High affinity kainate receptor subunits are necessary for ionotropic but not metabotropic signaling
Fernandes, Herman B.; Catches, Justin S.; Petralia, Ronald S.; Copits, Bryan A.; Xu, Jian; Russell, Theron A.; Swanson, Geoffrey T.; Contractor, Anis
2009-01-01
Summary Kainate receptors are atypical members of the glutamate receptor family which are able to signal through both ionotropic and metabotropic pathways. Of the five individual kainate receptor subunits the high-affinity subunits, GluK4 (KA1) and GluK5 (KA2), are unique in that they do not form functional homomeric receptors in recombinant expression systems, but combine with the primary subunits GluK1-3 (GluR5-7) to form heteromeric assemblies. Here we generated a GluK4 mutant mouse by disrupting the Grik4 gene locus. We found that loss of the GluK4 subunit leads to a significant reduction in synaptic kainate receptor currents. Moreover, ablation of both high-affinity subunits in GluK4/GluK5 double knockout mice leads to a complete loss of pre- and postsynaptic ionotropic function of synaptic kainate receptors. The principal subunits remain at the synaptic plasma membrane, but are distributed away from postsynaptic densities and presynaptic active zones. There is also an alteration in the properties of the remaining kainate receptors, as kainic acid application fails to elicit responses in GluK4/GluK5 knockout neurons. Despite the lack of detectable ionotropic synaptic receptors, the kainate receptor-mediated inhibition of the slow afterhyperpolarization current (IsAHP), which is dependent on metabotropic pathways, was intact in GluK4/GluK5 knockout mice. These results uncover a previously unknown critical role for the high-affinity kainate receptor subunits as obligatory components of ionotropic kainate receptor function, and further, demonstrate that kainate receptor participation in metabotropic signaling pathways does not require their classic role as ion channels. PMID:19778510
High-affinity kainate receptor subunits are necessary for ionotropic but not metabotropic signaling.
Fernandes, Herman B; Catches, Justin S; Petralia, Ronald S; Copits, Bryan A; Xu, Jian; Russell, Theron A; Swanson, Geoffrey T; Contractor, Anis
2009-09-24
Kainate receptors signal through both ionotropic and metabotropic pathways. The high-affinity subunits, GluK4 and GluK5, are unique among the five receptor subunits, as they do not form homomeric receptors but modify the properties of heteromeric assemblies. Disruption of the Grik4 gene locus resulted in a significant reduction in synaptic kainate receptor currents. Moreover, ablation of GluK4 and GluK5 caused complete loss of synaptic ionotropic kainate receptor function. The principal subunits were distributed away from postsynaptic densities and presynaptic active zones. There was also a profound alteration in the activation properties of the remaining kainate receptors. Despite this, kainate receptor-mediated inhibition of the slow afterhyperpolarization current (I(sAHP)), which is dependent on metabotropic pathways, was intact in GluK4/GluK5 knockout mice. These results uncover a previously unknown obligatory role for the high-affinity subunits for ionotropic kainate receptor function and further demonstrate that kainate receptor participation in metabotropic signaling pathways does not require their classic role as ion channels.
Dancing partners at the synapse: auxiliary subunits that shape kainate receptor function
Copits, Bryan A.; Swanson, Geoffrey T.
2012-01-01
Kainate receptors are a family of ionotropic glutamate receptors whose physiological roles differ from those of other subtypes of glutamate receptors in that they predominantly serve as modulators, rather than mediators, of synaptic transmission. Neuronal kainate receptors exhibit unusually slow kinetic properties that have been difficult to reconcile with the behaviour of recombinant kainate receptors. Recently, however, the neuropilin and tolloid-like 1 (NETO1) and NETO2 proteins were identified as auxiliary kainate receptor subunits that shape both the biophysical properties and synaptic localization of these receptors. PMID:22948074
Functional kainate-selective glutamate receptors in cultured hippocampal neurons.
Lerma, J; Paternain, A V; Naranjo, J R; Mellström, B
1993-12-15
Glutamate mediates fast synaptic transmission at the majority of excitatory synapses throughout the central nervous system by interacting with different types of receptor channels. Cloning of glutamate receptors has provided evidence for the existence of several structurally related subunit families, each composed of several members. It has been proposed that KA1 and KA2 and GluR-5, GluR-6, and GluR-7 families represent subunit classes of high-affinity kainate receptors and that in vivo different kainate receptor subtypes might be constructed from these subunits in heteromeric assembly. However, despite some indications from autoradiographic studies and binding data in brain membranes, no functional pure kainate receptors have so far been detected in brain cells. We have found that early after culturing, a high percentage of rat hippocampal neurons express functional, kainate-selective glutamate receptors. These kainate receptors show pronounced desensitization with fast onset and very slow recovery and are also activated by quisqualate and domoate, but not by alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate. Our results provide evidence for the existence of functional glutamate receptors of the kainate type in nerve cells, which are likely to be native homomeric GluR-6 receptors.
Functional kainate-selective glutamate receptors in cultured hippocampal neurons.
Lerma, J; Paternain, A V; Naranjo, J R; Mellström, B
1993-01-01
Glutamate mediates fast synaptic transmission at the majority of excitatory synapses throughout the central nervous system by interacting with different types of receptor channels. Cloning of glutamate receptors has provided evidence for the existence of several structurally related subunit families, each composed of several members. It has been proposed that KA1 and KA2 and GluR-5, GluR-6, and GluR-7 families represent subunit classes of high-affinity kainate receptors and that in vivo different kainate receptor subtypes might be constructed from these subunits in heteromeric assembly. However, despite some indications from autoradiographic studies and binding data in brain membranes, no functional pure kainate receptors have so far been detected in brain cells. We have found that early after culturing, a high percentage of rat hippocampal neurons express functional, kainate-selective glutamate receptors. These kainate receptors show pronounced desensitization with fast onset and very slow recovery and are also activated by quisqualate and domoate, but not by alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate. Our results provide evidence for the existence of functional glutamate receptors of the kainate type in nerve cells, which are likely to be native homomeric GluR-6 receptors. PMID:7505445
Contractor, A; Swanson, G T; Sailer, A; O'Gorman, S; Heinemann, S F
2000-11-15
To understand the physiological role of kainate receptors and their participation in seizure induction in animal models of epilepsy, it will be necessary to develop a comprehensive description of their action in the CA3 region of the hippocampus. Activation of presynaptic kainate receptors depresses excitatory synaptic transmission at mossy fiber and associational-commissural inputs to CA3 pyramidal neurons (Vignes et al., 1998; Bortolotto et al., 1999; Kamiya and Ozawa, 2000). In this study, we use gene-targeted mice lacking glutamate receptor 5 (GluR5) or GluR6 kainate receptor subunits to identify the receptor subunits that comprise the kainate receptors responsible for presynaptic modulation of CA3 transmission. We found that bath application of kainate (3 microm) profoundly reduced EPSCs at mossy fiber and collateral synapses in neurons from wild-type and GluR5(-/-) mice but had no effect on EPSCs in neurons from GluR6(-/-) mice. These results therefore contrast with previous studies that supported a role for GluR5-containing receptors at mossy fiber and associational-commissural synapses (Vignes et al., 1998; Bortolotto et al., 1999). Surprisingly, at perforant path synapses kainate receptor activation enhanced transmission; this potentiation was abolished in both GluR5 and GluR6 knock-out mice. Kainate receptors thus play multiple and complex roles to modulate excitatory synaptic transmission in the CA3 region of the hippocampus.
