problem, and as a first step, the efficiency of common extraction protocols from the literature were tested. Samples were analyzed by SEM/EDX in order to assess the purity of the siliceous material following extraction. As a result of these tests, a new extraction protocol combining acid digestion, oxidation and dry ashing to acquire pure samples of phytoliths from harvested plants is proposed. In a second step, modern and well dated archaeological materials (harvested plants grown within a FACE experiment and plant residues from a 17th century French mummy) were analyzed in 14C-AMS. Results should allow either to demonstrate the reliability of 14C-AMS analysis of phytolith occluded carbon as a dating tool or trigger further investigations of possible sources of old occluded carbon in phytoliths if the 14C ages are still older than expected.

  7. AMS 14C analysis of teeth from archaeological sites showing anomalous esr dating results

    NASA Astrophysics Data System (ADS)

    Grün, Rainer; Abeyratne, Mohan; Head, John; Tuniz, Claudio; Hedges, Robert E. M.

    We have carried out AMS radiocarbon analysis on two groups of samples: the first one gave reasonable ESR age estimates and the second one yielded serious age underestinations. All samples were supposedly older than 35 ka, the oldest being around 160 ka. Two pretreatment techniques were used for radiocarbon dating: acid evolution and thermal release. Heating to 600, 750 and 900°C combined with total de-gassing at these temperatures was chosen to obtain age estimates on the organic fraction, secondary carbonates and original carbonate present in the hydroxyapatite mineral phase, respectively. All radiocarbon results present serious age underestimations. The secondary carbonate fraction gives almost modern results indicating an extremely rapid exchange of this component. Owing to this very rapid carbonate exchange it is not likely that the ESR signals used for dating are associated with the secondary carbonates. One tooth from Tabun with independent age estimates of >150 ka was further investigated by the Oxford AMS laboratory, yielding an age estimate of 1930±100 BP on the residual collagen from dentine and 18,000±160 BP on the carbonate component of the enamel bioapatite. We did not, however, find an explanation of why some samples give serious ESR underestimatioils whilst many others provide reasonable results.

  8. Vegetation stability in the Southeastern Brazilian coastal area from 5500 to 1400 14C yr BP deduced from charcoal analysis.

    PubMed

    Scheel-Ybert

    2000-06-01

    Charcoal analysis of six shell mounds showed that no major changes of the mainland vegetation ecosystem have taken place along the southeastern Brazilian coast (22 degrees 53'-22 degrees 57'S, 42 degrees 03'-42 degrees 33'W) from 5500 to 1400 14C yr BP. These shell mounds have been occupied by sedentary fisher-gatherer-hunters. Charcoal fragments retrieved from vertical profiles in the archaeological sites were examined; taxonomic determinations were based on a reference collection of charred woods and a program for computer-aided identification. Charcoal assemblages of all the studied sites present taxa from various restinga vegetation types, mangroves, xeromorphic coastal forest, and inland Atlantic Forest. The restinga ecosystem, characteristic of the Brazilian coast, is associated with sandy beach ridges; the restinga forest was much more abundant during the studied period than nowadays. The charcoal assemblages represent mainly the local vegetation; a regional reconstruction depends on the study of numerous sites. In the Cabo Frio region, open restinga taxa are more abundant in the Sambaqui do Forte, while forest elements are more important in the Sambaquis Salinas Peroano and Boca da Barra. The sites studied in the Arraial do Cabo (Sambaqui da Ponta da Cabeça) and in the Saquarema regions (Sambaquis da Pontinha and da Beirada) show that open restinga formations were locally predominant. A comparison of multivariate analysis applied to both charcoal assemblages and to phytosociological data of the extant vegetation showed a good correspondence between the charcoal spectra and the present vegetation. The high taxonomic diversity of archaeological charcoal samples and numerous fragments showing traces of decay before charring suggests that aleatory gathering of dead wood constituted the main source of firewood for fisher-gatherer-hunters populations. Condalia sp. was probably selected for cultural reasons.The only significant fluctuations on the charcoal

  9. Palaeoenvironmental Transitions Between 22 ka and 8 ka in Monsoonally Influenced Namibia

    NASA Astrophysics Data System (ADS)

    Eitel, Bernhard; Blümel, Wolf Dieter; Hüser, Klaus

    The paper presents a preliminary reconstruction of the development of different palaeoenvironments between the Last Glacial Maximum (LGM; c. 22 - 18 ka) and the Holocene Altithermal (HA; c. 8 ka - 4 ka) in Namibia. The synopsis is based on 36 optical datations of dune sands and fine-grained, silty deposits (OSL and TL). Most of the data were published by different research groups during the last decade. The synoptic view of all available optical age determinations is necessary because palaeoclimatic interpretations for southwestern Africa are not possible using results based only on local studies and on partly unreliable datations (e. g. 14C ages of calcretes). The compilation of all available datations and a synoptical interpretation such as the one presented here, show that gradual transitions and not abrupt changes from arid to more humid conditions occurred. These transitions did not affect all regions of Namibia at the same time and intensity. Differentiations in time and space are necessary for arriving a consistent model of the palaeoenvironmental transitions between LGM and HA.

  10. 14C plateaus and global stratigraphic correlation during Termination IA

    NASA Astrophysics Data System (ADS)

    Sarnthein, M.; Grootes, P. M.; Kennett, J. P.; Nadeau, M.

    2006-12-01

    In search of a global 14C reference record for Termination IA, we analyzed three published 14C records with centennial-scale resolution, that provide independent evidence for calibrating the 14C time scale: (1) A sediment record from Cariaco Basin (ODP Site 1002) correlated to the U/Th-dated Hulu Cave record (Hughen et al., 2006), (2) a U/Th dated speleothem record from the Bahamas (Beck et al., 2001, 2006), and (3) a set of U/Th-dated coral ages (IntCal04 plus Fairbanks et al., 2005) that unfortunately lack data from 18-15 cal. ka. All these records exhibit significant changes in the slope of 14C vs. calendar ages, allowing us to define a suite of major and minor "14C plateaus" in each record, that in total occupy >70% of the 14C record between 19 and 14 cal. ka. Despite their different origin the three records are largely consistent. When dating resolution is sufficient, most plateaus show a characteristic internal structure incorporating 14C inversions, in particular near the onset of a plateau. Plateau boundary ages for the Cariaco record have a total range of uncertainty of 150-450 yr due to uncertainties with age calibration (Hughen et al., 2006), in addition to the range of dating resolution. During Termination IA, a period of dramatic climate change, these boundary ages should serve as datums for the global correlation of marine sediment records. Moreover, they are employed to deduce apparent paleoventil-ation ages and thus circulation patterns of surface and bottom water masses, as demonstrated for example from the northern Pacific and the Icelandic Sea.

  11. Reconstruction of past climate variability in SE Spain between 14 and 8 ka

    NASA Astrophysics Data System (ADS)

    Budsky, Alexander; Scholz, Denis; Mertz-Kraus, Regina; Christoph, Spötl; Gibert, Luis; Jochum, Klaus Peter; Andreae, Meinrat O.

    2016-04-01

    In comparison to the large climatic oscillations during the Pleistocene, Holocene climate only underwent minor changes. Nevertheless, cyclic climate changes also occurred during the Holocene. The Bond events, represented by the presence of cold, ice-bearing waters from the north of Iceland as far south as the latitude of Britain, occurred at a cyclicity of about 1500 a and were particularly pronounced during the Early Holocene. However, their climatic impact on the terrestrial realm was not consistent over Europe, in particular with respect to changes in precipitation. Here we present a precisely dated high-resolution flowstone record from Cueva Victoria, SE Spain, a site well suited to study the competing influence of the Atlantic and Mediterranean Sea on the southern Iberian Peninsula. We sampled several flowstones with a thickness of up to 60 cm. 230Th/U-dating has shown that these deposits mainly formed during relatively warm climate intervals of the Middle and Late Pleistocene, i.e. interglacials and interstadials (Budsky et al., 2015; Gibert et al., 2016). Here we focus on a short (11 cm) flowstone sequence from the Holocene with a high temporal resolution (centennial for stable isotopes and annual for trace elements). The flowstone grew between 14 and ca. 8 ka b2k. The decreasing trend of the δ18O and δ13C values as well as of several trace elements between 12 and 11 ka b2k reflects an increase in temperature and precipitation at the beginning of the Holocene. In particular, Sr and Mg show a trend towards low and stable values. Subsequently, from 10.5 to 8 ka b2k, the δ13C values show a high variability (-11 to -4), whereas the δ18O values are rather stable (between -6 and -7). Maxima in δ13C are interpreted as drier conditions in response to Bond events. These events possibly led to a change of the atmospheric circulation, affecting the vegetation in SE Spain, which evolved towards an open C3 vegetation at ca. 8 ka b2k concomitant with drier conditions

  12. Sporo-pollen assemblage and paleoclimate events in shelf area of the southern Yellow Sea since 15 ka B. P.

    NASA Astrophysics Data System (ADS)

    Meng, Guanglan; Han, Yousong; Wang, Shaoqing; Wang, Zhenyan

    2004-03-01

    Based on the authors’ 1986 to 1994 sporo-pollen assemblage analysis in the southern Yellow Sea area, data from 3 main cores were studied in combination with14C, palaeomagnetic and thermoluminescence data. The evolution of the paleoclimate environments in the southern Yellow Sea since 15ka B. P. was revealed that, in deglaciation of the last glacial period, the climate of late glaciation transformed into that of postglaciation, accompanied by a series of violent climate fluctuations. These evolution events happened in a global climate background and related to the geographic changes in eastern China. We distinguished three short-term cooling events and two warming events. Among them, the sporo-pollen assemblage of subzone A1 showed some cold climate features indicating that a cooling event occurred at about 15-14ka. B. P. in early deglaciation. This subzone corresponds to the Oldest Dryas. In subzone A3, many drought-enduring herbal pollens and some few pollens of cold-resistant Picea, Abies, etc. were found, which indicated that a cooling event, with cold and arid climate, occurred at about 12-11ka. B. P. in late deglaciation. This subzone corresponds to the Younger Dryas. The sporo-pollen assemblage of zone B showed warm and arid climate features in postglaciation. Although the assemblage of subzone B2 indicated a cold and arid climate environment, the development of flora in subzone B2 climate was less cold than that in A3. Subzone B2 indicated a cooling event which occurred at about 9ka B. P. in early olocene. Subzone A2, with some distinct differences from subzone A1 and A3, indicated a warming event which occurred at 14-13ka. B.P. and should correspond to a warming fluctuation. The sporo-pollen assemblage of zone C showed features of warn-moist flora and climate, and indicated a warming event which universally occurred along the coast of eastern China at 8-3 ka B. P. in middle Holocene, and its duration was longer than that of any climate events mentioned

  13. Stable C, O and clumped isotope systematics and 14C geochronology of carbonates from the Quaternary Chewaucan closed-basin lake system, Great Basin, USA: Implications for paleoenvironmental reconstructions using carbonates

    NASA Astrophysics Data System (ADS)

    Hudson, Adam M.; Quade, Jay; Ali, Guleed; Boyle, Douglas; Bassett, Scott; Huntington, Katharine W.; De los Santos, Marie G.; Cohen, Andrew S.; Lin, Ke; Wang, Xiangfeng

    2017-09-01

    Isotopic compositions of lacustrine carbonates are commonly used for dating and paleoenvironmental reconstructions. Here we use carbonate δ13C and δ18O, clumped (Δ47), and 14C compositions to better understand the carbonate isotope system in closed-basin lakes and trace the paleohydrologic and temperature evolution in the Chewaucan closed-basin lake system, northern Great Basin, USA, over the Last Glacial/Holocene transition. We focus on shorezone tufas to establish that they form in isotopic equilibrium with lake water and DIC, they can be dated reliably using 14C, and their clumped isotope composition can be used to reconstruct past lake temperature. Calculations of the DIC budget and reservoir age for the lake indicate residence time is short, and dominated by exchange with atmospheric CO2 at all past lake levels. Modern lake DIC and shorezone tufas yield δ13C and 14C values consistent with isotopic equilibrium with recent fossil fuel and bomb-influenced atmospheric CO2, supporting these calculations. δ13C values of fossil tufas are also consistent with isotopic equilibrium with pre-industrial atmospheric CO2 at all shoreline elevations. This indicates that the 14C reservoir effect for this material is negligible. Clumped isotope (Δ47) results indicate shorezone tufas record mean annual lake temperature. Modern (average 13 ± 2 °C) and 18 ka BP-age tufas (average 6 ± 2 °C) have significantly different temperatures consistent with mean annual temperature lowering of 7 ± 3 °C (1 SE) under full glacial conditions. For shorezone tufas and other lake carbonates, including spring mounds, mollusk shells, and ostracod tests, overall δ13C and δ18O values co-vary according to the relative contribution of spring and lacustrine end member DIC and water compositions in the drainage system, but specific isotope values depend strongly upon sample context and are not well correlated with past lake depth. This contrasts with the interpretation that carbonate

  14. Stable C, O and clumped isotope systematics and 14C geochronology of carbonates from the Quaternary Chewaucan closed-basin lake system, Great Basin, USA: Implications for paleoenvironmental reconstructions using carbonates

    USGS Publications Warehouse

    Hudson, Adam; Quade, Jay; Ali, Guleed; Boyle, Douglas P.; Bassett, Scott; Huntington, Katharine W.; De los Santos, Marie G.; Cohen, Andrew S.; Lin, Ke; Wang, Xiangfeng

    2017-01-01

    Isotopic compositions of lacustrine carbonates are commonly used for dating and paleoenvironmental reconstructions. Here we use carbonate δ13C and δ18O, clumped (Δ47), and 14C compositions to better understand the carbonate isotope system in closed-basin lakes and trace the paleohydrologic and temperature evolution in the Chewaucan closed-basin lake system, northern Great Basin, USA, over the Last Glacial/Holocene transition. We focus on shorezone tufas to establish that they form in isotopic equilibrium with lake water and DIC, they can be dated reliably using 14C, and their clumped isotope composition can be used to reconstruct past lake temperature. Calculations of the DIC budget and reservoir age for the lake indicate residence time is short, and dominated by exchange with atmospheric CO2 at all past lake levels. Modern lake DIC and shorezone tufas yield δ13C and 14C values consistent with isotopic equilibrium with recent fossil fuel and bomb-influenced atmospheric CO2, supporting these calculations. δ13C values of fossil tufas are also consistent with isotopic equilibrium with pre-industrial atmospheric CO2 at all shoreline elevations. This indicates that the 14C reservoir effect for this material is negligible. Clumped isotope (Δ47) results indicate shorezone tufas record mean annual lake temperature. Modern (average 13 ± 2 °C) and 18 ka BP-age tufas (average 6 ± 2 °C) have significantly different temperatures consistent with mean annual temperature lowering of 7 ± 3 °C (1 SE) under full glacial conditions. For shorezone tufas and other lake carbonates, including spring mounds, mollusk shells, and ostracod tests, overall δ13C and δ18O values co-vary according to the relative contribution of spring and lacustrine end member DIC and water compositions in the drainage system, but specific isotope values depend strongly upon sample context and are not well correlated with past lake depth. This contrasts with the interpretation that carbonate

  15. The 14 bp Del/Ins HLA-G polymorphism is related with high blood pressure in acute coronary syndrome and type 2 diabetes mellitus.

    PubMed

    García-González, Ilian Janet; Valle, Yeminia; Rivas, Fernando; Figuera-Villanueva, Luis Eduardo; Muñoz-Valle, José Francisco; Flores-Salinas, Hector Enrique; Gutiérrez-Amavizca, Bianca Ethel; Dávalos-Rodríguez, Nory Omayra; Padilla-Gutiérrez, Jorge Ramón

    2014-01-01

    Immunologic and inflammatory processes are involved in the pathogenesis of acute coronary syndrome (ACS) and type 2 diabetes mellitus (DM2). Human leukocyte antigen-G (HLA-G) is a negative regulator of the immune response. This study evaluates the 14 bp Del/Ins HLA-G polymorphism in ACS and DM2. Three hundred and seventy individuals from Western Mexico were recruited and categorized into three groups: ACS (86), DM2 without coronary complications (70), and healthy subjects (214). Genotyping of the 14 bp Del/Ins HLA-G polymorphism was performed by PCR and Native-PAGE. The most common risk factors were hypertension and overweight in ACS and DM2, respectively. The genetic distribution of the 14 bp Del/Ins HLA-G polymorphism showed no significant differences between groups (P ≥ 0.23). Nonetheless, the Ins/Ins genotype was associated with high blood pressure (HBP) in the DM2 group (OR(c) = 1.65, P = 0.02). The genetic recessive model showed similar findings (OR(c) = 3.03, P = 0.04). No association was found in ACS, with a P of 0.05; nevertheless, the prevalence of Ins/Ins carriers was quite similar to that found in the DM2-HBP group. The 14 bp Del/Ins HLA-G polymorphism was not a susceptibility factor for ACS or DM2; however, the Ins/Ins genotype might have contributed to the development of HBP in the studied groups.

  16. Direct linking of Greenland and Antarctic ice cores at the Toba eruption (74 ka BP)

    NASA Astrophysics Data System (ADS)

    Svensson, A.; Bigler, M.; Blunier, T.; Clausen, H. B.; Dahl-Jensen, D.; Fischer, H.; Fujita, S.; Goto-Azuma, K.; Johnsen, S. J.; Kawamura, K.; Kipfstuhl, S.; Kohno, M.; Parrenin, F.; Popp, T.; Rasmussen, S. O.; Schwander, J.; Seierstad, I.; Severi, M.; Steffensen, J. P.; Udisti, R.; Uemura, R.; Vallelonga, P.; Vinther, B. M.; Wegner, A.; Wilhelms, F.; Winstrup, M.

    2013-03-01

    The Toba eruption that occurred some 74 ka ago in Sumatra, Indonesia, is among the largest volcanic events on Earth over the last 2 million years. Tephra from this eruption has been spread over vast areas in Asia, where it constitutes a major time marker close to the Marine Isotope Stage 4/5 boundary. As yet, no tephra associated with Toba has been identified in Greenland or Antarctic ice cores. Based on new accurate dating of Toba tephra and on accurately dated European stalagmites, the Toba event is known to occur between the onsets of Greenland interstadials (GI) 19 and 20. Furthermore, the existing linking of Greenland and Antarctic ice cores by gas records and by the bipolar seesaw hypothesis suggests that the Antarctic counterpart is situated between Antarctic Isotope Maxima (AIM) 19 and 20. In this work we suggest a direct synchronization of Greenland (NGRIP) and Antarctic (EDML) ice cores at the Toba eruption based on matching of a pattern of bipolar volcanic spikes. Annual layer counting between volcanic spikes in both cores allows for a unique match. We first demonstrate this bipolar matching technique at the already synchronized Laschamp geomagnetic excursion (41 ka BP) before we apply it to the suggested Toba interval. The Toba synchronization pattern covers some 2000 yr in GI-20 and AIM-19/20 and includes nine acidity peaks that are recognized in both ice cores. The suggested bipolar Toba synchronization has decadal precision. It thus allows a determination of the exact phasing of inter-hemispheric climate in a time interval of poorly constrained ice core records, and it allows for a discussion of the climatic impact of the Toba eruption in a global perspective. The bipolar linking gives no support for a long-term global cooling caused by the Toba eruption as Antarctica experiences a major warming shortly after the event. Furthermore, our bipolar match provides a way to place palaeo-environmental records other than ice cores into a precise climatic

  17. Impact of climate variability on terrestrial environment in Western Europe between 45 and 9 kyr cal. BP: vegetation dynamics recorded by the Bergsee Lake (Black Forest, Germany).

    NASA Astrophysics Data System (ADS)

    Duprat-Oualid, Fanny; Begeot, Carole; Rius, Damien; Millet, Laurent; Magny, Michel

    2016-04-01

    changes at millennial/pluri-millennial scale. The well-known afforestation of the Late-Glacial interstadial and the Holocene (with pine and hazel-dominated forests respectively) are recorded. Our results also reveal a three-phase sequence in the Last-Glacial. The persistence of very cold conditions between 24 and 30 kyr cal. BP favored a drastic steppe grassland. In contrast, trees proportion increased during the two other periods (14.7-24 and 30-45 kyr cal. BP) in correlation with a relative favorable climate. Second, the respons of vegetation to centennial scale climatic events is characterized by the successive rapid establishment of two different landscapes. GS are dominated by steppic taxa (Artemisia, Helianthemum), whereas more or less complete ecological successions Juniperus-Betula-Pinus seem to occur for most GIs when edaphic conditions became more favorable. Therefore, we suggest a global forcing defined by the strong impact of the climate variability on vegetation changes. We also propose the contribution of local characteristics (latitude, topography) which favored flora migration and long distance pollen inputs from refuge areas. Heiri O., Koinig K.A., Spötl C., Barrett S, Brauer A., Drescher-Schneider R., Gaar D., Ivy-Ochs S., Kerschner H., Luetscher M., Moran A., Nicolussi K., Preusser F., Schmidt R., Schoeneich P., Schwörer C., Sprafke T., Terhorst B., Tinner W. -2014- "Palaeoclimate records 60-8 ka in the Austrian and Swiss Alps and their forelands", Quaternary Science Review, 106 : 186-205.

  18. Lake level and climate records of the last 90 ka from the Northern Basin of Lake Van, eastern Turkey

    NASA Astrophysics Data System (ADS)

    Çağatay, M. N.; Öğretmen, N.; Damcı, E.; Stockhecke, M.; Sancar, Ü.; Eriş, K. K.; Özeren, S.

    2014-11-01

    Sedimentary, geochemical and mineralogical analyses of the ICDP cores recovered from the Northern Basin (NB) of Lake Van provide evidence of lake level and climatic changes related to orbital and North Atlantic climate system over the last 90 ka. High lake levels are generally observed during the interglacial and interstadial periods, which are marked by deposition of varved sediments with high total organic carbon (TOC), total inorganic carbon (TIC), low detrital influx (high Ca/F) and high δ18O and δ13C values of authigenic carbonate. During the glacial and stadial periods of 71-58 ka BP (Marine Isotope Stage 4, MIS4) and end of last glaciation-deglaciation (30-14.5 ka BP; MIS3) relatively low lake levels prevailed, and grey homogeneous to faintly laminated clayey silts were deposited at high sedimentation and low organic productivity rates. Millennial-scale variability of the proxies during 60-30 ka BP (MIS3 is correlated with the Dansgaard-Oeschger (D-O)) and Holocene abrupt climate events in the Atlantic. These events are characterized by laminated sediments, with high TOC, TIC, Ca/Fe, δ18O and δ13C values. The Lake Van NB records correlate well in the region with the climate records from the lakes Zeribar and Urmia in Iran and the Sofular Cave in NW Anatolia, but are in general in anti-phase to those from the Dead Sea Basin (Lake Lisan) in the Levant. The relatively higher δ18O values (0 to -0.4‰) for the interglacial and interstadial periods in the Lake Van NB section are due to the higher temperature and seasonality of precipitation and higher evaporation, whereas the lower values (-0.8 to -2‰) during the glacial and stadial periods are caused mainly by relative decrease in both temperature and seasonality of precipitation. The high δ18O values (up to 4.2‰) during the Younger Dryas, together with the presence of dolomite and low TOC contents, supports evaporative conditions and low lake level. A gradual decrease in the δ18O values from an

  19. Excess warming in Central Europe after the 8.2 ka cold event: evidence from a varve-dated ostracod δ18O record from Mondsee (Austria)

    NASA Astrophysics Data System (ADS)

    Lauterbach, Stefan; Andersen, Nils; Erlenkeuser, Helmut; Danielopol, Dan L.; Namiotko, Tadeusz; Hüls, Matthias; Belmecheri, Soumaya; Nantke, Carla; Meyer, Hanno; Chapligin, Bernhard; von Grafenstein, Uli; Brauer, Achim

    2017-04-01

    As evidenced by numerous palaeoclimate records worldwide, the Holocene warm period has been punctuated by several short, low-amplitude cold episodes. Among these, the so-called 8.2 ka cold event represents a particularly prominent climate anomaly. Accordingly, several proxy-based and modeling studies have addressed its causal mechanisms, absolute dating, duration, amplitude, spatio-temporal characteristics and environmental consequences so far. However, knowledge about the dynamics and causes of subsequent climate recovery is still limited although this is essential for understanding rapid climate change. Here we present a new sub-decadally resolved and precisely dated oxygen isotope (δ18O) record for the interval 7.7-8.7 ka BP derived from benthic ostracods preserved in the varved lake sediments of pre-Alpine Mondsee (Austria), providing new insights into climate development around the 8.2 ka cold event in Central Europe. The high-resolution Mondsee δ18O record reveals the occurrence of a pronounced cold spell around 8.2 ka BP, whose amplitude (˜1.0 ‰ , equivalent to a 1.5-2.0 ˚ C cooling), total duration (151 years) and absolute dating (8231-8080 varve years BP, i.e. calendar years before AD 1950) agrees well with results from other Northern Hemisphere palaeoclimate archives, e.g. the Greenland ice cores. In addition, the Mondsee data set provides evidence for a 75-year-long δ18O overshoot directly following the 8.2 ka event (between 8080 and 8005 varve years BP), which is interpreted as a period of excess warming (about 0.5-0.6 ˚ C above the pre-8.2 ka event level) in Central Europe. Though so far not been explicitly described elsewhere, this observation is consistent with evidence from other proxy records in the North Atlantic realm, therefore likely reflecting a hemispheric-scale signal rather than a local phenomenon. As a possible trigger we suggest an enhanced resumption of the Atlantic meridional overturning circulation (AMOC), supporting

  20. Climate controls on savanna C3 and C4 expansion in Southern Africa during the last 36 kyr BP

    NASA Astrophysics Data System (ADS)

    Wang, Y. V.; Larsen, T.; Andersen, N.; Blanz, T.; Schneider, R. R.

    2010-12-01

    Savannahs contain a mixture of C3 and C4 vegetation, accounting for more than a quarter of global primary production and are the second most important biome on the continents. However, our understanding on how savannahs will respond to rising CO2 concentration and temperatures or the IPCC estimated decrease in rainfall is not yet clear in spite of potential far reaching socio-economic consequences. In this study, we used the δD and δ13C of sedimentary long-chain n-alkanes (n-C27,29,31,33 ) in concert with reconstructions for sea surface temperatures and fluvial discharge from a marine sediment core (GIK16160-3, 18°14.47’S, 37°52.27’W, 1334m water depth), collected near the Zambezi river mouth to examine savannah responses under different hydrological and climate conditions in Southern Africa during the last 36 kyr BP. Our data show large variability in both δD and δ13C records of the four n-alkanes, with isotopic differences between individual n-alkanes being far more pronounced during the Glacial than during the Deglacial and Holocene. These large differences may be explained by proportionally higher contributions of C4 grasses over C3 trees to the n-C33,31, which seems to be opposite for n-C29. A strong anticorrelation between δD and δ13C from 36 to 16 kyr BP for n-C31 (R2=0.55) and n-C33 (R2=0.70) suggests that δD of these n-alkanes is strongly influenced by changes in vegetation types as well as physiological effects, rather than being directly related to evaporation/ precipitation balance. In contrast, no apparent relationship (R2=0.32) exists between δD and δ13C of n-C29, suggesting that n-C29 is the most promising hydrological proxy due to less variable vegetation type contributions to n-C29 throughout the core. The C4 plant contribution, which was estimated by taking into account the four n-alkanes δ13C signals and their abundance, implies dominance of C4 grass between 36 and 20 kyr BP, and more evenly distributed C3 and C4 vegetation from

  1. Determination of 14C age of inorganic and organic carbon in ancient Siberian permafrost

    NASA Astrophysics Data System (ADS)

    Onstott, T. C.; Liang, R.; Lau, M.; Vishnivetskaya, T. A.; Lloyd, K. G.; Pfiffner, S. M.; Hodgins, G.; Rivkina, E.

    2017-12-01

    Permafrost represents a large reservoir of ancient carbon that could have an important impact on the global carbon budget during climate warming. Due to the low turnover rate of carbon by microorganisms at subzero temperatures, the persistence of ancient carbon in younger permafrost deposits could also pose challenges for radiocarbon dating of permafrost sediment. We utilized Accelerator Mass Spectrometry to determine the 14C age of inorganic carbon, labile and recalcitrant organic carbon in Siberian permafrost sediment sampled at various depths from 2.9 to 5.6m. The fraction of inorganic carbon (CO2) was collected after acidification using phosphoric acid. The labile (younger) and recalcitrant (old) organic carbon in the subsequent residues were collected after combustion at 400 ºC and 800 ºC, respectively. The percentages of inorganic carbon increased from the youngest (2.9m) to the oldest (5.6m), whereas the fractions for organic carbon varied significantly at different depths. The 14C age determined in the inorganic fraction in the top sample (2.9 m) was 21,760 yr BP and gradually increased to 33,900 yr BP in the relative deeper sediment (3.5 and 5.6 m). Surprisingly, the fraction of "younger" carbon liberated at 400 oC was older than the more recalcitrant and presumably older organic carbon liberated at 800 oC in all cases. Moreover, the 14C age of the younger and older organic carbon fractions did not increase with depth as observed in the carbonate fraction. In particular, the 14C age of the organic carbon in the top sample (38,590-41,700 yr BP) was much older than the deeper samples at depth of 3.5m (18,228-20,158 yr BP) and 5.6m (29,040-38,020 yr BP). It should be noticed that the metabolism of ancient carbon in frozen permafrost may vary at different depths due to the different proportion of necromass and metabolically active microbes. Therefore, additional knowledge about the carbon dynamics of permafrost and more investigation would be required to

  2. Source of the Organic Matter and Land-Marine Interaction Phases in Great Rann of Kachch Basin, India

    NASA Astrophysics Data System (ADS)

    Khonde, N. N.; Bhushan, R.; Agnihotri, R.; Maurya, D. M.; Chamyal, L. S.

    2017-12-01

    Using δ13C and C/N ratio of sedimentary organic matter (OM) in 14C AMS dated sediment core from central Great Rann of Kachchh (GRK) basin, we track sediment dispositional history since 18 ka BP. Temporal changes in the δ13C and C/N ratios were inferred in terms of OM source, which could be function of river discharge, relative sea level changes, and also due to land-cover changes in the catchment area. The down core variations in TOC vs TC doesn't show significant correlation suggesting diverse origin of the OM in GRK sediments. Between 18-13 ka BP, pulses of high C/N ratio (18-34) and depleted δ13C (average -23‰; with respect to typical marine -21‰) values hint terrestrially derived OM in rather overall marine environment. High terrestrial OM input from riverine inputs in post glacial period could be relatable to intense monsoonal conditions. Later to this phase, between 14-10 ka BP, C/N ratios show large fluctuations indicating rapidly fluctuating environment, albeit δ13C remains relatively stable at -21‰ typical of marine OM. A significant positive incursion in C/N ratio (45-60) is seen during early-mid Holocene time ( 10-6 ka BP) with and highly depleted δ13C ( -25‰) values indicating enhanced terrestrial OM input. This could be owing to increased riverine fluxes to the basin under intensified monsoonal climate. Between 6-2.5 ka BP during mid-Holocene, C/N ratios shows declining trend with enriched δ13C values, suggesting presence of marine OM source at the core-site. This overlaps with the weaker monsoonal conditions prevailing in the northwest India. Lake records from Rajasthan also support this contention. After 2.5 ka BP, C/N ratios indicate marine OM values, whereas δ13C fluctuates from marine to terrestrial values indicating `mixed-source' of the OM during this period, most likely due to unstable land-marine conditions and large-scale reworking of sediments.

  3. AMS 14C and 230Th/U dating on stalagmites from North Altai Mountain, Siberia, Russia

    NASA Astrophysics Data System (ADS)

    Li, H. C.; Yin, J. J.; Blyakharchuk, T.; Shen, C. C.

    2017-12-01

    Three stalagmites, two from Lunnaya Cave (LUN-1 and LUN-2, 52º40.729'N, 88º43.854' E, 481 m a.s.l.), one from Nadezhda Cave (HOP-1, 52º38.872'N, 88º39.194'E, 550 m a.s.l.) located along Mrassy River in the northern Altai Mountains, Siberia, Russia were collected in the summer of 2016 for paleoclimate reconstruction. HOP-1 is a 21-cm long stalagmite which contains very low U content (238U = 70 ppb) and relatively high Th content (232Th = 2 9.3 ppb), resulting in unsuccessful 230Th/U dating (-262 ± 284 yr BP in the top and -19,935 ± 22,246 yr BP). Thirty one AMS 14C dates from 27 horizons of the stalagmite provide a detailed chronology, showing that the stalagmite grew from 6,350 ± 45 yr BP to 490 ± 10 Calib. yr BP. Both LUN-1 and LUN-2 are about 20-cm long. The growth feature of LUN-2 is similar to that of HOP-1 with continuous growth, clear bands of depositional cycles in white non-transparent calcite, whereas LUN-1 has light yellow transparent calcite in the center part with multiple growth hiatuses. The 230Th/U dates show that LUN-1 from 2725 ± 775 yr BP at 193 mm depth to 823 ± 28 yr BP at 12 mm depth with very fast growth rate during 900 1500 yr BP. The AMS 14C dates of LUN-1 provide similar growth pattern with very fast growth between the first hiatus at 12 mm depth and the second hiatus at 155 cm depth. Six 14C dates from this fast growth period are all around 1500 Calib. yr BP without a correct age sequence. Two 14C dates from the top 12 mm exhibit "nuclear bomb signal" (percentage of modern carbon >100%). Similar ages of AMS 14C and 230Th/U dating results in the lower part indicate that dead carbon influence in radiocarbon ages are negligible. 230Th/U dating is not successful for LUN-2. The preliminary AMS 14C dating on LUN-2 shows that the stalagmite continuously deposited from 13335 ± 150 Calib. yr BP. All three stalagmites do not have growth deposition during the Little Ice Age due to cold and dry climates. Further work on stable isotope

  4. One Isotope, Two Tales: using plant and cosmogenic 14C to constrain Holocene glacier activity on Baffin Island.

    NASA Astrophysics Data System (ADS)

    Pendleton, S.; Miller, G. H.; Lifton, N. A.; Young, N. E.

    2017-12-01

    As the cryosphere continues to undergo rapid and accelerating change, it is more important than ever to understand past glacier activity to predict the future of the cryosphere. However, continuous Holocene glacier records are notoriously difficult to reconstruct because an advancing glacier will re-incorporate previous deposits so that moraines typically only record the farthest downvalley glacier expansion. Here we combine dates of ice margin advance from in situ dead vegetation with in situ cosmogenic 14C (in situ 14C) from preserved bedrock surfaces at the same locations to further constrain the timing of ice-free episodes during the Holocene following deglaciation on southern Baffin Island. Radiocarbon ages from recently exposed in situ plants suggest that ice last advanced over sample locations at 9.4, 9.2, 9.0, and 3.7 ka and that they remained ice covered until modern times. Associated in situ 14C inventories are variable, but well above background levels, suggesting some amount of Holocene in situ 14C production. Using plant 14C ages representing the beginning of ice coverage and in situ 14C inventories representative of exposure prior to ice coverage, a simple model of cosmogenic in situ 14C production (accounting for muon production through ice) provides constraints timing and duration of ice-free times at sample locations prior to their most recent burial. Using conservative Holocene ice thicknesses, the locations buried at 9.4, 9.2, and 9.0 ka require, at minimum, 1000 years of pre-burial exposure to match the observed in situ 14C inventory. This suggests these locations were ice free by at least 10 ka and likely earlier. The in situ 14C inventory at the location buried at 3.7 ka limits prior exposure to 2000 years, suggesting that this location experienced more complex Holocene ice cover/burial history. These pilot data show that valuable information regarding periods of exposure is contained within in situ 14C inventories. Additional paired plant and

  5. Extraction of in situ cosmogenic 14C from olivine

    USGS Publications Warehouse

    Pigati, J.S.; Lifton, N.A.; Timothy, Jull A.J.; Quade, Jay

    2010-01-01

    Chemical pretreatment and extraction techniques have been developed previously to extract in situ cosmogenic radiocarbon (in situ 14C) from quartz and carbonate. These minerals can be found in most environments on Earth, but are usually absent from mafic terrains. To fill this gap, we conducted numerous experiments aimed at extracting in situ 14C from olivine ((Fe,Mg)2SiO4). We were able to extract a stable and reproducible in situ 14C component from olivine using stepped heating and a lithium metaborate (LiBO2) flux, following treatment with dilute HNO3 over a variety of experimental conditions. However, measured concentrations for samples from the Tabernacle Hill basalt flow (17.3 ?? 0.3 ka4) in central Utah and the McCarty's basalt flow (3.0 ?? 0.2 ka) in western New Mexico were significantly lower than expected based on exposure of olivine in our samples to cosmic rays at each site. The source of the discrepancy is not clear. We speculate that in situ 14C atoms may not have been released from Mg-rich crystal lattices (the olivine composition at both sites was ~Fo65Fa35). Alternatively, a portion of the 14C atoms released from the olivine grains may have become trapped in synthetic spinel-like minerals that were created in the olivine-flux mixture during the extraction process, or were simply retained in the mixture itself. Regardless, the magnitude of the discrepancy appears to be inversely proportional to the Fe/(Fe+Mg) ratio of the olivine separates. If we apply a simple correction factor based on the chemical composition of the separates, then corrected in situ 14C concentrations are similar to theoretical values at both sites. At this time, we do not know if this agreement is fortuitous or real. Future research should include measurement of in situ 14C concentrations in olivine from known-age basalt flows with different chemical compositions (i.e. more Fe-rich) to determine if this correction is robust for all olivine-bearing rocks. ?? 2010 by the Arizona

  6. Phosphorylation of cMyBP-C Affects Contractile Mechanisms in a Site-specific Manner

    PubMed Central

    Wang, Li; Ji, Xiang; Barefield, David; Sadayappan, Sakthivel; Kawai, Masakata

    2014-01-01

    Cardiac myosin binding protein-C (cMyBP-C) is a cardiac-specific, thick-filament regulatory protein that is differentially phosphorylated at Ser273, Ser282, and Ser302 by various kinases and modulates contraction. In this study, phosphorylation-site-specific effects of cMyBP-C on myocardial contractility and cross-bridge kinetics were studied by sinusoidal analysis in papillary and trabecular muscle fibers isolated from t/t (cMyBP-C-null) mice and in their counterparts in which cMyBP-C contains the ADA (Ala273-Asp282-Ala302), DAD (Asp273-Ala282-Asp302), and SAS (Ser273-Ala282-Ser302) mutations; the results were compared to those from mice expressing the wild-type (WT) transgene on the t/t background. Under standard activating conditions, DAD fibers showed significant decreases in tension (∼50%), stiffness, the fast apparent rate constant 2πc, and its magnitude C, as well as its magnitude H, but an increase in the medium rate constant 2πb, with respect to WT. The t/t fibers showed a smaller drop in stiffness and a significant decrease in 2πc that can be explained by isoform shift of myosin heavy chain. In the pCa-tension study using the 8 mM phosphate (Pi) solution, there was hardly any difference in Ca2+ sensitivity (pCa50) and cooperativity (nH) between the mutant and WT samples. However, in the solutions without Pi, DAD showed increased nH and slightly decreased pCa50. We infer from these observations that the nonphosphorylatable residue 282 combined with phosphomimetic residues Asp273 and/or Asp302 (in DAD) is detrimental to cardiomyocytes by lowering isometric tension and altering cross-bridge kinetics with decreased 2πc and increased 2πb. In contrast, a single change of residue 282 to nonphosphorylatable Ala (SAS), or to phosphomimetic Asps together with the changes of residues 273 and 302 to nonphosphorylatable Ala (ADA) causes minute changes in fiber mechanics. PMID:24606935

  7. Determination of radiocarbon reservoir age of Lake Van by mineral magnetic and geochemical analysis

    NASA Astrophysics Data System (ADS)

    Makaroglu, Ozlem; Namik Cagatay, M.; Pesonen, Lauri J.; Orbay, Naci

    2017-04-01

    Lake Van is the largest soda lake in the world, located on the east Anatolian Plateau in Turkey. Its varved sediments provide an excellent archive of high-resolution paleoclimate record for the Near East. Varve counting and radiocarbon methods are therefore important dating techniques for investigating the Lake Van sedimentary paleoclimate record. In here we present detailed magnetic and geochemical record of Lake Van. We have studied 4.56 m (core VP0801) and 4.70 m (core VP0807) long cores recovered from 80 m and 65 m water depths located in SE and SW of Lake Van, respectively. Here, we have benefited from magnetic properties with associated remanent magnetization of the sediments from Lake Van to correlate the cores which contain of tephra layers. The cores cover the last 8.4 ka and lithologically include three laminated sedimentary units. From top to the bottom, the units were dated 4.2 ka BP-present, 5.4-4.2 ka BP and older than 5.4 ka BP. We identified tephra layers previously dated by varve counting, and used the varve ages to obtain age models for the cores. We also obtained a total of eight Accelerator Mass Spectrometry (AMS) 14C dates from total organic carbon (TOC) in the two cores, close to the tephra layers. Comparison of the varve ages of the AMS 14C dated samples with their corresponding AMS 14C dates indicates large differences, suggesting significant reservoir ages that range from 2.8 to 2.5 ka for 3.0-2.4 varve ka BP and from 2.8 to 3.3 ka for 8.0-5.9 varve ka BP. The results suggest that the reservoir age of the organic matter increases with the varve age of the sediments. This increase is mainly related to the rate of supply of "dead" carbon from the old carbonate rocks in the watershed of Lake Van, which was relatively higher during 8.4-5.9 ka than during 3.0-2.4 ka BP because of the higher atmospheric precipitation and higher rate of biochemical weathering during the former period.

  8. Roles for Cardiac MyBP-C in Maintaining Myofilament Lattice Rigidity and Prolonging Myosin Cross-Bridge Lifetime

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Palmer, B.M.; Sadayappan, S.; Wang, Y.

    2011-10-06

    We investigated the influence of cardiac myosin binding protein-C (cMyBP-C) and its constitutively unphosphorylated status on the radial and longitudinal stiffnesses of the myofilament lattice in chemically skinned myocardial strips of the following mouse models: nontransgenic (NTG), effective null for cMyBP-C (t/t), wild-type cMyBP-C expressed into t/t (WT{sub t/t}), and constitutively unphosphorylated cMyBP-C (AllP{sub -t/t}). We found that the absence of cMyBP-C in the t/t and the unphosphorylated cMyBP-C in the AllP{sub -t/t} resulted in a compressible cardiac myofilament lattice induced by rigor not observed in the NTG and WT{sub t/t}. These results suggest that the presence and phosphorylation ofmore » the N-terminus of cMyBP-C provides structural support and radial rigidity to the myofilament lattice. Examination of myofilament longitudinal stiffness under rigor conditions demonstrated a significant reduction in cross-bridge-dependent stiffness in the t/t compared with NTG controls, but not in the AllP{sub -t/t} compared with WT{sub t/t} controls. The absence of cMyBP-C in the t/t and the unphosphorylated cMyBP-C in the AllP{sub -t/t} both resulted in a shorter myosin cross-bridge lifetime when myosin isoform was controlled. These data collectively suggest that cMyBP-C provides radial rigidity to the myofilament lattice through the N-terminus, and that disruption of the phosphorylation of cMyBP-C is sufficient to abolish this structural role of the N-terminus and shorten cross-bridge lifetime. Although the presence of cMyBP-C also provides longitudinal rigidity, phosphorylation of the N-terminus is not necessary to maintain longitudinal rigidity of the lattice, in contrast to radial rigidity.« less

  9. Progressive glacial retreat in the Southern Altiplano (Uturuncu volcano, 22°S) between 65 and 14 ka constrained by cosmogenic 3He dating

    NASA Astrophysics Data System (ADS)

    Blard, Pierre-Henri; Lave, Jérôme; Farley, Kenneth A.; Ramirez, Victor; Jimenez, Nestor; Martin, Léo C. P.; Charreau, Julien; Tibari, Bouchaïb; Fornari, Michel

    2014-07-01

    This work presents the first reconstruction of late Pleistocene glacier fluctuations on Uturuncu volcano, in the Southern Tropical Andes. Cosmogenic 3He dating of glacial landforms provides constraints on ancient glacier position between 65 and 14 ka. Despite important scatter in the exposure ages on the oldest moraines, probably resulting from pre-exposure, these 3He data constrain the timing of the moraine deposits and subsequent glacier recessions: the Uturuncu glacier may have reached its maximum extent much before the global LGM, maybe as early as 65 ka, with an equilibrium line altitude (ELA) at 5280 m. Then, the glacier remained close to its maximum position, with a main stillstand identified around 40 ka, and another one between 35 and 17 ka, followed by a limited recession at 17 ka. Then, another glacial stillstand is identified upstream during the late glacial period, probably between 16 and 14 ka, with an ELA standing at 5350 m. This stillstand is synchronous with the paleolake Tauca highstand. This result indicates that this regionally wet and cold episode, during the Heinrich 1 event, also impacted the Southern Altiplano. The ELA rose above 5450 m after 14 ka, synchronously with the Bolling-Allerod.

  10. Arctic ground squirrels of the mammoth-steppe: paleoecology of Late Pleistocene middens (˜24 000 29 450 14C yr BP), Yukon Territory, Canada

    NASA Astrophysics Data System (ADS)

    Zazula, Grant D.; Froese, Duane G.; Elias, Scott A.; Kuzmina, Svetlana; Mathewes, Rolf W.

    2007-04-01

    This paper presents paleoecological analyses of 48 fossil arctic ground squirrel ( Spermophilus parryii) middens (nests and caches) recovered from ice-rich loess sediments in the Klondike region of west-central Yukon Territory. AMS radiocarbon dates and stratigraphic association of middens with Dawson tephra (˜25 300 14C yr BP), indicate these paleoecological data reflect the onset of glacial conditions of early Marine Isotope Stage (MIS) 2 and terminal MIS 3 (˜24 000-29 450 14C yr BP). Plant macrofossils include at least 60 plant taxa, including diverse graminoids ( Poa, Elymus trachycaulus, Kobresia myosuroides), steppe forbs ( Penstemon gormanii, Anemone patens var. multifida, Plantago cf. canescens), tundra forbs ( Draba spp., Bistorta vivipara), dwarf shrubs ( Salix cf. arctica, S. cf. polaris), sage ( Artemisia frigida) and rare trees ( Picea mariana). Many of these taxa identified in the middens represent the first recorded fossils for these plants in Eastern Beringia and add to our knowledge of the floristic composition of Pleistocene vegetation and biogeography in this region. Fossil beetles include typical members of the Eastern Beringian steppe-tundra fauna ( Lepidophorus lineaticollis and Connatichela artemisiae) and others suggesting predominantly dry, open habitats. Cache forage selection is suggested by some plant taxa which were particularly frequent and abundant in the middens ( Bistorta vivipara, Kobresia myosuroides, Ranunculus spp., Potentilla, Erysimum cf. cheiranthoides, Poa, Carex and Draba). Factors such as proximity of vegetation to burrows and abundance of fruits and seeds per plant were probably important in cache selection. Glacial conditions enabled arctic ground squirrels to form widespread and dense populations in regions such as the Klondike in which they are rare or absent at present. This fossil midden record supports previous hypotheses that suggest arctic ground squirrels evolved in and are well-adapted to the open, steppe

  11. Investigating the Usefulness of Cosmogenic in situ 14C for the Dating of Alluvial Fan Surfaces

    NASA Astrophysics Data System (ADS)

    Goehring, B. M.; Blisniuk, K.; Moon, S.

    2017-12-01

    Accurate and unambiguous constraints on the age of alluvial fan surfaces remain one of the ultimate achievements for the application of cosmogenic nuclides exposure dating. Information on the age of a fan is not only useful for understanding the rate of sediment transfer from adjacent hillslopes, but also the displacement of an alluvial fan surface and their incised channels represent one of the clearest markers of long-term (102 - 104 years) slip along faults in many regions. Common nuclides such as 10Be, 26Al, and 36Cl, which are often applied to dating alluvial fans, are hampered by inheritance due to their long half-life as nuclides accumulate during exhumation and transport. Here, we present results from a systematic study investigating the usefulness of the cosmogenic nuclide carbon-14 (14C) from the Ash Wash Fan of the Anza Borrego Desert, California, which is well-dated with both 10Be of amalgamated boulder surfaces and U-series ages from pedogenic carbonates. We sampled individual boulders from multiple fan channel bars, rather than an amalgamation of many boulders from a single fan channel bar. Our new14C results yield a median ± half-interquartile age of 4.7 ± 0.8 ka (n = 4, 1 outlier removed). These results are in excellent agreement with the existing U-series and new p-IR-IRSL chronology (5.2 ± 0.3 ka and 5.5 ± 0.8 ka, respectively), but slightly younger than the previously published 10Be amalgamation date of 7.0 ± 1.0 ka. In contrast, 10Be exposure dates of the same boulder in our study yield a median ± half-interquartile age of 10.9 ± 2.6 ka, which we interpret to be the result of insufficient burial time during transport and/or erosion of the boulder to remove accumulated 10Be. Our results suggest that 14C may be a viable chronometer of alluvial fan surfaces less than ca. 25 ka. Finally, inspired by approaches in the burial dating community, we will also explore the possibility of a paired nuclide isochron approach. Measured 14C and 10Be

  12. Assembly of human C-terminal binding protein (CtBP) into tetramers.

    PubMed

    Bellesis, Andrew G; Jecrois, Anne M; Hayes, Janelle A; Schiffer, Celia A; Royer, William E

    2018-06-08

    C-terminal binding protein 1 (CtBP1) and CtBP2 are transcriptional coregulators that repress numerous cellular processes, such as apoptosis, by binding transcription factors and recruiting chromatin-remodeling enzymes to gene promoters. The NAD(H)-linked oligomerization of human CtBP is coupled to its co-transcriptional activity, which is implicated in cancer progression. However, the biologically relevant level of CtBP assembly has not been firmly established; nor has the stereochemical arrangement of the subunits above that of a dimer. Here, multi-angle light scattering (MALS) data established the NAD + - and NADH-dependent assembly of CtBP1 and CtBP2 into tetramers. An examination of subunit interactions within CtBP1 and CtBP2 crystal lattices revealed that both share a very similar tetrameric arrangement resulting from assembly of two dimeric pairs, with specific interactions probably being sensitive to NAD(H) binding. Creating a series of mutants of both CtBP1 and CtBP2, we tested the hypothesis that the crystallographically observed interdimer pairing stabilizes the solution tetramer. MALS data confirmed that these mutants disrupt both CtBP1 and CtBP2 tetramers, with the dimer generally remaining intact, providing the first stereochemical models for tetrameric assemblies of CtBP1 and CtBP2. The crystal structure of a subtle destabilizing mutant suggested that small structural perturbations of the hinge region linking the substrate- and NAD-binding domains are sufficient to weaken the CtBP1 tetramer. These results strongly suggest that the tetramer is important in CtBP function, and the series of CtBP mutants reported here can be used to investigate the physiological role of the tetramer. © 2018 Bellesis et al.

  13. The Pech-de-l'Azé I Neandertal child: ESR, uranium-series, and AMS 14C dating of its MTA type B context.

    PubMed

    Soressi, M; Jones, H L; Rink, W J; Maureille, B; Tillier, A-M

    2007-04-01

    The Pech-de-l'Azé I skull and mandible are included in the juvenile Neandertal remains from Europe. However, some preserved features in the cranial skeleton seem to distinguish the specimen from other Neandertal children. Unfortunately, the stratigraphic position and dating of this child has never been clear. Our recent work on unpublished archives show that the Pech-de-l'Azé I Neandertal child was discovered at the bottom of layer 6, attributed to the Mousterian of Acheulean tradition type B. These skull and mandible are the first diagnostic human remains (aside from an isolated tooth) attributed to the Mousterian of Acheulian tradition (MTA) type B. Consequently, we confirm that Neandertals were the makers of this Mousterian industry, which is characterized by unusual high frequencies of Upper Paleolithic type tools, elongated blanks and blades. We were able to date the context of the hominid remains by dating layer 6 and the layers above and beneath it using ESR, coupled ESR/(230)Th/(234)U (coupled ESR/U-series), and AMS (14)C. Coupled ESR/U-series results on 16 mammalian teeth constrain the age of the uppermost layer 7 to 41-58ka, and layer 6 to 37-51ka. The wide spread in each age estimate results mainly from uncertainties in the gamma-dose rate. These ages are concordant with AMS (14)C ages of two bones coming from the top of layer 6, which provide dates of about 41.7-43.6ka cal BP. A combination of stratigraphic arguments and dating results for layers 6 and 7 show that the Neandertal child cannot be older than 51ka or younger than 41ka. The lowermost layer 4 is shown to be older than 43ka by the principle of superposition and ESR dating in the immediately overlying layer 5. This study shows that the MTA type B had been manufactured by Neandertals before the arrival of anatomically modern humans in the local region. Additionally, by providing a firm chronological framework for the specific morphometric the features of Pech-de-l'Azé I Neandertal child, this

  14. Reconstruction of the Late Quaternary Glaciation of the Macha Khola valley (Gorkha Himal, Nepal) using relative and absolute ( 14C, 10Be, dendrochronology) dating techniques

    NASA Astrophysics Data System (ADS)

    Zech, W.; Glaser, B.; Abramowski, U.; Dittmar, C.; Kubik, P. W.

    2003-11-01

    Late Quaternary glacier fluctuations in the Macha Khola valley (Gorkha Himal, Nepal) were reconstructed using relative and absolute dating techniques. Our results indicate that younger moraine complexes were left by Late Holocene (<1.7 cal. ka BP), mid-Holocene (ca 3 cal. ka BP), and Lateglacial (ca 13 cal. ka BP) ice advances. Older Late Quaternary glacier advances occurred during Marine Oxygen Isotope Stages (MIS) 2 and 3-4. No relics of Middle or Early Pleistocene glaciations could be found. During MIS 3-4, glaciers advanced down to an altitude of at least 2150 m a.s.l., corresponding to an ELA depression of approximately 1300 m. At about 3500 m a.s.l., the MIS 2 Macha Khola glacier reached almost the thickness of the former MIS 3-4 glacier and retreated some time before 17.9 cal. ka BP. The Lateglacial glacier advanced again several times to altitudes between 2450 and 3400 m a.s.l. The mid-Holocene glaciers extended much farther down-valley than the Late Holocene ones. Dendrochronological data of Abies spectabilis suggested several periods of unfavourable growth conditions especially at the beginning of the 19th (1820) and 20th (1905) centuries.

  15. Holocene thermal optimal and climate variability of East Asian monsoon inferred from forest reconstruction of a subalpine pollen sequence, Taiwan

    NASA Astrophysics Data System (ADS)

    Liew, P. M.; Lee, C. Y.; Kuo, C. M.

    2006-10-01

    The East Asian monsoon Holocene optimal period has been debated both about duration and whether conditions were a maximum in thermal conditions or in precipitation. In this study we show Holocene climate variability inferred by a forest reconstruction of a subalpine pollen sequence from peat bog deposits in central Taiwan, based on modern analogues of various altitudinal biomes in the region. A warmer interval occurred between 8 and 4 ka BP (calibrated 14C years) when the subtropical forests were more extensive. The Holocene thermal optimum is represented by an altitudinal tropical forest at 6.1-5.9 ka BP and 6.9 ka BP and only the latter was accompanied by wet conditions, indicating decoupling of thermal and precipitation mechanism in the middle Holocene. Abrupt and relative severe cold phases, shown by biome changes, occurred at about 11.2-11.0 ka BP; 7.5 ka BP; 7.2 ka BP; 7.1 ka BP; 5.2 ka BP, 5.0 ka BP and 4.9 ka BP. A spectral analysis of pollen of a relatively cold taxon — Salix, reveals that the time series is dominated by a 1500 yr periodicity and similar to the cold cycle reported in the marine records of Indian and western Pacific Oceans. The cold-warm conditions inferred by the change of forests show close relationship to solar energy in comparison with the production rate of Be-10.

  16. An investigation into the association between HLA-G 14 bp insertion/deletion polymorphism and multiple sclerosis susceptibility.

    PubMed

    Mohammadi, Nabiallah; Adib, Minoo; Alsahebfosoul, Fereshteh; Kazemi, Mohammad; Etemadifar, Masoud

    2016-01-15

    Human Leukocyte Antigen G (HLA-G) gene polymorphism and expression rate have recently been suggested to have a potential role in susceptibility to Multiple Sclerosis (MS), a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system with unknown etiology. The aim of this study was to investigate the association of the frequency of HLA-G gene 14 bp insertion/deletion polymorphism and its plasma level with MS susceptibility. In this study, the HLA-G gene from 212 patients and 210 healthy individuals was amplified using real time PCR and screened for the 14 bp insertion/deletion polymorphism. In addition, HLA-G plasma levels of the patients were measured and compared to normal controls by ELISA method. Our results revealed that 14 bp insertion in HLA-G could result in lower plasma HLA-G level of the subjects, regardless of their health status and vice versa. Additionally, significant correlation of HLA-G genotype and its plasma level with MS susceptibility was observed. In conclusion, not only HLA-G 14 bp insertion/deletion polymorphism could be associated with expression rate of the HLA-G gene and its plasma level, but also could be considered as a risk factor for susceptibility to MS in our study population. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. New Insights into the 8.2 ka Cold Event and Subsequent Climate Recovery in Central Europe Provided by a Precisely Dated Ostracod δ18O Record from Mondsee (Austria)

    NASA Astrophysics Data System (ADS)

    Lauterbach, S.; Andersen, N.; Brauer, A.; Erlenkeuser, H.; Danielopol, D. L.; Namiotko, T.; Huels, M.; Belmecheri, S.; Nantke, C.; Meyer, H.; Chapligin, B.; von Grafenstein, U.

    2015-12-01

    As evidenced by numerous palaeoclimate records worldwide, the Holocene warm period has been interrupted by several short, low-amplitude cold episodes. Among these, the so-called 8.2 ka cold event is the most prominent Holocene climate perturbation but despite extensive studies, knowledge about its synchrony in different areas and particularly about the dynamics of subsequent climate recovery is still limited. As this is of crucial importance for understanding the complex mechanisms that trigger rapid climate fluctuations and for testing the performance of climate models, new data on the 8.2 ka cold event are needed. Here we present a new sub-decadally resolved, precisely dated oxygen isotope (δ18O) record for the interval 7.7-8.7 ka BP obtained from benthic ostracods preserved in the varved lake sediments of Mondsee (Austria), providing new insights into climate development around the 8.2 ka cold event in Central Europe. The new high-resolution δ18O data set reveals the occurrence of a pronounced cold spell around 8.2 ka BP, whose amplitude (~1.0 ‰, equivalent to a 1.5-2.0 °C cooling), total duration (151 a) and absolute dating (8231-8080 a BP, i.e. calendar years before AD 1950) perfectly agree with results from other Northern Hemisphere palaeoclimate archives, e.g. the precisely dated Greenland ice cores. In addition, the Mondsee δ18O record also indicates a 75-year-long air temperature overshoot of ~0.7 °C directly after the 8.2 ka event (between 8080 and 8005 a BP), which is so far only poorly documented in the mid-latitudes. However, this observation is consistent with results from coupled climate models and high-latitude proxy records, thus likely reflecting a hemispheric-scale climate signal driven by enhanced resumption of the Atlantic meridional overturning circulation (AMOC), which apparently also caused synchronous migrations of atmospheric and oceanic front systems in the North Atlantic realm.

  18. Vegetation history and climate variability since 1.3kaBP reconstructed from high-resolution multiproxy analysis of mountainous peat sediment, Southeast China

    NASA Astrophysics Data System (ADS)

    Ma, Chunmei; Cui, Anning; Fang, Yiman; Zhao, Lin; Jia, Yulian

    2017-04-01

    Climate change during the last two millennia is one of the most important focuses of the "Past Global Changes" (PAGES) initiative. In this study, vegetation history and climate variability since 1.3kaBP was reconstructed from high-resolution multiproxy analysis of mountainous peat sediment from the central part of a swamp in Jiangxi Province, China. 210Pb, 137Cs and AMS14C dating were used to build the age framework on the basis of Bacon model. Pollen, Humification degree (HD), Loss-on ignition (LOI), XRF scan elements and grain-size distribution were analyzed. During 637-800 AD, the vegetation combination consists of upland herbs taxa and scattered evergreen Quercus (Quercus E). However, the pollen concentration was very low, and plant genera were seldom. Since harsh environment is not conducive to pollen storage, vegetation condition reconstructed by pollen information cannot reflect real climate change. During the Medieval Warm Period (MWP, 800-1250 AD) vegetation is abundant through the entire period, Quercus E is the building group of the forest, Pinus and Castanopsis are sporadic. Upland herbs grew up vigorously in the lower part of forest. Peat began to accumulate in the basin high terrain, where wetland herbs grew vigorous. The climate during MWP was characterized by warm and wet, inside there were obvious secondary fluctuations. Dramatic vegetation changes were recorded during the Little Ice Age LIA,1340-1870 AD). The vegetation community was primarily dominated by Castanopsis, upland land herbs thrive; wetland herbs were sparse with great fluctuations depending on changes in the humidity. Overall, during LIA, temperature pattern was featured by "four cold period and three warm period", and humidity condition was experienced a process from drought to wet. Periodic analysis of the moisture proxy (PCA 1) and temperature indicator (E/D: evergreen/deciduous tree pollen) shows cyclic fluctuations of 150 years in the temperature and precipitation, which is

  19. Logarithmic phase Escherichia coli K1 efficiently avoids serum killing by promoting C4bp-mediated C3b and C4b degradation

    PubMed Central

    Wooster, David G; Maruvada, Ravi; Blom, Anna M; Prasadarao, Nemani V

    2006-01-01

    Meningitis caused by Escherichia coli K1 is a serious illness in neonates with neurological sequelae in up to 50% of survivors. A high degree of bacteremia is required for E. coli K1 to cross the blood–brain barrier, which suggests that the bacterium must evade the host defence mechanisms and survive in the bloodstream. We previously showed that outer membrane protein A (OmpA) of E. coli binds C4b-binding protein (C4bp), an inhibitor of complement activation via the classical pathway. Nevertheless, the exact mechanism by which E. coli K1 survives in serum remains elusive. Here, we demonstrate that log phase (LP) OmpA+E. coli K1 avoids serum bactericidal activity more effectively than postexponential phase bacteria. OmpA–E. coli cannot survive in serum grown to either phase. The increased serum resistance of LP OmpA+E. coli is the result of increased binding of C4bp, with a concomitant decrease in the deposition of C3b and the downstream complement proteins responsible for the formation of the membrane attack complex. C4bp bound to E. coli K1 acts as a cofactor to factor I in the cleavage of both C3b and C4b, which shuts down the ensuing complement cascade. Accordingly, a peptide corresponding to the complement control protein domain 3 of C4bp sequence, was able to compete with C4bp binding to OmpA and cause increased deposition of C3b. Thus, binding of C4bp appears to be responsible for survival of E. coli K1 in human serum. PMID:16556262

  20. Pedo-sedimentary constituents as paleoenvironmental proxies in the Sudano-Sahelian belt during the Late Quaternary (southwestern Chad Basin)

    NASA Astrophysics Data System (ADS)

    Diaz, Nathalie; Dietrich, Fabienne; Sebag, David; King, Georgina E.; Valla, Pierre G.; Durand, Alain; Garcin, Yannick; de Saulieu, Geoffroy; Deschamps, Pierre; Herman, Frédéric; Verrecchia, Eric P.

    2018-07-01

    Climate and environmental changes since the Last Glacial Maximum in the tropical zone of West Africa are usually inferred from marine and continental records. In this study, the potential of carbonate pedo-sedimentary geosystems, i.e. Vertisol relics, to record paleoenvironmental changes in the southwestern part of Chad Basin are investigated. A multi-dating approach was applied on different pedogenic organo-mineral constituents. Optically stimulated luminescence (OSL) dating was performed on the soil K-rich feldspars and was combined with radiocarbon dating on both the inorganic (14Cinorg) and organic carbon (14Corg) soil fractions. Three main pedo-sedimentary processes were assessed over the last 20 ka BP: 1) the soil parent material deposition, from 18 ka to 12 ka BP (OSL), 2) the soil organic matter integration, from 11 cal ka to 8 cal ka BP (14Corg), and 3) the pedogenic carbonate nodule precipitation, from 7 cal ka to 5 cal ka BP (14Cinorg). These processes correlate well with the Chad Basin stratigraphy and West African records and are shown to be related to significant changes in the soil water balance responding to the evolution of continental hydrology during the Late Quaternary. The last phase affecting the Vertisol relics is the increase of erosion, which is hypothesized to be due to a decrease of the vegetation cover triggered by (i) the onset of drier conditions, possibly strengthened by (ii) anthropogenic pressure. Archaeological data from Far North Cameroon and northern Nigeria, as well as sedimentation times in Lake Tilla (northeastern Nigeria), were used to test these relationships. The increase of erosion is suggested to possibly occur between c. 3 cal ka and 1 cal ka BP. Finally, satellite images revealed similar geosystems all along the Sudano-Sahelian belt, and initial 14Cinorg ages of the samples collected in four sites gave similar ages to those reported in this study. Consequently, the carbonate pedo-sedimentary geosystems are valuable

  1. The HLA-G 14 bp insertion/deletion polymorphism and its association with soluble HLA-G levels in women with recurrent miscarriages.

    PubMed

    Kalotra, V; Lall, M; Verma, I C; Kaur, A; Kaur, A

    2018-03-01

    HLA-G, a nonclassical class-Ib gene is mainly expressed on extravillous trophoblasts at the fetal-maternal interface. HLA-G molecule is considered to play an important role in maternal immune suppression during pregnancy. The 14bp insertion/deletion polymorphism (rs66554220) in exon eight of the HLA-G gene influences HLA-G mRNA stability and isoform splicing patterns. In this study, 202 recurrent miscarriage (RM) women with two or more than two consecutive miscarriages, their 202 partners and 204 fertile control women with at least one live birth and no miscarriages were analyzed for 14bp insertion/deletion polymorphism. Soluble HLA-G (sHLA-G) levels were also determined and compared between randomly selected 111 RM women and 111 control women using QAYEE-Bio ELISA kits. Student's t test and χ 2 test were used to depict the statistical differences. The results showed no significant differences for 14bp allele and genotype frequencies between the study groups. However, our study showed a significant difference (P = .0107) for sHLA-G levels in RM women and control women. Furthermore, a significant difference (P = .0135) for sHLA-G levels in relation to +/-14bp heterozygous genotype was seen between the two groups. The 14bp allele sharing between the partners did not show any significant association with the number of miscarriages in RM couples. The association of 14bp polymorphism and recurrent miscarriages was not significant in our study. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Roles of Sea Level and Climate Change in the Development of Holocene Deltaic Sequences in the Yellow Sea

    NASA Astrophysics Data System (ADS)

    Liu, J.; Milliman, J. D.

    2002-12-01

    Both post-glacial sea-level and climatic changes are preserved in the the shallow, low gradient, sediment-dominated Yellow Sea. As a result of rapid flooding during melt-water pulse (MWP) 1A, 14.3-14.1 ka BP, sea level reached the southern edge of the North Yellow Sea (NYS), and after MWP-1B (11.6-11.4 ka BP) sea level entered the Bohai Sea. The first major Yellow River-derived deltaic deposit formed in the NYS during decelerated transgression following MWP-1B and increased river discharge in response to re-intensification of the summer monsoon about 11 ka cal BP. A second subaqueous delta formed in the South Yellow Sea about 9-7 ka BP during decelerated transgression after MWP-1C flooding and in response to the southern shift of the Yellow River mouth. The modern subaqueous and subaerial deltas in the west Bahai Gulf and (to a lesser extent) along the Jiangus coast have formed during the modern sea-level highstand. These changing Holocene patterns are most clearly illustrated by a short film clip.

  3. A 75 ka Stalagmite Paleoclimate Record from Northern Venezuela

    NASA Astrophysics Data System (ADS)

    Retrum, J. B.; Gonzalez, L. A.; Edwards, R.; Tincher, S. M.; Cheng, H.; Urbani, F.

    2011-12-01

    A stalagmite collected from Cueva Zarraga in the northern Venezuelan Andes was analyzed to determine local paleoclimatic history and help examine climate change in the Caribbean. Ages were determined by U/Th disequilibrium and the stalagmite shows a nearly complete record for ~ 75 ka. Two significant periods of non-deposition have been identified. The first period ranges between the Last Glacial Maximum at 19,820 ± 149 cal yr BP and a brief resumption of stalagmite growth at 15,409 ± 747 cal yr BP, likely representing the Bølling-Allerød interstadial. After the brief period of deposition, growth does not resume unil the Holocene at 10,408 ± 78 cal yr BP. Carbon and oxygen isotopes show a major depletion shift from the last glacial period to the Holocene, suggesting warmer and wetter conditions during the Holocene. The oxygen isotope depletion shift is also seen in the Cariaco Basin foraminifera record off the northern coast of Venezuela. While tempting to attribute δ13C depletion to decrease of the C4 plant contribution, there is no evidence that the area experience major vegetation changes. We attribute the δ13C depletion to enhanced recycling of soil CO2 resulting from canopy effects. Today, Cueva Zarraga is at the northern extent of the Inter-Tropical Convergence Zone (ITCZ). The cooler and drier conditions of the last glacial period suggest a southern displacement of the ITCZ. The close proximity of Cueva Zarraga to Cariaco Basin may allow for a high resolution tropical terrestrial and oceanic climatic response comparison.

  4. Vegetation and climate history in the Laptev Sea region (arctic Siberia) during Late Quaternary inferred from pollen records

    NASA Astrophysics Data System (ADS)

    Andreev, A.; Schirrmeister, L.; Tarasov, P.

    2009-04-01

    A number of permafrost sections dated by 14C, TL, IRSL, and 230U/Th were analysed for pollen. Pollen spectra suggest that wet grass-sedge tundra habitats dominated during an interstadial c. 200-170 ka ago. The climate was rather wet and cold. The pollen spectra reflect sparser grass-sedge vegetation cover during the Late Saalian stadial, c. 170-130 ka BP. Environmental conditions were much more severe compared with the previous interstadial. Open Poaceae and Artemisia communities dominated at the beginning of the Last Interglacial. Some shrubs (Alnus fruticosa, Salix, Betula nana) grew in more protected and wetter places. Climate was rather warm (similar to modern conditions)during this time. Shrub tundra with Alnus fruticosa and Betula nana s.l. dominated in the area during the Eemian climatic optimum, when summer temperatures were 4-5°C higher than today. Early Weichselian pollen records reflect harsh environmental conditions; sparser vegetation (mostly grass and sedge communities) during this time. Middle Weichselian (Karginsky) Interstadial records with dominance of Cyperaceae and Poaceae with some Artemisia and Salix reflects tundra- and steppe-like associations with willow shrubs dominated the area. The climate was relatively moist and warm. A rather high content of algae colonies in the sediments indicates shallow water habitats (e.g. centres of ice wedge polygons). Dominance of Poaceae, Cyperaceae, Artemisia, and Caryophyllaceae pollen with some other herbs is typical for the 40-32 ka BP (climatic optimum) old sediments when open herb dominated the area. High pollen concentrations reflect that dense grass-sedge dominated vegetation; presence of Salix is also characteristic. The records point to climate amelioration during the Middle Weichselian compared to the Early Weichselian. Climate conditions became colder and drier c. 30-26 ka BP. Pollen spectra reflect that sedge-grass-Artemisia with some Caryophyllaceae and Asteraceae dominated the vegetation

  5. A regional record of expanded Holocene wetlands and prehistoric human occupation from paleowetland deposits of the western Yarlung Tsangpo valley, southern Tibetan Plateau

    NASA Astrophysics Data System (ADS)

    Hudson, Adam M.; Olsen, John W.; Quade, Jay; Lei, Guoliang; Huth, Tyler E.; Zhang, Hucai

    2016-07-01

    The Asian Monsoon, which brings ∼80% of annual precipitation to much of the Tibetan Plateau, provides runoff to major rivers across the Asian continent. Paleoclimate records indicate summer insolation and North Atlantic paleotemperature changes forced variations in monsoon rainfall through the Holocene, resulting in hydrologic and ecologic changes in plateau watersheds. We present a record of Holocene hydrologic variability in the Yarlung Tsangpo (YT) valley of the southern Tibetan Plateau, based on sedimentology and 14C dating of organic-rich 'black mats' in paleowetlands deposits, that shows changes in wetlands extent in response to changing monsoon intensity. Four sedimentary units indicate decreasing monsoon intensity since 10.4 ka BP. Wet conditions occurred at ∼10.4 ka BP, ∼9.6 ka BP and ∼7.9-4.8 ka BP, with similar-to-modern conditions from ∼4.6-2.0 ka BP, and drier-than-modern conditions from ∼2.0 ka BP to present. Wetland changes correlate with monsoon intensity changes identified in nearby records, with weak monsoon intervals corresponding to desiccation and erosion of wetlands. Dating of in situ ceramic and microlithic artifacts within the wetlands indicates Epipaleolithic human occupation of the YT valley after 6.6 ka BP, supporting evidence for widespread colonization of the Tibetan Plateau in the early and mid-Holocene during warm, wet post-glacial conditions.

  6. Measurements of 14C in ancient ice from Taylor Glacier, Antarctica constrain in situ cosmogenic 14CH4 and 14CO production rates

    NASA Astrophysics Data System (ADS)

    Petrenko, Vasilii V.; Severinghaus, Jeffrey P.; Schaefer, Hinrich; Smith, Andrew M.; Kuhl, Tanner; Baggenstos, Daniel; Hua, Quan; Brook, Edward J.; Rose, Paul; Kulin, Robb; Bauska, Thomas; Harth, Christina; Buizert, Christo; Orsi, Anais; Emanuele, Guy; Lee, James E.; Brailsford, Gordon; Keeling, Ralph; Weiss, Ray F.

    2016-03-01

    Carbon-14 (14C) is incorporated into glacial ice by trapping of atmospheric gases as well as direct near-surface in situ cosmogenic production. 14C of trapped methane (14CH4) is a powerful tracer for past CH4 emissions from ;old; carbon sources such as permafrost and marine CH4 clathrates. 14C in trapped carbon dioxide (14CO2) can be used for absolute dating of ice cores. In situ produced cosmogenic 14C in carbon monoxide (14CO) can potentially be used to reconstruct the past cosmic ray flux and past solar activity. Unfortunately, the trapped atmospheric and in situ cosmogenic components of 14C in glacial ice are difficult to disentangle and a thorough understanding of the in situ cosmogenic component is needed in order to extract useful information from ice core 14C. We analyzed very large (≈1000 kg) ice samples in the 2.26-19.53 m depth range from the ablation zone of Taylor Glacier, Antarctica, to study in situ cosmogenic production of 14CH4 and 14CO. All sampled ice is >50 ka in age, allowing for the assumption that most of the measured 14C originates from recent in situ cosmogenic production as ancient ice is brought to the surface via ablation. Our results place the first constraints on cosmogenic 14CH4 production rates and improve on prior estimates of 14CO production rates in ice. We find a constant 14CH4/14CO production ratio (0.0076 ± 0.0003) for samples deeper than 3 m, which allows the use of 14CO for correcting the 14CH4 signals for the in situ cosmogenic component. Our results also provide the first unambiguous confirmation of 14C production by fast muons in a natural setting (ice or rock) and suggest that the 14C production rates in ice commonly used in the literature may be too high.

  7. Synergistic Measurement of Ice Cloud Microphysics using C- and Ka-Band Radars

    NASA Astrophysics Data System (ADS)

    Ewald, F.; Gross, S.; Hagen, M.; Li, Q.; Zinner, T.

    2017-12-01

    Ice clouds play an essential role in the climate system since they have a large effect on the Earth's radiation budget. Uncertainties associated with their spatial and temporal distribution as well as their optical and microphysical properties still account for large uncertainties in climate change predictions. Substantial improvement of our understanding of ice clouds was achieved with the advent of cloud radars into the field of ice cloud remote sensing. Here, highly variable ice crystal size distributions are one of the key issues remaining to be resolved. With radar reflectivity scaling with the sixth moment of the particle size, the assumed ice crystal size distribution has a large impact on the results of microphysical retrievals. Different ice crystal sizes distributions can, however, be distinguished, when cloud radars of different wavelength are used simultaneously.For this study, synchronous RHI scans were performed for a common measurement range of about 30 km between two radar instruments using different wavelengths: the dual-polarization C-band radar POLDIRAD operated at DLR and the Mira-36 Ka-band cloud radar operated at the University of Munich. For a measurement period over several months, the overlapping region for ice clouds turned out to be quite large. This gives evidence on the presence of moderate-sized ice crystals for which the backscatter is sufficient high to be visible in the C-band as well. In the range between -10 to +10 dBz, reflectivity measurements from both radars agreed quite well indicating the absence of large ice crystals. For reflectivities above +10 dBz, we observed differences with smaller values at the Ka-band due to Mie scattering effects at larger ice crystals.In this presentation, we will show how this differential reflectivity can be used to gain insight into ice cloud microphysics on the basis of electromagnetic scattering calculations. We will further explore ice cloud microphysics using the full polarization agility

  8. High resolution sedimentary record from the Cocos Ridge: evidence of land-ocean linkages in the Eastern Equatorial Pacific over the last 70 ka

    NASA Astrophysics Data System (ADS)

    Murdmaa, I.; Ivanova, E.; Leduc, G.; Beaufort, L.; Peresypkin, V.; Vidal, L.; Ovsepyan, E.; Alekhina, G.; Kravtsov, V.; Vasileva, V.

    2009-04-01

    We analyzed n-alkanes spectra, TOC content, and C/N ratio in the upper 12 m of the giant IMAGES Core MD02-2529 from the Cocos Ridge (08°12.33'N; 84°07.32'W; 1619 m w.d.) to estimate terrestrial organic matter (TOM) and marine organic matter (MOM) contribution to the total organic matter budget in sediments. Multi-proxy studies of nannofossils, benthic and planktic foraminifers reveal productivity variations during the time interval of the last ~ 70 ka recovered by the upper part of the core according to the age model based on AMS-14C dates and benthic oxygen isotope record. According to the shipboard core description, the slightly calcareous hemipelagic mud recovered by Core MD02-2529 contains a considerable admixture of terrestrial plant remains. This is confirmed by optical microscopic and SEM studies which reveal a strong pyritization of the particular terrestrial organic matter. As estimated by the proportion of the mainly terrestrial long-molecular alkanes (C23 - C38) relative to mainly planktic short-molecular ones (C10 - C22), the TOM input largely controls variations in the TOC content throughout the studied core interval, possibly except for the Upper Holocene, where higher TOC values correspond to relatively increased MOM content. TOM strongly dominates over the MOM content in sediments of the beginning of Termination 1, most enriched in total organic matter (up to 3.4% TOC). High content of the TOM is also fixed by n-alkane data over the Younger Dryas and H-events. Mass accumulation rates (MAR) of TOC, as well as terrestrial and marine organic matter, generally support the data on percentages, but show that the MOM flux was considerable even during the maximum TOM input at the beginning of Termination I. We suggest that this abundant TOM flux was related to the glacioeustatic sea level lowstand at the LGM, during which the emerged shelf became a vegetated coastal plain affected by seasonally humid tropical monsoon climate. The terrestrial organic

  9. Insights from 14C into C loss pathways in degraded peatlands

    NASA Astrophysics Data System (ADS)

    Evans, Martin; Evans, Chris; Allott, Tim; Stimson, Andrew; Goulsbra, Claire

    2016-04-01

    Peatlands are important global stores of terrestrial carbon. Lowered water tables due to changing climate and direct or indirect human intervention produce a deeper aerobic zone and have the potential to enhance loss of stored carbon from the peat profile. The quasi continuous accumulation of organic matter in active peatlands means that the age of fluvial dissolved organic carbon exported from peatland systems is related to the source depth in the peat profile. Consequently 14C analysis of DOC in waters draining peatlands has the potential not only to tell us about the source of fluvial carbon and the stability of the peatland but also about the dominant hydrological pathways in the peatland system. This paper will present new radiocarbon determinations from peatland streams draining the heavily eroded peatlands of the southern Pennine uplands in the UK. These blanket peatland systems are highly degraded, with extensive bare peat and gully erosion resulting from air pollution during the industrial revolution, overgrazing, wildfire and climatic changes. Deep and extensive gullying has significantly modified the hydrology of these systems leading to local and more widespread drawdown of water table. 14C data from DOC in drainage waters are presented from two catchments; one with extensive gully erosion and the other with a combination of gully erosion and sheet erosion of the peat. At the gully eroded site DOC in drainage waters is as old as 160 BP but at the site with extensive sheet erosion dates of up to 1069 BP are amongst the oldest recorded from blanket peatland globally These data indicate significant degradation of stored carbon from the eroding peatlands. Initial comparisons of the 14C data with modelled water table for the catchments and depth-age curves for catchment peats suggests that erosion of the peat surface, allowing decomposition of exposed older organic material is a potential mechanism producing aged carbon from the eroded catchment. This

  10. Ka Band Objects: Observation and Monitoring (KaBOOM)

    NASA Astrophysics Data System (ADS)

    Geldzahler, B.

    2012-09-01

    NASA has embarked on a path that will enable the implementation of a high power, high resolution X/Ka band radar system using widely spaced 12m antennas to better track and characterize near Earth objects and orbital debris. This radar system also has applications for cost effective space situational awareness. We shall demonstrate Ka band coherent uplink arraying with real-time atmospheric compensation using three 12m antennas at the Kennedy Space Center (KSC). Our proposed radar system can complement and supplement the activities of the Space Fence. The proposed radar array has the advantages of filling the gap between dusk and dawn and offers the possibility of high range resolution (4 cm) and high spatial resolution (?10 cm at GEO) when used in a VLBI mode. KSC was chosen because [a] of reduced implementation costs, [b] there is a lot of water vapor in the air (not Ka band friendly), and [c] the test satellites have a low elevation adding more attenuation and turbulence to the demonstration. If Ka band coherent uplink arraying can be made to work at KSC, it will work anywhere. We expect to rebaseline X-band in 2013, and demonstrate Ka band uplink arraying in 2014.

  11. Relative paleointensity (RPI) in the latest Pleistocene (10-45 ka) and implications for the "mystery interval" in atmospheric radiocarbon production at 17 ka.

    NASA Astrophysics Data System (ADS)

    Channell, J. E. T.; Hodell, D. A.

    2017-12-01

    Relative paleointensity (RPI) proxies have been used to improve the resolution of Quaternary stratigraphies, and have been matched to oxygen isotope stratigraphies over the last 2 Myrs. The archeomagnetic archive has been important for the Holocene RPI record, and the older Quaternary record has come largely from ODP/IODP and MD (Marion Dufresne - Calypso) marine cores. Beyond the range of archeomagnetic data, published RPI stacks have poor consistency in the 10-30 ka (latest Pleistocene) interval, possibly due to poor quality of ODP/IODP and MD cores in the upper few meters of the sedimentary sections. We report RPI data from a suite of conventional piston cores and Kasten cores from the SW Iberian margin collected during cruise JC089 of the RSS James Cook in August 2013. The age models were acquired by correlation of Ca/Ti XRF core-scanning data to L* reflectance from the Cariaco Basin that is tied to the Greenland ice-core chronology. Mean sedimentation rates are in the 10-20 cm/kyr range. The Holocene RPI record from these marine cores can be broadly correlated to the archeomagnetic RPI compilations. The preceding RPI data are characterized by a short-lived minimum at 13-15 ka, a high in RPI at 17-20 ka, preceded by a discontinuous RPI decrease to 40 ka at the time of the well-documented Laschamp geomagnetic excursion. A stack of 12 RPI records from the SW Iberian margin for the 0-45 ka interval are compared with 11 records from elsewhere, including marine and lake records from the Pacific and South Atlantic realms, chosen on the basis of mean sedimentation rates (>20 cm/kyr) and superior age models. The resulting stacks are very different to previously published RPI stacks, particularly for the 10-30 ka interval, and imply a global (dipole-field) high at 17-20 ka that has implications for the 190 ‰ drop in atmospheric 14C during the so-called "mystery interval" (17.5-14.5 ka).

  12. Stabilization of p21 by mTORC1/4E-BP1 predicts clinical outcome of head and neck cancers

    PubMed Central

    Llanos, Susana; García-Pedrero, Juana M.; Morgado-Palacin, Lucia; Rodrigo, Juan P.; Serrano, Manuel

    2016-01-01

    The levels, regulation and prognostic value of p21 in head and neck squamous cell carcinomas (HNSCC) has been puzzling for years. Here, we report a new mechanism of regulation of p21 by the mTORC1/4E-BP1 pathway. We find that non-phosphorylated 4E-BP1 interacts with p21 and induces its degradation. Accordingly, hyper-activation of mTORC1 results in phosphorylation of 4E-BP1 and stabilization of p21. In HNSCC, p21 levels strongly correlate with mTORC1 activity but not with p53 status. Finally, clinical data indicate that HNSCC patients with p21 and phospho-S6-double-positive tumours present a better disease-specific survival. We conclude that over-activation of the mTORC1/4E-BP1/p21 pathway is a frequent and clinically relevant alteration in HNSCC. PMID:26832959

  13. Multi-proxy dating of Holocene maar lakes and Pleistocene dry maar sediments in the Eifel, Germany

    NASA Astrophysics Data System (ADS)

    Sirocko, Frank; Dietrich, Stephan; Veres, Daniel; Grootes, Pieter M.; Schaber-Mohr, Katja; Seelos, Klemens; Nadeau, Marie-Josée; Kromer, Bernd; Rothacker, Leo; Röhner, Marieke; Krbetschek, Matthias; Appleby, Peter; Hambach, Ulrich; Rolf, Christian; Sudo, Masafumi; Grim, Stephanie

    2013-02-01

    During the last twelve years the ELSA Project (Eifel Laminated Sediment Archive) at Mainz University has drilled a total of about 52 cores from 27 maar lakes and filled-in maar basins in the Eifel/Germany. Dating has been completed for the Holocene cores using 6 different methods (210Pb and 137Cs activities, palynostratigraphy, event markers, varve counting, 14C). In general, the different methods consistently complement one another within error margins. Event correlation was used for relating typical lithological changes with historically known events such as the two major Holocene flood events at 1342 AD and ca 800 BC. Dating of MIS2-MIS3 core sections is based on greyscale tuning, radiocarbon and OSL dating, magnetostratigraphy and tephrochronology. The lithological changes in the sediment cores demonstrate a sequence of events similar to the North Atlantic rapid climate variability of the Last Glacial Cycle. The warmest of the MIS3 interstadials was GI14, when a forest with abundant spruce covered the Eifel area from 55 to 48 ka BP, i.e. during a time when also other climate archives in Europe suggested very warm conditions. The forest of this "Early Stage 3 warm phase" developed subsequently into a steppe with scattered birch and pine, and finally into a glacial desert at around 25 ka BP. Evidence for Mono Lake and Laschamp geomagnetic excursions is found in two long cores. Several large eruptions during Middle and Late Pleistocene (Ulmener Maar - 11,000 varve years BP, Laacher See - 12,900 varve years BP, Mosenberg volcanoes/Meerfelder Maar 41-45 cal ka BP, Dümpel Maar 116 ka BP, Glees Maar - 151 ka BP) produced distinct ash-layers crucial for inter-core and inter-site correlations. The oldest investigated maar of the Eifel is 40Ar/39Ar dated to the time older than 520 ka BP.

  14. Biomarker reconstruction of phytoplankton productivity and community structure changes in the mud area southwest off Cheju Island during the past 9 ka

    NASA Astrophysics Data System (ADS)

    Wang, Z. C.; Xiao, X.; Yuan, Z. N.; Wang, F.; Xing, L.; Li, L.; Zhao, M.

    2017-12-01

    High-resolution biomarker records from the mud area southwest off Cheju Island in the East China Sea reveal the variabilities of the phytoplankton productivity and community structure during the past 9 ka. This area has undergone dramatic environmental changes during the last glacial cycle, as eustatic sea-level fluctuations resulting in major migration of the coastline. We use the brassicasterol, dinosterol and alkenones records in three sediment cores (B3-1: 31.62°N, 125.75°E; F10: 31.75°N, 126.11°E; F11: 31.88°N, 126.35°E) to reconstruct diatom community, dinoflagellate community and haptophyte community, respectively. The low content of alkenones and relative high contents of brassicasterol and dinosterol of the three sediment cores indicated that diatoms and dinoflagellates were the main marine productivity during the Holocene. The phytoplankton productivity was generally low during the early-Holocene (9-5 ka BP) because of the low input of nutrient. The phytoplankton productivity increased during the mid-Holocene (5-3 ka BP) in response to the upwelling which complemented the nutrient to the upper layer. High content of alkenones in F11 during this period caused by the establishment of the modern circulation pattern around 5-6 ka BP because the intrusion of the Yellow Sea Warm Current (YSWC) brought the high-temperature and high-salinity waters to the core site which provide the suitable living conditions for the haptophytes growth in the east of the mud area. In contrast, the decreased trend of alkenones in F11 around 4 ka BP revealed a weakened YSWC. During the late-Holocene (3-1 ka BP), the phytoplankton productivity showed increasing trend in three sediment cores. The inverse relationships of SST and brassicasterol/dinosterol between B3-1 and F11 indicated the migration of the cold center in this area during this time interval. The hydrology change resulted in a spatial difference in the mud area during the late Holocene.