Paternain, A V; Morales, M; Lerma, J
1995-01-01
Although both protein and mRNAs for kainate receptor subunits are abundant in several brain regions, the responsiveness of AMPA receptors to kainate has made it difficult to demonstrate the presence of functional kainate-type receptors in native cells. Recently, however, we have shown that many hippocampal neurons in culture express glutamate receptors of the kainate type. The large nondesensitizing response that kainate induces at AMPA receptors precludes detection and analysis of smaller, rapidly desensitizing currents induced by kainate at kainate receptors. Consequently, the functional significance of these strongly desensitizing glutamate receptors remains enigmatic. We report here that the family of new noncompetitive antagonists of AMPA receptors (GYKI 52466 and 53655) minimally affects kainate-induced responses at kainate receptors while completely blocking AMPA receptor-mediated currents, making it possible to separate the responses mediated by each receptor. These compounds will allow determination of the role played by kainate receptors in synaptic transmission and plasticity in the mammalian brain, as well as evaluation of their involvement in neurotoxicity.
Xu, Jian; Marshall, John J; Fernandes, Herman B; Nomura, Toshihiro; Copits, Bryan A; Procissi, Daniele; Mori, Susumu; Wang, Lei; Zhu, Yongling; Swanson, Geoffrey T; Contractor, Anis
2017-02-21
Kainate receptors are members of the glutamate receptor family that regulate synaptic function in the brain. They modulate synaptic transmission and the excitability of neurons; however, their contributions to neural circuits that underlie behavior are unclear. To understand the net impact of kainate receptor signaling, we generated knockout mice in which all five kainate receptor subunits were ablated (5ko). These mice displayed compulsive and perseverative behaviors, including over-grooming, as well as motor problems, indicative of alterations in striatal circuits. There were deficits in corticostriatal input to spiny projection neurons (SPNs) in the dorsal striatum and correlated reductions in spine density. The behavioral alterations were not present in mice only lacking the primary receptor subunit expressed in adult striatum (GluK2 KO), suggesting that signaling through multiple receptor types is required for proper striatal function. This demonstrates that alterations in striatal function dominate the behavioral phenotype in mice without kainate receptors. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Kainate receptors coming of age: milestones of two decades of research
Contractor, Anis; Mulle, Christophe; Swanson, Geoffrey T
2011-01-01
Two decades have passed since the first report of the cloning of a kainate receptor (KAR) subunit. The intervening years have seen a rapid growth in our understanding of the biophysical properties and function of kainate receptors in the brain. This research has led to an appreciation that kainate receptors play quite distinct roles at synapses relative to other members of the glutamate-gated ion channel receptor family, despite structural and functional commonalities. The surprisingly diverse and complex nature of KAR signaling underlies their unique impact on neuronal networks through their direct and indirect effects on synaptic transmission, and their prominent role in regulating cellular excitability. This review pieces together highlights from the two decades of research subsequent to the cloning of the first subunit, and provides an overview of our current understanding of the role of KARs in the CNS and their potential importance to neurological and neuropsychiatric disorders. PMID:21256604
NASA Technical Reports Server (NTRS)
Stegenga, S. L.; Kalb, R. G.
2001-01-01
Spinal motor neurons undergo experience-dependent development during a critical period in early postnatal life. It has been suggested that the repertoire of glutamate receptor subunits differs between young and mature motor neurons and contributes to this activity-dependent development. In the present study we examined the expression patterns of N-methyl-D-aspartate- and kainate-type glutamate receptor subunits during the postnatal maturation of the spinal cord. Young motor neurons express much higher levels of the N-methyl-D-aspartate receptor subunit NR1 than do adult motor neurons. Although there are eight potential splice variants of NR1, only a subgroup is expressed by motor neurons. With respect to NR2 receptor subunits, young motor neurons express NR2A and C, while adult motor neurons express only NR2A. Young motor neurons express kainate receptor subunits GluR5, 6 and KA2 but we are unable to detect these or any other kainate receptor subunits in the adult spinal cord. Other spinal cord regions display a distinct pattern of developmental regulation of N-methyl-D-aspartate and kainate receptor subunit expression in comparison to motor neurons. Our findings indicate a precise spatio-temporal regulation of individual subunit expression in the developing spinal cord. Specific combinations of subunits in developing neurons influence their excitable properties and could participate in the emergence of adult neuronal form and function.
Kainate receptor pore‐forming and auxiliary subunits regulate channel block by a novel mechanism
Brown, Patricia M. G. E.; Aurousseau, Mark R. P.; Musgaard, Maria; Biggin, Philip C.
2016-01-01
Key points Kainate receptor heteromerization and auxiliary subunits, Neto1 and Neto2, attenuate polyamine ion‐channel block by facilitating blocker permeation.Relief of polyamine block in GluK2/GluK5 heteromers results from a key proline residue that produces architectural changes in the channel pore α‐helical region.Auxiliary subunits exert an additive effect to heteromerization, and thus relief of polyamine block is due to a different mechanism.Our findings have broad implications for work on polyamine block of other cation‐selective ion channels. Abstract Channel block and permeation by cytoplasmic polyamines is a common feature of many cation‐selective ion channels. Although the channel block mechanism has been studied extensively, polyamine permeation has been considered less significant as it occurs at extreme positive membrane potentials. Here, we show that kainate receptor (KAR) heteromerization and association with auxiliary proteins, Neto1 and Neto2, attenuate polyamine block by enhancing blocker permeation. Consequently, polyamine permeation and unblock occur at more negative and physiologically relevant membrane potentials. In GluK2/GluK5 heteromers, enhanced permeation is due to a single proline residue in GluK5 that alters the dynamics of the α‐helical region of the selectivity filter. The effect of auxiliary proteins is additive, and therefore the structural basis of polyamine permeation and unblock is through a different mechanism. As native receptors are thought to assemble as heteromers in complex with auxiliary proteins, our data identify an unappreciated impact of polyamine permeation in shaping the signalling properties of neuronal KARs and point to a structural mechanism that may be shared amongst other cation‐selective ion channels. PMID:26682513
Preferential assembly of heteromeric kainate and AMPA receptor amino terminal domains
Lomash, Suvendu; Chittori, Sagar; Glasser, Carla
2017-01-01
Ion conductivity and the gating characteristics of tetrameric glutamate receptor ion channels are determined by their subunit composition. Competitive homo- and hetero-dimerization of their amino-terminal domains (ATDs) is a key step controlling assembly. Here we measured systematically the thermodynamic stabilities of homodimers and heterodimers of kainate and AMPA receptors using fluorescence-detected sedimentation velocity analytical ultracentrifugation. Measured affinities span many orders of magnitude, and complexes show large differences in kinetic stabilities. The association of kainate receptor ATD dimers is generally weaker than the association of AMPA receptor ATD dimers, but both show a general pattern of increased heterodimer stability as compared to the homodimers of their constituents, matching well physiologically observed receptor combinations. The free energy maps of AMPA and kainate receptor ATD dimers provide a framework for the interpretation of observed receptor subtype combinations and possible assembly pathways. PMID:29058671
Preferential assembly of heteromeric kainate and AMPA receptor amino terminal domains.
Zhao, Huaying; Lomash, Suvendu; Chittori, Sagar; Glasser, Carla; Mayer, Mark L; Schuck, Peter
2017-10-23
Ion conductivity and the gating characteristics of tetrameric glutamate receptor ion channels are determined by their subunit composition. Competitive homo- and hetero-dimerization of their amino-terminal domains (ATDs) is a key step controlling assembly. Here we measured systematically the thermodynamic stabilities of homodimers and heterodimers of kainate and AMPA receptors using fluorescence-detected sedimentation velocity analytical ultracentrifugation. Measured affinities span many orders of magnitude, and complexes show large differences in kinetic stabilities. The association of kainate receptor ATD dimers is generally weaker than the association of AMPA receptor ATD dimers, but both show a general pattern of increased heterodimer stability as compared to the homodimers of their constituents, matching well physiologically observed receptor combinations. The free energy maps of AMPA and kainate receptor ATD dimers provide a framework for the interpretation of observed receptor subtype combinations and possible assembly pathways.
Tucholski, Janusz; Simmons, Micah S; Pinner, Anita L; McMillan, Laurence D; Haroutunian, Vahram; Meador-Woodruff, James H
2013-08-21
Dysfunctional glutamate neurotransmission has been implicated in the pathophysiology of schizophrenia. Abnormal expressions in schizophrenia of ionotropic glutamate receptors (iGluRs) and the proteins that regulate their trafficking have been found to be region and subunit specific in brain, suggesting that abnormal trafficking of iGluRs may contribute toward altered glutamatergic neurotransmission. The post-translational modification N-glycosylation of iGluR subunits can be used as a proxy for their intracellular localization. Receptor complexes assemble in the lumen of the endoplasmic reticulum, where N-glycosylation begins with the addition of N-linked oligomannose glycans, and is subsequently trimmed and replaced by more elaborate glycans while trafficking through the Golgi apparatus. Previously, we found abnormalities in N-glycosylation of the GluR2 AMPA receptor subunit in schizophrenia. Here, we investigated N-glycosylation of N-methyl-D-aspartate and kainate (KA) receptor subunits in the dorsolateral prefrontal cortex from patients with schizophrenia and a comparison group. We used enzymatic deglycosylation with two glycosidases: endoglycosidase H (Endo H), which removes immature high mannose-containing sugars, and peptide-N-glycosidase F (PNGase F), which removes all N-linked sugars. The NR1, NR2A, NR2B, GluR6, and KA2 subunits were all sensitive to treatment with Endo H and PNGase F. The GluR6 KA receptor subunit was significantly more sensitive to Endo H-mediated deglycosylation in schizophrenia, suggesting a larger molecular mass of N-linked high mannose and/or hybrid sugars on GluR6. This finding, taken with our previous work, suggests that a cellular mechanism underlying abnormal glutamate neurotransmission in schizophrenia may involve abnormal trafficking of both AMPA and KA receptors.
Ruiz, Arnaud; Sachidhanandam, Shankar; Utvik, Jo Kristian; Coussen, Françoise; Mulle, Christophe
2005-12-14
Heteromeric kainate receptors (KARs) containing both glutamate receptor 6 (GluR6) and KA2 subunits are involved in KAR-mediated EPSCs at mossy fiber synapses in CA3 pyramidal cells. We report that endogenous glutamate, by activating KARs, reversibly inhibits the slow Ca2+-activated K+ current I(sAHP) and increases neuronal excitability through a G-protein-coupled mechanism. Using KAR knockout mice, we show that KA2 is essential for the inhibition of I(sAHP) in CA3 pyramidal cells by low nanomolar concentrations of kainate, in addition to GluR6. In GluR6(-/-) mice, both ionotropic synaptic transmission and inhibition of I(sAHP) by endogenous glutamate released from mossy fibers was lost. In contrast, inhibition of I(sAHP) was absent in KA2(-/-) mice despite the preservation of KAR-mediated EPSCs. These data indicate that the metabotropic action of KARs did not rely on the activation of a KAR-mediated inward current. Biochemical analysis of knock-out mice revealed that KA2 was required for the interaction of KARs with Galpha(q/11)-proteins known to be involved in I(sAHP) modulation. Finally, the ionotropic and metabotropic actions of KARs at mossy fiber synapses were differentially sensitive to the competitive glutamate receptor ligands kainate (5 nM) and kynurenate (1 mM). We propose a model in which KARs could operate in two modes at mossy fiber synapses: through a direct ionotropic action of GluR6, and through an indirect G-protein-coupled mechanism requiring the binding of glutamate to KA2.
Wondolowski, Joyce; Frerking, Matthew
2009-01-01
Kainate receptors (KARs) contribute to postsynaptic excitation in only a select subset of neurons. To define the parameters that specify the postsynaptic expression of KARs, we examined the contribution of KARs to EPSCs on hippocampal interneurons in area CA1. Interneurons in stratum radiatum/lacunosum-moleculare (SR/SLM) express KARs both with and without the GluR5 subunit, but KAR-mediated EPSCs are generated mainly, if not entirely, by GluR5-containing KARs. Extrasynaptic glutamate spillover profoundly recruits AMPARs with little effect on KARs, indicating that KARs are targeted at the synapse more precisely than AMPARs. However, spontaneous EPSCs with a conventional AMPAR component did not have a resolvable contribution of KARs, suggesting that the KARs that contribute to the evoked EPSCs are at a distinct set of synapses. GluR5-containing KARs on interneurons in stratum oriens do not contribute substantially to the EPSC. We conclude that KARs are localized to synapses by cell type-, synapse-, and subunit-selective mechanisms. PMID:19144856
Marshall, John J; Xu, Jian; Contractor, Anis
2018-04-18
Kainate receptors are members of the glutamate receptor family that function by both generating ionotropic currents through an integral ion channel pore and coupling to downstream metabotropic signaling pathways. They are highly expressed in the striatum, yet their roles in regulating striatal synapses are not known. Using mice of both sexes, we demonstrate that GluK2-containing kainate receptors expressed in direct pathway spiny projection neurons (dSPNs) inhibit glutamate release at corticostriatal synapses in the dorsolateral striatum. This inhibition requires postsynaptic kainate-receptor-mediated mobilization of a retrograde endocannabinoid (eCB) signal and activation of presynaptic CB1 receptors. This pathway can be activated during repetitive 25 Hz trains of synaptic stimulation, causing short-term depression of corticostriatal synapses. This is the first study to demonstrate a role for kainate receptors in regulating eCB-mediated plasticity at the corticostriatal synapse and demonstrates an important role for these receptors in regulating basal ganglia circuits. SIGNIFICANCE STATEMENT The GRIK2 gene, encoding the GluK2 subunit of the kainate receptor, has been linked to several neuropsychiatric and neurodevelopmental disorders including obsessive compulsive disorder (OCD). Perseverative behaviors associated with OCD are known to result from pathophysiological changes in the striatum and kainate receptor knock-out mice have striatal-dependent phenotypes. However, the role of kainate receptors in striatal synapses is not known. We demonstrate that GluK2-containing kainate receptors regulate corticostriatal synapses by mobilizing endocannabinoids from direct pathway spiny projection neurons. Synaptic activation of GluK2 receptors during trains of synaptic input causes short-term synaptic depression, demonstrating a novel role for these receptors in regulating striatal circuits. Copyright © 2018 the authors 0270-6474/18/383901-10$15.00/0.