  15. Interaction of HmC1q with leech microglial cells: involvement of C1qBP-related molecule in the induction of cell chemotaxis

    PubMed Central

    2012-01-01

    Background In invertebrates, the medicinal leech is considered to be an interesting and appropriate model to study neuroimmune mechanisms. Indeed, this non-vertebrate animal can restore normal function of its central nervous system (CNS) after injury. Microglia accumulation at the damage site has been shown to be required for axon sprouting and for efficient regeneration. We characterized HmC1q as a novel chemotactic factor for leech microglial cell recruitment. In mammals, a C1q-binding protein (C1qBP alias gC1qR), which interacts with the globular head of C1q, has been reported to participate in C1q-mediated chemotaxis of blood immune cells. In this study, we evaluated the chemotactic activities of a recombinant form of HmC1q and its interaction with a newly characterized leech C1qBP that acts as its potential ligand. Methods Recombinant HmC1q (rHmC1q) was produced in the yeast Pichia pastoris. Chemotaxis assays were performed to investigate rHmC1q-dependent microglia migration. The involvement of a C1qBP-related molecule in this chemotaxis mechanism was assessed by flow cytometry and with affinity purification experiments. The cellular localization of C1qBP mRNA and protein in leech was investigated using immunohistochemistry and in situ hybridization techniques. Results rHmC1q-stimulated microglia migrate in a dose-dependent manner. This rHmC1q-induced chemotaxis was reduced when cells were preincubated with either anti-HmC1q or anti-human C1qBP antibodies. A C1qBP-related molecule was characterized in leech microglia. Conclusions A previous study showed that recruitment of microglia is observed after HmC1q release at the cut end of axons. Here, we demonstrate that rHmC1q-dependent chemotaxis might be driven via a HmC1q-binding protein located on the microglial cell surface. Taken together, these results highlight the importance of the interaction between C1q and C1qBP in microglial activation leading to nerve repair in the medicinal leech. PMID:22356764

  16. Interaction of HmC1q with leech microglial cells: involvement of C1qBP-related molecule in the induction of cell chemotaxis.

    PubMed

    Tahtouh, Muriel; Garçon-Bocquet, Annelise; Croq, Françoise; Vizioli, Jacopo; Sautière, Pierre-Eric; Van Camp, Christelle; Salzet, Michel; Nagnan-le Meillour, Patricia; Pestel, Joël; Lefebvre, Christophe

    2012-02-22

    In invertebrates, the medicinal leech is considered to be an interesting and appropriate model to study neuroimmune mechanisms. Indeed, this non-vertebrate animal can restore normal function of its central nervous system (CNS) after injury. Microglia accumulation at the damage site has been shown to be required for axon sprouting and for efficient regeneration. We characterized HmC1q as a novel chemotactic factor for leech microglial cell recruitment. In mammals, a C1q-binding protein (C1qBP alias gC1qR), which interacts with the globular head of C1q, has been reported to participate in C1q-mediated chemotaxis of blood immune cells. In this study, we evaluated the chemotactic activities of a recombinant form of HmC1q and its interaction with a newly characterized leech C1qBP that acts as its potential ligand. Recombinant HmC1q (rHmC1q) was produced in the yeast Pichia pastoris. Chemotaxis assays were performed to investigate rHmC1q-dependent microglia migration. The involvement of a C1qBP-related molecule in this chemotaxis mechanism was assessed by flow cytometry and with affinity purification experiments. The cellular localization of C1qBP mRNA and protein in leech was investigated using immunohistochemistry and in situ hybridization techniques. rHmC1q-stimulated microglia migrate in a dose-dependent manner. This rHmC1q-induced chemotaxis was reduced when cells were preincubated with either anti-HmC1q or anti-human C1qBP antibodies. A C1qBP-related molecule was characterized in leech microglia. A previous study showed that recruitment of microglia is observed after HmC1q release at the cut end of axons. Here, we demonstrate that rHmC1q-dependent chemotaxis might be driven via a HmC1q-binding protein located on the microglial cell surface. Taken together, these results highlight the importance of the interaction between C1q and C1qBP in microglial activation leading to nerve repair in the medicinal leech.

  17. New insights on water level variability for Lake Turkana for the past 15 ka and at 150 ka from relict beaches

    NASA Astrophysics Data System (ADS)

    Forman, S. L.; Wright, D.

    2015-12-01

    Relict beaches adjacent to Lake Turkana provide a record of water level variability for the Late Quaternary. This study focused on deciphering the geomorphology, sedimentology, stratigraphy and 14C chronology of strand plain sequences in the Kalokol and Lothagam areas. Nine >30 m oscillations in water level were documented between ca. 15 and 4 ka. The earliest oscillation between ca. 14.5 and 13 ka is not well constrained with water level to at least 70 m above the present surface and subsequently fell to at least 50 m. Lake level increased to ~ 90 m between ca. 11.2 and 10.4 ka, post Younger Dryas cooling. Water level fell by >30 m by 10.2 ka, with another potential rise at ca. 8.5 ka to >70 m above current level. Lake level regressed by > 40 m at 8.2 ka coincident with cooling in the equatorial Eastern Atlantic Ocean. Two major >70 m lake level oscillations centered at 6.6 and 5.2 ka may reflect enhanced convection with warmer sea surface temperatures in the Western Indian Ocean. The end of the African Humid Period occurred from ca. 8.0 to 4.5 ka and was characterized by variable lake level (± > 40 m), rather than one monotonic fall in water level. This lake level variability reflects a complex response to variations in the extent and intensity of the East and West African Monsoons near geographic and topographic limits within the catchment of Lake Turkana. Also, for this closed lake basin excess and deficits in water input are amplified with a cascading lake effect in the East Rift Valley and through the Chew Bahir Basin. The final regression from a high stand of > 90 m began at. 5.2 ka and water level was below 20 m by 4.5 ka; and for the remainder of the Holocene. This sustained low stand is associated with weakening of the West African Monsoon, a shift of the mean position of Congo Air Boundary west of the Lake Turkana catchment and with meter-scale variability in lake level linked to Walker circulation across the Indian Ocean. A surprising observation is

  18. Groundwater flowpaths and residence times inferred by 14C, 36Cl and 4He isotopes in the Continental Intercalaire aquifer (North-Western Africa)

    NASA Astrophysics Data System (ADS)

    Petersen, J. O.; Deschamps, P.; Hamelin, B.; Fourré, E.; Gonçalvès, J.; Zouari, K.; Guendouz, A.; Michelot, J.-L.; Massault, M.; Dapoigny, A.; ASTER Team

    2018-05-01

    In a semi-arid to arid climate context, dependency on groundwater resources may lead to overexploitation and deterioration of water quality. The Continental Intercalaire (CI) aquifer is one such continental-scale aquifer (more than a million of km2), which is mainly confined, poorly recharged but intensely abstracted. To date, the management of this resource relies on hydrogeological modelling and key parameters such as recharge/discharge rate and groundwater dynamics. We use a combination of residence time indicators (14C, 36Cl, 4He) and stable isotopes of water (2H and 18O) to give greater constraint on the groundwater residence time in the CI. In previous studies, 14C measurements and steady state modelling indicate a residence time of less than 100 ka whereas in others, 36Cl measurements and transient scenarios modelling suggest a longer residence time (>500 ka). In this study, most of the 14C measurements are below the limit of detection, establishing residence times greater than 40 ka and confirming the necessity of strict sampling protocols to exclude all air and AMS measurements when low 14C concentrations are expected. In the Tunisian recharge area, detectable 14C indicate sporadic recharge episodes (3-7 ka and 29-43 ka), whereas 4He and 36Cl concentrations in central areas suggest very old (<2 Ma) groundwaters. In these central areas, chlorine concentration can reach more than 2 g/l. Since 36Cl concentrations are up to 4 time less than the initial input, we are confident there is no excessive deep 36Cl production. We characterise five distinct flowpaths reaching the Tunisian discharge area using their isotopic signatures. According to our mixing model, the average contribution from the main recharge area, the Algerian Atlas Mountains, is around 88%. This value is close to hydrogeological models. Conversely, the contribution from the Dahar Mountains is lower than in the hydrogeological modelling (2% against 10%) whereas the Tinhert shows a greater

  19. Source-to-sink sediment transfer in the Piave River system (North-Eastern Italy) since the Last Glacial Maximum

    NASA Astrophysics Data System (ADS)

    Carton, Alberto; Bondesan, Aldino; Fontana, Alessandro; Meneghel, Mirco; Miola, Antonella; Mozzi, Paolo; Primon, Sandra; Surian, Nicola

    2010-05-01

    Aim of this study is the definition of sediment production, transfer and deposition in the Piave River system from the Last Glacial Maximum to the Present, through a basin-scale approach. The Piave River flows from North to South in the eastern sector of the Italian Alps and reaches the Adriatic Sea. Its length is 220 km and the catchment is 3899 km2. The fluvial system consists of a mountainous portion, with maximum elevation of 3343 m a.s.l., and a lower part where the river flows in the Venetian alluvial plain. Average precipitation is 1350 mm/a; the runoff coefficient is 0.63 and the mean discharge at the mouth is 60 m3/s. The highest sediment delivery to the plain was at the peak of LGM, when the Piave glacier had its maximum expansion and reached the Alpine piedmont. In this period the Piave megafan received large volumes of sediments through glaciofluvial streams and achieved its maximum expansion. LGM alluvial sediments in the distal portion of the megafan are 20-30 m thick. The last glacial advance in the Vittorio Veneto terminal moraines, at the debouch of the valley in the Venetian Plain, dates 17.6 ka 14C BP. Deglaciation started immediately afterwards and the retreat of the glacial front was rather fast, considering that at around 15.0 ka 14C BP the Prealpine tract of valley was already ice-free. Following the onset of deglaciation until about 8.0 ka 14C BP, alluvial sediments were mostly trapped in the terminal valley tracts, while the whole alluvial plain experienced a severe erosive phase, comprising the whole Lateglacial and early Holocene. At ca. 8.0 ka 14C BP, the Piave River started to downcut its Prealpine valley fill, an event which re-mobilized the alluvial sediments and contributed to delta formation on the Adriatic coast since 6.0 ka 14C BP. Post-glacial aggradation in the distal tract of the Nervesa megafan started only at about 4.0 - 3.0 ka 14C BP. In Roman times the fluvial system was rather stable, while between the 5th and 10th century

  20. Impact of disease-causing mutations on inter-domain interactions in cMyBP-C: a steered molecular dynamics study.

    PubMed

    Krishnamoorthy, Navaneethakrishnan; Gajendrarao, Poornima; Olivotto, Iacopo; Yacoub, Magdi

    2017-07-01

    The molecular interactions of the sarcomeric proteins are essential in the regulation of various cardiac functions. Mutations in the gene MYBPC3 coding for cardiac myosin-binding protein-C (cMyBP-C), a multi-domain protein, are the most common cause of hypertrophic cardiomyopathy (HCM). The N-terminal complex, C1-motif-C2 is a central region in cMyBP-C for the regulation of cardiac muscle contraction. However, the mechanism of binding/unbinding of this complex during health and disease is unknown. Here, we study possible mechanisms of unbinding using steered molecular dynamics simulations for the complex in the wild type, in single mutations (E258K in C1, E441K in C2), as well as in a double mutation (E258K in C1 + E441K in C2), which are associated with severe HCM. The observed molecular events and the calculation of force utilized for the unbinding suggest the following: (i) double mutation can encourage the formation of rigid complex that required large amount of force and long-time to unbind, (ii) C1 appears to start to unbind ahead of C2 regardless of the mutation, and (iii) unbinding of C2 requires larger amount of force than C1. This molecular insight suggests that key HCM-causing mutations might significantly modify the native affinity required for the assembly of the domains in cMyBP-C, which is essential for normal cardiac function.

  1. The historical Coffin-Lowry syndrome family revisited: identification of two novel mutations of RPS6KA3 in three male patients.

    PubMed

    Nishimoto, Hiromi Koso; Ha, Kyungsoo; Jones, Julie R; Dwivedi, Alka; Cho, Hyun-Min; Layman, Lawrence C; Kim, Hyung-Goo

    2014-09-01

    Coffin-Lowry syndrome (CLS) is a rare X-linked dominant disorder characterized by intellectual disability, craniofacial abnormalities, short stature, tapering fingers, hypotonia, and skeletal malformations. CLS is caused by mutations in the Ribosomal Protein S6 Kinase, 90 kDa, Polypeptide 3 (RPS6KA3) gene located at Xp22.12, which encodes Ribosomal S6 Kinase 2 (RSK2). Here we analyzed RPS6KA3 in three unrelated CLS patients including one from the historical Coffin-Lowry syndrome family and found two novel mutations. To date, over 140 mutations in RPS6KA3 have been reported. However, the etiology of the very first familial case, which was described in 1971 by Lowry with detailed phenotype and coined the term CLS, has remained unknown. More than 40 years after the report, we succeeded in identifying deposited fibroblast cells from one patient of this historic family and found a novel heterozygous 216 bp in-frame deletion, encompassing exons 15 and 16 of RPS6KA3. Drop episodes in CLS patients were reported to be associated with truncating mutations deleting the C-terminal kinase domain (KD), and only one missense mutation and one single basepair duplication involving the C-terminal KD of RSK2 in the patients with drop episode have been reported thus far. Here we report the first in-frame deletion in C-terminal KD of RPS6KA3 in a CLS patient with drop episodes. © 2014 Wiley Periodicals, Inc.

  2. From source to sink: Unravelling the complex in situ cosmogenic 10Be-14C signature in eroding bedrock surfaces and river sediment from the Bolivian Altiplano

    NASA Astrophysics Data System (ADS)

    Hippe, Kristina; Lupker, Maarten; Gordijn, Tiemen; Ivy-Ochs, Susan; Kober, Florian; Christl, Marcus; Wacker, Lukas; Hajdas, Irka; Wieler, Rainer

    2017-04-01

    Sediment storage is a critical component of fluvial sedimentary systems. By interrupting transport processes, intermittent sediment storage can effectively decouple source from sink and buffer the transmission of signals of environmental change (e.g., in climate, vegetation, human impact) through the fluvial system. Combined in situ cosmogenic 14C-10Be analysis in fluvial sediment provides a unique method to simultaneously assess sediment transit times (in situ 14C signal) and long-term sediment production rates from bedrock erosion (10Be signal). The key is the much shorter half-life of in situ 14C compared to 10Be which causes a rapid decrease of the in situ 14C concentration when sediment is buried during sediment storage and creates an offset to 10Be. Here, we use the in situ 14C-10Be chronometer to determine changes in surface erosion and estimate absolute rates of sediment transfer in a catchment on the Bolivian Altiplano. Previous research in the study area has found a significant offset in the in situ 14C-10Be inventories from river sediments with much lower in situ 14C concentrations than expected from the 10Be content for steady-state conditions. This offset has been interpreted to reflect sediment storage over the past 11-20 ka [1]. Additional analyses of in situ 14C and 10Be in a dense network of sediment samples from the main channel and tributaries agree with previous data and yield very low in situ 14C concentrations that suggest an increase in storage duration by a few ka with downstream distance. However, analyses of in situ 14C-10Be in hilltop samples from the eroding source area reveal an almost as large offset as in the river sediments. Such complex in situ 14C-10Be inventories in the source area have a severe impact on the quantification of sediment storage times and strongly challenge previous data interpretation. The most straightforward explanation for the in situ 14C-10Be offset at hilltop locations is a change in denudation rate during the

  3. High-precision 14C and 40Ar/39Ar dating of the Campanian Ignimbrite (Y-5) reconciles the time-scales of climatic-cultural processes at 40 ka

    NASA Astrophysics Data System (ADS)

    Giacco, Biagio; Hajdas, Irka; Isaia, Roberto; Deino, Alan; Nomade, Sebastien

    2017-04-01

    The Campanian Ignimbrite (CI) super-eruption ( 40 ka, Southern Italy) is the largest known volcanic event of Mediterranean area. The CI tephra is widely dispersed through western Eurasia and occurs in close stratigraphic association with significant Late Pleistocene paleoclimatic and Paleolithic cultural events. This makes the CI tephra one of the most important tool for investigating several scientific issues ranging from volcanology, paleoclimatology to archaeology. Yet despite concerted attempts, the absolute age of the CI eruption is not well constrained. Here we present the first direct radiocarbon age for the CI obtained using accepted modern practices, from multiple 14C analyses of an exceptional large charred tree branch embedded in the lithified Yellow Tuff facies of the CI pyroclastic flow deposits, as well as new high-precision 40Ar/39Ar dating for the CI. These data substantially improve upon previous age determinations and permit fuller exploitation of the chronological potential of the CI tephra marker. Specifically, the results of our study are twofold: they provide (i) a robust pair of 14C and 40Ar/39Ar ages for refining both the radiocarbon calibration curve and the Late Pleistocene time-scale in the narrow, but significant time-span across CI event and (ii) compelling chronological evidence for the significance of the combined influence of the CI eruption and Heinrich Event 4 on European climate and potentially evolutionary processes of the Early Upper Palaeolithic.

  4. Concentrating Solar Power Projects - KaXu Solar One | Concentrating Solar

    Science.gov Websites

    Power | NREL KaXu Solar One This page provides information on KaXu Solar One, a concentrating . Status Date: April 14, 2015 Project Overview Project Name: KaXu Solar One Country: South Africa Location

  5. Wetlands sediment record from the upper Yarlung Tsangpo valley, southwest Tibetan Plateau, reveals mid-Holocene Epipaleolithic human occupation coincident with increased early and mid-Holocene wetness driven by enhanced Indian Monsoon rainfall

    NASA Astrophysics Data System (ADS)

    Hudson, A. M.; Olsen, J. W.; Quade, J.; Lei, G.; Huth, T.; Zhang, H.; Perreault, C.

    2016-12-01

    The headwaters of the Yarlung Tsangpo river valley, located in the southwestern Tibetan Plateau, are characterized by a cold and dry climate, but contain abundant river-marginal wetlands environments, which fluctuate in extent in response to changes in local water table elevation. This region receives 80% of precipitation from the Indian Monsoon, which forms the dominant control on moisture availability, and hence wetlands extent. Our paleowetlands record, based on 14C dating of organic-rich paleowetlands deposits, provides a novel record of Holocene monsoon intensity. The wetlands deposits consist of four sedimentary units that indicate decreasing wetlands extent and monsoon intensity since 10.4 ka BP. Wet conditions occurred at ˜10.4 ka BP, ˜9.6 ka BP and ˜7.9-4.8 ka BP, with similar-to-modern conditions from ˜4.6-2.0 ka BP, and drier-than-modern conditions from ˜2.0 ka BP to present. Wetland changes correlate with monsoon intensity changes identified in nearby records, with weak monsoon intervals corresponding to desiccation and erosion of wetlands deposits. Dating of in situ ceramic and microlithic artifacts in wetlands sediments at multiple sites indicates Epipaleolithic human occupation of the YT valley after 6.6 ka BP. Artifact typology study reveals a similar microlithic technology was employed across the high plateau interior, but XRF obsidian provenance reveals separate northeast and southwest lithic conveyance zones. This indicates widespread colonization of the high, arid Tibetan Plateau interior by one or more highly mobile human populations during the early and mid-Holocene, coincident with favorable warm, wet climate conditions.

  6. Fluvial landscapes evolution in the Gangkou River basin of southern Taiwan: Evidence from the sediment cores

    NASA Astrophysics Data System (ADS)

    Chen, Jia-Hong; Chyi, Shyh-Jeng; Yen, Jiun-Yee; Lin, Li-Hung; Yen, I.-Chin; Yu, Neng-Ti; Ho, Lih-Der; Jen, Chia-Hung

    2017-04-01

    The Gangkou River basin is the largest basin in the eastern Hengchun Peninsula of Taiwan. Its main river length is 31km and the basin area is 102sq. km. The width of the active channel is relatively narrow, but the valley from the middle to downstream is remarkably wide, indicating a feature of underfit stream. We drilled two sediment cores in the downstream area, including a 30m core (core-A) from a higher terrace, which is 14m above mean sea level, and a 20m core (core-B) from a lower terrace, which is 4m above mean sea level. Most of the sediments in the core-A are mud, which represents the flood plain facies, and 14C dates in the core-A range from 11ka to 7ka BP. Furthermore, the sediment layers reveal signals of marine events at the core depths of 5m to 11m by X-ray fluorescence. In the core-B, there is an erosional surface at the core depth of 5m. The age of the fluvial gravel layer above the erosional surface is about 0.4ka BP, and the mud layer top the surface is about 8.5ka BP. The preliminary results show that (1) as the tectonic uplift rate induced by the marine terraces around the basin is 1.0 to 2.5 mm/yr, and the accumulation rate of the mud layer in the basin is 6.7 to 8.7 mm/yr, the sediments infilling (more than 30-meters-thick) in the downstream area of the basin should be the results of the lower tectonic uplifting and the higher post-glacial sea level rise and; (2) the marine sediment layer with 14C dates of 7.5ka to 8.5ka BP is very likely the remain of the maximum flooding surface (MFS) in the early Holocene. These results indicate that the fluvial landscapes evolution of the basin was controlled by the sea-level; (3) the erosional surface in the core-B indicates the Gangkou River continuously erode the infilling sediments from 7ka to 0.4ka BP. Previous studies show that the sea-level around Taiwan gradually declined from its high stand since 6ka, we proposed that the continuous erosion was probably the results of tectonic uplifting and

  7. Blood pressure (BP) assessment-from BP level to BP variability.

    PubMed

    Feber, Janusz; Litwin, Mieczyslaw

    2016-07-01

    The assessment of blood pressure (BP) can be challenging in children, especially in very young individuals, due to their variable body size and lack of cooperation. In the absence of data relating BP with cardiovascular outcomes in children, there is a need to convert absolute BP values (in mmHg) into age-, gender- and height appropriate BP percentiles or Z-scores in order to compare a patient's BP with the BP of healthy children of the same age, but also of children of different ages. Traditionally, the interpretation of BP has been based mainly on the assessment of the BP level obtained by office, home or 24-h BP monitoring. Recent studies suggest that it is not only BP level (i.e. average BP) but also BP variability that is clinically important for the development of target organ damage, including the progression of chronic kidney disease. In this review we describe current methods to evaluate of BP level, outline available methods for BP variability assessment and discuss the clinical consequences of BP variability, including its potential role in the management of hypertension.

  8. High-Resolution Speleothem Records of the Indian Ocean Monsoon Variability of the Last 6 ka and 0,5 ka From Soqotra Island, Yemen

    NASA Astrophysics Data System (ADS)

    de Geest, P.; Verheyden, S.; Cheng, H.; Edwards, L. R.; Keppens, E.

    2004-12-01

    Soqotra is an arid tropical island in the Indian Ocean, situated between the Horn of Africa and the Arabian Peninsula. The inter-tropical convergence zone (ITCZ) passes there twice each year, resulting in a bi-annual rainy season. High-resolution \\delta18O and \\delta13C ratios of speleothems from two different caves are used to reconstruct changes in the Monsoon intensity and/or variability. Based on 10 TIMS 234U/230Th dating, two active speleothems from Hoq (S-STM1) and Kazekas Caves (S-STM5) have formed over a period of 6 ka BP and 0,5 ka BP, respectively. To obtain a detailed climate reconstruction more than 1000 \\delta13C and \\delta18O measurements were carried out, providing a time resolution between 2,5 and 10 years. In S-STM1 \\delta18O -values range between -4,5\\permil and -1,5\\permil and \\delta13C -values between -10,5\\permil and -5,5\\permil; while for S-STM5 these values range respectively between -4\\permil and -2\\permil and -7\\permil and -3\\permil (vs VPDB). Based on the comparison between \\delta18O excursions and historical meteorological data, the amount of precipitation is reflected in the \\delta18O signal. Different mechanisms for the \\delta13C are considered, such as a diminution of the C4-type vegetation during droughts, resulting in more positive \\delta13C -value or kinetic effects during the calcification process itself. Throughout the time series, co-variation occur between \\delta13C and \\delta18O -values (R2= 0,69) exhibiting long term (millennial) and short term (decadal) variations. In both stalagmites, layers of white porous calcite (WPC) (0,1-0,5mm) and dark dense calcite (DDC) (0,01-0,1mm) alternate, most probably due to seasonal variations. The WPC has more positive \\delta13C and \\delta18O -values, while the DDC shows more negative values, clearly demonstrated by high-resolution micro sampling up to a monthly to bi-weekly resolution. A positive correlation between the greyscale variations in the calcite fabric, the

  9. HLA-G 14-bp Ins/Ins Genotype in Patients Harbouring Helicobacter pylori Infection: A Potential Risk Factor?

    PubMed

    Genre, J; Reginaldo, F P Santos; Andrade, J Marco de Leon; Lima, F P; da Camara, A V Coutinho; Donadi, E A; Crispim, J C

    2016-01-01

    H. pylori is a potent pathogen due to its capacity to successfully evade host defence mechanisms. Despite inducing immune responses in infected individuals, sometimes these responses fail to clear the infection and the bacterium establishes a persistent infection leading to chronic inflammation. In this context, we hypothesized that human leucocyte antigen G (HLA-G), a non-classical major histocompatibility complex molecule that has the ability to regulate immune responses both in physiological and in pathological conditions, may play an important role in promoting tolerance and helping H. pylori to subvert host defence and consequently establish a chronic infection. Therefore, we evaluated the expression of HLA-G 14-bp Ins/Del polymorphism in patients harbouring H. pylori infection, as well as their relationship with histological and demographic variables, to gain a better understanding of the actual role of HLA-G and its genetic polymorphisms in bacterial infection. Sixty-eight patients with clinical symptoms suggestive of H. pylori infection were enrolled to assess HLA-G 14-bp Ins/Del polymorphism allele and genotype frequencies. After adjustment for covariates (age and gender), the odds of having the genotype Ins/Ins, compared to Del/Del, were 3.77 times greater among HP+ cases than among controls. These findings suggest that the 14-bp Ins/Ins genotype, already associated with inflammatory and autoimmune diseases as well as some viral and parasitic infections, could confer a greater risk of developing H. pylori infection. © 2015 The Foundation for the Scandinavian Journal of Immunology.

  10. Ka-band study: 1988

    NASA Technical Reports Server (NTRS)

    Layland, J. W.; Horttor, R. L.; Clauss, R. C.; Wilcher, J. H.; Wallace, R. J.; Mudgway, D. J.

    1989-01-01

    The Ka-band study team was chartered in late 1987 to bring together all the planning elements for establishing 32 GHz (Ka-band) as the primary downlink frequency for deep-space operation, and to provide a stable baseline from which to pursue that development. This article summarizes the results of that study at its conclusion in mid-1988, and corresponds to material presented to NASA's Office of Space Operations on July 14, 1988. For a variety of reasons, Ka-band is the right next major step in deep-space communications. It offers improved radio metric accuracy through reduced plasma sensitivity and increased bandwidth. Because of these improvements, it offers the opportunity to reduce costs in the flight radio system or in the DSN by allocating part of the overall benefits of Ka-band to this cost reduction. A mission scenario is being planned that can drive at least two and possibly all three of the DSN subnets to provide a Ka-band downlink capability by the turn of the century. The implementation scenario devised by the study team is believed to be feasible within reasonable resource expectations, and capable of providing the needed upgrade as a natural follow-on to the technology development which is already underway.

  11. Sea level and global ice volumes from the Last Glacial Maximum to the Holocene.

    PubMed

    Lambeck, Kurt; Rouby, Hélène; Purcell, Anthony; Sun, Yiying; Sambridge, Malcolm

    2014-10-28

    The major cause of sea-level change during ice ages is the exchange of water between ice and ocean and the planet's dynamic response to the changing surface load. Inversion of ∼1,000 observations for the past 35,000 y from localities far from former ice margins has provided new constraints on the fluctuation of ice volume in this interval. Key results are: (i) a rapid final fall in global sea level of ∼40 m in <2,000 y at the onset of the glacial maximum ∼30,000 y before present (30 ka BP); (ii) a slow fall to -134 m from 29 to 21 ka BP with a maximum grounded ice volume of ∼52 × 10(6) km(3) greater than today; (iii) after an initial short duration rapid rise and a short interval of near-constant sea level, the main phase of deglaciation occurred from ∼16.5 ka BP to ∼8.2 ka BP at an average rate of rise of 12 m⋅ka(-1) punctuated by periods of greater, particularly at 14.5-14.0 ka BP at ≥40 mm⋅y(-1) (MWP-1A), and lesser, from 12.5 to 11.5 ka BP (Younger Dryas), rates; (iv) no evidence for a global MWP-1B event at ∼11.3 ka BP; and (v) a progressive decrease in the rate of rise from 8.2 ka to ∼2.5 ka BP, after which ocean volumes remained nearly constant until the renewed sea-level rise at 100-150 y ago, with no evidence of oscillations exceeding ∼15-20 cm in time intervals ≥200 y from 6 to 0.15 ka BP.

  12. Cherubism Mice Also Deficient in c-Fos Exhibit Inflammatory Bone Destruction Executed by Macrophages That Express MMP14 Despite the Absence of TRAP+ Osteoclasts.

    PubMed

    Kittaka, Mizuho; Mayahara, Kotoe; Mukai, Tomoyuki; Yoshimoto, Tetsuya; Yoshitaka, Teruhito; Gorski, Jeffrey P; Ueki, Yasuyoshi

    2018-01-01

    Currently, it is believed that osteoclasts positive for tartrate-resistant acid phosphatase (TRAP+) are the exclusive bone-resorbing cells responsible for focal bone destruction in inflammatory arthritis. Recently, a mouse model of cherubism (Sh3bp2 KI/KI ) with a homozygous gain-of-function mutation in the SH3-domain binding protein 2 (SH3BP2) was shown to develop auto-inflammatory joint destruction. Here, we demonstrate that Sh3bp2 KI/KI mice also deficient in the FBJ osteosarcoma oncogene (c-Fos) still exhibit noticeable bone erosion at the distal tibia even in the absence of osteoclasts at 12 weeks old. Levels of serum collagen I C-terminal telopeptide (ICTP), a marker of bone resorption generated by matrix metalloproteinases (MMPs), were elevated, whereas levels of serum cross-linked C-telopeptide (CTX), another resorption marker produced by cathepsin K, were not increased. Collagenolytic MMP levels were increased in the inflamed joints of the Sh3bp2 KI/KI mice deficient in c-Fos. Resorption pits contained a large number of F4/80+ macrophages and genetic depletion of macrophages rescued these erosive changes. Importantly, administration of NSC405020, an MMP14 inhibitor targeted to the hemopexin (PEX) domain, suppressed bone erosion in c-Fos-deficient Sh3bp2 KI/KI mice. After activation of the NF-κB pathway, macrophage colony-stimulating factor (M-CSF)-dependent macrophages from c-Fos-deficient Sh3bp2 KI/KI mice expressed increased amounts of MMP14 compared with wild-type macrophages. Interestingly, receptor activator of NF-κB ligand (RANKL)-deficient Sh3bp2 KI/KI mice failed to show notable bone erosion, whereas c-Fos deletion did restore bone erosion to the RANKL-deficient Sh3bp2 KI/KI mice, suggesting that osteolytic transformation of macrophages requires both loss-of-function of c-Fos and gain-of-function of SH3BP2 in this model. These data provide the first genetic evidence that cells other than osteoclasts can cause focal bone destruction in

  13. Lake System Development on the northern Tibetan Plateau during the last 12 ka

    NASA Astrophysics Data System (ADS)

    Ramisch, A. C.; Lockot, G.; Kasper, T.; Schulte, P.; Zhang, Y.; Daut, G.; Haberzettl, T.; Stauch, G.; Hartmann, K.; Zhu, L.; Lehmkuhl, F.; Maeusbacher, R.; Wuennemann, B.; Diekmann, B.

    2013-12-01

    Donggi Cona (northern Tibetan Plateau) and Lake Nam Co (southern Tibetan Plateau). Major differences occur during two broad Holocene episodes: Until ~6 ka cal BP the differences reach their maximum with a peak around 9.5 cal ka BP. An intensification of the Indian Summer Monsoon (ISM) led to wetter conditions and an increased minerogenic input into Lake Nam Co. Subsequently, the aridification on the TP led to decreased minerogenic input in all three lakes especially since ~2 ka cal BP. Short term divergences from this trend are caused by dry spells on the northern TP. Their timing is quasi synchronous to Holocene Bond events, suggesting a teleconnection of northern TP climate to the circulation of the North Atlantic Ocean.

  14. Vegetation and Climate Change during the Last Deglaciation in the Great Khingan Mountain, Northeastern China

    PubMed Central

    Wu, Jing; Liu, Qiang; Wang, Luo; Chu, Guo-qiang; Liu, Jia-qi

    2016-01-01

    The Great Khingan Mountain range, Northeast China, is located on the northern limit of modern East Asian Summer Monsoon (EASM) and thus highly sensitive to the extension of the EASM from glacial to interglacial modes. Here, we present a high-resolution pollen record covering the last glacial maximum and the early Holocene from a closed crater Lake Moon to reconstruct vegetation history during the glacial-interglacial transition and thus register the evolution of the EASM during the last deglaciation. The vegetation history has gone through distinct changes from subalpine meadow in the last glacial maximum to dry steppe dominated by Artemisia from 20.3 to 17.4 ka BP, subalpine meadow dominated by Cyperaceae and Artemisia between 17.4 and 14.4 ka BP, and forest steppe dominated by Betula and Artemisia after 14.4 ka BP. The pollen-based temperature index demonstrates a gradual warming trend started at around 20.3 ka BP with interruptions of several brief events. Two cold conditions occurred around at 17.2–16.6 ka BP and 12.8–11.8 ka BP, temporally correlating to the Henrich 1 and the Younger Dryas events respectively, 1and abrupt warming events occurred around at 14.4 ka BP and 11.8 ka BP, probably relevant to the beginning of the Bølling-Allerød stages and the Holocene. The pollen-based moisture proxy shows distinct drought condition during the last glacial maximum (20.3–18.0 ka BP) and the Younger Dryas. The climate history based on pollen record of Lake Moon suggests that the regional temperature variability was coherent with the classical climate in the North Atlantic, implying the dominance of the high latitude processes on the EASM evolution from the Last Glacial Maximum (LGM) to early Holocene. The local humidity variability was influenced by the EASM limitedly before the Bølling-Allerød warming, which is mainly controlled by the summer rainfall due to the EASM front covering the Northeast China after that. PMID:26730966

  15. Vegetation and Climate Change during the Last Deglaciation in the Great Khingan Mountain, Northeastern China.

    PubMed

    Wu, Jing; Liu, Qiang; Wang, Luo; Chu, Guo-qiang; Liu, Jia-qi

    2016-01-01

    The Great Khingan Mountain range, Northeast China, is located on the northern limit of modern East Asian Summer Monsoon (EASM) and thus highly sensitive to the extension of the EASM from glacial to interglacial modes. Here, we present a high-resolution pollen record covering the last glacial maximum and the early Holocene from a closed crater Lake Moon to reconstruct vegetation history during the glacial-interglacial transition and thus register the evolution of the EASM during the last deglaciation. The vegetation history has gone through distinct changes from subalpine meadow in the last glacial maximum to dry steppe dominated by Artemisia from 20.3 to 17.4 ka BP, subalpine meadow dominated by Cyperaceae and Artemisia between 17.4 and 14.4 ka BP, and forest steppe dominated by Betula and Artemisia after 14.4 ka BP. The pollen-based temperature index demonstrates a gradual warming trend started at around 20.3 ka BP with interruptions of several brief events. Two cold conditions occurred around at 17.2-16.6 ka BP and 12.8-11.8 ka BP, temporally correlating to the Henrich 1 and the Younger Dryas events respectively, 1and abrupt warming events occurred around at 14.4 ka BP and 11.8 ka BP, probably relevant to the beginning of the Bølling-Allerød stages and the Holocene. The pollen-based moisture proxy shows distinct drought condition during the last glacial maximum (20.3-18.0 ka BP) and the Younger Dryas. The climate history based on pollen record of Lake Moon suggests that the regional temperature variability was coherent with the classical climate in the North Atlantic, implying the dominance of the high latitude processes on the EASM evolution from the Last Glacial Maximum (LGM) to early Holocene. The local humidity variability was influenced by the EASM limitedly before the Bølling-Allerød warming, which is mainly controlled by the summer rainfall due to the EASM front covering the Northeast China after that.

  16. Sea level and global ice volumes from the Last Glacial Maximum to the Holocene

    PubMed Central

    Lambeck, Kurt; Rouby, Hélène; Purcell, Anthony; Sun, Yiying; Sambridge, Malcolm

    2014-01-01

    The major cause of sea-level change during ice ages is the exchange of water between ice and ocean and the planet’s dynamic response to the changing surface load. Inversion of ∼1,000 observations for the past 35,000 y from localities far from former ice margins has provided new constraints on the fluctuation of ice volume in this interval. Key results are: (i) a rapid final fall in global sea level of ∼40 m in <2,000 y at the onset of the glacial maximum ∼30,000 y before present (30 ka BP); (ii) a slow fall to −134 m from 29 to 21 ka BP with a maximum grounded ice volume of ∼52 × 106 km3 greater than today; (iii) after an initial short duration rapid rise and a short interval of near-constant sea level, the main phase of deglaciation occurred from ∼16.5 ka BP to ∼8.2 ka BP at an average rate of rise of 12 m⋅ka−1 punctuated by periods of greater, particularly at 14.5–14.0 ka BP at ≥40 mm⋅y−1 (MWP-1A), and lesser, from 12.5 to 11.5 ka BP (Younger Dryas), rates; (iv) no evidence for a global MWP-1B event at ∼11.3 ka BP; and (v) a progressive decrease in the rate of rise from 8.2 ka to ∼2.5 ka BP, after which ocean volumes remained nearly constant until the renewed sea-level rise at 100–150 y ago, with no evidence of oscillations exceeding ∼15–20 cm in time intervals ≥200 y from 6 to 0.15 ka BP. PMID:25313072

  17. UV/vis, 1H, and 13C NMR spectroscopic studies to determine mangiferin p Ka values

    NASA Astrophysics Data System (ADS)

    Gómez-Zaleta, Berenice; Ramírez-Silva, María Teresa; Gutiérrez, Atilano; González-Vergara, Enrique; Güizado-Rodríguez, Marisol; Rojas-Hernández, Alberto

    2006-07-01

    The acid constants of mangiferin (a natural xanthonoid) in aqueous solution were determined through an UV/vis spectroscopic study employing the SQUAD program as a computational tool. A NMR study complements the p Ka values assignment and evidences a H-bridge presence on 1-C. The chemical model used was consistent with the experimental data obtained. The p Ka values determined with this procedure were as follows: H 4(MGF) = H 3(MGF) - + H +, pK(6-H) = 6.52 ± 0.06; H 3(MGF) - = H 2(MGF) 2- + H +, pK(3-H) = 7.97 ± 0.06; H 2(MGF) 2- = H(MGF) 3- + H +, pK(7-H) = 9.44 ± 0.04; H(MGF) 3- = (MGF) 4- + H +, pK(1-H) = 12.10 ± 0.01; where it has been considered mangiferin C 19H 18O 11 as H 4(MGF). Mangiferin UV/vis spectral behavior, stability study in aqueous solution as well as NMR spectroscopy studies: one-dimensional 1H, 13C, 2D correlated 1H/ 13C performed by (g)-HSQC and (g)-HMBC methods; are also presented. p Ka values determination of H 4(MGF) in aqueous solution is a necessary contribution to subsequent pharmacokinetic study, and a step towards the understanding of its biological effects.

  18. Comparison of the gravimetric, phenol red, and 14C-PEG-3350 methods to determine water absorption in the rat single-pass intestinal perfusion model.

    PubMed

    Sutton, S C; Rinaldi, M T; Vukovinsky, K E

    2001-01-01

    This study was undertaken to determine whether the gravimetric method provided an accurate measure of water flux correction and to compare the gravimetric method with methods that employ nonabsorbed markers (eg, phenol red and 14C-PEG-3350). Phenol red,14C-PEG-3350, and 4-[2-[[2-(6-amino-3-pyridinyl)-2-hydroxyethyl]amino]ethoxy]-, methyl ester, (R)-benzene acetic acid (Compound I) were co-perfused in situ through the jejunum of 9 anesthetized rats (single-pass intestinal perfusion [SPIP]). Water absorption was determined from the phenol red,14C-PEG-3350, and gravimetric methods. The absorption rate constant (ka) for Compound I was calculated. Both phenol red and 14C-PEG-3350 were appreciably absorbed, underestimating the extent of water flux in the SPIP model. The average +/- SD water flux microg/h/cm) for the 3 methods were 68.9 +/- 28.2 (gravimetric), 26.8 +/- 49.2 (phenol red), and 34.9 +/- 21.9 (14C-PEG-3350). The (average +/- SD) ka for Compound I (uncorrected for water flux) was 0.024 +/- 0.005 min(-1). For the corrected, gravimetric method, the average +/- SD was 0.031 +/- 0.001 min(-1). The gravimetric method for correcting water flux was as accurate as the 2 "nonabsorbed" marker methods.

  19. Calibration of the C-14 timescale over the past 30,000 years using mass spectrometric U-Th ages from Barbados corals

    NASA Technical Reports Server (NTRS)

    Bard, Edouard; Hamelin, Bruno; Fairbanks, Richard G.; Zindler, Alan

    1990-01-01

    Uranium-thorium ages obtained by mass spectrometry from corals raised off the island of Barbados confirm the high precision of this technique over at least the past 30,000 years. Comparison of the U-Th ages with C-14 ages obtained on the Holocene samples shows that the U-Th ages are accurate, because they accord with the dendrochronological calibration. Before 9,000 yr BP, the C-14 ages are systematically younger than the U-Th ages, with a maximum difference of about 3500 yr at about 20,000 yr BP. The U-Th technique thus provides a way of calibrating the radiocarbon timescale beyond the range of dendrochronological calibration.

  20. Vegetation and Water Level Changes for the Northeast U.S. During the "8.2 ka Event"

    NASA Astrophysics Data System (ADS)

    Newby, P. E.; Donnelly, J. P.; Shuman, B.; MacDonald, D.

    2006-12-01

    Cool conditions, known as the "8.2 ka event", occurred between 8400 and 7900 cal yr B.P. in Greenland, Europe and elsewhere in the North Atlantic. The impact of this brief cool interval on local forests is recorded in radiocarbon-dated, high-resolution pollen stratigraphies for New Long Pond (41^{0}50'N, 70^{0}42'W) and Davis Pond (42^{0}30'N, 73^{0}19'W), Massachusetts. The vegetation response to the event is recorded differently for regions with contrasting soil types. At New Long Pond, the sandy outwash derived soils are associated with changes in jack/red, white and pitch pine populations, whereas the dominant changes in vegetation for the clay-rich, proglacial lake derived soils around Davis Pond are among oak, hemlock, and beech. At both sites, pollen evidence for the "8.2 ka event" may be easily overlooked within the more dominant regional pattern for the Northeast, which shows a shift from dry to moist conditions in conjunction with changes from predominantly white pine to oak with more mesic plant taxa between 9000 and 8000 cal yr B.P. At New Long Pond, the "8.2 ka event" is brief, preceded by a low-stand in water-level during the early Holocene and dominated by white pine pollen. After 9000 cal yr B.P., pitch pine with beech, maple, hop/hornbeam, elm and ash pollen indicate a mixed mesophytic forest. A radiocarbon-dated decrease in loss-on-ignition values at 8400 cal yr B.P., likely related to a drawdown in lake level, distinguishes the "8.2 event" and helps highlight subtle shifts in vegetation that favor colder and drier conditions than before the event. Following this brief episode, the pollen data indicate a return to warm and moist conditions until about 5600 years ago. At Davis Pond, increased oak and decreased hemlock pollen abundances, followed by an increase in beech pollen abundance is evident and show what may be the dominant regional pollen signature for the "8.2 ka event" in the Northest. This pattern is also recorded at nearby Berry and

  1. Explosive eruptive record in the Katmai region, Alaska Peninsula: an overview

    USGS Publications Warehouse

    Fierstein, Judy

    2007-01-01

    At least 15 explosive eruptions from the Katmai cluster of volcanoes and another nine from other volcanoes on the Alaska Peninsula are preserved as tephra layers in syn- and post-glacial (Last Glacial Maximum) loess and soil sections in Katmai National Park, AK. About 400 tephra samples from 150 measured sections have been collected between Kaguyak volcano and Mount Martin and from Shelikof Strait to Bristol Bay (∼8,500 km2 ). Five tephra layers are distinctive and widespread enough to be used as marker horizons in the Valley of Ten Thousand Smokes area, and 140 radiocarbon dates on enclosing soils have established a time framework for entire soil–tephra sections to 10 ka; the white rhyolitic ash from the 1912 plinian eruption of Novarupta caps almost all sections. Stratigraphy, distribution and tephra characteristics have been combined with microprobe analyses of glass and Fe– Ti oxide minerals to correlate ash layers with their source vents. Microprobe analyses (typically 20–50 analyses per glass or oxide sample) commonly show oxide compositions to be more definitive than glass in distinguishing one tephra from another; oxides from the Kaguyak caldera-forming event are so compositionally coherent that they have been used as internal standards throughout this study. Other than the Novarupta and Trident eruptions of the last century, the youngest locally derived tephra is associated with emplacement of the Snowy Mountain summit dome (<250 14C years B.P.). East Mageik has erupted most frequently during Holocene time with seven explosive events (9,400 to 2,400 14C years B.P.) preserved as tephra layers. Mount Martin erupted entirely during the Holocene, with lava coulees (>6 ka), two tephras (∼3,700 and ∼2,700 14C years B.P.), and a summit scoria cone with a crater still steaming today. Mount Katmai has three times produced very large explosive plinian to sub-plinian events (in 1912; 12– 16 ka; and 23 ka) and many smaller pyroclastic deposits show that

  2. The Mars Global Surveyor Ka-Band Link Experiment (MGS/KaBLE-II)

    NASA Astrophysics Data System (ADS)

    Morabito, D.; Butman, S.; Shambayati, S.

    1999-01-01

    The Mars Global Surveyor (MGS) spacecraft, launched on November 7, 1996, carries an experimental space-to-ground telecommunications link at Ka-band (32 GHz) along with the primary X-band (8.4-GHz) downlink. The signals are simultaneously transmitted from a 1.5-m-diameter parabolic antenna on MGS and received by a beam-waveguide (BWG) research and development (R&D) 34-meter a ntenna located in NASA's Goldstone Deep Space Network (DSN) complex near Barstow, California. This Ka-band link experiment (KaBLE-II) allows the performances of the Ka-band and X-band signals to be compared under nearly identical conditions. The two signals have been regularly tracked during the past 2 years. This article presents carrier-signal-level data (P_c/N_o) for both X-band and Ka-band acquired over a wide range of station elevation angles, weather conditions, and solar elongation angles. The cruise phase of the mission covered the period from launch (November 7, 1996) to Mars orbit capture (September 12, 1997). Since September 12, 1997, MGS has been in orbit around Mars. The measurements confirm that Ka-band could increase data capacity by at least a factor of three (5 dB) as compared with X-band. During May 1998, the solar corona experiment, in which the effects of solar plasma on the X-band and Ka-band links were studied, was conducted. In addition, frequency and difference frequency (f_x - f_(Ka)/3.8), ranging, and telemetry data results are presented. MGS/KaBLE-II measured signal strengths (for 54 percent of the experiments conducted) that were in reasonable agreement with predicted values based on preflight knowledge, and frequency residuals that agreed between bands and whose statistics were consistent with expected noise sources. For passes in which measured signal strengths disagreed with predicted values, the problems were traced to known deficiencies, for example, equipment operating under certain conditions, such as a cold Ka-band solid-state power amplifier (SSPA

  3. Origin of pockmarks and chimney structures on the flanks of the Storegga Slide, offshore Norway

    USGS Publications Warehouse

    Paull, C.K.; Ussler, W.; Holbrook, W.S.; Hill, T.M.; Keaten, R.; Mienert, J.; Haflidason, H.; Johnson, J.E.; Winters, W.J.; Lorenson, T.D.

    2008-01-01

    Seafloor pockmarks and subsurface chimney structures are common on the Norwegian continental margin north of the Storegga Slide scar. Such features are generally inferred to be associated with fluid expulsion, and imply overpressures in the subsurface. Six long gravity and piston cores taken from the interior of three pockmarks were compared with four other cores taken from the same area but outside the pockmarks, in order to elucidate the origins and stratigraphy of these features and their possible association with the Storegga Slide event. Sulfate gradients in cores from within pockmarks are less steep than those in cores from outside the pockmarks, which indicates that the flux of methane to the seafloor is presently smaller within the pockmarks than in the adjacent undisturbed sediments. This suggests that these subsurface chimneys are not fluid flow conduits lined with gas hydrate. Methane-derived authigenic carbonates and Bathymodiolus shells obtained from a pockmark at >6.3 m below the seafloor indicate that methane was previously available to support a chemosynthetic community within the pockmark. AMS 14C measurements of planktonic Foraminifera overlying and interlayered with the shell-bearing sediment indicate that methane was present on the seafloor within the pockmark prior to 14 ka 14C years B.P., i.e., well before the last major Storegga Slide event (7.2 ka 14C years B.P., or 8.2 ka calendar years B.P.). These observations provide evidence that overpressured fluids existed within the continental margin sediments off Norway during the last major advance of Pleistocene glaciation. 

  4. Pollen-based reconstruction of vegetational and climatic change over the past ~30 ka at Shudu Lake in the Hengduan Mountains of Yunnan, southwestern China.

    PubMed

    Yao, Yi-Feng; Song, Xiao-Yan; Wortley, Alexandra H; Wang, Yu-Fei; Blackmore, Stephen; Li, Cheng-Sen

    2017-01-01

    The Hengduan Mountains, with a distinct altitudinal differentiation and strong vertical vegetation zonation, occupy an important position in southwestern China as a global hotspot of biodiversity. Pollen analysis of lake sediments sampled along an altitudinal gradient in this region helps us to understand how this vegetation zonation arose and how it has responded to climate change and human impacts through time. Here we present a ~30-ka pollen record and interpret it in terms of vegetational and climatic change from a 310 cm-long core from Shudu Lake, located in the Hengduan Mountains region. Our results suggest that from 30 to 22 cal. ka BP, the vegetation was dominated by steppe/grassland (comprising mainly Artemisia, Poaceae and Polygonaceae) and broad-leaved forest (primarily Quercus, Betula and Castanopsis) in the lake catchment, reflecting a relatively warm, wet climate early in this phase and slightly warmer, drier conditions late in the phase. The period between 22 and 13.9 cal. ka BP was marked by a large expansion of needle- and broad-leaved mixed forest (Pinus, Abies and Quercus) and a decline in the extent of steppe/grassland, indicating warming, drying climatic conditions followed by a cold, wet period. Between 13.9 and 3 cal. ka BP, steppe/grassland expanded and the area covered by needle- and broad-leaved mixed forest reduced, implying a fluctuating climate dominated by warm and humid conditions. After 3 cal. ka BP, the vegetation was characterized by an increase in needle-leaved forest and reduction in steppe/grassland, suggesting warming and drying climate. A synthesis of palynological investigations from this and other sites suggests that the vegetation succession patterns seen along an altitudinal gradient in northwestern Yunnan since the Late Pleistocene are comparable, but that each site has its own characteristics probably due to the influences of altitude, topography, microclimate and human impact.

  5. A 2000-yr High-resolution Stalagmite Record From Zhenzhu Cave in Hebei, North China: Interpretations of AMS 14C, 230Th/U, 210Pb Dating, and δ18O, δ13C Results

    NASA Astrophysics Data System (ADS)

    Li, H. C.; Yin, J.; Rao, Z.; Mii, H. S.; Shen, C. C.; Pillutla, R. K.; Li, Y. X.

    2016-12-01

    An 11.1-cm long stalagmite (ZZ12) collected from Zhenzhu cave (38°15'N, 113°42'E, 975m a.s.l.) located at Tiangui mountain of Hebei province, North China. The 230Th/U dates on 12 horizons exhibit large uncertainties with many reversed age sequences due to low U contents and low 230Th/232Th ratios. While the 230Th/U dating is not able to provide the chronology of this stalagmite, AMS 14C dating on 27 samples from various depths of the stalagmite yields a reliable age-depth relationship. Three AMS 14C dates from the top 5 mm appear nuclear bomb carbon indicating that this part was deposited after AD 1950. Seven samples for 210Pb dating were taken from the upper 14 mm with 2 mm intervals, showing exponential decay of excess 210Pb and supporting the AMS 14C dating results. At the base of the stalagmite, charcoal grains were included in the carbonate stalagmite. This charcoal sample has a Calibrated 14C age of 1865±20 a BP. The carbonates at adjacent depths show Calibrated 14C ages of 1900±15 and 2215±75 a BP respectively. The bomb carbon and similar ages between the charcoal and carbonates indicate that dead carbon influence on the 14C dates in some horizons may not be serious. From the 27 AMS 14C dates, we select 17 AMS 14C dates which have minimal influence of dead carbon fraction to construct the chronology. The established chronology shows that slow growth rates occurred prior to 1100 a BP and after 600 a BP. This time interval involves the Medieval Warm Period, while the fast growth rate during this interval may reflect warm and wet climatic conditions. A total of 835 samples were drilled from the stalagmite for δ18O and δ13C analyses. The current 900-year δ18O and δ13C records reveal climate and vegetation changes in the study area. Strong decadal oscillations in the δ18O record reflect variations of monsoonal rain, with relatively dry between AD 1350 and AD 1550 and after AD 1960. The δ13C record appears mainly multi-centennial variations with a 4

  6. An Arabidopsis Ran-binding protein, AtRanBP1c, is a co-activator of Ran GTPase-activating protein and requires the C-terminus for its cytoplasmic localization

    NASA Technical Reports Server (NTRS)

    Kim, Soo-Hwan; Roux, Stanley J.

    2003-01-01

    Ran-binding proteins (RanBPs) are a group of proteins that bind to Ran (Ras-related nuclear small GTP-binding protein), and thus either control the GTP/GDP-bound states of Ran or help couple the Ran GTPase cycle to a cellular process. AtRanBP1c is a Ran-binding protein from Arabidopsis thaliana (L.) Heynh. that was recently shown to be critically involved in the regulation of auxin-induced mitotic progression [S.-H. Kim et al. (2001) Plant Cell 13:2619-2630]. Here we report that AtRanBP1c inhibits the EDTA-induced release of GTP from Ran and serves as a co-activator of Ran-GTPase-activating protein (RanGAP) in vitro. Transient expression of AtRanBP1c fused to a beta-glucuronidase (GUS) reporter reveals that the protein localizes primarily to the cytosol. Neither the N- nor C-terminus of AtRanBP1c, which flank the Ran-binding domain (RanBD), is necessary for the binding of PsRan1-GTP to the protein, but both are needed for the cytosolic localization of GUS-fused AtRanBP1c. These findings, together with a previous report that AtRanBP1c is critically involved in root growth and development, imply that the promotion of GTP hydrolysis by the Ran/RanGAP/AtRanBP1c complex in the cytoplasm, and the resulting concentration gradient of Ran-GDP to Ran-GTP across the nuclear membrane could be important in the regulation of auxin-induced mitotic progression in root tips of A. thaliana.

  7. A Holocene paleosecular variation from 14C-dated volcanic rocks in Western North America

    USGS Publications Warehouse

    Hagstrum, J.T.; Champion, D.E.

    2002-01-01

    A paleosecular variation (PSV) curve for western North America is presented on the basis of 94 virtual geomagnetic poles (VGPs) from dated volcanic rocks sampled at 446 sites. Approximately 60% of the paleomagnetic database has been previously published. A curve defined by "spherical smoothed splines" is fitted to the VGPs, ranked by the quality of the age determinations, where the data density is highest between 3690 and -30 years before present (B.P.) (A.D. 1950), between 7800 and 7050 years B.P., and between 14,060 and 12,700 years B.P. The younger segments of the curve derived from volcanic rocks are similar but less complex than other high-resolution PSV curves derived from lacustrine sediments, particularly the record at Fish Lake, Oregon. The PSV record from lava flows (PSVL), however, is perhaps more reliable in its general shape and chronology because of the higher fidelity of volcanic rocks as magnetic field recorders and because of the greater density of 14C dates. The new PSVL record provides a partial Holocene master curve for western North America and will be of particular value in dating geological and archeological materials using paleomagnetic directions.

  8. 28-ka History of Sea Surface Temperature, Primary Productivity and Planktonic Community Variability in the Western Arabian Sea

    NASA Astrophysics Data System (ADS)

    Pourmand, A.; Marcantonio, F.; Bianchi, T.

    2006-12-01

    Uranium-series radionuclides and organic compounds, which represent major groups of planktonic organisms, have been measured in western Arabian Sea sediments that span the past 28 ka. Variability of the Indian Ocean monsoons and their influence on primary productivity, sea surface temperature (SST), and planktonic community structure has been investigated. The average alkenone-derived SST for the glacial was ~3°C lower than that measured for the Holocene. We also identify, for the first time, an interval of exceptionally low SSTs between 19-18.1 ka BP (15.3°C at 18.5 ka). During this time, the low SSTs coincide with high cumulative biomarker fluxes (CBF). We propose that intensification of winter northeast monsoon winds during the glacial period resulted in cold SSTs, deep convective mixing, and enhanced primary productivity. Following the last termination, and within the Holocene, SSTs vary by ~2°C with high CBFs occurring at times of relatively warmer SSTs. The fluxes of dinoflagellates and zooplankton relative to the total flux of organisms remain constant throughout the record. However, transitioning from the glacial to the Holocene, diatom fluxes comparatively increase relative to the total flux of organisms, while those of coccolithophorids decrease. Considering that the Indian Ocean monsoons are an important component of the global climate system, a shift in the planktonic ecosystem structure in the Arabian Sea may have important implications for the global biogeochemical cycle of carbon.

  9. Association between HLA-G 14bp Gene Polymorphism and Serum sHLA-G Protein Concentrations in Preeclamptic Patients and Normal Pregnant Women.

    PubMed

    Rokhafrooz, Saber; Ghadiri, Ata; Ghandil, Pegah; Ghafourian, Mehri; Hossaini, Seyed Hojjat; Daraei, Nahid; Najafian, Mahin; Rouhizadeh, Ahmad

    2018-06-28

    Preeclampsia (PE) is a multisystem syndrome that is a primary source of fetal-maternal morbidity and mortality. Human leukocyte antigen-G (HLA-G) is a nonclassical Major histocompatibility complex (MHC) class-Ib molecule expressed on the extravillous trophoblast and seems to have immunomodulatory functions during pregnancy. The purpose of our study was to investigate whether HLA-G may be a vital marker in the modulation of the pregnancy. In this case-control study, a number of 150 healthy pregnant women and 150 patients with PE had been genotyped for the 14 base-pair (bp) insertion/deletion polymorphism in exon 8 of the HLA-G gene, and the serum level of soluble HLA-G (sHLA-G) protein was measured using the enzyme-linked immunosorbent assay. Data showed that the PE syndrome was not related to the HLA-G 14 bp genotype. But, the serum level of sHLA-G in PE patients was significantly lower than that in healthy pregnant women in the third trimester (11.74 and 24.48 U/ml, respectively, p < 0.001). However, no significant association was observed between the HLA-G 14 bp genotype and serum sHLA-G level. Our results demonstrate that measurement of sHLA-G protein level may be helpful as a primary diagnosis for the pathogenesis of PE. Overall, this study suggests that the association between HLA-G 14 bp polymorphism and serum sHLA-G level in different ethnic populations of PE should be taken into consideration.

  10. Sensitivity of sediment magnetic records to climate change during Holocene for the northern South China Sea

    NASA Astrophysics Data System (ADS)

    Ouyang, Tingping; Li, Mingkun; Zhao, Xiang; Zhu, Zhaoyu; Tian, Chengjing; Qiu, Yan; Peng, Xuechao; Hu, Qiao

    2016-05-01

    Magnetic property has been proved to be a sensitive proxy to climate change for both terrestrial and marine sediments. Based on the schedule frame established by AMS 14C dating of foraminifera, detail magnetic analyses were performed for core PC24 sediments at sampling intervals of 2 cm to discuss magnetic sensitivity of marine sediment to climate during Holocene for the northern South China Sea. The results indicated that: 1) Concentration dependent magnetic parameters are positive corresponding to variation of temperature. The frequency dependent susceptibility coefficient basically reflected the variation in humidity; 2) XARM/SIRM was more sensitive to detrital magnetite particles and SIRM/X was more effective to biogenic magnetite particles. Variations of XARM/SIRM and SIRM/X are corresponding to precipitation and temperature, respectively; 3) the Holocene Megathermal in the study area was identified as 7.5-3.4 cal. ka BP. The warmest stage of Holocene for the study area should be during 6.1 to 3.9 cal. ka BP; 4) The 8 ka cold event was characterized as cold and dry during 8.55 to 8.25 cal. ka BP; 5) During early and middle Holocene, the climate combinations were warm dry and cold wet. It turned to warm and wet after 2.7 cal. ka BP.

  11. Cold Reversal on Kodiak Island, Alaska, Correlated with the European Younger Dryas by Using Variations of Atmospheric C-14 Content

    NASA Technical Reports Server (NTRS)

    Hajdas, Irka; Bonani, Georges; Boden, Per; Peteet, Dorothy M.; Mann, Daniel H.

    1999-01-01

    High-resolution AMS (accelerator-mass-spectrometer) radiocarbon dating was performed on late-glacial macrofossils in lake sediments from Kodiak Island, Alaska, and on shells in marine sediments from southwest Sweden. In both records, a dramatic drop in radiocarbon ages equivalent to a rise in the atmospheric C-14 by approximately 70%. coincides with the beginning of the cold period at 11000 yr B.P. (C-14 age). Thus our results show that a close correlation between climatic records around the globe is possible by using a global signature of changes in atmospheric C-14 content.

  12. The 14 bp Del/Ins HLA-G Polymorphism Is Related with High Blood Pressure in Acute Coronary Syndrome and Type 2 Diabetes Mellitus

    PubMed Central

    García-González, Ilian Janet; Valle, Yeminia; Rivas, Fernando; Figuera-Villanueva, Luis Eduardo; Muñoz-Valle, José Francisco; Flores-Salinas, Hector Enrique; Gutiérrez-Amavizca, Bianca Ethel; Dávalos-Rodríguez, Nory Omayra; Padilla-Gutiérrez, Jorge Ramón

    2014-01-01

    Immunologic and inflammatory processes are involved in the pathogenesis of acute coronary syndrome (ACS) and type 2 diabetes mellitus (DM2). Human leukocyte antigen-G (HLA-G) is a negative regulator of the immune response. This study evaluates the 14 bp Del/Ins HLA-G polymorphism in ACS and DM2. Three hundred and seventy individuals from Western Mexico were recruited and categorized into three groups: ACS (86), DM2 without coronary complications (70), and healthy subjects (214). Genotyping of the 14 bp Del/Ins HLA-G polymorphism was performed by PCR and Native-PAGE. The most common risk factors were hypertension and overweight in ACS and DM2, respectively. The genetic distribution of the 14 bp Del/Ins HLA-G polymorphism showed no significant differences between groups (P ≥ 0.23). Nonetheless, the Ins/Ins genotype was associated with high blood pressure (HBP) in the DM2 group (ORc = 1.65, P = 0.02). The genetic recessive model showed similar findings (ORc = 3.03, P = 0.04). No association was found in ACS, with a P of 0.05; nevertheless, the prevalence of Ins/Ins carriers was quite similar to that found in the DM2-HBP group. The 14 bp Del/Ins HLA-G polymorphism was not a susceptibility factor for ACS or DM2; however, the Ins/Ins genotype might have contributed to the development of HBP in the studied groups. PMID:24689061

  13. Risk Assessment of Mineral Groundwater Near Rogaška Slatina

    NASA Astrophysics Data System (ADS)

    Trcek, Branka; Leis, Albrecht

    2017-10-01

    Groundwater resources of mineral and thermo-mineral water are invaluable for planning a sustainable spatial and economic development of the Rogaška Slatina area, which requires a protection of this natural heritage. Numerous previous investigations of Rogaška groundwaters were subjects to balneology and to demands for larger exploitation quantities, that is why information are missing that are essential for definition of the Rogaška fractured aquifer system with mineral and thermo-mineral water and for its protection. The isotopic investigations of groundwaters stored in the Rogaška Slatina fractured aquifer system were performed aiming at answering open questions on the groundwater recharge and dynamics, on connections between different types of aquifers and on solute transport. Environmental isotopes 2H, 18O, 3H, 13C of dissolved inorganic carbon and 14C were analysed in mineral, thermo-mineral and spring waters. Results indicated the source and mechanism of groundwater recharge, its renewability, a transit time distribution, hydraulic interrelationships, the groundwater origin and its evolution due to effects of water-rock interaction. The mean residence time estimates of mineral and thermo- mineral water in the aquifer are between 3400 and 14000 years. On the other hand, the mixing processes between younger and older waters or mineral and spring waters are reflected as well as waters that infiltrated predominantly after the 1960s. These suggest the vulnerability of the research systems to man-made impacts. The presented results coupled with available information on a physical hydrogeology and water chemistry asses the optimal balance between the environmental protection and economic use of mineral water resources in the study area. They are essential for the protection strategy development of mineral and thermo-mineral water in the Rogaška Slatina area bringing together the state administration and local authorities and stakeholders.

  14. Uranium-series coral ages from the US Atlantic Coastal Plain-the "80 ka problem" revisited

    USGS Publications Warehouse

    Wehmiller, J. F.; Simmons, K.R.; Cheng, H.; Edwards, R. Lawrence; Martin-McNaughton, J.; York, L.L.; Krantz, D.E.; Shen, C.-C.

    2004-01-01

    Uranium series coral ages for emergent units from the passive continental margin US Atlantic Coastal Plain (ACP) suggest sea level above present levels at the end of marine oxygen isotope stage (MIS) 5, contradicting age-elevation relations based on marine isotopic or coral reef models of ice equivalent sea level. We have reexamined this problem by obtaining high precision 230Th/238U and 231Pa/235U thermal ionization mass spectrometric ages for recently collected and carefully cleaned ACP corals, many in situ. We recognize samples that show no evidence for diagenesis on the basis of uranium isotopic composition and age concordance. Combining new and earlier data, among those ages close to or within the age range of MIS 5, over 85% cluster between 65 and 85 ka BP. Of the corals that we have analyzed, those that show the least evidence for diagenesis on the basis of uranium isotopic composition and age concordance have ages between 80 and 85 ka BP, consistent with a MIS 5a correlation. The units from which these samples have been collected are all emergent and have elevations within ???3-5m of those few units where early stage 5 (???125,000 ka BP) coral ages have been obtained. The ACP appears to record an unusual history of relative sea level throughout MIS 5, a history that is also apparent in the dated coral record for Bermuda. We speculate that this history is related to the regional (near-to intermediate-field) effects of ancestral Laurentide Ice sheets on last interglacial shorelines of the western North Atlantic. ?? 2004 Elsevier Ltd and INQUA. All rights reserved.

  15. History of Larix decidua Mill. (European larch) since 130 ka

    NASA Astrophysics Data System (ADS)

    Wagner, Stefanie; Litt, Thomas; Sánchez-Goñi, Maria-Fernanda; Petit, Rémy J.

    2015-09-01

    Retrospective studies focussing on forest dynamics using fossil and genetic data can provide important keys to prepare forests for the future. In this study we analyse the impact of past climate and anthropogenic changes on Larix decidua Mill. (European larch) populations based on a new range-wide fossil compilation encompassing the last 130 ka and on recently produced genetic data (nuclear, mitochondrial). Results demonstrate that during the last 130 ka L. decidua persisted close to its current distribution range and colonized vast areas outside this range during the first two early Weichselian interstadials (c. 87-109 ka and c. 83-78 ka), reaching a distributional maxima in the north-central European lowlands. Some fossil sites point to notably rapid responses to some abrupt climate events (Dansgaard-Oeschger cycles and Heinrich Events). Combined fossil and genetic data identify at least six MIS 2 refuges and postglacial recolonization pathways. The establishment of extant L. decidua forests dates back to the first two millennia of the Holocene (c. 11.5-9.5 ka) and the onset of anthropogenic impact was inferred since the late Neolithic (c. 6 ka), with major changes occurring since the Bronze Age (c. 4 ka). During the last 300 years human-induced translocations resulted in recent admixture of populations originating from separate refuges. Altogether, the results of this study provide valuable clues for developing sustainable conservation and management strategies targeting ancient genetic lineages and for studying evolutionary issues.

  16. Late Pleistocene - Holocene surface processes and landscape evolution in the central Swiss Alps

    NASA Astrophysics Data System (ADS)

    Boxleitner, Max; Musso, Alessandra; Waroszewski, Jarosław; Malkiewicz, Małgorzata; Maisch, Max; Dahms, Dennis; Brandová, Dagmar; Christl, Marcus; de Castro Portes, Raquel; Egli, Markus

    2017-10-01

    The European Alps are a geomorphologically active region and experience a number of gravity-driven hillslope processes. Soil and landscape formation in the Alps has consequently undergone several minor and major traceable changes of developmental trajectories during the Holocene. Soil development is hypothesised to be often non-linear with time and characterised by stages of progressive and regressive evolution caused by upbuilding (formation, profile deepening) and erosion (profile shallowing). Several cold and warm climate phases are identified during the Holocene but it is largely unknown which effects these might have had on slope processes. By using datable moraines (10Be) and mires (14C), we have constructed a temporal framework for these processes. Using the geochemical imprint of mires in the Alpine setting of the Göschener-valley of the Central Swiss Alps, we reconstructed general (mostly erosional) landscape processes for the last ca. 10 ka. As this is the type locality for the Göschener cold phase, we assumed that this phase (Göschener cold phase I and II 1.5 and 2.5 ka BP) should have left easily recognizable traits. After deglaciation (11-12 ka BP), soil evolution was progressive. Beginning around 8 ka BP, we detect a distinct increase in erosion here, together with a vegetation change (towards tundra vegetation) and the highest measured rates of carbon sequestration. Other phases of high geomorphic activity were recognised ca. 5-6 ka BP, 4 ka BP and, to a lesser extent, 1-3 ka ago. The cold phase at 5-6 ka BP corresponds to a less distinct change in vegetation and lessened erosion. Human impact is increasingly obvious since about 2.4 ka BP which overlaps with the Göschener cold phase. Nonetheless, erosion processes were not extraordinarily high during this period and a climate effect cannot be distinguished. We detect evidence of increasing human disturbance (regressive soil evolution) for about the last 1 ka. We also detect an increase in dust

  17. Satellite Communications for Unmanned Aircraft C2 Links: C-Band, Ku-Band and Ka-Band

    NASA Technical Reports Server (NTRS)

    Kerczewski, Robert J.; Wilson, Jeffrey D.; Bishop, William D.

    2016-01-01

    Unmanned aircraft (UA) that require access to controlled (or non-segregated) airspace require a highly reliable and robust command and control (C2) link, operating over protected aviation spectrum. While operating within radio line-of-sight (LOS) UA can make use of air-to-ground C2 links to terrestrial stations. When operating beyond LOS (BLOS) where a group of networked terrestrial stations does not exist to provide effective BLOS coverage, a satellite communications link is required. Protected aviation spectrum for satellite C2 links has only recently been allocated in bands where operational satellites exist. A previously existing C-Band allocation covers a bands where there are currently no operational satellites. The new allocations, within the Fixed Satellite Service bands at Ku and Ka-Bands will not be finalized until 2023 due to the need for the development of standards and technical decisions on the operation of UA satellite C2 links within these bands. This paper provides an overview of BLOS satellite C2 links, some of the conditions which will need to be met for the operation of such links, and a look at some aspects of spectrum sharing which may constrain these operations.

  18. Rock Magnetic Properties, Paleosecular Variation Record and Relative Paleointensity Stack between 11 and 21 14C kyr B.P. From Sediment Cores, Lake Moreno (Argentina)

    NASA Astrophysics Data System (ADS)

    Gogorza, C. S.; Irurzun, M. A.; Lirio, J. M.; Nunez, H.; Chaparro, M. A.; Sinito, A. M.

    2008-05-01

    We conducted a detailed study of natural remanence and rock magnetic properties on sediments cores from lake Moreno (South-Western Argentina). Based on these measurements, we constructed a paleosecular variation (PSV) record (Irurzun et al., 2008) and a relative paleointensity stack for the period 11-21 14C. The Declination and Inclination logs of the characteristic remanent magnetization for the cores as function of shortened depth are obtained. The data from all cores were combined to obtain a composite record using the Fisher method. Comparison between stacked inclination and declination records of lake Moreno and results obtained in previous works, lake Escondido (Gogorza et al., 1999; Gogorza et al., 2002) and lake El Trébol (Irurzun et al., 2008), shows good agreement. This agreement made possible to transform the stacked curves into time series that spans the interval 11 and 21 14C kyr B.P. Rock magnetic properties of the sediments cores showed uniform magnetic mineralogy and grain size, suggesting that they were suitable for relative paleointensity studies. The remanent magnetization at 20mT (NRM20mT) was normalized using the anhysteric remanent magnetization at 20mT (ARM20mT), the saturation of the isothermal remanent magnetization at 20mT (SIRM20mT) and the low field magnetic susceptibility {k}. Coherence analysis showed that the normalized records were not affected by local environmental conditions. The recorded pseudo-Thellier paleointensity was compared with records obtained from conventional normalizing methods. Comparing the paleointensity curves with others obtained previously in other lakes in the area has allowed us to reach reliable conclusions about centennial-scale features. References: Gogorza, C.S.G., Sinito, A.M., Di Tommaso, I., Vilas, J.F., Creer, K., Núnez, H. Holocene Geomagnetic Secular Variations Recorded by Sediments from Escondido lake (South Argentina). Earth, Planets and Space, V51(2), 93- 106. 1999. Gogorza, C.S.G., Sinito, A

  19. Distributions and Transformations of Natural Abundance 14C and 13C in Dissolved and Particulate Lipids in a Major Temperate Estuary

    NASA Astrophysics Data System (ADS)

    Bauer, J. E.; Canuel, E. A.; McIntosh, H.; Barrett, A.; Ferer, E.; Hossler, K.

    2013-12-01

    Limited previous studies have shown major differences in the natural 14C and 13C isotopic signatures and radiocarbon ages of different biochemical classes (e.g., proteins, carbohydrates, lipid, etc.) in river, estuarine and marine dissolved and particulate organic matter (DOM and POM, respectively). Of particular note are the much greater radiocarbon ages of lipophilic materials than other compound classes. Possible explanations for these findings include greater-than-expected inputs of fossil and highly aged lipid-containing organic matter to rivers and estuaries, extended sorptive-protection of lipophilic materials from degradation and/or lower overall reactivities of lipids vs. other major biochemical classes. We measured the Delta 14C and del 13C signatures and 14C ages of lipid classes in DOM and POM in a major temperate estuary, Delaware Bay (USA) over two years. Changes in DOM were also followed during large volume dark and light incubations to assess the microbial and photochemical reactivity and processing of DOM and lipids. Neutral lipids in DOM were among the most highly aged (> 30,000 yrs BP) of any materials measured in natural waters to date, and were significantly older than co-occurring polar lipids (~4,000-5,000 yrs BP). In general, DOM lipid ages were significantly greater than POM lipid ages across the river-estuary transect, arguing against sorptive protection as the major factor explaining greater ages of lipid than those of other compound classes. Both dark and light incubations of DOM resulted in losses of very highly aged material (30-50,000 y BP), with the remnant exported lipids being correspondingly younger. The microbial and photochemical alterations were most pronounced for lipids from freshwater reaches of the system (i.e., the Delaware River). These findings suggest that a) dissolved vs. particulate lipids have fundamentally different sources and/or physico-chemical partitioning, b) different lipid classes (e.g., neutral vs. polar

  20. Structure of C 14 and B 14 from the C 14 , 15 ( d , He 3 ) B 13 , 14 reactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bedoor, S.; Wuosmaa, A. H.; Albers, M.

    We have studied the C-14,C-15(d,He-3)B-13,B-14 proton-removing reactions in inverse kinematics. The (d,He-3) reaction probes the proton occupation of the target ground state, and also provides spectroscopic information about the final states in B-13,B-14. The experiments were performed using C-14,C-15 beams from the ATLAS accelerator at Argonne National Laboratory. The reaction products were analyzed with the HELIOS device. Angular distributions were obtained for transitions from both reactions. The C-14-beam data reveal transitions to excited states in B-13 that suggest configurations with protons outside the pi(0p(3/2)) orbital, and some possibility of proton cross-shell 0p-1s0d excitations, in the C-14 ground state. The C-15-beammore » data confirm the existence of a broad 2(-) excited state in B-14. The experimental data are compared to the results of shell-model calculations.« less

  1. Tropical Andean and African glacier extent through the Holocene assessed with proglacial in situ 14C and 10Be measurements

    NASA Astrophysics Data System (ADS)

    Vickers, A. C.; Shakun, J. D.; Goehring, B. M.; Kelly, M. A.; Jackson, M. S.; Jomelli, V.

    2017-12-01

    We present measurements of the in situ cosmogenic radionuclides 14C and 10Be from recently exposed proglacial bedrock samples at the margin of the Quelccaya Ice Cap in Peru (n=5) and the Rwenzori mountains in Africa (n=3) to calculate cumulative exposure, burial, and erosion histories at these sites over the Holocene. The Holocene history (11 ka - present) of tropical glaciers gives important context to their observed retreat over the last century, insight into their sensitivity to climate forcing, and constraints on past climate change. Paired in situ 14C/10Be methods are used to exploit the multiple controls on nuclide concentrations and their differing half-lives (5730 years vs 1.38 Myr). In particular, the concentrations of both 14C and 10Be increase with exposure and decrease with glacial erosion; however,14C decreases not only due to glacial erosion, but also in appreciable amounts due to radio-decay during periods of burial as short as 800 years. Our results show similarities at both sites, with moderately high 10Be concentrations but 14C/10Be ratios approximately one-third of the production value, suggesting that both sites experienced several thousand years of exposure followed by burial during the mid-to-late Holocene. Our results are consistent with recently exposed subfossil plant remains at the Quelccaya margin that imply ice extended beyond its current position since 5.2 ka We will also present 10Be ages of several boulders from probable Little Ice Age moraines of the Charquini Sur Glacier in Bolivia (n=2) and Ritacuba Negro Glacier in Colombia (n=4) to better understand the timing of Little Ice Age advances in the tropical Andes.

  2. Pollen stratigraphy, vegetation and climate history of the last 215 ka in the Azzano Decimo core (plain of Friuli, north-eastern Italy)

    NASA Astrophysics Data System (ADS)

    Pini, R.; Ravazzi, C.; Donegana, M.

    2009-06-01

    The pollen record of the long succession of marine and continental deposits filling the subsident north-Adriatic foredeep basin (NE Italy) documents the history of vegetation, the landscape evolution and the climate forcing during the last 215 ka at the south-eastern Alpine foreland. The chronology relies on several 14C determinations as well as on estimated ages of pollen-stratigraphical and sea-level event tie-points derived from comparison with high-resolution marine records, speleothemes and ice cores. Mixed temperate rainforests persisted throughout MIS 7a-7c, being replaced by conifer forests after the local glacioeustatic regression during early MIS 6. The Alpine piedmont facing the Adriatic foredeeep was glaciated at the culmination of the penultimate glaciation, as directly testified by in situ fluvioglacial aggradation related to the building of a large morainic amphitheatre. The pollen record allows correlation with other European records and with the IRD from N-Atlantic and off Iberia, thus the duration of the penultimate glacial culmination at the southalpine fringe is estimated less than 13 ka between 148 ± 1 and >135 ka. The site was not reached by the Last Interglacial maximum sea transgression and enregistered a typical, though incomplete, Eemian forest record, lacking Mediterranean evergreen trees. A complex sequence of stadial-interstadial episodes is reconstructed during the Early and Middle Würm: major xerophyte peaks match IRD maxima occurred during Heinrich events in deep-sea cores offshore Iberia and in the N-Atlantic and allows to frame lumps of interstadial phases, marked by Picea peaks, each one including several DO warm events. Broad-leaved thermophilous forests disappeared from the north-eastern plain of Italy at the end of the Early Würm, whereas reduced populations of Abies and Fagus probably sheltered even during the Last Glacial Maximum. A renewed fluvioglacial in situ deposition between 30.4 ± 0.4 and 21.6 ± 0.5 ka cal BP sets

  3. Maximizing MST's inductive capability with a Bp programmable power supply

    NASA Astrophysics Data System (ADS)

    Chapman, B. E.; Holly, D. J.; Jacobson, C. M.; McCollam, K. J.; Morin, J. C.; Sarff, J. S.; Squitieri, A.

    2016-10-01

    A major goal of the MST program is the advancement of inductive control for the development of both the RFP's fusion potential and, synergistically, the predictive capability of fusion science. This entails programmable power supplies (PPS's) for the Bt and Bp circuits. A Bt PPS is already in place, allowing advanced RFP operation and the production of tokamak plasmas, and a Bp PPS prototype is under construction. To explore some of the new capabilities to be provided by the Bp PPS, the existing Bt PPS has been temporarily connected to the Bp circuit. One key result is new-found access to very low Ip (20 kA) and very low Lundquist number, S (104). At this low S, simulation of RFP plasmas with the MHD code NIMROD is readily achievable, and work toward validation of extended MHD models using NIMROD is underway with direct comparisons to these MST plasmas. The full Bp PPS will also provide higher Ip and S than presently possible, allowing MST to produce plasmas with S spanning as much as five orders of magnitude, a dramatic extension of MST's capability. In these initial tests, the PPS has also increased five-fold MST's Ip flattop duration, to about 100 ms. This, coupled with the recently demonstrated PPS ability to drive large-amplitude sinusoidal oscillations in Ip, will allow tests of extended-duration oscillating field current drive, the goal of which is ac sustainment of a quasi-dc plasma current. Work supported by US DOE.

  4. Present day and Allerod - Younger Dryas marine 14C reservoir ages of surface waters in the North Atlantic-Norwegian Sea

    NASA Astrophysics Data System (ADS)

    Mangerud, J.; Bondevik, S.; Gulliksen, S.; Birks, H. H.; Reimer, P.; Hufthammer, A. K.; Hoisaeter, T.

    2005-12-01

    In order to compare radiocarbon dates on marine and terrestrial samples, the former have to be corrected for a marine reservoir age. We have calculated present day reservoir ages in this area by dating 22 whales collected AD 1860-1901 and 23 molluscs collected AD 1857-1926. Whales feed on pelagic organisms and will provide the reservoir age for the open ocean surface water. However, they travel large distances and integrate the reservoir ages of water masses along their way. Molluscs are stationary and monitor the sea water passing their living site. For the surface water in the N-Atlantic and Norwegian Sea we recommend to use the mean obtained for the two sets, i.e. reservoir ages of 400 +/- 40 and 375 +/- 30 years relative to tree rings of Intcal04 and British oak respectively, for the parts of the Holocene where specific time-dependent reservoir ages are not determined. The reservoir ages relative to British oak best reflects regional processes and we therefore prefer those, whereas IntCal04 ages are much more precisely determined, but dominated by trees from NW-USA in this time period. The reservoir ages for Allerod-Younger Dryas (YD) are obtained by dating parallel samples of terrestrial plant fragments and marine shells from sediment cores from the outermost western coast of Norway. The marine mud contains both plant fragments blown or washed in from adjacent land and in situ marine shells. In the earliest period (13,800-14,500 cal yrs BP) the reservoir age is 300-400 years, similar to present day values. This suggests that the exchange of CO2 between the atmosphere and the surface ocean was comparable to the present. During a short interval 13,200-13,500 cal yrs BP we found higher reservoir ages of 500-600 years coinciding with lower organic carbon content in our cores, and an inter-Allerod fluctuation seen in marine records. During the early YD the reservoir ages increased gradually from 400 to 650 years, causing a 700-14C year-long plateau, centred at 11

  5. 78 FR 60270 - BP America Inc., BP Corporation North America Inc., BP America Production Company, and BP Energy...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-01

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. IN13-15-000] BP America Inc., BP Corporation North America Inc., BP America Production Company, and BP Energy Company; Notice of Designation of Commission Staff as Non-Decisional With respect to an order issued by the Commission on August...

  6. Mid-Brunhes magnetic excursions in marine isotope stages 9, 13, 14, and 15 (286, 495, 540, and 590 ka) at North Atlantic IODP Sites U1302/3, U1305, and U1306

    NASA Astrophysics Data System (ADS)

    Channell, J. E. T.

    2017-02-01

    Integrated Ocean Drilling Program (IODP) Site U1302/3 (Orphan Knoll, off Newfoundland) recorded magnetic excursions in marine isotope stages (MIS) 9a (at 286 ka) and 13a (at 495 ka). Sites U1306 and U1305 (Eirik Drift, off SE Greenland) record excursions in MIS 14a/b (at 540 ka) and 15b/c (at 590 ka). In the excursion intervals, magnetic measurements of continuous "u-channel" samples from multiple holes within site are augmented by measurements of cubic (8 cm3) discrete samples. The excursions lie in relative paleointensity (RPI) minima at each site and in RPI reference stacks, and correspond to dated intervals of 10Be overproduction in other deep-sea sediment records. Although observed at multiple holes at each site, and from u-channel and discrete samples, the excursions are not observed at all three sites, and often at only one of the three sites. Sporadic recording of these magnetic excursions, and excursions in general, is attributed to a combination of filtering by the process of acquisition of detrital remanent magnetization (DRM), postdepositional overprint of weak excursion magnetizations, the millennial or even centennial duration of directional excursions, and nonuniform sedimentation rates at these timescales in North Atlantic sediment drifts.

  7. Volcanic history and 40Ar/39Ar and 14C geochronology of Terceira Island, Azores, Portugal

    USGS Publications Warehouse

    Calvert, Andrew T.; Moore, Richard B.; McGeehin, John P.; Rodrigues da Silva, Antonio

    2006-01-01

    Seven new 40Ar/39Ar and 23 new radiocarbon ages of eruptive units, in support of new geologic mapping, improve the known chronology of Middle to Late Pleistocene and Holocene volcanic activity on the island of Terceira, Azores and define an east-to-west progression in stratovolcano growth. The argon ages indicate that Cinco Picos Volcano, the oldest on Terceira, completed its main subaerial cone building activity by about 370–380 ka. Collapse of the upper part of the stratovolcanic edifice to form a 7 × 9 km caldera occurred some time after 370 ka. Postcaldera eruptions of basalt from cinder cones on and near the caldera floor and trachytic pyroclastic flow and pumice fall deposits from younger volcanoes west of Cinco Picos have refilled much of the caldera. The southern portion of Guilherme Moniz Volcano, in the central part of the island, began erupting prior to 270 ka and produced trachyte domes, flows, and minor pyroclastic deposits until at least 111 ka. The northern part of Guilherme Moniz Caldera is less well exposed than the southern part, but reflects a similar age range. The northwest portion of the caldera was formed sometime after 44 ka. Several well-studied ignimbrites that blanket much of the island likely erupted from Guilherme Moniz Volcano. The Pico Alto Volcanic Center, a tightly spaced cluster of trachyte domes and short flows, is a younger part of Guilherme Moniz Volcano. Stratigraphic studies and our new radiocarbon ages suggest that most of the Pico Alto eruptions occurred during the period from about 9000 to 1000 years BP. Santa Barbara Volcano is the youngest stratovolcano on Terceira, began erupting prior to 29 ka, and has been active historically.

  8. Origin and fate of sedimentary organic matter in the northern Bay of Bengal during the last 18 ka

    NASA Astrophysics Data System (ADS)

    Contreras-Rosales, L. A.; Schefuß, E.; Meyer, V.; Palamenghi, L.; Lückge, A.; Jennerjahn, T. C.

    2016-11-01

    The Northern Bay of Bengal (NBoB) is a globally important region for deep-sea organic matter (OM) deposition due to massive fluvial discharge from the Ganges-Brahmaputra-Meghna (G-B-M) rivers and moderate to high surface productivity. Previous studies have focused on carbon burial in turbiditic sediments of the Bengal Fan. However, little is known about the storage of carbon in pelagic and hemipelagic sediments of the Bay of Bengal over millennial time scales. This study presents a comprehensive history of OM origin and fate as well as a quantification of carbon sediment storage in the Eastern Bengal Slope (EBS) during the last 18 ka. Bulk organic proxies (TOC, TIC, TN, δ13CTOC, δ15NTN) and content and composition of total hydrolysable amino acids (THAA) in a sediment core (SO188-342KL) from the EBS were analyzed. Three periods of high OM accumulation were identified: the Late Glacial (LG), the Bölling/Alleröd (B/A), and the Early Holocene Climatic Optimum (EHCO). Lower eustatic sea level before 15 ka BP allowed a closer connection between the EBS and the fluvial debouch, favoring high terrestrial OM input to the core site. This connection was progressively lost between 15 and 7 ka BP as sea level rose to its present height and terrestrial OM input decreased considerably. Export and preservation of marine OM was stimulated during periods of summer monsoon intensification (B/A and EHCO) as a consequence of higher surface productivity enhanced by cyclonic-eddy nutrient pumping and fluvial nutrient delivery into the photic zone. Changes in the THAA composition indicate that the marine plankton community structure shifted from calcareous-dominated before 13 ka BP to siliceous-dominated afterwards. They also indicate that the relative proportion of marine versus terrestrial OM deposited at site 342KL was primarily driven by relative sea level and enlarged during the Holocene. The ballasting effect of lithogenic particles during periods of high coastal proximity and

  9. Geomagnetic Dipole Lows and Excursions of the last 800 ka : connection with Interglacials and/or low Obliquity Times?

    NASA Astrophysics Data System (ADS)

    Thouveny, N.