Andreou, Anna P; Holland, Philip R; Lasalandra, Michele P; Goadsby, Peter J
2015-03-01
Migraine is a common and disabling neurologic disorder, with important psychiatric comorbidities. Its pathophysiology involves activation of neurons in the trigeminocervical complex (TCC). Kainate receptors carrying the glutamate receptor subunit 5 (GluK1) are present in key brain areas involved in migraine pathophysiology. To study the influence of kainate receptors on trigeminovascular neurotransmission, we determined the presence of GluK1 receptors within the trigeminal ganglion and TCC with immunohistochemistry. We performed in vivo electrophysiologic recordings from TCC neurons and investigated whether local or systemic application of GluK1 receptor antagonists modulated trigeminovascular transmission. Microiontophoretic application of a selective GluK1 receptor antagonist, but not of a nonspecific ionotropic glutamate receptor antagonist, markedly attenuated cell firing in a subpopulation of neurons activated in response to dural stimulation, consistent with selective inhibition of postsynaptic GluK1 receptor-evoked firing seen in all recorded neurons. In contrast, trigeminovascular activation was significantly facilitated in a different neuronal population. The clinically active kainate receptor antagonist LY466195 attenuated trigeminovascular activation in all neurons. In addition, LY466195 demonstrated an N-methyl-d-aspartate receptor-mediated effect. This study demonstrates a differential role of GluK1 receptors in the TCC, antagonism of which can inhibit trigeminovascular activation through postsynaptic mechanisms. Furthermore, the data suggest a novel, possibly presynaptic, modulatory role of trigeminocervical kainate receptors in vivo. Differential activation of kainate receptors suggests unique roles for this receptor in pro- and antinociceptive mechanisms in migraine pathophysiology.
How glutamate receptor subunits mix and match: details uncovered.
Hansen, Kasper B; Traynelis, Stephen F
2011-07-28
Until now, the atomic details explaining why certain subunits prefer to coassemble has been lacking in our understanding of glutamate receptor biogenesis. In this issue, Kumar et al. describe the structural basis by which preferential subunit assembly occurs for homomeric and heteromeric kainate-type glutamate receptors. Copyright © 2011 Elsevier Inc. All rights reserved.
Pourcho, Roberta G; Qin, Pu; Goebel, Dennis J; Fyk-Kolodziej, Bozena
2002-12-16
Fast-acting excitatory neurotransmission in the retina is mediated primarily by glutamate, acting at alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) -selective and kainate-selective receptors. To localize these sites of action, cat retinas were stimulated with either AMPA or kainate and processed for histochemical visualization of cobalt uptake through calcium-permeable channels. Treatment with both agonists resulted in staining of A- and B-type horizontal cells and several types of OFF cone bipolar cells; there was no evidence for staining of ON cone bipolar cells or rod bipolar cells. The subpopulations of OFF cone bipolar cells differed in their responses with two distinct types that stained heavily with cobalt after exposure to AMPA and three different types that were preferentially labeled after exposure to kainate. Although many amacrine and ganglion cells appeared to respond to both agonists, AII amacrine cells were stained after stimulation by AMPA but not by kainate. The OFF cone bipolar cells that exhibit AMPA-stimulated cobalt uptake were found to have a high level of correspondence with cells that show immunocytochemical staining for the AMPA-selective glutamate receptor subunits GluR1 and GluR2/3. Similarly, the cone bipolar cells exhibiting kainate-stimulated cobalt uptake resemble those that are immunoreactive for the kainate subunit GluR5. The results indicate that, whereas many retinal neurons express both AMPA and kainate receptors, AII amacrine cells and subpopulations of OFF cone bipolar cells are limited to the expression of either AMPA or kainate receptors. This differential expression may contribute to the unique character of transmission by these cell types. Copyright 2002 Wiley-Liss, Inc.
Structure and assembly mechanism for heteromeric kainate receptors.
Kumar, Janesh; Schuck, Peter; Mayer, Mark L
2011-07-28
Native glutamate receptor ion channels are tetrameric assemblies containing two or more different subunits. NMDA receptors are obligate heteromers formed by coassembly of two or three divergent gene families. While some AMPA and kainate receptors can form functional homomeric ion channels, the KA1 and KA2 subunits are obligate heteromers which function only in combination with GluR5-7. The mechanisms controlling glutamate receptor assembly involve an initial step in which the amino terminal domains (ATD) assemble as dimers. Here, we establish by sedimentation velocity that the ATDs of GluR6 and KA2 coassemble as a heterodimer of K(d) 11 nM, 32,000-fold lower than the K(d) for homodimer formation by KA2; we solve crystal structures for the GluR6/KA2 ATD heterodimer and heterotetramer assemblies. Using these structures as a guide, we perform a mutant cycle analysis to probe the energetics of assembly and show that high-affinity ATD interactions are required for biosynthesis of functional heteromeric receptors. Copyright © 2011 Elsevier Inc. All rights reserved.
Catches, Justin S; Xu, Jian; Contractor, Anis
2012-03-17
There is a clear link between dysregulation of glutamatergic signaling and mood disorders. Genetic variants in the glutamate receptor gene GRIK4, which encodes the kainate receptor subunit GluK4, alter the susceptibility for depression, bipolar disorder and schizophrenia. Here we demonstrate that Grik4(-/-) mice have reduced anxiety and an antidepressant-like phenotype. In the elevated zero-maze, a test for anxiety and risk taking behavior, Grik4(-/-) mice spent significantly more time exploring the open areas of the maze. In anxiogenic tests of marble-burying and novelty-induced suppression of feeding, anxiety-like behavior was consistently reduced in knockout animals. In the forced swim test, a test of learned helplessness that is used to determine depression-like behavior, knockout mice demonstrated significantly less immobility suggesting that Grik4 ablation has an antidepressant-like effect. Finally, in the sucrose preference test, a test for anhedonia in rodents, Grik4(-/-) mice demonstrated increased sucrose preference. Expression of the GluK4 receptor subunit in the forebrain is restricted to the CA3 region of the hippocampus and dentate gyrus regions where KARs are known to modulate synaptic plasticity. We tested whether Grik4 ablation had effects on mossy fiber (MF) plasticity and found there to be a significant impairment in LTP likely through a loss of KAR modulation of excitability of the presynaptic MF axons. These studies demonstrate a clear anxiolytic and antidepressant phenotype associated with ablation of Grik4 and a parallel disruption in hippocampal plasticity, providing support for the importance of this receptor subunit in mood disorders. Copyright © 2011 Elsevier B.V. All rights reserved.
Catches, Justin S.; Xu, Jian; Contractor, Anis
2012-01-01
There is a clear link between dysregulation of glutamatergic signaling and mood disorders. Genetic variants in the glutamate receptor gene GRIK4, which encodes the kainate receptor subunit GluK4, alter the susceptibility for depression, bipolar disorder and schizophrenia. Here we demonstrate that Grik4−/− mice have reduced anxiety and an antidepressant-like phenotype. In the elevated zero-maze, a test for anxiety and risk taking behavior, Grik4−/− mice spent significantly more time exploring the open areas of the maze. In anxiogenic tests of marble-burying and novelty-induced suppression of feeding, anxiety-like behavior was consistently reduced in knockout animals. In the forced swim test, a test of learned helplessness that is used to determine depression-like behavior, knockout mice demonstrated significantly less immobility suggesting that Grik4 ablation has an antidepressant-like effect. Finally, in the sucrose preference test, a test for anhedonia in rodents, Grik4−/− mice demonstrated increased sucrose preference. Expression of the GluK4 receptor subunit in the forebrain is restricted to the CA3 region of the hippocampus and dentate gyrus regions where KARs are known to modulate synaptic plasticity. We tested whether Grik4 ablation had effects on mossy fiber (MF) plasticity and found there to be a significant impairment in LTP likely through a loss of KAR modulation of excitability of the presynaptic MF axons. These studies demonstrate a clear anxiolytic and antidepressant phenotype associated with ablation of Grik4 and a parallel disruption in hippocampal plasticity, providing support for the importance of this receptor subunit in mood disorders. PMID:22203159
Pressey, Jessica C; Mahadevan, Vivek; Khademullah, C Sahara; Dargaei, Zahra; Chevrier, Jonah; Ye, Wenqing; Huang, Michelle; Chauhan, Alamjeet K; Meas, Steven J; Uvarov, Pavel; Airaksinen, Matti S; Woodin, Melanie A
2017-04-14
Synaptic inhibition depends on a transmembrane gradient of chloride, which is set by the neuron-specific K + -Cl - co-transporter KCC2. Reduced KCC2 levels in the neuronal membrane contribute to the generation of epilepsy, neuropathic pain, and autism spectrum disorders; thus, it is important to characterize the mechanisms regulating KCC2 expression. In the present study, we determined the role of KCC2-protein interactions in regulating total and surface membrane KCC2 expression. Using quantitative immunofluorescence in cultured mouse hippocampal neurons, we discovered that the kainate receptor subunit GluK2 and the auxiliary subunit Neto2 significantly increase the total KCC2 abundance in neurons but that GluK2 exclusively increases the abundance of KCC2 in the surface membrane. Using a live cell imaging assay, we further determined that KCC2 recycling primarily occurs within 1-2 h and that GluK2 produces an ∼40% increase in the amount of KCC2 recycled to the membrane during this time period. This GluK2-mediated increase in surface recycling translated to a significant increase in KCC2 expression in the surface membrane. Moreover, we found that KCC2 recycling is enhanced by protein kinase C-mediated phosphorylation of the GluK2 C-terminal residues Ser-846 and Ser-868. Lastly, using gramicidin-perforated patch clamp recordings, we found that the GluK2-mediated increase in KCC2 recycling to the surface membrane translates to a hyperpolarization of the reversal potential for GABA (E GABA ). In conclusion, our results have revealed a mechanism by which kainate receptors regulate KCC2 expression in the hippocampus. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Rutkowska-Wlodarczyk, Izabela; Aller, M Isabel; Valbuena, Sergio; Bologna, Jean-Charles; Prézeau, Laurent; Lerma, Juan
2015-04-01
Kainate receptors (KARs) are found ubiquitously in the CNS and are present presynaptically and postsynaptically regulating synaptic transmission and excitability. Functional studies have proven that KARs act as ion channels as well as potentially activating G-proteins, thus indicating the existance of a dual signaling system for KARs. Nevertheless, it is not clear how these ion channels activate G-proteins and which of the KAR subunits is involved. Here we performed a proteomic analysis to define proteins that interact with the C-terminal domain of GluK1 and we identified a variety of proteins with many different functions, including a Go α subunit. These interactions were verified through distinct in vitro and in vivo assays, and the activation of the Go protein by GluK1 was validated in bioluminescence resonance energy transfer experiments, while the specificity of this association was confirmed in GluK1-deficient mice. These data reveal components of the KAR interactome, and they show that GluK1 and Go proteins are natural partners, accounting for the metabotropic effects of KARs. Copyright © 2015 the authors 0270-6474/15/355171-09$15.00/0.
Type II and III Taste Bud Cells Preferentially Expressed Kainate Glutamate Receptors in Rats.
Lee, Sang-Bok; Lee, Cil-Han; Kim, Se-Nyun; Chung, Ki-Myung; Cho, Young-Kyung; Kim, Kyung-Nyun
2009-12-01
Glutamate-induced cobalt uptake reveals that non-NMDA glutamate receptors (GluRs) are present in rat taste bud cells. Previous studies involving glutamate induced cobalt staining suggest this uptake mainly occurs via kainate type GluRs. It is not known which of the 4 types of taste bud cells express subunits of kainate GluR. Circumvallate and foliate papillae of Sprague-Dawley rats (45~60 days old) were used to search for the mRNAs of subunits of non-NMDA GluRs using RT-PCR with specific primers for GluR1-7, KA1 and KA2. We also performed RT-PCR for GluR5, KA1, PLCbeta2, and NCAM/SNAP 25 in isolated single cells from taste buds. Taste epithelium, including circumvallate or foliate papilla, express mRNAs of GluR5 and KA1. However, non-taste tongue epithelium expresses no subunits of non-NMDA GluRs. Isolated single cell RT-PCR reveals that the mRNAs of GluR5 and KA1 are preferentially expressed in Type II and Type III cells over Type I cells.
Benzodiazepine and kainate receptor binding sites in the RCS rat retina.
Stasi, Kalliopi; Naskar, Rita; Thanos, Solon; Kouvelas, Elias D; Mitsacos, Ada
2003-02-01
The effect of age and photoreceptor degeneration on the kainate subtype of glutamate receptors and on the benzodiazepine-sensitive gamma-aminobutyric acid-A receptors (GABA(A)) in normal and RCS (Royal College of Surgeons) rats were investigated. [(3)H]Kainate and [(3)H]flunitrazepam were used as radioligands for kainate and GABA(A)/benzodiazepine()receptors, respectively, using the quantitative receptor autoradiography technique. In both normal and RCS rat retina we observed that [(3)Eta]flunitrazepam and [(3)Eta]kainate binding levels were several times higher in inner plexiform layer (IPL) than in outer plexiform layer (OPL) at all four ages studied (P17, P35, P60 and P180). Age-related changes in receptor binding were observed in normal rat retina: [(3)Eta]flunitrazepam binding showed a significant decrease of 25% between P17 and P60 in IPL,and [(3)Eta]kainate binding showed significant decreases between P17 and P35 in both synaptic layers (71% in IPL and 63% in OPL). Degeneration-related changes in benzodiazepine and kainate receptor binding were observed in RCS rat retina. In IPL, [(3)Eta]flunitrazepam and [(3)Eta]kainate binding levels were higher than in normal retina at P35 (by 24% and 86%, respectively). In OPL, [(3)Eta]flunitrazepam binding was higher in RCS than in normal retina on P35 (74%) and also on P60 (62%). The results indicate that postnatal changes occur in kainate and benzodiazepine receptor binding sites in OPL and IPL of the rat retina up to 6 months of age. The data also suggest that the receptor binding changes observed in the RCS retina could be a consequence of the primary photoreceptor degeneration.
Functional Validation of Heteromeric Kainate Receptor Models.