    2006-12-01

    Paleomagnetic directions, relative paleointensities (RPI) and authigenic 10Be/9Be ratio were measured along sedimentary clayey-carbonate sequences in high accumulation rate sites of the Portuguese margin (0-400 ka BP) and West-Equatorial Pacific (600-1300 ka BP. Series of high and low RPI features are placed on the chronological scale using C-14 ages, using correlations with of delta O-18 records with the Greenland ice cores and SPECMAP records, and using the ages of polarity reversals. During the time intervals of dramatically low RPI anomalous paleodirections document excursions or polarity reversals. Significant peaks of the authigenic 10Be/9Be ratio point in stratigraphic layers recording all low RPI phases. Plotted against RPI data the 10Be/9Be ratios statistically follow the expected power law (Elsasser et al. ,1958 and Lal, 1988), which strongly establishes the unique and direct link between the recorded cosmogenic enhancement and dipole moment loss, allowing us to univocally interpret our 10Be/9Be ratio and RPI records in terms of geomagnetic dipole moment lows and highs (DML and DMH) alternation. delta O-18 records of the same cores (e.g. Abreu et al. 2004), provide the frame to interpret dipole moment variations in a paleoclimatic context within strict stratigraphic terms. We note that most DML of the last 400 ka fall in the end of interglacial stages, while DMH are rather related with full glacials. We then confirm this coincidence, though whithout strict stratigraphic control, by comparing the SINT-800 curve (Guyodo and Valet, 1999) and the S. E. Pacific near Sea Floor mag. record (Gee et al., 2000), with the highest resolution 18O record yet available (Bassinot et al. 1994). Complex Wavelet analyses using modulus and phase reveal that the geomagnetic moment proxy records contain a maximum power for periods between 30 and 100 ka. DML do not occur in any fixed eccentricity context, but several DML fall at the time of obliquity minima. The comparison of

  10. Climate-induced fluvial dynamics in tropical Africa around the last glacial maximum?

    NASA Astrophysics Data System (ADS)

    Sangen, Mark; Neumann, Katharina; Eisenberg, Joachim

    2011-11-01

    The alluvia of the Ntem, Nyong and Sanaga fluvial systems in southern Cameroon recorded repeated fluvial activity fluctuations during the Late Pleistocene, including the last glacial maximum (LGM), the beginning of the African Humid Period and the northern hemispheric Bølling-Allerød. We applied a multi-proxy approach on alluvial stratigraphies dated between 22.4 and 13.0 cal ka BP, including remote sensing, sedimentological and morphogenetic methods, phytoliths, sponge spicules, 14C and δ 13C data. A distinct NE-SW gradient of landscape and fluvial dynamics around the LGM can be drawn, with evidence for the persistence of extended fluvial rainforest refuges only in the Ntem catchment. The Sanaga and Nyong catchment areas were characterized by frequent channel migrations, floodplain reorganization and unstable vegetation subject to fire, including grasslands, woodlands, and gallery forests with bamboo thickets. In spite of increasing rainfall after 16.4 cal ka BP, persisting landscape instability played the major role for fluvial system dynamics, floodplain transformations and vegetation development until 13.0 cal ka BP, before a general landscape stabilization and rainforest expansion set in at the beginning of the Holocene.

  11. Preliminary study of land-plant biomarkers in marine sediments of Alfonso basin and its relationship with the climate of the last 3.5 ka

    NASA Astrophysics Data System (ADS)

    Ricaurte-Villota, Constanza; Gonzalez-Yajimovich, Oscar; Betancourt-Portela, Julian

    2014-05-01

    This study used biomarkers such as n-alkanes, especially focused on the long chain n-alkanes and some diagnostic indexes derived from abundance, to elucidate molecular changes in the contribution of organic matter to the sediments, especially terrestrial vegetation surrounding continental areas around of Alfonso basin in response to climate change, particularly changes in the hydrological cycle. The results show that in general the n-alkanes of organic matter (OM) of Alfonso basin sediments are composed of a mixture of waxes derived from phytoplankton and terrestrial plants, with a greater contribution from phytoplankton compare to terrestrial vegetation, in the oldest part of the record, associated with a marine productivity increased period favored by rainfall. Maximum abundance of C29, and high values of C27/C31 ratio indicate leaves from trees as a source wax, probably succulents plants characteristic of arid zones, with C3 as one of their metabolic pathway, identified from mean ACL values around 29.5. The low CPI index indicates contamination and microbial communities as a possible source of long chain n-alkanes, probably due to anoxic bottom conditions in Alfonso basin favor the development of these communities. Finally, it is suggested no change in the community, at least for the last ~ 3.5 ka BP, but increased cover vegetation (biomass) in southern California during periods of increased rainfall (from ~ 3.5 to ~ 1.7 ka BP). The ability of terrestrial plant communities to adapt for longer periods before being replaced by other species, when faced with gradual changes rather than rapid climate change is reflected in a few changes in its composition.

  12. Enhancement of B-cell receptor signaling by a point mutation of adaptor protein 3BP2 identified in human inherited disease cherubism.

    PubMed

    Ogi, Kazuhiro; Nakashima, Kenji; Chihara, Kazuyasu; Takeuchi, Kenji; Horiguchi, Tomoko; Fujieda, Shigeharu; Sada, Kiyonao

    2011-09-01

    Tyrosine phosphorylation of adaptor protein c-Abl-Src homology 3 (SH3) domain-binding protein-2 (3BP2, also referred to SH3BP2) positively regulates the B-cell antigen receptor (BCR)-mediated signal transduction, leading to the activation of nuclear factor of activated T cells (NFAT). Here we showed the effect of the proline to arginine substitution of 3BP2 in which is the most common mutation in patients with cherubism (P418R) on B-cell receptor signaling. Comparing to the wild type, overexpression of the mutant form of 3BP2 (3BP2-P416R, corresponding to P418R in human protein) enhanced BCR-mediated activation of NFAT. 3BP2-P416R increased the signaling complex formation with Syk, phospholipase C-γ2 (PLC-γ2), and Vav1. In contrast, 3BP2-P416R could not change the association with the negative regulator 14-3-3. Loss of the association mutant that was incapable to associate with 14-3-3 could not mimic BCR-mediated NFAT activation in Syk-deficient cells. Moreover, BCR-mediated phosphorylation of extracellular signal regulated kinase (ERK) and c-Jun N-terminal kinase (JNK) was not affected by P416R mutation. These results showed that P416R mutation of 3BP2 causes the gain of function in B cells by increasing the interaction with specific signaling molecules. © 2011 The Authors. Journal compilation © 2011 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

  13. Simulating vegetation dynamics in Chile from 21ka BP to present: Effects of climate change on vegetation functions and cover

    NASA Astrophysics Data System (ADS)

    Werner, Christian; Liakka, Johan; Schmid, Manuel; Fuentes, Juan-Pablo; Ehlers, Todd A.; Hickler, Thomas

    2017-04-01

    Vegetation composition and establishment is strongly dependent on climate conditions but also a result of vegetation dynamics (competition for light, water and nutrients). In addition, vegetation exerts control over the development of landscapes as it mediates the climatic and hydrological forces shaping the terrain via hillslope and fluvial processes. At the same time, topography as well as soil texture and soil depth affect the microclimate, soil water storage and rooting space that is defining the environmental envelope for vegetation development. Within the EarthShape research program (www.earthshape.net) we evaluate these interactions by simulating the co-evolution of landscape and vegetation with a dynamic vegetation model (LPJ-GUESS) and a landscape evolution model (LandLab). LPJ-GUESS is a mechanistic model driven by daily or monthly weather data and explicitly simulates vegetation physiology, succession, competition and water and nutrient cycling. Here we present the results of first transient vegetation simulations from 21kyr BP to present-day using the TraCE-21ka climate dataset for four focus sites along the coastal cordillera of Chile that are exposed to a substantial meridional climate gradient (ranging from hyper-arid to humid-temperate conditions). We show that the warming occurring in the region from LGM to present, in addition to the increase of atmospheric CO2 concentrations, led to a shift in vegetation composition and surface cover. Future work will show how these changes resonate in the dynamics of hillslope and fluvial erosion and ultimately bi-directional feedback mechanisms of vegetation development and landscape evolution/ soil formation (see also companion presentation by Schmid et al., this session).

  14. A complete terrestrial radiocarbon record for 11.2 to 52.8 kyr B.P.

    PubMed

    Bronk Ramsey, Christopher; Staff, Richard A; Bryant, Charlotte L; Brock, Fiona; Kitagawa, Hiroyuki; van der Plicht, Johannes; Schlolaut, Gordon; Marshall, Michael H; Brauer, Achim; Lamb, Henry F; Payne, Rebecca L; Tarasov, Pavel E; Haraguchi, Tsuyoshi; Gotanda, Katsuya; Yonenobu, Hitoshi; Yokoyama, Yusuke; Tada, Ryuji; Nakagawa, Takeshi

    2012-10-19

    Radiocarbon ((14)C) provides a way to date material that contains carbon with an age up to ~50,000 years and is also an important tracer of the global carbon cycle. However, the lack of a comprehensive record reflecting atmospheric (14)C prior to 12.5 thousand years before the present (kyr B.P.) has limited the application of radiocarbon dating of samples from the Last Glacial period. Here, we report (14)C results from Lake Suigetsu, Japan (35°35'N, 135°53'E), which provide a comprehensive record of terrestrial radiocarbon to the present limit of the (14)C method. The time scale we present in this work allows direct comparison of Lake Suigetsu paleoclimatic data with other terrestrial climatic records and gives information on the connection between global atmospheric and regional marine radiocarbon levels.

  15. A 150-ka-long record for the volcano-tectonic deformation of Central Anatolian Volcanic Province

    NASA Astrophysics Data System (ADS)

    Karabacak, Volkan; Tonguç Uysal, I.; Ünal-İmer, Ezgi; Mutlu, Halim; Zhao, Jian-xin

    2017-04-01

    The Anatolian Block represents one of the most outstanding examples of intra-plate deformation related to continental collision. Deformation related to the convergence of the Afro-Arabian continent toward north gives rise to widespread and intense arc volcanism in the Central Anatolia. All the usual studies on dating the volcano-tectonic deformation of the region are performed entirely on volcanic events of the geological record resulted in eruptions. However, without volcanic eruption, magma migration and related fluid pressurization also generate crustal deformation. In the current study has been funded by the Scientific and Technological Research Council of Turkey with the project no. 115Y497, we focused on fracture systems and their carbonate veins around the Ihlara Valley (Cappadocia) surrounded by well-known volcanic centers with latest activities of the southern Central Anatolian Volcanic Province. We dated 37 samples using the Uranium-series technique and analyzed their isotope systematics from fissure veins, which are thought to be controlled by the young volcanism in the region. Our detailed fracture analyses in the field show that there is a regional dilatation as a result of a NW-SE striking extension which is consistent with the results of recent GPS studies. The Uranium-series results indicate that fracture development and associated carbonate vein deposition occurred in the last 150 ka. Carbon and oxygen isotope systematics have almost remained unchanged in the studied time interval. Although veins in the region were precipitated from fluids primarily of meteoric origin, fluids originating from water-rock interaction also contribute for the deposition of carbonate veins. The age distribution indicates that the crustal deformation intensified during 7 different period at about 4.7, 34, 44, 52, 83, 91, 149 ka BP. Four of these periods (4.7, 34, 91, 149 ka BP) correspond to the volcanic activities suggested in the previous studies. The three crustal

  16. Past climate variability between 97 and 7 ka reconstructed from a multi proxy speleothem record from Western Cuba

    NASA Astrophysics Data System (ADS)

    Winterhalder, Sophie; Scholz, Denis; Mangini, Augusto; Spötl, Christoph; Jochum, Klaus Peter; Pajón, Jesús M.

    2016-04-01

    The tropical hydrological cycle plays a key role in regulating global climate, mainly through the export of heat and moisture to higher latitudes, and is highly sensitive to climate change, for instance due to changes in the position of the Intertropical Convergence Zone (ITCZ). Previous work on Caribbean stalagmites suggests a strong connection of precipitation variability to North Atlantic (NA) sea surface temperatures on multidecadal to millenial timescales (Fensterer et al., 2012; Fensterer et al., 2013; Winter et al., 2011). Cold phases in the NA potentially lead to a southward shift of the ITCZ and thus drier conditions in Cuba. On orbital timescales, Cuban stalagmites suggest a relation of speleothem δ18O values with the δ18O value of Caribbean surface waters (Fensterer et al., 2013). Here we present an expansion of the Cuban speleothem record covering the whole last glacial period from the end of MIS5c (97 ka BP) until 7 ka with hiatuses between 93-80 ka, 37-35 ka and 13-10 ka. Stalagmite Cuba medio (CM) has been precisely dated with 60 230Th/U-ages, mainly performed by the MC-ICPMS technique. The δ18O and δ13C records are completed by a continuous, high resolution LA-ICPMS trace element profile. These data allow for the first time to establish a multi-proxy climate reconstruction for the North Western Caribbean at decadal to centennial resolution for this period. The long-term variability of the δ18O values probably reflects rainfall amount in Cuba. The response to some Dansgaard/Oeschger and Heinrich stadials confirms the previously observed correlation between Caribbean and NA climate variability. However, this connection is not clearly imprinted throughout the record. Furthermore, trace elements, such as Mg, do not proof without ambiguity drier conditions in Cuba during NA cold events, such as the Heinrich stadials. This suggests that climate variability in Cuba was more complex during the last 100ka, and that the NA was not the only driving factor

  17. Limiting age for the Provo shoreline of Lake Bonneville

    USGS Publications Warehouse

    Miller, David; Wahl, David B.; McGeehin, John; Rosario, Jose J.; Oviatt, Charles G.; Anderson, Lysanna; Presnetsova, Liubov S.

    2015-01-01

    Pluvial Lake Bonneville features a prominent shoreline at the Provo level, which has been interpreted as having formed during a period of threshold-stabilized overflow. The timing of Provo shoreline development is important for paleoclimate interpretations and for inferences on geomorphic process rates. Estimates for the timing of the shoreline formation, based on radiocarbon measurements from gastropod shells, are from approximately 18 to 15 cal ka. One key radiocarbon age on plant fragments from Swan Lake, which formed in the threshold spillway after overflow ceased, has been taken as a young limiting age. The conventional age of 12090 ± 300 14C when calibrated at 2σ has large uncertainty (13375–15103 cal BP). We report six new AMS radiocarbon ages recovered from new Swan Lake sediment cores. A twig near the base of lacustrine muds was dated at 11,615 ± 40 14C yr (13,350 to 13,560 cal BP). Age determinations on roots in that interval and deeper in the core are somewhat younger. These ages limit the last overflow of the Provo stand to earlier than ∼13.5 cal ka BP, consistent with the younger bound of the imprecise age reported by Bright. If conservative interpretations of sedimentation rates for the thick well-sorted sand interval below the lacustrine muds are correct and landscape change that resulted in damming of Swan Lake is accounted for, cessation of flow probably occurred before ∼14.5 cal ka BP.

  18. Evidence for stagnation of the Harvard sublobe (Lake Michigan lobe) in Northeastern Illinois, U.S.A., from 24 000 to 17 600 BP and subsequent tundra-like ice-marginal paleoenvironments from 17 600 to 15 700 BP

    USGS Publications Warehouse

    Curry, B. Brandon; Yansa, C.H.

    2004-01-01

    Glacial deposits of the last glaciation associated with the Harvard sublobe (Lake Michigan lobe) in northeastern Illinois, U.S.A., occur between sediment with dateable organics. The lower organics include fragments of Picea sp. as young as 24 000 ?? 270 BP. The supraglacial organics occur sparsely in laminated silt and fine sand in landforms that are positioned relatively high on the landscape, such as deposits from ice-walled lakes. These terrestrial organics yield ages that are 2500 to 1300 14C years older than organics at the base of sediment successions in nearby kettle basins. Basal 14C ages from four upland sites range from 17 610 ?? 270 to 16 120 ?? 80 BP. Our revised time-distance diagram of the Harvard sublobe now reflects a period of stagnation from 24 000 to about 17 600 BP. The supraglacial lacustrine silt yielded plant macrofossil assemblages of primarily tundra plants, including Salix herbacea and Dryas integrifolia. These plants likely grew in supraglacial and ice-marginal environments. The ostracode fauna include Cytherissa lacustris and Limnocythere friabilis. Geomorphic relations and ostracode ecology indicate that more than 17 m of ice buttressed some of the supraglacial lakes.

  19. New and revised 14C dates for Hawaiian surface lava flows: Paleomagnetic and geomagnetic implications

    USGS Publications Warehouse

    Pressline, N.; Trusdell, F.A.; Gubbins, David

    2009-01-01

    Radiocarbon dates have been obtained for 30 charcoal samples corresponding to 27 surface lava flows from the Mauna Loa and Kilauea volcanoes on the Island of Hawaii. The submitted charcoal was a mixture of fresh and archived material. Preparation and analysis was undertaken at the NERC Radiocarbon Laboratory in Glasgow, Scotland, and the associated SUERC Accelerator Mass Spectrometry facility. The resulting dates range from 390 years B.P. to 12,910 years B.P. with corresponding error bars an order of magnitude smaller than previously obtained using the gas-counting method. The new and revised 14C data set can aid hazard and risk assessment on the island. The data presented here also have implications for geomagnetic modelling, which at present is limited by large dating errors. Copyright 2009 by the American Geophysical Union.

  20. Quantitative reconstruction of summer precipitation using a mid-Holocene δ13C common millet record from Guanzhong Basin, northern China

    NASA Astrophysics Data System (ADS)

    Yang, Qing; Li, Xiaoqiang; Zhou, Xinying; Zhao, Keliang; Sun, Nan

    2016-12-01

    To quantitatively reconstruct Holocene precipitation for particular geographical areas, suitable proxies and faithful dating controls are required. The fossilized seeds of common millet (Panicum miliaceum) are found throughout the sedimentary strata of northern China and are suited to the production of quantitative Holocene precipitation reconstructions: their isotopic carbon composition (δ13C) gives a measure of the precipitation required during the growing season of summer (here the interval from mid-June to September) and allows these seeds to be dated. We therefore used a regression function, as part of a systematic study of the δ13C of common millet, to produce a quantitative reconstruction of mid-Holocene summer precipitation in the Guanzhong Basin (107°40'-107°49' E, 33°39'-34°45' N). Our results showed that mean summer precipitation at 7.7-3.4 ka BP was 353 mm, ˜ 50 mm or 17 % higher than present levels, and the variability increased, especially after 5.2 ka BP. Maximum mean summer precipitation peaked at 414 mm during the period 6.1-5.5 ka BP, ˜ 109 mm (or 36 %) higher than today, indicating that the East Asian summer monsoon (EASM) peaked at this time. This work can provide a new proxy for further research into continuous paleoprecipitation sequences and the variability of summer precipitation, which will promote the further research into the relation between early human activity and environmental change.

  1. Sequence stratigraphy of the subaqueous Changjiang (Yangtze River) delta since the Last Glacial Maximum

    NASA Astrophysics Data System (ADS)

    Xu, Taoyu; Wang, Guoqing; Shi, Xuefa; Wang, Xin; Yao, Zhengquan; Yang, Gang; Fang, Xisheng; Qiao, Shuqing; Liu, Shengfa; Wang, Xuchen; Zhao, Quanhong

    2016-01-01

    This study focuses on sedimentary research at the subaqueous Changjiang (Yangtze River) delta, based on five high-resolution seismic profiles and seven borehole cores with accurate AMS 14C datings. Three distinct seismic units were identified from the seismic profiles according to seismic reflection characteristics, and five sedimentary facies were recognized from borehole cores. These facies constituted a fining upward sedimentary sequence in relation to postglacial sea-level transgression. Three sequence surfaces (sequence boundary (SB), transgressive surface (TS), and maximum flooding surface (MFS)) demarcate the boundaries between early transgressive system tract (E-TST), late transgressive system tract (L-TST), early highstand system tract (E-HST) and late highstand system tract (L-HST), which constitute the sixth order sequence. These system tracts were developed coevally with postglacial sea-level rise. E-TST (~ 19-12 ka BP) corresponds to an incised-valley infilling in the early stages of postglacial transgression whereas L-TST (~ 12-7.5 ka BP) was formed during the last stage of postglacial transgression. The progradational structure of L-TST reflected in seismic profiles is possibly related to the intensification of the East Asian summer monsoon. E-HST (~ 7.5-2 ka BP) was deposited in response to the highstand after maximum postglacial transgression was reached, while L-HST (~ 2 ka BP-present) was initiated by accelerated progradation of the Changjiang delta.

  2. Glacial terminations and the Last Interglacial in the Okhotsk Sea; Their implication to global climatic changes

    NASA Astrophysics Data System (ADS)

    Gorbarenko, Sergey; Velivetskaya, Tatyana; Malakhov, Mikhail; Bosin, Aleksandr

    2017-05-01

    Paleoclimate data from the Okhotsk Sea (OS) over Terminations II and I (TII, TI), and the Last and Present Interglacial (LIG, PIG) periods were compiled in order to examine Northern Hemisphere climate and sea level changes. Based on records of four AMS 14C-dated OS cores over TI-PIG, it is argued that the OS productivity/climate, IRD (ice-rafted debris), and benthic foraminiferal oxygen isotope (δ18Obf) proxies provide representative and in-phase evidence of the Northern Hemisphere climate and continental ice sheet changes consistent with the LR 04 δ18Obf curve. Chronologies for two central OS cores over TII-LIG-cooling event 23 (C23) were constructed by correlating OS productivity proxies with well-dated δ18O records of Chinese speleothems because OS environment is modulated by East Asian Monsoon; and, as well as correlating measured magnetic paleointensity excursions with those in the dated PISO-1500 paleointensity stack. Results show several OS climatic and environment states, including TII coeval with Asian Weak Monsoon Interval (WMI) II since 136 ka, LIG with a sharp two-step transition (130.2-129 ka) and demise at С25 (116.5 ka), and last glaciation with coolings at C24 (111 ka) and C23. The OS productivity and IRD records demonstrate certain climate amelioration in the middle of WMI-II, and two insignificant cooling events inside the LIG marked by C27 (126 ka) and C26 (120.6 ka). OS δ18Obf records of both cores demonstrate a gradual trend of lighter values since around 131.5 ka BP, continuing from the onset of LIG (129 ka) to minimum values at 126 ka BP (C27), then nearly constant values until 121.5 ka, followed by a slight increase up to 120.6 ka (C26), and a subsequent strong increase up to 116.5 ka (C25). The magnitude of OS δ18Obf oscillations is 1.35‰, which is less than those in the N. Atlantic. It may therefore be suggested that this OS index probably tracks changes in continental ice sheet volume and sea level.

  3. A physical map of the human regulator of complement activation gene cluster linking the complement genes CR1, CR2, DAF, and C4BP

    PubMed Central

    1988-01-01

    We report the organization of the human genes encoding the complement components C4-binding protein (C4BP), C3b/C4b receptor (CR1), decay accelerating factor (DAF), and C3dg receptor (CR2) within the regulator of complement activation (RCA) gene cluster. Using pulsed field gel electrophoresis analysis these genes have been physically linked and aligned as CR1-CR2-DAF-C4BP in an 800-kb DNA segment. The very tight linkage between the CR1 and the C4BP loci, contrasted with the relative long DNA distance between these genes, suggests the existence of mechanisms interfering with recombination within the RCA gene cluster. PMID:2450163

  4. Synthesis and characterization of 3-ketohexadecanoic acid-1-14-C, DL-3-hydroxyhexadecanoic acid-1-14-C, and trans-2-hexadecenoic acid-1-14-C.

    PubMed

    Jones, J A; Blecher, M

    1966-05-01

    The chemical synthesis and characterization of three intermediates in the Beta oxidation of palmitic acid-1-(14)C by rat liver mitochondria, namely, 3-ketohexadecanoic acid-1-(14)C, DL-3-hydroxyhexadecanoic acid-1-(14)C, and trans-2-hexadecenoic acid-1-(14)C, are described.

  5. The Arrival of Homo sapiens into the Southern Cone at 14,000 Years Ago

    PubMed Central

    Politis, Gustavo G.; Gutiérrez, María A.; Blasi, Adriana

    2016-01-01

    The Arroyo Seco 2 site contains a rich archaeological record, exceptional for South America, to explain the expansion of Homo sapiens into the Americas and their interaction with extinct Pleistocene mammals. The following paper provides a detailed overview of material remains found in the earliest cultural episodes at this multi-component site, dated between ca. 12,170 14C yrs B.P. (ca. 14,064 cal yrs B.P.) and 11,180 14C yrs B.P. (ca. 13,068 cal yrs B.P.). Evidence of early occupations includes the presence of lithic tools, a concentration of Pleistocene species remains, human-induced fractured animal bones, and a selection of skeletal parts of extinct fauna. The occurrence of hunter-gatherers in the Southern Cone at ca. 14,000 cal yrs B.P. is added to the growing list of American sites that indicate a human occupation earlier than the Clovis dispersal episode, but posterior to the onset of the deglaciation of the Last Glacial Maximum (LGM) in the North America. PMID:27683248

  6. The Arrival of Homo sapiens into the Southern Cone at 14,000 Years Ago.

    PubMed

    Politis, Gustavo G; Gutiérrez, María A; Rafuse, Daniel J; Blasi, Adriana

    The Arroyo Seco 2 site contains a rich archaeological record, exceptional for South America, to explain the expansion of Homo sapiens into the Americas and their interaction with extinct Pleistocene mammals. The following paper provides a detailed overview of material remains found in the earliest cultural episodes at this multi-component site, dated between ca. 12,170 14C yrs B.P. (ca. 14,064 cal yrs B.P.) and 11,180 14C yrs B.P. (ca. 13,068 cal yrs B.P.). Evidence of early occupations includes the presence of lithic tools, a concentration of Pleistocene species remains, human-induced fractured animal bones, and a selection of skeletal parts of extinct fauna. The occurrence of hunter-gatherers in the Southern Cone at ca. 14,000 cal yrs B.P. is added to the growing list of American sites that indicate a human occupation earlier than the Clovis dispersal episode, but posterior to the onset of the deglaciation of the Last Glacial Maximum (LGM) in the North America.

  7. Quantifying and overcoming bioturbation in marine sediment cores: dual 14C and δ18O analysis on single foraminifera

    NASA Astrophysics Data System (ADS)

    Lougheed, Bryan; Metcalfe, Brett; Wacker, Lukas

    2017-04-01

    Marine sediment cores used in palaeoceanography form the basis of our current understanding of past global climate and ocean chemistry. Precision and accuracy of geochronological control in these sediment cores are crucial in unravelling the timing of rapid shifts in palaeoclimate and, ultimately, the interdependency of global climate mechanisms and their causality. Aware of the problems associated with bioturbation (the mixing of ocean sediments by benthic organisms) palaeoceanographers generally aim to retrieve sediment cores from locations with high sediment accumulation rates, thus minimising the influence of bioturbation as much as possible. However, the practice of concentrating only on areas of the ocean floor with high sedimentation accumulation rates has the potential to introduce a geographical bias into our understanding of global palaeoclimate. For example, global time averaged sediment accumulation rates for the ocean floor (excluding continental margins) indicate that vast areas of the ocean floor have sediment accumulation rates less than the recommended minimum advised sediment accumulation rates of 10 cm/ka or greater. Whilst many studies have focussed on quantifying the impact of bioturbation on our understanding of the past, few have attempted to overcome the problems associated with bioturbation. Recent pioneering developments in 14C AMS at the Laboratory of Ion Beam Physics at ETH Zürich have led to the development of the Mini Carbon Dating System (MICADAS). This compact 14C AMS system can be coupled to a carbonate handling system, thus enabling the direct AMS measurement of gaseous samples, i.e. without graphitisation, allowing for the analysis of carbonate samples of <100 μg. Likewise, while earlier isotope ratio mass spectrometry (IRMS) technology required a minimum of 100 μg of carbonate to produce a successful δ18O measurement, more recent advances in IRMS technology have made routine measurements of as little as 5 μg possible

  8. Lake sediment records on climate change and human activities in the Xingyun Lake catchment, SW China.

    PubMed

    Zhang, Wenxiang; Ming, Qingzhong; Shi, Zhengtao; Chen, Guangjie; Niu, Jie; Lei, Guoliang; Chang, Fengqin; Zhang, Hucai

    2014-01-01

    Sediments from Xinyun Lake in central Yunnan, southwest China, provide a record of environmental history since the Holocene. With the application of multi-proxy indicators (total organic carbon (TOC), total nitrogen (TN), δ13C and δ15N isotopes, C/N ratio, grain size, magnetic susceptibility (MS) and CaCO3 content), as well as accelerator mass spectrometry (AMS) 14C datings, four major climatic stages during the Holocene have been identified in Xingyun's catchment. A marked increase in lacustrine palaeoproductivity occurred from 11.06 to 9.98 cal. ka BP, which likely resulted from an enhanced Asian southwest monsoon and warm-humid climate. Between 9.98 and 5.93 cal. ka BP, a gradually increased lake level might have reached the optimum water depth, causing a marked decline in coverage by aquatic plants and lake productivity of the lake. This was caused by strong Asian southwest monsoon, and coincided with the global Holocene Optimum. During the period of 5.60-1.35 cal. ka BP, it resulted in a warm and dry climate at this stage, which is comparable to the aridification of India during the mid- and late Holocene. The intensifying human activity and land-use in the lake catchment since the early Tang Dynasty (∼1.35 cal. ka BP) were associated with the ancient Dian culture within Xingyun's catchment. The extensive deforestation and development of agriculture in the lake catchment caused heavy soil loss. Our study clearly shows that long-term human activities and land-use change have strongly impacted the evolution of the lake environment and therefore modulated the sediment records of the regional climate in central Yunnan for more than one thousand years.

  9. Abrupt hydroclimate disruption across the Australian arid zone 50 ka coincident with human colonization

    NASA Astrophysics Data System (ADS)

    Miller, G. H.; Fogel, M. L.; Magee, J. W.; Gagan, M. K.

    2016-12-01

    Although many studies focus on how climate change impacted ancient societies, in Australia a growing body of evidence indicates that activities of the earliest human colonizers in turn altered the Australian climate. We utilize the stable isotopes of carbon and oxygen preserved in near-continuous 100 ka time series of avian eggshell from five regions across the Australian arid zone to reconstruct ecosystem status (d13C) and effective moisture (d18O). Training sets of sub-modern samples provide the basis for the reconstructions. Together, d13C and d18O provide independent estimates of ecosystem status and climate over the past 100 ka from the same dated sample, reducing correlation uncertainties between proxies. Changes in eggshell d13C document a dramatic reduction of palatable summer-wet C4 grasses in all regions between 50 and 45 ka, that has persisted through to modern times. Continuous 100 ka records of effective moisture derived from eggshell d18O show moist conditions from 100 to 60 ka, with variable drying after 60 ka, but the strong shift toward greatest aridity is coincident with the onset of the last glacial maximum 30 ka ago, 15 ka after the observed ecosystem restructuring. Combining the d13C and d18O time-series shows that an abrupt and permanent restructuring of the moisture/ecosystem balance occurred between 50 and 45 ka. Additional studies show that most large monsoon-fed inland arid-zone lakes carried permanent water at least intermittently between 120 and 50 ka, but never experienced permanent deep-water status after 45 ka, despite a wide range of global climate states, including the early Holocene when most other monsoon systems were reinvigorated. The lack of exceptional climate shifts either locally or globally between 60 and 40 ka eliminates climate as the cause of the ecosystem restructuring and persistent lake desiccation. Collectively these data suggest the wave of human colonization across Australia in altered land surface characteristics

  10. Sea-level changes and shelf break prograding sequences during the last 400 ka in the Aegean margins: Subsidence rates and palaeogeographic implications

    NASA Astrophysics Data System (ADS)

    Lykousis, V.

    2009-09-01

    The subsidence rates of the Aegean margins during the Middle-Upper Pleistocene were evaluated based on new and historical seismic profiling data. High-resolution seismic profiling (AirGun, Sparker and 3.5 kHz) have shown that (at least) four major oblique prograding sequences can be traced below the Aegean marginal slopes at increasing subbottom depths. These palaeo-shelf break glacial delta sediments have been developed during successive low sea-level stands (LST prograding sequences), suggesting continuous and gradual subsidence of the Aegean margins during the last 400 ka. Subsidence rates of the Aegean margins were calculated from the vertical displacement of successive topset-to-foreset transitions (palaeo-shelf break) of the LST prograding sediment sequences. The estimated subsidence rates that were calculated in the active boundaries of the Aegean microplate (North Aegean margins, Gulfs of Patras and Corinth) are high and range from 0.7 to 1.88 m ka -1, while the lowest values (0.34-0.60 m ka -1) are related to the low tectonic and seismic activity margins like the margin of Cyclades plateau. Lower subsidence rates (0.34-0.90 m ka -1) were estimated for the period 146-18 ka BP (oxygen isotopic stages 6-2) and higher (1.46-1.88 m ka -1) for the period from 425 to 250 ka BP (oxygen isotopic stages 12/10-8). A decrease of about 50% of the subduction rates in the Aegean margins was observed during the last 400 ka. During the isotopic stages 8, 10, 11 and 12, almost the 50-60% of the present Aegean Sea was land with extensive drainage systems and delta plains and large lakes in the central and North Aegean. Marine transgression in the North Aegean was rather occurred during the isotopic 9 interglacial period. The estimated palaeomorphology should imply fan delta development and sediment failures in the steep escarpments of the North Aegean margins and high sedimentation rates and turbidite sediment accumulation in the basins. It is deduced that the Black Sea was

  11. Late Holocene monsoon climate of northeastern Taiwan inferred from elemental (C, N) and isotopic (δ13C, δ15N) data in lake sediments

    NASA Astrophysics Data System (ADS)

    Selvaraj, Kandasamy; Wei, Kuo-Yen; Liu, Kon-Kee; Kao, Shuh-Ji

    2012-03-01

    Little information exists about centennial-scale climate variability on oceanic islands in the western Pacific where the East Asian monsoon (EAM) strongly influences the climate, mountain ecosystem and the society. In this study, we investigate a 168 cm long sediment core recovered from Emerald Peak Lake in subalpine NE Taiwan for the contents of grain size, total organic carbon (TOC), C/N ratio, and stable isotopes (δ13C and δ15N) to reconstruct the monsoon climate and vegetation density during the late Holocene. Six radiocarbon (14C) ages obtained on plant remains used for the chronology indicate that the sediment core has been accumulated since ˜3770 cal BP with a mean sedimentation rate of 44.6 cm/ka. The sub-centennial resolution of our proxy records reveals strong fluctuations of the EAM and vegetation density for the past ˜3770 cal BP. The greater contents of coarse and medium sediments with overall decreasing trends from 3770 to 2000 cal BP suggest an increasing fine sediment influx from the catchment likely due to an increasing lake water level. Although low TOC content, C/N ratio, and enriched δ13C values in bulk and fine sediments during this interval suggest a sparsely vegetated catchment, increasing trends of TOC content and C/N ratio together with decreasing trends of δ13C and δ15N values indicate a strengthening pattern of summer monsoon. This is in contrast to a decreasing monsoon strength inferred from Dongge Cave δ18O record at that time, supporting the idea of anti-phasing of summer EAM and Indian summer monsoon. Since 2000 cal BP, higher content of fine sediments with high TOC content and C/N ratio but relatively depleted δ13C and low δ15N values suggest a high but stable lake water level and dense C3 plants, consistent with a stronger summer monsoon in a wet climate. Within this general trend, we interpret a prominent change of proxy parameters in sediments from ˜560 to 150 cal BP, as subtropical evidence for the Little Ice Age in NE

  12. The timing, two-pulsed nature, and variable climatic expression of the 4.2 ka event: A review and new high-resolution stalagmite data from Namibia

    NASA Astrophysics Data System (ADS)

    Railsback, L. Bruce; Liang, Fuyuan; Brook, G. A.; Voarintsoa, Ny Riavo G.; Sletten, Hillary R.; Marais, Eugene; Hardt, Ben; Cheng, Hai; Edwards, R. Lawrence

    2018-04-01

    The climatic event between 4.2 and 3.9 ka BP known as the "4.2 ka event" is commonly considered to be a synchronous global drought that happened as one pulse. However, careful comparison of records from around the world shows that synchrony is possible only if the published chronologies of the various records are shifted to the extent allowed by the uncertainties of their age data, that several records suggest a two-pulsed event, and that some records suggest a wet rather than dry event. The radiometric ages constraining those records have uncertainties of several decades if not hundreds of years, and in some records the event is represented by only one or two analyses. This paper reports a new record from Stalagmite DP1 from northeastern Namibia in which high 230Th/232Th activity ratios allow small age uncertainties ranging between only 10-28 years, and the event is documented by more than 35 isotopic analyses and by petrographic observation of a surface of dissolution. The ages from Stalagmite DP1 combine with results from 11 other records from around the world to suggest an event centered at about 4.07 ka BP with bracketing ages of 4.15 to 3.93 ka BP. The isotopic and petrographic results suggest a two-pulsed wet event in northeastern Namibia, which is in the Southern Hemisphere's summer rainfall zone where more rain presumably fell with southward migration of the Inter-Tropical Convergence Zone as the result of cooling in the Northern Hemisphere. Comparison with other records from outside the region of dryness from the Mediterranean to eastern Asia suggests that multiple climatic zones similarly moved southward during the event, in some cases bringing wetter conditions that contradict the notion of global drought.

  13. Determination of the pKa of the N-terminal amino group of ubiquitin by NMR

    PubMed Central

    Oregioni, Alain; Stieglitz, Benjamin; Kelly, Geoffrey; Rittinger, Katrin; Frenkiel, Tom

    2017-01-01

    Ubiquitination regulates nearly every aspect of cellular life. It is catalysed by a cascade of three enzymes and results in the attachment of the C-terminal carboxylate of ubiquitin to a lysine side chain in the protein substrate. Chain extension occurs via addition of subsequent ubiquitin molecules to either one of the seven lysine residues of ubiquitin, or via its N-terminal α-amino group to build linear ubiquitin chains. The pKa of lysine side chains is around 10.5 and hence E3 ligases require a mechanism to deprotonate the amino group at physiological pH to produce an effective nucleophile. In contrast, the pKa of N-terminal α-amino groups of proteins can vary significantly, with reported values between 6.8 and 9.1, raising the possibility that linear chain synthesis may not require a general base. In this study we use NMR spectroscopy to determine the pKa for the N-terminal α-amino group of methionine1 of ubiquitin for the first time. We show that it is 9.14, one of the highest pKa values ever reported for this amino group, providing a rational for the observed need for a general base in the E3 ligase HOIP, which synthesizes linear ubiquitin chains. PMID:28252051

  14. AixMICADAS, the accelerator mass spectrometer dedicated to 14C recently installed in Aix-en-Provence, France

    NASA Astrophysics Data System (ADS)

    Bard, Edouard; Tuna, Thibaut; Fagault, Yoann; Bonvalot, Lise; Wacker, Lukas; Fahrni, Simon; Synal, Hans-Arno

    2015-10-01

    A compact AMS system dedicated to measuring 14C in ultra-small samples was installed at the CEREGE in Aix-en-Provence at the end of March 2014, together with an automated graphitization system. AixMICADAS operates at around 200 kV with carbon ion stripping in helium leading to a transmission of about 47%. The hybrid ion source works with graphite targets and CO2 gas. It is coupled to a versatile gas interface system that ensures stable gas measurements from different sources: a cracker for CO2 in glass ampoules, an elemental analyzer for combusting organic matter and an automated system to handle carbonate by wet chemistry. The analyses performed during the first half-year of operation show that a precision of about 2‰ is reached on modern samples of about 1 mg of carbon. Measurements of IAEA reference materials of various 14C ages show a good agreement with consensus values. Direct measurements of geological graphites indicate a machine background equivalent to an age of 68,000 years BP. AixMICADAS is thus limited solely by the 14C contamination of samples in the field and in the laboratory. The performances of the gas ion source and its gas interface system were tested with two CO2 production units: the elemental analyzer and the automated carbonate hydrolysis unit. These tests show that samples ranging between 10 and 100 μg C can produce a 12C- ion beam of the order of 10-15 μA during time spans ranging from 3 to 30 min depending on the sample mass. Coupling the automated hydrolysis system to the gas ion source of AixMICADAS, enables us to develop a method involving sequential leaching of carbonate samples with direct 14C measurements of the leached fractions and the residual sample. The main advantage is that all of steps leaching and hydrolysis are performed in the same vial for a particular sample. A sequential leaching was applied to a young carbonate sample (ca. 6600 years BP) whose 14C age agrees with previous determination and which shows no sign of

  15. Effect of methylation on the side-chain pKa value of arginine.

    PubMed

    Evich, Marina; Stroeva, Ekaterina; Zheng, Yujun George; Germann, Markus W

    2016-02-01

    Arginine methylation is important in biological systems. Recent studies link the deregulation of protein arginine methyltransferases with certain cancers. To assess the impact of methylation on interaction with other biomolecules, the pKa values of methylated arginine variants were determined using NMR data. The pKa values of monomethylated, symmetrically dimethylated, and asymmetrically dimethylated arginine are similar to the unmodified arginine (14.2 ± 0.4). Although the pKa value has not been significantly affected by methylation, consequences of methylation include changes in charge distribution and steric effects, suggesting alternative mechanisms for recognition. © 2015 The Protein Society.

  16. Hunter-Gatherer Responses to the 8.2 Ka Cold Event in the Fennoscandian Arctic

    NASA Astrophysics Data System (ADS)

    Manninen, M. A.

    2014-12-01

    Because of a marked influence of warm Atlantic water to primary productivity in the Barents Sea, the marine ecosystem in northernmost Fennoscandia is sensitive to disturbances in the North Atlantic oceanographic system. The 8.2 ka climate event, according to current knowledge, was triggered by a disturbance in the North Atlantic Thermohaline circulation. This suggests concurrent and strong climatic and marine cooling in the area covering the northernmost parts of Finland, Norway, and Sweden during the climate event. In this area ecosystem response to the 8.2 ka event can therefore be expected to have been prominent, which in turn should be reflected in the contemporary human socio-economic systems. A study that employs lithic technological, statistical, and spatial analyses of Late Mesolithic (ca. 8450-6850 cal BP) lithic technology and settlement configuration in the area indicates that lithic technology and settlement patterns were reorganised following the climatic and marine cooling. The studied groups changed their lithic technology as a result of developments that led to increased use of terrestrial resources and an accompanying long-distance coast/inland residential mobility pattern. Besides lithic technological changes and long-distance mobility on land, decreased marine productivity probably also explains the disappearance of semi-subterranean houses from the coast at ca. 8200 cal BP, while their reappearance after ca. 7500 cal BP can be linked to a increased influx of warm salty water into the Barents Sea. The results suggest that in the past a long period of decreased influx of Atlantic water into the Barents Sea has had disastrous consequences for the marine ecosystem. At present the Barents Sea fisheries have notable economic importance and produce, for example, over 90% of the Norwegian Atlantic cod (Gadus morhua) catch.

  17. Monsoon Related Fluctuations in Terrigenous Sedimentation and Biological Productivity in the Bay of Bengal During the Past 24,500 Years

    NASA Astrophysics Data System (ADS)

    K V, S.; Kurian, J.; Meloth, T.; Rasik, R.

    2011-12-01

    Reconstruction of the Indian monsoon precipitation on a centennial to millennial scale has important relevance on the future climate and hydrologic change over the entire South Asia. Here we present paleo-monsoon records from a AMS 14C dated sediment core from the Bay of Bengal (ABP-24/01; location - 11°15.52' N & 90°21.84' E, water depth - 3206 m) that span the past 24.5 ka BP (calendar age). The array of inorganic and organic geochemical proxy records examined here assist the reconstruction of monsoon associated precipitation/ runoff, oceanic productivity and water column processes during the last glacial maximum (LGM ~21±2 ka BP) to the late Holocene. During the early stages of LGM, terrigenous elemental concentrations (Al, Fe) remained low, with substantial increase towards late LGM stage. Significantly, the substantial LGM increase in the eolian proxy concentrations (Mg, Rb) suggest that with the diminishing strength of the rain bearing SW monsoon during LGM the dry NE monsoon strengthened, leading to increased dust input to the Bay of Bengal. Although the LGM biological productivity (Corg, CaCO3, Ba) at the site remained low due to the relative decrease in runoff-derived nutrients, the ocean bottom seems to have less ventilated (Mn, U, V). The deglacial period is associated with slightly increasing monsoonal runoff increasing trend in terrigenous input, without any increase in biological productivity. Interestingly, the enhanced terrigenous input to the core site occurred during 12.5 - 10 ka BP. The Holocene was characterised by a dramatic increase in biological productivity between 8.5 and 7 ka BP as well as relatively enhanced river influx. While the various proxy records suggest a substantial decrease in monsoonal terrigenous influx after 7 ka BP, the productivity records remained at elevated values with better ventilated bottom waters.

  18. A 27cal ka biomarker-based record of ecosystem changes from lacustrine sediments of the Chihuahua Desert of Mexico

    NASA Astrophysics Data System (ADS)

    Chávez-Lara, C. M.; Holtvoeth, J.; Roy, P. D.; Pancost, R. D.

    2018-07-01

    Hydroclimate variation of the northwest Mexico during the late Pleistocene and Holocene is an active area of debate, with uncertainty in the nature and sources of precipitation. Previous research has inferred the influences of winter storms, summer monsoonal rain and autumn tropical cyclones. The impacts on regional and local ecosystems, however, are not well constrained. Here, we investigate the response of lacustrine and terrestrial habitats of the Santiaguillo Basin in the Chihuahua Desert (Mexico) to hydrological changes occurring since the late last glacial. Biomarkers from the sediments reflect variable input of organic matter (OM) from algal and bacterial biomass, aquatic microfauna and surrounding vegetation, revealing distinct stages of ecosystem adaption over the last 27 cal ka. Based on previously published and new data, we show that a perennial productive lake was present during the late glacial and it persisted until 17.5 cal ka BP. Coinciding with Heinrich event 1, OM supply from deteriorating wetland soils may have been caused by early dry conditions. Further phases of increasing aridity and a shrinking water body drove changing OM quality and biomarker composition during the early and mid-Holocene. A pronounced shift in biomarker distributions at 4 cal ka BP suggests that the supply of plant litter from resinous trees and grasses increased, likely reflecting the establishment of modern vegetation. Our results illustrate the potential of biomarker applications in the area, adding to the evidence of hydroclimate variability and enabling reconstructions of local ecosystem dynamics.

  19. A multi-proxy intercomparison of environmental change in two maar lake records from central Turkey during the last 14 ka

    NASA Astrophysics Data System (ADS)

    Roberts, C. Neil; Allcock, Samantha L.; Arnaud, Fabien; Dean, Jonathan R.; Eastwood, Warren J.; Jones, Matthew D.; Leng, Melanie J.; Metcalfe, Sarah E.; Malet, Emmanuel; Woodbridge, Jessie; Yiǧitbaşıoǧlu, Hakan

    2016-04-01

    Individual palaeoenvironmental records are a combination of regional-scale (e.g. climatic) and local factors. In order to separate these signals, we compare multiple proxies from two nearby maar lake records, on the assumption that common signals are due to regional-scale forcing. On the other side, we infer that residual signals are likely to be local and site-specific, rather than reflecting regional climate changes. A new core sequence from Nar lake has been dated by varve counting and U-Th as covering the last 13,800 years (Dean et al., 2015; Roberts et al., 2016). Periods of marked dryness are associated with peaks in Mg/dolomite, elevated Diatom-Inferred Electrical Conductivity, an absence of laminated sediments, and low Quercus/chenopod ratios. These conditions occurred during the Late-Glacial stadial, at 4.3-3.7 and 3.2-2.6 ka BP. Wet phases occurred during the early Holocene and again 1.5-0.6 ka, characterised by negative δ18O values, calcite precipitation, high Ca/Sr ratios, a high % of planktonic diatoms, laminated sediments, and high Quercus/chenopod ratios. Comparison with the independently dated record from Eski Acıgöl (Roberts et al., 2001) shows good correspondence for many proxies, especially for δ18O. A ranking of multiple proxies shows the worst correspondence is for clastic lithogenic elements (e.g. Ti flux). Differences between the two lake records are caused by basin infilling at Eski Acıgöl, which fails to register climatic changes during the last 2 ka, and to catchment erosion and increased flux of lithogenic elements into Nar lake; this is catchment-specific and primarily anthropogenic rather than climatic in origin. In separating a regional signal from site-specific "noise", two lakes may therefore be better than one. Dean, J.R. et al. 2015 Eastern Mediterranean hydroclimate over the late glacial and Holocene, reconstructed from the sediments of Nar lake, central Turkey, using stable isotopes and carbonate mineralogy. Quaternary

  20. CacyBP/SIP as a regulator of transcriptional responses in brain cells

    PubMed Central

    Kilanczyk, Ewa; Filipek, Anna; Hetman, Michal

    2014-01-01

    Summary The Calcyclin-Binding Protein/Siah-1-Interacting Protein (CacyBP/SIP) is highly expressed in the brain and was shown to regulate the β-catenin-driven transcription in thymocytes. Therefore, it was investigated whether in brain cells CacyBP/SIP might play a role as a transcriptional regulator. In BDNF- or forskolin-stimulated rat primary cortical neurons, overexpression of CacyBP/SIP enhanced transcriptional activity of the cAMP-response element (CRE). In addition, overexpressed CacyBP/SIP enhanced BDNF-mediated activation of the Nuclear Factor of Activated T-cells (NFAT) but not the Serum Response Element (SRE). These stimulatory effects required an intact C-terminal domain of CacyBP/SIP. Moreover, in C6 rat glioma cells, the overexpressed CacyBP/SIP enhanced activation of CRE- or NFAT- following forskolin- or serum stimulation, respectively. Conversely, knockdown of endogenous CacyBP/SIP reduced activation of CRE- and NFAT but not SRE. Taken together, these results indicate that CacyBP/SIP is a novel regulator of CRE- and NFAT-driven transcription. PMID:25163685

  1. Thinning History of the Weddell Sea Embayment Using in situ 14C Exposure Ages from the Lassiter Coast

    NASA Astrophysics Data System (ADS)

    Nichols, K. A.; Johnson, J.; Goehring, B. M.; Balco, G.

    2017-12-01

    We present a suite of in situ 14C cosmogenic nuclide exposure ages from nunataks at the Lassiter Coast in West Antarctica on the west side of the Weddell Sea Embayment (WSE) to constrain the thinning history of the Ronne-Filchner Ice Shelf. Constraints on past ice extents in the WSE remain relatively understudied, despite the WSE draining 22% of the Antarctic Ice Sheet (AIS). Information lacking includes unambiguous geological evidence for the maximum Last Glacial Maximum (LGM) ice thickness and the timing of subsequent ice retreat in key peripheral locations. Past studies using long-lived cosmogenic nuclides have shown that, due to the cold-based nature of the AIS, inheritance of nuclide concentrations from previous periods of exposure is a common problem. We utilised the cosmogenic nuclide 14C to circumvent the issue of inheritance. The short half-life of 14C means measured concentrations are largely insensitive to inheritance, as relatively short periods of ice cover (20-30 kyr) result in significant 14C decay. Furthermore, samples saturated in 14C will demonstrate that their location was above the maximum LGM thickness of the ice sheet and exposed for at least the past ca. 35 kyr. Preliminary results from four samples indicate elevations between 63 and 360 m above the present-day ice surface elevations were deglaciated between 7 and 6 ka. With little exposed rock above these elevations (ca. 70 m), this may indicate that the locality was entirely covered by ice during the LGM. Additional 14C measurements will form a full elevation transect of samples to decipher the post-LGM thinning history of ice at this location.

  2. Sea ice cover variability and river run-off in the western Laptev Sea (Arctic Ocean) since the last 18 ka

    NASA Astrophysics Data System (ADS)

    Hörner, T.; Stein, R.; Fahl, K.; Birgel, D.

    2015-12-01

    Multi-proxy biomarker measurements were performed on two sediment cores (PS51/154, PS51/159) with the objective reconstructing sea ice cover (IP25, brassicasterol, dinosterol) and river-runoff (campesterol, β-sitosterol) in the western Laptev Sea over the last 18 ka with unprecedented temporal resolution. The sea ice cover varies distinctly during the whole time period. The absence of IP25 during 18 and 16 ka indicate that the western Laptev Sea was mostly covered with permanent sea ice (pack ice). However, a period of temporary break-up of the permanent ice coverage occurred at c. 17.2 ka (presence of IP25). Very little river-runoff occurred during this interval. Decreasing terrigenous (riverine) input and synchronous increase of marine produced organic matter around 16 ka until 7.5 ka indicate the gradual establishment of a marine environment in the western Laptev Sea related to the onset of the post-glacial transgression of the shelf. Strong river run-off and reduced sea ice cover characterized the time interval between 15.2 and 12.9 ka, including the Bølling/Allerød warm period (14.7 - 12.9 ka). Moreover, the DIP25 Index (ratio of HBI-dienes and IP25) might document the presence of Atlantic derived water at the western Laptev Sea shelf area. A sudden return to severe sea ice conditions occurred during the Younger Dryas (12.9 - 11.6 ka). This abrupt climate change was observed in the whole circum-Arctic realm (Chukchi Sea, Bering Sea, Fram Strait and Laptev Sea). At the onset of the Younger Dryas, a distinct alteration of the ecosystem (deep drop in terrigenous and phytoplankton biomarkers) may document the entry of a giant freshwater plume, possibly relating to the Lake Agassiz outburst at 13 ka. IP25 concentrations increase and higher values of the PIP25 Index during the last 7 ka reflect a cooling of the Laptev Sea spring season. Moreover, a short-term variability of c. 1.5 thousand years occurred during the last 12 ka, most probably following Bond Cycles.

  3. Critical evaluation of climate syntheses to benchmark CMIP6/PMIP4 127 ka Last Interglacial simulations in the high-latitude regions

    NASA Astrophysics Data System (ADS)

    Capron, E.; Govin, A.; Feng, R.; Otto-Bliesner, B. L.; Wolff, E. W.

    2017-07-01

    The Last Interglacial (LIG, ∼129-116 thousand years ago, ka) represents an excellent case study to investigate the response of sensitive components of the Earth System and mechanisms of high-latitude amplification to a climate warmer than present-day. The Paleoclimate Model Intercomparison Project (Phase 4, hereafter referred as PMIP4) and the Coupled Model Intercomparison Project (Phase 6, hereafter referred as CMIP6) are coordinating the design of (1) a LIG Tier 1 equilibrium simulation to simulate the climate response at 127 ka, a time interval associated with a strong orbital forcing and greenhouse gas concentrations close to preindustrial levels and (2) associated Tier 2 sensitivity experiments to examine the role of the ocean, vegetation and dust feedbacks in modulating the response to this orbital forcing. Evaluating the capability of the CMIP6/PMIP4 models to reproduce the 127 ka polar and sub-polar climate will require appropriate data-based benchmarks which are currently missing. Based on a recent data synthesis that offers the first spatio-temporal representation of high-latitude (i.e. poleward of 40°N and 40°S) surface temperature evolution during the LIG, we produce a new 126-128 ka time slab, hereafter named 127 ka time slice. This 127 ka time slice represents surface temperature anomalies relative to preindustrial and is associated with quantitative estimates of the uncertainties related to relative dating and surface temperature reconstruction methods. It illustrates warmer-than-preindustrial conditions in the high-latitude regions of both hemispheres. In particular, summer sea surface temperatures (SST) in the North Atlantic region were on average 1.1 °C (with a standard error of the mean of 0.7 °C) warmer relative to preindustrial and 1.8 °C (with a standard error of the mean of 0.8 °C) in the Southern Ocean. In Antarctica, average 127 ka annual surface air temperature was 2.2 °C (with a standard error of the mean of 1.4 °C) warmer

  4. A 400-ka tephrochronological framework for Central America from Lake Petén Itzá (Guatemala) sediments

    NASA Astrophysics Data System (ADS)

    Kutterolf, S.; Schindlbeck, J. C.; Anselmetti, F. S.; Ariztegui, D.; Brenner, M.; Curtis, J.; Schmid, D.; Hodell, D. A.; Mueller, A.; Pérez, L.; Pérez, W.; Schwalb, A.; Frische, M.; Wang, K.-L.

    2016-10-01

    Lake Petén Itzá, northern Guatemala, lies within a hydrologically closed basin in the south-central area of the Yucatán Peninsula, and was drilled under the auspices of the International Continental Scientific Drilling Program (ICDP) in 2006. At 16°55‧N latitude, the lake is ideally located for study of past climate and environmental conditions in the Neotropical lowlands. Because of its great depth (>160 m), Lake Petén Itzá has a record of continuous sediment accumulation that extends well into the late Pleistocene. A key obstacle to obtaining long climate records from the region is the difficulty of establishing a robust chronology beyond ∼40 ka, the limit of 14C dating. Tephra layers within the Lake Petén Itzá sediments, however, enable development of age/depth relations beyond 40 ka. Ash beds from large-magnitude, Pleistocene-to-Holocene silicic eruptions of caldera volcanoes along the Central American Volcanic Arc (CAVA) were found throughout drill cores collected from Lake Petén Itzá. These ash beds were used to establish a robust chronology extending back 400 ka. We used major- and trace-element glass composition to establish 12 well-constrained correlations between the lacustrine tephra layers in Lake Petén Itzá sediments and dated deposits at the CAVA source volcanoes, and with their marine equivalents in eastern Pacific Ocean sediments. The data also enabled revision of eight previous determinations of erupted volumes and masses, and initial estimates for another four eruptions, as well as the designation of source areas for 14 previously unknown eruptions. The new and revised sedimentation rates for the older sediment successions identify the interglacial of MIS5a between 84 and 72 ka, followed by a stadial between 72 and 59 ka that corresponds to MIS4. We modified the age models for the Lake Petén Itzá sediment sequences, extended the paleoclimate and paleoecological record for this Neotropical region to ∼400 ka, and determined the

  5. Novel cAMP binding protein-BP (CREBBP) mutation in a girl with Rubinstein-Taybi syndrome, GH deficiency, Arnold Chiari malformation and pituitary hypoplasia

    PubMed Central

    2013-01-01

    Background Rubinstein-Taybi syndrome (RTS) is a rare autosomal dominant disorder (prevalence 1:125,000) characterised by broad thumbs and halluces, facial dysmorphism, psychomotor development delay, skeletal defects, abnormalities in the posterior fossa and short stature. The known genetic causes are point mutations or deletions of the cAMP-response element binding protein-BP (CREBBP) (50-60% of the cases) and of the homologous gene E1A-binding protein (EP300) (5%). Case presentation We describe, for the first time in literature, a RTS Caucasian girl, 14-year-old, with growth hormone (GH) deficiency, pituitary hypoplasia, Arnold Chiari malformation type 1, double syringomyelic cavity and a novel CREBBP mutation (c.3546insCC). Conclusion We hypothesize that CREBBP mutation we have identified in this patient could be responsible also for RTS atypical features as GH deficiency and pituitary hypoplasia. PMID:23432975

  6. Surface-exposure ages of Front Range moraines that may have formed during the Younger Dryas, 8.2 cal ka, and Little Ice Age events

    USGS Publications Warehouse

    Benson, L.; Madole, R.; Kubik, P.; McDonald, R.

    2007-01-01

    Surface-exposure (10Be) ages have been obtained on boulders from three post-Pinedale end-moraine complexes in the Front Range, Colorado. Boulder rounding appears related to the cirque-to-moraine transport distance at each site with subrounded boulders being typical of the 2-km-long Chicago Lakes Glacier, subangular boulders being typical of the 1-km-long Butler Gulch Glacier, and angular boulders being typical of the few-hundred-m-long Isabelle Glacier. Surface-exposure ages of angular boulders from the Isabelle Glacier moraine, which formed during the Little Ice Age (LIA) according to previous lichenometric dating, indicate cosmogenic inheritance values ranging from 0 to ???3.0 10Be ka.11Surface-exposure ages in this paper are labeled 10Be; radiocarbon ages are labeled 14C ka, calendar and calibrated radiocarbon ages are labeled cal ka, and layer-based ice-core ages are labeled ka. 14C ages, calibrated 14C ages, and ice core ages are given relative to AD 1950, whereas 10Be ages are given relative to the sampling date. Radiocarbon ages were calibrated using CALIB 5.01 and the INTCAL04 data base Stuiver et al. (2005). Ages estimated using CALIB 5.01 are shown in terms of their 1-sigma range. Subangular boulders from the Butler Gulch end moraine yielded surface-exposure ages ranging from 5 to 10.2 10Be ka. We suggest that this moraine was deposited during the 8.2 cal ka event, which has been associated with outburst floods from Lake Agassiz and Lake Ojibway, and that the large age range associated with the Butler Gulch end moraine is caused by cosmogenic shielding of and(or) spalling from boulders that have ages in the younger part of the range and by cosmogenic inheritance in boulders that have ages in the older part of the range. The surface-exposure ages of eight of nine subrounded boulders from the Chicago Lakes area fall within the 13.0-11.7 10Be ka age range, and appear to have been deposited during the Younger Dryas interval. The general lack of inheritance in

  7. Large Variations of Atmospheric 14C Associated With Dansgaard-Oeschger Cycles 10- 13

    NASA Astrophysics Data System (ADS)

    Weyhenmeyer, C. E.; Burns, S. J.; Fleitmann, D.; Mangini, A.; Matter, A.; Guilderson, T.; Reimer, P. J.

    2006-12-01

    A 1.7 m long stalagmite from Moomi Cave, Socotra Island in the Indian Ocean provides a continuous, high- resolution record of climate change between 53 and 41 kyr BP. In the northern high-latitude regions, this time period is characterized by several rapid climate change events, corresponding to Dansgaard-Oeschger (D/O) cycles 10-13. It has been suggested that these D/O cycles may be global events but high-resolution data from the low-latitude regions are scarce. As a result, the driving and feedback mechanisms of these rapid changes remain poorly understood. The presented stalagmite data of U/Th, stable isotopes (del 18O, del 13C) and radiocarbon (14C) provide unique information regarding the nature and timing of rapid climate changes in the tropics. A depth-age model for the Moomi Cave stalagmite was developed from 25 high-precision U/Th measurements, providing a solid chronology for this record. Oxygen isotope measurements of the stalagmite calcite reveal several large variations that are believed to reflect changes in the amount of precipitation, rather than temperature. A comparison to the Greenland Ice Core records shows a remarkable similarity to D/O cycles 10- 13 with warmer periods in the high-latitude regions being associated with increased precipitation in the tropics and vice versa. The stalagmite radiocarbon (14C) values from over 100 individual measurements reveal an almost identical cyclic pattern, tracing all four D/O cycles. Assuming no changes in the carbonate chemistry of the precipitating fluid, the radiocarbon values of the stalagmite calcite directly reflect changes in global atmospheric 14C concentrations. There are three possible explanations for these cyclic variations of 14C values: 1) changes in the carbonate chemistry of the drip water resulting in changes of the dead carbon fraction (DCF); 2) changes in the solar activity and/or Earth's magnetic field resulting in direct variations of atmospheric 14C concentrations; and 3) changes in

  8. Ocean-atmosphere interactions as drivers of mid-to-late Holocene rapid climate changes: Evidence from high-resolution stalagmite records at DeSoto Caverns, Southeast USA

    NASA Astrophysics Data System (ADS)

    Aharon, Paul; Dhungana, Rajesh

    2017-08-01

    Oxygen and carbon isotope time-series derived from an actively growing aragonitic stalagmite in DeSoto Caverns exhibit with unusual clarity rapid hydroclimate changes in the mid-to-late Holocene. Data consist of 1884 δ18O and δ13C determinations whose chronology is anchored on 35 230Th/234U absolute dates in the interval 6.0-1.1 cal ka BP. Exceptional 18O and 13C-enrichments centered at 4.8 ± 0.14 cal ka BP likely represent the imprints of a severe drought. Isotope cycles from 4.7 to 1.3 cal ka BP, exhibit a dominant periodicity of 68 ± 4 yrs. A gradual cooling trend of ∼0.6 °C/103 yrs is attributed to a declining seasonal contrast in insolation. The synchronicity of the mega-drought in the Southeast US with the (1) termination of the African Humid Period; (ii) abrupt reduction of the North Atlantic Deep Water production, and (iii) rapid sea-ice expansion in the polar regions of both Hemispheres testifies to the global extent and rapidity of the "5 ka" event and points to the North Atlantic Deep Water variability as the likely controlling factor. The multidecadal cycles are consistent with alternating dry and wet summers occurring during a long-term switch in the seasonal rainfall amount dominance from winter to summer. The periodic summer droughts in the Southeast US support climate models that predict profound hydroclimate changes in the late Holocene governed by the Atlantic Multidecadal Oscillation. The relatively short and rapid hydroclimate phase transitions documented in this study introduce a complication in the correlation of late Holocene drought events that had significant societal impacts.

  9. Early Deglaciation of Drangajökull, Vestfirðir, Iceland: Smaller than Present by 9.2 ka

    NASA Astrophysics Data System (ADS)

    Harning, D.; Geirsdottir, A.; Miller, G. H.; Zalzal, K.

    2016-12-01

    The Holocene histories of Iceland's largest ice caps suggest rapid early Holocene deglaciation and disappearance by 9 ka, other than possible small remnants of Vatnajökull. The least documented is Drangajökull, Vestfirðir, NW Iceland, where our team has been working since 2010. A recent study claims Drangajökull behaved differently than the other Iceland ice caps, deglaciating much later, and persisting through the Holocene Thermal Maximum (HTM). We test this postulate through a suite of sediment cores from threshold lakes both proximal and distal to the ice cap's contemporary margin. Distal lakes document rapid early Holocene deglaciation across the southern highland plateau, with the northern margin of the ice cap reaching a size comparable to Drangajökull's contemporary limit by 10.3 ka. A proximal lake to the north records a transient readvance at 9.6 ka, likely in association with meltwater pulses from the disintegrating Laurentide Ice Sheet (LIS). Two other southeastern proximal lakes, whose catchments extend well beneath the modern ice cap, demonstrate that Drangajökull was already smaller than present before 9.2 ka. Supporting evidence for local early Holocene warmth is derived from biological summer temperature proxies in a lake record, with age control (tephra/14C) demonstrating continuous sediment accumulation from 10.3 ka to present. Peak warmth (HTM) inferred from elevated algal productivity occurred between 8.9 and 7.2 ka. The record of terrestrial warmth closely aligns with regional SST and precipitation records that together with lake sediment characteristics provide firm evidence that Drangajökull responded similarly to Iceland's other large ice caps. Drangajökull was smaller than its contemporary margin before 9.2 ka, and likely disappeared entirely during the warmer and drier summers between 9 and 7 ka, reforming in the Late Holocene.

  10. C:N:P Molar Ratios, Sources and 14C Dating of Surficial Sediments from the NW Slope of Cuba.

    PubMed

    de la Lanza Espino, Guadalupe; Soto, Luis A

    2015-01-01

    The surficial sediments recovered from 12 sites located near the channel axis of the Florida Straits and the lower slope off NW Cuba were analyzed for total organic carbon (TOC), nitrogen (TN), phosphorus (TP), elemental C:N:P ratios, C and N isotopic values, and 14C dating. The depth profiles of TOC, TN, and TP (0-18 cm) displayed a downcore trend and a significant variation. The TOC values were low (0.15 to 0.62%; 66 to 516 µmol g(-1)). Sites near the island's lower slope had lower TOC average concentrations (158-333 µmol g(-1)) than those closer to the channel axis (averaging 341-516 µmol g(-1); p <0.05). The TN concentrations near the lower slope attained 0.11% (80 µmol g(-1)), whereas, towards the channel axis, they decreased to 0.07% (55 µmol g(-1); p<0.05). The C:N ratios ranged from 1.9 to 10.2. The mean molar C:N ratio (5.4) indicated a marine hemipelagic deposition. The TP was lower at sites near the lower slope (38.4 to 50.0 µmol gv; 0.12% to 0.16%) than those near the channel axis (50.0 to 66 µmol g(-1); 0.15 to 0.21%). C:P fluctuated from 7.7 to 14.1 in the surficial sediment layer. The bulk organic δ13Corg and δ15N values confirmed pelagic organic sources, and the 14C dating revealed that the sediments were deposited during the Holocene (1000-5000 yr BP). We suggest that the hydrodynamic conditions in the Straits influence vertical and advective fluxes of particulate organic material trapped in the mixed-layer, which reduces the particulate matter flux to the seabed.

  11. C:N:P Molar Ratios, Sources and 14C Dating of Surficial Sediments from the NW Slope of Cuba

    PubMed Central

    de la Lanza Espino, Guadalupe; Soto, Luis A.

    2015-01-01

    The surficial sediments recovered from 12 sites located near the channel axis of the Florida Straits and the lower slope off NW Cuba were analyzed for total organic carbon (TOC), nitrogen (TN), phosphorus (TP), elemental C:N:P ratios, C and N isotopic values, and 14C dating. The depth profiles of TOC, TN, and TP (0-18 cm) displayed a downcore trend and a significant variation. The TOC values were low (0.15 to 0.62%; 66 to 516 µmol g-1). Sites near the island’s lower slope had lower TOC average concentrations (158-333 µmol g-1) than those closer to the channel axis (averaging 341-516 µmol g-1; p <0.05). The TN concentrations near the lower slope attained 0.11% (80 µmol g-1), whereas, towards the channel axis, they decreased to 0.07% (55 µmol g-1; p<0.05). The C:N ratios ranged from 1.9 to 10.2. The mean molar C:N ratio (5.4) indicated a marine hemipelagic deposition. The TP was lower at sites near the lower slope (38.4 to 50.0 µmol g-1; 0.12% to 0.16%) than those near the channel axis (50.0 to 66 µmol g-1; 0.15 to 0.21%). C:P fluctuated from 7.7 to 14.1 in the surficial sediment layer. The bulk organic δ13Corg and δ15N values confirmed pelagic organic sources, and the 14C dating revealed that the sediments were deposited during the Holocene (1000-5000 yr BP). We suggest that the hydrodynamic conditions in the Straits influence vertical and advective fluxes of particulate organic material trapped in the mixed-layer, which reduces the particulate matter flux to the seabed. PMID:26110791

  12. Early Holocene (8.6 ka) rock avalanche deposits, Obernberg valley (Eastern Alps): Landform interpretation and kinematics of rapid mass movement.

    PubMed

    Ostermann, Marc; Sanders, Diethard; Ivy-Ochs, Susan; Alfimov, Vasily; Rockenschaub, Manfred; Römer, Alexander

    2012-10-15

    In the Obernberg valley, the Eastern Alps, landforms recently interpreted as moraines are re-interpreted as rock avalanche deposits. The catastrophic slope failure involved an initial rock volume of about 45 million m³, with a runout of 7.2 km over a total vertical distance of 1330 m (fahrböschung 10°). 36 Cl surface-exposure dating of boulders of the avalanche mass indicates an event age of 8.6 ± 0.6 ka. A 14 C age of 7785 ± 190 cal yr BP of a palaeosoil within an alluvial fan downlapping the rock avalanche is consistent with the event age. The distal 2 km of the rock-avalanche deposit is characterized by a highly regular array of transverse ridges that were previously interpreted as terminal moraines of Late-Glacial. 'Jigsaw-puzzle structure' of gravel to boulder-size clasts in the ridges and a matrix of cataclastic gouge indicate a rock avalanche origin. For a wide altitude range the avalanche deposit is preserved, and the event age of mass-wasting precludes both runout over glacial ice and subsequent glacial overprint. The regularly arrayed transverse ridges thus were formed during freezing of the rock avalanche deposits.

  13. Early Holocene (8.6 ka) rock avalanche deposits, Obernberg valley (Eastern Alps): Landform interpretation and kinematics of rapid mass movement

    PubMed Central

    Ostermann, Marc; Sanders, Diethard; Ivy-Ochs, Susan; Alfimov, Vasily; Rockenschaub, Manfred; Römer, Alexander

    2012-01-01

    In the Obernberg valley, the Eastern Alps, landforms recently interpreted as moraines are re-interpreted as rock avalanche deposits. The catastrophic slope failure involved an initial rock volume of about 45 million m³, with a runout of 7.2 km over a total vertical distance of 1330 m (fahrböschung 10°). 36Cl surface-exposure dating of boulders of the avalanche mass indicates an event age of 8.6 ± 0.6 ka. A 14C age of 7785 ± 190 cal yr BP of a palaeosoil within an alluvial fan downlapping the rock avalanche is consistent with the event age. The distal 2 km of the rock-avalanche deposit is characterized by a highly regular array of transverse ridges that were previously interpreted as terminal moraines of Late-Glacial. ‘Jigsaw-puzzle structure’ of gravel to boulder-size clasts in the ridges and a matrix of cataclastic gouge indicate a rock avalanche origin. For a wide altitude range the avalanche deposit is preserved, and the event age of mass-wasting precludes both runout over glacial ice and subsequent glacial overprint. The regularly arrayed transverse ridges thus were formed during freezing of the rock avalanche deposits. PMID:24966447

  14. The rise and fall of Lake Bonneville between 45 and 10.5 ka

    USGS Publications Warehouse

    Benson, L.V.; Lund, S.P.; Smoot, J.P.; Rhode, D.E.; Spencer, R.J.; Verosub, K.L.; Louderback, L.A.; Johnson, C.A.; Rye, R.O.; Negrini, R.M.

    2011-01-01

    A sediment core taken from the western edge of the Bonneville Basin has provided high-resolution proxy records of relative lake-size change for the period 45.1-10.5 calendar ka (hereafter ka). Age control was provided by a paleomagnetic secular variation (PSV)-based age model for Blue Lake core BL04-4. Continuous records of ??18O and total inorganic carbon (TIC) generally match an earlier lake-level envelope based on outcrops and geomorphic features, but with differences in the timing of some hydrologic events/states. The Stansbury Oscillation was found to consist of two oscillations centered on 25 and 24 ka. Lake Bonneville appears to have reached its geomorphic highstand and began spilling at 18.5 ka. The fall from the highstand to the Provo level occurred at 17.0 ka and the lake intermittently overflowed at the Provo level until 15.2 ka, at which time the lake fell again, bottoming out at ~14.7 ka. The lake also fell briefly below the Provo level at ~15.9 ka. Carbonate and ??18O data indicate that between 14.7 and 13.1 ka the lake slowly rose to the Gilbert shoreline and remained at about that elevation until 11.6 ka, when it fell again. Chemical and sedimentological data indicate that a marsh formed in the Blue Lake area at 10.5 ka.Relatively dry periods in the BL04-4 records are associated with Heinrich events H1-H4, suggesting that either the warming that closely followed a Heinrich event increased the evaporation rate in the Bonneville Basin and (or) that the core of the polar jet stream (PJS) shifted north of the Bonneville Basin in response to massive losses of ice from the Laurentide Ice Sheet (LIS) during the Heinrich event. The second Stansbury Oscillation occurred during Heinrich event H2, and the Gilbert wet event occurred during the Younger Dryas cold interval. Several relatively wet events in BL04-4 occur during Dansgaard-Oeschger (DO) warm events.The growth of the Bear River glacier between 32 and 17 ka paralleled changes in the values of proxy

  15. Age evaluation and causation of rock-slope failures along the western margin of the Antrim Lava Group (ALG), Northern Ireland, based on cosmogenic isotope (36Cl) surface exposure dating

    NASA Astrophysics Data System (ADS)

    Southall, David W.; Wilson, Peter; Dunlop, Paul; Schnabel, Christoph; Rodés, Ángel; Gulliver, Pauline; Xu, Sheng

    2017-05-01

    The temporal pattern of postglacial rock-slope failure in a glaciated upland area of Ireland (the western margin of the Antrim Lava Group) was evaluated using both 36Cl exposure dating of surface boulders on run-out debris and 14C dating of basal organic soils from depressions on the debris. The majority of the 36Cl ages ( 21-15 ka) indicate that major failures occurred during or immediately following local deglaciation ( 18-17 ka). Other ages ( 14-9 ka) suggest some later, smaller-scale failures during the Lateglacial and/or early Holocene. The 14C ages (2.36-0.15 cal ka BP) indicate the very late onset of organic accumulation and do not provide close limiting age constraints. Rock-slope failure during or immediately following local deglaciation was probably in response to some combination of glacial debuttressing, slope steepening and paraglacial stress release. Later failures may have been triggered by seismic activity associated with glacio-isostatic crustal uplift and/or permafrost degradation consequent upon climate change. The 36Cl ages support the findings of previous studies that show the deglacial - Lateglacial period in northwest Ireland and Scotland to have been one of enhanced rock-slope failure. Table S2 Concentrations of main elements (as oxides) etc.

  16. 14C age reassessment of groundwater from the discharge zone due to cross-flow mixing in the deep confined aquifer

    NASA Astrophysics Data System (ADS)

    Mao, Xumei; Wang, Hua; Feng, Liang

    2018-05-01

    In a groundwater flow system, the age of groundwater should gradually increase from the recharge zone to the discharge zone within the same streamline. However, it is occasionally observed that the groundwater age becomes younger in the discharge zone in the piedmont alluvial plain, and the oldest age often appears in the middle of the plain. A new set of groundwater chemistry and isotopes was employed to reassess the groundwater 14C ages from the discharge zone in the North China Plain (NCP). Carbonate precipitation, organic matter oxidation and cross-flow mixing in the groundwater from the recharge zone to the discharge zone are recognized according to the corresponding changes of HCO3- (or DIC) and δ13C in the same streamline of the third aquifer of the NCP. The effects of carbonate precipitation and organic matter oxidation are calibrated with a 13C mixing model and DIC correction, but these corrected 14C ages seem unreasonable because they grow younger from the middle plain to the discharge zone in the NCP. The relationship of Cl- content and the recharge distance is used to estimate the expected Cl- content in the discharge zone, and ln(a14C)/Cl is proposed to correct the a14C in groundwater for the effect of cross-flow mixing. The 14C ages were reassessed with the corrected a14C due to the cross-flow mixing varying from 1.25 to 30.58 ka, and the groundwater becomes older gradually from the recharge zone to the discharge zone. The results suggest that the reassessed 14C ages are more reasonable for the groundwater from the discharge zone due to cross-flow mixing.

  17. Paleointensity results for 0 and 4 ka from Hawaiian lava flows: a new approach to sampling

    NASA Astrophysics Data System (ADS)

    Cromwell, G.; Tauxe, L.; Staudigel, H.; Ron, H.; Trusdell, F.

    2012-04-01

    Paleointensity data are typically generated from core samples drilled out of the massive parts of lava flows. During Thellier-Thellier type experiments, these massive samples suffer from very low success rates (~20%), as shown by failure to meet statistical criteria. Low success generally occurs for two reasons: 1) alteration of the sample during the heating process, and 2) multi-domain behavior of massive material. Moreover, recent studies of historical lava flows show that massive samples may not accurately reflect the intensity of the magnetic field even when they are successful (Valet et al., 2010). Alternatively, submarine basaltic glasses (SBG) produce high success rates (~80%) for Thellier-Thellier type experiments, likely due to near instantaneous cooling rates which produce single-domain magnetic grains. In addition, SBG have been proven to produce accurate records of the magnetic field (e.g., Pick and Tauxe, 1993). In this study we investigate the success of paleointensity experiments on subaerial quenched basalts from Hawaii in the quest for single domain, rapidly cooled subaerial analogs to SBG. We also examine the effects of grain size and cooling rate on the accuracy of paleointensity results. During March 2011, we collected samples from 31 dated lava flows (0-3800 BP), including the historical 1950 C.E. and 2010 C.E. flows. Each lava flow was additionally subsampled when unique cooling structures within the unit could be identified. Single-domain, rapidly quenched glasses from the 1950 and 2010 flows are ideally behaved, i.e. straight Arai plots, and accurately record the expected geomagnetic field strength. However, slower cooled specimens from the same flows produce sagged Arai plots and consistently underestimate expected geomagnetic field intensity. Results from ideally behaved glasses over the last 4 ka indicate periods of rapid field change in Hawaii and a possible high intensity field spike around 2.7 ka. We will present new results from our

  18. Quantitative summer and winter temperature reconstructions from pollen and chironomid data in the Baltic-Belarus area

    NASA Astrophysics Data System (ADS)

    Veski, Siim; Seppä, Heikki; Stančikaitė, Migle; Zernitskaya, Valentina; Reitalu, Triin; Gryguc, Gražyna; Heinsalu, Atko; Stivrins, Normunds; Amon, Leeli; Vassiljev, Jüri; Heiri, Oliver

    2015-04-01

    Quantitative reconstructions based on fossil pollen and chironomids are widely used and useful for long-term climate variability estimations. The Lateglacial and early Holocene period (15-8 ka BP) in the Baltic-Belarus (BB) area between 60°-51° N was characterized by sudden shifts in climate due to various climate forcings affecting the climate of the northern hemisphere and North Atlantic, including the proximity of receding ice sheets. Climate variations in BB during the LG were eminent as the southern part of the region was ice free during the Last Glacial Maximum over 19 ka BP, whereas northern Estonia became ice free no sooner than 13 ka BP. New pollen based reconstructions of summer (May-to-August) and winter (December-to-February) temperatures between 15-8 ka BP along a S-N transect in the BB area display trends in temporal and spatial changes in climate variability. These results are completed by two chironomid-based July mean temperature reconstructions (Heiri et al. 2014). The magnitude of change compared with modern temperatures was more prominent in the northern part of BB area than in the southern part. The 4 °C winter and 2 °C summer warming at the start of GI-1 was delayed in the BB area and Lateglacial maximum temperatures were reached at ca 13.6 ka BP, being 4 °C colder than the modern mean. The Younger Dryas cooling in the area was 5 °C colder than present as inferred by all proxies (Veski et al. in press). In addition, our analyses show an early Holocene divergence in winter temperature trends with modern values reaching 1 ka earlier (10 ka BP) in southern BB compared to the northern part of the region (9 ka BP). Heiri, O., Brooks, S.J., Renssen, H., Bedford, A., Hazekamp, M., Ilyashuk, B., Jeffers, E.S., Lang, B., Kirilova, E., Kuiper, S., Millet, L., Samartin, S., Toth, M., Verbruggen, F., Watson, J.E., van Asch, N., Lammertsma, E., Amon, L., Birks, H.H., Birks, J.B., Mortensen, M.F., Hoek, W.Z., Magyari, E., Muñoz Sobrino, C., Seppä, H

  19. Paleomagnetic secular variation at the Azores during the last 3 ka

    NASA Astrophysics Data System (ADS)

    di Chiara, Anita; Speranza, Fabio; Porreca, Massimiliano

    2012-07-01

    We report on 33 new paleomagnetic directions obtained from 16 lava flows emplaced in the last 3 ka on São Miguel, the largest island of the Azores. The data provide 27 well-dated directions from historical or 14C dated flows which, together with 6 directions previously gathered from the same flows by Johnson et al. (1998), yield the first paleomagnetic directional record of the last 3 ka from the Atlantic Ocean. Within-flow directions are consistent, suggesting that inclination swings from 60° to 25° and declination changes between -10° to 20° reflect variations in the geomagnetic field over the last 3 ka. To a first approximation, the declination record is consistent with predictions from CALS3k.4 and gufm1 global field models. Conversely, inclination values are lower than model predictions at two different ages: 1) four sites from the 1652 AD flow yield I = 48° instead of I = 63° predicted by gufm1; 2) data from several flows nicely mimic the inclination minimum of 800-1400 AD, but inclination values are lower by ˜10° than CALS3k.4 model predictions. By interpolating a cubic spline fit on declination / inclination versus age data, we tentatively infer the directional evolution of the geomagnetic field at the Azores from 1000 BC to 1600 AD. The obtained curve shows three tracks in virtual overlap during the 1000-800 BC, 800-500 BC, and 400-700 AD time spans.

  20. pKa shifting in double-stranded RNA is highly dependent upon nearest neighbors and bulge positioning.

    PubMed

    Wilcox, Jennifer L; Bevilacqua, Philip C

    2013-10-22

    Shifting of pKa's in RNA is important for many biological processes; however, the driving forces responsible for shifting are not well understood. Herein, we determine how structural environments surrounding protonated bases affect pKa shifting in double-stranded RNA (dsRNA). Using (31)P NMR, we determined the pKa of the adenine in an A(+)·C base pair in various sequence and structural environments. We found a significant dependence of pKa on the base pairing strength of nearest neighbors and the location of a nearby bulge. Increasing nearest neighbor base pairing strength shifted the pKa of the adenine in an A(+)·C base pair higher by an additional 1.6 pKa units, from 6.5 to 8.1, which is well above neutrality. The addition of a bulge two base pairs away from a protonated A(+)·C base pair shifted the pKa by only ~0.5 units less than a perfectly base paired hairpin; however, positioning the bulge just one base pair away from the A(+)·C base pair prohibited formation of the protonated base pair as well as several flanking base pairs. Comparison of data collected at 25 °C and 100 mM KCl to biological temperature and Mg(2+) concentration revealed only slight pKa changes, suggesting that similar sequence contexts in biological systems have the potential to be protonated at biological pH. We present a general model to aid in the determination of the roles protonated bases may play in various dsRNA-mediated processes including ADAR editing, miRNA processing, programmed ribosomal frameshifting, and general acid-base catalysis in ribozymes.

  1. Late-Wisconsinan submarine moraines along the north shore of the Estuary and Gulf of St. Lawrence (Eastern Canada)

    NASA Astrophysics Data System (ADS)

    Lajeunesse, Patrick; St-Onge, Guillaume

    2013-04-01

    A series of ice-contact submarine fans and morainal banks along the Québec North-Shore of the Estuary and Gulf of St. Lawrence (Eastern Canada), between the Manicouagan River delta and the Mingan Islands, have been revealed with great detail by recent multibeam echosounder and high-resolution subbottom profiler surveys. These grounding-line landforms are observed between 65 and 190 m water depths and were constructed as the marine-based margin of the Laurentide Ice Sheet (LIS) stabilized or readvanced. Radiocarbon ages obtained from shells sampled in sediment cores collected in glaciomarine deposits 6 km south of a grounding line in the Sept-Iles area indicate a stabilisation that took place around 11 000 14C yr BP (12.5 ka cal BP with a ΔR=120 ± 40 yr). In the Mingan Islands area, organic matter collected in distal deposits of an ice-contact fan is dated at 10 800 14C yr BP (11.6 ka cal BP). The position of the Sept-Iles and Mingan deposits, 20 km south of the ~9.7-9.5 14C kyr BP North-Shore Moraine, suggests that these ice marginal landforms were constructed during the Younger Dryas (YD) cold episode and that they might be the eastward submarine extent of the early YD St. Narcisse morainic system. Superimposed till sheets and morainal banks observed within grounding line deposits indicate that this stability phase was interrupted by local readvances that were marked in some cases by ice streaming. Segments of this morainic system are also visible along the shoreline in some sectors, where they have been generally washed out of fine fragments by waves. Another series of ice-contact deposits and landforms of similar nature observed farther offshore and at greater depths (100-190 m) were formed during a previous phase of stabilisation of the LIS margin. This older morainic system was probably deposited immediately after the opening of the Estuary and Gulf of the St. Lawrence.

  2. Application of mathematical expectation (ME) strategy for detecting low frequency mutations: An example for evaluating 14-bp insertion/deletion (indel) within the bovine PRNP gene.

    PubMed

    Yang, Qing; Zhang, Sihuan; Liu, Liangliang; Cao, Xiukai; Lei, Chuzhao; Qi, Xinglei; Lin, Fengpeng; Qu, Weidong; Qi, Xingshan; Liu, Jiming; Wang, Rongmin; Chen, Hong; Lan, Xianyong

    2016-09-02

    The detection method based on the mathematical expectation (ME) strategy is fast and accuracy for low frequency mutation screening in large samples. Previous studies have found that the 14-bp insertion/deletion (indel) variants of the 3' untranslated region (3' UTR) within bovine PRNP gene have been characterized with low frequency (≤5%) in global breeds outside China, which has not been determined in Chinese cattle breeds yet. Therefore, this study aimed to identify the 14-bp indel within PRNP gene in 5 major Chinese indigenous cattle breeds and to evaluate its associations with phenotypic traits. It was the first time to use ME strategy to detect low frequency indel polymorphisms and found that minor allele frequency was 0.038 (Qinchuan), 0.033 (Xianan), 0.013 (Nanyang), 0.003 (Jiaxian), and zero (Ji'an), respectively. Compared to the traditional detection method by which the sample was screened one by one, the reaction time by using the ME method was decreased 62.5%, 64.9%, 77.6%, 88.9% and 66.4%, respectively. In addition, the 14-bp indel was significantly associated with the growth traits in 2 cattle breeds, with the body length of Qinchuan cattle as well as the body weight and waistline of Xianan cattle. Our results have uncovered that the method based on ME strategy is rapid, reliable, and cost-effective for detecting the low frequency mutation as well as our findings provide a potential valuable theoretical basis for the marker-assisted selection (MAS) in beef cattle.

  3. Application of mathematical expectation (ME) strategy for detecting low frequency mutations: An example for evaluating 14-bp insertion/deletion (indel) within the bovine PRNP gene

    PubMed Central

    Yang, Qing; Zhang, Sihuan; Liu, Liangliang; Cao, Xiukai; Lei, Chuzhao; Qi, Xinglei; Lin, Fengpeng; Qu, Weidong; Qi, Xingshan; Liu, Jiming; Wang, Rongmin; Chen, Hong; Lan, Xianyong

    2016-01-01

    ABSTRACT The detection method based on the mathematical expectation (ME) strategy is fast and accuracy for low frequency mutation screening in large samples. Previous studies have found that the 14-bp insertion/deletion (indel) variants of the 3′ untranslated region (3′ UTR) within bovine PRNP gene have been characterized with low frequency (≤5%) in global breeds outside China, which has not been determined in Chinese cattle breeds yet. Therefore, this study aimed to identify the 14-bp indel within PRNP gene in 5 major Chinese indigenous cattle breeds and to evaluate its associations with phenotypic traits. It was the first time to use ME strategy to detect low frequency indel polymorphisms and found that minor allele frequency was 0.038 (Qinchuan), 0.033 (Xianan), 0.013 (Nanyang), 0.003 (Jiaxian), and zero (Ji'an), respectively. Compared to the traditional detection method by which the sample was screened one by one, the reaction time by using the ME method was decreased 62.5%, 64.9%, 77.6%, 88.9% and 66.4%, respectively. In addition, the 14-bp indel was significantly associated with the growth traits in 2 cattle breeds, with the body length of Qinchuan cattle as well as the body weight and waistline of Xianan cattle. Our results have uncovered that the method based on ME strategy is rapid, reliable, and cost-effective for detecting the low frequency mutation as well as our findings provide a potential valuable theoretical basis for the marker-assisted selection (MAS) in beef cattle. PMID:27580010

  4. Paleo-Environment and C-14 Dating: The Key to the Depositional Age of the Tha Chang and Related Sand Pits, Northeastern Thailand

    NASA Technical Reports Server (NTRS)

    Putthapiban, P.; Zolensky, M.; Jull, T.; Demartino, M.; Salyapongse, S.

    2012-01-01

    - Arizona AMS Laboratory. Although, there is no sharp boundary between the unconsolidated sedimentary horizons in the pits, C-14 ages obtained from the Tha Chang vary from 34,340 BP at the middle horizon (approx 10 m below ground zero) to >49,900 BP at the lower horizon with unknown basal formation (highly pyritized zone approx 20 - 25 m below ground zero). The ages for the Chumpuang vary from 41,700 BP, >45,900 BP and >49,900 BP from the upper most to the lower most of a broad horizon (approx 8 m to approx 12 m below ground zero). The C-14 age of the pottery collected from layer approximately 5 m below ground zero is 2,514 BP. The nature of fluviatile together with occasional mass wasting characteristics of all sand pits studies suggest the relatively faster depositional rate of the lower horizon which involved more flooding and mass wasting deposits than those of the upper horizons. The apparent of some mixing of the wood ages may indicate reworking and lag deposits nature of the area. The depositional rate of the upper most sand and soil horizon (5 m thick) is approximately 1 m per 500 years which mean both erosion and deposition had played a significant role during that time period. In term of the true age of the formation, we argue that since most of the materials deposited are reworked materials, all ages obtained from fossil fragments could not be the age of sand and gravel formation. Furthermore, the maximum age of all the tektite bearing horizons cannot be older than 0.8 Ma. The oldest C-14 age of 49,900 BP is interpreted as the minimum age of the Tha Chang and related sand pits formation when geomorphology of the area was a lot more hilly and much higher gradient than that of the present day.

  5. Current achievements and challenges of a multiple dating approach (14C, 230Th/U and 36Cl) to infer tsunami transport age(s) of reef-top boulders on Bonaire (Leeward Antilles)

    NASA Astrophysics Data System (ADS)

    Rixhon, Gilles; May, Simon Matthias; Engel, Max; Mechernich, Silke; Schroeder-Ritzrau, Andrea; Frank, Norbert; Fohlmeister, Jens; Boulvain, Frédéric; Dunai, Tibor; Brückner, Helmut

    2017-04-01

    The deposition of supratidal coarse-clast deposits is difficult to date, limiting their value for inferring frequency-magnitude patterns of high-energy wave events. On Bonaire (Leeward Antilles, Caribbean), these deposits form prominent landforms, and transport by one or several Holocene tsunamis is assumed at least for the largest clasts. Although a large dataset of 14C and electron spin resonance (ESR) ages is available for major coral rubble ridges and ramparts, it is still debated whether these data reflect the timing of major events, and how these datasets are biased by the reworking of coral fragments. As an attempt to overcome the current challenges for dating the dislocation of singular boulders, three distinct dating methods are implemented and compared: (i) 14C dating of boring bivalves attached to the boulders; (ii) 230Th/U dating of post-depositional, secondary calcite flowstone and subaerial microbialites at the underside of the boulders; and (iii) surface exposure dating of overturned boulders via 36Cl concentration measurements in corals. Approaches (ii) and (iii) have never been applied to coastal boulder deposits so far. The three 14C age estimates are older than 37 ka, i.e. most probably beyond the applicability of the method, which is attributed to post-depositional diagenetic processes, shedding doubt on the usefulness of this method in the local context. The remarkably convergent 230Th/U ages, all pointing to the Late Holocene period (1.0-1.6 ka), are minimum ages for the transport event(s). The microbialite sample yields an age of 1.23±0.23 ka and both flowstone samples are in stratigraphic order: the older (onset of carbonate precipitation) and younger flowstone layers yield ages of 1.59±0.03 and 1.23±0.03 ka, respectively. Four coral samples collected from the topside of overturned boulders yielded similar 36Cl concentration measurements. However, the computed ages are affected by large uncertainties, mostly due to the high natural

  6. 21,000 years of Ethiopian African monsoon variability recorded in sediments of the western Nile deep-sea fan: impact of the Nile freshwater inflow for the Mediterranean thermo-haline circulation

    NASA Astrophysics Data System (ADS)

    Revel, Marie; Colin, Christophe; Bernasconi, Stephano; Combourieu-Nebout, Nathalie; Ducassou, Emmanuelle; Rolland, Yann; Bosch, Delphine

    2014-05-01

    response to huge volumes of fresh-water delivered principally by the Nile River from 12 to 8.4 cal. ka BP in the eastern Mediterranean. We propose that the large hydrological change in Ethiopian latitude could be a trigger for the 8.2 ka cooling event recorded in high latitude. Revel R., Colin C., Bernasconi S., Combourieu-Nebout N., Ducassou E., Grousset F.E., Rolland Y., Migeon S., Brunet P., Zhaa Y., Bosch D., Mascle J.,. "21,000 years of Ethiopian African moonsoon variability recorded in sediments of the western Nile deep sea fan", Regional Environmental Change, in press.

  7. Paleopedology plus TL, 10Be, and14C dating as tools in stratigraphic and paleoclimatic investigations, Mississippi River Valley, U.S.A.

    USGS Publications Warehouse

    Markewich, H.W.; Wysocki, D.A.; Pavich, M.J.; Rutledge, E.M.; Millard, H.T.; Rich, F.J.; Maat, P.B.; Rubin, M.; McGeehin, J.P.

    1998-01-01

    Thick ( ??? 35 m) loess deposits are present on ridges and high bluffs in the northern-half of the Lower Mississippi Valley (LMV), U.S.A. Detailed descriptions of the loess sections and pedologic, physiochemical, and mineralogic analyses and TL, 14C, and 10Be age determinations, allow preliminary paleoclimatic reconstructions for the late Quaternary of central North America. No age data are available for the oldest (Fifth) loess. 10Be and TL age data suggest a 250-200 ka age for the Fourth or Crowleys Ridge(?) Loess, and indicate that the Loveland or Third Loess is time equivalent to oxygen isotope stage 6, ??? 190-120 ka. A weakly developed paleosol is present in the basal-half of the Loveland. The Sangamon Geosol is present in the upper 5 m and represents all of oxygen isotope stage 5, ??? 130-60 ka. It formed in a climate as warm as, but drier and (or) with greater variation in precipitation, than the present. The Roxana Silt (second loess) was deposited during oxygen isotope stages 4 and 3, ??? 65-26 ka. The early Wisconsinan interglacial-glacial transition, represented by the Sangamon Geosol and the unnamed paleosol in the basal Roxana Silt, was slow. The paleoclimate during the 35 k yr of Roxana deposition was cool to cold and wet. Age and pedologic data indicate that deposition of the Peoria Loess (the youngest) began around 25 ka when the area's climate changed abruptly from cool or cold and wet to cold and dry, with periods of sustained high winds.

  8. Intensive Versus Standard Blood Pressure Control in SPRINT-Eligible Participants of ACCORD-BP.

    PubMed

    Buckley, Leo F; Dixon, Dave L; Wohlford, George F; Wijesinghe, Dayanjan S; Baker, William L; Van Tassell, Benjamin W

    2017-12-01

    We sought to determine the effect of intensive blood pressure (BP) control on cardiovascular outcomes in participants with type 2 diabetes mellitus (T2DM) and additional risk factors for cardiovascular disease (CVD). This study was a post hoc, multivariate, subgroup analysis of ACCORD-BP (Action to Control Cardiovascular Risk in Diabetes Blood Pressure) participants. Participants were eligible for the analysis if they were in the standard glucose control arm of ACCORD-BP and also had the additional CVD risk factors required for SPRINT (Systolic Blood Pressure Intervention Trial) eligibility. We used a Cox proportional hazards regression model to compare the effect of intensive versus standard BP control on CVD outcomes. The "SPRINT-eligible" ACCORD-BP participants were pooled with SPRINT participants to determine whether the effects of intensive BP control interacted with T2DM. The mean baseline Framingham 10-year CVD risk scores were 14.5% and 14.8%, respectively, in the intensive and standard BP control groups. The mean achieved systolic BP values were 120 and 134 mmHg in the intensive and standard BP control groups ( P < 0.001). Intensive BP control reduced the composite of CVD death, nonfatal myocardial infarction (MI), nonfatal stroke, any revascularization, and heart failure (hazard ratio 0.79; 95% CI 0.65-0.96; P = 0.02). Intensive BP control also reduced CVD death, nonfatal MI, and nonfatal stroke (hazard ratio 0.69; 95% CI 0.51-0.93; P = 0.01). Treatment-related adverse events occurred more frequently in participants receiving intensive BP control (4.1% vs. 2.1%; P = 0.003). The effect of intensive BP control on CVD outcomes did not differ between patients with and without T2DM ( P > 0.62). Intensive BP control reduced CVD outcomes in a cohort of participants with T2DM and additional CVD risk factors. © 2017 by the American Diabetes Association.

  9. A 3500 14C yr High-Resolution Record of Water-Level Changes in Lake Titicaca, Bolivia/Peru

    NASA Astrophysics Data System (ADS)

    Abbott, Mark B.; Binford, Michael W.; Brenner, Mark; Kelts, Kerry R.

    1997-03-01

    Sediment cores collected from the southern basin of Lake Titicaca (Bolivia/Peru) on a transect from 4.6 m above overflow level to 15.1 m below overflow level are used to identify a new century-scale chronology of Holocene lake-level variations. The results indicate that lithologic and geochemical analyses on a transect of cores can be used to identify and date century-scale lake-level changes. Detailed sedimentary analyses of subfacies and radiocarbon dating were conducted on four representative cores. A chronology based on 60 accelerator mass spectrometer radiocarbon measurements constrains the timing of water-level fluctuations. Two methods were used to estimate the 14C reservoir age. Both indicate that it has remained nearly constant at ˜250 14C yr during the late Holocene. Core studies based on lithology and geochemistry establish the timing and magnitude of five periods of low lake level, implying negative moisture balance for the northern Andean altiplano over the last 3500 cal yr. Between 3500 and 3350 cal yr B.P., a transition from massive, inorganic-clay facies to laminated organic-matter-rich silts in each of the four cores signals a water-level rise after a prolonged mid-Holocene dry phase. Evidence of other significant low lake levels occurs 2900-2800, 2400-2200, 2000-1700, and 900-500 cal yr B.P. Several of the low lake levels coincided with cultural changes in the region, including the collapse of the Tiwanaku civilization.

  10. Transport of sup 14 C-IAA and sup 14 C-ACC within floral organs of Ipomoea nil

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kiss, H.G.; Maurice, H.R.; Koning, R.E.

    1989-04-01

    The transport of {sup 14}C-IAA {sup 14}C-ACC from agarose donor blocks applied to I. nil filaments their recovery as {sup 14}C-accumulation into floral organs was examined. The accumulation of the isotopes in the corolla tissue was greater when {sup 14}C-ACC was applied than {sup 14}C-IAA in intact isolated flower buds. Greater levels of the isotopes accumulated in the pistil, with minimal levels in receptacle and calyx tissues from isolated buds. With intact buds, greater levels of the isotopes were recovered in pistil, calyx receptacle tissues. This study provides further evidence for the role of the filaments as transport vectors formore » IAA ACC for the production of ethylene.« less

  11. Late Wisconsinan glaciation and postglacial relative sea-level change on western Banks Island, Canadian Arctic Archipelago

    NASA Astrophysics Data System (ADS)

    Lakeman, Thomas R.; England, John H.

    2013-07-01

    The study revises the maximum extent of the northwest Laurentide Ice Sheet (LIS) in the western Canadian Arctic Archipelago (CAA) during the last glaciation and documents subsequent ice sheet retreat and glacioisostatic adjustments across western Banks Island. New geomorphological mapping and maximum-limiting radiocarbon ages indicate that the northwest LIS inundated western Banks Island after ~ 31 14C ka BP and reached a terminal ice margin west of the present coastline. The onset of deglaciation and the age of the marine limit (22-40 m asl) are unresolved. Ice sheet retreat across western Banks Island was characterized by the withdrawal of a thin, cold-based ice margin that reached the central interior of the island by ~ 14 cal ka BP. The elevation of the marine limit is greater than previously recognized and consistent with greater glacioisostatic crustal unloading by a more expansive LIS. These results complement emerging bathymetric observations from the Arctic Ocean, which indicate glacial erosion during the Last Glacial Maximum (LGM) to depths of up to 450 m.

  12. pKa of fentanyl varies with temperature: implications for acid-base management during extremes of body temperature.

    PubMed

    Thurlkill, Richard L; Cross, David A; Scholtz, J Martin; Pace, C Nick

    2005-12-01

    The pKa of fentanyl has not been measured previously at varying extremes of body temperature. The goal of this laboratory investigation was to test the hypothesis that the pKa of fentanyl changes with temperature. The investigation involved measuring the pKa values of aqueous fentanyl at varying temperatures. The investigation was conducted in a controlled laboratory environment. No human or animal subjects were involved. Because no live subjects were involved in the investigation, no interventions were necessary. This paper reports the effect of temperature on the pKa of fentanyl. The pKa of aqueous fentanyl was measured at 15 degrees C, 25 degrees C, 37 degrees C, 42 degrees C, and 47.5 degrees C by potentiometric titration in 0.01 mmol/L of potassium chloride after extensive degassing. Data were analyzed using the least squares method with an appropriately fitting equation. The pKa of fentanyl was found to change in a similar manner to the neutral point of water at varying temperatures. This finding has implications for the bioavailability of fentanyl at extremes of body temperature in association with the clinical acid-base management of the patient. Clinical implications for differing methods of intraoperative acid-base management at varying temperatures are discussed.

  13. Geochronology and paleoenvironment of pluvial Harper Lake, Mojave Desert, California, USA

    USGS Publications Warehouse

    Garcia, Anna L.; Knott, Jeffrey R.; Mahan, Shannon; Bright, Jordan

    2014-01-01

    Accurate reconstruction of the paleo-Mojave River and pluvial lake (Harper, Manix, Cronese, and Mojave) system of southern California is critical to understanding paleoclimate and the North American polar jet stream position over the last 500 ka. Previous studies inferred a polar jet stream south of 35°N at 18 ka and at ~ 40°N at 17–14 ka. Highstand sediments of Harper Lake, the upstream-most pluvial lake along the Mojave River, have yielded uncalibrated radiocarbon ages ranging from 24,000 to > 30,000 14C yr BP. Based on geologic mapping, radiocarbon and optically stimulated luminescence dating, we infer a ~ 45–40 ka age for the Harper Lake highstand sediments. Combining the Harper Lake highstand with other Great Basin pluvial lake/spring and marine climate records, we infer that the North American polar jet stream was south of 35°N about 45–40 ka, but shifted to 40°N by ~ 35 ka. Ostracodes (Limnocythere ceriotuberosa) from Harper Lake highstand sediments are consistent with an alkaline lake environment that received seasonal inflow from the Mojave River, thus confirming the lake was fed by the Mojave River. The ~ 45–40 ka highstand at Harper Lake coincides with a shallowing interval at downstream Lake Manix.

  14. Terrestrial biosphere changes over the last 120 kyr and their impact on ocean δ 13C

    NASA Astrophysics Data System (ADS)

    Hoogakker, B. A. A.; Smith, R. S.; Singarayer, J. S.; Marchant, R.; Prentice, I. C.; Allen, J. R. M.; Anderson, R. S.; Bhagwat, S. A.; Behling, H.; Borisova, O.; Bush, M.; Correa-Metrio, A.; de Vernal, A.; Finch, J. M.; Fréchette, B.; Lozano-Garcia, S.; Gosling, W. D.; Granoszewski, W.; Grimm, E. C.; Grüger, E.; Hanselman, J.; Harrison, S. P.; Hill, T. R.; Huntley, B.; Jiménez-Moreno, G.; Kershaw, P.; Ledru, M.-P.; Magri, D.; McKenzie, M.; Müller, U.; Nakagawa, T.; Novenko, E.; Penny, D.; Sadori, L.; Scott, L.; Stevenson, J.; Valdes, P. J.; Vandergoes, M.; Velichko, A.; Whitlock, C.; Tzedakis, C.

    2015-03-01

    A new global synthesis and biomization of long (>40 kyr) pollen-data records is presented, and used with simulations from the HadCM3 and FAMOUS climate models to analyse the dynamics of the global terrestrial biosphere and carbon storage over the last glacial-interglacial cycle. Global modelled (BIOME4) biome distributions over time generally agree well with those inferred from pollen data. The two climate models show good agreement in global net primary productivity (NPP). NPP is strongly influenced by atmospheric carbon dioxide (CO2) concentrations through CO2 fertilization. The combined effects of modelled changes in vegetation and (via a simple model) soil carbon result in a global terrestrial carbon storage at the Last Glacial Maximum that is 210-470 Pg C less than in pre-industrial time. Without the contribution from exposed glacial continental shelves the reduction would be larger, 330-960 Pg C. Other intervals of low terrestrial carbon storage include stadial intervals at 108 and 85 ka BP, and between 60 and 65 ka BP during Marine Isotope Stage 4. Terrestrial carbon storage, determined by the balance of global NPP and decomposition, influences the stable carbon isotope composition (δ13C) of seawater because terrestrial organic carbon is depleted in 13C. Using a simple carbon-isotope mass balance equation we find agreement in trends between modelled ocean δ13C based on modelled land carbon storage, and palaeo-archives of ocean δ13C, confirming that terrestrial carbon storage variations may be important drivers of ocean δ13C changes.

  15. 53BP1 promotes microhomology-mediated end-joining in G1-phase cells

    PubMed Central

    Xiong, Xiahui; Du, Zhanwen; Wang, Ying; Feng, Zhihui; Fan, Pan; Yan, Chunhong; Willers, Henning; Zhang, Junran

    2015-01-01

    Alternative non-homologous end joining (alt-NHEJ) was originally identified as a backup repair mechanism in the absence of classical NHEJ (c-NHEJ) factors but recent studies have demonstrated that alt-NHEJ is active even when c-NHEJ as well as homologous recombination is available. The functions of 53BP1 in NHEJ processes are not well understood. Here, we report that 53BP1 promotes DNA double-strand break (DSB) repair and genomic stability not only in c-NHEJ-proficient but also -deficient human G1-phase cells. Using an array of repair substrates we show that these effects of 53BP1 are correlated with a promotion of microhomology-mediated end-joining (MMEJ), a subtype of alt-NHEJ, in G1-phase. Consistent with a specific role in MMEJ we confirm that 53BP1 status does not affect c-NHEJ. 53BP1 supports sequence deletion during MMEJ consistent with a putative role in facilitating end-resection. Interestingly, promotion of MMEJ by 53BP1 in G1-phase cells is only observed in the presence of functional BRCA1. Depletion of both 53BP1 and BRCA1 increases repair needing microhomology usage and augments loss of DNA sequence, suggesting that MMEJ is a highly regulated DSB repair process. Together, these findings significantly expand our understanding of the cell-cycle-dependent roles of 53BP1 in DSB repair. PMID:25586219

  16. Density Functional Theory Calculation of pKa's of Thiols in Aqueous Solution Using Explicit Water Molecules and the Polarizable Continuum Model.

    PubMed

    Thapa, Bishnu; Schlegel, H Bernhard

    2016-07-21

    The pKa's of substituted thiols are important for understanding their properties and reactivities in applications in chemistry, biochemistry, and material chemistry. For a collection of 175 different density functionals and the SMD implicit solvation model, the average errors in the calculated pKa's of methanethiol and ethanethiol are almost 10 pKa units higher than for imidazole. A test set of 45 substituted thiols with pKa's ranging from 4 to 12 has been used to assess the performance of 8 functionals with 3 different basis sets. As expected, the basis set needs to include polarization functions on the hydrogens and diffuse functions on the heavy atoms. Solvent cavity scaling was ineffective in correcting the errors in the calculated pKa's. Inclusion of an explicit water molecule that is hydrogen bonded with the H of the thiol group (in neutral) or S(-) (in thiolates) lowers error by an average of 3.5 pKa units. With one explicit water and the SMD solvation model, pKa's calculated with the M06-2X, PBEPBE, BP86, and LC-BLYP functionals are found to deviate from the experimental values by about 1.5-2.0 pKa units whereas pKa's with the B3LYP, ωB97XD and PBEVWN5 functionals are still in error by more than 3 pKa units. The inclusion of three explicit water molecules lowers the calculated pKa further by about 4.5 pKa units. With the B3LYP and ωB97XD functionals, the calculated pKa's are within one unit of the experimental values whereas most other functionals used in this study underestimate the pKa's. This study shows that the ωB97XD functional with the 6-31+G(d,p) and 6-311++G(d,p) basis sets, and the SMD solvation model with three explicit water molecules hydrogen bonded to the sulfur produces the best result for the test set (average error -0.11 ± 0.50 and +0.15 ± 0.58, respectively). The B3LYP functional also performs well (average error -1.11 ± 0.82 and -0.78 ± 0.79, respectively).

  17. Summed Probability Distribution of 14C Dates Suggests Regional Divergences in the Population Dynamics of the Jomon Period in Eastern Japan.

    PubMed

    Crema, Enrico R; Habu, Junko; Kobayashi, Kenichi; Madella, Marco

    2016-01-01

    Recent advances in the use of summed probability distribution (SPD) of calibrated 14C dates have opened new possibilities for studying prehistoric demography. The degree of correlation between climate change and population dynamics can now be accurately quantified, and divergences in the demographic history of distinct geographic areas can be statistically assessed. Here we contribute to this research agenda by reconstructing the prehistoric population change of Jomon hunter-gatherers between 7,000 and 3,000 cal BP. We collected 1,433 14C dates from three different regions in Eastern Japan (Kanto, Aomori and Hokkaido) and established that the observed fluctuations in the SPDs were statistically significant. We also introduced a new non-parametric permutation test for comparing multiple sets of SPDs that highlights point of divergences in the population history of different geographic regions. Our analyses indicate a general rise-and-fall pattern shared by the three regions but also some key regional differences during the 6th millennium cal BP. The results confirm some of the patterns suggested by previous archaeological studies based on house and site counts but offer statistical significance and an absolute chronological framework that will enable future studies aiming to establish potential correlation with climatic changes.

  18. Summed Probability Distribution of 14C Dates Suggests Regional Divergences in the Population Dynamics of the Jomon Period in Eastern Japan

    PubMed Central

    Habu, Junko; Kobayashi, Kenichi; Madella, Marco

    2016-01-01

    Recent advances in the use of summed probability distribution (SPD) of calibrated 14C dates have opened new possibilities for studying prehistoric demography. The degree of correlation between climate change and population dynamics can now be accurately quantified, and divergences in the demographic history of distinct geographic areas can be statistically assessed. Here we contribute to this research agenda by reconstructing the prehistoric population change of Jomon hunter-gatherers between 7,000 and 3,000 cal BP. We collected 1,433 14C dates from three different regions in Eastern Japan (Kanto, Aomori and Hokkaido) and established that the observed fluctuations in the SPDs were statistically significant. We also introduced a new non-parametric permutation test for comparing multiple sets of SPDs that highlights point of divergences in the population history of different geographic regions. Our analyses indicate a general rise-and-fall pattern shared by the three regions but also some key regional differences during the 6th millennium cal BP. The results confirm some of the patterns suggested by previous archaeological studies based on house and site counts but offer statistical significance and an absolute chronological framework that will enable future studies aiming to establish potential correlation with climatic changes. PMID:27128032

  19. [Clinical significance of NS1-BP expression in esophageal squamous cell carcinoma].

    PubMed

    Ren, K; Qian, D; Wang, Y W; Pang, Q S; Zhang, W C; Yuan, Z Y; Wang, P

    2018-01-23

    Objective: To investigate the clinical significance of NS1-BP expression in patients with esophageal squamous cell carcinoma (ESCC), and to study the roles of NS1-BP in proliferation and apoptosis of ESCC cells. Methods: A total of 98 tumor tissues and 30 adjacent normal tissues from 98 ESCC patients were used as study group and control group, and these samples were collected in Sun Yat-Sen University Cancer Center between 2002 and 2008. In addition, 46 ESCC tissues which were collected in Cancer Institute and Hospital of Tianjin Medical University were used as validation group. Expression of mucosal NS1-BP was detected by immunohistochemistry. Kaplan-Meier curve and log-rank test were used to analyze the survival rate. Multivariate Cox proportional hazard model was used to analyze the prognostic factors. Furthermore, NS1-BP was over expressed or knocked down in ESCC cells by transient transfection. Protein levels of c-Myc were detected by western blot. Cell viability and apoptosis was analyzed by MTT assay and flow cytometry. Results: Among all of tested samples, NS1-BP were down-regulated in 9 out of 30 non-tumorous normal esophageal tissues (30.0%) and 85 out of 144 ESCC tissues (59.0%), respectively, showing a statistically significant difference ( P =0.012). In the study group, three-year disease-free survival rate of NS1-BP high expression group (53.2%) was significantly higher than that of NS1-BP low expression group (27.6%; P =0.009). In the validation group, the three-year disease-free survival rates were 57.8% and 25.5% in NS1-BP high and low levels groups, respectively, showing a similar results ( P =0.016). Importantly, multivariate analyses showed that low expression of NS1-BP was an independent predictor for chemoradiotherapy sensitivity and shorter disease-free survival time in ESCC patients( P <0.05 for all). Furthermore, overexpressed NS1-BP in TE-1 cells repressed c-Myc expression, inhibited cell proliferation and promoted apoptosis. In contrast

  20. Surface Nutrient Utilisation and Productivity During Glacial-Interglacial Periods from the Equatorial Indian Ocean

    NASA Astrophysics Data System (ADS)

    R, C. K.; Bhushan, R.; Agnihotri, R.; Sawlani, R.; Jull, A. J. T.

    2016-12-01

    Seawaters and underlying sediments off Sri Lanka provide a unique marine realm affected by both branches of Northern Indian Ocean i.e. Arabian Sea (AS) and Bay of Bengal (BOB). AS and BOB are known for their distinct response to southwest monsoon. AS experiencing mainly winds and upwelling while BOB receives precipitation driven surface runoff from the Indian sub-continent. Multiple proxies were measured on a radiocarbon dated sediment core raised off Sri Lanka; their down core variations were used to understand oceanic history (nutrient utilisation, surface productivity, nature of organic matter) spanning last glacial-interglacial cycle ( 26 to 2.5 ka BP). Variations in CaCO3, biogenic silica (BSi) and δ15N from 26 ka to 12.5 ka BP indicate the region was experiencing high surface productivity with probably reduced surface nutrient utilisation efficiency. Sedimentary δ15N depth profile is decoupled from down core variations of major productivity indices (e.g. CaCO3, OC), hinting plausibly partial utilization of nutrients in the mixed layer (photic zone). δ13C of OC and C/N (wt. ratio) clearly reveal the terrestrial origin of organic matter at 15 ka BP, a period known for witnessing onset of deglaciation in northern hemisphere. δ13C minimum at 9 ka BP indicates intense monsoonal activity during this time coinciding well with solar insolation (June) maximum of the northern hemisphere. With the onset of Holocene ( 11 ka BP), δ15N variations appear to correlate with BSi and Ba/Ti indicating enhanced utilization of available nutrients at surface. Suggesting surface productivity over the region was probably micro-nutrient limited. The increased inventory of terrestrial runoff in Holocene probably demonstrates enhanced carbon sequestration capability of the region.

  1. Lead-Lag relationships? Asynchrounous and Abrupt Shifts in Atmospheric Circulation, Temperature, and Vegetation during the 8.2 ka Event in the Eastern Mediterranean at Tenaghi Philippon, Greece

    NASA Astrophysics Data System (ADS)

    Niedermeyer, E. M.; Mulch, A.; Pross, J.

    2017-12-01

    The "8.2 ka event" has been an abrupt and prominent climate perturbation during the Holocene, and is characterized by an episode of generally colder and dryer conditions in the Northern Hemisphere realm. However, evidence to what extent this event has had an impact on climate in the Mediterranean region is ambiguous, in particular with respect to rainfall, temperature and vegetation change on land. Here we present a new, high-resolution record (ø 15 years during the event) of paleotemperatures from the Tenaghi Philippon peat deposit, Eastern Macedonia, Greece, using the MBT'/CBT index based on brGDGTs (branched Glycerol-Dialkyl-Glycerol-Tetraethers). Our data show fairly stable temperatures before the event, which is initiated at 8.1 ka by an abrupt and continuous cooling during the first 35 years of the event. After a short, 10-year episode of minimum temperatures, the event is ended by a similarly abrupt and continuous warming within 38 years. Comparison of our record with a previous study of the stable hydrogen isotopic composition of higher-plant waxes (δDwax) on the same core1 shows that changes in temperature occurred simultaneously with shifts in atmospherics moisture sources (Mediterranean vs Atlantic). Interestingly, further comparison of our data with a previous palynological study of the same core2 reveals that changes in vegetation associated with the 8.2 ka event precede shifts in hydrology and temperature by 100 years. This suggests either pronounced changes in seasonality of temperature and rainfall after the onset of the 8.2 ka event, i.e. at the peak of the event, or that changes in local atmospheric circulation (moisture sources) and temperature where not the initial trigger of changes in vegetation. References: Pross, J., Kotthoff, U., Müller, U.C., Peyron, O., Dormoy, I., Schmiedl, G., Kalaitzidis, S. and Smith, A.M. (2009): Massive perturbation in terrestrial ecosystems of the Eastern Mediterranean region associated with the 8.2 kyr B.P

  2. 8800 years of high-altitude vegetation and climate history at the Rutor Glacier forefield, Italian Alps. Evidence of middle Holocene timberline rise and glacier contraction

    NASA Astrophysics Data System (ADS)

    Badino, Federica; Ravazzi, Cesare; Vallè, Francesca; Pini, Roberta; Aceti, Amelia; Brunetti, Michele; Champvillair, Elena; Maggi, Valter; Maspero, Francesco; Perego, Renata; Orombelli, Giuseppe

    2018-04-01

    Sedimentary archives at or near the timberline ecotone in Alpine glaciated areas contain records to study Holocene climate change and the interplay between climate, ecosystems, and humans. We focused on records of timberline and glacier oscillations in the Rutor Glacier forefield (Western Italian Alps) in the last 8800 years. Human activity in this area was negligible for most of the Holocene. We adopted an integrative stratigraphic approach including proxies for glacier advance and timberline estimation, sedimentary events, and reconstructed temperatures. Changes in timberline ecotone correlate to climate until the Middle Ages. Pollen-stratigraphic evidence of a primary plant succession highlights a lag beween local deglaciation and the first reliable 14C age. The radiocarbon chronology points to a prolonged phase of glacier contraction between 8.8 and 3.7 ka cal BP. Even later the glacier remained within its LIA limits. Between 8.4 and 4 ka cal BP MAT-inferred TJuly fluctuated near 12.4 °C, ca. 3.1 °C higher than today. During this period, a Pinus cembra forest belt grew at 2600 m asl with an upper limit of tree groves placed 434 ± 310 m above the current open forest limit. This Holocene phase of thermal maximum ended between 3.98 and 3.51 ± 70 ka cal BP and with a substantial rearrangement of forest composition; temperature reconstruction shows a decrease of 1.8 °C. This climate deterioration concluded the Subboreal thermal optimum, mirroring glacial advances widely documented in the Alps. The Rutor Glacier advanced at ca. AD 1093 ± 65, and remained inside the LIA maximum extent. The LIA started since AD 1594, and culminated between AD 1751 and 1864.

  3. Onboard Interferometric SAR Processor for the Ka-Band Radar Interferometer (KaRIn)

    NASA Technical Reports Server (NTRS)

    Esteban-Fernandez, Daniel; Rodriquez, Ernesto; Peral, Eva; Clark, Duane I.; Wu, Xiaoqing

    2011-01-01

    An interferometric synthetic aperture radar (SAR) onboard processor concept and algorithm has been developed for the Ka-band radar interferometer (KaRIn) instrument on the Surface and Ocean Topography (SWOT) mission. This is a mission- critical subsystem that will perform interferometric SAR processing and multi-look averaging over the oceans to decrease the data rate by three orders of magnitude, and therefore enable the downlink of the radar data to the ground. The onboard processor performs demodulation, range compression, coregistration, and re-sampling, and forms nine azimuth squinted beams. For each of them, an interferogram is generated, including common-band spectral filtering to improve correlation, followed by averaging to the final 1 1-km ground resolution pixel. The onboard processor has been prototyped on a custom FPGA-based cPCI board, which will be part of the radar s digital subsystem. The level of complexity of this technology, dictated by the implementation of interferometric SAR processing at high resolution, the extremely tight level of accuracy required, and its implementation on FPGAs are unprecedented at the time of this reporting for an onboard processor for flight applications.

  4. Inland aeolian deposits of the Iberian Peninsula: Sand dunes and clay dunes of the Duero Basin and the Manchega Plain. Palaeoclimatic considerations

    NASA Astrophysics Data System (ADS)

    Bernat Rebollal, M.; Pérez-González, A.

    2008-12-01

    stages can be established, the latter well marked in the DB through soil A horizon development. Thus, the main sand dune formation in the DB and the eastern regions of the MP occurred between 13.5 and 7 ka BP, during the cold and arid Younger Dryas episode and the Early Holocene. The clay dunes of the MP accumulated mainly from 29 to 19 ka BP that corresponds with Heinrich events HE-3 and HE-2 and the Last Glacial Maximum. However, clay dunes were also formed between 13.5 and 7 ka BP. In both locations, there have been reactivations of some sand deposits in the recent Holocene, with maximum activity around 5-2 ka BP and 0.5-0.2 ka BP. On the other hand, three marked stages of stabilisation of the DB aeolian system have been established with 14C-AMS, around 10.2, 6.2 and 1.2 ka BP. Finally, the main winds contributing to dune construction were also responsible for the deflation processes with the formation of erosional depressions.

  5. Climate variability in the past ∼19,000 yr in NE Tibetan Plateau inferred from biomarker and stable isotope records of Lake Donggi Cona

    NASA Astrophysics Data System (ADS)

    Saini, Jeetendra; Günther, Franziska; Aichner, Bernhard; Mischke, Steffen; Herzschuh, Ulrike; Zhang, Chengjun; Mäusbacher, Roland; Gleixner, Gerd

    2017-02-01

    We investigated 4.84-m-long sediment record spanning over the Late Glacial and Holocene from Lake Donggi Cona to be able to reconstruct circulation pattern on the Tibetan Plateau (TP). Presently, Lake Donggi Cona is located at the boundaries of Westerlies and Asian monsoon circulations in the northeastern TP. However, the exact timing and stimulating mechanisms for climatic changes and monsoon shifts in this region are still debated. We used a 19-ka-long stable isotope record of sedimentary n-alkanes to address this discrepancy by providing insights into paleohydrological conditions. The δD of nC23 is influenced by lake water evaporation; the δD values of sedimentary nC29 are mainly controlled by moisture source and temperature changes. Long-chain n-alkanes dominate over the core whereas three mean clusters (i.e. microbial, aquatic and terrestrial) can be inferred. Multi-proxies suggest five major episodes in the history of Lake Donggi Cona. The Lake Donggi Cona record indicates that the Late Glacial (18.4-14.8 cal ka BP) was dominated by low productivity of mainly microbial and aquatic organisms. Relatively low δD values suggest low temperatures and moist conditions eventually caused by stronger Westerlies, winter monsoon and melt-water influence. Likely, the shift (∼17.9 cal ka BP) from microbial to enhanced aquatic input suggests either a change from deep to shallow water lake or a break in local stratification. Between 14.8 and 13.0 cal ka BP, variable climatic conditions prevailed. Although the Westerlies weekend, the increase in temperature enhanced the permafrost and snow melting (displayed by a high sedimentary accumulation rate). Higher δD values indicate increasingly arid conditions with higher temperatures which eventually lead to high evaporative conditions and lowest lake levels. Low vegetation cover and high erosion rates led to high sediment accumulation resulting in stratification followed by anoxia in the terminal lake. From 13.0 to 9.2 cal

  6. A 130 ka reconstruction of rainfall on the Bolivian Altiplano

    NASA Astrophysics Data System (ADS)

    Placzek, C. J.; Quade, J.; Patchett, P. J.

    2013-02-01

    New efforts to link climate reconstructions from shoreline deposits and sediment cores yield an improved and more detailed lake history from the Bolivian Altiplano. On the Southern Altiplano, 10 lake oscillations have been identified from this new unified chronology, each coincident with North Atlantic cold events such as Heinrich Events H5, H2, H1, and the Younger Dryas. By coupling this new lake history to a hydrologic budget model we are able to evaluate precipitation variability on the Southern Bolivian Altiplano over the last 130 ka. These modeling efforts underscore the relative aridity of the Altiplano during the rare and small lake cycles occurring between 80 and 20 ka, when colder temperatures combined with little or no change in rainfall produced smaller paleolakes. Relative aridity between 80 and 20 ka contrasts with the immense Tauca lake cycle (18.1-14.1 ka), which was six times larger than modern Lake Titicaca and coincided with Heinrich Event 1. This improved paleolake record from the Southern Altiplano reveals a strong link between central Andean climate and Atlantic sea-surface temperature gradients during the late Pleistocene, even though today rainfall variability is driven mostly by Pacific sea-surface temperature anomalies associated with El Niño/Southern Oscillation. However, not all Heinrich Events appear to result in lake expansions, most conspicuously during the global cold interval between 80 and 20 ka when the Altiplano and Amazon Basin were relatively arid.

  7. Functional Analysis of Interactions Between 53BP1, BRCA1 and p53

    DTIC Science & Technology

    2004-07-01

    deficiency synergize in tumorigenesis. Furthermore, the loss of a single 53BP1 allele enhances the susceptibility to cancer in the absence of p53. 14...specific antibodies against these sites and showed that at least two of them (S25 and S29) are phosphorylated in vivo by ATM, the kinase mutated in cancer ...characterized by chromosomal aberrations, genetic instability and cancer predisposition. +HU 153BP1 Fig. 5: Lack of 53BP1 prevents the efficient accumulation

  8. The prenyl-binding protein PrBP/δ: a chaperone participating in intracellular trafficking

    PubMed Central

    Zhang, Houbin; Constantine, Ryan; Frederick, Jeanne M.; Baehr, Wolfgang

    2012-01-01

    Expressed ubiquitously, PrBP/δ functions as chaperone/co-factor in the transport of a subset of prenylated proteins. PrBP/δ features an immunoglobulin-like β-sandwich fold for lipid binding, and interacts with diverse partners. PrBP/δ binds both C-terminal C15 and C20 prenyl side chains of phototransduction polypeptides and small GTP-binding (G) proteins of the Ras superfamily. PrBP/δ also interacts with the small GTPases, ARL2 and ARL3, which act as release factors (GDFs) for prenylated cargo. Targeted deletion of the mouse Pde6d gene encoding PrBP/δ resulted in impeded trafficking to the outer segments of GRK1 and cone PDE6 which are predicted to be farnesylated and geranylgeranylated, respectively. Rod and cone transducin trafficking was largely unaffected. These trafficking defects produce progressive cone-rod dystrophy in the Pde6d−/− mouse. PMID:22960045

  9. Weak acid-concentration Atot and dissociation constant Ka of plasma proteins in racehorses.

    PubMed

    Stampfli, H R; Misiaszek, S; Lumsden, J H; Carlson, G P; Heigenhauser, G J

    1999-07-01

    The plasma proteins are a significant contributor to the total weak acid concentration as a net anionic charge. Due to potential species difference, species-specific values must be confirmed for the weak acid anionic concentrations of proteins (Atot) and the effective dissociation constant for plasma weak acids (Ka). We studied the net anion load Atot of equine plasma protein in 10 clinically healthy mature Standardbred horses. A multi-step titration procedure, using a tonometer covering a titration range of PCO2 from 25 to 145 mmHg at 37 degrees C, was applied on the plasma of these 10 horses. Blood gases (pH, PCO2) and electrolytes required to calculate the strong ion difference ([SID] = [(Na(+) + K(+) + Ca(2+) + Mg(2+))-(Cl(-) + Lac(-) + PO4(2-))]) were simultaneously measured over a physiological pH range from 6.90-7.55. A nonlinear regression iteration to determine Atot and Ka was performed using polygonal regression curve fitting applied to the electrical neutrality equation of the physico-chemical system. The average anion-load Atot for plasma protein of 10 Standardbred horses was 14.89 +/- 0.8 mEq/l plasma and Ka was 2.11 +/- 0.50 x 10(-7) Eq/l (pKa = 6.67). The derived conversion factor (iterated Atot concentration/average plasma protein concentration) for calculation of Atot in plasma is 0.21 mEq/g protein (protein-unit: g/l). This value compares closely with the 0.24 mEq/g protein determined by titration of Van Slyke et al. (1928) and 0.22 mEq/g protein recently published by Constable (1997) for horse plasma. The Ka value compares closely with the value experimentally determined by Constable in 1997 (2.22 x 10(7) Eq/l). Linear regression of a set of experimental data from 5 Thoroughbred horses on a treadmill exercise test, showed excellent correlation with the regression lines not different from identity for the calculated and measured variables pH, HCO3 and SID. Knowledge of Atot and Ka for the horse is useful especially in exercise studies and in

  10. Fate of 14C-terpolymer (methylmethacrylate-14C, 2-hydroxyethylmethacrylate, butylacrylate) nanoparticles after peroral administration to rats.

    PubMed

    Kukan, M; Bezek, S; Koprda, V; Labský, J; Kálal, J; Bauerová, K; Trnovec, T

    1989-05-01

    The fate of 14C-terpolymer (methylmethacrylate-14C, 2-hydroxyethylmethacrylate, butylacrylate) nanoparticles was studied in male Wistar rats after peroral administration. These nanoparticles may reach systemic circulation as evidenced by the plasma 14C level, excretion of the label in the urine, as well as organ label deposition. It was found that at least 2% of the dose of 14C was absorbed from the gastrointestinal tract. As expected, the radioactive nanoparticles were excreted predominantly via the feces. The amount of the label in the gastrointestinal tract, liver, and carcasses fell below the limit of detection on day seven after administration. However in the spleen and lung some slight radioactivity persisted after 7 d of experiment.

  11. Incorporation of sup 14 C from ( sup 14 C)phenylalanine into condensed tannin of sorghum grain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reddy, V.; Butler, L.G.

    A procedure is described for obtaining condensed tannin from sorghum (Sorghum bicolor (L.) Moench) seeds metabolically labeled from ({sup 14}C)phenylalanine. The ({sup 14}C)tannin should be useful in determining the metabolic fate of dietary condensed tannin.

  12. Stable isotopes in yellow-bellied marmot (Marmota flaviventris) fossils reveal environmental stability in the late Quaternary of the Colorado Rocky Mountains

    NASA Astrophysics Data System (ADS)

    Reynard, Linda M.; Meltzer, David J.; Emslie, Steven D.; Tuross, Noreen

    2015-03-01

    High elevation plant and animal communities are considered extremely sensitive to environmental change. We investigated an exceptional fossil record of yellow-bellied marmot (Marmota flaviventris) specimens that was recovered from Cement Creek Cave (elev. 2860 m) and ranged in age from radiocarbon background circa 49.8 cal ka BP to ~ 1 cal ka BP. We coupled isotopic and radiocarbon measurements (δ18O, δD, δ15N, δ13C, and 14C) of bone collagen from individually-AMS dated specimens of marmots to assess ecological responses by this species to environmental change over time in a high elevation basin in the Rocky Mountains of southwestern Colorado, USA. We find little change in all four isotope ratios over time, demonstrating considerable environmental stability during periods when the marmots were present. The stable ecology and the apparent persistence of the small mammal community in the cave fauna throughout the late Quaternary are in marked contrast to the changes that occurred in the large mammal community, including local extirpation and extinction, at the end of the Pleistocene.

  13. Late Quaternary glaciation history of monsoon-dominated Dingad basin, central Himalaya, India

    NASA Astrophysics Data System (ADS)

    Shukla, Tanuj; Mehta, Manish; Jaiswal, Manoj K.; Srivastava, Pradeep; Dobhal, D. P.; Nainwal, H. C.; Singh, Atul K.

    2018-02-01

    The study presents the Late Quaternary glaciation history of monsoon-dominated Dokriani Glacier valley, Dingad basin, central Himalaya, India. The basin is tested for the mechanism of landforms preservation in high relief and abundant precipitation regimes of the Higher Himalaya. Field geomorphology and remote sensing data, supported by Optical Stimulated Luminescence (OSL) dating enabled identification of five major glacial events of decreasing magnitude. The oldest glacial stage, Dokriani Glacial Stage I (DGS-I), extended down to ∼8 km (2883 m asl) from present-day snout (3965 m asl) followed by other four glaciations events viz. DGS-II, DGS-III, DGS-IV and DGS-V terminating at ∼3211, 3445, 3648 and ∼3733 m asl respectively. The DGS-I glaciation (∼25-∼22 ka BP) occurred during early Marine Isotope Stage (MIS) -2, characterized as Last Glacial Maximum (LGM) extension of the valley. Similarly, DGS-II stage (∼14-∼11 ka BP) represents the global cool and dry Older Dryas and Younger Dryas event glaciation. The DGS-III glaciation (∼8 ka BP) coincides with early Holocene 8.2 ka cooling event, the DGS-IV glaciations (∼4-3.7 ka BP) corresponds to 4.2 ka cool and drier event, DGS-V (∼2.7-∼1 ka BP) represents the cool and moist late Holocene glacial advancement of the valley. This study suggests that the Dokriani Glacier valley responded to the global lowering of temperature and variable precipitation conditions. This study also highlights the close correlation between the monsoon-dominated valley glaciations and Northern Hemisphere cooling events influenced by North Atlantic climate.

  14. Atmospheric 14 C CO 2 variations in Japan during 1982--1999 based on 14 C measurements of rice grains.

    PubMed

    Shibata, Setsuko; Kawano, Eiko; Nakabayashi, Takeshige

    2005-08-01

    (14)C in rice grains is a useful tracer of atmospheric (14)C(CO(2)). (14)C measurement in rice grains for 17 years during 1982--1999 reveals the following. There is negative correlation between Delta(14)C and the population densities of localities in Japan. Under-populated areas in the northern area of Japan and Okinawa remained clean in the 1990s. The (14)C(CO(2)) decline rates at those areas are near to that of Shauinsland. A latitudinal effect due to Chinese nuclear tests is observed in 1982. Small Seuss effects is observed at the middle latitudes in East Asia after 1995.

  15. Sea-Level Change in the Russian Arctic Since the Last Glacial Maximum

    NASA Astrophysics Data System (ADS)

    Horton, B.; Baranskaya, A.; Khan, N.; Romanenko, F. A.

    2017-12-01

    Relative sea-level (RSL) databases that span the Last Glacial Maximum (LGM) to present have been used to infer changes in climate, regional ice sheet variations, the rate and geographic source of meltwater influx, and the rheological structure of the solid Earth. Here, we have produced a quality-controlled RSL database for the Russian Arctic since the LGM. The database contains 394 index points, which locate the position of RSL in time and space, and 244 limiting points, which constrain the minimum or maximum limit of former sea level. In the western part of the Russian Arctic (Barents and White seas,) RSL was driven by glacial isostatic adjustment (GIA) due to deglaciation of the Scandinavian ice sheet, which covered the Baltic crystalline shield at the LGM. RSL data from isolation basins show rapid RSL from 80-100 m at 11-12 ka BP to 15-25 m at 4-5 ka BP. In the Arctic Islands of Franz-Joseph Land and Novaya Zemlya, RSL data from dated driftwood in raised beaches show a gradual fall from 25-35 m at 9-10 ka BP to 5-10 m at 3 ka BP. In the Russian plain, situated at the margins of the formerly glaciated Baltic crystalline shield, RSL data from raised beaches and isolation basins show an early Holocene rise from less than -20 m at 9-11 ka BP before falling in the late Holocene, illustrating the complex interplay between ice-equivalent meltwater input and GIA. The Western Siberian Arctic (Yamal and Gydan Peninsulas, Beliy Island and islands of the Kara Sea) was not glaciated at the LGM. Sea-level data from marine and salt-marsh deposits show RSL rise at the beginning of the Holocene to a mid-Holocene highstand of 1-5 m at 5-1 ka BP. A similar, but more complex RSL pattern is shown for Eastern Siberia. RSL data from the Laptev Sea shelf show RSL at -40- -45 m and 11-14 ka BP. RSL data from the Lena Delta and Tiksi region have a highstand from 5 to 1 ka BP. The research is supported by RSF project 17-77-10130

  16. An 8bp indel in exon 1 of Ghrelin gene associated with chicken growth.

    PubMed

    Fang, Meixia; Nie, Qinghua; Luo, Chenglong; Zhang, Dexiang; Zhang, Xiquan

    2007-04-01

    Ghrelin, acts as the endogenous ligand for growth hormone secretagogues receptor (GHS-R), is a novel growth hormone (GH) releasing peptide with reported effects on food intake in chickens. In this study, an 8 bp indel polymorphism in exon 1 of the chicken Ghrelin (cGHRL) gene was genotyped in a F(2) designed full-sib population to analyze its associations with chicken growth and carcass traits. Later, mRNA level in the proventriculus was determined by real-time PCR to reveal the expression feature of cGHRL gene. Result showed that this 8 bp indel was significantly associated with body weight at the age of 28 days (BW28) and 56 days (BW56), eviscerated weight (EW) and leg muscle weight (LMW) (P<0.05), highly significantly associated with hatch weight (HW), BW14, 21, 35, 42, 49, 90 and body length (BL), dressed weight (DW), eviscerated weight with giblet (EWG), wing weight (WW), breast muscle weight (BMW) and head and neck weight (HNW) (P<0.01). Meanwhile, A allele (with 'CTAACCTG') was positive for chicken growth as individuals with AA genotype had the highest value of all traits. Analysis on cGhrelin mRNA level revealed that it differed significantly among individuals with three genotypes (P<0.05). Individuals with AB genotype had the highest mRNA level, whereas that of AA had the lowest one. It was concluded that this 8 bp indel of cGHRL gene was significantly associated with most body weight and body composition traits, and negative effect of endogenous Ghrelin on chicken growth were indicated by this study.

  17. Idiopathic paraproteinaemia. I. Studies in an animal model--the ageing C57BL/KaLwRij mouse.

    PubMed Central

    Radl, J; Hollander, C F; van den Berg, P; de Glopper, E

    1978-01-01

    A search for a suitable animal model for studies on idiopathic paraproteinaemia showed that an age-dependent increase in the appearance of homogeneous immunoglobulins in serum was common to all of the seven mouse strains investigated to date. The highest frequency was found in C57Bl/KaLwRij mice. Further investigations in this strain demonstrated that, except for some quantitative differences, most of the features of human and C57BL Mouse idiopathic paraproteinaemia were essentially the same. No clear-cut correlation was found between the idiopathic paraproteinaemia and, in the old C57B1 mice, a rather frequently occurring reticulum cell sarcoma B and amyloidosis. The mouse idiopathic paraproteinaemia can be regarded as an analogue of the human idiopathic paraproteinaemia and therefore as a suitable model for further experimental studies. PMID:367647

  18. The Ka'bah: House of God

    ERIC Educational Resources Information Center

    Social Education, 1978

    1978-01-01

    Describes the major Moslem edifice (the Ka'bah) in the holy city of Mecca and explains the importance of the Ka'bah in Muslim religious belief. Cultural and religious practices related to the Ka'bah are described. (Author/DB)

  19. The prenyl-binding protein PrBP/δ: a chaperone participating in intracellular trafficking.

    PubMed

    Zhang, Houbin; Constantine, Ryan; Frederick, Jeanne M; Baehr, Wolfgang

    2012-12-15

    Expressed ubiquitously, PrBP/δ functions as chaperone/co-factor in the transport of a subset of prenylated proteins. PrBP/δ features an immunoglobulin-like β-sandwich fold for lipid binding, and interacts with diverse partners. PrBP/δ binds both C-terminal C15 and C20 prenyl side chains of phototransduction polypeptides and small GTP-binding (G) proteins of the Ras superfamily. PrBP/δ also interacts with the small GTPases, ARL2 and ARL3, which act as release factors (GDFs) for prenylated cargo. Targeted deletion of the mouse Pde6d gene encoding PrBP/δ resulted in impeded trafficking to the outer segments of GRK1 and cone PDE6 which are predicted to be farnesylated and geranylgeranylated, respectively. Rod and cone transducin trafficking was largely unaffected. These trafficking defects produce progressive cone-rod dystrophy in the Pde6d(-/-) mouse. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. New data from fringing-reef cores for the mid-Holocene higher sea level in Hainan Island, northern South China Sea

    NASA Astrophysics Data System (ADS)

    Yao, Yantao; Zhan, Wenhuan; Sun, Jie

    2017-04-01

    Most previous research on sea level indicators (including beachrock, abrasion platforms, notches and coral reefs) from coast of northern South China Sea suggested a higher sea level in the mid-Holocene. Microatolls, considered to be one of the most reliable indicators, led to an estimation of 2 to 3 m or even more higher sea levels in the mid-Holocene at southwest Leizhou Peninsula. Volcanic activities, however, occurred at several stages during the Quaternary at southern Leizhou Peninsula and northern Hainan Island, indicating a tectonically unstable local crust. Comprehensive comparison of microatolls between the volcanic and the non-volcanic coasts implied obvious uplift of the volcanic coast, where elevation of microatolls was higher than those on the non-volcanic coast. In addition, microatolls from the non-volcanic coast universally demonstrated a mid-Holocene higher sea level of less than 1 m. Similar studies to date at some tectonically stable locations, distant from the major glaciation centers (the far-field), provided evidence that the mid-Holocene sea level was not as high as that estimated before. On the longest and also the widest fringing reef of Hainan Island, 10 cores were drilled in a transect approximately perpendicular to coastline. Upper and lower unconformities for the layer of Holocene marine sediments witnessed the Holocene transgression and regression, respectively. U-series and AMS14C ages of in-situ surface corals and deposits from the unconformities, compiled with sedimentary characteristics, announced a highest sea level of 1.18 m in 5.30 cal ka BP. The rapid sea level rise mainly occurred in 6.25 5.75 cal ka BP at a rate up to 11.4 mm/a. From 5.30 cal ka BP to 4.50 cal ka BP, it can be regarded as a relative sea level stand, for most surface fossil microatolls on reef flat lived in this period. Since then there might be a sudden and fast sea level fall in 4.50 4.14 cal ka BP, resulting in fast exposure of the initial reef flat and then

  1. Root-Uptake of C-14 Acetic Acid by Various Plants and C-14 Dynamics Surrounding the Experimental Tessera

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ogiyama, S.; Takeda, H.; Uchida, S.

    Carbon-14 (C-14, t{sub 1/2} = 5.73x10{sup 3} yrs) from radioactive waste is one of the most important radioactive nuclides for environmental assessment in the context of geological disposal, and understanding the transfer of radioactive elements to plants is essential for public health safety. In order to obtain fundamental knowledge, culture experiments using marigold (Tagetes patula L.), tall fescue (Festuca arundinacea S.), paddy rice (Oryza sativa L.), radish (Raphanus sativus L.), and carrot (Daucus carota L.) plants were conducted to examine root-uptake and dynamics of C-14 in the laboratory. The C-14 radioactivity in each plant part (e.g. shoot, root, edible part,more » etc.), medium (e.g. culture solution, sand, etc.), and air was determined. The distribution of C-14 in the plants was visualized using autoradiography. For a comparison, autoradiography was also done using Na-22. Results of the present study indicated that C-14 labeled CO{sub 2} gas was released from the culture solution to the atmosphere. Clear autoradiography images were observed in plants for the shoots and lower roots which were soaked in the culture solution. The upper roots which were not soaked in the culture solution were not clearly imaged. In the radiotracer experiment using Na-22, a clear image was observed for the whole carrot seedling, even including the upper root, on the autoradiography. However, the amounts of C-14 acetic acid absorbed by all the plants through their roots were considered to be very small. Inorganic carbon transformed from C-14 acetic acid would be taken up by plants through the roots, and some fraction of C-14 would be assimilated into the shoots by photosynthesis. (authors)« less

  2. A ˜50 ka record of monsoonal variability in the Darjeeling foothill region, eastern Himalayas

    NASA Astrophysics Data System (ADS)

    Ghosh, Ruby; Bera, Subir; Sarkar, Anindya; Paruya, Dipak Kumar; Yao, Yi-Feng; Li, Cheng-Sen

    2015-04-01

    Pollen, phytoliths and δ 13C signatures of soil organic matter from two fluvial sedimentary sequences of the Darjeeling foothill region, eastern Himalayas are used to portray palaeoclimatic oscillations and their impact on regional plant communities over the last ˜50 ka. Quantitative palaeoclimate estimation using coexistence approach on pollen data and other proxies indicate significant oscillations in precipitation during the late part of MIS 3 (46.4-25.9 ka), early and middle part of MIS 2 (25.9-15.6 ka), and 5.4 to 3.5 ka. Middle to late MIS 3 (ca 46.4-31 ka.) was characterized by a comparatively low monsoonal activity and slightly higher temperature than that during ca 31 ka onwards. Simultaneous expansion of deciduous trees and chloridoid grasses also imply a drier and warmer phase. Between 31 and 22.3 ka (late MIS 3 to mid-MIS 2), higher precipitation and a slightly cooler temperature led to an increase in evergreen elements over deciduous taxa and wet-loving panicoid grasses over dry-loving chloridoid grasses than earlier. After ca 22.3 ka, shrinking of forest cover, expansion of C4 chloridoid grasses, Asteraceae and Cheno-ams in the vegetation with lowering of temperature and precipitation characterized the onset of the LGM which continued till 18.3 ka. End of the LGM is manifested by a restoration in the forest cover and in the temperature and precipitation regime. Later, during 5.4 to 4.3 ka, a strong monsoonal activity supported a dense moist evergreen forest cover that subsequently declined during 4.3 to 3.5 ka. A further increase in deciduous elements and non-arboreals might be a consequence of reduced precipitation and higher temperature during this phase. A comparison between monsoonal rainfall, MAT and palaeoatmospheric CO2 with floral dynamics since last ˜50 ka indicates that these fluctuations in plant succession were mainly driven by monsoonal variations.

  3. Determination of pKa values of new phenacyl-piperidine derivatives by potentiometric titration method in aqueous medium at room temperature (25±0.5oC).

    PubMed

    Zafar, Shaista; Akhtar, Shamim; Tariq, Talat; Mushtaq, Noushin; Akram, Arfa; Ahmed, Ahsaan; Arif, Muhammad; Naeem, Sabahat; Anwar, Sana

    2014-07-01

    Dissociation constant (pKa) of ten novel phenacyl derivatives of piperidine were determined by potentiometric titration method in aqueous medium at room temperature (25 ±0.5°C). The sample solutions were prepared in deionized water with ionic strength 0.01M and titrated with 0.1M NaOH solution. In addition, ΔG values were also calculated. Different prediction software programs were used to calculate pKa values too and compared to the experimentally observed pKa values. The experimental and theoretical values were found in close agreement. The results obtained in this research would help to predict the good absorption of the studied compounds and can be selected as lead molecules for the synthesis of CNS active agents because of their lipophilic nature especially compound VII.

  4. TopBP1 functions with 53BP1 in the G1 DNA damage checkpoint

    PubMed Central

    Cescutti, Rachele; Negrini, Simona; Kohzaki, Masaoki; Halazonetis, Thanos D

    2010-01-01

    TopBP1 is a checkpoint protein that colocalizes with ATR at sites of DNA replication stress. In this study, we show that TopBP1 also colocalizes with 53BP1 at sites of DNA double-strand breaks (DSBs), but only in the G1-phase of the cell cycle. Recruitment of TopBP1 to sites of DNA replication stress was dependent on BRCT domains 1–2 and 7–8, whereas recruitment to sites of DNA DSBs was dependent on BRCT domains 1–2 and 4–5. The BRCT domains 4–5 interacted with 53BP1 and recruitment of TopBP1 to sites of DNA DSBs in G1 was dependent on 53BP1. As TopBP1 contains a domain important for ATR activation, we examined whether it contributes to the G1 cell cycle checkpoint. By monitoring the entry of irradiated G1 cells into S-phase, we observed a checkpoint defect after siRNA-mediated depletion of TopBP1, 53BP1 or ATM. Thus, TopBP1 may mediate the checkpoint function of 53BP1 in G1. PMID:20871591

  5. TopBP1 functions with 53BP1 in the G1 DNA damage checkpoint.

    PubMed

    Cescutti, Rachele; Negrini, Simona; Kohzaki, Masaoki; Halazonetis, Thanos D

    2010-11-03

    TopBP1 is a checkpoint protein that colocalizes with ATR at sites of DNA replication stress. In this study, we show that TopBP1 also colocalizes with 53BP1 at sites of DNA double-strand breaks (DSBs), but only in the G1-phase of the cell cycle. Recruitment of TopBP1 to sites of DNA replication stress was dependent on BRCT domains 1-2 and 7-8, whereas recruitment to sites of DNA DSBs was dependent on BRCT domains 1-2 and 4-5. The BRCT domains 4-5 interacted with 53BP1 and recruitment of TopBP1 to sites of DNA DSBs in G1 was dependent on 53BP1. As TopBP1 contains a domain important for ATR activation, we examined whether it contributes to the G1 cell cycle checkpoint. By monitoring the entry of irradiated G1 cells into S-phase, we observed a checkpoint defect after siRNA-mediated depletion of TopBP1, 53BP1 or ATM. Thus, TopBP1 may mediate the checkpoint function of 53BP1 in G1.

  6. The new Section 23 of DO160C/ED14C lightning testing of externally mounted electrical equipment

    NASA Astrophysics Data System (ADS)

    Burrows, B. J. C.

    1991-08-01

    The new Section 23 is introduced which has only very recently been fully approved by the RTCA for incorporation into the first revision of DO160C/ED14C. Full threat lightning direct effects testing of equipment is entirely new to DO160, the only existing lightning testing is transient testing for LRU's (Line Replaceable Units) by pin or cable bundle injection methods, for equipment entirely contained within the airframe and assumed to be unaffected by direct effects. This testing required transients of very low amplitude compared with lightning itself, whereas the tests now to be described involve full threat lightning testing, that is using the previously established severe parameters of lightning appropriate to the Zone, such as 200 kA for Zone 1A as in AC20-136. Direct effects (i.e., damage) testing involves normally the lightning current arc attaching to the object under test (or very near to it) so submitting it to full potential for the electric, mechanical, thermal and shock damage which is caused by high current arcing. Since equipment for any part of the airframe require qualification, tests to demonstrate safety of equipment in fuel vapor regions of the airframe are also included.

  7. A 62 ka record from the WAIS Divide ice core with annual resolution to 30 ka (so far)

    NASA Astrophysics Data System (ADS)

    Fudge, T. J.; Taylor, K.; McGwire, K.; Brook, E.; Sowers, T.; Steig, E.; White, J.; Vaughn, B.; Bay, R.; McConnell, J.; Waddington, E.; Conway, H.; Clow, G.; Cuffey, K.; Cole-Dai, J.; Ferris, D.; Severinghaus, J.

    2012-04-01

    Drilling of the West Antarctic Ice Sheet (WAIS) Divide ice core has been completed to a depth of 3400 m, about 60 meters above the bed. We present an annually resolved time scale for the most recent 30ka (to 2800 m) based on electrical conductivity measurements, called "timescale WDC06A-5". Below 2800 m the ice is dated by matching isotopes, methane, and/or dust records to other ice cores. Optical borehole logging provides stratigraphic ties to other cores for the bottom-most 75 m that was drilled in December 2011, and indicates the bottom-most ice has an age of 62 ka. The relatively young ice at depth is likely the result of basal melting. The inferred annual layer thickness of the deep ice is >1 cm, suggesting that annual layer counting throughout the entire core may be possible with continuous flow analysis of the ice core chemistry; however, the annual signal in the electrical measurements fades at about 30 ka. We compare the WDC06A-5 timescale through the glacial-interglacial transition with the Greenland GICC05 and GISP2 timescales via rapid variations in methane. We calculate a preliminary delta-age with: 1) accumulation rate inferred from the annual layer thicknesses and thinning functions computed with a 1-D ice flow model, and 2) surface temperature inferred from the low resolution d18O record and a preliminary borehole temperature profile. The WDC06A-5 timescale agrees with the GICC05 and GISP2 timescales to within decades at the 8.2k event and the ACR termination (Younger Dryas/Preboreal transition, 11.7 ka). This is within the delta-age and correlation uncertainties. At the rapid methane drop at ~12.8 ka, the WDC06A-5 timescale is ~150 years older than GICC05 and ~90 older than GISP2; while at ~14.8 ka, the timescales once again agree within the delta-age and correlation uncertainties. The cause of the age discrepancy at 12.8 ka is unclear. We also compare the WDC06A-5 timescale at Dansgaard-Oeschger events 3 and 4 (~27.5 and 29 ka) to the

  8. Deglaciation of the Eurasian ice sheet complex

    NASA Astrophysics Data System (ADS)

    Patton, Henry; Hubbard, Alun; Andreassen, Karin; Auriac, Amandine; Whitehouse, Pippa L.; Stroeven, Arjen P.; Shackleton, Calvin; Winsborrow, Monica; Heyman, Jakob; Hall, Adrian M.

    2017-08-01

    2.5 × 106 km2 and drained the present day Vistula, Elbe, Rhine and Thames rivers through the Seine Estuary. During the Bølling/Allerød oscillation after c. 14.6 ka BP, two major proglacial lakes formed in the Baltic and White seas, buffering meltwater pulses from eastern Fennoscandia through to the Younger Dryas when these massive proglacial freshwater lakes flooded into the North Atlantic Ocean. Deglaciation temporarily abated during the Younger Dryas stadial at 12.9 ka BP, when remnant ice across Svalbard, Franz Josef Land, Novaya Zemlya, Fennoscandia and Scotland experienced a short-lived but dynamic re-advance. The final stage of deglaciation converged on present day ice cover around the Scandes mountains and the Barents Sea by 8.7 ka BP, although the phase-lagged isostatic recovery still continues today.

  9. ORIGIN OF PALMITIC ACID CARBON IN PALMITATES FORMED FROM HEXADECANE-1-C14 AND TETRADECANE-1-C14 BY MICROCOCCUS CERIFICANS

    PubMed Central

    Finnerty, W. R.; Kallio, R. E.

    1964-01-01

    Finnerty, W. R. (University of Iowa, Iowa City), and R. E. Kallio. Origin of palmitic acid carbon in palmitates formed from hexadecane-1-C14 and tetradecane-1-C14 by Micrococcus cerificans. J. Bacteriol. 87:1261–1265. 1964.—Degradation of the palmitic acid moiety of cetyl palmitate and myristyl palmitate formed from hexadecane-1-C14 and tetradecane-1-C14 by Micrococcus cerificans was carried out. The patterns of C14 labeling in palmitic acid from cetyl palmitate showed that hexadecane is oxidized at the C1 position, and cetyl alcohol and palmitic acid thus formed are directly esterified. Palmitic acid arising from tetradecane and esterified to tetradecanol appeared to have been synthesized by the addition of two carbon atoms to an existing 14-carbon atom skeleton. Considerable mixing of C14 occurred in the C1 and C2 positions of palmitic acid thus synthesized. PMID:14188700

  10. Construction of C35 gene bait recombinants and T47D cell cDNA library.

    PubMed

    Yin, Kun; Xu, Chao; Zhao, Gui-Hua; Liu, Ye; Xiao, Ting; Zhu, Song; Yan, Ge

    2017-11-20

    C35 is a novel tumor biomarker associated with metastasis progression. To investigate the interaction factors of C35 in its high expressed breast cancer cell lines, we constructed bait recombinant plasmids of C35 gene and T47D cell cDNA library for yeast two-hybrid screening. Full length C35 sequences were subcloned using RT-PCR from cDNA template extracted from T47D cells. Based on functional domain analysis, the full-length C35 1-348bp was also truncated into two fragments C351-153bp and C35154-348bp to avoid auto-activation. The three kinds of C35 genes were successfully amplified and inserted into pGBKT7 to construct bait recombinant plasmids pGBKT7-C351-348bp, pGBKT7-C351-153bp and pGBKT7-C35154-348bp, then transformed into Y187 yeast cells by the lithium acetate method. Auto-activation and toxicity of C35 baits were detected using nutritional deficient medium and X-α-Gal assays. The T47D cell ds cDNA was generated by SMART TM technology and the library was constructed using in vivo recombination-mediated cloning in the AH109 yeast strain using a pGADT7-Rec plasmid. The transformed Y187/pGBKT7-C351-348bp line was intensively inhibited while the truncated Y187/pGBKT7-C35 lines had no auto-activation and toxicity in yeast cells. The titer of established cDNA library was 2 × 10 7 pfu/mL with high transformation efficiency of 1.4 × 10 6 , and the insert size of ds cDNA was distributed homogeneously between 0.5-2.0 kb. Our research generated a T47D cell cDNA library with high titer, and the constructed two C35 "baits" contained a respective functional immunoreceptor tyrosine based activation motif (ITAM) and the conserved last four amino acids Cys-Ile-Leu-Val (CILV) motif, and therefore laid a foundation for screening the C35 interaction factors in a BC cell line.

  11. Holocene Activity of the Enriquillo-Plantain Garden Fault in Lake Enriquillo Derived from Seismic Stratigraphy

    NASA Astrophysics Data System (ADS)

    Rios, J. K.; McHugh, C. M.; Hornbach, M. J.; Mann, P.; Wright, V. D.; Gurung, D.

    2013-12-01

    The Enriquillo-Plantain-Garden fault zone (EPGF) crosses Lake Enriquillo (LE) in the Dominican Republic and extends E-W across the southern peninsula of Haiti, south of the Baie de Port au Prince (BPP). Seismic stratigraphic studies of CHIRP high-resolution subbottom profiles calibrated to ages obtained from sediment cores and previous coral reef studies provide a Holocene record of relative sea level rise into the BPB and LE and a time frame for understanding tectonics of the EPGF. The BPP is 20 km wide, 20 km long, 150 m deep, and surrounded by coral reefs at water depths of 30 m. Three seismic units were identified: Unit 1: stepped terraces 5-10 m high. Laminated strata onlaps the terraces. This unit possibly represents Marine Isotope Stages 6 and 5, but has not been dated. Unit 2: laminated strata, thicker than 10 m and dated near its top at 22 ka BP. The microfossil assemblages reveal that during the latest Pleistocene sea level lowstand the BPP had a restricted connection with the global ocean. Few well-preserved marine microfossils are present and mostly are reworked. Geochemical analyses reveal that the laminated sediments were deposited during wet periods (>Si, Al wt %, Cu ppm) and dry periods (>Ca wt %). Unit 3: acoustically transparent, ~10 m thick, dated near its base and top at 14 ka BP and 2 ka BP, respectively. This unit represents the Holocene initiation of sea level rise and high stand containing well-preserved marine fossils. At ~9.5 ka BP planktonic foraminifers become abundant implying deepening of marine waters. Lake Enriquillo is 127 km east of the BPP. It is 15 km wide, 40 km long and 45 m deep. CHIRP subbottom profiles penetrated ~30 m below the lake floor. Four main acoustic units were identified: Unit 1: deformed basement with steeply dipping and folded beds. Based on land studies this unit is likely Plio-Pleistocene in age. Unit 2: laminated strata. Ages from coral reefs and deformed strata on land indicate this unit is likely pre-20 ka

  12. Sedimentologic and Stratigraphic Aspects of Late Quaternary (<14 cal. ka?) Valley Fill (Paleo-Roanoke River) Beneath the Barrier Islands of the Outer Banks, North Carolina, USA

    NASA Astrophysics Data System (ADS)

    Farrell, K. M.; Brooks, R. W.

    2002-12-01

    Provided here is a preliminary interpretation of the late Pleistocene (<14 cal. ka) facies succession that infilled the paleo-Roanoke River valley, and its transition into the overlying barrier island complex beneath the Outer Banks of North Carolina. Previous work (e.g. Riggs and others, 1992) reported that the Albemarle Embayment of eastern N.C. is underlain by a series of Pleistocene paleovalley complexes and provided hypotheses to test regarding valley distribution, sea level changes, and the ages of facies and sequences generated in response to coastal evolution. This report provides stratigraphic and sedimentologic criteria to support collaborative interpretations of eight cores acquired by a coastal geology cooperative research program on the Outer Banks to test these hypotheses. In cores OBX-02, 03, and 05, the late Quaternary (<14 cal. ka) fill is about 41 m thick. Here it erosionally overlies a bioturbated marine shelf deposit (OBX-2, 3, 5) that Wehmiller (personal communication) correlated (at OBX-05, depth -41 m) with the early/middle Pleistocene aminozone, AZ-4 (see Riggs and others, 1992). Above this, the late Quaternary fill (in cores OBX-02, 03, 05, 06) includes a succession of four facies units: 1) a basal sandy gravel (<6 m), 2) a dark gray complexly interbedded mud and gravel (<9 m), 3) bioturbated muddy sand (<15 m), and 4) an upward fining sand, with a basal gravel (<15 m). (Dimensional aspects of these units remain undefined until integration with GPR and seismic profiles). Six radiocarbon dates (from Thieler, personal communication) on samples from unit 2 (OBX-05: from -32.3, -33.6 and -35 m; OBX-02: from -27.7, -33.0, and -33.0 m) fall within the range 10 to 14 cal. ka. These were deposited during the Younger Dryas (Mallinson and others, Thieler, personal communications). Stratigraphic relations suggest that unit 1, although not dated, was deposited at the onset of this phase of global cooling. Unit 1, interpreted as fluvial thalweg and

  13. A comparison of the Greenland ice-core and IntCal timescales through the Laschamp geomagnetic excursion, utilising new 14C data from Tenaghi Philippon, Greece

    NASA Astrophysics Data System (ADS)

    Staff, Richard; Hardiman, Mark; Bronk Ramsey, Christopher; Hare, Vincent; Koutsodendris, Andreas; Pross, Jörg

    2017-04-01

    Cosmogenic radionuclides, such as 10Be and 14C, share a common production signal, with their formation in the Earth's upper atmosphere modulated by changes to the geomagnetic field, as well as variations in the intensity of the solar wind. Here, we present 54 14C measurements from a terrestrial fen peat core extracted from the site of Tenaghi Philippon, NE Greece, contiguously spanning the time period between 48,000 and 39,000 cal. BP. Utilising the most pronounced cosmogenic production peak of the last 100,000 years - that associated with the Laschamp geomagnetic excursion circa 41,000 years ago - we exploit this common production signal, comparing Greenland 10Be with our Tenaghi Philippon 14C record, thereby providing a means to assess the concordance between the radiocarbon (IntCal) and Greenland ice-core (GICC05) timescales themselves for this, the oldest portion of the radiocarbon technique.

  14. Deep-Space Ka-Band Flight Experience

    NASA Astrophysics Data System (ADS)

    Morabito, D. D.

    2017-11-01

    Lower frequency bands have become more congested in allocated bandwidth as there is increased competition between flight projects and other entities. Going to higher frequency bands offers significantly more bandwidth, allowing for the use of much higher data rates. However, Ka-band is more susceptible to weather effects than lower frequency bands currently used for most standard downlink telemetry operations. Future or prospective flight projects considering deep-space Ka-band (32-GHz) telemetry data links have expressed an interest in understanding past flight experience with received Ka-band downlink performance. Especially important to these flight projects is gaining a better understanding of weather effects from the experience of current or past missions that operated Ka-band radio systems. We will discuss the historical flight experience of several Ka-band missions starting from Mars Observer in 1993 up to present-day deep-space missions such as Kepler. The study of historical Ka-band flight experience allows one to recommend margin policy for future missions. Of particular interest, we will review previously reported-on flight experience with the Cassini spacecraft Ka-band radio system that has been used for radio science investigations as well as engineering studies from 2004 to 2015, when Cassini was in orbit around the planet Saturn. In this article, we will focus primarily on the Kepler spacecraft Ka-band link, which has been used for operational telemetry downlink from an Earth trailing orbit where the spacecraft resides. We analyzed the received Ka-band signal level data in order to characterize link performance over a wide range of weather conditions and as a function of elevation angle. Based on this analysis of Kepler and Cassini flight data, we found that a 4-dB margin with respect to adverse conditions ensures that we achieve at least a 95 percent data return.

  15. The Alleret Maar lacustrine sequence (French Massif Central): a 150 ka long early-middle Pleistocene continental paleoenvironmental record.

    NASA Astrophysics Data System (ADS)

    Nomade, S.; Pastre, J.; Guillou, H.; Gauthier, A.; Scaillet, S.

    2008-12-01

    Lacustrine maar sequences of the French Massif Central are of great interest for paleoclimatic and paleoenvironmental reconstructions of mid-latitudes Quaternary continental environments. In particular, the western Velay region yields exceptional sequences spanning the last 450 ka (Reille et al., J. Quat. Sci. 2000). However, older sequences remain largely unknown despite the presence of interbedded alkaline tephras allowing precise absolute radiochronological control of many lacustrine squences. The Alleret maar is a 1500 m wide phreatomagmatic crater that provides a long lacustrine sequence (41 m). The upper part of this sequence (AL2 core, 14.6 m) was studied between 2005 and 2006 (Pastre et al., C. R. Acad Sci, 2007). A 39Ar/40Ar date (557 ± 5ka) obtained from an interbedded tephra layer located at 7m as well as the associated pollen data attribute the beginning of this sequence to the MIS 15. Thanks to the AL3 core recovered in 2005 (40.6 m, CNRS Meudon) several new tephra layers were discovered in the bottom part of this lacustrine sequence. Three new 39Ar/40Ar ages (single crystal analyses) from trachytic tephra layers were obtained at the LSCE Argon Laboratory (France). These layers are located at -30.2, -36.2 and -39.2m. Ages obtained relative to the ACR-2 flux standard (1,201Ma, Kuiper et al., Science, 2008) range from 692 ± 6 ka (MSWD: 2.3, n=18) for the youngest (-30.2m) to 726 ± 9Ka Ka (MSWD: 2.2, n=12) for the lowest tephra located at -39.2m. These new dates indicate a relatively homogeneous deposition rate of 3.5cm/ka and that the last 10 meters cover the MIS 17-MIS18 period. According to these current radiochronological data the complete lacustrine sequence last more than 150ka. Ongoing sedimentary and pollen studies will allow to extend the paleoenvironmental and paleoclimatic records of the French Massif Central towards the beginning of the early middle Pleistocene.

  16. The last glaciation of Bear Peninsula, central Amundsen Sea Embayment of Antarctica: Constraints on timing and duration revealed by in situ cosmogenic 14C and 10Be dating

    NASA Astrophysics Data System (ADS)

    Johnson, Joanne S.; Smith, James A.; Schaefer, Joerg M.; Young, Nicolás E.; Goehring, Brent M.; Hillenbrand, Claus-Dieter; Lamp, Jennifer L.; Finkel, Robert C.; Gohl, Karsten

    2017-12-01

    Ice streams in the Pine Island-Thwaites region of West Antarctica currently dominate contributions to sea level rise from the Antarctic ice sheet. Predictions of future ice-mass loss from this area rely on physical models that are validated with geological constraints on past extent, thickness and timing of ice cover. However, terrestrial records of ice sheet history from the region remain sparse, resulting in significant model uncertainties. We report glacial-geological evidence for the duration and timing of the last glaciation of Hunt Bluff, in the central Amundsen Sea Embayment. A multi-nuclide approach was used, measuring cosmogenic 10Be and in situ14C in bedrock surfaces and a perched erratic cobble. Bedrock 10Be ages (118-144 ka) reflect multiple periods of exposure and ice-cover, not continuous exposure since the last interglacial as had previously been hypothesized. In situ14C dating suggests that the last glaciation of Hunt Bluff did not start until 21.1 ± 5.8 ka - probably during the Last Glacial Maximum - and finished by 9.6 ± 0.9 ka, at the same time as ice sheet retreat from the continental shelf was complete. Thickening of ice at Hunt Bluff most likely post-dated the maximum extent of grounded ice on the outer continental shelf. Flow re-organisation provides a possible explanation for this, with the date for onset of ice-cover at Hunt Bluff providing a minimum age for the timing of convergence of the Dotson and Getz tributaries to form a single palaeo-ice stream. This is the first time that timing of onset of ice cover has been constrained in the Amundsen Sea Embayment.

  17. Radiocarbon dating casts doubt on the late chronology of the Middle to Upper Palaeolithic transition in southern Iberia.

    PubMed

    Wood, Rachel E; Barroso-Ruíz, Cecilio; Caparrós, Miguel; Jordá Pardo, Jesús F; Galván Santos, Bertila; Higham, Thomas F G

    2013-02-19

    It is commonly accepted that some of the latest dates for Neanderthal fossils and Mousterian industries are found south of the Ebro valley in Iberia at ca. 36 ka calBP (calibrated radiocarbon date ranges). In contrast, to the north of the valley the Mousterian disappears shortly before the Proto-Aurignacian appears at ca. 42 ka calBP. The latter is most likely produced by anatomically modern humans. However, two-thirds of dates from the south are radiocarbon dates, a technique that is particularly sensitive to carbon contaminants of a younger age that can be difficult to remove using routine pretreatment protocols. We have attempted to test the reliability of chronologies of 11 southern Iberian Middle and early Upper Paleolithic sites. Only two, Jarama VI and Zafarraya, were found to contain material that could be reliably dated. In both sites, Middle Paleolithic contexts were previously dated by radiocarbon to less than 42 ka calBP. Using ultrafiltration to purify faunal bone collagen before radiocarbon dating, we obtain ages at least 10 ka (14)C years older, close to or beyond the limit of the radiocarbon method for the Mousterian at Jarama VI and Neanderthal fossils at Zafarraya. Unless rigorous pretreatment protocols have been used, radiocarbon dates should be assumed to be inaccurate until proven otherwise in this region. Evidence for the late survival of Neanderthals in southern Iberia is limited to one possible site, Cueva Antón, and alternative models of human occupation of the region should be considered.

  18. Radiocarbon dating casts doubt on the late chronology of the Middle to Upper Palaeolithic transition in southern Iberia

    PubMed Central

    Wood, Rachel E.; Barroso-Ruíz, Cecilio; Caparrós, Miguel; Jordá Pardo, Jesús F.; Galván Santos, Bertila; Higham, Thomas F. G.

    2013-01-01

    It is commonly accepted that some of the latest dates for Neanderthal fossils and Mousterian industries are found south of the Ebro valley in Iberia at ca. 36 ka calBP (calibrated radiocarbon date ranges). In contrast, to the north of the valley the Mousterian disappears shortly before the Proto-Aurignacian appears at ca. 42 ka calBP. The latter is most likely produced by anatomically modern humans. However, two-thirds of dates from the south are radiocarbon dates, a technique that is particularly sensitive to carbon contaminants of a younger age that can be difficult to remove using routine pretreatment protocols. We have attempted to test the reliability of chronologies of 11 southern Iberian Middle and early Upper Paleolithic sites. Only two, Jarama VI and Zafarraya, were found to contain material that could be reliably dated. In both sites, Middle Paleolithic contexts were previously dated by radiocarbon to less than 42 ka calBP. Using ultrafiltration to purify faunal bone collagen before radiocarbon dating, we obtain ages at least 10 ka 14C years older, close to or beyond the limit of the radiocarbon method for the Mousterian at Jarama VI and Neanderthal fossils at Zafarraya. Unless rigorous pretreatment protocols have been used, radiocarbon dates should be assumed to be inaccurate until proven otherwise in this region. Evidence for the late survival of Neanderthals in southern Iberia is limited to one possible site, Cueva Antón, and alternative models of human occupation of the region should be considered. PMID:23382220

  19. Evidence for insolation and Pacific forcing of late glacial through Holocene climate in the Central Mojave Desert (Silver Lake, CA)

    NASA Astrophysics Data System (ADS)

    Kirby, Matthew E.; Knell, Edward J.; Anderson, William T.; Lachniet, Matthew S.; Palermo, Jennifer; Eeg, Holly; Lucero, Ricardo; Murrieta, Rosa; Arevalo, Andrea; Silveira, Emily; Hiner, Christine A.

    2015-09-01

    Silver Lake is the modern terminal playa of the Mojave River in southern California (USA). As a result, it is well located to record both influences from the winter precipitation dominated San Bernardino Mountains - the source of the Mojave River - and from the late summer to early fall North American monsoon at Silver Lake. Here, we present various physical, chemical and biological data from a new radiocarbon-dated, 8.2 m sediment core taken from Silver Lake that spans modern through 14.8 cal ka BP. Texturally, the core varies between sandy clay, clayey sand, and sand-silt-clay, often with abrupt sedimentological transitions. These grain-size changes are used to divide the core into six lake status intervals over the past 14.8 cal ka BP. Notable intervals include a dry Younger Dryas chronozone, a wet early Holocene terminating 7.8 - 7.4 cal ka BP, a distinct mid-Holocene arid interval, and a late Holocene return to ephemeral lake conditions. A comparison to potential climatic forcings implicates a combination of changing summer - winter insolation and tropical and N Pacific sea-surface temperature dynamics as the primary drivers of Holocene climate in the central Mojave Desert.

  20. Modelling silicon supply during the Last Interglacial (MIS 5e) at Lake Baikal

    NASA Astrophysics Data System (ADS)

    Panizzo, V. N.; Swann, G. E. A.; Mackay, A. W.; Pashley, V.; Horstwood, M. S. A.

    2018-06-01

    Limnological reconstructions of primary productivity have demonstrated its response over Quaternary timescales to drivers such as climate change, landscape evolution and lake ontogeny. In particular, sediments from Lake Baikal, Siberia, provide a valuable uninterrupted and continuous sequence of biogenic silica (BSi) records, which document orbital and sub-orbital frequencies of regional climate change. We here extend these records via the application of stable isotope analysis of silica in diatom opal (δ30Sidiatom) from sediments covering the Last Interglacial cycle (Marine Isotope Stage [MIS] 5e; c. 130 to 115 ka BP) as a means to test the hypothesis that it was more productive than the Holocene. δ30Sidiatom data for the Last Interglacial range between +1.29 and +1.78‰, with highest values between c. 127 to 124 ka BP (+1.57 to +1.78‰). Results show that diatom dissolved silicon (DSi) utilisation, was significantly higher (p = 0.001) during MIS 5e than the current interglacial, which reflects increased diatom productivity over this time (concomitant with high diatom biovolume accumulation rates [BVAR] and warmer pollen-inferred vegetation reconstructions). Diatom BVAR are used, in tandem with δ30Sidiatom data, to model DSi supply to Lake Baikal surface waters, which shows that highest delivery was between c. 123 to 120 ka BP (reaching peak supply at c. 120 ka BP). When constrained by sedimentary mineralogical archives of catchment weathering indices (e.g. the Hydrolysis Index), data highlight the small degree of weathering intensity and therefore representation that catchment-weathering DSi sources had, over the duration of MIS 5e. Changes to DSi supply are therefore attributed to variations in within-lake conditions (e.g. turbulent mixing) over the period, where periods of both high productivity and modelled-DSi supply (e.g. strong convective mixing) account for the decreasing trend in δ30Sidiatom compositions (after c. 124 ka BP).