Paramo, Teresa; Brown, Patricia M G E; Musgaard, Maria; Bowie, Derek; Biggin, Philip C
2017-11-21
Kainate receptors require the presence of external ions for gating. Most work thus far has been performed on homomeric GluK2 but, in vivo, kainate receptors are likely heterotetramers. Agonists bind to the ligand-binding domain (LBD) which is arranged as a dimer of dimers as exemplified in homomeric structures, but no high-resolution structure currently exists of heteromeric kainate receptors. In a full-length heterotetramer, the LBDs could potentially be arranged either as a GluK2 homomer alongside a GluK5 homomer or as two GluK2/K5 heterodimers. We have constructed models of the LBD dimers based on the GluK2 LBD crystal structures and investigated their stability with molecular dynamics simulations. We have then used the models to make predictions about the functional behavior of the full-length GluK2/K5 receptor, which we confirmed via electrophysiological recordings. A key prediction and observation is that lithium ions bind to the dimer interface of GluK2/K5 heteromers and slow their desensitization. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Platelet Kainate Receptor Signaling Promotes Thrombosis by Stimulating Cyclooxygenase Activation
Sun, Henry; Swaim, AnneMarie; Herrera, Jesus Enrique; Becker, Diane; Becker, Lewis; Srivastava, Kalyan; Thompson, Laura E.; Shero, Michelle R.; Perez-Tamayo, Alita; Suktitpat, Bhoom; Mathias, Rasika; Contractor, Anis; Faraday, Nauder; Morrell, Craig N.
2009-01-01
Rationale Glutamate is a major signaling molecule that binds to glutamate receptors including the ionotropic glutamate receptors; kainate (KA) receptor (KAR), the N-methyl-D-aspartate (NMDA) receptor (NMDAR), and the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor (AMPAR). Each is well characterized in the central nervous system (CNS), but glutamate has important signaling roles in peripheral tissues as well, including a role in regulating platelet function. Objective Our previous work has demonstrated that glutamate is released by platelets in high concentrations within a developing thrombus and increases platelet activation and thrombosis. We now show that platelets express a functional KAR that drives increased agonist induced platelet activation. Methods and Results KAR induced increase in platelet activation is in part the result of activation of platelet cyclooxygenase (COX) in a Mitogen Activated Protein Kinase (MAPK) dependent manner. Platelets derived from KA receptor subunit knockout mice (GluR6−/−) are resistant to KA effects and have a prolonged time to thrombosis in vivo. Importantly, we have also identified polymorphisms in KA receptor subunits that are associated with phenotypic changes in platelet function in a large group of Caucasians and African Americans. Conclusion Our data demonstrate that glutamate regulation of platelet activation is in part COX dependent, and suggest that the KA receptor is a novel anti-thrombotic target. PMID:19679838
Wyeth, Megan S.; Pelkey, Kenneth A.; Petralia, Ronald S.; Salter, Michael W.; McInnes, Roderick R.
2014-01-01
Neto1 and Neto2 auxiliary subunits coassemble with NMDA receptors (NMDARs) and kainate receptors (KARs) to modulate their function. In the hippocampus, Neto1 enhances the amplitude and prolongs the kinetics of KAR-mediated currents at mossy fiber (MF)–CA3 pyramidal cell synapses. However, whether Neto1 trafficks KARs to synapses or simply alters channel properties is unresolved. Therefore, postembedding electron microscopy was performed to investigate the localization of GluK2/3 subunits at MF–CA3 synapses in Neto-null mice. Postsynaptic GluK2/3 Immunogold labeling was substantially reduced in Neto-null mice compared with wild types. Moreover, spontaneous KAR-mediated synaptic currents and metabotropic KAR signaling were absent in CA3 pyramidal cells of Neto-null mice. A similar loss of ionotropic and metabotropic KAR function was observed in Neto1, but not Neto2, single knock-out mice, specifically implicating Neto1 in regulating CA3 pyramidal cell KAR localization and function. Additional controversy pertains to the role of Neto proteins in modulating synaptic NMDARs. While Immunogold labeling for GluN2A at MF–CA3 synapses was comparable between wild-type and Neto-null mice, labeling for postsynaptic GluN2B was robustly increased in Neto-null mice. Accordingly, NMDAR-mediated currents at MF–CA3 synapses exhibited increased sensitivity to a GluN2B-selective antagonist in Neto1 knockouts relative to wild types. Thus, despite preservation of the overall MF–CA3 synaptic NMDAR-mediated current, loss of Neto1 alters NMDAR subunit composition. These results confirm that Neto protein interactions regulate synaptic localization of KAR and NMDAR subunits at MF–CA3 synapses, with implications for both ionotropic and metabotropic glutamatergic recruitment of the CA3 network. PMID:24403160
Kainate receptors coming of age: milestones of two decades of research.
Contractor, Anis; Mulle, Christophe; Swanson, Geoffrey T
2011-03-01
Two decades have passed since the first report of the cloning of a kainate-type glutamate receptor (KAR) subunit. The intervening years have seen a rapid growth in our understanding of the biophysical properties and function of KARs in the brain. This research has led to an appreciation that KARs play very distinct roles at synapses relative to other members of the glutamate-gated ion channel receptor family, despite structural and functional commonalities. The surprisingly diverse and complex nature of KAR signaling underlies their unique impact upon neuronal networks through their direct and indirect effects on synaptic transmission, and their prominent role in regulating cell excitability. This review pieces together highlights from the two decades of research subsequent to the cloning of the first subunit, and provides an overview of our current understanding of the role of KARs in the CNS and their potential importance to neurological and neuropsychiatric disorders. Copyright © 2011 Elsevier Ltd. All rights reserved.
Presynaptic Kainate Receptor Mediation of Frequency Facilitation at Hippocampal Mossy Fiber Synapses
NASA Astrophysics Data System (ADS)
Schmitz, Dietmar; Mellor, Jack; Nicoll, Roger A.
2001-03-01
Inhibition of transmitter release by presynaptic receptors is widespread in the central nervous system and is typically mediated via metabotropic receptors. In contrast, very little is known about facilitatory receptors, and synaptic activation of a facilitatory autoreceptor has not been established. Here we show that activation of presynaptic kainate receptors can facilitate transmitter release from hippocampal mossy fiber synapses. Synaptic activation of these presumed ionotropic kainate receptors is very fast (<10 ms) and lasts for seconds. Thus, these presynaptic kainate receptors contribute to the short-term plasticity characteristics of mossy fiber synapses, which were previously thought to be an intrinsic property of the synapse.
Bhandage, Amol K; Jin, Zhe; Hellgren, Charlotte; Korol, Sergiy V; Nowak, Krzysztof; Williamsson, Louise; Sundström-Poromaa, Inger; Birnir, Bryndis
2017-04-15
The amino acid glutamate opens cation permeable ion channels, the iGlu receptors. These ion channels are abundantly expressed in the mammalian brain where glutamate is the main excitatory neurotransmitter. The neurotransmitters and their receptors are being increasingly detected in the cells of immune system. Here we examined the expression of the 18 known subunits of the iGlu receptors families; α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA), kainate, N-methyl-d-aspartate (NMDA) and delta in human peripheral blood mononuclear cells (PBMCs). We compared the expression of the subunits between four groups: men, non-pregnant women, healthy pregnant women and depressed pregnant women. Out of 18 subunits of the iGlu receptors, mRNAs for 11 subunits were detected in PBMCs from men and non-pregnant women; AMPA: GluA3, GluA4, kainate: GluK2, GluK4, GluK5, NMDA: GluN1, GluN2C, GluN2D, GluN3A, GluN3B, and delta: GluD1. In the healthy and the depressed pregnant women, in addition, the delta GluD2 subunit was identified. The mRNAs for GluK4, GluK5, GluN2C and GluN2D were expressed at a higher level than other subunits. Gender, pregnancy or depression during pregnancy altered the expression of GluA3, GluK4, GluN2D, GluN3B and GluD1 iGlu subunit mRNAs. The greatest changes recorded were the lower GluA3 and GluK4 mRNA levels in pregnant women and the higher GluN2D mRNA level in healthy but not in depressed pregnant women as compared to non-pregnant individuals. Using subunit specific antibodies, the GluK4, GluK5, GluN1, GluN2C and GluN2D subunit proteins were identified in the PBMCs. The results show expression of specific iGlu receptor subunit in the PBMCs and support the idea of physiology-driven changes of iGlu receptors subtypes in the immune cells. Copyright © 2017 Elsevier B.V. All rights reserved.