  1. Distribution and biomarkers of carbon-14-labeled fullerene C60 ([(14) C(U)]C60 ) in female rats and mice for up to 30 days after intravenous exposure.

    PubMed

    Sumner, Susan C J; Snyder, Rodney W; Wingard, Christopher; Mortensen, Ninell P; Holland, Nathan A; Shannahan, Jonathan H; Dhungana, Suraj; Pathmasiri, Wimal; Han, Li; Lewin, Anita H; Fennell, Timothy R

    2015-12-01

    A comprehensive distribution study was conducted in female rats and mice exposed to a suspension of uniformly carbon-14-labeled C60 ([(14) C(U)]C60 ). Rodents were administered [(14) C(U)]C60 (~0.9 mg kg(-1) body weight) or 5% polyvinylpyrrolidone-saline vehicle alone via a single tail vein injection. Tissues were collected at 1 h and 1, 7, 14 and 30 days after administration. A separate group of rodents received five daily injections of suspensions of either [(14) C(U)]C60 or vehicle with tissue collection 14 days post exposure. Radioactivity was detected in over 20 tissues at all time points. The highest concentration of radioactivity in rodents at each time point was in liver, lungs and spleen. Elimination of [(14) C(U)]C60 was < 2% in urine and feces at any 24 h time points. [(14) C(U)]C60 and [(14) C(U)]C60 -retinol were detected in liver of rats and together accounted for ~99% and ~56% of the total recovered at 1 and 30 days postexposure, respectively. The blood radioactivity at 1 h after [(14) C(U)]C60 exposure was fourfold higher in rats than in mice; blood radioactivity was still in circulation at 30 days post [(14) C(U)]C60 exposure in both species (<1%). Levels of oxidative stress markers increased by 5 days after exposure and remained elevated, while levels of inflammation markers initially increased and then returned to control values. The level of cardiovascular marker von Willebrand factor, increased in rats, but remained at control levels in mice. This study demonstrates that [(14) C(U)]C60 is retained in female rodents with little elimination by 30 days after i.v. exposure, and leads to systemic oxidative stress. Copyright © 2015 John Wiley & Sons, Ltd.

  2. The production of (14C) oxalate during the metabolism of (14C) carbohydrates in isolated rat hepatocytes.

    PubMed

    Rofe, A M; James, H M; Bais, R; Edwards, J B; Conyers, R A

    1980-04-01

    Oxalate (14C) was produced during the metabolism of (U-14C) carbohydrates in hepatocytes isolated from normal rats. At 10 mM, the order of oxalate production was fructose > glycerol > xylitol > sorbitol greater than or equal to glucose in the ratio 10 : 4 : 3 : 1 : 1. This difference between oxalate production from fructose and glucose was reflected in their rates of utilisation, glucose being poorly metabolised in hepatocytes from fasted rats. Fructose was rapidly metabolised, producing glucose, lactate and pyruvate as the major metabolites. Glycerol, xylitol and sorbitol were metabolised at half the rate of fructose, the major metabolites being glucose, lactate and glycerophosphate. The marked similarity in the pattern of intermediary metabolites produced by these polyols was not, however, reflected in the rates of oxalate production. Hepatic polyol metabolism resulted in high levels of cytosolic NADH, as indicated by elevated lactate : pyruvate and glycerophosphate : dihydroxyacetone phosphate ratios. The artificial electron acceptor, phenazine methosulphate (PMS) stimulated oxalate production from the polyols, particularly xylitol. In the presence of PMS, the order of oxalate production was fructose greater than or equal to xylitol > glycerol > sorbitol in the ratio 10 : 10 : 6 : 2. The production of glucose, lactate and pyruvate from the polyols was also stimulated by PMS, whereas the general metabolism of fructose, including oxalate production, was little affected. Oxalate (14C) was produced from (1-14C), (2-14C) and (6-14C) but not (3,4-14C) glucose in hepatocytes isolated from non-fasted, pyridoxine-deficient rats. Whilst this labelling pattern is consistent with oxalate being produced by a number of pathways, it is suggested that metabolism via hydroxypyruvate is a major route for oxalate production from various carbohydrates, with perhaps the exception of xylitol, which appears to have an alternative mechanism for oxalate production. The observation that

  3. The biogeophysical climatic impacts of anthropogenic land use change during the Holocene

    NASA Astrophysics Data System (ADS)

    Smith, M. Clare; Singarayer, Joy S.; Valdes, Paul J.; Kaplan, Jed O.; Branch, Nicholas P.

    2016-04-01

    anomalies found in our single model simulations were -0.22 at 1850 CE, -0.11 at 2 ka BP, and -0.03 °C at 7 ka BP. Regionally, the largest temperature changes were in Europe with anomalies of -0.83 at 1850 CE, -0.58 at 2 ka BP, and -0.24 °C at 7 ka BP. Large-scale precipitation features such as the Indian monsoon, the Intertropical Convergence Zone (ITCZ), and the North Atlantic storm track are also impacted by local land use and remote teleconnections. We investigated how advection by surface winds, mean sea level pressure (MSLP) anomalies, and tropospheric stationary wave train disturbances in the mid- to high latitudes led to remote teleconnections.

  4. No evidence for a deglacial intermediate water Δ14C anomaly in the SW Atlantic

    NASA Astrophysics Data System (ADS)

    Sortor, R. N.; Lund, D. C.

    2010-12-01

    Reconstructions of Δ14C from the eastern tropical Pacific show that severe depletions in 14C occurred at intermediate depths during the last deglaciation (Marchitto et al. 2007; Stott et al. 2009). Marchitto et al. (2007) suggested that old radiocarbon from an isolated abyssal reservoir was injected via the Southern Ocean, and that this anomaly was then carried by Antarctic Intermediate Water (AAIW) to the tropical Pacific. However, a core from the southeastern Pacific Ocean near Chile, which is in the direct path of modern-day AAIW, does not exhibit the excursion and therefore casts doubts upon the AAIW mechanism (De Pol-Holz et al. 2010). Here we evaluate whether or not a deglacial 14C anomaly similar to that in the eastern tropical Pacific occurred at intermediate depths in the South Atlantic. We reconstructed Δ14C using planktonic and benthic foraminifera from core KNR159-5-36GGC on the Brazil Margin (27○31’S and 46○28’W, 1268 m depth). In the modern ocean, the hydrography near this core site is heavily influenced by AAIW (Oppo & Horowitz, 2000). Benthic Δ14C values were determined using raw benthic 14C ages and calendar-calibrated planktonic ages. The deglacial benthic Δ14C trend at this site is similar to the atmospheric Δ14C trend, and is consistent with U/Th-dated corals from intermediate depths on the Brazil Margin (Mangini et al. 2010). The amplitude and timing of Δ14C changes in the foraminiferal and coral records are especially congruous during the Mystery Interval. We find no evidence in the southwestern Atlantic of a ~300‰ decrease in intermediate water Δ14C beginning at 18 kyr BP. Changes in reservoir age of ~1000 years are required to create a Baja-like Δ14C anomaly off Brazil, an implausible increase for a subtropical gyre location. Furthermore, the resulting sedimentation rates would be up to ~145 cm/kyr during the deglaciation, an order of magnitude higher than the average sedimentation rate for 36GGC. When our results are

  5. Deglacial remobilization of permafrost carbon to sediments along the East Siberian Arctic Seas

    NASA Astrophysics Data System (ADS)

    Martens, J.; Wild, B.; Bröder, L.; Andersson, A.; Pearce, C.; O'Regan, M.; Jakobsson, M.; Tesi, T.; Muschitiello, F.; Sköld, M.; Semiletov, I. P.; Dudarev, O.; Gustafsson, O.

    2017-12-01

    Current climate change is expected to thaw large quantities of permafrost carbon (PF-C) and expose it to degradation which emits greenhouse gases (i.e. CO2 and CH4). Warming causes a gradual deepening of the seasonally thawed active layer surface of permafrost soils, but also the abrupt collapse of deeper Ice Complex Deposits (ICD), especially along Siberian coastlines. It was recently hypothesized that past warming already induced large-scale permafrost degradation after the last glacial, which ultimately amplified climate forcing. We here assess the mobilization of PF-C to East Siberian Arctic Sea sediments during these warming periods. We perform source apportionment using bulk carbon isotopes (ΔΔ14C, δ13C) together with terrestrial biomarkers (CuO-derived lignin phenols) as indicators for PF-C transfer. We apply these techniques to sediment cores (SWERUS-L2) from the Chukchi Sea (4-PC1) and the southern Lomonosov Ridge (31-PC1). We found that PF-C fluxes during the Bølling-Allerød warming (14.7 to 12.7 cal ka BP), the Younger Dryas cooling (12.7 to 11.7 cal ka BP) and the early Holocene warming (until 11 cal ka BP) were overall higher than mid and late Holocene fluxes. In the Chukchi Sea, PF-C burial was 2x higher during the deglaciation (7.2 g m-2 a-1) than in the mid and late Holocene (3.6 g m-2 a-1), and ICD were the dominant source of PF-C (79.1%). Smaller fractions originated from the active layer (9.1%) and marine sources (11.7%). We conclude that thermo-erosion of ICD released large amounts of PF-C to the Chukchi Sea, likely driven by climate warming and the deglacial sea level rise. This contrasts to earlier analyses of Laptev Sea sediments where active layer material from river transport dominated the carbon flux. Preliminary data on lignin phenol concentrations of Lomonosov Ridge sediments suggest that the postglacial remobilization of PF-C was one order of magnitude higher (10x) than during both the preceding glacial and the subsequent Holocene

  6. Environmental Change recorded in Lacustrine Sediments from Tangra Yumco, Tibetan Plateau, at 16.5 ka cal BP and during the Younger Dryas Chronozone

    NASA Astrophysics Data System (ADS)

    Henkel, K.; Ahlborn, M.; Haberzettl, T.; Kasper, T.; Daut, G.; Ju, J.; Ma, Q.; Wang, J.; Zhu, L.; Maeusbacher, R.

    2013-12-01

    In the purpose of understanding the recent climate change on the Tibetan Plateau (TP) and beyond and to allow predictions for future climate scenarios it is imperative to investigate past climate changes. The numerous lake systems on the TP serve as ideal archives for past hydrological changes, which are assumed to be caused by variations in strength and extent of monsoonal air masses. By now, the spatial and temporal monsoonal evolution on the TP is intensively discussed. With the focus on a W-E lake transect on the southern TP we investigate lakes with a multi-dating and multi-proxy analyses approach, which has already been successfully carried out on Nam Co, the easternmost lake of the transect. In this study, we present results from a ~11.5 m long lacustrine sediment record from the terminal lake Tangra Yumco (4,540 m a.s.l., 31°13'N, 86°43'E), representing the center of the transect. Tangra Yumco is the deepest lake recorded on the TP so far. Via a hydro-acoustic survey observed submerged beach berms (45 m below recent lake level) and exposed lake level terraces up to ~205 m above lake level indicate large lake level fluctuations in the past. The record consists of an interbedding of fine grained silty sediments with a lamination of different thicknesses (sub-mm to cm) and partly intercalated blackish sandy layers. Homogeneous areas, which occur especially in the upper two thirds of the profile, represent turbidite deposits. Until now, color- and greyscale-, magnetic susceptibility- and XRF-scanning were applied. For age control 22 14C AMS-radiocarbon measurements were carried out on bulk organic matter. To determine a possible carbon reservoir effect, additional surface sediment samples were measured as well as one modern aquatic plant. The results indicate a reservoir effect of ~2,120 +110/-90 years. Assuming a constant reservoir effect, the base of the record reveals a corrected radiocarbon age of 17,270 +325/-310 cal BP. The sediment accumulation rate is

  7. Accelerator mass spectrometry analysis of 14C-oxaliplatin concentrations in biological samples and 14C contents in biological samples and antineoplastic agents

    NASA Astrophysics Data System (ADS)

    Toyoguchi, Teiko; Kobayashi, Takeshi; Konno, Noboru; Shiraishi, Tadashi; Kato, Kazuhiro; Tokanai, Fuyuki

    2015-10-01

    Accelerator mass spectrometry (AMS) is expected to play an important role in microdose trials. In this study, we measured the 14C concentration in 14C-oxaliplatin-spiked serum, urine and supernatant of fecal homogenate samples in our Yamagata University (YU) - AMS system. The calibration curves of 14C concentration in serum, urine and supernatant of fecal homogenate were linear (the correlation coefficients were ⩾0.9893), and the precision and accuracy was within the acceptance criteria. To examine a 14C content of water in three vacuum blood collection tubes and a syringe were measured. 14C was not detected from water in these devices. The mean 14C content in urine samples of 6 healthy Japanese volunteers was 0.144 dpm/mL, and the intra-day fluctuation of 14C content in urine from a volunteer was little. The antineoplastic agents are administered to the patients in combination. Then, 14C contents of the antineoplastic agents were quantitated. 14C contents were different among 10 antineoplastic agents; 14C contents of paclitaxel injection and docetaxel hydrate injection were higher than those of the other injections. These results indicate that our quantitation method using YU-AMS system is suited for microdosing studies and that measurement of baseline and co-administered drugs might be necessary for the studies in low concentrations.

  8. Evidence from the northwestern Venezuelan Andes for extraterrestrial impact: The black mat enigma

    NASA Astrophysics Data System (ADS)

    Mahaney, W. C.; Kalm, V.; Krinsley, D. H.; Tricart, P.; Schwartz, S.; Dohm, J.; Kim, K. J.; Kapran, B.; Milner, M. W.; Beukens, R.; Boccia, S.; Hancock, R. G. V.; Hart, K. M.; Kelleher, B.

    2010-03-01

    A carbon-rich black layer encrusted on a sandy pebbly bed of outwash in the northern Venezuelan Andes, previously considered the result of an alpine grass fire, is now recognized as a 'black mat' candidate correlative with Clovis Age sites in North America, falling within the range of 'black mat' dated sites (~ 12.9 ka cal BP). As such, the bed at site MUM7B, which dates to < 11.8 ka 14C years BP (raw dates) and appears to be contemporaneous with the Younger Dryas (YD) cooling event, marks a possibly much more extensive occurrence than previously identified. No fossils (megafauna) or tool assemblages were observed at this newly identified candidate site (3800 a.m.s.l.), as in the case of the North American sites. Here, evidence is presented for an extraterrestrial impact event at ~ 12.9 ka. The impact-related Andean bed, located ~ 20 cm above 13.7-13.3 ka cal BP alluvial and glaciolacustrine deposits, falls within the sediment characteristics and age range of 'black mat' dated sites (~ 12.9 ka cal BP) in North America. Site sediment characteristics include: carbon, glassy spherules, magnetic microspherules, carbon mat 'welded' onto coarse granular material, occasional presence of platinum group metals (Rh and Ru), planar deformation features (pdfs) in fine silt-size fragmental grains of quartz, as well as orthoclase, and monazite (with an abundance of Rare Earth Elements—REEs). If the candidate site is 'black mat', correlative with the 'black mat' sites of North America, such an extensive occurrence may support the hypothesized airburst/impact over the Laurentide Glacier, which led to a reversal of Allerød warming and the onset of YD cooling and readvance of glaciers. While this finding does not confirm such, it merits further investigation, which includes the reconnaissance for additional sites in South America. Furthermore, if confirmed, such an extensive occurrence may corroborate an impact origin.

  9. Mid Holocene climate change and impact on evolution on human settlements in northern central Europe

    NASA Astrophysics Data System (ADS)

    Krossa, V. R.; Kim, H.-J.; Moros, M.; Dörfler, W.; Blanz, T.; Sinninghe Damsté, J. S.; Schneider, R.

    2012-04-01

    The Mid Holocene climate evolution in the North Atlantic was marked by a climate optimum, followed by a transition toward colder conditions, starting at about 6 ka BP. This climate transition was accompanied by a radical change from a hunter-gatherer-fisher society toward a society based on agriculture and the domestication of animals in northern Germany and Denmark. The aim of this study is to better understand the potential impact of oceanic and terrestrial climate change on such human societies in northern Germany and Denmark. We present paleoclimatic and paleoecological reconstructions from sites surrounding the landscape where these human groups settled during the Mid Holocene. These reconstructions include a high resolution UK'37 Sea Surface Temperature (SST) record from the Skagerrak, an MBT-CBT record for estimating lake temperature from Lake Belau, Northern Germany using the calibration set of Tierney et al. (2010), and a Loss On Ignition (LOI) record representing the anoxic/oxic state from the Gotland Basin, Baltic Sea. The UK'37 record is interpreted to reflect warm season SSTs, and shows a step-like temperature drop of about 6 °C from 6.5 to 5.0 ka BP, immediately followed by a 2 °C warming at about 5.0 ka BP. The MBT-CBT lake record probably reflects mean annual temperature at our site. The record suggests mild winters and/or warm summers until 5.3 ka BP, followed by 2 °C colder conditions within 500 years. The temperature proxies suggest a positive mode in North Atlantic Oscillation (NAO) until around 5.3 ka BP, followed by conditions typical of a negative NAO mode. Furthermore, the LOI record from the Gotland Basin implies a trend from oxic to more anoxic conditions, starting at ~5.8 ka BP. More severe anoxic conditions could have led to an ecosystem shift within the Baltic Sea, resulting in a decline of copepods, codfish and seals, thus influencing mesolithic hunting activity. The climatic and ecological changes that affected the Baltic Sea might

  10. The preparation of BP single crystals by high pressure flux method

    NASA Technical Reports Server (NTRS)

    Kumashiro, Y.; Misawa, S.; Gonda, S.

    1984-01-01

    Single crystals of BP, a III-V compound semiconductor, were obtained by the high pressure flux method. Cu3P and Ni12P5 powders were used as the flux, and mixed with BP powder. Two kinds of mixtures were prepared: (1) 1.8g (BP) + 35 G (Cu3P) and (2) 1.7 g (BP) + 25 g (Ni12P5). They were compressed into pellets, heated at 1300 C for 24 h in an induction furnace under a pressure of 1 MPa using Ar-P2 gas, and slowly cooled to room temperature. In case (1), BP single crystals grew along the (III) plane, and in case (2) they grew as an aggregate of crystallites. The cathodoluminescence spectra of the synthetic BP crystals showed peaks near 680 nm (1.82 eV) for case (1), and 500 nm (2.47 eV) for case (2). By using the high pressure flux method conventional sized crystals were obtained in a relatively short time.

  11. The 23,500 y 14C BP White Pumice Plinian eruption and associated debris avalanche and Tochimilco lava flow of Popocatépetl volcano, México

    NASA Astrophysics Data System (ADS)

    Siebe, Claus; Salinas, Sergio; Arana-Salinas, Lilia; Macías, José Luis; Gardner, James; Bonasia, Rosanna

    2017-03-01

    The White Pumice (WP) is one of the thickest and most voluminous Plinian fallouts produced by Popocatépetl volcano in central Mexico during the Late Pleistocene-Holocene. Its eruption 23,500 14C y BP (27,800 cal BP) was triggered by the catastrophic failure of the SW flank of the volcano. The resulting debris avalanche was highly mobile reaching 72 km from the cone with an apparent coefficient of friction (L/H) of 0.06. The deposit covers an area of 1200 km2, and has a volume of 10.4 km3. This gigantic landslide, characterized by exceptionally large proximal hummocks (> 400 m) provoked the sudden decompression of the hydrothermal and magmatic systems, which produced an initial blast followed by the rise of a Plinian column that reached an altitude of 33 km. The isopach map allows the recognition of a dispersal axis pointing toward the south, where an area of 2490 km2 was covered by > 10 cm of pumice and ash. The total volume of the pumice fallout was estimated at 1.9 km3 DRE (Dense Rock Equivalent). Pumice clasts are dacitic (62-66 wt.% SiO2, anhydrous basis), highly vesicular (55-88 vol.%) and display a seriate texture with phenocrysts of plagioclase + hornblende + augite + hypersthene + oxides (Ti-magnetite and ilmenite) + apatite. As the eruption advanced, discharge rates became more intermittent and the height of the column fluctuated and finally collapsed, generating pumice-and-ash flows that were emplaced around the volcano. This short but intense activity was followed during subsequent years by rain-induced lahars that reached great distances from the volcano. At the same time, more degassed andesitic-dacitic (61-65 wt.% SiO2) magma was erupted effusively (4.4 km3, DRE) in the new horseshoe-shaped 5 km-wide crater from which the Tochimilco lava flow descended toward the SSE, where it inundated an area of 68 km2 and reached as far as 22 km from its source. Since then, multiple eruptions have reconstructed the summit cone, almost completely obliterating the

  12. The DSS-14 C-band exciter

    NASA Technical Reports Server (NTRS)

    Rowan, D. R.

    1989-01-01

    The development and implementation of a C-band exciter for use with the Block IV Receiver-Exciter Subsystem at Deep Space Station 14 (DSS-14) has been completed. The exciter supplements the standard capabilities of the Block IV system by providing a drive signal for the C-band transmitter while generating coherent translation frequencies for C-band (5-GHz) to S-band (2.2- to 2.3-GHz) Doppler extraction, C-band to L-band (1.6-GHz) zero delay measurements, and a level calibrated L-band test signal. Exciter functions are described, and a general explanation and description of the C-band uplink controller is presented.

  13. Automatized sspKa measurements of dihydrogen phosphate and Tris(hydroxymethyl) aminomethane in acetonitrile/water mixtures from 20 to 60°C.

    PubMed

    Acquaviva, A; Tascon, M; Padró, J M; Gagliardi, L G; Castells, C B

    2014-09-01

    We measured pKa values of Tris(hydroxymethyl)aminomethane and dihydrogen phosphate; both are commonly used to prepare buffers for reverse-phase liquid chromatography (RPLC), in acetonitrile/water mixtures from 0% to 70% (v/v) (64.6% (w/w)) acetonitrile and at 20, 30, 40, 50, and 60°C. The procedure is based on potentiometric measurements of pH of buffer solutions of variable solvent compositions using a glass electrode and a novel automated system. The method consists in the controlled additions of small volumes of a thermostated solution from an automatic buret into another isothermal solution containing exactly the same buffer-component concentrations, but a different solvent composition. The continuous changes in the solvent composition induce changes in the potentials. Thus, only two sequences of additions are needed: increasing the amount of acetonitrile from pure water and decreasing the content of acetonitrile from 70% (v/v) (64.6% (w/w)). In the procedure with homemade apparatus, times for additions, stirring, homogenization, and data acquisition are entirely controlled by software programmed for this specific routine. This rapid, fully automated method was applied to acquire more than 40 potential data covering the whole composition range (at each temperature) in about two hours and allowed a systematic study of the effect of temperature and acetonitrile composition on acid-base equilibria of two widely used substances to control pH close to 7. The experimental pKa results were fitted to empirical functions between pKa and temperature and acetonitrile composition. These equations allowed predictions of pKa to estimate the pH of mixtures at any composition and temperature, which would be very useful, for instance, during chromatographic method development. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Molecular characterization and distribution of a 145-bp tandem repeat family in the genus Populus.

    PubMed

    Rajagopal, J; Das, S; Khurana, D K; Srivastava, P S; Lakshmikumaran, M

    1999-10-01

    This report aims to describe the identification and molecular characterization of a 145-bp tandem repeat family that accounts for nearly 1.5% of the Populus genome. Three members of this repeat family were cloned and sequenced from Populus deltoides and P. ciliata. The dimers of the repeat were sequenced in order to confirm the head-to-tail organization of the repeat. Hybridization-based analysis using the 145-bp tandem repeat as a probe on genomic DNA gave rise to ladder patterns which were identified to be a result of methylation and (or) sequence heterogeneity. Analysis of the methylation pattern of the repeat family using methylation-sensitive isoschizomers revealed variable methylation of the C residues and lack of methylation of the A residues. Sequence comparisons between the monomers revealed a high degree of sequence divergence that ranged between 6% and 11% in P. deltoides and between 4.2% and 8.3% in P. ciliata. This indicated the presence of sub-families within the 145-bp tandem family of repeats. Divergence was mainly due to the accumulation of point mutations and was concentrated in the central region of the repeat. The 145-bp tandem repeat family did not show significant homology to known tandem repeats from plants. A short stretch of 36 bp was found to show homology of 66.7% to a centromeric repeat from Chironomus plumosus. Dot-blot analysis and Southern hybridization data revealed the presence of the repeat family in 13 of the 14 Populus species examined. The absence of the 145-bp repeat from P. euphratica suggested that this species is relatively distant from other members of the genus, which correlates with taxonomic classifications. The widespread occurrence of the tandem family in the genus indicated that this family may be of ancient origin.

  15. Preliminary paleomagnetic and rock magnetic results from 17 to 22 ka sediment of Jeju Island, Korea: Geomagnetic excursional behavior or rock magnetic anomalies?

    NASA Astrophysics Data System (ADS)

    Ahn, Hyeon-Seon; Sohn, Young Kwan; Lee, Jin-Young; Kim, Jin Cheul

    2018-05-01

    Paleomagnetic and rock magnetic investigations were performed on a 64-cm-thick section of nonmarine unconsolidated muddy sediment from the Gosan Formation on Jeju Island, Korea. This sediment was recently dated to have been deposited between 22 and 17 kyr BP calibrated, with a sedimentation rate of 13-25 cm/kyr, based on many radiocarbon ages. Interestingly, stepwise alternating field (AF) demagnetization revealed characteristic natural remanent magnetizations with anomalous directions, manifested by marked deviations from the direction of today's axial dipole field, for some separate depth levels. On the other hand, stepwise thermal (TH) demagnetization showed more complex behavior, resulting in the identification of multiple remanence components. For all TH-treated specimens, consistently two different components are predominant: a low-temperature component unblocked below 240-320 °C entirely having normal-polarity apparently within the secular variation range of the Brunhes Chron, and a high-temperature component with unblocking temperatures (Tubs) between 240-320 and 520-580 °C that have anomalous directions, concentrated in the 13-34-cm-depth interval ( 17-19 ka in inferred age) and possibly below 53 cm depth (before 20 ka). Rock magnetic results also infer the dominance of low-coercivity magnetic particles having 300 and 580 °C Curie temperature as remanence carriers, suggestive of (titano)maghemite and/or Ti-rich titanomagnetite and magnetite (or Ti-poor titanomagnetite), respectively. A noteworthy finding is that AF demagnetizations in this study often lead to incomplete separation of the two remanence components possibly due to their strongly overlapping AF spectra. The unusual directions do not appear to result from self-reversal remanences. Then, one interpretation is that the low-temperature components are attributable to post-depositional chemical remanences, associated possibly with the later formation of the mineral phase having Tub 300 °C

  16. Hepatitis C virus core protein targets 4E-BP1 expression and phosphorylation and potentiates Myc-induced liver carcinogenesis in transgenic mice.

    PubMed

    Abdallah, Cosette; Lejamtel, Charlène; Benzoubir, Nassima; Battaglia, Serena; Sidahmed-Adrar, Nazha; Desterke, Christophe; Lemasson, Matthieu; Rosenberg, Arielle R; Samuel, Didier; Bréchot, Christian; Pflieger, Delphine; Le Naour, François; Bourgeade, Marie-Françoise

    2017-08-22

    Hepatitis C virus (HCV) is a leading cause of liver diseases including the development of hepatocellular carcinoma (HCC). Particularly, core protein has been involved in HCV-related liver pathologies. However, the impact of HCV core on signaling pathways supporting the genesis of HCC remains largely elusive. To decipher the host cell signaling pathways involved in the oncogenic potential of HCV core, a global quantitative phosphoproteomic approach was carried out. This study shed light on novel differentially phosphorylated proteins, in particular several components involved in translation. Among the eukaryotic initiation factors that govern the translational machinery, 4E-BP1 represents a master regulator of protein synthesis that is associated with the development and progression of cancers due to its ability to increase protein expression of oncogenic pathways. Enhanced levels of 4E-BP1 in non-modified and phosphorylated forms were validated in human hepatoma cells and in mouse primary hepatocytes expressing HCV core, in the livers of HCV core transgenic mice as well as in HCV-infected human primary hepatocytes. The contribution of HCV core in carcinogenesis and the status of 4E-BP1 expression and phosphorylation were studied in HCV core/Myc double transgenic mice. HCV core increased the levels of 4E-BP1 expression and phosphorylation and significantly accelerated the onset of Myc-induced tumorigenesis in these double transgenic mice. These results reveal a novel function of HCV core in liver carcinogenesis potentiation. They position 4E-BP1 as a tumor-specific target of HCV core and support the involvement of the 4E-BP1/eIF4E axis in hepatocarcinogenesis.

  17. Structure of 14C and 14B from the C,1514(d ,3He)B,1413 reactions

    NASA Astrophysics Data System (ADS)

    Bedoor, S.; Wuosmaa, A. H.; Albers, M.; Alcorta, M.; Almaraz-Calderon, Sergio; Back, B. B.; Bertone, P. F.; Deibel, C. M.; Hoffman, C. R.; Lighthall, J. C.; Marley, S. T.; Mcneel, D. G.; Pardo, R. C.; Rehm, K. E.; Schiffer, J. P.; Shetty, D. V.

    2016-04-01

    We have studied the C,1514(d ,3He)B,1413 proton-removing reactions in inverse kinematics. The (d ,3He ) reaction probes the proton occupation of the target ground state, and also provides spectroscopic information about the final states in B,1413. The experiments were performed using C,1514 beams from the ATLAS accelerator at Argonne National Laboratory. The reaction products were analyzed with the HELIOS device. Angular distributions were obtained for transitions from both reactions. The 14C-beam data reveal transitions to excited states in 13B that suggest configurations with protons outside the π (0 p3 /2) orbital, and some possibility of proton cross-shell 0 p -1 s 0 d excitations, in the 14C ground state. The 15C-beam data confirm the existence of a broad 2- excited state in 14B. The experimental data are compared to the results of shell-model calculations.

  18. Late quaternary temperature record from buried soils of the North American Great Plains

    USGS Publications Warehouse

    Nordt, L.; Von Fischer, J.; Tieszen, L.

    2007-01-01

    We present the first comprehensive late Quaternary record of North American Great Plains temperature by assessing the behavior of the stable isotopic composition (δ13C) of buried soils. After examining the relationship between the δ13C of topsoil organic matter and July temperature from 61 native prairies within a latitudinal range of 46°–38°N, we applied the resulting regression equation to 64 published δ13C values from buried soils of the same region to construct a temperature curve for the past 12 k.y. Estimated temperatures from 12 to 10 ka (1 k.y. = 1000 14C yr B.P.) fluctuated with a periodicity of ∼1 k.y. with two cool excursions between −4.5 and −3.5 °C and two warmer excursions between −1 and 0 °C, relative to modern. Early Holocene temperatures from ca. 10–7.5 ka were −1.0 to −2.0 °C before rising to +1.0 °C in the middle Holocene between 6.0 and 4.5 ka. After a cool interlude from 4.2 to 2.6 ka, when temperatures dropped to slightly below modern, another warm interval ensued from 2.6 to 1 ka as temperatures increased to ∼+0.5 °C. A final decline in temperature to below modern occurred beginning ca. 0.5 ka. Cooler than present temperatures in the Great Plains indicate telecommunications with cool-water episodes in the Gulf of Mexico and North Atlantic potentially governed by a combination of glacial meltwater pulses and low solar irradiance.

  19. New residence times of the Holocene reworked shells on the west coast of Bohai Bay, China

    NASA Astrophysics Data System (ADS)

    Shang, Zhiwen; Wang, Fu; Li, Jianfen; Marshall, William A.; Chen, Yongsheng; Jiang, Xingyu; Tian, Lizhu; Wang, Hong

    2016-01-01

    Shelly cheniers and shell-rich beds found intercalated in near-shore marine muds and sandy sediments can be used to indicate the location of ancient shorelines, and help to estimate the height of sea level. However, dating the deposition of material within cheniers and shell-rich beds is not straightforward because much of this material is transported and re-worked, creating an unknown temporal off-set, i.e., the residence time, between the death of a shell and its subsequent entombment. To quantify the residence time during the Holocene on a section of the northern Chinese coastline a total 47 shelly subsamples were taken from 17 discrete layers identified on the west coast of Bohai Bay. This material was AMS 14C dated and the calibrated ages were systematically compared. The subsamples were categorized by type as articulated and disarticulated bivalves, gastropod shells, and undifferentiated shell-hash. It was found that within most individual layers the calibrated ages of the subsamples got younger relative to the amount of apparent post-mortem re-working the material had been subject to. For examples, the 14C ages of the bivalve samples trended younger in this order: shell-hash → split shells → articulated shells. We propose that the younger subsample age determined within an individual layer will be the closest to the actual depositional age of the material dated. Using this approach at four Holocene sites we find residence times which range from 100 to 1260 cal yrs, with two average values of 600 cal yrs for the original 14C dates older than 1 ka cal BP and 100 cal yrs for the original 14C dates younger than 1 ka cal BP, respectively. Using this semi-empirical estimation of the shell residence times we have refined the existing chronology of the Holocene chenier ridges on the west coast of Bohai Bay.

  20. Late quaternary lake level changes of Taro Co and neighbouring lakes, southwestern Tibetan Plateau, based on OSL dating and ostracod analysis

    NASA Astrophysics Data System (ADS)

    Alivernini, Mauro; Lai, Zhongping; Frenzel, Peter; Fürstenberg, Sascha; Wang, Junbo; Guo, Yun; Peng, Ping; Haberzettl, Torsten; Börner, Nicole; Mischke, Steffen

    2018-07-01

    The Late Quaternary lake history of Taro Co and three neighbouring lakes was investigated to reconstruct local hydrological conditions and the regional moisture availability. Ostracod-based water depth and habitat reconstructions combined with OSL and radiocarbon dating are performed to better understand the Taro Co lake system evolution during the Late Quaternary. A high-stand is observed at 36.1 ka before present which represents the highest lake level since then related to a wet stage and resulting in a merging of Taro Co and its neighbouring lakes Zabuye and Lagkor Co this time. The lake level then decreased and reached its minimum around 30 ka. After c. 20 ka, the lake rose above the present day level. A minor low-stand, with colder and drier conditions, is documented at 12.5 cal. ka BP. Taro Co Zabuye and Lagkor Co formed one large lake with a corresponding high-stand during the early Holocene (11.2-9.7 cal. ka BP). After this Holocene lake level maximum, all three lakes shrank, probably related to drier conditions, and Lagkor Co became separated from the Taro Co-Zabuye system at c.7 ka. Subsequently, the lake levels decreased further about 30 m and Taro Co began to separate from Zabuye Lake at around 3.5 ka. The accelerating lake-level decrease of Taro Co was interrupted by a short-term lake level rise after 2 ka BP, probably related to minor variations of the monsoonal components. A last minor high-stand occurred at about 0.8 ka before today and subsequently the lake level of Taro Co registers a slight increase in recent years.

  1. Fade Mitigation Techniques at Ka-Band

    NASA Technical Reports Server (NTRS)

    Dissanayake, Asoka (Editor)

    1996-01-01

    Rain fading is the dominant propagation impairment affecting Ka-band satellite links and rain fade mitigation is a key element in the design of Ka-band satellite networks. Some of the common fade mitigation techniques include: power control, diversity, adaptive coding, and resource sharing. The Advanced Communications Technology Satellite (ACTS) provides an excellent opportunity to develop and test Ka-band rain impairment amelioration techniques. Up-link power control and diversity are discussed in this paper.

  2. 7Li(15N, 14C)8Be reaction at 81 MeV and 14C + 8Be interaction versus that of 13C + 8Be

    NASA Astrophysics Data System (ADS)

    Rudchik, A. T.; Rudchik, A. A.; Muravynets, L. M.; Kemper, K. W.; Rusek, K.; Koshchy, E. I.; Piasecki, E.; Trzcinska, A.; Pirnak, Val. M.; Ponkratenko, O. A.; Strojek, I.; Stolarz, A.; Plujko, V. A.; Sakuta, S. B.; Siudak, R.; Ilyin, A. P.; Stepanenko, Yu. M.; Shyrma, Yu. O.; Uleshchenko, V. V.

    2018-03-01

    Angular distributions of the 7Li(15N, 14C)8Be reaction were measured at the energy Elab(15N) = 81 MeV. Data for transfer to the ground and first two excited states in 8Be were acquired as well as to the 14C ground and excited states. The reaction data were analyzed within the coupled-reaction-channels (CRC) method. The required 15N + 7Li entrance channel potential was taken from the 15N + 7Li elastic scattering. The 14C + 8Be potential was found by fitting Woods-Saxon form potentials to those generated by double folded real and imaginary potentials in the region of interaction. These generated potentials were then used in the CRC calculations. Proton transfer dominants this reaction, including to the excited states of 8Be. The reaction dependence on the exit channel potential was examined by using the 13C + 8Be potential previously deduced from the 9Be(12C, 13C)8Be reaction and 14C + 8Be from the 13C(9Be, 8Be)14C reaction.

  3. Disposition of /sup 14/C-acetohydroxamic acid and /sup 14/C-acetamide in the rat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Putcha, L.; Griffith, D.P.; Feldman, S.

    Acetohydroxamic acid (AHA) has been identified as a potential agent for the treatment of infection-induced staghorn renal calculi in patients. The pharmacokinetics and disposition of /sup 14/C-acetamide have been evaluated in rats following iv and oral administration. The results of these experiments suggest that, following oral administration to rats, AHA is absorbed very rapidly from the gastrointestinal tract and is metabolized to acetamide and CO/sub 2/. Approximately 50-56% of the iv dose and 40-49% of the oral dose of /sup 14/C-AHA is excreted in the urine, suggesting a significant nonrenal elimination pathway for AHA and metabolite(s). Administration of /sup 14/C-acetamidemore » to rats revealed that the compound is predominantly eliminated via the renal route, accounting for 68% of the administered radioactive dose. However, approximately 30% of the dose in the case of both AHA and acetamide could not be recovered, either in the urine or in the breath, during the 72-hr period of the experiment. This suggests that acetamide, may undergo further metabolism to get incorporated into the acetate pool. This would result in very slow elimination of the remaining activity as /sup 14/CO/sub 2/ or as another unknown metabolite.« less

  4. AMS 14 C dating controlled records of monsoon and Indonesian throughflow variability from the eastern Indian Ocean of the past 32,000 years

    NASA Astrophysics Data System (ADS)

    Li, Z. Y.; Chen, M. T.; Shi, X.; Liu, S.; Wang, H.

    2015-12-01

    Zi-Ye Li a, Min-Te Chen b, Hou-Jie Wang a, Sheng-Fa Liu c, Xue-Fa Shi ca College of Marine Geosciences, Ocean University of China, Qingdao 266100, P.R. Chinab Institute of Applied Geosciences, National Taiwan Ocean University, Keelung, Taiwan 20224, ROCc First Institute of Oceanography, SOA, Qingdao 266100, P.R. China Indonesian throughflow (ITF) is one of the most important currents responsible for transporting heat and moisture from the western Pacific to the Indian Oceans. The ITF is also well-known as effectively in modulating the global climate change with the interactions among ENSO and Asian monsoons. Here we present an AMS 14C dating controlled sea surface temperature (SST) record from core SO184-10043 (07°18.57'S, 105°03.53'E), which was retrieved from 2171m water depth at a north-south depression located at the southeastern offshore area of Sumatera in the eastern Indian Ocean. Based on our high-resolution SST using Mg/Ca analyses based on planktonic foraminifera shells of Globigerinoides ruber and alkenone index, U k'37-SST, oxygen isotope stratigraphy, and AMC 14C age-controls, our records show that, during the past 32,000 years, the SSTs were decreased which imply weaker ITF during Marine Isotope Stage (MIS) 2 and 3. The weaker UTF may respond to strengthened northeast monsoon during the boreal winter. During 21 to 15ka, the southeast monsoon had been stronger and the northeast monsoon was relatively weaker. During 15 to 8ka, rapid sea level rising may allow the opening of the gateways in the Makassar Strait and Lombok Strait that may have further strengthened the ITF. During the early Holocene, the northeast and southeast monsoons seem to be both strengthened. We will discuss the implications of the hydrographic variability and their age uncertainties in this paper during the meeting.

  5. Benzo[a]pyrene (BP) DNA adduct formation in DNA repair–deficient p53 haploinsufficient [Xpa(−/−)p53(+/−)] and wild-type mice fed BP and BP plus chlorophyllin for 28 days

    PubMed Central

    Poirier, Miriam C.

    2012-01-01

    We have evaluated DNA damage (DNA adduct formation) after feeding benzo[a]pyrene (BP) to wild-type (WT) and cancer-susceptible Xpa(−/−)p53(+/−) mice deficient in nucleotide excision repair and haploinsufficient for the tumor suppressor p53. DNA damage was evaluated by high-performance liquid chromatography/electrospray ionization tandem mass spectrometry (HPLC/ES-MS/MS), which measures r7,t8,t9-trihydroxy-c-10-(N 2-deoxyguanosyl)-7,8,9,10-tetrahydrobenzo[a]pyrene (BPdG), and a chemiluminescence immunoassay (CIA), using anti-r7,t8-dihydroxy-t-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (BPDE)–DNA antiserum, which measures both BPdG and the other stable BP-DNA adducts. When mice were fed 100 ppm BP for 28 days, BP-induced DNA damage measured in esophagus, liver and lung was typically higher in Xpa(−/−)p53(+/−) mice, compared with WT mice. This result is consistent with the previously observed tumor susceptibility of Xpa(−/−)p53(+/−) mice. BPdG, the major DNA adduct associated with tumorigenicity, was the primary DNA adduct formed in esophagus (a target tissue in the mouse), whereas total BP-DNA adducts predominated in higher levels in the liver (a non-target tissue in the mouse). In an attempt to lower BP-induced DNA damage, we fed the WT and Xpa(−/−)p53(+/−) mice 0.3% chlorophyllin (CHL) in the BP-containing diet for 28 days. The addition of CHL resulted in an increase of BP–DNA adducts in esophagus, liver and lung of WT mice, a lowering of BPdG in esophagi of WT mice and livers of Xpa(−/−)p53(+/−) mice and an increase of BPdG in livers of WT mice. Therefore, the addition of CHL to a BP-containing diet showed a lack of consistent chemoprotective effect, indicating that oral CHL administration may not reduce PAH–DNA adduct levels consistently in human organs. PMID:22828138

  6. pKa predictions for proteins, RNAs, and DNAs with the Gaussian dielectric function using DelPhi pKa.

    PubMed

    Wang, Lin; Li, Lin; Alexov, Emil

    2015-12-01

    We developed a Poisson-Boltzmann based approach to calculate the pKa values of protein ionizable residues (Glu, Asp, His, Lys and Arg), nucleotides of RNA and single stranded DNA. Two novel features were utilized: the dielectric properties of the macromolecules and water phase were modeled via the smooth Gaussian-based dielectric function in DelPhi and the corresponding electrostatic energies were calculated without defining the molecular surface. We tested the algorithm by calculating pKa values for more than 300 residues from 32 proteins from the PPD dataset and achieved an overall RMSD of 0.77. Particularly, the RMSD of 0.55 was achieved for surface residues, while the RMSD of 1.1 for buried residues. The approach was also found capable of capturing the large pKa shifts of various single point mutations in staphylococcal nuclease (SNase) from pKa-cooperative dataset, resulting in an overall RMSD of 1.6 for this set of pKa's. Investigations showed that predictions for most of buried mutant residues of SNase could be improved by using higher dielectric constant values. Furthermore, an option to generate different hydrogen positions also improves pKa predictions for buried carboxyl residues. Finally, the pKa calculations on two RNAs demonstrated the capability of this approach for other types of biomolecules. © 2015 Wiley Periodicals, Inc.

  7. The Mars Observer Ka-band link experiment

    NASA Technical Reports Server (NTRS)

    Rebold, T. A.; Kwok, A.; Wood, G. E.; Butman, S.

    1994-01-01

    The Ka-Band Link Experiment was the first demonstration of a deep-space communications link in the 32- to 35-GHz band (Ka-band). It was carried out using the Mars Observer spacecraft while the spacecraft was in the cruise phase of its mission and using a 34-meter beam-waveguide research and development antenna at the Goldstone complex of the DSN. The DSN has been investigating the performance benefits of a shift from X-band (8.4 GHz) to Ka-band (32 GHz) for deep-space communications. The fourfold increase in frequency is expected to offer a factor of 3 to 10 improvement (5 to 10 dB) in signal strength for a given spacecraft transmitter power and antenna size. Until recently, the expected benefits were based on performance studies, with an eye to implementing such a link, but theory was transformed to reality when a 33.7-GHz Ka-band signal was received from the spacecraft by DSS 13. This article describes the design and implementation of the Ka-Band Link Experiment from the spacecraft to the DSS-13 system, as well as results from the Ka-band telemetry demonstration, ranging demonstration, and long-term tracking experiment. Finally, a preliminary analysis of comparative X- and Ka-band tracking results is included. These results show a 4- to 7-dB advantage for Ka-band using the system at DSS 13, assuming such obstacles as antenna pointing loss and power conversion loss are overcome.

  8. Pollen-based continental climate reconstructions at 6 and 21 ka: a global synthesis

    USGS Publications Warehouse

    Bartlein, P.J.; Harrison, S.P.; Brewer, Sandra; Connor, S.; Davis, B.A.S.; Gajewski, K.; Guiot, J.; Harrison-Prentice, T. I.; Henderson, A.; Peyron, O.; Prentice, I.C.; Scholze, M.; Seppa, H.; Shuman, B.; Sugita, S.; Thompson, R.S.; Viau, A.E.; Williams, J.; Wu, H.

    2010-01-01

    Subfossil pollen and plant macrofossil data derived from 14C-dated sediment profiles can provide quantitative information on glacial and interglacial climates. The data allow climate variables related to growing-season warmth, winter cold, and plant-available moisture to be reconstructed. Continental-scale reconstructions have been made for the mid-Holocene (MH, around 6 ka) and Last Glacial Maximum (LGM, around 21 ka), allowing comparison with palaeoclimate simulations currently being carried out as part of the fifth Assessment Report (AR5) of the Intergovernmental Panel on Climate Change. The synthesis of the available MH and LGM climate reconstructions and their uncertainties, obtained using modern-analogue, regression and model-inversion techniques, is presented for four temperature variables and two moisture variables. Reconstructions of the same variables based on surface-pollen assemblages are shown to be accurate and unbiased. Reconstructed LGM and MH climate anomaly patterns are coherent, consistent between variables, and robust with respect to the choice of technique. They support a conceptual model of the controls of Late Quaternary climate change whereby the first-order effects of orbital variations and greenhouse forcing on the seasonal cycle of temperature are predictably modified by responses of the atmospheric circulation and surface energy balance.

  9. Pollen-based continental climate reconstructions at 6 and 21 ka: A global synthesis

    USGS Publications Warehouse

    Bartlein, P.J.; Harrison, S.P.; Brewer, Sandra; Connor, S.; Davis, B.A.S.; Gajewski, K.; Guiot, J.; Harrison-Prentice, T. I.; Henderson, A.; Peyron, O.; Prentice, I.C.; Scholze, M.; Seppa, H.; Shuman, B.; Sugita, S.; Thompson, R.S.; Viau, A.E.; Williams, J.; Wu, H.

    2011-01-01

    Subfossil pollen and plant macrofossil data derived from 14C-dated sediment profiles can provide quantitative information on glacial and interglacial climates. The data allow climate variables related to growing-season warmth, winter cold, and plant-available moisture to be reconstructed. Continental-scale reconstructions have been made for the mid-Holocene (MH, around 6 ka) and Last Glacial Maximum (LGM, around 21 ka), allowing comparison with palaeoclimate simulations currently being carried out as part of the fifth Assessment Report (AR5) of the Intergovernmental Panel on Climate Change. The synthesis of the available MH and LGM climate reconstructions and their uncertainties, obtained using modern-analogue, regression and model-inversion techniques, is presented for four temperature variables and two moisture variables. Reconstructions of the same variables based on surface-pollen assemblages are shown to be accurate and unbiased. Reconstructed LGM and MH climate anomaly patterns are coherent, consistent between variables, and robust with respect to the choice of technique. They support a conceptual model of the controls of Late Quaternary climate change whereby the first-order effects of orbital variations and greenhouse forcing on the seasonal cycle of temperature are predictably modified by responses of the atmospheric circulation and surface energy balance. ?? 2010 The Author(s).

  10. Lateglacial vegetation dynamics in the eastern Baltic region between 14,500 and 11,400 cal yr BP: A complete record since the Bølling (GI-1e) to the Holocene

    NASA Astrophysics Data System (ADS)

    Veski, Siim; Amon, Leeli; Heinsalu, Atko; Reitalu, Triin; Saarse, Leili; Stivrins, Normunds; Vassiljev, Jüri

    2012-04-01

    This paper discusses a complete record of vegetation history since the Bølling (GI-1e) warming (14,500 cal yr BP) up to the Holocene in Latvia. To date, this is the only complete record of such age in the eastern Baltic area and the northernmost area for which Bølling records are present. Combining pollen evidence, pollen accumulation rates (PAR) and plant macrofossil data, we assess the local and regional vegetation development, and we attempt to separate the true Lateglacial vegetation signal by removing the obviously redeposited thermophilous pollen; however, we remove not only their signal, we discuss the possibilities of separating the redeposition signal of the so-called "local Lateglacial trees", pine and birch, by looking at their corrosion and degradation. The results show that the Bølling warming in the eastern Baltic area was a treeless tundra community consisting of the shrubs Betula nana, Dryas octopetala and Salix polaris. The Older Dryas cold spell is clearly recognised as a decline in the total concentration of plant macrofossils and PARs at between 14,200 and 13,500 cal yr BP. At 13,460 cal yr BP, the B. nana macrofossils disappear, and tree birch (Betula sect. Albae) appears, marking the start of tree birch forest. The presence of pine forest is confirmed by a variety of macrofossils, including bark, wood, needles and seeds, since 13,400 cal yr BP, at the same time at which pine stomata are found. The first identified pine stomata finds are associated with a Pinus PAR over 3000 grains cm-2 yr-1 and pine macrofossil finds with a Pinus PAR over 4000 grains cm-2 yr-1. During the warmest period of the GI-1a (Allerød) at 13,000-12,700 cal yr BP, a pine forest with deciduous trees (birch -Betula pendula and aspen -Populus tremula) developed in the study area. The Younger Dryas (GS-1) cooling strongly affected the floral composition in eastern Latvia. The PAR of the tree taxa declined abruptly from a maximum value at 12,700 to below 1000 grains cm-2

  11. Preparation of 14C-Labeled Sterigmatocystin in Liquid Media

    PubMed Central

    Hsieh, Dennis P. H.; Yang, Susie L.

    1975-01-01

    14C-labeled sterigmatocystin was prepared from surface cultures of Aspergillus versicolor A-18074 maintained in liquid media by multiple additions of [1-14C]acetate to the cultures. The highest yield of 7.75 mg/10 ml was found with a sucrose-asparagine-ammonium medium in which more than 3% of the radioactivity of the added [1-14C]acetate was recovered in the purified [ring-14C] sterigmatocystin. The method offers an easy way to prepare 14C-labeled sterigmatocystin for studies of this mycotoxin. PMID:1110489

  12. Deletion of uncharacterized domain from α-1,3-glucanase of Bacillus circulans KA-304 enhances heterologous enzyme production in Escherichia coli.

    PubMed

    Yano, Shigekazu; Suyotha, Wasana; Zanma, Sumika; Konno, Hiroyuki; Cherdvorapong, Vipavee; Wakayama, Mamoru

    2018-05-08

    α-1,3-Glucanase (Agl-KA) of Bacillus circulans KA-304 consists of an N-terminal discoidin domain (DS1), a carbohydrate binding module family 6 (CBM6), threonine and proline repeats (TP), a second discoidin domain (DS2), an uncharacterized conserved domain (UCD), and a C-terminal catalytic domain. Previously, we reported that DS1, CBM6, and DS2 have α-1,3-glucan-binding activity and contribute to α-1,3-glucan hydrolysis. In this study, UCD deletion mutant (AglΔUCD) was constructed, and its properties were compared with those of Agl-KA. α-1,3-Glucan hydrolyzing, α-1,3-glucan binding, and protoplast-forming activities of AglΔUCD were almost the same as those of Agl-KA. k cat /K m values of AgΔUCD and Agl-KA were 11.4 and 11.1 s -1 mg -1 mL, respectively. AglΔUCD and Agl-KA exhibited similar characteristics, such as optimal pH, pH stability, optimal temperature, and thermostability. These results suggest that UCD is not α-1,3-glucan-binding and flexible linker domain, and that deletion of UCD does not affect the affinity of N-terminal binding domains and the catalytic action of the C-terminal domain. Subsequently, heterologous UCenzyme productivity of AglΔD in Escherichia coli was compared with that of Agl-KA. The productivity of AglΔUCD was about 4-fold larger than that of Agl-KA after an 8-h induction at 30°C. In the case of induction at 20°C, the productivity of AglΔUCD was also larger than that of Agl-KA. These findings indicate that deletion of only UCD enhances the enzyme productivity in E. coli.

  13. Evidence for higher-than-average air temperatures after the 8.2 ka event provided by a Central European δ18O record

    NASA Astrophysics Data System (ADS)

    Andersen, Nils; Lauterbach, Stefan; Erlenkeuser, Helmut; Danielopol, Dan L.; Namiotko, Tadeusz; Hüls, Matthias; Belmecheri, Soumaya; Dulski, Peter; Nantke, Carla; Meyer, Hanno; Chapligin, Bernhard; von Grafenstein, Ulrich; Brauer, Achim

    2017-09-01

    The so-called 8.2 ka event represents one of the most prominent cold climate anomalies during the Holocene warm period. Accordingly, several studies have addressed its trigger mechanisms, absolute dating and regional characteristics so far. However, knowledge about subsequent climate recovery is still limited although this might be essential for the understanding of rapid climatic changes. Here we present a new sub-decadally resolved and precisely dated oxygen isotope (δ18O) record for the interval between 7.7 and 8.7 ka BP (103 calendar years before AD 1950), derived from the calcareous valves of benthic ostracods preserved in the varved lake sediments of pre-Alpine Mondsee (Austria). Besides a clear reflection of the 8.2 ka event, showing a good agreement in timing, duration and magnitude with other regional stable isotope records, the high-resolution Mondsee lake sediment record provides evidence for a 75-year-long interval of higher-than-average δ18O values directly after the 8.2 ka event, possibly reflecting increased air temperatures in Central Europe. This observation is consistent with evidence from other proxy records in the North Atlantic realm, thus most probably reflecting a hemispheric-scale climate signal rather than a local phenomenon. As a possible trigger we suggest an enhanced resumption of the Atlantic meridional overturning circulation (AMOC), supporting assumptions from climate model simulations.

  14. Using 14C and 3H to understand groundwater flow and recharge in an aquifer window

    NASA Astrophysics Data System (ADS)

    Atkinson, A. P.; Cartwright, I.; Gilfedder, B. S.; Cendón, D. I.; Unland, N. P.; Hofmann, H.

    2014-12-01

    Knowledge of groundwater residence times and recharge locations is vital to the sustainable management of groundwater resources. Here we investigate groundwater residence times and patterns of recharge in the Gellibrand Valley, southeast Australia, where outcropping aquifer sediments of the Eastern View Formation form an "aquifer window" that may receive diffuse recharge from rainfall and recharge from the Gellibrand River. To determine recharge patterns and groundwater flow paths, environmental isotopes (3H, 14C, δ13C, δ18O, δ2H) are used in conjunction with groundwater geochemistry and continuous monitoring of groundwater elevation and electrical conductivity. The water table fluctuates by 0.9 to 3.7 m annually, implying recharge rates of 90 and 372 mm yr-1. However, residence times of shallow (11 to 29 m) groundwater determined by 14C are between 100 and 10 000 years, 3H activities are negligible in most of the groundwater, and groundwater electrical conductivity remains constant over the period of study. Deeper groundwater with older 14C ages has lower δ18O values than younger, shallower groundwater, which is consistent with it being derived from greater altitudes. The combined geochemistry data indicate that local recharge from precipitation within the valley occurs through the aquifer window, however much of the groundwater in the Gellibrand Valley predominantly originates from the regional recharge zone, the Barongarook High. The Gellibrand Valley is a regional discharge zone with upward head gradients that limits local recharge to the upper 10 m of the aquifer. Additionally, the groundwater head gradients adjacent to the Gellibrand River are generally upwards, implying that it does not recharge the surrounding groundwater and has limited bank storage. 14C ages and Cl concentrations are well correlated and Cl concentrations may be used to provide a first-order estimate of groundwater residence times. Progressively lower chloride concentrations from 10

  15. A new Late Weichselian and Holocene marine chronology for the western Svalbard slope 30,000-0 cal years BP

    NASA Astrophysics Data System (ADS)

    Jessen, Simon P.; Rasmussen, Tine L.; Nielsen, Tove; Solheim, Anders

    2010-05-01

    Data have been compiled from eleven sediment cores from 76° to 80°N on the western Svalbard slope. The cores are from water depths between 630 and 1880 m and show clear similarities in lithology and magnetic susceptibility. All cores penetrated into mass transported sediments from glacigenic debris flow events and turbidity flow events. The mass transport probably occurred when the ice reached the shelf edge. The deposits date between 24,080 ± 150 and 23,550 ± 185 calibrated (cal) years BP. The records also include laminated, fine grained sediments interpreted as deposits from sediment-laden meltwater plumes dated between 14,780 ± 220 and 14,300 ± 260 cal years BP. In Holocene sediments a diatom-rich fine grained layer dates 10,100 ± 150 to 9840 ± 200 cal years BP. The eleven cores have been stacked into one record with absolute age control from 35 AMS 14C dates. Together with oxygen isotope stratigraphy and contents of ice rafted detritus the stacked record provides a useful chronology tool for cores on the western Svalbard slope. Our study improves the age control of earlier well documented glacial events and shows that the maximum glacial state and the onset of the deglaciation both occurred 2500-3000 years earlier than previously reconstructed for the western Svalbard margin. The results indicate that during the last 30,000 years advance and retreat of the Svalbard-Barents Sea Ice Sheet was closely linked to the flow of Atlantic Water and Polar Water over the margin.

  16. Coherent monsoonal changes in the northern tropics revealed by Chadian lakes (L. Chad and Yoa) sedimentary archives during the African Humid Period

    NASA Astrophysics Data System (ADS)

    Sylvestre, Florence; Kroepelin, Stefan; Pierre, Deschamps; Christine, Cocquyt; Nicolas, Waldmann; Kazuyo, Tachikawa; Amaral Paula, Do; Doriane, Delanghe; Guillaume, Jouve; Edouard, Bard; Camille, Bouchez; Jean-Claude, Doumnang; Jean-Charles, Mazur; Martin, Melles; Guillemette, Menot; Frauke, Rostek; Nicolas, Thouveny; Volkner, Wennrich

    2016-04-01

    In northern African tropics, it is now well established that the Last Glacial Maximum (LGM) was extremely dry followed by a wetter Holocene. Numerous palaeolake records reveal a fairly consistent pattern of a moister early Holocene resulting in a green Sahara followed by the onset of aridification about 4000 years ago. These palaeoenvironmental conditions are deciphered from several continental records distributed over the sub-Saharan zone and including diverse environments. However, pronounced differences in the timing and amplitude of these moisture changes inferred from sedimentary records point to both regional climatic variability change and site-specific influences of local topographic-hydrogeological factors which biased the evolution of water balance reconstructed from individual lacustrine archives. Here we present hydrological reconstructions from Chadian lakes, i.e. Lake Chad (c. 13°N) and Lake Yoa (19°N). Because of their location, both records allow to reconstruct lake level fluctuations and environmental changes according to a gradient from Sahelian to Saharan latitudes. Whereas Lake Chad is considered as a good sensor of climatic changes because of its large drainage basin covering 610,000 km2 in the Sudanian belt, Lake Yoa logs the northern precipitation changes in the Sahara. Combining sedimentological (laser diffraction grain size) and geochemical (XRF analysis) data associated with bio-indicators proxies (diatoms, pollen), we compare lake-level fluctuations and environmental changes during the last 12,000 years. After the hyperarid Last Glacial Maximum period during which dunes covered the Lake Chad basin, both lake records indicate an onset of more humid conditions between 12.5-11 ka cal BP. These resulted in lacustrine transgressions approaching their maximum extension at c. 10.5 ka cal BP. The lacustrine phase was probably interrupted by a relatively short drying event occurring around 8.2 ka cal BP which is well-defined in Lake Yoa by

  17. The bomb 14C transient in the Pacific Ocean

    NASA Astrophysics Data System (ADS)

    Rodgers, Keith B.; Schrag, Daniel P.; Cane, Mark A.; Naik, Naomi H.

    2000-04-01

    A modeling study of the bomb 14C transient is presented for the Pacific Ocean. A primitive equation ocean circulation model has been configured for a high-resolution domain that accounts for the Indonesian Throughflow (ITF). Four separate runs were performed: (1) seasonal forcing with 20 Sv of ITF transport, (2) seasonal forcing with 10 Sv of ITF transport, (3) seasonal forcing with no ITF transport, and (4) interannual forcing with 15 Sv of ITF transport. This study has two main objectives. First, it is intended to describe the time evolution of the bomb 14C transient. This serves as a tool with which one can identify the physical processes controlling the evolving bomb 14C distribution in the Pacific thermocline and thus provides an interpretive framework for the database of Δ14C measurements in the Pacific. Second, transient tracers are applied to the physical oceanographic problem of intergyre exchange. This is of importance in furthering our understanding of the potential role of the upper Pacific Ocean in climate variability. We use bomb 14C as a dye tracer of intergyre exchange between the subtropical gyres and the equatorial upwelling regions of the equatorial Pacific. Observations show that while the atmospheric Δ14C signal peaked in the early to mid-1960s, the Δ14C levels in the surface water waters of the subtropical gyres peaked near 1970, and the Δ14C of surface waters in the equatorial Pacific continued to rise through the 1980s. It is shown that the model exhibits skill in representing the large-scale observed features observed for the bomb 14C transient in the Pacific Ocean. The model successfully captures the basin-scale inventories of bomb 14C in the tropics as well as in the extratropics of the North Pacific. For the equatorial Pacific this is attributed to the model's high meridional resolution. The discrepancies in the three-dimensional distribution of bomb 14C between the model and data are discussed within the context of the dynamical

  18. Identification and synchronization of the common cosmic-ray signal in the IntCal13 14C calibration and the Greenland ice-core 10Be records

    NASA Astrophysics Data System (ADS)

    Muscheler, Raimund; Adolphi, Florian; Bronk Ramsey, Christopher; Rasmussen, Sune; Hughen, Konrad; Cooper, Alan; Turney, Chris

    2017-04-01

    The production rates of cosmogenic radionuclides (such as 10Be and 14C) are modulated by the solar and geomagnetic shielding of galactic cosmic rays. In addition, 14C and 10Be are influenced by the carbon cycle and the atmospheric transport and deposition, respectively. Isolating and identifying the common production signal allows us to synchronize ice core 10Be and tree ring 14C records during the Holocene (Adolphi and Muscheler, 2016), thereby connecting ice core climate records with 14C-dated records. Extending this comparison further back in time is challenging due to deteriorating quality of the 14C calibration record, IntCal13, (Reimer et al., 2013) and possible unidentified climate influences on the ice-core 10Be records. Nevertheless, by focusing on the most prominent production-rate features this comparison can be extended far back into the last glacial where, for example, the linkage of tree-ring based Kauri 14C data and the Greenland ice-core time scale (GICC05) suggested unresolved data and/or time scale differences around the period of the Laschamp geomagnetic field minimum at about 42000 yrs BP (Muscheler et al., 2014). Here we show that the data underlying the IntCal13 14C record and the ice-core 10Be records exhibit common variability that allows us to tentatively link the ice core GICC05 time scale to the radiocarbon time scale for almost the complete radiocarbon dating range. The observed time scale differences could be related to uncertainties in both the U/Th-based dating of the IntCal13 calibration data set and the GICC05 time scale, and we show that the two can be reconciled within the uncertainties of the ice-core layer counting. This direct comparison between IntCal13 and 10Be also suggests that the 14C differences shown in (Muscheler et al., 2014) around the Laschamp geomagnetic field minimum can be reduced by moderate adjustments to the GICC05 time scale. References: Adolphi, F., and Muscheler, R., 2016, Synchronizing the Greenland ice

  19. Distribution and biomarker of carbon-14 labeled fullerene C60 ([(14) C(U)]C60 ) in pregnant and lactating rats and their offspring after maternal intravenous exposure.

    PubMed

    Snyder, Rodney W; Fennell, Timothy R; Wingard, Christopher J; Mortensen, Ninell P; Holland, Nathan A; Shannahan, Jonathan H; Pathmasiri, Wimal; Lewin, Anita H; Sumner, Susan C J

    2015-12-01

    A comprehensive distribution study was conducted in pregnant and lactating rats exposed to a suspension of uniformly carbon-14 labeled C60 ([(14) C(U)]C60 ). Rats were administered [(14) C(U)]C60 (~0.2 mg [(14) C(U)]C60 kg(-1) body weight) or 5% polyvinylpyrrolidone (PVP)-saline vehicle via a single tail vein injection. Pregnant rats were injected on gestation day (GD) 11 (terminated with fetuses after either 24 h or 8 days), GD15 (terminated after 24 h or 4 days), or GD18 (terminated after 24 h). Lactating rats were injected on postnatal day 8 and terminated after 24 h, 3 or 11 days. The distribution of radioactivity in pregnant dams was influenced by both the state of pregnancy and time of termination after exposure. The percentage of recovered radioactivity in pregnant and lactating rats was highest in the liver and lungs. Radioactivity was quantitated in over 20 tissues. Radioactivity was found in the placenta and in fetuses of pregnant dams, and in the milk of lactating rats and in pups. Elimination of radioactivity was < 2% in urine and feces at each time point. Radioactivity remained in blood circulation up to 11 days after [(14) C(U)]C60 exposure. Biomarkers of inflammation, cardiovascular injury and oxidative stress were measured to study the biological impacts of [(14) C(U)]C60 exposure. Oxidative stress was elevated in female pups of exposed dams. Metabolomics analysis of urine showed that [(14) C(U)]C60 exposure to pregnant rats impacted the pathways of vitamin B, regulation of lipid and sugar metabolism and aminoacyl-tRNA biosynthesis. This study demonstrated that [(14) C(U)]C60 crosses the placenta at all stages of pregnancy examined, and is transferred to pups via milk. Copyright © 2015 John Wiley & Sons, Ltd.

  20. C14 Assays and Autoradiographic Studies on the Rooster Comb

    PubMed Central

    Balazs, Endre A.; Szirmai, John A.; Bergendahl, Gudrun

    1959-01-01

    The distribution of C14 was studied in various parts of the rooster comb following treatment with testosterone. The value of gas-phase assay of C14 in tissue has been demonstrated and the results compared with those of autoradiographic studies on the same tissue. The results of these experiments showed that androgen treatment significantly increases the rate of incorporation of C14 in various parts of the comb. The specific activity of carbon in the comb, cornea, and liver differed, depending on which precursor, viz. glucose-6-C14, glucose-1-C14, and glucuronolactone-U-C14, was administered. The highest values were obtained after the administration of glucose-6-C14; glucuronolactone-U-C14 gave the lowest specific activity. The specific activity of carbon in different parts of the comb showed considerable variation. Carbon assay of serial sections of the comb cut at various planes showed that the specific activity of carbon was highest in the mucoid layer. Both C14 assays and autoradiograms indicate that C14 is also present in other parts of the comb. As seen in autoradiography, the concentration of C14 was highest in the epithelium, in the blood vessel walls, and in the avascular collagenous tissue. These results, and indications from previous studies, suggest that the high specific activity of carbon in the mucoid layer is due mainly to the presence of C14-labelled hyaluronic acid. Autoradiograms and PAS staining suggest that a significant amount of C14 is also incorporated into the glycoproteins associated with the collagen fibers. PMID:13654453

  1. U-series vs 14C ages of deep-sea corals from the southern Labrador Sea: Sporadic development of corals and geochemical processes hampering estimation of ambient water ventilation ages

    NASA Astrophysics Data System (ADS)

    Hillaire-Marcel, Claude; Maccali, Jenny; Ménabréaz, Lucie; Ghaleb, Bassam; Blénet, Aurélien; Edinger, Evan

    2017-04-01

    Deep-sea scleractinian corals were collected with the remotely operated ROPOS vehicle off Newfounland. Fossil specimens of Desmophyllum dianthus were raised from coral graveyards at Orphan Knoll (˜1700m depth) and Flemish cap (˜2200 m depth), while live specimens were collected directly in overlying steep rock slopes. D. dianthus has an aragonitic skeleton and is thus particularly suited for U-Th dating. We obtained > 70 U-series ages along with > 20 14C measurements. Results display a discrete age distribution with two age clusters: a Bølling-Allerød and Holocene cluster with > 20 samples, and a Marine Isotope Stage (MIS) 5c cluster with ˜50 samples. Only two samples lay outside these clusters, at ˜ 64 ka and at ˜181 ka. Contrary to the New England seamounts where coral presence seems to have been continue through the last 70 ka, Orphan Knoll and Flemish Cap graveyards are marked by the absence of preserved specimens from MIS 2 to MIS 4 and throughout MIS 6. For filter-feeding deep-sea corals, access to food-rich waters is essential. Hence the Holocene and MIS 5 clusters observed in the Labrador basin might represent intervals linked to high food availability, either through production in the overlying water column, more effectively in relation to particulate and dissolved organic carbon transport via an active Western Boundary Undercurrent. Comparison of 230Th-ages vs 14C-ages in order to document changes in ventilation ages of the ambient water masses is equivocal due to the presence of some diagenetic and/or initial 230Th-excess. In addition, discrete diagenetic U-fluxes can be documented from 234U/238U vs 230Th/238U data. They point to a recent winnowing of sediment overlying the fossil corals that we link to the Holocene intensification of the Western Boundary Undercurrent, which resulted in driving Fe-Mn coatings.

  2. Polymer-Based Black Phosphorus (bP) Hybrid Materials by in Situ Radical Polymerization: An Effective Tool To Exfoliate bP and Stabilize bP Nanoflakes

    PubMed Central

    2018-01-01

    Black phosphorus (bP) has been recently investigated for next generation nanoelectronic multifunctional devices. However, the intrinsic instability of exfoliated bP (the bP nanoflakes) toward both moisture and air has so far overshadowed its practical implementation. In order to contribute to fill this gap, we report here the preparation of new hybrid polymer-based materials where bP nanoflakes (bPn) exhibit a significantly improved stability. The new materials have been prepared by different synthetic paths including: (i) the mixing of conventionally liquid-phase exfoliated bP (in dimethyl sulfoxide, DMSO) with poly(methyl methacrylate) (PMMA) solution; (ii) the direct exfoliation of bP in a polymeric solution; (iii) the in situ radical polymerization after exfoliating bP in the liquid monomer (methyl methacrylate, MMA). This last methodology concerns the preparation of stable suspensions of bPn–MMA by sonication-assisted liquid-phase exfoliation (LPE) of bP in the presence of MMA followed by radical polymerization. The hybrids characteristics have been compared in order to evaluate the bP dispersion and the effectiveness of the bPn interfacial interactions with polymer chains aimed at their long-term environmental stabilization. The passivation of the bPn is particularly effective when the hybrid material is prepared by in situ polymerization. By using this synthetic methodology, the nanoflakes, even if with a gradient of dispersion (size of aggregates), preserve their chemical structure from oxidation (as proved by both Raman and 31P-solid state NMR studies) and are particularly stable to air and UV light exposure. The feasibility of this approach, capable of efficiently exfoliating bP while protecting the bPn, has been then verified by using different vinyl monomers (styrene and N-vinylpyrrolidone), thus obtaining hybrids where the nanoflakes are embedded in polymer matrices with a variety of intriguing thermal, mechanical, and solubility characteristics.

  3. Insights from a synthesis of old and new climate-proxy data from the Pyramid and Winnemucca lake basins for the period 48 to 11.5 cal ka

    USGS Publications Warehouse

    Benson, Larry; Smoot, J.P.; Lund, S.P.; Mensing, S.A.; Foit, F.F.; Rye, R.O.

    2013-01-01

    A synthesis of old and new paleoclimatic data from the Pyramid and Winnemucca lake basins indicates that, between 48.0 and 11.5·103 calibrated years BP (hereafter ka), the climate of the western Great Basin was, to a degree, linked with the climate of the North Atlantic. Paleomagnetic secular variation (PSV) records from Pyramid Lake core PLC08-1 were tied to the GISP2 ice-core record via PSV matches to North Atlantic sediment cores whose isotopic and(or) carbonate records could be linked to the GISP2 δ18O record. Relatively dry intervals in the western Great Basin were associated with cold Heinrich events and relatively wet intervals were associated with warm Dansgaard-Oeschger (DO) oscillations. The association of western Great Basin dry events with North Atlantic cold events (and vice versa) switched sometime after the Laurentide Ice Sheet (LIS) reached its maximum extent. For example, the Lahontan highstand, which culminated at 15.5 ka, and a period of elevated lake level between 13.1 and 11.7 ka were associated with cold North Atlantic conditions, the latter period with the Youngest Dryas event. Relatively dry periods were associated with the Bølling and Allerød warm events. A large percentage of the LIS may have been lost to the North Atlantic during Heinrich events 1 and 2 and may have resulted in the repositioning of the Polar Jet Stream over North America. The Trego Hot Springs, Wono, Carson Sink, and Marble Bluff tephras found in core PLC08-1 have been assigned GISP2 calendar ages of respectively, 29.9, 33.7, 34.1, and 43.2 ka. Given its unique trace-element chemistry, the Carson Sink Bed is the same as Wilson Creek Ash 15 in the Mono Lake Basin. This implies that the Mono Lake magnetic excursion occurred at approximately 34 ka and it is not the Laschamp magnetic excursion. The entrance of the First Americans into the northern Great Basin is dated to approximately 14.4 ka, a time when the climate was relatively dry. Evidence for human occupation of

  4. Do cosmogenic nuclides (10Be, 14C , 21Ne, 26Al) track late Quaternary climate changes on the Altiplano?

    NASA Astrophysics Data System (ADS)

    Hippe, K.; Kober, F.; Zeilinger, G.; Ivy-Ochs, S.; Kubik, P.; Maden, C.; Wieler, R.

    2010-12-01

    The high Altiplano plateau is the most prominent element of the Central Andes, separating the Andean Cordilleras between 15° to 22° S. It represents a tectonically quiet, intramontane basin with arid to semi-arid climate, low relief and internal drainage. Throughout the late Quaternary regional climate on the Altiplano repeatedly changed between wet and dry conditions [1]. The influence of climate on the plateau evolution during the Pleistocene/Holocene is unclear, however, as data on erosion processes and rates on the Altiplano are sparse. Here, we present a multiple-nuclide study investigating surface denudation at the eastern Altiplano of Bolivia (16°-17° S) on millennial and longer timescales. The aim is a better understanding of the complex feedback between climate, tectonics and geomorphology on the topographic evolution of the Andes. Catchment-wide denudation (CWD) rates are provided for a 150 km NW-SE transect along the Altiplano edge based on the analyses of cosmogenic 10Be, 26Al, 21Ne and in-situ 14C in river-borne sediment. Single nuclide CWD rates obtained for 10Be, 26Al and 21Ne are similar for all three nuclides and on the order of 3-37 mm/ka. Thus, the calculated denudation rates provide an averaged denudation history dating back at least to the middle Pleistocene. Denudation rates correlate positively with the mean basin hillslope, which is mainly controlled by basin lithology. For most catchments both, the 26Al/10Be ratios and the 21Ne/10Be ratios indicate a complex erosion/exposure history with probably several periods of sediment storage and burial/shielding totalling ~0.5 - 1.2 Ma. Local geomorphology featuring low slopes and low relief, small terraces and local floodplains also suggests that sediment transport might have been periodically ineffective. Concentrations of in-situ produced short-lived 14C are significantly lower than expected from the concentrations of the long-lived and stable cosmogenic nuclides. This would indicate a 30

  5. Identification of last interglacial deposits in eastern Beringia: a cautionary note from the Palisades, interior Alaska

    USGS Publications Warehouse

    Reyes, Alberto V.; Zazula, Grant D.; Kuzmina, Svetlana; Ager, Thomas A.; Froese, Duane G.

    2011-01-01

    Last interglacial sediments in unglaciated Alaska and Yukon (eastern Beringia) are commonly identified by palaeoecological indicators and stratigraphic position ~2-5m above the regionally prominent Old Crow tephra (124 + or - 10ka). We demonstrate that this approach can yield erroneous age assignments using data from a new exposure at the Palisades, a site in interior Alaska with numerous exposures of last interglacial sediments. Tephrochronology, stratigraphy, plant macrofossils, pollen and fossil insects from a prominent wood-rich organic silt unit are all consistent with a last interglacial age assignment. However, six 14C dates on plant and insect macrofossils from the organic silt range from non-finite to 4.0 14C ka BP, indicating that the organic silt instead represents a Holocene deposit with a mixed-age assemblage of organic material. In contrast, wood samples from presumed last interglacial organic-rich sediments elsewhere at the Palisades, in a similar stratigraphic position with respect to Old Crow tephra, yield non-finite 14C ages. Given that local permafrost thaw since the last interglaciation may facilitate reworking of older sediments into new stratigraphic positions, minimum constraining ages based on 14C dating or other methods should supplement age assignments for last interglacial sediments in eastern Beringia that are based on palaeoecology and stratigraphic association with Old Crow tephra.

  6. Revised age of late Neanderthal occupation and the end of the Middle Paleolithic in the northern Caucasus

    PubMed Central

    Pinhasi, Ron; Higham, Thomas F. G.; Golovanova, Liubov V.; Doronichev, Vladimir B.

    2011-01-01

    Advances in direct radiocarbon dating of Neanderthal and anatomically modern human (AMH) fossils and the development of archaeostratigraphic chronologies now allow refined regional models for Neanderthal–AMH coexistence. In addition, they allow us to explore the issue of late Neanderthal survival in regions of Western Eurasia located within early routes of AMH expansion such as the Caucasus. Here we report the direct radiocarbon (14C) dating of a late Neanderthal specimen from a Late Middle Paleolithic (LMP) layer in Mezmaiskaya Cave, northern Caucasus. Additionally, we provide a more accurate chronology for the timing of Neanderthal extinction in the region through a robust series of 16 ultrafiltered bone collagen radiocarbon dates from LMP layers and using Bayesian modeling to produce a boundary probability distribution function corresponding to the end of the LMP at Mezmaiskaya. The direct date of the fossil (39,700 ± 1,100 14C BP) is in good agreement with the probability distribution function, indicating at a high level of probability that Neanderthals did not survive at Mezmaiskaya Cave after 39 ka cal BP ("calendrical" age in kiloannum before present, based on IntCal09 calibration curve). This challenges previous claims for late Neanderthal survival in the northern Caucasus. We see striking and largely synchronous chronometric similarities between the Bayesian age modeling for the end of the LMP at Mezmaiskaya and chronometric data from Ortvale Klde for the end of the LMP in the southern Caucasus. Our results confirm the lack of reliably dated Neanderthal fossils younger than ∼40 ka cal BP in any other region of Western Eurasia, including the Caucasus. PMID:21555570

  7. Evolution of dissolved inorganic carbon in groundwater recharged by cyclones and groundwater age estimations using the 14C statistical approach

    NASA Astrophysics Data System (ADS)

    Meredith, K. T.; Han, L. F.; Cendón, D. I.; Crawford, J.; Hankin, S.; Peterson, M.; Hollins, S. E.

    2018-01-01

    The Canning Basin is the largest sedimentary basin in Western Australia and is located in one of the most cyclone prone regions of Australia. Despite its importance as a future resource, limited groundwater data is available for the Basin. The main aims of this paper are to provide a detailed understanding of the source of groundwater recharge, the chemical evolution of dissolved inorganic carbon (DIC) and provide groundwater age estimations using radiocarbon (14CDIC). To do this we combine hydrochemical and isotopic techniques to investigate the type of precipitation that recharge the aquifer and identify the carbon processes influencing 14CDIC, δ13CDIC, and [DIC]. This enables us to select an appropriate model for calculating radiocarbon ages in groundwater. The aquifer was found to be recharged by precipitation originating from tropical cyclones imparting lower average δ2H and δ18O values in groundwater (-56.9‰ and -7.87‰, respectively). Water recharges the soil zone rapidly after these events and the groundwater undergoes silicate mineral weathering and clay mineral transformation processes. It was also found that partial carbonate dissolution processes occur within the saturated zone under closed system conditions. Additionally, the processes could be lumped into a pseudo-first-order process and the age could be estimated using the 14C statistical approach. In the single-sample-based 14C models, 14C0 is the initial 14CDIC value used in the decay equation that considers only 14C decay rate. A major advantage of using the statistical approach is that both 14C decay and geochemical processes that cause the decrease in 14CDIC are accounted for in the calculation. The 14CDIC values of groundwater were found to increase from 89 pmc in the south east to around 16 pmc along the groundwater flow path towards the coast indicating ages ranging from modern to 5.3 ka. A test of the sensitivity of this method showed that a ∼15% error could be found for the oldest

  8. BP Control and Long-Term Risk of ESRD and Mortality

    PubMed Central

    Gassman, Jennifer; Appel, Lawrence J.; Smogorzewski, Miroslaw; Sarnak, Mark J.; Glidden, David V.; Bakris, George; Gutiérrez, Orlando M.; Hebert, Lee A.; Ix, Joachim H.; Lea, Janice; Lipkowitz, Michael S.; Norris, Keith; Ploth, David; Pogue, Velvie A.; Rostand, Stephen G.; Siew, Edward D.; Sika, Mohammed; Tisher, C. Craig; Toto, Robert; Wright, Jackson T.; Wyatt, Christina; Hsu, Chi-yuan

    2017-01-01

    We recently showed an association between strict BP control and lower mortality risk during two decades of follow-up of prior participants in the Modification of Diet in Renal Disease (MDRD) trial. Here, we determined the risk of ESRD and mortality during extended follow-up of the African American Study of Kidney Disease and Hypertension (AASK) trial. We linked 1067 former AASK participants with CKD previously randomized to strict or usual BP control (mean arterial pressure ≤92 mmHg or 102–107 mmHg, respectively) to the US Renal Data System and Social Security Death Index; 397 patients had ESRD and 475 deaths occurred during a median follow-up of 14.4 years from 1995 to 2012. Compared with the usual BP arm, the strict BP arm had unadjusted and adjusted relative risks of ESRD of 0.92 (95% confidence interval [95% CI], 0.75 to 1.12) and 0.95 (95% CI, 0.78 to 1.16; P=0.64), respectively, and unadjusted and adjusted relative risks of death of 0.92 (95% CI, 0.77 to 1.10) and 0.81 (95% CI, 0.68 to 0.98; P=0.03), respectively. In meta-analyses of individual-level data from the MDRD and the AASK trials, unadjusted relative risk of ESRD was 0.88 (95% CI, 0.78 to 1.00) and unadjusted relative risk of death was 0.87 (95% CI, 0.76 to 0.99) for strict versus usual BP arms. Our findings suggest that, during long–term follow-up, strict BP control does not delay the onset of ESRD but may reduce the relative risk of death in CKD. PMID:27516235

  9. Early Holocene Great Salt Lake

    USGS Publications Warehouse

    Oviatt, Charles G.; Madsen, David B.; Miller, David; Thompson, Robert S.; McGeehin, John P.

    2015-01-01

    Shorelines and surficial deposits (including buried forest-floor mats and organic-rich wetland sediments) show that Great Salt Lake did not rise higher than modern lake levels during the earliest Holocene (11.5–10.2 cal ka BP; 10–9 14C ka BP). During that period, finely laminated, organic-rich muds (sapropel) containing brine-shrimp cysts and pellets and interbedded sodium-sulfate salts were deposited on the lake floor. Sapropel deposition was probably caused by stratification of the water column — a freshwater cap possibly was formed by groundwater, which had been stored in upland aquifers during the immediately preceding late-Pleistocene deep-lake cycle (Lake Bonneville), and was actively discharging on the basin floor. A climate characterized by low precipitation and runoff, combined with local areas of groundwater discharge in piedmont settings, could explain the apparent conflict between evidence for a shallow lake (a dry climate) and previously published interpretations for a moist climate in the Great Salt Lake basin of the eastern Great Basin.

  10. Using 14C and 3H to understand groundwater flow and recharge in an aquifer window

    NASA Astrophysics Data System (ADS)

    Atkinson, A. P.; Cartwright, I.; Gilfedder, B. S.; Cendón, D. I.; Unland, N. P.; Hofmann, H.

    2014-06-01

    Knowledge of groundwater residence times and recharge locations are vital to the sustainable management of groundwater resources. Here we investigate groundwater residence times and patterns of recharge in the Gellibrand Valley, southeast Australia, where outcropping aquifer sediments of the Eastern View Formation form an "aquifer window" that may receive diffuse recharge and recharge from the Gellibrand River. To determine recharge patterns and groundwater flowpaths, environmental isotopes (3H, 14C, δ13C, δ18O, δ2H) are used in conjunction with groundwater geochemistry and continuous monitoring of groundwater elevation and electrical conductivity. Despite the water table fluctuating by 0.9-3.7 m annually producing estimated recharge rates of 90 and 372 mm yr-1, residence times of shallow (11-29 m) groundwater determined by 14C ages are between 100 and 10 000 years. 3H activities are negligible in most of the groundwater and groundwater electrical conductivity in individual areas remains constant over the period of study. Although diffuse local recharge is evident, the depth to which it penetrates is limited to the upper 10 m of the aquifer. Rather, groundwater in the Gellibrand Valley predominantly originates from the regional recharge zone, the Barongarook High, and acts as a regional discharge zone where upward head gradients are maintained annually, limiting local recharge. Additionally, the Gellibrand River does not recharge the surrounding groundwater and has limited bank storage. 14C ages and Cl concentrations are well correlated and Cl concentrations may be used to provide a first-order estimate of groundwater residence times. Progressively lower chloride concentrations from 10 000 years BP to the present day are interpreted to indicate an increase in recharge rates on the Barongarook High.

  11. An emerging c. 100 ka record of climate change from Baldwin Lake, San Bernardino Mountains, CA, U.S

    NASA Astrophysics Data System (ADS)

    Glover, K. C.; MacDonald, G. M.; Kirby, M. E.; Rhodes, E. J.

    2013-12-01

    Big Bear Valley (elevation ~2060 m) is situated in the east-west trending San Bernardino Mountains of California, close to the transition between Mediterranean and Mojave Desert ecoregions. Baldwin Lake is the older of two basins occupying the valley, with a sediment sequence that demonstrates a high rate of deposition and an apparent synchronicity with marine isotope and global paleoclimate records. Chronology has been established with both AMS radiocarbon and infra-red stimulated luminescence (IRSL) dates. This offers the potential to further investigate paleoclimate change over the past c. 100 ka for Southern California at a high temporal resolution. Baldwin Lake's basal date of 95.9 +/- 6.7 ka is derived from IRSL on feldspar grains, placing the onset of sedimentation into the modern basin during cool MIS 5(b). Phases of high productivity in the lake, including values of up to 35% total organic matter and marl facies, correlate with warm events MIS 5(a) and MIS 3. Glacial stages are largely defined by inorganic sedimentation, though depositional regime varies between high-energy MIS 5(b) and MIS 4, and a relatively quiescent MIS 2. Future work will reconstruct vegetation change prior to MIS 1, in order to elucidate millennial-scale changes in alpine groundcover and forests in Southern California during these globally pervasive Stages.

  12. Late Holocene subalpine lake sediments record a multi-proxy shift to increased aridity at 3.65 kyr BP, following a millennial-scale neopluvial interval in the Lake Tahoe watershed and western Great Basin, USA

    NASA Astrophysics Data System (ADS)

    Noble, Paula; Zimmerman, Susan; Ball, Ian; Adams, Kenneth; Maloney, Jillian; Smith, Shane

    2016-04-01

    A mid Holocene dry period has been reported from lake records in the Great Basin and Sierra Nevada, yet the spatial and temporal extent of this interval is not well understood. We present evidence for a millennial-scale interval of high winter precipitation (neopluvial) at the end of the mid Holocene in the Lake Tahoe-Pyramid Lake watershed in the northern Sierra Nevada that reached its peak ˜3.7 kcal yr BP. A transect of 4 cores recovered from Fallen Leaf Lake in the Tahoe Basin were dated using AMS14C on plant macrofossils, and analyzed using scanning XRF, C and N elemental and stable isotope measurements, and diatoms as paleoclimate proxies. Fallen Leaf Lake is a deep glacially-derived lake situated in the Glen Alpine Valley at an elevation of 1942m, ˜45 m above the level of Lake Tahoe. In Fallen Leaf Lake, the end of the neopluvial is dated at 3.65 ± 0.09 kcal yr BP, and is the largest post-glacial signal in the cores. The neopluvial interval is interpreted to be a period of increased snowpack in the upper watershed, supported by depleted g δ13Corg (-27.5) values, negative baseline shifts in TOC and TN, lower C:N, and high abundances of Aulacoseira subarctica, a winter-early spring diatom. Collectively, these proxies indicate cooler temperatures, enhanced mixing, and/or shortened summer stratification resulting in increased algal productivity relative to terrestrial inputs. The neopluvial interval ends abruptly at 3.65 ka, with a change from mottled darker opaline clay to a homogeneous olive clay with decreased A. subarctica and opal, and followed by a 50% reduction in accumulation rates. After this transition δ13Corg becomes enriched by 2‰ and TOC, TN, and C:N all show the start of positive trends that continue through the Holocene. Pyramid Lake is an endorheic basin situated at the terminal end of the watershed, and inflow arrives from the Lake Tahoe basin via the Truckee River. At Pyramid Lake, existing ages on paleo-shorelines indicate a significant

  13. Protonation/deprotonation process of Emodin in aqueous solution and pKa determination: UV/Visible spectrophotometric titration and quantum/molecular mechanics calculations

    NASA Astrophysics Data System (ADS)

    da Cunha, Antonio R.; Duarte, Evandro L.; Lamy, M. Teresa; Coutinho, Kaline

    2014-08-01

    We combined theoretical and experimental studies to elucidate the important deprotonation process of Emodin in water. We used the UV/Visible spectrophotometric titration curves to obtain its pKa values, pKa1 = 8.0 ± 0.1 and pKa2 = 10.9 ± 0.2. Additionally, we obtained the pKa values of Emodin in the water-methanol mixture (1:3v/v). We give a new interpretation of the experimental data, obtaining apparent pKa1 = 6.2 ± 0.1, pKa2 = 8.3 ± 0.1 and pKa3 > 12.7. Performing quantum mechanics calculations for all possible deprotonation sites and tautomeric isomers of Emodin in vacuum and in water, we identified the sites of the first and second deprotonation. We calculated the standard deprotonation free energy of Emodin in water and the pKa1, using an explicit model of the solvent, with Free Energy Perturbation theory in Monte Carlo simulations obtaining, ΔGaq = 12.1 ± 1.4 kcal/mol and pKa1 = 8.7 ± 0.9. With the polarizable continuum model for the solvent, we obtained ΔGaq = 11.6 ± 1.0 kcal/mol and pKa1 = 8.3 ± 0.7. Both solvent models gave theoretical results in very good agreement with the experimental values.

  14. Release kinetics of circulating cardiac myosin binding protein-C following cardiac injury

    PubMed Central

    Kuster, Diederik W. D.; Cardenas-Ospina, Adriana; Miller, Lawson; Liebetrau, Christoph; Troidl, Christian; Nef, Holger M.; Möllmann, Helge; Hamm, Christian W.; Pieper, Karen S.; Mahaffey, Kenneth W.; Kleiman, Neal S.; Stuyvers, Bruno D.; Marian, Ali J.

    2013-01-01

    Diagnosis of myocardial infarction (MI) is based on ST-segment elevation on electrocardiographic evaluation and/or elevated plasma cardiac troponin (cTn) levels. However, troponins lack the sensitivity required to detect the onset of MI at its earliest stages. Therefore, to confirm its viability as an ultra-early biomarker of MI, this study investigates the release kinetics of cardiac myosin binding protein-C (cMyBP-C) in a porcine model of MI and in two human cohorts. Release kinetics of cMyBP-C were determined in a porcine model of MI (n = 6, pigs, either sex) by measuring plasma cMyBP-C level serially from 30 min to 14 days after coronary occlusion, with use of a custom-made immunoassay. cMyBP-C plasma levels were increased from baseline (76 ± 68 ng/l) at 3 h (767 ± 211 ng/l) and peaked at 6 h (2,418 ± 780 ng/l) after coronary ligation. Plasma cTnI, cTnT, and myosin light chain-3 levels were all increased 6 h after ligation. In a cohort of patients (n = 12) with hypertrophic obstructive cardiomyopathy undergoing transcoronary ablation of septal hypertrophy, cMyBP-C was significantly increased from baseline (49 ± 23 ng/l) in a time-dependent manner, peaking at 4 h (560 ± 273 ng/l). In a cohort of patients with non-ST segment elevation MI (n = 176) from the SYNERGY trial, cMyBP-C serum levels were significantly higher (7,615 ± 4,514 ng/l) than those in a control cohort (416 ± 104 ng/l; n = 153). cMyBP-C is released in the blood rapidly after cardiac damage and therefore has the potential to positively mark the onset of MI. PMID:24337456

  15. Epitaxy of boron phosphide on AlN, 4H-SiC, 3C-SiC and ZrB2 substrates

    NASA Astrophysics Data System (ADS)

    Padavala, Balabalaji

    The semiconductor boron phosphide (BP) has many outstanding features making it attractive for developing various electronic devices, including neutron detectors. In order to improve the efficiency of these devices, BP must have high crystal quality along with the best possible electrical properties. This research is focused on growing high quality crystalline BP films on a variety of superior substrates like AlN, 4H-SiC, 3C-SiC and ZrB2 by chemical vapor deposition. In particular, the influence of various parameters such as temperature, reactant flow rates, and substrate type and its crystalline orientation on the properties of BP films were studied in detail. Twin-free BP films were produced by depositing on off-axis 4H-SiC(0001) substrate tilted 4° toward [11¯00] and crystal symmetry matched zincblende 3C-SiC. BP crystalline quality improved at higher deposition temperature (1200°C) when deposited on AlN, 4H-SiC, whereas increased strain in 3C-SiC and increased boron segregation in ZrB2 at higher temperatures limited the best deposition temperature to below 1200°C. In addition, higher flow ratios of PH 3 to B2H6 resulted in smoother films and improved quality of BP on all substrates. The FWHM of the Raman peak (6.1 cm -1), XRD BP(111) peak FWHM (0.18°) and peak ratios of BP(111)/(200) = 5157 and BP(111)/(220) = 7226 measured on AlN/sapphire were the best values reported in the literature for BP epitaxial films. The undoped films on AlN/sapphire were n-type with a highest electron mobility of 37.8 cm2/V˙s and a lowest carrier concentration of 3.15x1018 cm -3. Raman imaging had lower values of FWHM (4.8 cm-1 ) and a standard deviation (0.56 cm-1) for BP films on AlN/sapphire compared to 4H-SiC, 3C-SiC substrates. X-ray diffraction and Raman spectroscopy revealed residual tensile strain in BP on 4H-SiC, 3C-SiC, ZrB2/4H-SiC, bulk AlN substrates while compressive strain was evident on AlN/sapphire and bulk ZrB2 substrates. Among the substrates studied, Al

  16. Reconstructed Depositional Environment and Climate Record of Western North America Over the Past 25,000 Years from Tulare Lake, South-Central California

    NASA Astrophysics Data System (ADS)

    Mohammadi, O.; Wehunt, K.; Chumpitaz, G. A.; Bravo, B.; Ruiz, J.; Dhesi, H.; Halling, M. C.; Pyles, C. G.; Guo, J.; Negrini, R. M.

    2016-12-01

    Tulare Lake, located in the southern San Joaquin Valley, California has been the site of repeated geologic and paleoclimate studies due to its well preserved sedimentary record based on core, trench exposures, and the mapping of geomorphic features. Yet, no studies have focused on the effect of depositional environment variations on mineralogy. In this study, a series of integrated geochemical, sedimentary, and grain-size climate proxy data from core TL05-4A encompassing the last 25 cal. ka BP were analyzed. Preliminary sedimentary results as determined by X-ray diffraction (XRD) reveal a clay-dominant mineral assemblage containing variable smectite, illite, kaolinite, and chlorite followed by a secondary non-clay contribution in the form of quartz, feldspar, and calcite. The relative abundance of these minerals varies with depth and is tied to regional shifts in climate as best exemplified by an observed rapid increase in bulk clay percentages (+50%) after the Tioga deglaciation event ( 14 cal. ka BP). Six climosequences were determined—three wet periods interspaced by three dry episodes over the last 25 ka. Two important dry periods characterized by gypsum and bassanite occurred from 10.7-9.4 cal. ka BP (Preboreal warming) and 8.2-5.2 cal. ka BP (Holocene Climate Optimum) indicating oxygen depletion, more intense evaporation, and reducing conditions in the lake. These abrupt dry phases may help explain the geographic range reduction and extirpation of Mammuthus primigenius and other North American megafanua as warmer and dryer regional conditions led to enhanced water stress and diminished net primary productivity.

  17. New Progress in Paleoearthquake Studies of the East Sertengshan Piedmont Fault, Inner Mongolia, China

    NASA Astrophysics Data System (ADS)

    He, Zhongtai

    2017-04-01

    The two eastern segments of the Sertengshan piedmont fault have moved considerably since the Holocene. Several paleoseismic events have occurred along the fault since 30 ka BP. Paleoearthquake studies have been advanced by digging new trenches and combining the results with the findings of previous studies. Comprehensive analyses of the trenches revealed that 6 paleoseismic events have occurred on the Kuoluebulong segment since approximately 30 ka BP within the following successive time periods: 19.01-37.56 ka, 18.73 ka, 15.03-15.86 ka, 10.96 ka, 5.77-6.48 ka and 2.32 ka BP. The analyses also revealed that 6 paleoseismic events have occurred on the Dashetai segment since approximately 30 ka BP, and the successive occurrence times are 29.07 ka, 19.12-28.23 ka, 13.92-15.22 ka, 9.38-9.83 ka, 6.08-8.36 ka and 3.59 ka BP. The results indicate that quasi-periodic recurrences occurred along the two segments with an approximate 4000 a mean recurrence interval. The consistent timing of the 6 events between the two segments indicates that the segments might conform to the cascade rupturing model between the two segments of the Sertengshan piedmont fault. The latest event on the Kuoluebulong segment of the Sertengshan piedmont fault is the historical M8 earthquake that occurred on November 11, 7 BC, which was recorded by a large number of Chinese historical texts.

  18. Microwave Spectrum of the H_2S Dimer: Observation of K_{a}=1 Lines

    NASA Astrophysics Data System (ADS)

    Das, Arijit; Mandal, Pankaj; Lovas, Frank J.; Medcraft, Chris; Arunan, Elangannan

    2017-06-01

    Large amplitude tunneling motions in (H_2S)_{2} complicate the analysis of its microwave spectrum. The previous rotational spectrum of (H_2S)_{2} was observed using the Balle-Flygare pulsed nozzle FT microwave spectrometers at NIST and IISc. For most isotopomers of (H_2S)_{2} a two state pattern of a-type K_{a}=0 transitions had been observed and were interpreted to arise from E_{1}^{+/-} and E_{2}^{+/-} states of the six tunneling states expected for (H_2S)_{2}. K_{a}=0 lines gave us only the distance between the acceptor and donor S atoms. The (B+C)/2 for E_{1} and E_{2} states were found to be 1749.3091(8) MHz and 1748.1090(8) MHz respectively. In this work, we have observed the K_{a}=1 microwave transitions which enable us to determine finer structural details of the dimer. The observation of the K_{a}=1 lines indicate that (H_2S)_{2} is not spherical in nature, their interactions do have some anisotropy. Preliminary assignment of K_{a}=1 lines for the E_{1} state results in B=1752.859 MHz and C=1745.780 MHz. We also report a new progression of lines which probably belongs to the parent isotopomers. F. J. Lovas, P. K. Mandal and E. Arunan, unpublished work P. K. Mandal Ph.D. Dissertation, Indian Institute of Science, (2005) F. J. Lovas, R. D. Suenram, and L. H. Coudert. 43rd Int.Symp. on Molecular Spectroscopy. (1988)

  19. CVD growth and properties of boron phosphide on 3C-SiC

    NASA Astrophysics Data System (ADS)

    Padavala, Balabalaji; Frye, C. D.; Wang, Xuejing; Raghothamachar, Balaji; Edgar, J. H.

    2016-09-01

    Improving the crystalline quality of boron phosphide (BP) is essential for realizing its full potential in semiconductor device applications. In this study, 3C-SiC was tested as a substrate for BP epitaxy. BP films were grown on 3C-SiC(100)/Si, 3C-SiC(111)/Si, and 3C-SiC(111)/4H-SiC(0001) substrates in a horizontal chemical vapor deposition (CVD) system. Films were produced with good crystalline orientation and morphological features in the temperature range of 1000-1200 °C using a PH3+B2H6+H2 mixture. Rotational twinning was absent in the BP due to the crystal symmetry-matching with 3C-SiC. Confocal 3D Raman imaging of BP films revealed primarily uniform peak shift and peak widths across the scanned area, except at defects on the surface. Synchrotron white beam X-ray topography showed the epitaxial relationship between BP and 3C-SiC was (100) 〈 011 〉 BP||(100) 〈 011 〉 3C-SiC and (111) 〈 11 2 ̅ 〉 BP||(111) 〈 11 2 ̅ 〉 3C-SiC. Scanning electron microscopy, Raman spectroscopy and X-ray diffraction analysis indicated residual tensile strain in the films and improved crystalline quality at temperatures below 1200 °C. These results indicated that BP properties could be further enhanced by employing high quality bulk 3C-SiC or 3C-SiC epilayers on 4H-SiC substrates.

  20. CVD growth and properties of boron phosphide on 3C-SiC

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Padavala, Balabalaji; Frye, C. D.; Wang, Xuejing

    Improving the crystalline quality of boron phosphide (BP) is essential for realizing its full potential in semiconductor device applications. In this study, 3C-SiC was tested as a substrate for BP epitaxy. BP films were grown on 3C-SiC(100)/Si, 3C-SiC(111)/Si, and 3C-SiC(111)/4H-SiC(0001) substrates in a horizontal chemical vapor deposition (CVD) system. Films were produced with good crystalline orientation and morphological features in the temperature range of 1000–1200 °C using a PH3+B2H6+H2 mixture. Rotational twinning was absent in the BP due to the crystal symmetry-matching with 3C-SiC. Confocal 3D Raman imaging of BP films revealed primarily uniform peak shift and peak widths acrossmore » the scanned area, except at defects on the surface. Synchrotron white beam X-ray topography showed the epitaxial relationship between BP and 3C-SiC was (100) <011>BP||(100) <011>3C-SiC and (111)View the MathML sourceBP||(111)View the MathML source3C-SiC. Scanning electron microscopy, Raman spectroscopy and X-ray diffraction analysis indicated residual tensile strain in the films and improved crystalline quality at temperatures below 1200 °C. These results indicated that BP properties could be further enhanced by employing high quality bulk 3C-SiC or 3C-SiC epilayers on 4H-SiC substrates.« less

  1. Pollen-climate relationships in time (9 ka, 6 ka, 0 ka) and space (upland vs. lowland) in eastern continental Asia

    NASA Astrophysics Data System (ADS)

    Tian, Fang; Cao, Xianyong; Dallmeyer, Anne; Zhao, Yan; Ni, Jian; Herzschuh, Ulrike

    2017-01-01

    Temporal and spatial stability of the vegetation-climate relationship is a basic ecological assumption for pollen-based quantitative inferences of past climate change and for predicting future vegetation. We explore this assumption for the Holocene in eastern continental Asia (China, Mongolia). Boosted regression trees (BRT) between fossil pollen taxa percentages (Abies, Artemisia, Betula, Chenopodiaceae, Cyperaceae, Ephedra, Picea, Pinus, Poaceae and Quercus) and climate model outputs of mean annual precipitation (Pann) and mean temperature of the warmest month (Mtwa) for 9 and 6 ka (ka = thousand years before present) were set up and results compared to those obtained from relating modern pollen to modern climate. Overall, our results reveal only slight temporal differences in the pollen-climate relationships. Our analyses suggest that the importance of Pann compared with Mtwa for taxa distribution is higher today than it was at 6 ka and 9 ka. In particular, the relevance of Pann for Picea and Pinus increases and has become the main determinant. This change in the climate-tree pollen relationship parallels a widespread tree pollen decrease in north-central China and the eastern Tibetan Plateau. We assume that this is at least partly related to vegetation-climate disequilibrium originating from human impact. Increased atmospheric CO2 concentration may have permitted the expansion of moisture-loving herb taxa (Cyperaceae and Poaceae) during the late Holocene into arid/semi-arid areas. We furthermore find that the pollen-climate relationship between north-central China and the eastern Tibetan Plateau is generally similar, but that regional differences are larger than temporal differences. In summary, vegetation-climate relationships in China are generally stable in space and time, and pollen-based climate reconstructions can be applied to the Holocene. Regional differences imply the calibration-set should be restricted spatially.

  2. Young cumulate complex beneath Veniaminof caldera, Aleutian arc, dated by zircon in erupted plutonic blocks

    USGS Publications Warehouse

    Bacon, C.R.; Sison, T.W.; Mazdab, F.K.

    2007-01-01

    Mount Veniaminof volcano, Alaska Peninsula, provides an opportunity to relate Quaternary volcanic rocks to a coeval intrusive complex. Veniaminof erupted tholeiitic basalt through dacite in the past ???260 k.y. Gabbro, diorite, and miarolitic granodiorite blocks, ejected 3700 14C yr B.P. in the most recent caldera-forming eruption, are fragments of a shallow intrusive complex of cumulate mush and segregated vapor-saturated residual melts. Sensitive high-resolution ion microprobe (SHRIMP) analyses define 238U-230Th isochron ages of 17.6 ?? 2.7 ka, 5+11/-10 ka, and 10.2 ?? 4.0 ka (2??) for zircon in two granodiorites and a diorite, respectively. Sparse zircons from two gabbros give 238-230Th model ages of 36 ?? 8 ka and 26 ?? 7 ka. Zircons from granodiorite and diorite crystallized in the presence of late magmatic aqueous fluid. Although historic eruptions have been weakly explosive Strombolian fountaining and small lava effusions, the young ages of plutonic blocks, as well as late Holocene dacite pumice, are evidence that the intrusive complex remains active and that evolved magmas can segregate at shallow levels to fuel explosive eruptions. ?? 2007 The Geological Society of America.

  3. Discussion: Reporting and calibration of post-bomb 14C data

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reimer, P J; Brown, T A; Reimer, R W

    2004-10-11

    The definitive paper by Stuiver and Polach (1977) established the conventions for reporting of {sup 14}C data for chronological and geophysical studies based on the radioactive decay of {sup 14}C in the sample since the year of sample death or formation. Several ways of reporting {sup 14}C activity levels relative to a standard were also established, but no specific instructions were given for reporting nuclear weapons testing (post-bomb) {sup 14}C levels in samples. Because the use of post-bomb {sup 14}C is becoming more prevalent in forensics, biology, and geosciences, a convention needs to be adopted. We advocate the use ofmore » fraction modern with a new symbol F{sup 14}C to prevent confusion with the previously used Fm, which may or may not have been fractionation corrected. We also discuss the calibration of post-bomb {sup 14}C samples and the available datasets and compilations, but do not give a recommendation for a particular dataset.« less

  4. Stone Age settlement and Holocene water level changes of the Baltic Sea in the Torvajoe Basin area, Narva-Luga Klint Bay, NE Estonia

    NASA Astrophysics Data System (ADS)

    Raig, Hanna; Rosentau, Alar; Muru, Merle; Risberg, Jan

    2014-05-01

    The Tõrvajõe basin is located in NE Estonia in the southern part of the Narva-Luga Klint Bay, that is characterized by slow post-glacial isostatic uplift (about 0-1mm/yr) and slowly undulating low topography. Post-glacial changes of the water-level of the Baltic Sea have at times flooded the area, and at times, it has emerged as terrestrial land. In addition to a complex geological development, the surroundings of the Tõrvajõe basin are interesting from the archaeological point of view because of abundant archaeological findings in the area, of which the oldest (c 8.1 cal ka BP) from the Mesolithic period and the majority, indicating very intense habitation (c 7.1-5.5 cal ka BP), from the Neolithic period. Development of the Tőrvajőe basin area during the period of Stone Age settlement (c 8.1-5.5 cal. ka BP) is studied with multiple geological and archaeological proxies. Sediments are described by lithostratigraphical methods, loss-on-ignition. AMS radiocarbon dates are used to date events and create an age-depth model. Environment is described by pollen analyses and water environment by siliceous microfossil analyses. Palaeogeographical reconstructions for time slices of interest are created to illustrate Stone Age settlement pattern and changes of the coastline and landscape over time. The aim of this interdisciplinary study is to investigate and associate palaeoenvironmental conditions and water-level changes with Stone Age settlement pattern in the Tőrvajőe area. Results show four developmental stages in the post-glacial history of the basin: Ancylus Lake lagoon, mire, lagoon during the Litorina Sea and mire. During the Ancylus Lake transgression at about 10.8-10.2 cal. ka BP a spit started to form north of the basin and a lagoon evolved behind it. Following the Ancylus Lake regression river activity and formation of palaeosoil and fen peat took place. Due to the Litorina Sea transgression, that was initially slower but accelerated around 7.8-7.6 cal ka

  5. E4bp4 regulates carboxylesterase 2 enzymes through repression of the nuclear receptor Rev-erbα in mice.

    PubMed

    Zhao, Mengjing; Zhang, Tianpeng; Yu, Fangjun; Guo, Lianxia; Wu, Baojian

    2018-06-01

    Carboxylesterases (CES) are a family of phase I enzymes that play an important role in xenobiotic clearance and lipid metabolism. Here, we investigate a potential role of E4 promoter-binding protein 4 (E4bp4) in regulation of Ces and CPT-11 (irinotecan, a first-line drug for treating colorectal cancer) pharmacokinetics in mice. Mouse hepatoma Hepa-1c1c7 cells were transfected with Rev-erbα expression plasmid or siRNA targeting E4bp4. The relative mRNA and protein levels of Ces enzymes in the cells or the livers of wild-type and E4bp4-deficient (E4bp4 -/- ) mice were determined by qPCR and Western blotting, respectively. Transcriptional regulation of Ces by E4bp4/Rev-erbα were investigated using luciferase reporter, mobility shift, and co-immunoprecipitation (Co-IP) assays. Pharmacokinetic studies were performed with wild-type and E4bp4 -/- mice after intraperitoneal injection of CPT-11. E4bp4 ablation down-regulated an array of hepatic Ces genes in mice. E4bp4 -/- mice also showed reduced Ces-mediated metabolism and elevated systemic exposure of CPT-11, a well-known Ces substrate. Consistently, E4bp4 knockdown reduced the expression of Ces genes (Ces2b, Ces2e and Ces2f) in Hepa-1c1c7 cells. Furthermore, Rev-erbα repressed the transcription of Ces2b, whereas E4bp4 antagonized this repressive action. Co-IP experiment confirmed a direct interaction between E4bp4 and Rev-erbα. Through a combination of promoter analysis and mobility shift assays, we demonstrated that Rev-erbα trans-repressed Ces (Ces2b) through its specific binding to the -767 to-754 bp promoter region. In conclusion, E4bp4 regulates Ces enzymes through inhibition of the transrepression activity of Rev-erbα, thereby impacting the metabolism and pharmacokinetics of Ces substrates. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Sleep-time BP: prognostic marker of type 2 diabetes and therapeutic target for prevention.

    PubMed

    Hermida, Ramón C; Ayala, Diana E; Mojón, Artemio; Fernández, José R

    2016-02-01

    We investigated the prognostic value of clinic and ambulatory BP (ABP) to predict new-onset diabetes and whether risk reduction is related to the progressive decrease of clinic BP or awake or asleep ABP. We prospectively evaluated 2,656 individuals without diabetes, 1,292 men and 1,364 women, 50.6 ± 14.3 years of age, with baseline BP ranging from normotension to hypertension according to ABP criteria. At baseline and annually (more frequently if hypertension treatment was adjusted based on ABP) thereafter, ABP and physical activity (wrist actigraphy) were simultaneously monitored for 48 h to accurately derive the awake and asleep BP means. During a 5.9-year median follow-up, 190 participants developed type 2 diabetes. The asleep systolic ABP mean was the most significant predictor of new-onset diabetes in a Cox proportional-hazard model adjusted for age, waist circumference, glucose, chronic kidney disease (CKD) and hypertension treatment. Daytime clinic BP and awake or 48 h ABP mean had no predictive value when corrected by the asleep ABP mean. Analyses of BP changes during follow-up revealed a 30% reduction in the risk of new-onset diabetes per 1-SD decrease in asleep systolic ABP mean, independent of changes in clinic BP or awake or 48 h ABP means. Sleep-time BP is a highly significant independent prognostic marker for new-onset diabetes. Alteration in sleep-time BP regulation seems to precede, rather than follow, the development of new-onset diabetes. Most important, lowering asleep BP, a novel therapeutic target requiring ABP evaluation, could be a significant method for reducing new-onset diabetes risk.

  7. Authigenic carbonates from newly discovered active cold seeps on the northwestern slope of the South China Sea: Constraints on fluid sources, formation environments, and seepage dynamics

    NASA Astrophysics Data System (ADS)

    Liang, Qianyong; Hu, Yu; Feng, Dong; Peckmann, Jörn; Chen, Linying; Yang, Shengxiong; Liang, Jinqiang; Tao, Jun; Chen, Duofu

    2017-06-01

    Authigenic carbonates recovered from two newly discovered active cold seeps on the northwestern slope of the South China Sea have been studied using petrography, mineralogy, stable carbon and oxygen isotopic, as well as trace element compositions, together with AMS 14C ages of shells of seep-dwelling bivalves to unravel fluid sources, formation conditions, and seepage dynamics. The two seeps (ROV1 and ROV2), referred to as 'Haima seeps' herein, are approximately 7 kilometers apart, and are typified by abundant carbonate rocks represented bycrusts and nodules. Aragonite and high-Mg calcite are the main carbonate minerals. Based on low δ13Ccarbonate values ranging from -43.0‰ to -27.5‰ (V-PDB) methane is apparently the predominant carbon source of seep carbonates. The corresponding δ18O values, varying from 2.5‰ to 5.8‰ (V-PDB), mostly are higher than calculated values representing precipitation in equilibrium with seawater (2.5‰ to 3.8‰), which probably reflects past destabilization of locally abundant gas hydrates. In addition, we found that carbonates with bivalve shells are generally aragonite-dominated, and bear no barium enrichment but uranium enrichments, reflecting shallow formation depths close to the seafloor. In contrast, carbonate crusts without bivalve shells and nodules contain more calcite, and are characterized by major molybdenum enrichment and different degrees of barium enrichment, agreeing with precipitation at greater depth under strictly anoxic conditions. AMS 14C ages suggest that a major episode of carbonate precipitation occurred between 6.1 ka and 5.1 ka BP at the Haima seeps, followed by a possibly subordinate episode from approximately 3.9 ka to 2.9 ka BP. The common occurrence of dead bivalves at both sites indicates that chemosynthesis-based communities flourished to a greater extent in the past, probably reflecting a decline of seepage activity in recent times. Overall, these results confirm that authigenic carbonates from

  8. Kinetic study of benzyl [1-14C]acetate as a potential probe for astrocytic energy metabolism in the rat brain: Comparison with benzyl [2-14C]acetate.

    PubMed

    Okada, Maki; Yanamoto, Kazuhiko; Kagawa, Tomohiko; Yoshino, Keiko; Hosoi, Rie; Abe, Kohji; Zhang, Ming-Rong; Inoue, Osamu

    2016-02-01

    Brain uptake of [(14)C]acetate has been reported to be a useful marker of astrocytic energy metabolism. In addition to uptake values, the rate of radiolabeled acetate washout from the brain appears to reflect CO2 exhaustion and oxygen consumption in astrocytes. We measured the time-radioactivity curves of benzyl [1-(14)C]acetate ([1-(14)C]BA), a lipophilic probe of [1-(14)C]acetate, and compared it with that of benzyl [2-(14)C]acetate ([2-(14)C]BA) in rat brains. The highest brain uptake was observed immediately after injecting either [1-(14)C]BA or [2-(14)C]BA, and both subsequently disappeared from the brain in a single-exponential manner. Estimated [1-(14)C]BA washout rates in the cerebral cortex and cerebellum were higher than those of [2-(14)C]BA. These results suggested that [1-(14)C]BA could be a useful probe for estimating the astrocytic oxidative metabolism. The [1-(14)C]BA washout rate in the cerebral cortex of immature rats was lower than that of mature rats. An autoradiographic study showed that the washout rates of [1-(14)C]BA from the rat brains of a lithium-pilocarpine-induced status epilepticus model were not significantly different from the values in control rat brains except for the medial septal nucleus. These results implied that the enhancement of amino acid turnover rate rather than astrocytic oxidative metabolism was increased in status epilepticus. © The Author(s) 2015.

  9. Usefulness of Enzyme-linked Immunosorbent Assay Using Recombinant BP180 and BP230 for Serodiagnosis and Monitoring Disease Activity of Bullous Pemphigoid

    PubMed Central

    Lee, Eui Hyung; Kim, Yeon Hee; Kim, Sinyoung; Kim, Song-ee

    2012-01-01

    Background Bullous pemphigoid (BP) is an autoimmune subepidermal bullous disease associated with autoantibodies against BP180 and BP230. Enzyme-linked immunosorbent assay (ELISA) is a sensitive tool for the detection of immunoglobulin G (IgG) anti-BP180 and anti-BP230 autoantibodies. Objective The aim of this study was to evaluate the usefulness of ELISA for diagnosing and monitoring the disease activity of BP. Methods We evaluated serum IgG levels of anti-BP180 and anti-BP230 autoantibodies in 47 BP patients, 16 epidermolysis bullosa aquisita patients, and 15 healthy volunteers using ELISA. Through retrospective review of the medical records, the clinical characteristics of BP including disease activity, duration, pruritus severity and peripheral blood eosinophil counts were assessed. Results The sensitivity of BP180 ELISA was 97.9%, BP230 ELISA 72.3%, and a combination of the two was 100%. The specificity of BP180 ELISA was 90.3%, BP230 ELISA 100%, and a combination of the two was 90.3%. BP180 ELISA scores showed strong associations with disease activity, pruritus severity, peripheral blood eosinophil counts, and disease duration, whereas BP230 ELISA scores did not. Conclusion BP180 and BP230 ELISAs are highly sensitive methods for the diagnosis of BP, and BP180 ELISA, in particular, is a sensitive tool for monitoring the disease activity of BP. PMID:22363155

  10. New insights into Holocene eruption episodes from proximal deposit sequences at Mt. Taranaki (Egmont), New Zealand

    NASA Astrophysics Data System (ADS)

    Torres-Orozco, Rafael; Cronin, Shane J.; Pardo, Natalia; Palmer, Alan S.

    2017-01-01

    Upper stratovolcano flanks contain the most nuanced depositional record of long eruption episodes, but steep, irregular terrain makes these sequences difficult to correlate and interpret. This necessitates development of a detailed and systematic approach to describing localized depositional facies and relating these to eruptive processes. In this work, the late-Holocene eruption history of Mt. Taranaki/Egmont, New Zealand, was re-assessed based on a study of proximal deposits spanning the 14C-dated age range of 5.0-0.3 cal ka B.P. Mt. Taranaki is a textbook-example stratovolcano, with geological evidence pointing to sudden switches in scale, type and frequency of eruptions over its 130 ka history. The proximal stratigraphy presented here almost doubles the number of eruptions recognized from previous soil-stratigraphy studies. A total of 53 lithostratigraphic bed-sets record eruptions of the summit crater and parasitic vents like Fanthams Peak (the latter between 3.0 and 1.5 cal ka B.P.). At least 12 of the eruptions represented by these bed-sets comprise deposits comparable with or thicker than those of the latest sub-Plinian eruption of AD 1655. The largest eruption episode represented is the 4.6-4.7-cal ka B.P. Kokowai. Contrasting eruption styles were identified, from stable basaltic-andesite eruption columns at Fanthams Peak, to andesitic lava-dome extrusion, blasts and partial collapse of unstable eruption columns at Mt. Taranaki's summit. The centemetre-scale proximal deposit descriptions were used to identify several previously unknown, smaller eruption events. These details are indispensable for building a comprehensive probabilistic event record and in the development of realistic eruptive scenarios for complex eruption episodes prior to re-awakening of a volcano.

  11. Infilling and flooding of the Mekong River incised valley during deglacial sea-level rise

    NASA Astrophysics Data System (ADS)

    Tjallingii, Rik; Stattegger, Karl; Wetzel, Andreas; Van Phach, Phung

    2010-06-01

    The abrupt transition from fluvial to marine deposition of incised-valley-fill sediments retrieved from the southeast Vietnamese shelf, accurately records the postglacial transgression after 14 ka before present (BP). Valley-filling sediments consist of fluvial mud, whereas sedimentation after the transgression is characterized by shallow-marine carbonate sands. This change in sediment composition is accurately marked in high-resolution X-ray fluorescence (XRF) core scanning records. Rapid aggradation of fluvial sediments at the river mouth nearly completely filled the Mekong incised valley prior to flooding. However, accumulation rates strongly reduced in the valley after the river-mouth system flooded and stepped back. This also affected the sediment supply to deeper parts of the southeast Vietnamese shelf. Comparison of the Mekong valley-filling with the East Asian sea-level history of sub- and inter-tidal sediment records shows that the transgressive surface preserved in the incised-valley-fill records is a robust sea-level indicator. The valley was nearly completely filled with fluvial sediments between 13.0 and 9.5 ka BP when sea-level rose rather constantly with approximately 10 mm/yr, as indicated by the East Asian sea-level record. At shallower parts of the shelf, significant sediment reworking and the establishment of estuarine conditions at the final stage of infilling complicates accurate dating of the transgressive surface. Nevertheless, incised-valley-fill records and land-based drill sites indicate a vast and rapid flooding of the shelf from the location of the modern Vietnamese coastline to the Cambodian lowlands between 9.5 ka and 8.5 ka BP. Fast flooding of this part of the shelf is related with the low shelf gradient and a strong acceleration of the East Asian sea-level rise from 34 to 9 meter below modern sea level (mbsl) corresponding to the sea-level jump of melt water pulse (MWP) 1C.

  12. Enzyme-triggered delivery of chlorambucil from conjugates based on the cell-penetrating peptide BP16.

    PubMed

    Soler, Marta; González-Bártulos, Marta; Figueras, Eduard; Ribas, Xavi; Costas, Miquel; Massaguer, Anna; Planas, Marta; Feliu, Lidia

    2015-02-07

    The undecapeptide KKLFKKILKKL-NH2 (BP16) is a non-toxic cell-penetrating peptide (CPP) that is mainly internalized into cancer cells through a clathrin dependent endocytic mechanism and localizes in late endosomes. Moreover, this CPP is able to enhance the cellular uptake of chlorambucil (CLB) improving its cytotoxicity. In this work, we further explored the cell-penetrating properties of BP16 and those of its arginine analogue BP308. We investigated the influence on the cytotoxicity and on the cellular uptake of conjugating CLB at the N- or the C-terminal end of these undecapeptides. The effect of incorporating the cathepsin B-cleavable sequence Gly-Phe-Leu-Gly in CLB-BP16 and CLB-BP308 conjugates was also evaluated. The activity of CLB was significantly improved when conjugated at the N- or the C-terminus of BP16, or at the N-terminus of BP308. While CLB alone was not active (IC50 of 73.7 to >100 μM), the resulting conjugates displayed cytotoxic activity against CAPAN-1, MCF-7, PC-3, 1BR3G and SKMEL-28 cell lines with IC50 values ranging from 8.7 to 25.5 μM. These results were consistent with the internalization properties observed for the corresponding 5(6)-carboxyfluorescein-labeled conjugates. The presence of the tetrapeptide Gly-Phe-Leu-Gly at either the N- or the C-terminus of CLB-BP16 conjugates further increased the efficacy of CLB (IC50 of 3.6 to 16.2 μM), which could be attributed to its selective release in the lysosomal compartment. Enzymatic assays with cathepsin B showed the release of CLB-Gly-OH from these sequences within a short time. Therefore, the combination of BP16 with an enzymatic cleavable sequence can be used as a drug delivery system for the effective uptake and release of drugs in cancer cells.

  13. Forensic applications of 14C bomb-pulse dating

    NASA Astrophysics Data System (ADS)

    Zoppi, U.; Skopec, Z.; Skopec, J.; Jones, G.; Fink, D.; Hua, Q.; Jacobsen, G.; Tuniz, C.; Williams, A.

    2004-08-01

    After a brief review of the basics of 14C bomb-pulse dating, this paper presents two unique forensic applications. Particular attention is dedicated to the use of the 14C bomb-pulse to establish the time of harvest of illicit drugs such as heroin and opium. Preliminary measurements of 14C concentrations in milligram samples taken from seized drugs are presented. 14C bomb-pulse dating can determine whether drug distribution originates from stockpiles or recent manufacture, and support the action of law enforcement authorities against criminal organisations involved in drug trafficking. In addition, we describe the dating of wine vintages for a number of authenticated single label vintage red wines from the Barossa Valley - South Australia. Our results show that radiocarbon dating can be used to accurately determine wine vintages and therefore reveal the addition of unrelated materials of natural and synthetic origin.

  14. Metal Deposition Along the Peru Margin Since the Last Glacial Maximum: Evidence For Regime Change at \\sim 6ka

    NASA Astrophysics Data System (ADS)

    Tierney, J.; Cleaveland, L.; Herbert, T.; Altabet, M.

    2004-12-01

    The Peru Margin upwelling zone plays a key role in regulating marine biogeochemical cycles, particularly the fate of nitrate. High biological productivity and low oxygen waters fed into the oxygen minimum zone result in intense denitrification in the modern system, the consequences of which are global in nature. It has been very difficult, however, to study the paleoclimatic history of this region because of the poor preservation of carbonate in Peru Margin sediments. Here we present records of trace metal accumulation from two cores located in the heart of the suboxic zone off the central Peru coast. Chronology comes from multiple AMS 14C dates on the alkenone fraction of the sediment, as well as correlation using major features of the \\delta 15N record in each core. ODP Site 1228 provides a high resolution, continuous sediment record from the Recent to about 14ka, while gravity core W7706-41k extends the record to the Last Glacial Maximum. Both cores were sampled at a 100 yr resolution, then analyzed for % N, \\delta 15N, alkenones, and trace metal concentration. Analysis of redox-sensitive metals (Mo and V) alongside metals associated with changes in productivity (Ni and Zn) provides perspective on the evolution of the upwelling system and distinguishes the two major factors controlling the intensity of the oxygen minimum zone. The trace metal record exhibits a notable increase in the intensity and variability of low oxygen waters and productivity beginning around 6ka and extending to the present. Within this most recent 6ka interval, the data suggest fluctuations in oxygenation and productivity occur on 1000 yr timescales. Our core records, therefore, suggest that the Peru Margin upwelling system strengthened significantly during the mid to late Holocene.

  15. Deployment and Operational Experiences with CernVM-FS at the GridKa Tier-1 Center

    NASA Astrophysics Data System (ADS)

    Alef, Manfred; Jäger, Axel; Petzold and, Andreas; Verstege, Bernhard

    2012-12-01

    In 2012 the GridKa Tier-1 computing center hosts 130 kHS06 computing resources and 14PB disk and 17PB tape space. These resources are shared between the four LHC VOs and a number of national and international VOs from high energy physics and other sciences. CernVM-FS has been deployed at GridKa to supplement the existing NFS-based system to access VO software on the worker nodes. It provides a solution tailored to the requirement of the LHC VOs. We will focus on the first operational experiences and the monitoring of CernVM-FS on the worker nodes and the squid caches.

  16. The enzymic preparation of (14)C-kaurene.

    PubMed

    Graebe, J E

    1969-06-01

    Endosperm from immature seeds of Cucurbita pepo L. converts 2-(14)C-DL-mevalonate to (14)C-(-)-kaurene with a yield of nearly 40% of the active isomer. Kaurene is the main product and the only diterpene hydrocarbon which is formed from mevalonate in the system and is therefore easily obtained radiochemically pure. The product was identified by thin-layer chromatography and recrystallization with authentic (-)-kaurene to constant specific radioactivity.

  17. Chronological reconstruction of eolianites and transversal mobile dunes of northwest coast of Ceará State - Brazil, in the last 3000 cal yrs BP

    NASA Astrophysics Data System (ADS)

    Castro, João Wagner Alencar; Malta, Julia Varella; Miguel, Lucas Lavo Antonio Jimo; Cabral, Caique Lima; Passemilio, Alvaro Balmant

    2017-10-01

    Dunefields are very common in the northern coastal zone of northeast Brazil. They have the potential to yield important information about paleoclimate, paleo-winds and regional winds and their response to sea-level fluctuations during the Holocene. We reconstructed the coastal dunes geochronological evolution of northwest Ceará State - Brazil, in the last 3000 cal yrs BP, using detailed analyses of lithostratigraphy, microfossil (foraminifera), wind regime, dune monitoring and 8 radiocarbon dates. The chronology was based on 14C dating in eolianites and monitoring transversal mobile dunes movement processes. Radiocarbon date results indicated that the dunes corresponding to eolianites revealed ages between 2760-2480 and 980-750 cal yrs BP, suggesting that the vast transversal mobile dunefields were formed after this period in similar condition to the current sea-level. We considered that the material transportation by the prevailing east winds towards the transversal dunes is estimated in the order of 11.0 m/year, thus the current aeolian system is less than 1000 yrs BP.

  18. Ecosystem state shifts during long-term development of an Amazonian peatland.

    PubMed

    Swindles, Graeme T; Morris, Paul J; Whitney, Bronwen; Galloway, Jennifer M; Gałka, Mariusz; Gallego-Sala, Angela; Macumber, Andrew L; Mullan, Donal; Smith, Mark W; Amesbury, Matthew J; Roland, Thomas P; Sanei, Hamed; Patterson, R Timothy; Sanderson, Nicole; Parry, Lauren; Charman, Dan J; Lopez, Omar; Valderamma, Elvis; Watson, Elizabeth J; Ivanovic, Ruza F; Valdes, Paul J; Turner, T Edward; Lähteenoja, Outi

    2018-02-01

    The most carbon (C)-dense ecosystems of Amazonia are areas characterized by the presence of peatlands. However, Amazonian peatland ecosystems are poorly understood and are threatened by human activities. Here, we present an investigation into long-term ecohydrological controls on C accumulation in an Amazonian peat dome. This site is the oldest peatland yet discovered in Amazonia (peat initiation ca. 8.9 ka BP), and developed in three stages: (i) peat initiated in an abandoned river channel with open water and aquatic plants; (ii) inundated forest swamp; and (iii) raised peat dome (since ca. 3.9 ka BP). Local burning occurred at least three times in the past 4,500 years. Two phases of particularly rapid C accumulation (ca. 6.6-6.1 and ca. 4.9-3.9 ka BP), potentially resulting from increased net primary productivity, were seemingly driven by drier conditions associated with widespread drought events. The association of drought phases with major ecosystem state shifts (open water wetland-forest swamp-peat dome) suggests a potential climatic control on the developmental trajectory of this tropical peatland. A third drought phase centred on ca. 1.8-1.1 ka BP led to markedly reduced C accumulation and potentially a hiatus during the peat dome stage. Our results suggest that future droughts may lead to phases of rapid C accumulation in some inundated tropical peat swamps, although this can lead ultimately to a shift to ombrotrophy and a subsequent return to slower C accumulation. Conversely, in ombrotrophic peat domes, droughts may lead to reduced C accumulation or even net loss of peat. Increased surface wetness at our site in recent decades may reflect a shift towards a wetter climate in western Amazonia. Amazonian peatlands represent important carbon stores and habitats, and are important archives of past climatic and ecological information. They should form key foci for conservation efforts. © 2017 The Authors. Global Change Biology Published by John Wiley

  19. Synthesis, biophysical and functional studies of two BP100 analogues modified by a hydrophobic chain and a cyclic peptide.

    PubMed

    Carretero, Gustavo P B; Saraiva, Greice K V; Cauz, Ana C G; Rodrigues, Magali A; Kiyota, Sumika; Riske, Karin A; Dos Santos, Alcindo A; Pinatto-Botelho, Marcos F; Bemquerer, Marcelo P; Gueiros-Filho, Frederico J; Chaimovich, Hernan; Schreier, Shirley; Cuccovia, Iolanda M

    2018-05-09

    Antimicrobial peptides (AMPs) work as a primary defense against pathogenic microorganisms. BP100, (KKLFKKILKYL-NH 2 ), a rationally designed short, highly cationic AMP, acts against many bacteria, displaying low toxicity to eukaryotic cells. Previously we found that its mechanism of action depends on membrane surface charge and on peptide-to-lipid ratio. Here we present the synthesis of two BP100 analogs: BP100‑alanyl‑hexadecyl‑1‑amine (BP100-Ala-NH-C 16 H 33 ) and cyclo(1‑4)‑d‑Cys 1 , Ile 2 , Leu 3 , Cys 4 -BP100 (Cyclo(1‑4)‑cILC-BP100). We examined their binding to large unilamellar vesicles (LUV), conformational and functional properties, and compared with those of BP100. The analogs bound to membranes with higher affinity and a lesser dependence on electrostatic forces than BP100. In the presence of LUV, BP100 and BP100-Ala-NH-C 16 H 33 acquired α-helical conformation, while Cyclo(1‑4)‑cILC-BP100) was partly α-helical and partly β-turn. Taking in conjunction: 1. particle sizes and zeta potential, 2. effects on lipid flip-flop, 3. leakage of LUVs internal contents, and 4. optical microscopy of giant unilamellar vesicles, we concluded that at high concentrations, all three peptides acted by a carpet mechanism, while at low concentrations the peptides acted by disorganizing the lipid bilayer, probably causing membrane thinning. The higher activity and lesser membrane surface charge dependence of the analogs was probably due to their greater hydrophobicity. The MIC values of both analogs towards Gram-positive and Gram-negative bacteria were similar to those of BP100 but both analogues were more hemolytic. Confocal microscopy showed Gram-positive B. subtilis killing with concomitant extensive membrane damage suggestive of lipid clustering, or peptide-lipid aggregation. These results were in agreement with those found in model membranes. Copyright © 2018. Published by Elsevier B.V.

  20. Geochemistry and mineralogy of the older (> 40 ka) ignimbrites in the Campanian Plain, southern Italy

    NASA Astrophysics Data System (ADS)

    Belkin, Harvey E.; Raia, Federica; Rolandi, Giuseppe; Jackson, John C.; de Vivo, Benedetto

    2010-05-01

    The Campanian Plain in southern Italy has been volcanically active during the last 600 ka. The largest and best known eruption at 39 ka formed the Campanian Ignimbrite (CI), which has the largest volume (~310 km3) and the greatest areal extent. However, significant, but scattered deposits of older ignimbrites underlie the CI and document a long history of trachytic eruptions. We examined the geochemistry and mineralogy of 11 older ignimbrite strata by optical petrography, electron microprobe, scanning electron microscope, X-ray diffraction, and various whole-rock geochemical techniques. Strata at Durazzano (116.1 ka), Moschiano (184.7 ka), Seiano Valley A (245.9 ka), Seiano Valley B (289.6 ka), Taurano 7 (205.6 and 210.4 ka), Taurano 9 (183.8 ka), and Taurano 14 (157.4 ka) have been previously dated by the 40Ar/39Ar technique (Rolandi et al., 2003, Min. & Pet., 79) on hand-picked sanidine. The older ignimbrites are trachytic, but are highly altered with LOI from 8 to 17 wt%. Whole-rock compositions reflect variable element mobility during weathering; TiO2, Al2O3, Fe-oxide, and CaO tend to be enriched relative to average CI composition, whereas Na2O and K2O are depleted. X-ray diffraction identified major chabazite, kaolinite, and illite-smectite alteration products in some samples. The phenocryst mineralogy in all of the strata is typical for trachyte magma and consists of plagioclase (~An80 to ~An40), potassium feldspar (~Or50 to ~Or80), biotite (TiO2 = ~4.6 wt%, BaO = ~0.70 wt%, F = ~0.65 wt%), diopside (~Ca47Mg48Fe5 to ~Ca48Mg34Fe18), titanomagnetite, and uncommon Ca-amphibole. Relatively immobile trace elements Zr, Hf, Nb, and Th display similar abundance, linear trends, and ratios as those measured in the Campanian Ignimbrite: Th/Hf = ~4, Zr/Hf = ~50, and Zr/Nb = ~6. The similarity of trace element systematics and phenocryst mineralogy among the Campanian Ignimbrite and the older ignimbrites suggests that the magmagenesis processes and parental source have

  1. 14C tebuconazole degradation in Colombian soils.

    PubMed

    Mosquera, C S; Martínez, M J; Guerrero, J A

    2010-01-01

    Tebuconazole is a fungicide used on onion crops (Allium Fistulosum L) in Colombia. Persistence of pesticides in soils is characterized by the half-life (DT50), which is influenced by their chemical structure, the physical and chemical properties of the soil and the previous soil history. Based on its structural and chemical properties, tebuconazole should be expected to be relatively persistent in soils. Laboratory incubation studies were conducted to evaluate persistence and bond residues of 14C tebuconazole in three soils, two inceptisol (I) and one histosol (H). Textural classifications were: loam (101), loamy sand (102) and loam (H03), respectively. Data obtained followed a first-order degradation kinetics (R2 > or = 0.899) with DT50 values between 158 and 198 days. The production of 14CO2 from the 14C-ring-labelled test chemicals was very low and increased slightly during 63 days in all cases. The methanol extractable 14C-residues were higher than aqueous ones and both decreased over incubation time for the three soils. The formation of bound 14C-residues increased with time and final values were 11.3; 5.55 and 7.87% for 101, 102 and H03 respectively. Soil 101 showed the lowest mineralization rate and the highest bound residues formation, which might be explained by the clay fraction content. In contrast, an inverse behavior was found for soils 102 and H03, these results might be explained by the higher soil organic carbon content.

  2. 14 CFR 71.51 - Class C airspace.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... DESIGNATION OF CLASS A, B, C, D, AND E AIRSPACE AREAS; AIR TRAFFIC SERVICE ROUTES; AND REPORTING POINTS Class C Airspace § 71.51 Class C airspace. The Class C airspace areas listed in subpart C of FAA Order... 14 Aeronautics and Space 2 2013-01-01 2013-01-01 false Class C airspace. 71.51 Section 71.51...

  3. 14 CFR 71.51 - Class C airspace.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... DESIGNATION OF CLASS A, B, C, D, AND E AIRSPACE AREAS; AIR TRAFFIC SERVICE ROUTES; AND REPORTING POINTS Class C Airspace § 71.51 Class C airspace. The Class C airspace areas listed in subpart C of FAA Order... 14 Aeronautics and Space 2 2010-01-01 2010-01-01 false Class C airspace. 71.51 Section 71.51...

  4. Paleoclimate and Asian monsoon variability inferred from n-alkanes and their stable isotopes at lake Donggi Cona, NE Tibetan Plateau

    NASA Astrophysics Data System (ADS)

    Saini, Jeetendra; Guenther, Franziska; Mäusbacher, Roland; Gleixner, Gerd

    2015-04-01

    The Tibetan Plateau is one of the most extensive and sensitive region of elevated topography affecting global climate. The interplay between the Asian summer monsoon and the westerlies greatly influences the lake systems at the Tibetan Plateau. Despite a considerable number of research efforts in last decade, possible environmental reactions to change in monsoon dynamics are still not well understood. Here we present results from a sediment core of lake Donggi Cona, which dates back to late glacial period. Distinct organic geochemical proxies and stable isotopes are used to study the paleoenvironmental and hydrological changes in late glacial and Holocene period. Sedimentary n-alkanes of lake Donggi Cona are used as a proxy for paleoclimatic and monsoonal reconstruction. The hydrogen (δD) and carbon (δ13C) isotopes of n-alkanes are used as proxy for hydrological and phytoplankton productivity, respectively . Qualitative and quantitative analysis were performed for n-alkanes over the sediment core. δD proxy for sedimentary n-alkanes is used to infer lake water and rainfall signal. δD of (n-alkane C23) records the signal of the lake water, whereas δD of (n-alkane C29) record the precipitation signal, hence act as an appropriate proxy to track Asian monsoon. Long chain n-alkanes dominate over the sediment core while unsaturated mid chain n-alkenes have high abundance in some samples. From 18.4-13.8 cal ka BP, sample shows low organic productivity due to cold and arid climate. After 13.8-11.8 cal ka BP, slight increase in phytoplankton productivity indicate onset of weaker monsoon. From 11.8-6.8 cal ka BP, high content of organic matter indicates rise in productivity and strong monsoon with high inflow. After 6.8 cal ka BP, decrease in phytoplankton productivity indicating cooler climate and show terrestrial signal. Our results provide new insight into the variability of east Asian monsoon and changes in phytoplankton productivity for last 18.4 ka. Keywords: n

  5. 17 CFR 240.14c-101 - Schedule 14C. Information required in information statement.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... separate copy of the annual report to security holders, information statement, or Notice of Internet... annual reports to security holders, information statements, or Notices of Internet Availability of Proxy... 17 Commodity and Securities Exchanges 4 2014-04-01 2014-04-01 false Schedule 14C. Information...

  6. 17 CFR 240.14c-101 - Schedule 14C. Information required in information statement.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... separate copy of the annual report to security holders, information statement, or Notice of Internet... annual reports to security holders, information statements, or Notices of Internet Availability of Proxy... 17 Commodity and Securities Exchanges 3 2013-04-01 2013-04-01 false Schedule 14C. Information...

  7. 17 CFR 240.14c-101 - Schedule 14C. Information required in information statement.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... separate copy of the annual report to security holders, information statement, or Notice of Internet... annual reports to security holders, information statements, or Notices of Internet Availability of Proxy... 17 Commodity and Securities Exchanges 3 2012-04-01 2012-04-01 false Schedule 14C. Information...

  8. Autoradiographic disposition of (1-methyl-/sup 14/C)- and (2-/sup 14/C)caffeine in mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lachance, M.P.; Marlowe, C.; Waddell, W.J.

    1983-11-01

    Male, C57B1/6J mice received either (1-methyl-14C)caffeine or (2-14C)caffeine via the tail vein at a dose of 0.7 or 11 mg/kg, respectively. At 0.1, 0.33, 1, 3, 9, and 24 hr after treatment, the mice were anesthetized with ether and frozen by immersion in dry ice/hexane. The mice were processed for whole-body autoradiography by the Ullberg technique; this procedure does not allow thawing or contact with solvents. All autoradiographs revealed some retention of radioactivity at early time intervals in the lacrimal glands, seminal vesicle fluid, nasal and olfactory epithelium, and retinal melanocytes. The remaining portion of the animal was densitometrically uniformmore » except for the lower levels noted in the CNS and adipose tissues. Excretion of radioactivity by the liver and kidneys seems to be the major routes of elimination. Localization in the liver at late time intervals was confined principally to the centrilobular region. Late sites of retention, observed only after (1-methyl-14C)caffeine administration, included the pancreas, minor and major salivary glands, splenic red pulp, thymal cortex, bone marrow, and gastrointestinal epithelium. Sites of localization present in both studies included the olfactory epithelium, lacrimal glands, hair follicles, and retinal melanocytes. Further studies are needed to determine whether the localization at these various sites is due to metabolic degradation, active transport, or possibly a specific receptor interaction.« less

  9. Subepidermal Blistering Induced by Human Autoantibodies to BP180 Requires Innate Immune Players in a Humanized Bullous Pemphigoid Mouse Model

    PubMed Central

    Liu, Zhi; Sui, Wen; Zhao, Minglang; Li, Zhuowei; Li, Ning; Thresher, Randy; Giudice, George J.; Fairley, Janet A.; Sitaru, Cassian; Zillikens, Detlef; Ning, Gang; Marinkovich, Peter; Diaz, Luis A.

    2008-01-01

    Bullous pemphigoid (BP) is a cutaneous autoimmune inflammatory disease associated with subepidermal blistering and autoantibodies against BP180, a transmembrane collagen and major component of the hemidesmosome. Numerous inflammatory cells infiltrate the upper dermis in BP. IgG autoantibodies in BP fix complement and target multiple BP180 epitopes that are highly clustered within a non-collagen linker domain, termed NC16A. Anti-BP180 antibodies induce BP in mice. In this study, we generated a humanized mouse strain, in which the murine BP180NC14A is replaced with the homologous human BP180NC16A epitope cluster region. We show that the humanized NC16A (NC16A+/+) mice injected with anti-BP180NC16A autoantibodies develop BP-like subepidermal blisters. The F(ab′)2 fragments of pathogenic IgG fail to activate complement cascade and are no longer pathogenic. The NC16A+/+ mice pretreated with mast cell activation blocker or depleting of complement or neutrophils become resistant to BP. These findings suggest that the humoral response in BP critically depends on innate immune system players. PMID:18922680

  10. Nocturnal Hypertension and Altered Night-Day BP Profile and Atherosclerosis in Renal Transplant Patients.

    PubMed

    Mallamaci, Francesca; Tripepi, Rocco; Leonardis, Daniela; Mafrica, Angela; Versace, Maria Carmela; Provenzano, Fabio; Tripepi, Giovanni; Zoccali, Carmine

    2016-10-01

    The clinical relevance of ambulatory blood pressure monitoring (ABPM) for risk stratification in renal transplant patients still remains poorly defined. We investigated the association between clinic and ABPM with an established biomarker of atherosclerosis (intima-media thickness [IMT] by echo-color Doppler) in a large, inclusive survey (n = 172) in renal transplant patients at a single institution. Forty-two patients (24%) were classified as hypertensive by ABPM criteria and 29 (17%) by clinic blood pressure (BP) criteria. Average daytime and nighttime BP was 126 ± 12/78 ± 9 mm Hg and 123 ± 13/74 ± 10 mm Hg, respectively. Forty-five patients (26%) were classified as hypertensive by the daytime criterion (>135/85 mm Hg) and a much higher proportion (n = 119, 69%) by the nighttime criterion (>120/70 mm Hg). Sixty-two patients (36%) had a night-day ratio of 1 or greater, indicating clear-cut nondipping. The average nighttime systolic BP (r = 0.24, P = 0.001) and the night-day systolic BP ratio (r = 0.23, P = 0.002) were directly related to IMT, and these associations were much more robust than the 24-hour systolic BP-IMT relationship (r = 0.16, P = 0.04). Average daytime BP and clinic B were unrelated to IMT. In a multiple regression analysis adjusting for confounders, the night-day systolic BP ratio maintained an independent association with IMT (β = 0.14, P = 0.04). In renal transplant patients, the prevalence of nocturnal hypertension by far exceeds the prevalence of hypertension as assessed by clinic, daytime, and 24-hour ABPM. Nighttime systolic BP and the night-day ratio but no other BP metrics are independently associated with IMT. Blood pressure during nighttime may provide unique information for the assessment of cardiovascular risk attributable to BP burden in renal transplant patients.

  11. Centennial and millennial-scale hydroclimate changes in northwestern Patagonia since 16,000 yr BP

    NASA Astrophysics Data System (ADS)

    Moreno, Patricio I.; Videla, Javiera

    2016-10-01

    We examine hydroclimate changes at centennial/millennial timescales since 16,000 yr BP in northwestern Patagonia based on the pollen and charcoal record from Lago El Salto, a small closed-basin lake located in the Chilean Lake District (41°38‧48.02″S, 73° 5‧48.42″W). We observe cold/wet conditions between 14,500-16,000 yr BP, followed by further cooling with increased precipitation until 13,000 yr BP, enhanced precipitation seasonality and/or variability between 11,600-13,000 yr BP, and an extended warm-and-dry interval between 7600 and 11,300 yr BP with peak paleofire activity. Colder-and-wetter than present conditions and muted paleofire activity prevail between 5300 and 7600 yr BP, followed by alternating cold/wet and centennial-scale warm/dry phases starting at 5300 yr BP with three conspicuous megadroughts since 2500 yr BP. The most recent megadrought occurred during the Medieval Climate Anomaly. We identify a cold reversal that spans the Antarctic Cold Reversal (ACR) and the Younger Dryas (YD) chrons with stronger-than-present westerly influence during the former and enhanced variability during the latter. These results extend the northern limit of strong cooling and increase in precipitation during the ACR and the southern limit of influence of strong hydrologic variations during the YD in terrestrial environments, suggesting an overlap in the spheres of influence of processes originating from southern and northern polar latitudes. An extended warm southern westerly wind (SWW)-minimum interval is evident between 7600 and 11,300 yr BP, followed by a rapid shift to cool-moist conditions between 5300 and 7600 yr BP brought by a mid-Holocene SWW maximum. Since then we observe centennial-scale hydroclimate variability, which has driven biodiversity and fire-regime shifts of evergreen temperate rainforests.

  12. Pyrolysis-combustion 14C dating of soil organic matter

    USGS Publications Warehouse

    Wang, Hongfang; Hackley, Keith C.; Panno, S.V.; Coleman, D.D.; Liu, J.C.-L.; Brown, J.

    2003-01-01

    Radiocarbon (14C) dating of total soil organic matter (SOM) often yields results inconsistent with the stratigraphic sequence. The onerous chemical extractions for SOM fractions do not always produce satisfactory 14C dates. In an effort to develop an alternative method, the pyrolysis-combustion technique was investigated to partition SOM into pyrolysis volatile (Py-V) and pyrolysis residue (Py-R) fractions. The Py-V fractions obtained from a thick glacigenic loess succession in Illinois yielded 14C dates much younger but more reasonable than the counterpart Py-R fractions for the soil residence time. Carbon isotopic composition (??13C) was heavier in the Py-V fractions, suggesting a greater abundance of carbohydrate- and protein-related constituents, and ??13C was lighter in the Py-R fractions, suggesting more lignin- and lipid-related constituents. The combination of 14C dates and ??13C values indicates that the Py-V fractions are less biodegradation resistant and the Py-R fractions are more biodegradation resistant. The pyrolysis-combustion method provides a less cumbersome approach for 14C dating of SOM fractions. With further study, this method may become a useful tool for analyzing unlithified terrestrial sediments when macrofossils are absent. ?? 2003 University of Washington. Published by Elsevier Inc. All rights reserved.

  13. Multi-scale Holocene Asian monsoon variability deduced from a twin-stalagmite record in southwestern China

    NASA Astrophysics Data System (ADS)

    Huang, Wei; Wang, Yongjin; Cheng, Hai; Edwards, Richard Lawrence; Shen, Chuan-Chou; Liu, Dianbing; Shao, Qingfeng; Deng, Chao; Zhang, Zhenqiu; Wang, Quan

    2016-07-01

    We present two isotopic (δ18O and δ13C) sequences of a twin-stalagmite from Zhuliuping Cave, southwestern China, with 230Th dates from 14.6 to 4.6 ka. The stalagmite δ18O record characterizes orbital- to decadal-scale variability of Asian summer monsoon (ASM) intensity, with the Holocene optimum period (HOP) between 9.8 and 6.8 ka BP which is reinforced by its co-varying δ13C data. The large multi-decadal scale amplitude of the cave δ18O indicates its high sensitivity to climate change. Four centennial-scale weak ASM events during the early Holocene are centered at 11.2, 10.8, 9.1 and 8.2 ka. They can be correlated to cold periods in the northern high latitudes, possibly resulting from rapid dynamics of atmospheric circulation associated with North Atlantic cooling. The 8.2 ka event has an amplitude more than two-thirds that of the Younger Dryas (YD), and is significantly stronger than other cave records in the Asia monsoon region, likely indicating a more severe dry climate condition at the cave site. At the end of the YD event, the δ13C record lags the δ18O record by 300-500 yr, suggesting a multi-centennial slow response of vegetation and soil processes to monsoon enhancement.

  14. The Nedd4-binding partner 1 (N4BP1) protein is an inhibitor of the E3 ligase Itch

    PubMed Central

    Oberst, Andrew; Malatesta, Martina; Aqeilan, Rami I.; Rossi, Mario; Salomoni, Paolo; Murillas, Rodolfo; Sharma, Prashant; Kuehn, Michael R.; Oren, Moshe; Croce, Carlo M.; Bernassola, Francesca; Melino, Gerry

    2007-01-01

    Nedd4-binding partner-1 (N4BP1) has been identified as a protein interactor and a substrate of the homologous to E6AP C terminus (HECT) domain-containing E3 ubiquitin–protein ligase (E3), Nedd4. Here, we describe a previously unrecognized functional interaction between N4BP1 and Itch, a Nedd4 structurally related E3, which contains four WW domains, conferring substrate-binding activity. We show that N4BP1 association with the second WW domain (WW2) of Itch interferes with E3 binding to its substrates. In particular, we found that N4BP1 and p73α, a target of Itch-mediated ubiquitin/proteasome proteolysis, share the same binding site. By competing with p73α for binding to the WW2 domain, N4BP1 reduces the ability of Itch to recruit and ubiquitylate p73α and inhibits Itch autoubiquitylation activity both in in vitro and in vivo ubiquitylation assays. Similarly, both c-Jun and p63 polyubiquitylation by Itch are inhibited by N4BP1. As a consequence, genetic and RNAi knockdown of N4BP1 diminish the steady-state protein levels and significantly impair the transcriptional activity of Itch substrates. Notably, stress-induced induction of c-Jun was impaired in N4BP1−/− cells. These results demonstrate that N4BP1 functions as a negative regulator of Itch. In addition, because inhibition of Itch by N4BP1 results in the stabilization of crucial cell death regulators such as p73α and c-Jun, it is conceivable that N4BP1 may have a role in regulating tumor progression and the response of cancer cells to chemotherapy. PMID:17592138

  15. The Nedd4-binding partner 1 (N4BP1) protein is an inhibitor of the E3 ligase Itch.

    PubMed

    Oberst, Andrew; Malatesta, Martina; Aqeilan, Rami I; Rossi, Mario; Salomoni, Paolo; Murillas, Rodolfo; Sharma, Prashant; Kuehn, Michael R; Oren, Moshe; Croce, Carlo M; Bernassola, Francesca; Melino, Gerry

    2007-07-03

    Nedd4-binding partner-1 (N4BP1) has been identified as a protein interactor and a substrate of the homologous to E6AP C terminus (HECT) domain-containing E3 ubiquitin-protein ligase (E3), Nedd4. Here, we describe a previously unrecognized functional interaction between N4BP1 and Itch, a Nedd4 structurally related E3, which contains four WW domains, conferring substrate-binding activity. We show that N4BP1 association with the second WW domain (WW2) of Itch interferes with E3 binding to its substrates. In particular, we found that N4BP1 and p73 alpha, a target of Itch-mediated ubiquitin/proteasome proteolysis, share the same binding site. By competing with p73 alpha for binding to the WW2 domain, N4BP1 reduces the ability of Itch to recruit and ubiquitylate p73 alpha and inhibits Itch autoubiquitylation activity both in in vitro and in vivo ubiquitylation assays. Similarly, both c-Jun and p63 polyubiquitylation by Itch are inhibited by N4BP1. As a consequence, genetic and RNAi knockdown of N4BP1 diminish the steady-state protein levels and significantly impair the transcriptional activity of Itch substrates. Notably, stress-induced induction of c-Jun was impaired in N4BP1(-/-) cells. These results demonstrate that N4BP1 functions as a negative regulator of Itch. In addition, because inhibition of Itch by N4BP1 results in the stabilization of crucial cell death regulators such as p73 alpha and c-Jun, it is conceivable that N4BP1 may have a role in regulating tumor progression and the response of cancer cells to chemotherapy.

  16. 14C Analysis of Protein Extracts from Bacillus Spores

    PubMed Central

    Cappucio, Jenny A.; Sarachine Falso, Miranda J.; Kashgarian, Michaele; Buchholz, Bruce A.

    2014-01-01

    Investigators of bioagent incidents or interdicted materials need validated, independent analytical methods that will allow them to distinguish between recently made bioagent samples versus material drawn from the archives of a historical program. Heterotrophic bacteria convert the carbon in their food sources, growth substrate or culture media, into the biomolecules they need. The F14C (fraction modern radiocarbon) of a variety of media, Bacillus spores, and separated proteins from Bacillus spores was measured by accelerator mass spectrometry (AMS). AMS precisely measures F14C values of biological materials and has been used to date the synthesis of biomaterials over the bomb pulse era (1955 to present). The F14C of Bacillus spores reflects the radiocarbon content of the media in which they were grown. In a survey of commercial media we found that the F14C value indicated that carbon sources for the media were alive within about a year of the date of manufacture and generally of terrestrial origin. Hence, bacteria and their products can be dated using their 14C signature. Bacillus spore samples were generated onsite with defined media and carbon free purification and also obtained from archived material. Using mechanical lysis and a variety of washes with carbon free acids and bases, contaminant carbon was removed from soluble proteins to enable accurate 14C bomb-pulse dating. Since media is contemporary, 14C bomb-pulse dating of isolated soluble proteins can be used to distinguish between historical archives of bioagents and those produced from recent media. PMID:24814329

  17. 14C Analysis of protein extracts from Bacillus spores.

    PubMed

    Cappuccio, Jenny A; Falso, Miranda J Sarachine; Kashgarian, Michaele; Buchholz, Bruce A

    2014-07-01

    Investigators of bioagent incidents or interdicted materials need validated, independent analytical methods that will allow them to distinguish between recently made bioagent samples versus material drawn from the archives of a historical program. Heterotrophic bacteria convert the carbon in their food sources, growth substrate or culture media, into the biomolecules they need. The F(14)C (fraction modern radiocarbon) of a variety of media, Bacillus spores, and separated proteins from Bacillus spores was measured by accelerator mass spectrometry (AMS). AMS precisely measures F(14)C values of biological materials and has been used to date the synthesis of biomaterials over the bomb pulse era (1955 to present). The F(14)C of Bacillus spores reflects the radiocarbon content of the media in which they were grown. In a survey of commercial media we found that the F(14)C value indicated that carbon sources for the media were alive within about a year of the date of manufacture and generally of terrestrial origin. Hence, bacteria and their products can be dated using their (14)C signature. Bacillus spore samples were generated onsite with defined media and carbon free purification and also obtained from archived material. Using mechanical lysis and a variety of washes with carbon free acids and bases, contaminant carbon was removed from soluble proteins to enable accurate (14)C bomb-pulse dating. Since media is contemporary, (14)C bomb-pulse dating of isolated soluble proteins can be used to distinguish between historical archives of bioagents and those produced from recent media. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  18. Effects of Hange-shashin-to (TJ-14) and Keishi-ka-shakuyaku-to (TJ-60) on contractile activity of circular smooth muscle of the rat distal colon.

    PubMed

    Kito, Yoshihiko; Teramoto, Noriyoshi

    2012-11-01

    The Japanese Kampo medicines Hange-shashin-to (TJ-14) and Keishi-ka-shakuyaku-to (TJ-60) have been used to treat symptoms of human diarrhea on an empirical basis as Japanese traditional medicines. However, it remains unclear how these drugs affect smooth muscle tissues in the distal colon. The aim of the present study was to investigate the effects of TJ-14 and TJ-60 on the contractile activity of circular smooth muscle from the rat distal colon. TJ-14 and TJ-60 (both 1 mg/ml) inhibited spontaneous contractions of circumferentially cut preparations with the mucosa intact. Blockade of nitric oxide (NO) synthase or soluble guanylate cyclase activity abolished the inhibitory effects of TJ-60 but only attenuated the inhibitory effects of TJ-14. Apamin (1 μM), a blocker of small-conductance Ca(2+)-activated K(+) channels (SK channels), attenuated the inhibitory effects of 5 mg/ml TJ-60 but not those of 5 mg/ml TJ-14. TJ-14 suppressed contractile responses (phasic contractions and off-contractions) evoked by transmural nerve stimulation and increased basal tone, whereas TJ-60 had little effect on these parameters. These results suggest that 1 mg/ml TJ-14 or TJ-60 likely inhibits spontaneous contractions of the rat distal colon through the production of NO. Activation of SK channels seems to be involved in the inhibitory effects of 5 mg/ml TJ-60. Since TJ-14 has potent inhibitory effects on myogenic and neurogenic contractile activity, TJ-14 may be useful in suppressing gastrointestinal motility.

  19. Reconstruction of precipitation variability in the Strait of Yucatan associated with latitudinal shifts in the position of the Intertropical Convergence Zone since the Last Glacial Maximum

    NASA Astrophysics Data System (ADS)

    Staines-Urías, Francisca; Seidenkrantz, Marit-Solveig; Fischel, Andrea; Kuijpers, Antoon

    2017-04-01

    The elemental composition of sediments from gravity core HOLOVAR11-03 provides a ca. 40 ka record of past climate variability in the Strait of Yucatan, between the Caribbean Sea and the Gulf of Mexico, a region where precipitation variability is determined by the seasonal position of the Intertropical Convergence Zone (ITCZ). Within this region, sea level pressure decreases and rainfall increases as the ITCZ moves north of the equator in response to increased solar insolation in the Northern Hemisphere during boreal summer. In contrast, as the ITCZ retracts southward towards the equator during boreal winter, rainfall diminishes and the regional sea level pressure gradient strengthens. On interannual, multidecadal and millennial timescales, fluctuations in the average latitudinal position of the ITCZ in response to insolation forcing modulate the intensity and duration of the seasonal regimens, determining average regional precipitation and, ultimately, the elemental composition of the marine sedimentary record. Regionally, higher titanium and iron content in marine sediments reflect greater terrigenous input from inland runoff, indicating greater precipitation, hence a more northerly position of the ITCZ. Correspondingly, Ti and Fe concentration data were used to reconstruct regional rainfall variability since the Last Glacial Maxima (LGM ˜24 cal ka BP). HOLOVAR11-03 age model (based on 4 AMS 14C dates obtained from multi-specific samples of planktic foraminifera) shows stable sedimentation rates in the area throughout the cored period. Nonetheless, higher terrestrial mineral input is observed since the LGM and all through the last glacial termination (24 to 12 cal ka BP), indicating a period of increased precipitation. In contrast, lower Ti and Fe values are typical for the period between 12 and 8 cal ka BP, indicating reduced precipitation. A positive trend characterizes the following interval, showing a return to wetter conditions lasting until 5 cal ka BP

  20. Geochemistry, radiocarbon ages, and paleorecharge conditions along a transect in the central High Plains aquifer, southwestern Kansas, USA

    USGS Publications Warehouse

    McMahon, P.B.; Böhlke, J.K.; Christenson, S.C.

    2004-01-01

    Water samples from short-screen monitoring wells installed along a 90-km transect in southwestern Kansas were analyzed for major ions, trace elements, isotopes (H, B, C, N, O, S, Sr), and dissolved gases (He, Ne, N2, Ar, O2, CH4) to evaluate the geochemistry, radiocarbon ages, and paleorecharge conditions in the unconfined central High Plains aquifer. The primary reactions controlling water chemistry were dedolomitization, cation exchange, feldspar weathering, and O2 reduction and denitrification. Radiocarbon ages adjusted for C mass transfers ranged from <2.6 ka (14C) B.P. near the water table to 12.8 ± 0.9 ka (14C) B.P. at the base of the aquifer, indicating the unconfined central High Plains aquifer contained a stratified sequence of ground water spanning Holocene time. A cross-sectional model of steady-state ground-water flow, calibrated using radiocarbon ages, is consistent with recharge rates ranging from 0.8 mm/a in areas overlain by loess to 8 mm/a in areas overlain by dune sand. Paleorecharge temperatures ranged from an average of 15.2 ± 0.7 °C for the most recently recharged waters to 11.6 ± 0.4 °C for the oldest waters. The temperature difference between Early and Late Holocene recharge was estimated to be 2.4 ± 0.7 °C, after taking into account variable recharge elevations. Nitrogen isotope data indicate NO3 in paleorecharge (average concentration=193 μM) was derived from a relatively uniform source such as soil N, whereas NO3 in recent recharge (average concentration=885 μM) contained N from varying proportions of fertilizer, manure, and soil N. Deep water samples contained components of N2 derived from atmospheric, denitrification, and deep natural gas sources. Denitrification rates in the aquifer were slow (5 ± 2× 10−3 μmol N L−1 a−1), indicating this process would require >10 ka to reduce the average NO3 concentration in recent recharge to the Holocene background concentration.

  1. Mule/Huwe1/Arf-BP1 suppresses Ras-driven tumorigenesis by preventing c-Myc/Miz1-mediated down-regulation of p21 and p15.

    PubMed

    Inoue, Satoshi; Hao, Zhenyue; Elia, Andrew J; Cescon, David; Zhou, Lily; Silvester, Jennifer; Snow, Bryan; Harris, Isaac S; Sasaki, Masato; Li, Wanda Y; Itsumi, Momoe; Yamamoto, Kazuo; Ueda, Takeshi; Dominguez-Brauer, Carmen; Gorrini, Chiara; Chio, Iok In Christine; Haight, Jillian; You-Ten, Annick; McCracken, Susan; Wakeham, Andrew; Ghazarian, Danny; Penn, Linda J Z; Melino, Gerry; Mak, Tak W

    2013-05-15

    Tumorigenesis results from dysregulation of oncogenes and tumor suppressors that influence cellular proliferation, differentiation, apoptosis, and/or senescence. Many gene products involved in these processes are substrates of the E3 ubiquitin ligase Mule/Huwe1/Arf-BP1 (Mule), but whether Mule acts as an oncogene or tumor suppressor in vivo remains controversial. We generated K14Cre;Mule(flox/flox(y)) (Mule kKO) mice and subjected them to DMBA/PMA-induced skin carcinogenesis, which depends on oncogenic Ras signaling. Mule deficiency resulted in increased penetrance, number, and severity of skin tumors, which could be reversed by concomitant genetic knockout of c-Myc but not by knockout of p53 or p19Arf. Notably, in the absence of Mule, c-Myc/Miz1 transcriptional complexes accumulated, and levels of p21CDKN1A (p21) and p15INK4B (p15) were down-regulated. In vitro, Mule-deficient primary keratinocytes exhibited increased proliferation that could be reversed by Miz1 knockdown. Transfer of Mule-deficient transformed cells to nude mice resulted in enhanced tumor growth that again could be abrogated by Miz1 knockdown. Our data demonstrate in vivo that Mule suppresses Ras-mediated tumorigenesis by preventing an accumulation of c-Myc/Miz1 complexes that mediates p21 and p15 down-regulation.

  2. [C-reactive protein changes with antihypertensive and statin treatment].

    PubMed

    Rodilla, Enrique; Gómez-Belda, Ana; Costa, José A; Aragó, Miriam; Miralles, Amparo; González, Carmen; Pascual, José M

    2005-10-29

    The aim of this study was to evaluate the modifications of high sensitivity C-reactive protein (CRP) with antihypertensive and statin treatment in a hypertensive population with a wide range of coronary risks (CR). Retrospective follow-up study in 665 hypertensive patients: 556 (52% male) without dyslipidemia and CR (Framingham at 10 years) of 8.3 (7.6) as a control group (C) and 109 (61% male) with dyslipidemia and CR of 13.1 (8.8) who were treated with statins (T). Statins treatment was established according to NCEP-ATP-III. In both groups, the antihypertensive treatment was optimized in order to achieve blood pressure (BP) control (< 140/90 mmHg). A lipid profile and high sensitivity CRP (analyzed by nephelometry) was performed at the beginning and at the end of follow up [14.3 (3.6) months]. CRP levels were reduced in the T group -0.17 (0.2) mg/L vs. 0.14 (0.09) mg/L (p = 0.003, Mann-Whitney) in C. The lessening of CRP was not related to the reduction of lipids levels: total cholesterol (r = 0.06; p = 0.49), LDL-C (r = 0.11; p = 0.24), triglycerides (r = -0.02; p = 0.81) (Spearman), or to the reduction of systolic BP (r = -0.07; p = 0.44) and diastolic BP (r = -0.121; p = 0.21). The T group was treated with more antihypertensive drugs than C (2.2 [2.3] vs. 2.5 [1.2]; p = 0.02). Patients treated with ECA inhibitors or angiotensin II antagonist showed a tendency to decreasing the CRP levels more (p = 0.08). In hypertensive populations, statins induce a reduction of CRP levels. The reduction is not related to the lowering of lipids levels or BP values. The effect of statins on the reduction of CRP in hypertensive patients is not related to the lowering of lipids or BP.

  3. BP pledges to cut emissions

    NASA Astrophysics Data System (ADS)

    Showstack, Randy

    British Petroleum (BP), one of the world's biggest oil companies that could become even bigger if a merger with Amoco is approved, announced on September 18 that it will cut its emissions of greenhouse gases by 10% from a 1990 baseline of 40 million tons of carbon dioxide between now and the year 2010.The target, which is double the amount of emissions reductions that industrialized nations agreed to under the Kyoto protocol on climate change, will now stand next to BP's financial targets, said John Browne, group chief executive of BP.

  4. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  5. The build-up, configuration, and dynamical sensitivity of the Eurasian ice-sheet complex to Late Weichselian climatic and oceanic forcing

    NASA Astrophysics Data System (ADS)

    Patton, Henry; Hubbard, Alun; Andreassen, Karin; Winsborrow, Monica; Stroeven, Arjen P.

    2016-12-01

    The Eurasian ice-sheet complex (EISC) was the third largest ice mass during the Last Glacial Maximum (LGM), after the Antarctic and North American ice sheets. Despite its global significance, a comprehensive account of its evolution from independent nucleation centres to its maximum extent is conspicuously lacking. Here, a first-order, thermomechanical model, robustly constrained by empirical evidence, is used to investigate the dynamics of the EISC throughout its build-up to its maximum configuration. The ice flow model is coupled to a reference climate and applied at 10 km spatial resolution across a domain that includes the three main spreading centres of the Celtic, Fennoscandian and Barents Sea ice sheets. The model is forced with the NGRIP palaeo-isotope curve from 37 ka BP onwards and model skill is assessed against collated flowsets, marginal moraines, exposure ages and relative sea-level history. The evolution of the EISC to its LGM configuration was complex and asynchronous; the western, maritime margins of the Fennoscandian and Celtic ice sheets responded rapidly and advanced across their continental shelves by 29 ka BP, yet the maximum aerial extent (5.48 × 106 km2) and volume (7.18 × 106 km3) of the ice complex was attained some 6 ka later at c. 22.7 ka BP. This maximum stand was short-lived as the North Sea and Atlantic margins were already in retreat whilst eastern margins were still advancing up until c. 20 ka BP. High rates of basal erosion are modelled beneath ice streams and outlet glaciers draining the Celtic and Fennoscandian ice sheets with extensive preservation elsewhere due to frozen subglacial conditions, including much of the Barents and Kara seas. Here, and elsewhere across the Norwegian shelf and North Sea, high pressure subglacial conditions would have promoted localised gas hydrate formation.

  6. Dynamic Response of Mycobacterium vanbaalenii PYR-1 to BP Deepwater Horizon Crude Oil

    PubMed Central

    Kim, Seong-Jae; Kweon, Ohgew; Sutherland, John B.; Kim, Hyun-Lee; Jones, Richard C.; Burback, Brian L.; Graves, Steven W.; Psurny, Edward

    2015-01-01

    We investigated the response of the hydrocarbon-degrading Mycobacterium vanbaalenii PYR-1 to crude oil from the BP Deepwater Horizon (DWH) spill, using substrate depletion, genomic, and proteome analyses. M. vanbaalenii PYR-1 cultures were incubated with BP DWH crude oil, and proteomes and degradation of alkanes and polycyclic aromatic hydrocarbons (PAHs) were analyzed at four time points over 30 days. Gas chromatography-mass spectrometry (GC-MS) analysis showed a chain length-dependent pattern of alkane degradation, with C12 and C13 being degraded at the highest rate, although alkanes up to C28 were degraded. Whereas phenanthrene and pyrene were completely degraded, a significantly smaller amount of fluoranthene was degraded. Proteome analysis identified 3,948 proteins, with 876 and 1,859 proteins up- and downregulated, respectively. We observed dynamic changes in protein expression during BP crude oil incubation, including transcriptional factors and transporters potentially involved in adaptation to crude oil. The proteome also provided a molecular basis for the metabolism of the aliphatic and aromatic hydrocarbon components in the BP DWH crude oil, which included upregulation of AlkB alkane hydroxylase and an expression pattern of PAH-metabolizing enzymes different from those in previous proteome expression studies of strain PYR-1 incubated with pure or mixed PAHs, particularly the ring-hydroxylating oxygenase (RHO) responsible for the initial oxidation of aromatic hydrocarbons. Based on these results, a comprehensive cellular response of M. vanbaalenii PYR-1 to BP crude oil was proposed. This study increases our fundamental understanding of the impact of crude oil on the cellular response of bacteria and provides data needed for development of practical bioremediation applications. PMID:25888169

  7. TMEM14C is required for erythroid mitochondrial heme metabolism

    PubMed Central

    Yien, Yvette Y.; Robledo, Raymond F.; Schultz, Iman J.; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E.; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J.; Cooney, Jeffrey D.; Pierce, Eric L.; Mohler, Kyla; Dailey, Tamara A.; Miyata, Non; Kingsley, Paul D.; Garone, Caterina; Hattangadi, Shilpa M.; Huang, Hui; Chen, Wen; Keenan, Ellen M.; Shah, Dhvanit I.; Schlaeger, Thorsten M.; DiMauro, Salvatore; Orkin, Stuart H.; Cantor, Alan B.; Palis, James; Koehler, Carla M.; Lodish, Harvey F.; Kaplan, Jerry; Ward, Diane M.; Dailey, Harry A.; Phillips, John D.; Peters, Luanne L.; Paw, Barry H.

    2014-01-01

    The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias. PMID:25157825

  8. Sediment-palaeosol successions in Calabria and Sardinia suggest spatially differentiated palaeo-vegetation patterns in southern Italy during the Last Glacial period

    NASA Astrophysics Data System (ADS)

    Sauer, Daniela; Zucca, Claudio; Al-Sharif, Riyad; Zwanzig, Lisa; Madrau, Salvatore; Andreucci, Stefano; Pascucci, Vincenzo; Kadereit, Annette; Scarciglia, Fabio; Brückner, Helmut

    2016-04-01

    Several lakes on the southern Italian peninsula provide valuable palaeoenvironmental archives of the Last Glacial period. These archives include, e.g., the long high-resolution record from varved lake sediments of Lago Grande di Monticchio, the bigger one of two maar lakes situated on top of Mt. Vulture. Its pollen record indicates (1) temperate deciduous forest during MIS5.2-MIS5.1 (St. Germain 2); (2) frequent vegetation fluctuations, then Artemisia steppe during MIS5.1-MIS4; (3) alternations between open steppe (stadials) and wooded steppe (interstadials) during MIS3; and (4) open steppe during MIS2 (Last Glacial Maximum). However, only few palaeosol records of this period have been reported from southern Italy in the literature so far. Such records would allow for gaining insight also into spatial patterns of the vegetation cover during this period that should have formed, e.g., according to relief, elevation, and continentality gradient (related to the much lower coastline during the last glacial period). So far, we have studied three sediment-palaeosol successions in southern Italy, two in the Calabria region, and one in north-western Sardinia. All of them have developed in alluvial fan deposits resting on littoral sediments of the Last Interglacial period (MIS 5). The southernmost succession studied is located near Lazzaro (south of Reggio di Calabria). It is exposed in an alluvial fan overlying the MIS5.5 terrace. Due to strong tectonic uplift (1.3 m ka-1) the alluvial fan has been dissected by the same creek which previously had built it up. Therefore, its internal structure is exposed, exhibiting a detailed sediment-palaeosol sequence. The palaeosols are mainly characterized by accumulation of soil organic matter (SOM), bioturbation and secondary carbonates. They represent Chernozem- and Phaeozem-like soils that most likely formed under steppe to forest steppe. SOM of the two uppermost Lazzaro palaeosols was 14C-dated to 26.8-28.8 ka cal BP and 28

  9. Holocene temperature and hydrological changes reconstructed by bacterial 3-hydroxy fatty acids in a stalagmite from central China

    NASA Astrophysics Data System (ADS)

    Wang, Canfa; Bendle, James A.; Zhang, Hongbin; Yang, Yi; Liu, Deng; Huang, Junhua; Cui, Jingwei; Xie, Shucheng

    2018-07-01

    To achieve a sufficient understanding of the spatial dynamics of terrestrial climate variability, new proxies and networks of data that cover thousands of years and run up to the present day are needed. Here we show the first Gram-negative bacterial 3-hydroxy fatty acid (3-OH-FA) based temperature and hydrological records from any paleoclimate archive globally. The data, covering the last 9 ka before present (BP), are generated from an individual stalagmite, collected from Heshang Cave, located on a tributary of the Yangtze River, central China (30°27‧N, 110°25‧E; 294 m). Our results indicate a clear early-to-middle Holocene Climatic Optimum (8.0-6.0 ka BP) followed by a long-term monotonic cooling and increasing variability over the last 0.9 ka BP. The hydrological record shows two relatively long wet periods (8.8-5.9 ka BP and 3.0-0 ka BP) and one relatively dry period (5.9-3.0 ka BP) in central China. We show that 3-OH-FA biomarkers hold promise as independent tools for paleoclimate reconstruction, with the potential to deconvolve temperature and hydrological signals from an individual stalagmite.