Xenon reduces glutamate-, AMPA-, and kainate-induced membrane currents in cortical neurones.
Dinse, A; Föhr, K J; Georgieff, M; Beyer, C; Bulling, A; Weigt, H U
2005-04-01
The anaesthetic, analgesic, and neuroprotective effects of xenon (Xe) are believed to be mediated by a block of the NMDA (N-methyl-D-aspartate) receptor channel. Interestingly, the clinical profile of the noble gas differs markedly from that of specific NMDA receptor antagonists. The aim of this study was, therefore, to investigate whether Xe might be less specific, also inhibiting the two other subtypes of glutamate receptor channels, such as the alpha-amino-3-hydroxy-5-methyl-4-isoxazolole propionate (AMPA) and kainate receptors. The study was performed on voltage-clamped cortical neurones from embryonic mice and SH-SY5Y cells expressing GluR6 kainate receptors. Drugs were applied by a multi-barreled fast perfusion system. Xe, dissolved at approximately 3.45 mM in aqueous solution, diminished the peak and even more the plateau of AMPA and glutamate induced currents. At the control EC(50) value for AMPA (29 microM) these reductions were by about 40 and 56% and at 3 mM glutamate the reductions were by 45 and 66%, respectively. Currents activated at the control EC(50) value for kainate (57 microM) were inhibited by 42%. Likewise, Xe showed an inhibitory effect on kainate-induced membrane currents of SH-SY5Y cells transfected with the GluR6 subunit of the kainate receptor. Xe reduced kainate-induced currents by between 35 and 60%, depending on the kainate concentration. Xe blocks not only NMDA receptors, but also AMPA and kainate receptors in cortical neurones as well as GluR6-type receptors expressed in SH-SY5Y cells. Thus, Xe seems to be rather non-specific as a channel blocker and this may contribute to the analgesic and anaesthetic potency of Xe.
Glycine activated ion channel subunits encoded by ctenophore glutamate receptor genes
Alberstein, Robert; Grey, Richard; Zimmet, Austin; ...
2015-10-12
Recent genome projects for ctenophores have revealed the presence of numerous ionotropic glutamate receptors (iGluRs) in Mnemiopsis leidyi and Pleurobrachia bachei, among our earliest metazoan ancestors. Sequence alignments and phylogenetic analysis show that these form a distinct clade from the well-characterized AMPA, kainate, and NMDA iGluR subtypes found in vertebrates. Although annotated as glutamate and kainate receptors, crystal structures of the ML032222a and PbiGluR3 ligand-binding domains (LBDs) reveal endogenous glycine in the binding pocket, whereas ligand-binding assays show that glycine binds with nanomolar affinity; biochemical assays and structural analysis establish that glutamate is occluded from the binding cavity. Further analysismore » reveals ctenophore-specific features, such as an interdomain Arg-Glu salt bridge, present only in subunits that bind glycine, but also a conserved disulfide in loop 1 of the LBD that is found in all vertebrate NMDA but not AMPA or kainate receptors. In this paper, we hypothesize that ctenophore iGluRs are related to an early ancestor of NMDA receptors, suggesting a common evolutionary path for ctenophores and bilaterian species, and finally suggest that future work should consider both glycine and glutamate as candidate neurotransmitters in ctenophore species.« less
Rojas, Asheebo; Gueorguieva, Paoula; Lelutiu, Nadia; Quan, Yi; Shaw, Renee; Dingledine, Raymond
2014-01-01
Prostaglandin E2 (PGE2) regulates membrane excitability, synaptic transmission, plasticity, and neuronal survival. The consequences of PGE2 release following seizures has been the subject of much study. Here we demonstrate that the prostaglandin E2 receptor 1 (EP1, or Ptger1) modulates native kainate receptors, a family of ionotropic glutamate receptors widely expressed throughout the central nervous system. Global ablation of the EP1 gene in mice (EP1-KO) had no effect on seizure threshold after kainate injection but reduced the likelihood to enter status epilepticus. EP1-KO mice that did experience typical status epilepticus had reduced hippocampal neurodegeneration and a blunted inflammatory response. Further studies with native prostanoid and kainate receptors in cultured cortical neurons, as well as with recombinant prostanoid and kainate receptors expressed in Xenopus oocytes, demonstrated that EP1 receptor activation potentiates heteromeric but not homomeric kainate receptors via a second messenger cascade involving phospholipase C, calcium and protein kinase C. Three critical GluK5 C-terminal serines underlie the potentiation of the GluK2/GluK5 receptor by EP1 activation. Taken together, these results indicate that EP1 receptor activation during seizures, through a protein kinase C pathway, increases the probability of kainic acid induced status epilepticus, and independently promotes hippocampal neurodegeneration and a broad inflammatory response. PMID:24952362
Borghuis, Bart G; Looger, Loren L; Tomita, Susumu; Demb, Jonathan B
2014-04-30
A fundamental question in sensory neuroscience is how parallel processing is implemented at the level of molecular and circuit mechanisms. In the retina, it has been proposed that distinct OFF cone bipolar cell types generate fast/transient and slow/sustained pathways by the differential expression of AMPA- and kainate-type glutamate receptors, respectively. However, the functional significance of these receptors in the intact circuit during light stimulation remains unclear. Here, we measured glutamate release from mouse bipolar cells by two-photon imaging of a glutamate sensor (iGluSnFR) expressed on postsynaptic amacrine and ganglion cell dendrites. In both transient and sustained OFF layers, cone-driven glutamate release from bipolar cells was blocked by antagonists to kainate receptors but not AMPA receptors. Electrophysiological recordings from bipolar and ganglion cells confirmed the essential role of kainate receptors for signaling in both transient and sustained OFF pathways. Kainate receptors mediated responses to contrast modulation up to 20 Hz. Light-evoked responses in all mouse OFF bipolar pathways depend on kainate, not AMPA, receptors.
Agonist- and subunit-dependent potentiation of glutamate receptors by a nootropic drug aniracetam.