  10. Involvement of 4E-BP phosphorylation in embryonic development of the silkworm, Bombyx mori.

    PubMed

    Gu, Shi-Hong; Young, Shun-Chieh; Tsai, Wen-Hsien; Lin, Ju-Ling; Lin, Pei-Ling

    2011-07-01

    Phosphorylation of the translational repressor 4E-binding protein (4E-BP) plays a critical role in regulating the overall translation levels in cells. In the present study, we investigated 4E-BP phosphorylation of Bombyx mori eggs by an immunoblot analysis of a conserved phospho-specific antibody to 4E-BP and demonstrated its role during embryonic development. When HCl treatment was applied to diapause-destined eggs at 20 h after oviposition, a dramatic increase in the phosphorylation of 4E-BP occurred 5 min after treatment with HCl, and high phosphorylation levels were maintained throughout embryonic stage in HCl-treated eggs compared to those in diapause (control) eggs. When HCl treatment was applied to diapause eggs on day 10 after oviposition, no dramatic activation in 4E-BP phosphorylation occurred, indicating stage-specific effects of HCl treatment. In both non-diapause eggs and eggs whose diapause had been terminated by chilling of diapausing eggs at 5°C for 70 days and then were transferred to 25°C, high phosphorylation levels of 4E-BP were also detected. Moreover, 4E-BP phosphorylation dramatically increased when dechorionated eggs were incubated in medium. The addition of rapamycin, a specific inhibitor of mammalian target of rapamycin (TOR) signaling, and LY294002, a phosphoinositide 3-kinase (PI3K) inhibitor, but not the mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase (ERK) kinase (MEK) inhibitor, U0126, dose-dependently inhibited 4E-BP phosphorylation in dechorionated eggs, indicating that PI3K/TOR signaling is an upstream signaling event involved in 4E-BP phosphorylation. Examination of 4E-BP gene expression levels showed no differences between treatments with HCl and water in the first hour after treatment, indicating that changes in phosphorylation of 4E-BP upon HCl treatment are mainly regulated at the post-transcriptional level. In addition, MAPK pathways and glycogen synthase kinase (GSK)-3β phosphorylation were

  11. Late Glacial-Holocene ecostratigraphy of the south-eastern Aegean Sea, based on plankton and pollen assemblages

    NASA Astrophysics Data System (ADS)

    Triantaphyllou, M. V.; Antonarakou, A.; Kouli, K.; Dimiza, M.; Kontakiotis, G.; Papanikolaou, M. D.; Ziveri, P.; Mortyn, P. G.; Lianou, V.; Lykousis, V.; Dermitzakis, M. D.

    2009-08-01

    Quantitative analyses of coccolithophores, planktonic foraminifers, dinoflagellate cysts and pollen assemblages were carried out on shallow (NS-14) and deeper (NS-40) sediment cores from the south-eastern Aegean Sea. Nine coccolithophore (ACE 1-9) and nine planktonic foraminifer (APFE 1-9) ecozones, correlated with dinoflagellate cyst evidence, have been defined for the last ~14.5 cal. ka. Additionally, eight pollen assemblage zones (PAZ 1-8) have been recognised and correlated with the plankton ecozones. Although generally consistent with existing schemes for the central and eastern Mediterranean, the established high-resolution ecostratigraphy has led to an expanded palaeoecological reconstruction of the Late Glacial-Holocene archive in the south-eastern Aegean Sea, defining two warm and humid phases at 9.3-8.6 and 7.6-6.4 cal. ka b.p., associated with the deposition of the early Holocene sapropel S1, and a third one between 5.2 and 4.2 cal. ka b.p. The high sedimentation rates which characterise the study area enabled the detection of even minor and brief climatic events in the Aegean Sea during S1 deposition times. [InlineMediaObject not available: see fulltext.

  12. 14CO2 analysis of soil gas: Evaluation of sample size limits and sampling devices

    NASA Astrophysics Data System (ADS)

    Wotte, Anja; Wischhöfer, Philipp; Wacker, Lukas; Rethemeyer, Janet

    2017-12-01

    Radiocarbon (14C) analysis of CO2 respired from soils or sediments is a valuable tool to identify different carbon sources. The collection and processing of the CO2, however, is challenging and prone to contamination. We thus continuously improve our handling procedures and present a refined method for the collection of even small amounts of CO2 in molecular sieve cartridges (MSCs) for accelerator mass spectrometry 14C analysis. Using a modified vacuum rig and an improved desorption procedure, we were able to increase the CO2 recovery from the MSC (95%) as well as the sample throughput compared to our previous study. By processing series of different sample size, we show that our MSCs can be used for CO2 samples of as small as 50 μg C. The contamination by exogenous carbon determined in these laboratory tests, was less than 2.0 μg C from fossil and less than 3.0 μg C from modern sources. Additionally, we tested two sampling devices for the collection of CO2 samples released from soils or sediments, including a respiration chamber and a depth sampler, which are connected to the MSC. We obtained a very promising, low process blank for the entire CO2 sampling and purification procedure of ∼0.004 F14C (equal to 44,000 yrs BP) and ∼0.003 F14C (equal to 47,000 yrs BP). In contrast to previous studies, we observed no isotopic fractionation towards lighter δ13C values during the passive sampling with the depth samplers.

  13. Appearance of circulating and tissue /sup 14/C-lipids after oral /sup 14/C-tripalmitate administration in the late pregnant rat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Argiles, J.; Herrera, E.

    1989-02-01

    Studies were performed to determine whether and/or how dietary lipids participate in maternal hypertriglyceridemia during late gestation in the rat. After oral administration of glycerol-tri(1-14C)-palmitate, total radioactivity in plasma increased more rapidly in 20-day pregnant rats than in either 19-day pregnant rats or virgin controls. At the peak of plasma radioactivity, four hours after the tracer was administered, most of the plasma label corresponded to 14C-lipids in triglyceride-rich lipoproteins (d less than 1.006), and when expressed per micromol of triglyceride, values were higher in pregnant than in virgin rats. The difference was less after 24 hours, although at this timemore » the level of 14C-lipids in d less than 1.006 lipoproteins was still higher in 20-day pregnant rats than in virgins. Tissue 14C-lipids, as expressed per gram of fresh weight, were similar in pregnant and virgin rats, but the values in mammary glands were much higher in the former group. Estimated recovery of administered radioactivity four hours after tracer in total white adipose tissue, mammary glands, and plasma lipids was higher in pregnant than in virgin rats. No difference was found between 20-day pregnant and virgin rats either in the label retained in the gastrointestinal tract or in that exhaled as 14C-CO2 during the first four hours following oral administration of 14C-tripalmitate. These findings plus the known maternal hyperphagia, indicate that in the rat at late pregnancy triglyceride intestinal absorption is unchanged or even enhanced and that dietary lipids actively contribute to both maternal hypertriglyceridemia and lipid uptake by the mammary gland.« less

  14. Sedimentological analysis and long term chronostratigraphy (> 30 ka) of turbidite record offshore the central Algerian margin

    NASA Astrophysics Data System (ADS)

    Bachir, Roza Si; Babonneau, Nathalie; Cattaneo, Antonio; Ratzov, Gueorgui; Déverchère, Jacques; Yelles, Karim

    2016-04-01

    The Algerian margin is a Cenozoic passive margin located at the diffuse plate boundary between Eurasia and Africa, presently reactivated in compression. It is among the most seismically active areas of the Western Mediterranean and it suffered from numerous devastating earthquakes, for example the El Asnam earthquake in 1980 (Ms = 7.3) and the Boumerdès earthquake in 2003 (Ms = 6.7). A consistent dataset of sediment cores was collected between 2003 and 2007 during the MARADJA and PRISME cruises. Previous work has focused on the Holocene and allowed to highlight a consistent paleosesimological record in the central area of the Algerian margin (Algiers area). The purpose of this work is to extend the sedimentary analysis of turbiditic deposits over longer periods of time (throughout the Last Glacial Maximum), in order to determine whether the record of seismic events is exploitable, or if the impact of climate-driven and eustatic variations is dominant in turbidite triggering and accumulation. A sedimentological and stratigraphic approach was performed on the three most distal sediment cores of the area: PSM-KS21, PSM-KS23 and PSM-KS27. The establishment of an age model is based on radiocarbon dating and measurements of oxygen stable isotopes on planktonic foraminifera collected from the pelagic intervals (hemipelagites) interfingered with the turbidites. A homogeneous clay bed identifiable by its grey colour is a marker to correlate the three cores and it is dated between 18 and 19 ka BP. The PSM-KS23 core has the longest sedimentary record, thus it was used as a reference. Preliminary results show a significant increase in the number and thickness of individual turbidites between 10 and 20 ka BP. The expected results of this work are: 1) to determine whether the number of turbidites is consistent and correlates among the three cores; 2) to assess if the paleo-earthquake signal related to turbidites can be extracted beyond the Holocene; 3) to identify the

  15. Genome-wide profiles of CtBP link metabolism with genome stability and epithelial reprogramming in breast cancer.

    PubMed

    Di, Li-Jun; Byun, Jung S; Wong, Madeline M; Wakano, Clay; Taylor, Tara; Bilke, Sven; Baek, Songjoon; Hunter, Kent; Yang, Howard; Lee, Maxwell; Zvosec, Cecilia; Khramtsova, Galina; Cheng, Fan; Perou, Charles M; Miller, C Ryan; Raab, Rachel; Olopade, Olufunmilayo I; Gardner, Kevin

    2013-01-01

    The C-terminal binding protein (CtBP) is a NADH-dependent transcriptional repressor that links carbohydrate metabolism to epigenetic regulation by recruiting diverse histone-modifying complexes to chromatin. Here global profiling of CtBP in breast cancer cells reveals that it drives epithelial-to-mesenchymal transition, stem cell pathways and genome instability. CtBP expression induces mesenchymal and stem cell-like features, whereas CtBP depletion or caloric restriction reverses gene repression and increases DNA repair. Multiple members of the CtBP-targeted gene network are selectively downregulated in aggressive breast cancer subtypes. Differential expression of CtBP-targeted genes predicts poor clinical outcome in breast cancer patients, and elevated levels of CtBP in patient tumours predict shorter median survival. Finally, both CtBP promoter targeting and gene repression can be reversed by small molecule inhibition. These findings define broad roles for CtBP in breast cancer biology and suggest novel chromatin-based strategies for pharmacologic and metabolic intervention in cancer.

  16. Spaceflight Ka-Band High-Rate Radiation-Hard Modulator

    NASA Technical Reports Server (NTRS)

    Jaso, Jeffery M.

    2011-01-01

    A document discusses the creation of a Ka-band modulator developed specifically for the NASA/GSFC Solar Dynamics Observatory (SDO). This flight design consists of a high-bandwidth, Quadriphase Shift Keying (QPSK) vector modulator with radiation-hardened, high-rate driver circuitry that receives I and Q channel data. The radiationhard design enables SDO fs Ka-band communications downlink system to transmit 130 Mbps (300 Msps after data encoding) of science instrument data to the ground system continuously throughout the mission fs minimum life of five years. The low error vector magnitude (EVM) of the modulator lowers the implementation loss of the transmitter in which it is used, thereby increasing the overall communication system link margin. The modulator comprises a component within the SDO transmitter, and meets the following specifications over a 0 to 40 C operational temperature range: QPSK/OQPSK modulator, 300-Msps symbol rate, 26.5-GHz center frequency, error vector magnitude less than or equal to 10 percent rms, and compliance with the NTIA (National Telecommunications and Information Administration) spectral mask.

  17. A Neanderthal lower molar from Stajnia Cave, Poland.

    PubMed

    Dąbrowski, P; Nowaczewska, W; Stringer, C B; Compton, T; Kruszyński, R; Nadachowski, A; Stefaniak, K; Urbanowski, M

    2013-04-01

    The primary aim of this study was to conduct a taxonomic assessment of the second of three isolated human teeth found in the Stajnia Cave (north of the Carpathians, Poland) in 2008. The specimen was located near a human tooth (S5000), which was identified by Urbanowski et al. (2010) as a Neanderthal permanent upper molar. Both of these teeth were excavated from the D2 layer, which belongs to the D stratigraphic complex comprising the archaeological assemblage associated with the Micoquian tradition. An Ursus spelaeus bone and Mammuthus primigenius tooth that were also excavated from the D2 layer were dated to >49,000 years BP (by AMS (14)C) and 52.9 ka BP (by U-Th), respectively. The sediment overlying stratigraphic complex D was dated to 45.9 ka BP by the OSL method. The S4300 tooth is a lower first or second permanent molar belonging to an individual other than that who once possessed the S5000 tooth. The S4300 tooth exhibits a combination of traits typical of Neanderthal lower molars, including a mid-trigonid crest, large anterior fovea, taurodontism and subvertical grooves on the interproximal face, indicating that this tooth belonged to a Neanderthal individual. The S4300 tooth from Stajnia Cave is one of the oldest human remains found in Poland. Copyright © 2013 Elsevier GmbH. All rights reserved.

  18. Characterization of 14C in Swedish light water reactors.

    PubMed

    Magnusson, Asa; Aronsson, Per-Olof; Lundgren, Klas; Stenström, Kristina

    2008-08-01

    This paper presents the results of a 4-y investigation of 14C in different waste streams of both boiling water reactors (BWRs) and pressurized water reactors (PWRs). Due to the potential impact of 14C on human health, minimizing waste and releases from the nuclear power industry is of considerable interest. The experimental data and conclusions may be implemented to select appropriate waste management strategies and practices at reactor units and disposal facilities. Organic and inorganic 14C in spent ion exchange resins, process water systems, ejector off-gas and replaced steam generator tubes were analyzed using a recently developed extraction method. Separate analysis of the chemical species is of importance in order to model and predict the fate of 14C within process systems as well as in dose calculations for disposal facilities. By combining the results of this investigation with newly calculated production rates, mass balance assessments were made of the 14C originating from production in the coolant. Of the 14C formed in the coolant of BWRs, 0.6-0.8% was found to be accumulated in the ion exchange resins (core-specific production rate in the coolant of a 2,500 MWth BWR calculated to be 580 GBq GW(e)(-1) y(-1)). The corresponding value for PWRs was 6-10% (production rate in a 2,775 MWth PWR calculated to be 350 GBq GW(e)(-1) y(-1)). The 14C released with liquid discharges was found to be insignificant, constituting less than 0.5% of the production in the coolant. The stack releases, routinely measured at the power plants, were found to correspond to 60-155% of the calculated coolant production, with large variations between the BWR units.

  19. RanBP2 modulates Cox11 and hexokinase I activities and haploinsufficiency of RanBP2 causes deficits in glucose metabolism.

    PubMed

    Aslanukov, Azamat; Bhowmick, Reshma; Guruju, Mallikarjuna; Oswald, John; Raz, Dorit; Bush, Ronald A; Sieving, Paul A; Lu, Xinrong; Bock, Cheryl B; Ferreira, Paulo A

    2006-10-01

    The Ran-binding protein 2 (RanBP2) is a large multimodular and pleiotropic protein. Several molecular partners with distinct functions interacting specifically with selective modules of RanBP2 have been identified. Yet, the significance of these interactions with RanBP2 and the genetic and physiological role(s) of RanBP2 in a whole-animal model remain elusive. Here, we report the identification of two novel partners of RanBP2 and a novel physiological role of RanBP2 in a mouse model. RanBP2 associates in vitro and in vivo and colocalizes with the mitochondrial metallochaperone, Cox11, and the pacemaker of glycolysis, hexokinase type I (HKI) via its leucine-rich domain. The leucine-rich domain of RanBP2 also exhibits strong chaperone activity toward intermediate and mature folding species of Cox11 supporting a chaperone role of RanBP2 in the cytosol during Cox11 biogenesis. Cox11 partially colocalizes with HKI, thus supporting additional and distinct roles in cell function. Cox11 is a strong inhibitor of HKI, and RanBP2 suppresses the inhibitory activity of Cox11 over HKI. To probe the physiological role of RanBP2 and its role in HKI function, a mouse model harboring a genetically disrupted RanBP2 locus was generated. RanBP2(-/-) are embryonically lethal, and haploinsufficiency of RanBP2 in an inbred strain causes a pronounced decrease of HKI and ATP levels selectively in the central nervous system. Inbred RanBP2(+/-) mice also exhibit deficits in growth rates and glucose catabolism without impairment of glucose uptake and gluconeogenesis. These phenotypes are accompanied by a decrease in the electrophysiological responses of photosensory and postreceptoral neurons. Hence, RanBP2 and its partners emerge as critical modulators of neuronal HKI, glucose catabolism, energy homeostasis, and targets for metabolic, aging disorders and allied neuropathies.

  20. 14 CFR Appendix C to Part 151 - Appendix C to Part 151

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 14 Aeronautics and Space 3 2014-01-01 2014-01-01 false Appendix C to Part 151 C Appendix C to Part...) AIRPORTS FEDERAL AID TO AIRPORTS Pt. 151, App. C Appendix C to Part 151 There is set forth below an... Items 1. Maintenance-type work, including: (a) Seal coats. (b) Crack filling. (c) Resealing joints. (d...

  1. 14 CFR Appendix C to Part 25 - Appendix C to Part 25

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 14 Aeronautics and Space 1 2014-01-01 2014-01-01 false Appendix C to Part 25 C Appendix C to Part... AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY AIRPLANES Pt. 25, App. C Appendix C to Part 25 Part I—Atmospheric....062 EC28SE91.063 (c) Takeoff maximum icing. The maximum intensity of atmospheric icing conditions for...

  2. 14 CFR Appendix C to Part 25 - Appendix C to Part 25

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 14 Aeronautics and Space 1 2012-01-01 2012-01-01 false Appendix C to Part 25 C Appendix C to Part... AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY AIRPLANES Pt. 25, App. C Appendix C to Part 25 Part I—Atmospheric....062 EC28SE91.063 (c) Takeoff maximum icing. The maximum intensity of atmospheric icing conditions for...

  3. 14 CFR Appendix C to Part 25 - Appendix C to Part 25

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Appendix C to Part 25 C Appendix C to Part... AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY AIRPLANES Pt. 25, App. C Appendix C to Part 25 Part I—Atmospheric....062 EC28SE91.063 (c) Takeoff maximum icing. The maximum intensity of atmospheric icing conditions for...

  4. Arginine: Its pKa value revisited

    PubMed Central

    Fitch, Carolyn A; Platzer, Gerald; Okon, Mark; Garcia-Moreno E, Bertrand; McIntosh, Lawrence P

    2015-01-01

    Using complementary approaches of potentiometry and NMR spectroscopy, we have determined that the equilibrium acid dissociation constant (pKa value) of the arginine guanidinium group is 13.8 ± 0.1. This is substantially higher than that of ∼12 often used in structure-based electrostatics calculations and cited in biochemistry textbooks. The revised intrinsic pKa value helps explains why arginine side chains in proteins are always predominantly charged, even at pH values as great as 10. The high pKa value also reinforces the observation that arginine side chains are invariably protonated under physiological conditions of near neutral pH. This occurs even when the guanidinium moiety is buried in a hydrophobic micro-environment, such as that inside a protein or a lipid membrane, thought to be incompatible with the presence of a charged group. PMID:25808204

  5. A Ka-band chirped-pulse Fourier transform microwave spectrometer

    NASA Astrophysics Data System (ADS)

    Zaleski, Daniel P.; Neill, Justin L.; Muckle, Matt T.; Seifert, Nathan A.; Brandon Carroll, P.; Widicus Weaver, Susanna L.; Pate, Brooks H.

    2012-10-01

    The design and performance of a new chirped-pulse Fourier transform microwave (CP-FTMW) spectrometer operating from 25 to 40 GHz (Ka-band) is presented. This spectrometer is well-suited for the study of complex organic molecules of astronomical interest in the size range of 6-10 atoms that have strong rotational transitions in Ka-band under pulsed jet sample conditions (Trot = 1-10 K). The spectrometer permits acquisition of the full spectral band in a single data acquisition event. Sensitivity is enhanced by using two pulsed jet sources and acquiring 10 broadband measurements for each sample injection cycle. The spectrometer performance is benchmarked by measuring the pure rotational spectrum of several isotopologues of acetaldehyde in natural abundance. The rotational spectra of the singly substituted 13C and 18O isotopologues of the two lowest energy conformers of ethyl formate have been analyzed and the resulting substitution structures for these conformers are compared to electronic structure theory calculations.

  6. Climatic implications of the Quaternary fluvial tufa record in the NE Iberian Peninsula over the last 500 ka

    NASA Astrophysics Data System (ADS)

    Sancho, Carlos; Arenas, Concha; Vázquez-Urbez, Marta; Pardo, Gonzalo; Lozano, María Victoria; Peña-Monné, José Luis; Hellstrom, John; Ortiz, José Eugenio; Osácar, María Cinta; Auqué, Luis; Torres, Trinidad

    2015-11-01

    The drainage area of the Iberian Ranges (NE Spain) houses one of the most extensive Quaternary fluvial tufaceous records in Europe. In this study, tufa deposits in the Añamaza, Mesa, Piedra and Ebrón river valleys were mapped, stratigraphically described and chronologically referenced from U/Th disequilibrium series, amino acid racemization and radiocarbon methods. Tufa deposits accumulated in cascades, barrage-cascades and related damming areas developed in stepped fluvial systems. The maximum frequency of tufa deposition was identified at 120 ka (Marine Oxygen Isotope Stage [MIS] 5e), 102 ka (MIS 5c), 85 ka ( MIS 5a) and 7 ka (MIS 1), probably under warmer and wetter conditions than today. Additional phases of tufa deposition appear at 353 ka ( end of MIS 11), 258-180 ka (MIS 7) and 171-154 ka (MIS 6). Although most tufa deposition episodes are clearly correlated with interstadial periods, the occurrence of tufa deposits during the penultimate glaciation (MIS 6) is remarkable, indicating that the onset of this stage was climatically favourable in the Iberian Peninsula. Biostatic conditions and the dynamics of karstic systems regulating tufa deposition seem to be sensitive to the precipitation regime, controlled by shifts in the position of North Atlantic atmospheric belts, and summer insolation, regulated by orbital forcing.

  7. Biomarker evidence for increasing aridity in south-central India over the Holocene

    NASA Astrophysics Data System (ADS)

    Sarkar, S.; Wilkes, H.; Prasad, S.; Brauer, A.; Basavaiah, N.; Strecker, M. R.; Sachse, D.

    2012-12-01

    Summer monsoonal rainfall has played an important role in the development and sustenance of the largely agro-based economy in the Indian subcontinent in the recent past. A better understanding of past variations in monsoonal rainfall can therefore lead to an assessment of its potential impact on early human societies. However, our knowledge of spatiotemporal patterns of past monsoon strength, as inferred from proxy records, is limited due to the lack of high-resolution paleo-hydrological records from continental archives. Here, we reconstruct centennial-scale hydrological variability associated with changes in the intensity of the Indian Summer Monsoon based on a record of lipid biomarker abundances and compound-specific stable isotopic composition of a 10-m-long sediment core from saline-alkaline Lonar Lake, situated in the core 'monsoon zone' of south-central India. We identified three periods of distinct hydrology over the Holocene in south-central India. The period between 10.4 and 6.5 ka BP was characterized by a relatively high abundance of land-plant biomarkers, such as long-chain n-alkanes. The composition of these leaf-wax n-alkanes (weighted average of concentration of different chain-length n-alkanes, expressed as the ACL index) and their negative δ13C (-30‰ to -33 ‰) indicate the dominance of woody C3 vegetation in the catchment, and negative δD (-170‰ to -175‰) values argue for a wet period due to an intensified monsoon. Rapid fluctuations in abundance of both terrestrial and aquatic biomarkers between 6.5 and 4 ka BP indicate an unstable lake ecosystem, culminating in a transition to arid conditions. Higher ACL values and a pronounced shift to more positive δ13C values (up to -22‰) of leaf-wax n-alkanes over this period indicate a change of dominant vegetation to C4 grasses. Along with a 40‰ increase in leaf wax n-alkane δD values, which likely resulted from less rainfall and/or higher plant evapotranspiration, we interpret this period

  8. Low-level (submicromole) environmental 14C metrology

    NASA Astrophysics Data System (ADS)

    Currie, L. A.; Kessler, J. D.; Marolf, J. V.; McNichol, A. P.; Stuart, D. R.; Donoghue, J. C.; Donahue, D. J.; Burr, G. S.; Biddulph, D.

    2000-10-01

    Accelerator mass spectrometry (AMS) measurements of environmental 14C have been employed during the past decade at the several micromole level (tens of μg carbon), but advanced research in the atmospheric and marine sciences demands still higher (μg) sensitivity, an extreme example being the determination of 14C in elemental or "black" carbon (BC) at levels of 2-10 μg per kg of Greenland snow and ice (Currie et al., 1998). A fundamental limitation for 14C AMS is Poisson counting statistics, which sets in at about 1 μg modern-C. Using the small sample (25 μg) AMS target preparation facility at NOSAMS (Pearson et al., 1998), and the microsample combustion-dilution facility at NIST, we have demonstrated an intrinsic modern-C quantification limit ( mQ) of ca. 0.9 μg, based on a 1-parameter fit to the empirical AMS variance function. (For environmental 14C, the modern carbon quantification limit is defined as that mass ( mQ) corresponding to 10% relative standard deviation (rsd) for the fraction of modern carbon, σ( fM)/ fM.) Stringent control, required for quantitative dilution factors (DL), is achieved with the NIST on-line manometric/mass spectrometry facility that compensates also for unsuspected trace impurities from vigorous chemical processing (e.g., acid digestion). Our current combustion blank is trivial (mean: 0.16 ± 0.02 μg C, n=13) but lognormally distributed (dispersion [σ]: 0.07 ± 0.01 μg). An iterative numerical expression is introduced to assess the quantitative impacts of fossil and modern carbon blank components on mQ; and a new "clean chemistry" BC processing system is described for the minimization of such blanks. For the assay of soot carbon in Greenland snow/ice, the overall processing blank has been reduced from nearly 7 μg total carbon to less than 1 μg, and is undetectable for BC.

  9. NASA SCaN Overview and Ka-Band Actvities

    NASA Technical Reports Server (NTRS)

    Stegeman, James D.; Midon, Marco Mario; Davarian, Faramaz; Geldzahler, Barry

    2014-01-01

    The Ka- and Broadband Communications Conference is an international forum attended by worldwide experts in the area of Ka-Band Propagation and satellite communications. Since its inception, NASA has taken the initiative of organizing and leading technical sections on RF Propagation and satellite communications, solidifying its worldwide leadership in the aforementioned areas. Consequently, participation in this conference through the contributions described below will maintain NASA leadership in Ka- and above RF Propagation as it relates to enhancing current and future satellite communication systems supporting space exploration.

  10. The Small Mammal Sequence from the c. 76 - 72 ka Still Bay Levels at Blombos Cave, South Africa - Taphonomic and Palaeoecological Implications for Human Behaviour.

    PubMed

    Nel, Turid Hillestad; Henshilwood, Christopher Stuart

    2016-01-01

    The Still Bay, c. 76-72 ka, a prominent techno-tradition during the Middle Stone Age of southern Africa, has yielded innovative technologies, symbolic material culture, and shows evidence of expansion of hunting techniques and subsistence strategies. In this paper we present the results of the first systematic, taphonomic and palaeoenvironmental study of micromammals from the Still Bay levels at Blombos Cave. Our taphonomic analysis indicates that the micromammals were accumulated by avian predators occupying the cave. Post-depositional processes affecting the micromammal assemblage include organic waste decomposition and conditions associated with a limestone cave environment. The palaeoenvironmental reconstruction shows that Marine Isotope Stage (MIS) 5a at Blombos Cave had diverse micromammal communities occupying a variety of habitats and with rainfall pattern equal to present. The transition from MIS 5a to 4 is indicated by less diverse micromammal assemblages, increase in grassland and scrub vegetation, shifts in seasonal precipitation, and a decline in shrubs associated with fynbos. The onset of the glacial conditions associated with MIS 4 is visible in the micromammal assemblage. However humans occupying Blombos Cave during this c. 5 ka period showed an ability to cope with changing environmental conditions and were able to adapt and utilise a variety of available resources.

  11. Bomb 14C time history recorded in two modern stalagmites — importance for soil organic matter dynamics and bomb 14C distribution over continents

    NASA Astrophysics Data System (ADS)

    Genty, D.; Vokal, B.; Obelic, B.; Massault, M.

    1998-08-01

    Carbon 14 activity measurements made by Accelerator Mass Spectrometry on two modern stalagmites from the Han-sur-Lesse cave (Belgium) and from the Postojna Cave (Slovenia) permit the construction of 14C activity ( a14C) time series over the last 50 years. A high precision chronology is given by annual laminae in the first stalagmite and by a specific mark (explosion in the Postojna Cave in 1944) in the second one. In both stalagmites, 14C activity increase due to nuclear tests in the atmosphere is remarkable. However, instead of a sharp peak like the one observed in the atmosphere around 1963-1964, the 14C activities of the stalagmite CaCO 3 show an abrupt increase, with an offset of 1-10 years, followed by a high activity plateau for the Han-sur-Lesse sample and a slight decrease for the Postojna sample. For both stalagmites, the variation of the a14C amplitude between pre- and post-bomb period is much lower than the atmospheric record, which demonstrates the damping effect of the soil carbon reservoir. We have modeled the CaCO 3 activities using fractionation processes between atmosphere CO 2, soil CO 2 and organic matter (OM), dissolved inorganic carbon and stalagmite CaCO 3. In both cases studied, the model and former soil studies suggest that CO 2 from soil organic matter (SOM) decomposition, which has a slow turnover (i.e. >1 y), is of major importance in winter, when the development of speleothem is the most important. Combined with the fact that 80-90% of the stalagmite carbon comes from soil CO 2, this produces a damping effect on the speleothem a14C. Consequently, the `geochemical time resolution', at least for speleothem carbon, is much lower than the structural resolution given by annual laminae alternations and is mainly controlled by soil carbon dynamics: a14C and δ 13C are smoothed over several years. Differences between the 14C time series of the Han-sur-Lesse and Postojna stalagmites are likely to be due to the double amount of precipitation in

  12. Changes in northeast Atlantic hydrology during Termination 1: Insights from Celtic margin's benthic foraminifera

    NASA Astrophysics Data System (ADS)

    Mojtahid, M.; Toucanne, S.; Fentimen, R.; Barras, C.; Le Houedec, S.; Soulet, G.; Bourillet, J.-F.; Michel, E.

    2017-11-01

    Using benthic foraminiferal-based proxies in sediments from the Celtic margin, we provide a well-dated record across the last deglaciation of the Channel River dynamics and its potential impact on the hydrology of intermediate water masses along the European margin. Our results describe three main periods: 1) During the Last Glacial Maximum, and before ∼21 ka BP, the predominance of meso-oligotrophic species suggests well oxygenated water masses. After ∼21 ka BP, increasing proportions of eutrophic species related to enhanced riverine supply occurs concomitantly with early warming in Greenland air-temperatures; 2) A thick laminated deposit, occurring during a 1500-years long period of seasonal melting of the European Ice Sheet (EIS), is associated with early Heinrich Stadial 1 period (∼18.2-16.7 ka BP). The benthic proxies describe low salinity episodes, cold temperatures, severe dysoxia and eutrophic conditions on the sea floor, perhaps evidence for cascading of turbid meltwaters; 3) During late HS1 (∼16.7-14.7 ka BP), conditions on the Celtic margin's seafloor changed drastically and faunas indicate oligotrophic conditions as a result of the ceasing of EIS meltwater discharges. While surface waters were cold due to Laurentide Ice Sheet (LIS) icebergs releases, increasing benthic Mg/Ca ratios reveal a progressive warming of intermediate water masses whereas oxygen proxies indicate overall well oxygenated conditions. In addition to the well known effect of EIS meltwaters on surface waters in the Celtic margin, our benthic record documents a pronounced impact on intermediate water depths during HS1, which coincided with major AMOC disruptions.

  13. Accuracy of the WatchBP office ABI device for office blood pressure measurement over a wide range of arm sizes.

    PubMed

    Palatini, Paolo; Fania, Claudio; Gasparotti, Federica

    2018-04-01

    The aim of this study was to determine the accuracy of the WatchBP Office ABI monitor for office blood pressure measurement over a wide range of arm circumferences using the ANSI/AAMI/ISO 81060-2:2013 protocol. The device accuracy was tested in 88 participants whose mean±SD age was 54.5±17.6 years, whose arm circumference was 30.6±8.3 cm (range: 15-46 cm), and whose entry blood pressure (BP) was 138.3±23.4 mmHg for systolic and 83.7±14.6 mmHg for diastolic BP. Four cuffs (small, standard, large, and extra-large) suitable for arm circumferences ranging from 14.0 to 52.0 cm were used. The mean device-observer difference in the 264 separate BP data pairs was 0.7±3.8 mmHg for systolic BP and was 0.0±3.7 mmHg for diastolic BP. These data were in agreement with criterion 1 of the ANSI/AAMI/ISO 81060-2:2013 standard requirements (≤5±8 mmHg). Moreover, criterion 2 was satisfied, the mean±SD device-observer difference of the 88 participants being 0.7±3.1 and 0.0±3.2 mmHg, respectively, for systolic and diastolic BP. Good agreement between observer and device was present across the whole range of arm circumferences. These data show that the Microlife WatchBP Office ABI monitor satisfied the ANSI/AAMI/ISO 81060-2:2013 standard requirements across a wide range of arm sizes.

  14. Multi-Step Ka/Ka Dichroic Plate with Rounded Corners for NASA's 34m Beam Waveguide Antenna

    NASA Technical Reports Server (NTRS)

    Veruttipong, Watt; Khayatian, Behrouz; Hoppe, Daniel; Long, Ezra

    2013-01-01

    A multi-step Ka/Ka dichroic plate Frequency Selective Surface (FSS structure) is designed, manufactured and tested for use in NASA's Deep Space Network (DSN) 34m Beam Waveguide (BWG) antennas. The proposed design allows ease of manufacturing and ability to handle the increased transmit power (reflected off the FSS) of the DSN BWG antennas from 20kW to 100 kW. The dichroic is designed using HFSS and results agree well with measured data considering the manufacturing tolerances that could be achieved on the dichroic.

  15. "Founder crops" v. wild plants: Assessing the plant-based diet of the last hunter-gatherers in southwest Asia

    NASA Astrophysics Data System (ADS)

    Arranz-Otaegui, Amaia; González Carretero, Lara; Roe, Joe; Richter, Tobias

    2018-04-01

    The Natufian culture (c. 14.6-11.5 ka cal. BP) represents the last hunter-gatherer society that inhabited southwest Asia before the development of plant food production. It has long been suggested that Natufians based their economy on the exploitation of the wild ancestors of the Neolithic "founder crops", and that these hunter-gatherers were therefore on the "threshold to agriculture". In this work we review the available data on Natufian plant exploitation and we report new archaeobotanical evidence from Shubayqa 1, a Natufian site located in northeastern Jordan (14.6-11.5 ka cal. BP). Shubayqa 1 has produced an exceptionally large plant assemblage, including direct evidence for the continuous exploitation of club-rush tubers (often regarded as "missing foods") and other wild plants, which were probably used as food, fuel and building materials. Taking together this data we evaluate the composition of archaeobotanical assemblages (plant macroremains) from the Natufian to the Early Pre-Pottery Neolithic B (EPPNB). Natufian assemblages comprise large proportions of non-founder plant species (>90% on average), amongst which sedges, small-seeded grasses and legumes, and fruits and nuts predominate. During the Pre-Pottery Neolithic, in particular the EPPNB, the presence of "founder crops" increases dramatically and constitute up to c. 42% of the archaeobotanical assemblages on average. Our results suggest that plant exploitation strategies during the Natufian were very different from those attested during subsequent Neolithic periods. We argue that historically driven interpretations of the archaeological record have over-emphasized the role of the wild ancestors of domesticated crops previous to the emergence of agriculture.

  16. Composite δ13C and petrographic 195-355 ka record from Frasassi cave (central Italy) stalagmites: investigating drivers of speleothem calcite carbon isotope signals.

    NASA Astrophysics Data System (ADS)

    Vanghi, V.; Borsato, A.; Frisia, S.; Drysdale, R.; Hellstrom, J. C.; Bajo, P.; Montanari, A.

    2016-12-01

    Carbon isotope ratio of speleothem calcite is known to be a proxy for climate-dependent soil CO2 production. One of the paradigms is that, ideally, C stable isotope incorporation occurred in equilibrium. Yet, the process of degassing in the cave commonly results in δ13C values more positive than theoretically expected for speleothems formed in temperate-humid settings. Fabrics then provide the benchmark to unravel local, regional and global significance of speleothem δ13C. The δ13C time-series from two precisely U-Th dated Frasassi stalagmites covering the interval from 195 ka to 355 ka (Marine Isotope Stages 7 - 10) were interpreted on the basis of the sequence of fabrics. Columnar fabrics indicated deposition under constant kinetic fractionation, whereby δ13C shifts through time reflected a combination of atmospheric CO2 concentration changes and soil efficiency variability, controlled by regional mean annual temperature. Given that the δ13C values are constantly more-positive-than-expected because of the effect of degassing, shifts to more positive δ13C values above a baseline of -7 permil during glacials are here interpreted as driven by low soil efficiency and higher contribution of atmospheric CO2 (Breecker et al. 2012, Borsato et al. 2015). The comparison of high resolution δ13C curves with atmospheric pCO2 and benthic δ18O records further suggests that hemispheric temperature changes driven by insolation modulated the δ13C shifts above or below the baseline. Thus, a -3‰ shift from glacial to interglacial at terminations IV and III is here ascribed to changes in atmospheric pCO2 (Schubert and Jahren 2012). More open fabrics mark warmer conditions and increased soil productivity and are associated with more negative δ13C. In conclusion, only by coupling petrography and geochemical properties the global and local drivers of δ13C anomalies in stalagmites from this deep cave could be distinguished. Borsato et al. (2015), Earth Surface Processes and

  17. Divergent homologs of the predicted small RNA BpCand697 in Burkholderia spp.

    NASA Astrophysics Data System (ADS)

    Damiri, Nadzirah; Mohd-Padil, Hirzahida; Firdaus-Raih, Mohd

    2015-09-01

    The small RNA (sRNA) gene candidate, BpCand697 was previously reported to be unique to Burkholderia spp. and is encoded at 3' non-coding region of a putative AraC family transcription regulator gene. This study demonstrates the conservation of BpCand697 sequence across 32 Burkholderia spp. including B. pseudomallei, B. mallei, B. thailandensis and Burkholderia sp. by integrating both sequence homology and secondary structural analyses of BpCand697 within the dataset. The divergent sequence of BpCand697 was also used as a discriminatory power in clustering the dataset according to the potential virulence of Burkholderia spp., showing that B. thailandensis was clearly secluded from the virulent cluster of B. pseudomallei and B. mallei. Finally, the differential co-transcript expression of BpCand697 and its flanking gene, bpsl2391 was detected in Burkholderia pseudomallei D286 after grown under two different culture conditions using nutrient-rich and minimal media. It is hypothesized that the differential expression of BpCand697-bpsl2391 co-transcript between the two standard prepared media might correlate with nutrient availability in the culture media, suggesting that the physical co-localization of BpCand697 in B. pseudomallei D286 might be directly or indirectly involved with the transcript regulation of bpsl2391 under the selected in vitro culture conditions.

  18. Pre-eruptive conditions of dacitic magma erupted during the 21.7 ka Plinian event at Nevado de Toluca volcano, Central Mexico

    NASA Astrophysics Data System (ADS)

    Arce, J. L.; Gardner, J. E.; Macías, J. L.

    2013-01-01

    The Nevado de Toluca volcano in Central Mexico has been active over the last ca. 42 ka, during which tens of km3 of pyroclastic material were erupted and two important Plinian-type eruptions occurred at ca. 21.7 ka (Lower Toluca Pumice: LTP) and ca. 10.5 ka (Upper Toluca Pumice: UTP). Samples from both the LTP and UTP contain plagioclase, amphibole, iron-titanium oxides, and minor anhedral biotite, set in a vesicular, rhyolitic, glassy matrix. In addition, UTP dacites contain orthopyroxene. Analysis of melt inclusions in plagioclase phenocrysts yields H2O contents of 2-3.5 wt.% for LTP and 1.3-3.6 wt.% for UTP samples. Ilmenite-ulvospinel geothermometry yields an average temperature of ~ 868 °C for the LTP magma (hotter than the UTP magma, ~ 842 °C; Arce et al., 2006), whereas amphibole-plagioclase geothermometry yields a temperature of 825-859 °C for the LTP magma. Water-saturated experiments using LTP dacite suggest that: (i) amphibole is stable above 100 MPa and below 900 °C; (ii) plagioclase crystallizes below 250-100 MPa at temperatures of 850-900 °C; and (iii) pyroxene is stable only below pressures of 200-100 MPa and temperatures of 825-900 °C. Comparison of natural and experimental data suggests that the LTP dacitic magma was stored at 150-200 MPa (5.8-7.7 km below the volcano summit). No differences in pressure found between 21.7 ka and 10.5 ka suggest that these two magmas were stored at similar depths. Orthopyroxene produced in lower temperature LTP experiments is compositionally different to those found in UTP natural samples, suggesting that they originated in two different magma batches. Whole-rock chemistry, petrographic features, and mineral compositions suggest that magma mixing was responsible for the generation of the dacitic Plinian LTP eruption.

  19. 48 CFR 931.205-18 - Independent research and development (IR&D) and bid and proposal (B&P) costs.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... development (IR&D) and bid and proposal (B&P) costs. 931.205-18 Section 931.205-18 Federal Acquisition... bid and proposal (B&P) costs. (c)(2) IR&D costs are recoverable under DOE contracts to the extent they... the DOE program. The term “DOE program” encompasses the DOE total mission and its objectives. B&P...

  20. 48 CFR 931.205-18 - Independent research and development (IR&D) and bid and proposal (B&P) costs.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... development (IR&D) and bid and proposal (B&P) costs. 931.205-18 Section 931.205-18 Federal Acquisition... bid and proposal (B&P) costs. (c)(2) IR&D costs are recoverable under DOE contracts to the extent they... the DOE program. The term “DOE program” encompasses the DOE total mission and its objectives. B&P...

  1. 48 CFR 931.205-18 - Independent research and development (IR&D) and bid and proposal (B&P) costs.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... development (IR&D) and bid and proposal (B&P) costs. 931.205-18 Section 931.205-18 Federal Acquisition... bid and proposal (B&P) costs. (c)(2) IR&D costs are recoverable under DOE contracts to the extent they... the DOE program. The term “DOE program” encompasses the DOE total mission and its objectives. B&P...

  2. 48 CFR 931.205-18 - Independent research and development (IR&D) and bid and proposal (B&P) costs.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... development (IR&D) and bid and proposal (B&P) costs. 931.205-18 Section 931.205-18 Federal Acquisition... bid and proposal (B&P) costs. (c)(2) IR&D costs are recoverable under DOE contracts to the extent they... the DOE program. The term “DOE program” encompasses the DOE total mission and its objectives. B&P...

  3. 48 CFR 931.205-18 - Independent research and development (IR&D) and bid and proposal (B&P) costs.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... development (IR&D) and bid and proposal (B&P) costs. 931.205-18 Section 931.205-18 Federal Acquisition... bid and proposal (B&P) costs. (c)(2) IR&D costs are recoverable under DOE contracts to the extent they... the DOE program. The term “DOE program” encompasses the DOE total mission and its objectives. B&P...

  4. Estimating 14C groundwater ages in a methanogenic aquifer

    USGS Publications Warehouse

    Aravena, Ramon; Wassenaar, Leonard I; Plummer, Niel

    1995-01-01

    This paper addresses the problem of 14C age dating of groundwaters in a confined regional aquifer affected by methanogenesis. Increasing CH4 concentrations along the groundwater flow system and 13C and 14C isotopic data for dissolved inorganic carbon, dissolved organic carbon, and CH4 clearly show the effect of methanogenesis on groundwater chemistry. Inverse reaction path modeling using NETPATH indicates the predominant geochemical reactions controlling the chemical evolution of groundwater in the aquifer are incongruent dissolution of dolomite, ion exchange, methanogenesis, and oxidation of sedimentary organic matter. Modeling of groundwater 14C ages using NETPATH indicates that a significant part of groundwater in the Alliston aquifer is less than 13,000 years old; however, older groundwater in the range of 15,000–23,000 years is also present in the aquifer. This paper demonstrates that 14C ages calculated using NETPATH, incorporating the effects of methanogenesis on the carbon pools, provide reasonable groundwater ages that were not possible by other isotopic methods.

  5. Low energy measurements of the 10B(p ,α )7Be reaction

    NASA Astrophysics Data System (ADS)

    Wiescher, M.; deBoer, R. J.; Görres, J.; Azuma, R. E.

    2017-04-01

    previous measurement of the competing 10B(p ,γ )11C reaction, will provide the opportunity for an extensive R -matrix analysis of the rather complex level structure in the 11C compound nucleus system.

  6. The relationship between subcortical brain volume and striatal dopamine D2/3 receptor availability in healthy humans assessed with [11 C]-raclopride and [11 C]-(+)-PHNO PET.

    PubMed

    Caravaggio, Fernando; Ku Chung, Jun; Plitman, Eric; Boileau, Isabelle; Gerretsen, Philip; Kim, Julia; Iwata, Yusuke; Patel, Raihaan; Chakravarty, M Mallar; Remington, Gary; Graff-Guerrero, Ariel

    2017-11-01

    Abnormalities in dopamine (DA) and brain morphology are observed in several neuropsychiatric disorders. However, it is not fully understood how these abnormalities may relate to one another. For such in vivo findings to be used as biomarkers for neuropsychiatric disease, it must be understood how variability in DA relates to brain structure under healthy conditions. We explored how the availability of striatal DA D 2/3 receptors (D 2/3 R) is related to the volume of subcortical brain structures in a sample of healthy humans. Differences in D 2/3 R availability measured with an antagonist radiotracer ([ 11 C]-raclopride) versus an agonist radiotracer ([ 11 C]-(+)-PHNO) were examined. Data from 62 subjects scanned with [ 11 C]-raclopride (mean age = 38.98 ± 14.45; 23 female) and 68 subjects scanned with [ 11 C]-(+)-PHNO (mean age = 38.54 ± 14.59; 25 female) were used. Subcortical volumes were extracted from T1-weighted images using the Multiple Automatically Generated Templates (MAGeT-Brain) algorithm. Partial correlations were used controlling for age, gender, and total brain volume. For [ 11 C]-(+)-PHNO, ventral caudate volumes were positively correlated with BP ND in the dorsal caudate and globus pallidus (GP). Ventral striatum (VS) volumes were positively correlated with BP ND in the VS. With [ 11 C]-raclopride, BP ND in the VS was negatively correlated with subiculum volume of the hippocampus. Moreover, BP ND in the GP was negatively correlated with the volume of the lateral posterior nucleus of the thalamus. Findings are purely exploratory and presented corrected and uncorrected for multiple comparisons. We hope they will help inform the interpretation of future PET studies where concurrent changes in D 2/3 R and brain morphology are observed. Hum Brain Mapp 38:5519-5534, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  7. Analysis of Cry8Ka5-binding proteins from Anthonomus grandis (Coleoptera: Curculionidae) midgut.

    PubMed

    Nakasu, Erich Y T; Firmino, Alexandre A P; Dias, Simoni C; Rocha, Thales L; Ramos, Hudson B; Oliveira, Gustavo R; Lucena, Wagner; Carlini, Célia R; Grossi-de-Sá, Maria Fátima

    2010-07-01

    Biotech crops expressing Bacillus thuringiensis Cry toxins present a valuable approach for insect control. Cry8Ka5, which is highly toxic to the cotton boll weevil (Anthonomus grandis), was used as a model to study toxin-ligand interactions. Three Cry-binding proteins were detected after toxin overlay assays. Following de novo sequencing, a heat-shock cognate protein and a V-ATPase were identified, whilst a approximately 120 kDa protein remained unknown. Additional Cry8Ka5-binding proteins were visualized by two-dimensional gel electrophoresis ligand blots. (c) 2010 Elsevier Inc. All rights reserved.

  8. (14)C, delta(13)C and total C content in soils around a Brazilian PWR nuclear power plant.

    PubMed

    Dias, Cíntia Melazo; Telles, Everaldo C; Santos, Roberto Ventura; Stenström, Kristina; Nícoli, Iêda Gomes; da Silveira Corrêa, Rosangela; Skog, Göran

    2009-04-01

    Nuclear power plants release (14)C during routine operation mainly as airborne gaseous effluents. Because of the long half-life (5730 years) and biological importance of this radionuclide (it is incorporated in plant tissue by photosynthesis), several countries have monitoring programs in order to quantify and control these emissions. This paper compares the activity of (14)C in soils taken within 1km from a Brazilian nuclear power plant with soils taken within a reference area located 50km away from the reactor site. Analyses of total carbon, delta(13)C and (137)Cs were also performed in order to understand the local soil dynamics. Except for one of the profiles, the isotopic composition of soil organic carbon reflected the actual forest vegetation present in both areas. The (137)Cs data show that the soils from the base of hills are probably allocthonous. The (14)C measurements showed that there is no accumulation due to the operation of the nuclear facility, although excess (14)C was found in the litter taken in the area close to power plant. This indicates that the anthropogenic signal observed in the litter fall has not been transferred yet to the soil. This study is part of an extensive research programme in which other samples including air, vegetation and gaseous effluents (taken in the vent stack of the Brazilian nuclear power reactors Angra I and II) were also analyzed. The present paper aimed to evaluate how (14)C emissions from the nuclear power plant are transferred and stored by soils present in the surroundings of the reactor site. This is the first study concerning anthropogenic (14)C in soils in Brazil.

  9. Improving BP control through electronic communications: an economic evaluation.

    PubMed

    Fishman, Paul A; Cook, Andrea J; Anderson, Melissa L; Ralston, James D; Catz, Sheryl L; Carrell, David; Carlson, James; Green, Beverly B

    2013-09-01

    Web-based collaborative approaches to managing chronic illness show promise for both improving health outcomes and increasing the efficiency of the healthcare system. Analyze the cost-effectiveness of the Electronic Communications and Home Blood Pressure Monitoring to Improve Blood Pressure Control (e-BP) study, a randomized controlled trial that used a patient-shared electronic medical record, home blood pressure (BP) monitoring, and web-based pharmacist care to improve BP control (<140/90 mm Hg). Incremental cost-effectiveness analysis conducted from a health plan perspective. Cost-effectiveness of home BP monitoring and web-based pharmacist care estimated for percent change in patients with controlled BP and cost per mm Hg in diastolic and systolic BP relative to usual care and home BP monitoring alone. A 1% improvement in number of patients with controlled BP using home BP monitoring and web-based pharmacist care-the e-BP program-costs $16.65 (95% confidence interval: 15.37- 17.94) relative to home BP monitoring and web training alone. Each mm HG reduction in systolic and diastolic BP achieved through the e-BP program costs $65.29 (59.91-70.67) relativeto home BP monitoring and web tools only. Life expectancy was increased at an incremental cost of $1850 (1635-2064) and $2220 (1745-2694) per year of life saved for men and women, respectively. Web-based collaborative care can be used to achieve BP control at a relatively low cost. Future research should examine the cost impact of potential long-term clinical improvements.

  10. Ran-binding protein 5 (RanBP5) is related to the nuclear transport factor importin-beta but interacts differently with RanBP1.

    PubMed Central

    Deane, R; Schäfer, W; Zimmermann, H P; Mueller, L; Görlich, D; Prehn, S; Ponstingl, H; Bischoff, F R

    1997-01-01

    We report the identification and characterization of a novel 124-kDa Ran binding protein, RanBP5. This protein is related to importin-beta, the key mediator of nuclear localization signal (NLS)-dependent nuclear transport. RanBP5 was identified by two independent methods: it was isolated from HeLa cells by using its interaction with RanGTP in an overlay assay to monitor enrichment, and it was also found by the yeast two-hybrid selection method with RanBP1 as bait. RanBP5 binds to RanBP1 as part of a trimeric RanBP1-Ran-RanBP5 complex. Like importin-beta, RanBP5 strongly binds the GTP-bound form of Ran, stabilizing it against both intrinsic and RanGAP1-induced GTP hydrolysis and also against nucleotide exchange. The GAP resistance of the RanBP5-RanGTP complex can be relieved by RanBP1, which might reflect an in vivo role for RanBP1. RanBP5 is a predominantly cytoplasmic protein that can bind to nuclear pore complexes. We propose that RanBP5 is a mediator of a nucleocytoplasmic transport pathway that is distinct from the importin-alpha-dependent import of proteins with a classical NLS. PMID:9271386

  11. Stromatolite laminae (Lagoa Vermelha, Brasil) as archives for reservoir age changes

    NASA Astrophysics Data System (ADS)

    Bruggmann, Sylvie; Vasconcelos, Crisogono; Hajdas, Irka

    2016-04-01

    As laminated biogenic or abiogenic sedimentary structures [1], stromatolites record environmental changes along growth profiles, revealing possible changes in reservoir ages due to input of older carbon. A modern stromatolite sample was collected in Lagoa Vermelha (100 km east of Rio de Janeiro, Brasil) an area known for upwelling of South Atlantic Central Water (SACW). 34 samples from a transect cutting the lamination were collected with a hand-driller for standard geochemistry and 14C AMS analyses. Shells collected in 2015 were analysed for estimation of the present-day reservoir age. 14C ages of laminae and the reservoir age were used to apply the age-depth model to the stromatolite transect with the OxCal depositional model (Marine13 calibration curve; [2]). Small-scale changes in the composition of laminae report environmental changes, e.g. upwelling. The well-laminated middle part (laminated boundstone; ca. 4cm) of the stromatolite transect was found to have grown in a short time period of less than 100 years (1163-1210 14C y BP), with four excursions towards older 14C ages (ca. 1200 14C y BP). To detect possible changes of marine 14C, calendar years assuming a stable modern reservoir age were used to simulate atmospheric 14C ages with the southern hemisphere IntCal13 atmospheric calibration curve [3]. The offset between the measured and simulated 14C ages indicates a variability of the reservoir age between -99 and 268 14C y with highest reservoir correction found for the layers with indication of environmental changes (e.g. upwelling). Thus, this simulation confirms the occurrence of older carbon and points out the sensitivity of stromatolites for changing reservoir ages. [1] M.A. Semikhatov, C.D. Gebelein, P. Cloud, S.M. Awramik, W.C. Benmore (1979). Stromatolite morphogenesis - progress and problems. Canadian Journal of Earth Sciences, 19:992-1015. [2] P.J. Reimer, E. Bard, A. Bayliss, J. W. Beck, P. G. Blackwell, C. Bronk Ramsey, C. E. Buck, H. Cheng, R

  12. Structural basis for the differential effects of CaBP1 and calmodulin on Ca(V)1.2 calcium-dependent inactivation.

    PubMed

    Findeisen, Felix; Minor, Daniel L

    2010-12-08

    Calcium-binding protein 1 (CaBP1), a calmodulin (CaM) homolog, endows certain voltage-gated calcium channels (Ca(V)s) with unusual properties. CaBP1 inhibits Ca(V)1.2 calcium-dependent inactivation (CDI) and introduces calcium-dependent facilitation (CDF). Here, we show that the ability of CaBP1 to inhibit Ca(V)1.2 CDI and induce CDF arises from interaction between the CaBP1 N-lobe and interlobe linker residue Glu94. Unlike CaM, where functional EF hands are essential for channel modulation, CDI inhibition does not require functional CaBP1 EF hands. Furthermore, CaBP1-mediated CDF has different molecular requirements than CaM-mediated CDF. Overall, the data show that CaBP1 comprises two structural modules having separate functions: similar to CaM, the CaBP1 C-lobe serves as a high-affinity anchor that binds the Ca(V)1.2 IQ domain at a site that overlaps with the Ca²+/CaM C-lobe site, whereas the N-lobe/linker module houses the elements required for channel modulation. Discovery of this division provides the framework for understanding how CaBP1 regulates Ca(V)s. Copyright © 2010 Elsevier Ltd. All rights reserved.

  13. Structural basis for the differential effects of CaBP1 and calmodulin on CaV1.2 calcium-dependent inactivation

    PubMed Central

    Findeisen, Felix; Minor, Daniel L.

    2010-01-01

    Calcium-binding protein 1 (CaBP1), a calmodulin (CaM) homolog, endows certain voltage-gated calcium channels (CaVs) with unusual properties. CaBP1 inhibits CaV1.2 calcium-dependent inactivation (CDI) and introduces calcium-dependent facilitation (CDF). Here, we show that the ability of CaBP1 to inhibit CaV1.2 CDI and induce CDF arises from interaction between the CaBP1 N-lobe and interlobe linker residue Glu94. Unlike CaM, where functional EF hands are essential for channel modulation, CDI inhibition does not require functional CaBP1 EF-hands. Furthermore, CaBP1-mediated CDF has different molecular requirements than CaM-mediated CDF. Overall, the data show that CaBP1 comprises two structural modules having separate functions: similar to CaM, the CaBP1 C-lobe serves as a high-affinity anchor that binds the CaV1.2 IQ domain at a site that overlaps with the Ca2+/CaM C-lobe site, whereas the N-lobe/linker module houses the elements required for channel modulation. Discovery of this division provides the framework for understanding how CaBP1 regulates CaVs. PMID:21134641

  14. Mutations in ARL2BP, Encoding ADP-Ribosylation-Factor-Like 2 Binding Protein, Cause Autosomal-Recessive Retinitis Pigmentosa

    PubMed Central

    Davidson, Alice E.; Schwarz, Nele; Zelinger, Lina; Stern-Schneider, Gabriele; Shoemark, Amelia; Spitzbarth, Benjamin; Gross, Menachem; Laxer, Uri; Sosna, Jacob; Sergouniotis, Panagiotis I.; Waseem, Naushin H.; Wilson, Robert; Kahn, Richard A.; Plagnol, Vincent; Wolfrum, Uwe; Banin, Eyal; Hardcastle, Alison J.; Cheetham, Michael E.; Sharon, Dror; Webster, Andrew R.

    2013-01-01

    Retinitis pigmentosa (RP) is a genetically heterogeneous retinal degeneration characterized by photoreceptor death, which results in visual failure. Here, we used a combination of homozygosity mapping and exome sequencing to identify mutations in ARL2BP, which encodes an effector protein of the small GTPases ARL2 and ARL3, as causative for autosomal-recessive RP (RP66). In a family affected by RP and situs inversus, a homozygous, splice-acceptor mutation, c.101−1G>C, which alters pre-mRNA splicing of ARLBP2 in blood RNA, was identified. In another family, a homozygous c.134T>G (p.Met45Arg) mutation was identified. In the mouse retina, ARL2BP localized to the basal body and cilium-associated centriole of photoreceptors and the periciliary extension of the inner segment. Depletion of ARL2BP caused cilia shortening. Moreover, depletion of ARL2, but not ARL3, caused displacement of ARL2BP from the basal body, suggesting that ARL2 is vital for recruiting or anchoring ARL2BP at the base of the cilium. This hypothesis is supported by the finding that the p.Met45Arg amino acid substitution reduced binding to ARL2 and caused the loss of ARL2BP localization at the basal body in ciliated nasal epithelial cells. These data demonstrate a role for ARL2BP and ARL2 in primary cilia function and that this role is essential for normal photoreceptor maintenance and function. PMID:23849777

  15. Coastal eolian sand-ramp development related to paleo-sea-level changes during the Latest Pleistocene and Holocene (21–0 ka) in San Miguel Island, California, U.S.A.

    USGS Publications Warehouse

    Peterson, Curt D.; Erlandson, Jon M.; Stock, Errol; Hostetler, Steven W.; Price, David M.

    2017-01-01

    Coastal eolian sand ramps (5–130 m elevation) on the northern slope (windward) side of the small San Miguel Island (13 km in W-E length) range in age from late Pleistocene to modern time, though a major hiatus in sand-ramp growth occurred during the early Holocene marine transgression (16–9 ka). The Holocene sand ramps (1–5 m measured thicknesses) currently lack large dune forms, thereby representing deflated erosional remnants, locally covering thicker late Pleistocene sand-ramp deposits. The ramp sand was initially supplied from the adjacent island-shelf platform, extending about 20 km north of the present coastline. The sand-ramp deposits and interbedded loess soils were 14C dated using 112 samples from 32 archaeological sites and other geologic sections. Latest Pleistocene sand ramps (66–18 ka) were derived from across-shelf eolian sand transport during marine low stands. Shoreward wave transport supplied remobilized late Pleistocene sand from the inner shelf to Holocene beaches, where dominant NW winds supplied sand to the sand ramps. The onset dates of the sand-ramp deposition in San Miguel are 7.2 ± 1.5 ka (sample n = 14). The internal strata dates in the vertically accreting sand ramps are 3.4 ± 1.7 ka (n = 34). The sand ramps in San Miguel show wide-scale termination of sand supply in the latest Holocene time. The sand-ramp top dates or burial dates are 1.7 ± 0.9 ka (n = 28). The latest Holocene sand ramps are truncated along most of the island's northern coastline, indicating recent losses of nearshore sand reserves to onshore, alongshore, and, possibly, offshore sand sinks. The truncated sand ramps in San Miguel Island and in other sand-depleted marine coastlines provide warnings about future beach erosion and/or shoreline retreat from accelerated sea-level rise accompanying predicted global warming.

  16. Capture reactions on C-14 in nonstandard big bang nucleosynthesis

    NASA Technical Reports Server (NTRS)

    Wiescher, Michael; Gorres, Joachim; Thielemann, Friedrich-Karl

    1990-01-01

    Nonstandard big bang nucleosynthesis leads to the production of C-14. The further reaction path depends on the depletion of C-14 by either photon, alpha, or neutron capture reactions. The nucleus C-14 is of particular importance in these scenarios because it forms a bottleneck for the production of heavier nuclei A greater than 14. The reaction rates of all three capture reactions at big bang conditions are discussed, and it is shown that the resulting reaction path, leading to the production of heavier elements, is dominated by the (p, gamma) and (n, gamma) rates, contrary to earlier suggestions.

  17. Impact of liming and drying municipal sewage sludge on the amount and availability of (14)C-acetyl sulfamethoxazole and (14)C-acetaminophen residues.

    PubMed

    Geng, Chunnu; Bergheaud, Valérie; Garnier, Patricia; Zhu, Yong-Guan; Haudin, Claire-Sophie

    2016-01-01

    Acetyl Sulfamethoxazole (AC-SMX) and acetaminophen (ACM) can be found in municipal sewage sludge, and their content and availability may be influenced by sludge treatments, such as drying and liming. A sludge similarly centrifuged with/without a flocculant was spiked with (14)C-labelled AC-SMX or ACM. Then, it was either limed (20% CaO) or/and dried under different laboratory conditions (1 week at ambient temperature; and 48 h at 40 or 80 °C). The total amount and distribution of the (14)C-compounds among several chemical fractions, based on the sludge floc definition, were assessed at the end of the treatments. All the (14)C-activity brought initially was recovered in the limed and/or dried sludges for AC-SMX but only between 44.4 and 84.9% for ACM, with the highest rate obtained for the limed sludge. Drying at 80 °C or liming increased the percentage of the sludge total organic carbon recovered in the extracts containing soluble extracellular polymeric substances (S-EPS) and the percentage of the total (14)C-activity extracted simultaneously. The non-extractable residues represented only 3.9-11.6% of the total (14)C-activity measured in the treated sludges for AC-SMX and 16.9-21.8% for ACM. The presence of AC-SMX and ACM residues in the treated sludges, after liming and drying under different conditions, was shown using some (14)C-labelled molecules. At this time scale and according to the extraction method selected, most of the (14)C-residues remained soluble and easily extractable for both compounds. This result implies that certain precautions should be taken when storing sludges before being spread on the field. Sludge piles, particularly the limed sludge, should be protected from rain to limit the production of lixiviates, which may contain residues of AC-SMX and ACM. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Tunneling in BP-MoS2 heterostructure

    NASA Astrophysics Data System (ADS)

    Liu, Xiaochi; Qu, Deshun; Kim, Changsik; Ahmed, Faisal; Yoo, Won Jong

    Tunnel field effect transistor (TFET) is considered to be a leading option for achieving SS <60 mV/dec. In this work, black phosphorus (BP) and molybdenum disulfide (MoS2) heterojunction devices are fabricated. We find that thin BP flake and MoS2 form normal p-n junctions, tunneling phenomena can be observed when BP thickness increases to certain level. PEO:CsClO4 is applied on the surface of the device together with a side gate electrode patterned together with source and drain electrodes. The Fermi level of MoS2 on top of BP layer can be modulated by the side gating, and this enables to vary the MoS2-BP tunnel diode property from off-state to on-state. Since tunneling is the working mechanism of MoS2-BP junction, and PEO:CsClO4\\ possesses ultra high dielectric constant and small equivalent oxide thickness (EOT), a low SS of 55 mV/dec is obtained from MoS2-BP TFET. This work was supported by the Global Research Laboratory and Global Frontier R&D Programs at the Center for Hybrid Interface Materials, both funded by the Ministry of Science, ICT & Future Planning via the National Research Foundation of Korea (NRF).

  19. Holocene fire activity and vegetation response in South-Eastern Iberia

    NASA Astrophysics Data System (ADS)

    Gil-Romera, Graciela; Carrión, José S.; Pausas, Juli G.; Sevilla-Callejo, Miguel; Lamb, Henry F.; Fernández, Santiago; Burjachs, Francesc

    2010-05-01

    Since fire has been recognized as an essential disturbance in Mediterranean landscapes, the study of long-term fire ecology has developed rapidly. We have reconstructed a sequence of vegetation dynamics and fire changes across south-eastern Iberia by coupling records of climate, fire, vegetation and human activities. We calculated fire activity anomalies (FAAs) in relation to 3 ka cal BP for 10-8 ka cal BP, 6 ka cal BP, 4 ka cal BP and the present. For most of the Early to the Mid-Holocene uneven, but low fire events were the main vegetation driver at high altitudes where broadleaved and coniferous trees presented a highly dynamic post-fire response. At mid-altitudes in the mainland Segura Mountains, fire activity remained relatively stable, at similar levels to recent times. We hypothesize that coastal areas, both mountains and lowlands, were more fire-prone landscapes as biomass was more likely to have accumulated than in the inland regions, triggering regular fire events. The wet and warm phase towards the Mid-Holocene (between ca 8 and 6 ka cal BP) affected the whole region and promoted the spread of mesophytic forest co-existing with Pinus, as FAAs appear strongly negative at 6 ka cal BP, with a less important role of fire. Mid and Late Holocene landscapes were shaped by an increasing aridity trend and the rise of human occupation, especially in the coastal mountains where forest disappeared from ca 2 ka cal BP. Mediterranean-type vegetation (evergreen oaks and Pinus pinaster- halepensis types) showed the fastest post-fire vegetation dynamics over time.

  20. Mars Global Surveyor Ka-Band Frequency Data Analysis

    NASA Astrophysics Data System (ADS)

    Morabito, D.; Butman, S.; Shambayati, S.

    2000-01-01

    The Mars Global Surveyor (MGS) spacecraft, launched on November 7, 1996, carries an experimental space-to-ground telecommunications link at Ka-band (32 GHz) along with the primary X-band (8.4 GHz) downlink. The signals are simultaneously transmitted from a 1.5-in diameter parabolic high gain antenna (HGA) on MGS and received by a beam-waveguide (BWG) R&D 34-meter antenna located in NASA's Goldstone Deep Space Network (DSN) complex near Barstow, California. The projected 5-dB link advantage of Ka-band relative to X-band was confirmed in previous reports using measurements of MGS signal strength data acquired during the first two years of the link experiment from December 1996 to December 1998. Analysis of X-band and Ka-band frequency data and difference frequency (fx-fka)/3.8 data will be presented here. On board the spacecraft, a low-power sample of the X-band downlink from the transponder is upconverted to 32 GHz, the Ka-band frequency, amplified to I-W using a Solid State Power Amplifier, and radiated from the dual X/Ka HGA. The X-band signal is amplified by one of two 25 W TWTAs. An upconverter first downconverts the 8.42 GHz X-band signal to 8 GHz and then multiplies using a X4 multiplier producing the 32 GHz Ka-band frequency. The frequency source selection is performed by an RF switch which can be commanded to select a VCO (Voltage Controlled Oscillator) or USO (Ultra-Stable Oscillator) reference. The Ka-band frequency can be either coherent with the X-band downlink reference or a hybrid combination of the USO and VCO derived frequencies. The data in this study were chosen such that the Ka-band signal is purely coherent with the X-band signal, that is the downconverter is driven by the same frequency source as the X-band downlink). The ground station used to acquire the data is DSS-13, a 34-meter BWG antenna which incorporates a series of mirrors inside beam waveguide tubes which guide the energy to a subterranean pedestal room, providing a stable environment

  1. Unifying tephrostratigraphic approaches to redefine major Holocene marker tephras, Mt. Taranaki, New Zealand

    NASA Astrophysics Data System (ADS)

    Damaschke, M.; Cronin, S. J.; Torres-Orozco, R.; Wallace, R. C.

    2017-05-01

    In this study, geochemical fingerprinting of glass shards and titanomagnetite phenocrysts was used to match twenty complex pyroclastic deposits from the flanks of Mt. Taranaki to major tephra fall ;marker beds; in medial and distal deposition sites. These correlations hinged upon identifying time-bound compositional changes (a chemostratigraphy) in distal Taranaki tephra-fall sequences preserved in lake and peat sediment records around the volcano. The current work shows that previous soil-stratigraphy based studies led to miscorrelations, because they relied upon radiocarbon dates, a ;counting back; approach, and an underestimate of the number of eruptions that actually occurred in any time frame. The new tephrostratigraphy proposed at Mt. Taranaki resulted from stratigraphic rearranging of several earlier-defined units. Some tephra units are older than previously determined (e.g., Waipuku, Tariki, and Mangatoki; 6 to 9 cal ka BP), while one of the most prominent Taranaki marker tephra deposit, the Korito, is shown to lie stratigraphically above a widespread rhyolitic marker bed from Taupo volcano, the Stent Tephra (also known as unit Q; 4.3 cal ka BP). Pyroclastic tephra deposits previously dated between 6 to 4 cal ka BP at a key tephra section, c. 40 km NE of Mt. Taranaki's summit, were misidentified and are now shown to comprise new marker tephra deposits, including the Kokowai ( 4.7 cal ka BP), which is a prominent marker horizon on the eastern flanks of the volcano. A new local proximal stratigraphy for < 5 cal ka BP tephra units can be well correlated to tephra layers within distal lake and peat sequences, but the differences between the two records indicates an overall larger number of eruptions have occurred at this volcano than previously thought. This study additionally demonstrates the utility of titanomagnetite chemistry for discrimination and correlation of groups or sequences of tephra deposits - even if unique compositions cannot be identified.

  2. Ku/Ka band observations over polar ice sheets

    NASA Astrophysics Data System (ADS)

    Thibaut, Pierre; Lasne, Yannick; Guillot, Amandine; Picot, Nicolas; Rémy, Frédérique

    2015-04-01

    For the first time, comparisons between Ku and Ka altimeter measurements are possible thanks to the new AltiKa instrument embarked onboard the Saral mission launched on February 25, 2013. This comparison is of particular interest when dealing with ice sheet observations because both frequencies have different penetration characteristics. We propose in this paper to revisit the estimation of the ice sheet topography (and other related parameters) with altimeter systems and to present illustrations of the differences observed in Ku and Ka bands using AltiKa, Envisat/RA-2 but also Cryosat-2 measurements. Working on AltiKa waveforms in the frame of the PEACHI project has allowed us to better understand the impact of the penetration depth on the echo shape, to improve the estimation algorithm and to compare its output with historical results obtained on Envisat and ERS missions. In particular, analyses at cross-overs of the Cryosat-2 and Saral data will be presented. Sentinel-3 mission should be launch during 2015. Operating in Ku band and in delay/doppler mode, it will be crucial to account for penetration effects in order to accurately derive the ice sheet heights and trends. The results of the work presented here, will benefit to the Sentinel-3 mission.

  3. 14 CFR Appendix C to Part 43 - [Reserved

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 14 Aeronautics and Space 1 2012-01-01 2012-01-01 false [Reserved] C Appendix C to Part 43 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT MAINTENANCE, PREVENTIVE MAINTENANCE, REBUILDING, AND ALTERATION Appendix C to Part 43 [Reserved] ...

  4. 14 CFR Appendix C to Part 43 - [Reserved

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 14 Aeronautics and Space 1 2014-01-01 2014-01-01 false [Reserved] C Appendix C to Part 43 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT MAINTENANCE, PREVENTIVE MAINTENANCE, REBUILDING, AND ALTERATION Appendix C to Part 43 [Reserved] ...

  5. 14 CFR Appendix C to Part 43 - [Reserved

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false [Reserved] C Appendix C to Part 43 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT MAINTENANCE, PREVENTIVE MAINTENANCE, REBUILDING, AND ALTERATION Appendix C to Part 43 [Reserved] ...

  6. 40 CFR 721.10007 - Alcohols, C12-14-secondary, ethoxylated propoxylated.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Alcohols, C12-14-secondary... New Uses for Specific Chemical Substances § 721.10007 Alcohols, C12-14-secondary, ethoxylated... identified as alcohols, C12-14- secondary, ethoxylated propoxylated (PMN P-00-11; CAS No. 103331-86-8) is...

  7. Chemical Characterization and Removal of C-14 from Irradiated Graphite-12010

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cleaver, James; McCrory, Shilo; Smith, Tara E.

    2012-07-01

    Quantities of irradiated graphite waste are expected to drastically increase, which indicates the need for a graphite waste management strategy. Of greatest concern for long-term disposal of irradiated graphite is carbon-14 (C-14), with a half-life of 5730 years. Study of irradiated graphite from nuclear reactors indicates C-14 is concentrated on the outer 5 mm of the graphite structure. The aim of the research described here is to identify the chemical form of C-14 in irradiated graphite and develop a practical method by which C-14 can be removed. Characterization of pre- and post-irradiation graphite was conducted to determine bond type, functionalmore » groups, location and concentration of C-14 and its precursors via the use of surface sensitive characterization techniques. Because most surface C-14 originates from neutron activation of nitrogen, an understanding of nitrogen bonding to graphite may lead to a greater understanding of the formation pathway of C-14. However, no single technique provides a complete picture. Therefore, a portfolio of techniques has been developed, with each technique providing another piece to the puzzle that is the chemical nature of the C-14. Scanning Electron Microscopy (SEM), X-Ray Diffraction (XRD), and Raman Spectroscopy were used to evaluate the morphological features of graphite samples. The concentration, chemical composition, and bonding characteristics of C-14 and its precursors were determined through X-ray Photoelectron Spectroscopy (XPS), Time-of-Flight Secondary Ion Mass Spectrometry (SIMS), and Auger and Energy Dispersive X-ray Analysis Spectroscopy (EDX). High-surface-area graphite foam, POCOFoam{sup R}, was exposed to liquid nitrogen and irradiated. Characterization of this material has shown C-14 to C-12 ratios of 0.035. This information was used to optimize the thermal treatment of graphite. Thermal treatment of irradiated graphite as reported by Fachinger et al. (2007) uses naturally adsorbed oxygen complexes

  8. Paleoclimate in continental northwestern Europe during the Eemian and early Weichselian (125-97 ka): insights from a Belgian speleothem

    NASA Astrophysics Data System (ADS)

    Vansteenberge, Stef; Verheyden, Sophie; Cheng, Hai; Edwards, R. Lawrence; Keppens, Eddy; Claeys, Philippe

    2016-07-01

    The last interglacial serves as an excellent time interval for studying climate dynamics during past warm periods. Speleothems have been successfully used for reconstructing the paleoclimate of last interglacial continental Europe. However, all previously investigated speleothems are restricted to southern Europe or the Alps, leaving large parts of northwestern Europe undocumented. To better understand regional climate changes over the past, a larger spatial coverage of European last interglacial continental records is essential, and speleothems, because of their ability to obtain excellent chronologies, can provide a major contribution. Here, we present new, high-resolution data from a stalagmite (Han-9) obtained from the Han-sur-Lesse Cave in Belgium. Han-9 formed between 125.3 and ˜ 97 ka, with interruptions of growth occurring at 117.3-112.9 and 106.6-103.6 ka. The speleothem was investigated for its growth, morphology and stable isotope (δ13C and δ18O) composition. The speleothem started growing relatively late within the last interglacial, at 125.3 ka, as other European continental archives suggest that Eemian optimum conditions were already present during that time. It appears that the initiation of Han-9 growth is caused by an increase in moisture availability, linked to wetter conditions around 125.3 ka. The δ13C and δ18O proxies indicate a period of relatively stable conditions after 125.3 ka; however, at 120 ka the speleothem δ18O registered the first signs of regionally changing climate conditions, being a modification of ocean source δ18O linked to an increase in ice volume towards the Marine Isotope Stage (MIS) 5e-5d transition. At 117.5 ka, drastic vegetation changes are recorded by Han-9 δ13C immediately followed by a cessation of speleothem growth at 117.3 ka, suggesting a transition to significantly dryer conditions. The Han-9 record covering the early Weichselian displays larger amplitudes in both isotope proxies and changes in stalagmite

  9. Millennial-scale variability to 735 ka: High-resolution climate records from Santa Barbara Basin, CA

    NASA Astrophysics Data System (ADS)

    White, Sarah M.; Hill, Tessa M.; Kennett, James P.; Behl, Richard J.; Nicholson, Craig

    2013-06-01

    Determining the ultimate cause and effect of millennial-scale climate variability remains an outstanding problem in paleoceanography, partly due to the lack of high-resolution records predating the last glaciation. Recent cores from Santa Barbara Basin provide 2500-5700 year "windows" of climate with 10-50 year resolution. Ages for three cores, determined by seismic stratigraphic correlation, oxygen isotope stratigraphy, and biostratigraphy, date to 293 ka (MIS 8), 450 ka (MIS 12), and 735 ka (MIS 18). These records sample the Late Pleistocene, during which the 100 kyr cycle strengthened and the magnitude of glacial-interglacial cyclicity increased. Thus, these records provide a test of the dependence of millennial-scale behavior on variations in glacial-interglacial cyclicity. The stable isotopic (δ18O) composition of planktonic foraminifera shows millennial-scale variability in all three intervals, with similar characteristics (duration, cyclicity) to those previously documented during MIS 3 at this site. Stadial G. bulloides δ18O values are 2.75-1.75‰ (average 2.25‰) and interstadial values are 1.75-0.5‰ (average 1‰), with rapid (decadal-scale) interstadial and stadial initiations of 1-2‰, as in MIS 3. Interstadials lasted 250-1600 years and occurred every 650-1900 years. Stadial paleotemperatures were 3.5-9.5°C and interstadial paleotemperatures were 7.5-13°C. Upwelling, evidenced by planktonic foraminiferal assemblages and δ13C, increased during interstadials, similar to MIS 3; high productivity during some stadials was reminiscent of the Last Glacial Maximum. This study builds upon previous records in showing that millennial-scale shifts were an inherent feature of Northern Hemisphere glacial climates since 735 ka, and they remained remarkably constant in the details of their amplitude, cyclicity, and temperature variability.

  10. Interaction with Cyclin H/Cyclin-dependent Kinase 7 (CCNH/CDK7) Stabilizes C-terminal Binding Protein 2 (CtBP2) and Promotes Cancer Cell Migration*

    PubMed Central

    Wang, Yuchan; Liu, Fang; Mao, Feng; Hang, Qinlei; Huang, Xiaodong; He, Song; Wang, Yingying; Cheng, Chun; Wang, Huijie; Xu, Guangfei; Zhang, Tianyi; Shen, Aiguo

    2013-01-01

    CtBP2 has been demonstrated to possess tumor-promoting capacities by virtue of up-regulating epithelial-mesenchymal transition (EMT) and down-regulating apoptosis in cancer cells. As a result, cellular CtBP2 levels are considered a key factor determining the outcome of oncogenic transformation. How pro-tumorigenic and anti-tumorigenic factors compete for fine-tuning CtBP2 levels is incompletely understood. Here we report that the cyclin H/cyclin-dependent kinase 7 (CCNH/CDK7) complex interacted with CtBP2 in vivo and in vitro. Depletion of either CCNH or CDK7 decreased CtBP2 protein levels by accelerating proteasome-dependent CtBP2 clearance. Further analysis revealed that CCNH/CDK7 competed with the tumor repressor HIPK2 for CtBP2 binding and consequently inhibited phosphorylation and dimerization of CtBP2. Phosphorylation-defective CtBP2 interacted more strongly with CCNH/CDK7 and was more resistant to degradation. Finally, overexpression of CtBP2 increased whereas depletion of CtBP2 dampened the invasive and migratory potential of breast cancer cells. CtBP2 promoted the invasion and migration of breast cancer cells in a CCNH-dependent manner. Taken together, our data have delineated a novel pathway that regulates CtBP2 stability, suggesting that targeting the CCNH/CDK7-CtBP2 axis may yield a viable anti-tumor strategy. PMID:23393140

  11. Comparison of circulation times of thermal waters discharging from the Idaho batholith based on geothermometer temperatures, helium concentrations, and 14C measurements

    USGS Publications Warehouse

    Mariner, R.H.; Evans, William C.; Young, H.W.

    2006-01-01

    Circulation times of waters in geothermal systems are poorly known. In this study, we examine the thermal waters of the Idaho batholith to verify whether maximum system temperatures, helium concentrations, and 14C values are related to water age in these low-to-moderate temperature geothermal systems. He/N2 values of gas collected from thermal waters that circulate solely through distinct units of the Idaho batholith correlate linearly with Na-K-(4/3)Ca geothermometer temperatures, showing that both variables are excellent indicators of relative water age. Thermal waters that circulate in early Tertiary (45-50 Ma) granite of the Sawtooth batholith have 3.5 times more helium than thermal waters of the same aquifer temperature that circulate through the main Cretaceous granite (average 91 Ma). Hot spring waters circulating in hydrothermally altered parts of the batholith have very little dissolved helium and no correlation between He/N2 values and geothermometer temperatures. Thermal waters discharging from the Idaho batholith are more depleted in deuterium than modern precipitation in the area. Recharge to these geothermal systems occurred from at least 10,000 BP for the cooler systems up to about 33,000 BP for the hotter systems.

  12. Paleointensity results for 0 and 3 ka from Hawaiian lava flows: a new approach to sampling

    NASA Astrophysics Data System (ADS)

    Cromwell, G.; Tauxe, L.; Staudigel, H.; Ron, H.; Trusdell, F.

    2011-12-01

    Paleointensity data are typically generated from core samples drilled out of the massive parts of lava flows. During Thellier-Thellier type experiments, these massive samples suffer from very low success rates (~20%), as shown by failure to meet statistical criteria. Low success generally occurs for two reasons: 1) alteration of the sample during the heating process, and 2) multi-domain behavior of massive material. Moreover, recent studies of historical lava flows show that massive samples may not accurately reflect the intensity of the magnetic field even when they are successful (Valet et al., 2010). Alternatively, submarine basaltic glasses (SBG) produce high success rates (~80%) for Thellier-Thellier type experiments, likely due to near instantaneous cooling rates which produce single-domain magnetic grains. In addition, SBG have been proven to produce accurate records of the magnetic field (e.g., Pick and Tauxe, 1993). In this study we investigate the success of paleointensity experiments on subaerial quenched basalts from Hawaii in the quest for single domain, rapidly cooled subaerial analogs to SBG. We also examine the effects of grain size and cooling rate on the accuracy of paleointensity results. During March 2011, we collected samples from 31 dated lava flows (0-3360 BP), including the [historical] 1950 C.E. and 2010 C.E. flows. Each lava flow was additionally subsampled when unique cooling structures within the unit could be identified. Results from the 1950 and 2010 glasses accurately record the expected geomagnetic field strength. We will present results of a comprehensive data set of Hawaiian paleointensity focused on about the last 3 ka.

  13. Progress in the prediction of pKa values in proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alexov, Emil; Mehler, Ernest L.; Baker, Nathan A.

    2011-12-15

    The pKa-cooperative aims to provide a forum for experimental and theoretical researchers interested in protein pKa values and protein electrostatics in general. The first round of the pKa -cooperative, which challenged computational labs to carry out blind predictions against pKas experimentally determined in the laboratory of Bertrand Garcia-Moreno, was completed and results discussed at the Telluride meeting (July 6-10, 2009). This paper serves as an introduction to the reports submitted by the blind prediction participants that will be published in a special issue of PROTEINS: Structure, Function and Bioinformatics. Here we briefly outline existing approaches for pKa calculations, emphasizing methodsmore » that were used by the participants in calculating the blind pKa values in the first round of the cooperative. We then point out some of the difficulties encountered by the participating groups in making their blind predictions, and finally try to provide some insights for future developments aimed at improving the accuracy of pKa calculations.« less

  14. BP180 Is Critical in the Autoimmunity of Bullous Pemphigoid

    PubMed Central

    Liu, Yale; Li, Liang; Xia, Yumin

    2017-01-01

    Bullous pemphigoid (BP) is by far the most common autoimmune blistering dermatosis that mainly occurs in the elderly. The BP180 is a transmembrane glycoprotein, which is highly immunodominant in BP. The structure and location of BP180 indicate that it is a significant autoantigen and plays a key role in blister formation. Autoantibodies from BP patients react with BP180, which leads to its degradation and this has been regarded as the central event in BP pathogenesis. The consequent blister formation involves the activation of complement-dependent or -independent signals, as well as inflammatory pathways induced by BP180/anti-BP180 autoantibody interaction. As a multi-epitope molecule, BP180 can cause dermal–epidermal separation via combining each epitope with specific immunoglobulin, which also facilitates blister formation. In addition, some inflammatory factors can directly deplete BP180, thereby leading to fragility of the dermal–epidermal junction and blister formation. This review summarizes recent investigations on the role of BP180 in BP pathogenesis to determine the potential targets for the treatment of patients with BP. PMID:29276517

  15. Integrated magnetostratigraphy and lithostratigraphy of five cores in Yangtze delta, China : significance of sedimentary evolution

    NASA Astrophysics Data System (ADS)

    Peng, Jie; Yang, XiaoQiang; Qiang, XiaoKe; Liu, YeBo; Zhou, QiXian

    2017-04-01

    The sedimentary history and characteristics of the Yangtze delta help us understand the tectonic evolution and geological formation process in the Eastern coastal area of China since the Cenozoic Era. Previous chronology of sediments in this area are not detailed or precise. Furthermore, when the delta area reached the maximum is still debatable. Palaeomagnetic polarity reversal and excursions, AMS14C dating, optically stimulated luminescence (OSL) dating, and the hard clay marker layer analysis were integrated to establish the chronostratigraphic framework of five drilling cores from the south Yangtze delta. Results from the bottom part of core CSB6 suggested Gauss normal polarity chron, an age of more than about 2600 ka. The other four cores showed initial deposition time between 200-60 ka B.P., significantly later than CSB6. We infer the reason is that CSB6 locating in the Changxin-Fenghua Fracture. Combined with data from referenced magnetostratigraphic cores in the Yangtze River Delta, we suggest that tectonic movement resulted in a much longer depositional age in some parts of the Yangtze River Delta and influenced the sedimentary characteristics of thick (North) to thin (South) and thick (East) to thin (West). In conclusion, a relatively wide range of deposition in the Yangtze River Delta occurred since about 200 ka B.P. The deposition of fine particles (clay-silt), which was controlled by slow tectonic subsidence and sea-level changes, expanded to the whole delta region after about 60 ka B.P. We propose that this time scale maybe used for further study on the evolution of the Yangtze delta's paleoclimate and paleoenvironment. References [1]Peng J,Yang X Q,Qiang X K,et al.Magnetostratigraphy characteristics of several cores around the Qiantang River mouth and its significance.Chinese J.Geophys.(in Chinese),2016,59(8):2949-2964. [2]Li C X, Chen Q Q, Zhang J Q,et al. Stratigraphy and paleoenvironmental changes in the Yangtze Delta during the Late Quaternary

  16. Last Glacial mammals in South America: a new scenario from the Tarija Basin (Bolivia)

    NASA Astrophysics Data System (ADS)

    Coltorti, M.; Abbazzi, L.; Ferretti, M. P.; Iacumin, P.; Rios, F. Paredes; Pellegrini, M.; Pieruccini, P.; Rustioni, M.; Tito, G.; Rook, L.

    2007-04-01

    The chronology, sedimentary history, and paleoecology of the Tarija Basin (Bolivia), one of the richest Pleistocene mammalian sites in South America, are revised here based on a multidisciplinary study, including stratigraphy, sedimentology, geomorphology, paleontology, isotope geochemistry, and 14C geochronology. Previous studies have indicated a Middle Pleistocene age for this classic locality. We have been able to obtain a series of 14C dates encompassing all the fossil-bearing sequences previously studied in the Tarija Basin. The dated layers range in age from about 44,000 to 21,000 radiocarbon years before present (BP), indicating that the Tarija fauna is much younger than previously thought. Glacial advances correlated to marine isotopic stages (MIS) 4 and 2 (ca. 62 and 20 ka BP, respectively) are also documented at the base and at the very top of the Tarija Padcaya succession, respectively, indicating that the Bolivian Altiplano was not dry but sustained an ice cap during the Last Glacial Maximum. The results of this multidisciplinary study enable us to redefine the chronological limits of the Tarija sequence and of its faunal assemblage and to shift this paleontological, paleoclimatological, and paleoecological framework to the time interval from MIS 4 to MIS 2.

  17. New constraints on late Holocene eustatic sea-level changes from Mahé, Seychelles

    NASA Astrophysics Data System (ADS)

    Woodroffe, Sarah A.; Long, Antony J.; Milne, Glenn A.; Bryant, Charlotte L.; Thomas, Alexander L.

    2015-05-01

    This study provides new estimates of globally integrated ice sheet melt during the late Holocene (since 4 ka BP) from Seychelles in the western Indian Ocean, a tectonically stable, far field location where the necessary Glacial-Isostatic Adjustment (GIA) correction is small and is relatively insensitive to predictions using different Earth viscosity profiles. We compare sea level data from Seychelles to estimates of eustasy from two GIA models, ICE-5G and EUST3, which represent end-members in the quantity of global melt during the late Holocene. We use data from a range of coastal environments including fringing reef, present day beaches, fossil plateau and mangrove deposits on the largest island of the Seychelles archipelago, Mahé to reconstruct relative sea-level changes. Our data suggest that extensive coastal deposits of carbonate-rich sands that fringe the west coast formed in the last 2 ka and the horizontal nature of their surface topography suggests RSL stability during this period. Mangrove sediments preserved behind these deposits and in river mouths date to c. 2 ka and indicate that RSL was between -2 m and present during this interval. Correcting the reconstructed sea level data using a suite of optimal GIA models based on the two ice models mentioned above and a large number (c. 350) of Earth viscosity models gives a result that is consistent with the sedimentological constraints. When uncertainties in both model results and data are considered, it is possible to rule out eustatic sea levels below c. 2 m and more than a few decimetres above present during the past two millennia. This uncertainty is dominated by error in the reconstructions rather than the model predictions. We note, however, that our estimates of eustasy are more compatible with the EUST3 model compared to the ICE-5G model during the late Holocene (2-1 ka BP). Our evidence from Seychelles shows that the timing of when eustatic sea level first rose close to present is between the

  18. Drastic lake level changes of Lake Van (eastern Turkey) during the past ca. 600 ka: climatic, volcanic and tectonic control

    NASA Astrophysics Data System (ADS)

    Cukur, D.; Krastel, S.; Schmincke, H.; Sumita, M.; Tomonaga, Y.; Damci, E.

    2013-12-01

    Lake Van is the largest soda lake in the world with a present surface of 3,574 km2 and a maximum water depth of 450 m. Sedimentary deposits in the lake preserve one of the most complete record of continental climate in the Middle East since the Middle Pleistocene. We studied these deposits to characterize the evolution of the lake level and its possible relationships with changes in climate, volcanic, and regional tectonics since the formation of the lake ca. 600 ka ago. Changes in lake level were determined based on high-resolution seismic reflection profiles showing erosional surfaces, changes in stratal geometries such as downward shifts in coastal onlap, and recognition of distinctive stratigraphic features such as prograding delta clinoforms. Our results show that Lake Van has undergone drastic changes in surface elevation by as much as 600 meters over the past ca. 600 ka. Five major lowstands occurred at ca. ~600 ka, ca. 365-340 ka, ca 290-230 ka; ca. 150-130 ka; and ca. 30-14 ka. During a first period (A) (ca. 600-ca 230 ka) lake levels changed drastically by hundreds of m but at longer time intervals between low and high stands. Changes occurred more frequently but mostly by a few tens of m during the past ca. 230 ka years where we can distinguish a first period (B1) of stepwise transgressions between ca. 230 and 150 ka followed by a short regression between ca. 150 and 130 ka. Lake level rose stepwise again during period B2 lasting until ca 30 ka. During the past 30 ka a regression and a final transgression each lasted ca. 15 ka years. The major lowstand periods in Lake Van occurred during glacial periods, arguing for a climatic control of these lake-level fluctuations (i.e., significantly reduced precipitation leading to lake level low stands). Although climate forcing may have been the dominant cause for the drastic lake level changes of Lake Van, volcanic and tectonic forcing factors are also invoked. For example, the number of distinct tephra layers

  19. 40 CFR 721.644 - Amines, C12-14-tert-alkyl, sulfonates.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Amines, C12-14-tert-alkyl, sulfonates... Substances § 721.644 Amines, C12-14-tert-alkyl, sulfonates. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as amines, C12-14-tert-alkyl, sulfonates (PMN...

  20. 40 CFR 721.644 - Amines, C12-14-tert-alkyl, sulfonates.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Amines, C12-14-tert-alkyl, sulfonates... Substances § 721.644 Amines, C12-14-tert-alkyl, sulfonates. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as amines, C12-14-tert-alkyl, sulfonates (PMN...

  1. A post-MI power struggle: adaptations in cardiac power occur at the sarcomere level alongside MyBP-C and RLC phosphorylation.

    PubMed

    Toepfer, Christopher N; Sikkel, Markus B; Caorsi, Valentina; Vydyanath, Anupama; Torre, Iratxe; Copeland, O'Neal; Lyon, Alexander R; Marston, Steven B; Luther, Pradeep K; Macleod, Kenneth T; West, Timothy G; Ferenczi, Michael A

    2016-08-01

    Myocardial remodeling in response to chronic myocardial infarction (CMI) progresses through two phases, hypertrophic "compensation" and congestive "decompensation." Nothing is known about the ability of uninfarcted myocardium to produce force, velocity, and power during these clinical phases, even though adaptation in these regions likely drives progression of compensation. We hypothesized that enhanced cross-bridge-level contractility underlies mechanical compensation and is controlled in part by changes in the phosphorylation states of myosin regulatory proteins. We induced CMI in rats by left anterior descending coronary artery ligation. We then measured mechanical performance in permeabilized ventricular trabecula taken distant from the infarct zone and assayed myosin regulatory protein phosphorylation in each individual trabecula. During full activation, the compensated myocardium produced twice as much power and 31% greater isometric force compared with noninfarcted controls. Isometric force during submaximal activations was raised >2.4-fold, while power was 2-fold greater. Electron and confocal microscopy demonstrated that these mechanical changes were not a result of increased density of contractile protein and therefore not an effect of tissue hypertrophy. Hence, sarcomere-level contractile adaptations are key determinants of enhanced trabecular mechanics and of the overall cardiac compensatory response. Phosphorylation of myosin regulatory light chain (RLC) increased and remained elevated post-MI, while phosphorylation of myosin binding protein-C (MyBP-C) was initially depressed but then increased as the hearts became decompensated. These sensitivities to CMI are in accordance with phosphorylation-dependent regulatory roles for RLC and MyBP-C in crossbridge function and with compensatory adaptation in force and power that we observed in post-CMI trabeculae. Copyright © 2016 the American Physiological Society.

  2. Stratigraphy and Melt Compositions of the 3.6 and 6.7 ka Plinian Eruptions of Hudson Volcano, Chile.

    NASA Astrophysics Data System (ADS)

    Carey, S.; Scasso, R.; Kratzmann, D.; Naranjo, J.; Bande, A.

    2005-12-01

    Fallout deposits from two major Holocene eruptions of Hudson Volcano in southern Chile (3.6 ka and 6.7 ka BP, Naranjo and Stern, 1998) provide new evidence for multiple phases, including subplinian to plinian discharges and episodes of phreatomagmatic activity. Four phases have been identified for the 3.6 ka eruption. The melt was trachydacitic and did not exhibit any significant variation throughout the fall sequence. Phase one (P1) produced a commonly reverse graded, lapilli fall deposit. Phase two (P2) also produced a reverse graded, coarse lapilli fall layer. Phase three (P3) deposited a massive, poorly-sorted, silty-ash layer with pumice and minor accretionary lapilli. The final phase of the eruption (P4) laid down a commonly normal graded, coarse lapilli fall deposit. Phases P1, P2 and P4 represent fallout from high altitude plumes with minor intensity fluctuations, whereas P3 resulted from magma/water interactions and a lower eruption column. Isopach maps show a shift in the main dispersal axis for the 3.6 ka phreatomagmatic ashfall (P3), relative to the lapilli deposits. Phases 1, 2 and 4 trend generally to the east, whereas the axis for the P3 fallout trends northeast. This is likely caused by dispersal of material at different altitudes during the eruption and not a general change in the predominant wind direction. Three major phases (P1 to P3) were identified for the 6.7 ka eruption. The initial phase (P1) produced a commonly reverse graded, coarse lapilli fall deposit. The second phase (P2) produced a thick, distinctive accretionary lapilli-rich, silty-ash layer with accretionary lapilli diameters up to 2.3 cm at 35 kms from the volcano. The final phase (P3) laid down an often normal graded, coarse lapilli fall unit. The melt phase was also trachydacitic in composition and relatively uniform during the eruption, but less evolved than the magma erupted during the 3.6 ka event. The accretionary lapilli layer (P2) has been correlated with a widespread

  3. An HMGA2-IGF2BP2 Axis Regulates Myoblast Proliferation and Myogenesis

    PubMed Central

    Li, Zhizhong; Gilbert, Jason A.; Zhang, Yunyu; Zhang, Minsi; Qiu, Qiong; Ramanujan, Krishnan; Shavlakadze, Tea; Eash, John K.; Scaramozza, Annarita; Goddeeris, Matthew M.; Kirsch, David G.; Campbell, Kevin P.; Brack, Andrew S.; Glass, David J.

    2013-01-01

    Summary A group of genes that are highly and specifically expressed in proliferating skeletal myoblasts during myogenesis was identified. Expression of one of these genes, Hmga2, increases coincident with satellite cell activation, and later its expression significantly declines correlating with fusion of myoblasts into myotubes. Hmga2 knockout mice exhibit impaired muscle development and reduced myoblast proliferation, while overexpression of HMGA2 promotes myoblast growth. This perturbation in proliferation can be explained by the finding that HMGA2 directly regulates the RNA-binding protein IGF2BP2. Add-back of IGF2BP2 rescues the phenotype. IGF2BP2 in turn binds to and controls the translation of a set of mRNAs, including c-myc, Sp1, and Igf1r. These data demonstrate that the HMGA2-IGF2BP2 axis functions as a key regulator of satellite cell activation and therefore skeletal muscle development. PMID:23177649

  4. An HMGA2-IGF2BP2 axis regulates myoblast proliferation and myogenesis.

    PubMed

    Li, Zhizhong; Gilbert, Jason A; Zhang, Yunyu; Zhang, Minsi; Qiu, Qiong; Ramanujan, Krishnan; Shavlakadze, Tea; Eash, John K; Scaramozza, Annarita; Goddeeris, Matthew M; Kirsch, David G; Campbell, Kevin P; Brack, Andrew S; Glass, David J

    2012-12-11

    A group of genes that are highly and specifically expressed in proliferating skeletal myoblasts during myogenesis was identified. Expression of one of these genes, Hmga2, increases coincident with satellite cell activation, and later its expression significantly declines correlating with fusion of myoblasts into myotubes. Hmga2 knockout mice exhibit impaired muscle development and reduced myoblast proliferation, while overexpression of HMGA2 promotes myoblast growth. This perturbation in proliferation can be explained by the finding that HMGA2 directly regulates the RNA-binding protein IGF2BP2. Add-back of IGF2BP2 rescues the phenotype. IGF2BP2 in turn binds to and controls the translation of a set of mRNAs, including c-myc, Sp1, and Igf1r. These data demonstrate that the HMGA2-IGF2BP2 axis functions as a key regulator of satellite cell activation and therefore skeletal muscle development. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. The Potential for a Ka-band (32 GHz) Worldwide VLBI Network

    NASA Astrophysics Data System (ADS)

    Jacobs, C. S.; Bach, U.; Colomer, F.; Garcá-Miró, C.; Gómez-González, J.; Gulyaev, S.; Horiuchi, S.; Ichikawa, R.; Kraus, A.; Kronschnabl, G.; López-Fernández, J. A.; Lovell, J.; Majid, W.; T; Natusch; Neidhardt, A.; Phillips, C.; Porcas, R.; Romero-Wolf, A.; Saldana, L.; Schreiber, U.; Sotuela, I.; Takeuchi, H.; Trinh, J.; Tzioumis, A.; de Vincente, P.; Zharov, V.

    2012-12-01

    Ka-band (32 GHz, 9 mm) Very Long Baseline Interferometric (VLBI) networking has now begun and has tremendous potential for expansion over the next few years. Ka-band VLBI astrometry from NASA's Deep Space Network has already developed a catalog of 470 observable sources with highly accurate positions. Now, several antennas worldwide are planning or are considering adding Ka-band VLBI capability. Thus, there is now an opportunity to create a worldwide Ka-band network with potential for high resolution imaging and astrometry. With baselines approaching a Giga-lambda, a Ka-band network would be able to probe source structure at the nano-radian (200 as) level (100X better than Hubble) and thus gain insight into the astrophysics of the most compact regions of emission in active galactic nuclei. We discuss the advantages of Ka-band, show the known sources and candidates, simulate projected baseline (uv) coverage, and discuss potential radio frequency feeds. The combination of these elements demonstrates the feasibility of a worldwide Ka network within the next few years.

  6. The Potential for a Ka-band (32 GHz) Worldwide VLBI Network

    NASA Technical Reports Server (NTRS)

    Jacobs, C. S.; Bach, U.; Colomer, F.; Garcia-Miro, C.; Gomez-Gonzalez, J.; Gulyaev, S.; Horiuchi, S.; Ichikawa, R.; Kraus, A.; Kronschnabl, G.; hide

    2012-01-01

    Ka-band (32 GHz, 9mm) Very Long Baseline Interferometric (VLBI) networking has now begun and has tremendous potential for expansion over the next few years. Ka-band VLBI astrometry from NASA's Deep Space Network has already developed a catalog of 470 observable sources with highly accurate positions. Now, several antennas worldwide are planning or are considering adding Ka-band VLBI capability. Thus, there is now an opportunity to create a worldwide Ka-band network with potential for high resolution imaging and astrometry. With baselines approaching a Giga-lambda, a Ka-band network would be able to probe source structure at the nano-radian (200 as) level ( 100X better than Hubble) and thus gain insight into the astrophysics of the most compact regions of emission in active galactic nuclei. We discuss the advantages of Ka-band, show the known sources and candidates, simulate projected baseline (uv) coverage, and discuss potential radio frequency feeds. The combination of these elements demonstrates the feasibility of a worldwide Ka network within the next few years!

  7. A gene variation of 14-3-3 zeta isoform in rat hippocampus.

    PubMed

    Murakami, K; Situ, S Y; Eshete, F

    1996-11-14

    A variant form of 14-3-3 zeta was isolated from the rat hippocampal cDNA library. The cloned cDNA is 1687 bp in length and it contains an entire ORF (nt = 63-797) with 245 amino acids that is characteristic to 14-3-3 zeta subtype. By comparing with reported sequences of 14-3-3 zeta, we found three nucleotide substitutions within the coding sequence in our clone; C<-->T transition at nt = 325 and G<-->C transversions at nt = 387 and 388. Both are missense mutations, leading ACG (Thr) to ATG (Met) and CGT (Arg) to GCT (Ala) conversions at residue 88 and 109, respectively. Our results show that at least three different genetic variants of 14-3-3 zeta are present in rat species which results in protein variations. Such mutation in the amino acid sequence is an important indication of the diverse functions of this protein and may also contribute to the recent contradictory observations regarding the role of the 14-3-3 zeta subtype.

  8. Validation of the A&D BP UB-542 wrist device for home blood pressure measurement according to the European Society of Hypertension International Protocol revision 2010.

    PubMed

    Saladini, Francesca; Benetti, Elisabetta; Fania, Claudio; Palatini, Paolo

    2013-08-01

    The objective of this study was to determine the accuracy of the A&D BP UB-542 wrist device for home blood pressure (BP) measurement according to the International Protocol of the European Society of Hypertension (ESH). Device evaluation was carried out in 33 patients. The mean age was 50.9±10.1 years, the mean systolic BP was 141.6±22.8 mmHg (range 92 : 189), the mean diastolic BP was 89.2±11.4 mmHg (range 62 : 120), the mean arm circumference was 28.8±3.2 cm (range 23-35), and the mean wrist circumference was 17.1±1.4 cm (range 14-19.5). The protocol requirements were followed precisely. The device passed all requirements, fulfilling the standards of the protocol. On average, the device overestimated the systolic BP by 1.8±7.2 mmHg and diastolic BP by 1.6±5.7 mmHg. These data show that the A&D BP UB-542 wrist device met the requirements for validation by the International Protocol and can be recommended for clinical use in the adult population.

  9. Historic binnacle of 14C/12C concentration in Mexico City

    NASA Astrophysics Data System (ADS)

    Flores, J. A.; Solís, C.; Huerta, A.; Ortiz, M. E.; Rodríguez-Ceja, M. G.; Villanueva, J.; Chávez, E.

    The radiocarbon concentration is reduced in urban areas, generally due to high CO2 emissions derived from fossil fuels. In this paper, new Δ14C measurements in cellulose extracted from the growth rings of two trees over a 43-year period are presented. The first is in a zone with clean air (El Nayar, Durango, Mexico) and the second is from the Greater Mexico City area (Chapultepec). Data from El Nayar is consistent with that reported for Zone 2 of the Northern Hemisphere while that from the urban area shows a significant decrease in Δ14C. Our results are compared with data from other cities (Nagoya, Japan and Valladolid, Spain).

  10. Woody vegetation, fuel and fire track the melting of the Scandinavian ice-sheet before 9500 cal yr BP

    NASA Astrophysics Data System (ADS)

    Carcaillet, Christopher; Hörnberg, Greger; Zackrisson, Olle

    2012-11-01

    New studies indicate the presence of early Holocene ice-free areas far north in Scandinavia. Post-glacial fire and vegetation were investigated based on sedimentary charcoal and pollen from two small lakes in northern Sweden. Accumulation of organic sediment started around 10,900 and 9200 cal yr BP, showing that both lake valleys were ice-free extremely early given their northerly location. Fire events started after 9600 cal yr BP and became less common around the '8.2-ka event'. Woody vegetation provided fuel that contributed to fires. The first vegetation in our pollen record consisted of Hippophae, Dryas, grasses and sedges. Subsequently broadleaved trees (Betula, Salix) increased in abundance and later Pinus, Alnus, ferns and Lycopodium characterized the vegetation. Pollen from Larix, Picea and Malus were also found. The change in vegetation composition was synchronous with the decrease in lake-water pH in the region, indicating ecosystem-scale processes; this occurred during a period of net global and regional warming. The changes in fire frequency and vegetation appear independent of regional trends in precipitation. The reconstructed fire history and vegetation support the scenario of early ice-free areas far north in Scandinavia during early Holocene warming, creating favorable conditions for woody plants and wildfires.

  11. Production of C-14 and neutrons in red giants

    NASA Technical Reports Server (NTRS)

    Cowan, J. J.; Rose, W. K.

    1977-01-01

    We have examined the effects of mixing various amounts of hydrogen-rich material into the intershell convective region of red giants undergoing helium shell flashes. We find that significant amounts of C-14 can be produced via the N-14(n, p)C-14 reaction. If substantial portions of this intershell region are mixed out into the envelopes of red giants, then C-14 may be detectable in evolved stars. We find a neutron flux many orders of magnitude above the flux required for the classical s-process, and thus an intermediate neutron process (i-process) may operate in evolved red giants. In all cases studied we find substantial enhancements of O-17. These mixing models offer a plausible explanation of the observations of enhanced O-17 in the carbon star IRC 10216. For certain physical conditions we find significant enhancements of N-15 in the intershell region.

  12. Impacts of C-uptake by plants on the spatial distribution of 14C accumulated in vegetation around a nuclear facility-Application of a sophisticated land surface 14C model to the Rokkasho reprocessing plant, Japan.

    PubMed

    Ota, Masakazu; Katata, Genki; Nagai, Haruyasu; Terada, Hiroaki

    2016-10-01

    The impacts of carbon uptake by plants on the spatial distribution of radiocarbon ( 14 C) accumulated in vegetation around a nuclear facility were investigated by numerical simulations using a sophisticated land surface 14 C model (SOLVEG-II). In the simulation, SOLVEG-II was combined with a mesoscale meteorological model and an atmospheric dispersion model. The model combination was applied to simulate the transfer of 14 CO 2 and to assess the radiological impact of 14 C accumulation in rice grains during test operations of the Rokkasho reprocessing plant (RRP), Japan, in 2007. The calculated 14 C-specific activities in rice grains agreed with the observed activities in paddy fields around the RRP within a factor of four. The annual effective dose delivered from 14 C in the rice grain was estimated to be less than 0.7 μSv, only 0.07% of the annual effective dose limit of 1 mSv for the public. Numerical experiments of hypothetical continuous atmospheric 14 CO 2 release from the RRP showed that the 14 C-specific activities of rice plants at harvest differed from the annual mean activities in the air. The difference was attributed to seasonal variations in the atmospheric 14 CO 2 concentration and the growth of the rice plant. Accumulation of 14 C in the rice plant significantly increased when 14 CO 2 releases were limited during daytime hours, compared with the results observed during the nighttime. These results indicated that plant growth stages and diurnal photosynthesis should be considered in predictions of the ingestion dose of 14 C for long-term chronic releases and short-term diurnal releases of 14 CO 2 , respectively. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. BP180 dysfunction triggers spontaneous skin inflammation in mice.

    PubMed

    Zhang, Yang; Hwang, Bin-Jin; Liu, Zhen; Li, Ning; Lough, Kendall; Williams, Scott E; Chen, Jinbo; Burette, Susan W; Diaz, Luis A; Su, Maureen A; Xiao, Shengxiang; Liu, Zhi

    2018-06-04

    BP180, also known as collagen XVII, is a hemidesmosomal component and plays a key role in maintaining skin dermal/epidermal adhesion. Dysfunction of BP180, either through genetic mutations in junctional epidermolysis bullosa (JEB) or autoantibody insult in bullous pemphigoid (BP), leads to subepidermal blistering accompanied by skin inflammation. However, whether BP180 is involved in skin inflammation remains unknown. To address this question, we generated a BP180-dysfunctional mouse strain and found that mice lacking functional BP180 (termed Δ NC16A ) developed spontaneous skin inflammatory disease, characterized by severe itch, defective skin barrier, infiltrating immune cells, elevated serum IgE levels, and increased expression of thymic stromal lymphopoietin (TSLP). Severe itch is independent of adaptive immunity and histamine, but dependent on increased expression of TSLP by keratinocytes. In addition, a high TSLP expression is detected in BP patients. Our data provide direct evidence showing that BP180 regulates skin inflammation independently of adaptive immunity, and BP180 dysfunction leads to a TSLP-mediated itch. The newly developed mouse strain could be a model for elucidation of disease mechanisms and development of novel therapeutic strategies for skin inflammation and BP180-related skin conditions.

  14. 17 CFR 240.14c-1 - Definitions.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... director or officer of the registrant or any of its parents or subsidiaries. (b) Employee benefit plan. For purposes of § 240.14c-7, the term “employee benefit plan” means any purchase, savings, option, bonus..., trustees or officers. (c) Entity that exercises fiduciary powers. The term “entity that exercises fiduciary...

  15. The pKa Cooperative: A Collaborative Effort to Advance Structure-Based Calculations of pKa values and Electrostatic Effects in Proteins

    PubMed Central

    Nielsen, Jens E.; Gunner, M. R.; Bertrand García-Moreno, E.

    2012-01-01

    The pKa Cooperative http://www.pkacoop.org was organized to advance development of accurate and useful computational methods for structure-based calculation of pKa values and electrostatic energy in proteins. The Cooperative brings together laboratories with expertise and interest in theoretical, computational and experimental studies of protein electrostatics. To improve structure-based energy calculations it is necessary to better understand the physical character and molecular determinants of electrostatic effects. The Cooperative thus intends to foment experimental research into fundamental aspects of proteins that depend on electrostatic interactions. It will maintain a depository for experimental data useful for critical assessment of methods for structure-based electrostatics calculations. To help guide the development of computational methods the Cooperative will organize blind prediction exercises. As a first step, computational laboratories were invited to reproduce an unpublished set of experimental pKa values of acidic and basic residues introduced in the interior of staphylococcal nuclease by site-directed mutagenesis. The pKa values of these groups are unique and challenging to simulate owing to the large magnitude of their shifts relative to normal pKa values in water. Many computational methods were tested in this 1st Blind Prediction Challenge and critical assessment exercise. A workshop was organized in the Telluride Science Research Center to assess objectively the performance of many computational methods tested on this one extensive dataset. This volume of PROTEINS: Structure, Function, and Bioinformatics introduces the pKa Cooperative, presents reports submitted by participants in the blind prediction challenge, and highlights some of the problems in structure-based calculations identified during this exercise. PMID:22002877

  16. Rapid climate change from north Andean Lake Fúquene pollen records driven by obliquity: implications for a basin-wide biostratigraphic zonation for the last 284 ka

    NASA Astrophysics Data System (ADS)

    Bogotá-A, R. G.; Groot, M. H. M.; Hooghiemstra, H.; Lourens, L. J.; Van der Linden, M.; Berrio, J. C.

    2011-11-01

    This paper compares a new super-high resolution pollen record from a central location in Lake Fúquene (4°N) with 3 pollen records from marginal sites from the same lake basin, located at 2540 m elevation in the Eastern Cordillera of Colombia. We harmonized the pollen sum of all records, and provided previously published records of climate change with an improved age model using a new approach for long continental pollen records. We dissociated from subjective curve matching and applied a more objective procedure including radiocarbon ages, cyclostratigraphy, and orbital tuning using the new 284 ka long Fúquene Basin Composite record (Fq-BC) as the backbone ( Groot et al., 2011). We showed that a common ˜9 m cycle in the arboreal pollen percentage (AP%) records reflects obliquity forcing and drives vegetational and climatic change. The AP% records were tuned to the 41 kyr component filtered from standard benthic δ 18O LR04 record. Changes in sediment supply to the lake are reflected in concert by the four records making frequency analysis in the depth domain an adequate method to compare records from the same basin. We calibrated the original 14C ages and used where necessary biostratigraphic correlation, i.e. for records shorter than one obliquity cycle. Pollen records from the periphery of the lake showed changes in the abundance of Alnus and Weinmannia forests more clearly while centrally located record Fq-9C shows a more integrated signal of regional vegetation change. The revised age models show that core Fq-2 reflects the last 44 ka and composite record Fq-7C the last 85.5 ka. Marginally located core Fq-3 has an age of 133 ka at 32 m core depth and the lowermost 11 m of sediments appear of older but unknown age. The longest record Fq-BC shows ˜60 yr resolution over the period of 284-27 ka. All pollen records are in support of a common regional vegetation development leading to a robust reconstruction of long series of submillennial climate oscillations

  17. Foot-and-Mouth Disease Virus Counteracts on Internal Ribosome Entry Site Suppression by G3BP1 and Inhibits G3BP1-Mediated Stress Granule Assembly via Post-Translational Mechanisms

    PubMed Central

    Ye, Xu; Pan, Ting; Wang, Dang; Fang, Liurong; Ma, Jun; Zhu, Xinyu; Shi, Yanling; Zhang, Keshan; Zheng, Haixue; Chen, Huanchun; Li, Kui; Xiao, Shaobo

    2018-01-01

    Foot-and-mouth disease (FMD) is a highly contagious, severe viral illness notifiable to the World Organization for Animal Health. The causative agent, FMD virus (FMDV), replicates rapidly and efficiently inhibits host translation and the innate immune response for it has developed multiple tactics to evade host defenses and takes over gene expression machinery in the host cell. Here, we report a systemic analysis of the proteome and phosphoproteome of FMDV-infected cells. Bioinformatics analysis suggested that FMDV infection shuts off host cap-dependent translation, but leaves intact internal ribosome entry site (IRES)-mediated translation for viral proteins. Interestingly, several FMDV IRES-transacting factors, including G3BP stress granule assembly factor 1 (G3BP1), were dephosphorylated during FMDV infection. Ectopic expression of G3BP1 inhibited FMDV IRES activity, promoted assembly of stress granules, and activated innate immune responses, collectively suppressing FMDV replication. To counteract these host protective responses, FMDV-induced dephosphorylation of G3BP1, compromising its inhibitory effect on viral IRES. In addition, FMDV also proteolytically cleaved G3BP1 by its 3C protease (3Cpro). G3BP1 was cleaved at glutamic acid-284 (E284) by FMDV 3Cpro, and this cleavage completely lost the abilities of G3BP1 to activate innate immunity and to inhibit FMDV replication. Together, these data provide new insights into the post-translational mechanisms by which FMDV limits host stress and antiviral responses and indicate that G3BP1 dephosphorylation and its proteolysis by viral protease are important factors in the failure of host defense against FMDV infection.

  18. [Nondestructive discrimination of strawberry varieties by NIR and BP-ANN].

    PubMed

    Niu, Xiao-ying; Shao, Li-min; Zhao, Zhi-lei; Zhang, Xiao-yu

    2012-08-01

    Strawberry variety is a main factor that can influence strawberry fruit quality. The use of near-infrared reflectance spectroscopy was explored discriminate among samples of strawberry of different varieties. And the significance of difference among different varieties was analyzed by comparison of the chemical composition of the different varieties samples. The performance of models established using back propagation-artificial neural networks (BP-ANN), least squares-support vector machine and discriminant analysis were evaluated on spectra range of 4545-9090 cm(-1). The optimal model was obtained by BP-ANN with a topology of 12-18-3, which correctly classified 96.68% of calibration set and 97.14% of prediction set. And the 94.95%, 97% and 98.29% classifications were given respectively for "Tianbao" (n=99), "Fengxiang" (n=100) and "Mingxing" (n=117). One-way analysis of variance was made for comparison of the mean values for soluble solids content (SSC), titratable acid (TA), pH value and SSC-TA ratio, and the statistically significant differences were found. Principal component analysis was performed on the four chemical compositions, and obvious clustering tendencies for different varieties were found. These results showed that NIR combined with BP-ANN can discriminate strawberry of different varieties effectively, and the difference in chemical compositions of different varieties strawberry might be a chemical validation for NIR results.

  19. Calculation of the compounded uncertainty of 14C AMS measurements

    NASA Astrophysics Data System (ADS)

    Nadeau, Marie-Josée; Grootes, Pieter M.

    2013-01-01

    The correct method to calculate conventional 14C ages from the carbon isotopic ratios was summarised 35 years ago by Stuiver and Polach (1977) and is now accepted as the only method to calculate 14C ages. There is, however, no consensus regarding the treatment of AMS data, mainly of the uncertainty of the final result. The estimation and treatment of machine background, process blank, and/or in situ contamination is not uniform between laboratories, leading to differences in 14C results, mainly for older ages. As Donahue (1987) and Currie (1994), among others, mentioned, some laboratories find it important to use the scatter of several measurements as uncertainty while others prefer to use Poisson statistics. The contribution of the scatter of the standards, machine background, process blank, and in situ contamination to the uncertainty of the final 14C result is also treated in different ways. In the early years of AMS, several laboratories found it important to describe their calculation process in details. In recent years, this practise has declined. We present an overview of the calculation process for 14C AMS measurements looking at calculation practises published from the beginning of AMS until present.

  20. Detecting human presence at the border of the Northeastern Italian Pre-Alps. 14C dating at Rio Secco cave as expression of the first Gravettian and the late mousterian in the Northern Adriatic Region.

    PubMed

    Talamo, Sahra; Peresani, Marco; Romandini, Matteo; Duches, Rossella; Jéquier, Camille; Nannini, Nicola; Pastoors, Andreas; Picin, Andrea; Vaquero, Manuel; Weniger, Gerd-Christian; Hublin, Jean-Jacques

    2014-01-01

    In the northern Adriatic regions, which include the Venetian region and the Dalmatian coast, late Neanderthal settlements are recorded in few sites and even more ephemeral are remains of the Mid-Upper Palaeolithic occupations. A contribution to reconstruct the human presence during this time range has been produced from a recently investigated cave, Rio Secco, located in the northern Adriatic region at the foot of the Carnic Pre-Alps. Chronometric data make Rio Secco a key site in the context of recording occupation by late Neanderthals and regarding the diffusion of the Mid-Upper Palaeolithic culture in a particular district at the border of the alpine region. As for the Gravettian, its diffusion in Italy is a subject of on-going research and the aim of this paper is to provide new information on the timing of this process in Italy. In the southern end of the Peninsula the first occupation dates to around 28,000 14C BP, whereas our results on Gravettian layer range from 29,390 to 28,995 14C years BP. At the present state of knowledge, the emergence of the Gravettian in eastern Italy is contemporaneous with several sites in Central Europe and the chronological dates support the hypothesis that the Swabian Gravettian probably dispersed from eastern Austria.

  1. Carbon and 14C distribution in tropical and subtropical agricultural soils

    NASA Astrophysics Data System (ADS)

    Prastowo, Erwin; Grootes, Pieter; Nadeau, Marie

    2016-04-01

    Paddy soil management affects, through the alternating anoxic and oxic conditions it creates, the transport and stabilisation of soil organic matter (SOM). Irrigation water may percolate more organic materials - dissolved (DOM) and colloidal - into the subsoil during anoxic conditions. Yet a developed ploughpan tends to prevent C from going deeper in the subsoil and partly decouple C distribution in top and sub soil. We investigate the influence of different soil type and environment. We observed the C and 14C distribution in paddy and non-paddy soil profiles in three different soil types from four different climatic regions of tropical Indonesia, and subtropical China. Locations were Sukabumi (Andosol, ca. 850 m a.s.l), Bogor (clayey Alisol, ca. 240 m a.s.l), and Ngawi (Vertisol, ca. 70 m a.s.l) in Jawa, Indonesia, and Cixi (Alisol(sandy), ca. 4 - 6 m a.s.l) in Zhejiang Province, China. We compared rice paddies with selected neighbouring non-paddy fields and employed AMS 14C as a tool to study C dynamics from bulk, alkali soluble-humic, and insoluble humin samples, and macrofossils (plant remains, charcoal). Our data suggest that vegetation type determines the quantity and quality of biomass introduced as litter and root material in top and subsoil, and thus contributes to the soil C content and profile, which fits the 14C signal distribution, as well as 13C in Ngawi with C4 sugar cane as upland crop. 14C concentrations for the mobile humic acid fraction were generally higher than for bulk samples from the same depth, except when recent plant and root debris led to high 14C levels in near-surface samples. The difference in sampling, - averaged layer for bulk sample and 1-cm layer thickness for point sample - shows gradients in C and 14C across the layers, which could be a reason for discrepancies between the two. High 14C concentrations - in Andosol Sukabumi up to 111 pMC - exceed the atmospheric 14CO2concentration in the sampling year in 2012 (˜ 103 pMC) and

  2. Human (Clovis)-gomphothere (Cuvieronius sp.) association ∼ 13,390 calibrated yBP in Sonora, Mexico.

    PubMed

    Sanchez, Guadalupe; Holliday, Vance T; Gaines, Edmund P; Arroyo-Cabrales, Joaquín; Martínez-Tagüeña, Natalia; Kowler, Andrew; Lange, Todd; Hodgins, Gregory W L; Mentzer, Susan M; Sanchez-Morales, Ismael

    2014-07-29

    The earliest known foragers to populate most of North America south of the glaciers [∼ 11,500 to ≥ ∼ 10,800 (14)C yBP; ∼ 13,300 to ∼ 12,800 calibrated (Cal) years] made distinctive "Clovis" artifacts. They are stereotypically characterized as hunters of Pleistocene megamammals (mostly mammoth) who entered the continent via Beringia and an ice-free corridor in Canada. The origins of Clovis technology are unclear, however, with no obvious evidence of a predecessor to the north. Here we present evidence for Clovis hunting and habitation ∼ 11,550 yBP (∼ 13,390 Cal years) at "El Fin del Mundo," an archaeological site in Sonora, northwestern Mexico. The site also includes the first evidence to our knowledge for gomphothere (Cuvieronius sp.) as Clovis prey, otherwise unknown in the North American archaeological record and terminal Pleistocene paleontological record. These data (i) broaden the age and geographic range for Clovis, establishing El Fin del Mundo as one of the oldest and southernmost in situ Clovis sites, supporting the hypothesis that Clovis had its origins well south of the gateways into the continent, and (ii) expand the make-up of the North American megafauna community just before extinction.

  3. Human (Clovis)-gomphothere (Cuvieronius sp.) association ∼13,390 calibrated yBP in Sonora, Mexico

    NASA Astrophysics Data System (ADS)

    Sanchez, Guadalupe; Holliday, Vance T.; Gaines, Edmund P.; Arroyo-Cabrales, Joaquín; Martínez-Tagüeña, Natalia; Kowler, Andrew; Lange, Todd; Hodgins, Gregory W. L.; Mentzer, Susan M.; Sanchez-Morales, Ismael

    2014-07-01

    The earliest known foragers to populate most of North America south of the glaciers [∼11,500 to ≥ ∼10,800 14C yBP; ∼13,300 to ∼12,800 calibrated (Cal) years] made distinctive "Clovis" artifacts. They are stereotypically characterized as hunters of Pleistocene megamammals (mostly mammoth) who entered the continent via Beringia and an ice-free corridor in Canada. The origins of Clovis technology are unclear, however, with no obvious evidence of a predecessor to the north. Here we present evidence for Clovis hunting and habitation ∼11,550 yBP (∼13,390 Cal years) at "El Fin del Mundo," an archaeological site in Sonora, northwestern Mexico. The site also includes the first evidence to our knowledge for gomphothere (Cuvieronius sp.) as Clovis prey, otherwise unknown in the North American archaeological record and terminal Pleistocene paleontological record. These data (i) broaden the age and geographic range for Clovis, establishing El Fin del Mundo as one of the oldest and southernmost in situ Clovis sites, supporting the hypothesis that Clovis had its origins well south of the gateways into the continent, and (ii) expand the make-up of the North American megafauna community just before extinction.

  4. ACTS Ka-Band Earth Stations: Technology, Performance, and Lessons Learned

    NASA Technical Reports Server (NTRS)

    Reinhart, Richard C.; Struharik, Steven J.; Diamond, John J.; Stewart, David

    2000-01-01

    The Advanced Communications Technology Satellite (ACTS) Project invested heavily in prototype Ka-band satellite ground terminals to conduct an experiments program with the ACTS satellite. The ACTS experiment's program proposed to validate Ka-band satellite and ground station technology. demonstrate future telecommunication services. demonstrate commercial viability and market acceptability of these new services, evaluate system networking and processing technology, and characterize Ka-band propagation effects, including development of techniques to mitigate signal fading. This paper will present a summary of the fixed ground terminals developed by the NASA Glenn Research Center and its industry partners, emphasizing the technology and performance of the terminals (Part 1) and the lessons learned throughout their six year operation including the inclined orbit phase of operations (Full Report). An overview of the Ka-band technology and components developed for the ACTS ground stations is presented. Next. the performance of the ground station technology and its evolution during the ACTS campaign are discussed to illustrate the technical tradeoffs made during the program and highlight technical advances by industry to support the ACTS experiments program and terminal operations. Finally. lessons learned during development and operation of the user terminals are discussed for consideration of commercial adoption into future Ka-band systems. The fixed ground stations used for experiments by government, academic, and commercial entities used reflector based offset-fed antenna systems ranging in size from 0.35m to 3.4m antenna diameter. Gateway earth stations included two systems, referred to as the NASA Ground Station (NGS) and the Link Evaluation Terminal (LET). The NGS provides tracking, telemetry, and control (TT&C) and Time Division Multiple Access (TDMA) network control functions. The LET supports technology verification and high data rate experiments. The ground

  5. 40 CFR 721.642 - Amines, N-(C14-18 and C16-16 unsaturated alkyl)] dipropylene-tri-, tripropylenetetra-, and...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... substances amines, N-(C14-18 and C16-18 unsaturated alkyl)] dipropylenetri-, (PMN P-94-1244... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Amines, N-(C14-18 and C16-16... Amines, N-(C14-18 and C16-16 unsaturated alkyl)] dipropylene-tri-, tripropylenetetra-, and...

  6. BP Reg Experiment Operations

    NASA Image and Video Library

    2015-04-07

    ISS043E091755 (04/07/2015) --- Expedition 43 Commander Terry Virts is seen here working inside of the Columbus laboratory on the Blood Pressure Regulation (BP Reg) experiment. Astronauts returning from long-duration space flights risk experiencing dizziness or fainting when they stand immediately after returning to Earth. This has an important health risk as it reduces the potential for astronauts to safely escape from an emergency situation. BP Reg will help researchers develop appropriate countermeasures so that astronauts returning from long-duration space flights will have very low risk of experiencing dizziness or fainting when they return to Earth.

  7. BP Reg Experiment Operations

    NASA Image and Video Library

    2015-04-07

    ISS043E091740 (04/07/2015) --- Expedition 43 Commander Terry Virts is seen here working inside of the Columbus laboratory on the Blood Pressure Regulation (BP Reg) experiment. Astronauts returning from long-duration space flights risk experiencing dizziness or fainting when they stand immediately after returning to Earth. This has an important health risk as it reduces the potential for astronauts to safely escape from an emergency situation. BP Reg will help researchers develop appropriate countermeasures so that astronauts returning from long-duration space flights will have very low risk of experiencing dizziness or fainting when they return to Earth.

  8. Monitoring flux through the oxidative pentose phosphate pathway using [1-14C]gluconate.

    PubMed

    Garlick, Andrew P; Moore, Catherine; Kruger, Nicholas J

    2002-12-01

    The aim of this work was to examine the metabolism of exogenous gluconate by a 4-day-old cell suspension culture of Arabidopsis thaliana (L.) Heynh. Release of (14)CO(2) from [1-(14)C]gluconate was dependent on the concentration in the medium and could be resolved into a substrate-saturable component (apparent K(m) of approximately 0.4 mM) and an unsaturable component. At an external concentration of 0.3 mM, the rate of decarboxylation of applied gluconate was 0.2% of the rate of oxygen consumption by the cells. There was no effect of 0.3 mM gluconate on the rate of oxygen consumption, or on the rate of (14)CO(2) release from either [1-(14)C]glucose or [6-(14)C]glucose by the culture. The following observations argue that gluconate taken up by the cells is metabolised by direct phosphorylation to 6-phosphogluconate and subsequent decarboxylation through 6-phosphogluconate dehydrogenase. First, more than 95% of the label released from [1-(14)C]gluconate during metabolism by the cell culture was recovered as (14)CO(2). Secondly, inhibition of the oxidative pentose phosphate pathway (OPPP) by treatment with 6-aminonicotinamide preferentially inhibited release of (14)CO(2) from [1-(14)C]gluconate relative to that from [1-(14)C]glucose. Thirdly, perturbation of glucose metabolism by glucosamine did not affect (14)CO(2) from [1-(14)C]gluconate. Fourth, stimulation of the OPPP by phenazine methosulphate stimulated release of (14)CO(2) from [1-(14)C]gluconate to a far greater extent than that from [1-(14)C]glucose. It is proposed that measurement of (14)CO(2) from [1-(14)C]gluconate provides a simple and sensitive technique for monitoring flux through the OPPP pathway in plants.

  9. Trace-element deposition in the Cariaco Basin, Venezuela Shelf, under sulfate-reducing conditions: a history of the local hydrography and global climate, 20 ka to the present

    USGS Publications Warehouse

    Piper, David Z.; Dean, Walter E.

    2002-01-01

    the last 20 kyr. The accumulation rate of the marine fraction of Mo increased abruptly at about 14.8 ka (calendar years), from less than 0.5 µg cm-2 yr-1 to greater than 4 µg cm-2 yr-1. Its accumulation rate remained high but variable until 8.6 ka, when it decreased sharply to 1 µg cm-2 yr-1. It continued to decrease to 4.0 ka, to its lowest value for the past 15 kyr, before gradually increasing to the present. Between 14.8 ka and 8.6 ka, its accumulation rate exhibited strong maxima at 14.4, 13.0, and 9.9 ka. The oldest maximum corresponds to melt-water pulse IA into the Gulf of Mexico. A relative minimum, centered at about 11.1 ka, corresponds to melt-water pulse IB; a strong maximum occurs in the immediately overlying sediment. The maximum at 13.0 ka corresponds to onset of the Younger Dryas cold event. This pattern to the accumulation rate of Mo (and V) can be interpreted in terms of its deposition from bottom water of the basin, the hydrogenous fraction, under SO42- -reducing conditions, during times of intense bottom-water advection 14.8 ka to 11.1 ka and significantly less intense bottom-water advection 11 ka to the present. The accumulation rate of Cd shows a pattern that is only slightly different from that of Mo, although its deposition was determined largely by the rain rate of organic matter into the bottom water, a biogenic fraction whose deposition was driven by upwelling of nutrient-enriched water into the photic zone. Its accumulation exhibits only moderately high rates, on average, during both melt-water pulses. Its highest rate, and that of upwelling, occurred during the Younger Dryas, and again following melt-water pulse IB. The marine fractions of Cu, Ni, and Zn also have a strong biogenic signal. The siliciclastic terrigenous debris, however, represents the dominant source, and host, of Cu, Ni, and Zn. All four trace elements have a consid-erably weaker hydrogenous signal than biogenic signal. Accumulation rates of the terrigenous fraction, as

  10. Ka-band monopulse antenna-pointing systems analysis and simulation

    NASA Technical Reports Server (NTRS)

    Lo, V. Y.

    1996-01-01

    NASA 's Deep Space Network (DSN) has been using both 70-m and 34-m reflector antennas to communicate with spacecraft at S-band (2.3 GHz) and X-band (8.45 GHz). To improve the quality of telecommunication and to meet future mission requirements, JPL has been developing 34-m Ka-band (32-GHz) beam waveguide antennas. Presently, antenna pointing operates in either the open-loop mode with blind pointing using navigation predicts or the closed-loop mode with conical scan (conscan). Pointing accuracy under normal conscan operating conditions is in the neighborhood of 5 mdeg. This is acceptable at S- and X-bands, but not enough at Ka-band. Due to the narrow beamwidth at Ka-band, it is important to improve pointing accuracy significantly (approximately 2 mdeg). Monopulse antenna tracking is one scheme being developed to meet the stringent pointing-accuracy requirement at Ka-band. Other advantages of monopulse tracking include low sensitivity to signal amplitude fluctuations as well as single-pulse processing for acquisition and tracking. This article presents system modeling, signal processing, simulation, and implementation of Ka-band monopulse tracking feed for antennas in NASA/DSN ground stations.

  11. Late Quaternary dynamics of forest vegetation on northern Vancouver Island, British Columbia, Canada

    NASA Astrophysics Data System (ADS)

    Lacourse, Terri

    2005-01-01

    Pollen analysis of radiocarbon-dated lake sediment from northern Vancouver Island, southwest British Columbia reveals regional changes in forest vegetation over the last 12,200 14C yr (14,900 cal yr). Between at least 12,200 and 11,700 14C yr BP (14,900-13,930 cal yr BP), open woodlands were dominated by Pinus contorta, Alnus crispa, and various ferns. As P. contorta decreased in abundance, Alnus rubra and more shade-tolerant conifers (i.e., Picea and Tsuga mertensiana) increased. Increases in T. mertensiana, P. contorta, and A. crispa pollen accumulation rates (PARs) between 10,600 and 10,400 14C yr BP (11,660-11,480 cal yr BP) reflect a cool and moist climate during the Younger Dryas chronozone. Orbitally induced warming around 10,000 14C yr BP (11,090 cal yr BP) allowed the northward extension of Pseudotsuga menziesii, although Picea, Tsuga heterophylla, and A. rubra dominated early Holocene forests. By 7500 14C yr BP (8215 cal yr BP), shade-tolerant T. heterophylla was the dominant forest tree. Cupressaceae ( Thuja plicata and Chamaecyparis nootkatensis) was present by 7500 14C yr BP but reached its maximum after 3500 14C yr BP (3600 cal yr BP), when a cooler and wetter regional climate facilitated the development of temperate rainforest. The highest rates of vegetation change are associated with Lateglacial climate change and species with rapid growth rates and short life spans.

  12. Influence of northwest Pacific productivity on North Pacific Intermediate Water oxygen concentrations during the Bølling-Ållerød interval (14.7-12.9 ka)

    USGS Publications Warehouse

    Crusius, John; Pedersen, Thomas F.; Kienast, Stephanie; Keigwin, Lloyd D.; Labeyrie, Laurent

    2004-01-01

    Elevated productivity in the northwest Pacific is suggested as a new possible control driving past intervals of low-O2 intermediate water along the western continental margin of North America. According to this mechanism, O2 consumption would occur near the site of formation of North Pacific Intermediate Water (NPIW), due to increased respiration of organic carbon in response to a high-productivity event. Evidence is provided for such a productivity increase during the Bølling-Ållerød interval (14.7–12.9 ka), a time when laminated sediments were deposited along the northern California margin. By this mechanism, low-O2 events in intermediate waters off the western North American margin could occur without significant changes in the rate of NPIW ventilation.

  13. Mars Reconnaissance Orbiter Ka-band (32 GHz) Demonstration: Cruise Phase Operations

    NASA Technical Reports Server (NTRS)

    Shambayati, Shervin; Morabito, David; Border, James S.; Davarian, Faramaz; Lee, Dennis; Mendoza, Ricardo; Britcliffe, Michael; Weinreb, Sander

    2006-01-01

    The X-band (8.41 GHz) frequency currently used for deep space telecommunications is too narrow (50 MHz) to support future high rate missions. Because of this NASA has decided to transition to Ka-band (32 GHz) frequencies. As weather effects cause much larger fluctuations on Ka-band than on X-band, the traditional method of using a few dBs of margin to cover these fluctuations is wasteful of power for Ka-band; therefore, a different operations concept is needed for Ka-band links. As part of the development of the operations concept for Ka-band, NASA has implemented a fully functioning Ka-band communications suite on its Mars Reconnaissance Orbiter (MRO). This suite will be used during the primary science phase to develop and refine the Ka-band operations concept for deep space missions. In order to test the functional readiness of the spacecraft and the Deep Space Network's (DSN) readiness to support the demonstration activities a series of passes over DSN 34-m Beam Waveguide (BWG) antennas were scheduled during the cruise phase of the mission. MRO was launched on August 12, 2005 from Kennedy Space Center, Cape Canaveral, Florida, USA and went into Mars Orbit on March 10, 2006. A total of ten telemetry demonstration and one high gain antenna (HGA) calibration passes were allocated to the Ka-band demonstration. Furthermore, a number of "shadow" passes were also scheduled where, during a regular MRO track over a Ka-band capable antenna, Ka-band was identically configured as the X-band and tracked by the station. In addition, nine Ka-band delta differential one way ranging ((delta)DOR) passes were scheduled. During these passes, the spacecraft and the ground system were put through their respective paces. Among the highlights of these was setting a single day record for data return from a deep space spacecraft (133 Gbits) achieved during one 10-hour pass; achieving the highest data rate ever from a planetary mission (6 Mbps) and successfully demonstrating Ka-band DDOR

  14. Rapid increase in cosmogenic 14C in AD 775 measured in New Zealand kauri trees indicates short-lived increase in 14C production spanning both hemispheres

    NASA Astrophysics Data System (ADS)

    Güttler, D.; Adolphi, F.; Beer, J.; Bleicher, N.; Boswijk, G.; Christl, M.; Hogg, A.; Palmer, J.; Vockenhuber, C.; Wacker, L.; Wunder, J.

    2015-02-01

    In 2012, Miyake et al. reported a sudden and strong increase of the atmospheric radiocarbon (14C) content in Japanese cedar trees of 1.2% between AD 774 and 775. While their findings were quickly confirmed by a German oak chronology for the Northern Hemisphere (NH), the question remained if the effect was seen in both hemispheres. Here we present the first annually resolved Southern Hemisphere (SH) 14C record spanning the interval AD 760-787, using New Zealand kauri (Agathis australis) chronology wood. An almost identical distinct increase compared to Northern Hemisphere data was observed, suggesting a cosmic event with globally uniform impact as a potential cause for the increase. Deploying a carbon cycle box model a worldwide averaged net 14C production of 2.2 ×108 14C atoms cm-2 was estimated, which is 3.7 times higher than the average annual 14C production. The immediate appearance of the event in tree rings on both hemispheres suggests a short duration event of significantly less than 1 yr.

  15. Cloning, Expression and Characterization of a Thermostable Esterase HydS14 from Actinomadura sp. Strain S14 in Pichia pastoris.

    PubMed

    Sriyapai, Pichapak; Kawai, Fusako; Siripoke, Somjai; Chansiri, Kosum; Sriyapai, Thayat

    2015-06-12

    A thermostable esterase gene (hydS14) was cloned from an Actinomadura sp. S14 gene library. The gene is 777 bp in length and encodes a polypeptide of 258 amino acid residues with no signal peptide, no N-glycosylation site and a predicted molecular mass of 26,604 Da. The encoded protein contains the pentapeptide motif (GYSLG) and catalytic triad (Ser88-Asp208-His235) of the esterase/lipase superfamily. The HydS14 sequence shows 46%-64% identity to 23 sequences from actinomycetes (23 α/β-hydrolases), has three conserved regions, and contains the novel motif (GY(F)SLG), which distinguishes it from other clusters in the α/β-hydrolase structural superfamily. A plasmid containing the coding region (pPICZαA-hydS14) was used to express HydS14 in Pichia pastoris under the control of the AOXI promoter. The recombinant HydS14 collected from the supernatant had a molecular mass of ~30 kDa, which agrees with its predicted molecular mass without N-glycosylation. HydS14 had an optimum temperature of approximately 70 °C and an optimum pH of 8.0. HydS14 was stable at 50 and 60 °C for 120 min, with residual activities of above 80% and above 90%, respectively, as well as 50% activity at pH 6.0-8.0 and pH 9.0, respectively. The enzyme showed higher activity with p-nitrophenyl-C2 and C4. The Km and Vmax values for p-nitrophenyl-C4 were 0.21 ± 0.02 mM and 37.07 ± 1.04 μmol/min/mg, respectively. The enzyme was active toward short-chain p-nitrophenyl ester (C2-C6), displaying optimal activity with p-nitrophenyl-C4 (Kcat/Km = 11.74 mM(-1) · S(-1)). In summary, HydS14 is a thermostable esterase from Actinomadura sp. S14 that has been cloned and expressed for the first time in Pichia pastoris.

  16. A reassessment of the early archaeological record at Leang Burung 2, a Late Pleistocene rock-shelter site on the Indonesian island of Sulawesi.

    PubMed

    Brumm, Adam; Hakim, Budianto; Ramli, Muhammad; Aubert, Maxime; van den Bergh, Gerrit D; Li, Bo; Burhan, Basran; Saiful, Andi Muhammad; Siagian, Linda; Sardi, Ratno; Jusdi, Andi; Abdullah; Mubarak, Andi Pampang; Moore, Mark W; Roberts, Richard G; Zhao, Jian-Xin; McGahan, David; Jones, Brian G; Perston, Yinika; Szabó, Katherine; Mahmud, M Irfan; Westaway, Kira; Jatmiko; Saptomo, E Wahyu; van der Kaars, Sander; Grün, Rainer; Wood, Rachel; Dodson, John; Morwood, Michael J

    2018-01-01

    This paper presents a reassessment of the archaeological record at Leang Burung 2, a key early human occupation site in the Late Pleistocene of Southeast Asia. Excavated originally by Ian Glover in 1975, this limestone rock-shelter in the Maros karsts of Sulawesi, Indonesia, has long held significance in our understanding of early human dispersals into 'Wallacea', the vast zone of oceanic islands between continental Asia and Australia. We present new stratigraphic information and dating evidence from Leang Burung 2 collected during the course of our excavations at this site in 2007 and 2011-13. Our findings suggest that the classic Late Pleistocene modern human occupation sequence identified previously at Leang Burung 2, and proposed to span around 31,000 to 19,000 conventional 14C years BP (~35-24 ka cal BP), may actually represent an amalgam of reworked archaeological materials. Sources for cultural materials of mixed ages comprise breccias from the rear wall of the rock-shelter-remnants of older, eroded deposits dated to 35-23 ka cal BP-and cultural remains of early Holocene antiquity. Below the upper levels affected by the mass loss of Late Pleistocene deposits, our deep-trench excavations uncovered evidence for an earlier hominin presence at the site. These findings include fossils of now-extinct proboscideans and other 'megafauna' in stratified context, as well as a cobble-based stone artifact technology comparable to that produced by late Middle Pleistocene hominins elsewhere on Sulawesi.

  17. The Small Mammal Sequence from the c. 76 – 72 ka Still Bay Levels at Blombos Cave, South Africa – Taphonomic and Palaeoecological Implications for Human Behaviour

    PubMed Central

    Nel, Turid Hillestad; Henshilwood, Christopher Stuart

    2016-01-01

    The Still Bay, c. 76–72 ka, a prominent techno-tradition during the Middle Stone Age of southern Africa, has yielded innovative technologies, symbolic material culture, and shows evidence of expansion of hunting techniques and subsistence strategies. In this paper we present the results of the first systematic, taphonomic and palaeoenvironmental study of micromammals from the Still Bay levels at Blombos Cave. Our taphonomic analysis indicates that the micromammals were accumulated by avian predators occupying the cave. Post-depositional processes affecting the micromammal assemblage include organic waste decomposition and conditions associated with a limestone cave environment. The palaeoenvironmental reconstruction shows that Marine Isotope Stage (MIS) 5a at Blombos Cave had diverse micromammal communities occupying a variety of habitats and with rainfall pattern equal to present. The transition from MIS 5a to 4 is indicated by less diverse micromammal assemblages, increase in grassland and scrub vegetation, shifts in seasonal precipitation, and a decline in shrubs associated with fynbos. The onset of the glacial conditions associated with MIS 4 is visible in the micromammal assemblage. However humans occupying Blombos Cave during this c. 5 ka period showed an ability to cope with changing environmental conditions and were able to adapt and utilise a variety of available resources. PMID:27509023

  18. Molecular mechanism of the dual activity of 4EGI-1: Dissociating eIF4G from eIF4E but stabilizing the binding of unphosphorylated 4E-BP1

    DOE PAGES

    Sekiyama, Naotaka; Arthanari, Haribabu; Papadopoulos, Evangelos; ...

    2015-07-13

    The eIF4E-binding protein (4E-BP) is a phosphorylation-dependent regulator of protein synthesis. The nonphosphorylated or minimally phosphorylated form binds translation initiation factor 4E (eIF4E), preventing binding of eIF4G and the recruitment of the small ribosomal subunit. Signaling events stimulate serial phosphorylation of 4E-BP, primarily by mammalian target of rapamycin complex 1 (mTORC1) at residues T 37/T 46, followed by T 70 and S 65. Hyperphosphorylated 4E-BP dissociates from eIF4E, allowing eIF4E to interact with eIF4G and translation initiation to resume. Because overexpression of eIF4E is linked to cellular transformation, 4E-BP is a tumor suppressor, and up-regulation of its activity is amore » goal of interest for cancer therapy. A recently discovered small molecule, eIF4E/eIF4G interaction inhibitor 1 (4EGI-1), disrupts the eIF4E/eIF4G interaction and promotes binding of 4E-BP1 to eIF4E. Structures of 14- to 16-residue 4E-BP fragments bound to eIF4E contain the eIF4E consensus binding motif, 54YXXXXLΦ 60 (motif 1) but lack known phosphorylation sites. We report in this paper a 2.1-Å crystal structure of mouse eIF4E in complex with m 7GTP and with a fragment of human 4E-BP1, extended C-terminally from the consensus-binding motif (4E-BP1 50–84). The extension, which includes a proline-turn-helix segment (motif 2) followed by a loop of irregular structure, reveals the location of two phosphorylation sites (S 65 and T 70). Our major finding is that the C-terminal extension (motif 3) is critical to 4E-BP1–mediated cell cycle arrest and that it partially overlaps with the binding site of 4EGI-1. Finally, the binding of 4E-BP1 and 4EGI-1 to eIF4E is therefore not mutually exclusive, and both ligands contribute to shift the equilibrium toward the inhibition of translation initiation.« less

  19. Structure and characterization of a cDNA clone for phenylalanine ammonia-lyase from cut-injured roots of sweet potato

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki

    A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M{sub r} of its subunit was 77,000. The cells converted ({sup 14}C)-L-phenylalanine into ({sup 14}C)-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading framemore » capable of coding for a polypeptide with 707 amino acids (M{sub r} 77,137), a 22-bp 5{prime}-noncoding region and a 207-bp 3{prime}-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology.« less

  20. A 1-bp deletion in the gammaC-crystallin leads to dominant cataracts in mice.

    PubMed

    Zhao, Liya; Li, Kai; Bao, Shimin; Zhou, Yuxun; Liang, Yinming; Zhao, Guoji; Chen, Ye; Xiao, Junhua

    2010-08-01

    To date around 140 genetic alleles have been identified as being responsible for mouse cataract pathology, including Crya, Cryb, Cryg, Maf, Pax6, Pitx3, Sox, Connexins, MIP, and Lim-2. We obtained a dominant cataract mouse model from a spontaneous mutation in the F1 hybrids of outbred strain ICR mice crossed to the inbred strain BALB/cJ mice. Heterozygous and homozygous mutants expressed a nuclear cataract in both eyes. In 8-day-old mice, histological analysis showed that polygon epithelial cells were in the equatorial region and cortex underneath, and vacuole and sponge-like degeneration were in the cortical area underneath the posterior lens capsule. The nucleus of the lens was a deeply stained pink, with the shorter fibers losing their normal arrangement. For the entire eye, there was a blank zone in the equatorial region in 8-day-old mice; however, there was a certain degree of atrophy in cornea tension and retina in the lens in 3-month-old mice. The lens had been serious damaged in the homozygous mutants. For mutation mapping, heterozygous carriers were mated to wild-type C3H/HeJ mice, and offspring (F1 generation) with cataracts were backcrossed to the wild-type C3H/HeJ mice again. N2 mice with cataracts were used for genotyping. Using genome-wide linkage analysis, the mutation was mapped to chromosome 1 and the Cryg gene cluster between two markers was confirmed as the candidate gene. After direct sequencing the cDNA of the Cryg gene cluster, a 1-bp deletion was found in exon 3 of the Crygc gene, leading to a stop codon at the 76th amino acid of exon 3 which results in production of a truncated protein in mutant mice (Leu160Stop). Bioinformatic analysis of the mutant gammaC-crystallin reveals that the COOH-terminal of the mutant protein deletes a beta-sheet, which affects the function of the lens proteins and leads to the development of cataracts.

  1. Mass spectroscopic phosphoprotein mapping of Ral Binding protein 1 (RalBP1/Rip1/RLIP76)

    PubMed Central

    Herlevsen, Mikael C; Theodorescu, Dan

    2009-01-01

    RalBP1, a multifunctional protein implicated in cancer cell proliferation, radiation and chemoresistance and ligand dependent receptor internalization, is upregulated in bladder cancer and is a downstream effector of RalB, a GTPase associated with metastasis. RalBP1 can be regulated by phosphorylation by protein kinase C (PKC). No studies have comprehensively mapped RalBP1 phosphorylation sites or whether RalB affects these. We identified fourteen phosphorylation sites of RalBP1 in human bladder carcinoma UMUC-3 and embryonic kidney derived 293T cells. The phosphorylated residues are concentrated at the N-terminus. Ten of the first 100 amino acids of the primary structure were phosphorylated. Nine were serine residues, and one a threonine. We evaluated the effect of RalB overexpression on RalBP1 phosphorylation and found the largest change in phosphorylation status at S463 and S645. Further characterization of these sites will provide novel insights on RalBP1 biology, its functional relationship to RalB and possible avenues for therapeutic intervention. PMID:17706599

  2. Microdeletion/microduplication of proximal 15q11.2 between BP1 and BP2: a susceptibility region for neurological dysfunction including developmental and language delay.

    PubMed

    Burnside, Rachel D; Pasion, Romela; Mikhail, Fady M; Carroll, Andrew J; Robin, Nathaniel H; Youngs, Erin L; Gadi, Inder K; Keitges, Elizabeth; Jaswaney, Vikram L; Papenhausen, Peter R; Potluri, Venkateswara R; Risheg, Hiba; Rush, Brooke; Smith, Janice L; Schwartz, Stuart; Tepperberg, James H; Butler, Merlin G

    2011-10-01

    The proximal long arm of chromosome 15 has segmental duplications located at breakpoints BP1-BP5 that mediate the generation of NAHR-related microdeletions and microduplications. The classical Prader-Willi/Angelman syndrome deletion is flanked by either of the proximal BP1 or BP2 breakpoints and the distal BP3 breakpoint. The larger Type I deletions are flanked by BP1 and BP3 in both Prader-Willi and Angelman syndrome subjects. Those with this deletion are reported to have a more severe phenotype than individuals with either Type II deletions (BP2-BP3) or uniparental disomy 15. The BP1-BP2 region spans approximately 500 kb and contains four evolutionarily conserved genes that are not imprinted. Reports of mutations or disturbed expression of these genes appear to impact behavioral and neurological function in affected individuals. Recently, reports of deletions and duplications flanked by BP1 and BP2 suggest an association with speech and motor delays, behavioral problems, seizures, and autism. We present a large cohort of subjects with copy number alteration of BP1 to BP2 with common phenotypic features. These include autism, developmental delay, motor and language delays, and behavioral problems, which were present in both cytogenetic groups. Parental studies demonstrated phenotypically normal carriers in several instances, and mildly affected carriers in others, complicating phenotypic association and/or causality. Possible explanations for these results include reduced penetrance, altered gene dosage on a particular genetic background, or a susceptibility region as reported for other areas of the genome implicated in autism and behavior disturbances.

  3. Profile of NF-κBp(65/NFκBp50) among prostate specific antigen sera levels in prostatic pathologies.

    PubMed

    Bouraoui, Y; Ben Jemaa, A; Rodriguez, G; Ben Rais, N; Fraile, B; Paniagua, R; Sellemi, S; Royuela, M; Oueslati, R

    2012-10-01

    The aim of this work was to characterise the immunoexpression of NF-κB (p50/p65) in human prostatic pathologies and to study its profiles of activation among sera prostate specific antigen antigen (PSA) according the three groups: 0-4ng/mL, 4-20ng/mL and >20ng/mL. Twenty-four men with benign prostate hyperplasia (BPH); 19 men with prostate cancer (PC) and five men with normal prostates (NP). Immunohistochemical and western blot analysis was performed. Serum levels of PSA were assayed by immulite autoanalyser. In BPH and PC samples, immunoexpressions were observed for NF-κBp65 and NF-κBp50; while in NP samples, only were detected NF-κBp50. PC samples showed immunoreactions to NF-κBp65 and NF-κBp50 more intense (respectively 24.18±0.67 and 28.23±2.01) than that observed in BPH samples (respectively18.46±2.04 and 18.66±1.59) with special localisation in the nucleus. Different profiles of NF-κBp65 immunoexpressions were observed and BPH patients with sera PSA levels between 0-4ng/mL presented a significant weak percentage compared to BPH patients with sera PSA levels between 4-20ng/mL and >20ng/mL. No immunoreactions to NF-κBp65 were observed in PC patients with sera PSA levels between 4-20ng/mL. The sensibility of both NF-κB and PSA to inflammation allowed confirming the relationship between these two molecules and its involvement in prostatic diseases progression (inflammatory and neoplasic). Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  4. Geochemical properties and environmental impacts of seven Campanian tephra layers deposited between 40 and 38 ka BP in the varved lake sediments of Lago Grande di Monticchio, southern Italy

    NASA Astrophysics Data System (ADS)

    Wutke, Kristina; Wulf, Sabine; Tomlinson, Emma L.; Hardiman, Mark; Dulski, Peter; Luterbacher, Jürg; Brauer, Achim

    2015-06-01

    We present the results of new tephrostratigraphical and environmental impact studies of the 40-38 ka varved sediment section of Lago Grande di Monticchio (southern Italy). The sediments in this time zone are correlated with the Heinrich H4-stadial that occurred between Greenland Interstadials GI-9 and GI-8, and include the widespread Campanian Ignimbrite (CI, 39.3 ka) as a thick tephra layer in the middle of the H4 stadial. The CI in the Monticchio record is overlain by the Schiava tephra from Vesuvius, c. 1240 varve-years younger than the CI, and preceded by four tephras from small-scale eruptions of the Phlegrean Fields and by an Ischia-derived tephra. The four Phlegrean Field-derived tephras were deposited 600 varve-years or fewer prior to the deposition of the CI and show very similar major, minor, and trace element glass compositions to those of the CI. This close similarity in composition and age could compromise the accurate linking and synchronisation of palaeoenvironmental records in the central Mediterranean area. Microfacies analyses and μ-XRF core scanning were used to characterise primary and secondary depositional features of all seven tephra layers and to evaluate environmental and ecological responses after tephra deposition. Higher concentrations of tephra-derived material (mainly glass shards and pumices) in primary and reworked layers were detected by elevated K-counts in μ-XRF elemental core scans. Reworked tephra derives mainly from in-washing from the littoral zone and the catchment and occurs within five to 30 years, and up to 1240 varve years, after the deposition of thinner (1-5 mm) and thicker (5-230 mm) tephra fallout deposits, respectively. An obvious response of diatom population growth directly after the primary tephra deposition was observed for the thicker tephra layers (>1 mm) during the first 1-8 years after deposition of the primary deposit indicating that the additional input of potential nutrients (glass shards) temporarily

  5. Performance evolution of 60 kA HTS cable prototypes in the EDIPO test facility

    NASA Astrophysics Data System (ADS)

    Bykovsky, N.; Uglietti, D.; Sedlak, K.; Stepanov, B.; Wesche, R.; Bruzzone, P.

    2016-08-01

    During the first test campaign of the 60 kA HTS cable prototypes in the EDIPO test facility, the feasibility of a novel HTS fusion cable concept proposed at the EPFL Swiss Plasma Center (SPC) was successfully demonstrated. While the measured DC performance of the prototypes at magnetic fields from 8 T to 12 T and for currents from 30 kA to 70 kA was close to the expected one, an initial electromagnetic cycling test (1000 cycles) revealed progressive degradation of the performance in both the SuperPower and SuperOx conductors. Aiming to understand the reasons for the degradation, additional cycling (1000 cycles) and warm up-cool down tests were performed during the second test campaign. I c performance degradation of the SuperOx conductor reached ∼20% after about 2000 cycles, which was reason to continue with a visual inspection of the conductor and further tests at 77 K. AC tests were carried out at 0 and 2 T background fields without transport current and at 10 T/50 kA operating conditions. Results obtained in DC and AC tests of the second test campaign are presented and compared with appropriate data published recently. Concluding the first iteration of the HTS cable development program at SPC, a summary and recommendations for the next activity within the HTS fusion cable project are also reported.

  6. Records from Lake Qinghai: Holocene climate history of Northeastern Tibetan Plateau linking to global change

    NASA Astrophysics Data System (ADS)

    An, Z.; Colman, S.; Zhou, W.; Brown, E.; Li, X.; Jull, T.; Wang, S.; Liu, W.; Sun, Y.; Lu, X.; Song, Y.; Chang, H.; Cai, Y.; Xu, H.; Wang, X.; Liu, X.; Wu, F.; Han, Y.; Cheng, P.; Ai, L.; Wang, Z.; Qiang, X.; Shen, J.; Zhu, Y.; Wu, Z.; Liu, X.

    2008-12-01

    records for East Asian monsoon and Indian monsoon show that, in accordance with Asian monsoon climate changes, at 11-5ka cal. 14C BP Lake Qinghai revealed the warm and humid Optimal climate, while since 5ka cal.14C BP the Lake showed relatively cold and dry climate of New Glaciation, this orbital climate trend resembled northern hemisphere summer solar insolation changes. Lake Qinghai millennial-centennial climate events in Holocene are linked with Westerlies changes, and with East Asian summer monsoon front shift as well as winter monsoon, on centennial-decadal scale Lake Qinghai climate changes are controlled more by solar activities.

  7. The impact of the BP Baker report.

    PubMed

    Rodríguez, Jennifer M; Payne, Stephanie C; Bergman, Mindy E; Beus, Jeremy M

    2011-06-01

    This study examined the impact of the British Petroleum (BP) Baker Panel Report, reviewing the March 2005 BP-Texas City explosion, on the field of process safety. Three hundred eighty-four subscribers of a process safety listserv responded to a survey two years after the BP Baker Report was published. Results revealed respondents in the field of process safety are familiar with the BP Baker Report, feel it is important to the future safety of chemical processing, and believe that the findings are generalizable to other plants beyond BP-Texas City. Respondents indicated that few organizations have administered the publicly available BP Process Safety Culture Survey. Our results also showed that perceptions of contractors varied depending on whether respondents were part of processing organizations (internal perspective) or government or consulting agencies (external perspective). This research provides some insight into the beliefs of chemical processing personnel regarding the transportability and generalizability of lessons learned from one organization to another. This study has implications for both organizational scientists and engineers in that it reveals perceptions about the primary mechanism used to share lessons learned within one industry about one major catastrophe (i.e., investigation reports). This study provides preliminary information about the perceived impact of a report such as this one. Copyright © 2011 National Safety Council and Elsevier Ltd. All rights reserved.

  8. Test of 60 kA coated conductor cable prototypes for fusion magnets

    NASA Astrophysics Data System (ADS)

    Uglietti, D.; Bykovsky, N.; Sedlak, K.; Stepanov, B.; Wesche, R.; Bruzzone, P.

    2015-12-01

    Coated conductors could be promising materials for the fabrication of the large magnet systems of future fusion devices. Two prototype conductors (flat cables in steel conduits), each about 2 m long, were manufactured using coated conductor tapes (4 mm wide) from Super Power and SuperOx, with a total tape length of 1.6 km. Each flat cable is assembled from 20 strands, each strand consisting of a stack of 16 tapes surrounded by two half circular copper profiles, twisted and soldered. The tapes were measured at 12 T and 4.2 K and the results of the measurements were used for the assessment of the conductor electromagnetic properties at low temperature and high field. The two conductors were assembled together in a sample that was tested in the European Dipole (EDIPO) facility. The current sharing temperatures of the two conductors were measured at background fields from 8 T up to 12 T and for currents from 30 kA up to 70 kA: the measured values are within a few percent of the values expected from the measurements on tapes (short samples). After electromagnetic cycling, T cs at 12 T and 50 kA decreased from about 12 K to 11 K (about 10%), corresponding to less than 3% of I c.

  9. The discovery of nonthermal radio emission from magnetic Bp-Ap stars

    NASA Technical Reports Server (NTRS)

    Drake, Stephen A.; Abbott, David C.; Bastian, T. S.; Bieging, J. H.; Churchwell, E.

    1987-01-01

    In a VLA survey of chemically peculiar B- and A-type stars with strong magnetic fields, five of the 34 stars observed have been identified as 6 cm continuum sources. Three of the detections are helium-strong early Bp stars (Sigma Ori E, HR 1890, and Delta Ori C), and two are helium weak, silicon-strong stars with spectral types near A0p (IQ Aur = HD 34452, Babcock's star = HD 215441). The 6 cm luminosities L6 (ergs/s Hz) range from log L6 = 16.2 to 17.9, somewhat less than the OB supergiants and W-R stars. Three-frequency observations indicate that the helium-strong Bp stars are variable nonthermal sources.

  10. 14 CFR Appendix C to Part 125 - Ice Protection

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 14 Aeronautics and Space 3 2014-01-01 2014-01-01 false Ice Protection C Appendix C to Part 125... OR MORE; AND RULES GOVERNING PERSONS ON BOARD SUCH AIRCRAFT Pt. 125, App. C Appendix C to Part 125... conditions as described in appendix C of part 25 of this chapter. (c) Compliance with all or portions of this...

  11. First Younger Dryas moraines in Greenland

    NASA Astrophysics Data System (ADS)

    Funder, Svend; Larsen, Nicolaj K.; Linge, Henriette; Möller, Per; Schomacker, Anders; Fabel, Derek; Kjær, Kurt H.; Xu, Sheng

    2016-04-01

    Over the Greenland ice sheet the Younger Dryas (YD) cold climate oscillation (12.9-11.7 kaBP) began with up to 10°C drop in temperatures and ended with up to 12°C abrupt warming. In the light of the present warming and melting of the ice sheet, and its importance for future climate change, the ice sheet's response to these dramatic changes in the past is of great interest. However, even though much effort has gone into charting YD ice margin behaviour around Greenland in recent years, no clear-cut signal of response to the oscillation has been uncovered. Here we show evidence to suggest that three major outlets from a local ice cap at Greenland's north coast advanced and retreated synchronously during YD. The evidence comprises OSL (optically stimulated luminescence) dates from a marine transgression of the coastal valleys that preceded the advance, and exposure ages from boulders on the moraines, formed by glaciers that overrode the marine sediment. The OSL ages suggest a maximum age of 12.4 ±0.6 kaBP for the marine incursion, and 10 exposure ages on boulders from the three moraines provide an average minimum age of 12.5 ±0.7 kaBP for the moraines, implying that the moraines were formed within the interval 11.8-13.0 kaBP. Elsewhere in Greenland evidence for readvance has been recorded in two areas. Most notably, in the East Greenland fjord zone outlet glaciers over a stretch of 800 km coast advanced through the fjords. In Scoresby Sund, where the moraines form a wide belt, an extensive 14C and exposure dating programme has shown that the readvance here probably culminated before YD, while cessation of moraine formation and rapid retreat from the moraine belt did not commence until c. 11.5 kaBP, but no moraines have so far been dated to YD. Readvance is also seen in Disko Bugt, the largest ice sheet outlet in West Greenland. However, here the advance and retreat of the ice stream took place in mid YD times, and lasted only a few hundred years, while YD in

  12. Global calibration/validation of 2 years of SARAL/AltiKa data

    NASA Astrophysics Data System (ADS)

    Scharroo, Remko; Lillibridge, John; Leuliette, Eric; Bonekamp, Hans

    2015-04-01

    The AltiKa altimeter flying onboard the French/Indian SARAL satellite provides the first opportunity to examine Ka-band measurements of sea surface height, significant wave height and ocean surface wind speed. In this presentation we provide the results from our global calibration/validation analysis of the AltiKa measurements, with an emphasis on near real-time applications of interest to both EUMETSAT and NOAA. Traditional along-track SSHA, and single as well as dual-satellite crossover assessments of the AltiKa performance are be provided. Unique aspects of the AltiKa mission such as improved along-track resolution, reduced ionospheric path delay corrections, mission-specific wind speed and sea state bias corrections, and sensitivity to liquid moisture and rain are also explored. In February 2014, a major update to the ground processing was introduced. "Patch-2" improved the way wind speed was derived from altimeter backscatter, as suggested by Lillibridge et al. (1). The backscatter attenuation is now derived from the radiometer measurements via neural network algorithms, which also determine the wet tropospheric correction. We emphasize these improvements in our analysis. After 2 years in flight, SARAL/AltiKa is already providing a significant contribution to the constellation of operational radar altimetry missions, demonstrating the large benefits of high-rate Ka-band altimetry. (1) Lillibridge, John, Remko Scharroo, Saleh Abdalla, Doug Vandemark, 2014: One- and Two-Dimensional Wind Speed Models for Ka-Band Altimetry. J. Atmos. Oceanic Technol., 31, 630-638. doi: http://dx.doi.org/10.1175/JTECH-D-13-00167.1

  13. Sedimentary evidence of landscape and climate history since the end of MIS 3 in the Krkonoše Mountains, Czech Republic

    NASA Astrophysics Data System (ADS)

    Engel, Zbyněk; Nývlt, Daniel; Křížek, Marek; Treml, Václav; Jankovská, Vlasta; Lisá, Lenka

    2010-04-01

    A sedimentary core recovered from the cirque basin of Labský důl valley (1039 m a.s.l.) in the Krkonoše Mountains reflects the environmental history for approximately the last 30,000 years. Analyses of magnetic susceptibility, carbon content, pollen assemblages and macrofossil data in a 15 m thick sediment sequence provide the first continuous record of Lateglacial and Holocene vegetation history in Sudetes region of the Czech Republic. The succession of sedimentary units in the lower part of the core suggests that the cirque was ice-free before the onset of the last glaciation at the beginning of marine isotope stage 2. Highly variable climate prevailed during this period with cold conditions culminating about 18 cal ka BP. Cold climates persisted until the Lateglacial period, evidenced by an identified warming and subsequent cooling event correlated with the Younger Dryas period. Sparse, treeless vegetation dominated in the catchment area at that time. The sequence of interrupted thinly laminated silts reflects the retreat and temporary readvance of a local glacier in the cirque during 12.5-10.8 cal ka BP. Subsequently, the alpine treeline ecotone gradually shifted above the cirque floor. Palaeoclimatic conditions in the early Holocene fluctuated strongly, whereas since 5.1 cal ka BP conditions have been more stable. Pollen-based climate reconstructions suggest significant cooling at around 9.8-9.3, 7.7-7.5 and 4.0-3.3 cal ka BP. Spruce forests have dominated the site since 5.0 cal ka BP when the vegetation became similar to the modern one. Two phases of increased sedimentation were identified within the Holocene culminating about 9.2-7.5 cal ka BP and 5.8-5.5 cal ka BP. Sediment yield was as high as 2.4 mm yr -1 during the period, reflecting environmental changes during the Atlantic/Sub-Boreal transition.

  14. BP5 monolayer with multiferroicity and negative Poisson’s ratio: a prediction by global optimization method

    NASA Astrophysics Data System (ADS)

    Wang, Haidi; Li, Xingxing; Sun, Jiuyu; Liu, Zhao; Yang, Jinlong

    2017-12-01

    Based on global optimization Cuttlefish algorithm, we predict a stable two-dimensional (2D) phase of boron phosphide with 1:5 stoichiometry, i.e. boron pentaphosphide (BP5) monolayer, which has a lower formation energy than that of the commonly believed graphitic phase (g-BP). BP5 monolayer is a multiferroic material with coupled ferroelasticity and ferroelectricity. The predicted reversible strain is up to 41.41%, which is the largest one among all reported ferroelastic materials. Due to the non-centrosymmetric structure and electronegativity differences between boron and phosphorus atoms, an in-plane spontaneous polarization of 1.63  ×  10-10 C m-1 occurs in BP5. Moreover, the recently hunted negative Poisson’s ratio property, is also observed in BP5. As an indirect semiconductor with a band gap of 1.34 eV, BP5 displays outstanding optical and electronic properties, for instance strongly anisotropic visible-light absorption and high carrier mobility. Finally, we demonstrate that AlN (0 1 0) surface could be a suitable substrate for epitaxy growth of BP5 monolayer. Due to the rich and extraordinary properties of BP5, it’s considered to be a potential nanomaterial for designing electromechanical or optoelectronic devices, such as nonvolatile memory with conveniently readable/writeable capability.

  15. The George C. Marshall Space Flight Center's 14 X 14-Inch Trisonic Wind Tunnel: A Historical Perspective

    NASA Technical Reports Server (NTRS)

    Springer, A.

    1994-01-01

    A history of the National Aeronautics and Space Administration (NASA) George C. Marshall Space Flight Center's (MSFC) 14 x 14-Inch Trisonic Wind Tunnel is presented. Its early and continuing role in the United States space program is shown through highlights of the tunnel's history and the major programs tested in the tunnel over the past 40 years. The 14-Inch Tunnel has its beginning with the Army in the late 1950's under the Army Ballistic Missile Agency (ABMA). Such programs as the Redstone, Jupiter, Pershing, and early Saturn were tested in the 14-Inch Tunnel in the late 1950's. America's first launch vehicle, the Jupiter C, was designed and developed using the 14-Inch Wind Tunnel. Under NASA, the 14-Inch Wind Tunnel has made large contributions to the Saturn, Space Transportation System, and future launch vehicle programs such as Shuttle-C and the National Launch System. A technical description of the tunnel is presented for background information on the type and capabilities of the 14-Inch Wind Tunnel. The report concludes in stating: the 14-Inch Wind Tunnel as in speed of sound; transonic, at or near the speed of sound the past, will continue to play a large but unseen role in he development of America's space program.

  16. Tissue Distribution and Metabolism of Aflatoxin B1-14C in Broiler Chickens

    PubMed Central

    Mabee, Michael S.; Chipley, John R.

    1973-01-01

    The effects of administering low levels of aflatoxin B1-14C by crop intubation daily for 14 days to broiler chickens were determined. Studies on the distribution of 14C in the blood, selected organs, tissues, and excreta were conducted. No toxic effects were observed in broiler chickens during the 14 days of the experiment. The broiler chickens excreted 90.64% of the 14C administered. Of the 14C retained, 11.04, 9.83, 4.30, 12.52, 31.66, and 30.63% were detected in the blood, liver, heart, gizzard, breast, and leg, respectively. Chemical assay of those samples demonstrating radioactivity revealed that 81.2% of the radioactivity in these substrates was not extractable by classical extraction procedures while approximately 10% was extractable. Treatment of aqueous extracts for conjugated steroids by treatments with beta-glucuronidase revealed that 31.5% of the 14C detected in the aqueous extract was a liberated glucuronide conjugate of aflatoxin M1-14C. PMID:4715554

  17. Human (Clovis)–gomphothere (Cuvieronius sp.) association ∼13,390 calibrated yBP in Sonora, Mexico

    PubMed Central

    Sanchez, Guadalupe; Holliday, Vance T.; Gaines, Edmund P.; Arroyo-Cabrales, Joaquín; Martínez-Tagüeña, Natalia; Kowler, Andrew; Lange, Todd; Hodgins, Gregory W. L.; Mentzer, Susan M.; Sanchez-Morales, Ismael

    2014-01-01

    The earliest known foragers to populate most of North America south of the glaciers [∼11,500 to ≥ ∼10,800 14C yBP; ∼13,300 to ∼12,800 calibrated (Cal) years] made distinctive “Clovis” artifacts. They are stereotypically characterized as hunters of Pleistocene megamammals (mostly mammoth) who entered the continent via Beringia and an ice-free corridor in Canada. The origins of Clovis technology are unclear, however, with no obvious evidence of a predecessor to the north. Here we present evidence for Clovis hunting and habitation ∼11,550 yBP (∼13,390 Cal years) at “El Fin del Mundo,” an archaeological site in Sonora, northwestern Mexico. The site also includes the first evidence to our knowledge for gomphothere (Cuvieronius sp.) as Clovis prey, otherwise unknown in the North American archaeological record and terminal Pleistocene paleontological record. These data (i) broaden the age and geographic range for Clovis, establishing El Fin del Mundo as one of the oldest and southernmost in situ Clovis sites, supporting the hypothesis that Clovis had its origins well south of the gateways into the continent, and (ii) expand the make-up of the North American megafauna community just before extinction. PMID:25024193

  18. Best of both worlds: combining pharma data and state of the art modeling technology to improve in Silico pKa prediction.

    PubMed

    Fraczkiewicz, Robert; Lobell, Mario; Göller, Andreas H; Krenz, Ursula; Schoenneis, Rolf; Clark, Robert D; Hillisch, Alexander

    2015-02-23

    In a unique collaboration between a software company and a pharmaceutical company, we were able to develop a new in silico pKa prediction tool with outstanding prediction quality. An existing pKa prediction method from Simulations Plus based on artificial neural network ensembles (ANNE), microstates analysis, and literature data was retrained with a large homogeneous data set of drug-like molecules from Bayer. The new model was thus built with curated sets of ∼14,000 literature pKa values (∼11,000 compounds, representing literature chemical space) and ∼19,500 pKa values experimentally determined at Bayer Pharma (∼16,000 compounds, representing industry chemical space). Model validation was performed with several test sets consisting of a total of ∼31,000 new pKa values measured at Bayer. For the largest and most difficult test set with >16,000 pKa values that were not used for training, the original model achieved a mean absolute error (MAE) of 0.72, root-mean-square error (RMSE) of 0.94, and squared correlation coefficient (R(2)) of 0.87. The new model achieves significantly improved prediction statistics, with MAE = 0.50, RMSE = 0.67, and R(2) = 0.93. It is commercially available as part of the Simulations Plus ADMET Predictor release 7.0. Good predictions are only of value when delivered effectively to those who can use them. The new pKa prediction model has been integrated into Pipeline Pilot and the PharmacophorInformatics (PIx) platform used by scientists at Bayer Pharma. Different output formats allow customized application by medicinal chemists, physical chemists, and computational chemists.

  19. 14 CFR Appendix C to Part 29 - Icing Certification

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Icing Certification C Appendix C to Part 29 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY ROTORCRAFT Pt. 29, App. C Appendix C to Part 29—Icing Certification (a...

  20. Computing pKa Values in Different Solvents by Electrostatic Transformation.

    PubMed

    Rossini, Emanuele; Netz, Roland R; Knapp, Ernst-Walter

    2016-07-12

    We introduce a method that requires only moderate computational effort to compute pKa values of small molecules in different solvents with an average accuracy of better than 0.7 pH units. With a known pKa value in one solvent, the electrostatic transform method computes the pKa value in any other solvent if the proton solvation energy is known in both considered solvents. To apply the electrostatic transform method to a molecule, the electrostatic solvation energies of the protonated and deprotonated molecular species are computed in the two considered solvents using a dielectric continuum to describe the solvent. This is demonstrated for 30 molecules belonging to 10 different molecular families by considering 77 measured pKa values in 4 different solvents: water, acetonitrile, dimethyl sulfoxide, and methanol. The electrostatic transform method can be applied to any other solvent if the proton solvation energy is known. It is exclusively based on physicochemical principles, not using any empirical fetch factors or explicit solvent molecules, to obtain agreement with measured pKa values and is therefore ready to be generalized to other solute molecules and solvents. From the computed pKa values, we obtained relative proton solvation energies, which agree very well with the proton solvation energies computed recently by ab initio methods, and used these energies in the present study.