Tsuzuki, K; Takeuchi, T; Ozawa, S
1992-11-01
GluR1 and GluR2 cDNAs encoding non-NMDA subtypes of glutamate receptor were isolated from a rat brain cDNA library by Boulter et al. (Science, 249 (1990) 1033-1037). Functional receptors activated by kainate, alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) and glutamate were expressed in Xenopus oocytes injected with GluR1, GluR2 or a mixture of GluR1 and GluR2 RNAs. In GluR1-expressed oocytes, 1 mM aniracetam potentiated AMPA-induced currents by 99 +/- 10% (mean +/- S.E.M., n = 5) and glutamate-induced currents by 140 +/- 8% (n = 4), but little affected kainate-induced currents. Aniracetam was effective from a concentration of 0.1 mM, and it exhibited more conspicuous effects with the increase of the dose. In oocytes injected with GluR1 plus GluR2 RNAs, aniracetam more markedly potentiated current responses to AMPA and glutamate than those in oocytes injected with GluR1 RNA alone. For example, 1 mM aniracetam potentiated AMPA-induced currents by 396 +/- 76% (n = 4) and glutamate-induced currents by 970 +/- 65% (n = 5) in oocytes injected with 10% GluR1 and 90% GluR2 RNAs. In these oocytes, however, the potentiation of kainate-induced currents by 1 mM aniracetam was only 8 +/- 5% (n = 4). Thus, we conclude that the potentiation of the AMPA/kainate receptor by aniracetam depends on both species of agonists and subunit composition of the receptor.
Rangel, Alejandra; Burgaya, Ferran; Gavín, Rosalina; Soriano, Eduardo; Aguzzi, Adriano; Del Río, José A
2007-09-01
Normal physiologic functions of the cellular prion protein (PrPc) are still elusive. This GPI-anchored protein exerts many functions, including roles in neuron proliferation, neuroprotection or redox homeostasis. There are, however, conflicting data concerning its role in synaptic transmission. Although several studies report that PrPc participates in NMDA-mediated neurotransmission, parallel studies describe normal behavior of PrPc-mutant mice. Abnormal axon connections have been described in the dentate gyrus of the hippocampi of PrPc-deficient mice similar to those observed in epilepsy. A study indicates increased susceptibility to kainate (KA) in these mutant mice. We extend the observation of these studies by means of several histologic and biochemical analyses of KA-treated mice. PrPc-deficient mice showed increased sensitivity to KA-induced seizures in vivo and in vitro in organotypic slices. In addition, we show that this sensitivity is cell-specific because interference experiments to abolish PrPc expression increased susceptibility to KA in PrPc-expressing cells. We indicate a correlation of susceptibility to KA in cells lacking PrPc with the differential expression of GluR6 and GluR7 KA receptor subunits using real-time RT-PCR methods. These results indicate that PrPc exerts a neuroprotective role against KA-induced neurotoxicity, probably by regulating the expression of KA receptor subunits. (c) 2007 Wiley-Liss, Inc.
Vernon, Claire G.
2017-01-01
Peripheral sensory neurons in the dorsal root ganglia (DRG) are the initial transducers of sensory stimuli, including painful stimuli, from the periphery to central sensory and pain-processing centers. Small- to medium-diameter non-peptidergic neurons in the neonatal DRG express functional kainate receptors (KARs), one of three subfamilies of ionotropic glutamate receptors, as well as the putative KAR auxiliary subunit Neuropilin- and tolloid-like 2 (Neto2). Neto2 alters recombinant KAR function markedly but has yet to be confirmed as an auxiliary subunit that assembles with and alters the function of endogenous KARs. KARs in neonatal DRG require the GluK1 subunit as a necessary constituent, but it is unclear to what extent other KAR subunits contribute to the function and proposed roles of KARs in sensory ganglia, which include promotion of neurite outgrowth and modulation of glutamate release at the DRG–dorsal horn synapse. In addition, KARs containing the GluK1 subunit are implicated in modes of persistent but not acute pain signaling. We show here that the Neto2 protein is highly expressed in neonatal DRG and modifies KAR gating in DRG neurons in a developmentally regulated fashion in mice. Although normally at very low levels in adult DRG neurons, Neto2 protein expression can be upregulated via MEK/ERK signaling and after sciatic nerve crush and Neto2−/− neurons from adult mice have stunted neurite outgrowth. These data confirm that Neto2 is a bona fide KAR auxiliary subunit that is an important constituent of KARs early in sensory neuron development and suggest that Neto2 assembly is critical to KAR modulation of DRG neuron process outgrowth. SIGNIFICANCE STATEMENT Pain-transducing peripheral sensory neurons of the dorsal root ganglia (DRG) express kainate receptors (KARs), a subfamily of glutamate receptors that modulate neurite outgrowth and regulate glutamate release at the DRG–dorsal horn synapse. The putative KAR auxiliary subunit Neuropilin- and
Vernon, Claire G; Swanson, Geoffrey T
2017-03-22
Peripheral sensory neurons in the dorsal root ganglia (DRG) are the initial transducers of sensory stimuli, including painful stimuli, from the periphery to central sensory and pain-processing centers. Small- to medium-diameter non-peptidergic neurons in the neonatal DRG express functional kainate receptors (KARs), one of three subfamilies of ionotropic glutamate receptors, as well as the putative KAR auxiliary subunit Neuropilin- and tolloid-like 2 (Neto2). Neto2 alters recombinant KAR function markedly but has yet to be confirmed as an auxiliary subunit that assembles with and alters the function of endogenous KARs. KARs in neonatal DRG require the GluK1 subunit as a necessary constituent, but it is unclear to what extent other KAR subunits contribute to the function and proposed roles of KARs in sensory ganglia, which include promotion of neurite outgrowth and modulation of glutamate release at the DRG-dorsal horn synapse. In addition, KARs containing the GluK1 subunit are implicated in modes of persistent but not acute pain signaling. We show here that the Neto2 protein is highly expressed in neonatal DRG and modifies KAR gating in DRG neurons in a developmentally regulated fashion in mice. Although normally at very low levels in adult DRG neurons, Neto2 protein expression can be upregulated via MEK/ERK signaling and after sciatic nerve crush and Neto2 -/- neurons from adult mice have stunted neurite outgrowth. These data confirm that Neto2 is a bona fide KAR auxiliary subunit that is an important constituent of KARs early in sensory neuron development and suggest that Neto2 assembly is critical to KAR modulation of DRG neuron process outgrowth. SIGNIFICANCE STATEMENT Pain-transducing peripheral sensory neurons of the dorsal root ganglia (DRG) express kainate receptors (KARs), a subfamily of glutamate receptors that modulate neurite outgrowth and regulate glutamate release at the DRG-dorsal horn synapse. The putative KAR auxiliary subunit Neuropilin- and
Johansen, T H; Chaudhary, A; Verdoorn, T A
1995-11-01
We examined the actions of cyclothiazide, aniracetam, and 1-(4-aminophenyl)-4-methyl-7,8-methylenedioxy-5H-2,3-benzodiazepine (GYKI-52466) on recombinant alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) and kainate receptors. Receptors expressed in Xenopus oocytes or human embryonic kidney 293 cells were characterized using voltage and patch-clamp electrophysiology. Aniracetam and cyclothiazide potentiated AMPA receptor currents by slowing or blocking desensitization. Cyclothiazide was more potent at receptors consisting of flip subunits compared with receptors consisting of flop subunits, whereas aniracetam appeared to be more efficacious at flop receptors. The potency of GYKI-52466 did not differ in heteromeric flip or flop containing AMPA receptors, but GYKI-52466 was less potent at homomeric GluRAi and GluRDi receptors. At heteromeric AMPA receptors, 50 microM cyclothiazide increased the IC50 value for GYKI-52466 significantly. The increase was largest in GluRBi/Di receptors where the IC50 value shifted from 21.9 microM (95% confidence interval, 12.0-39.8 microM) to 126 microM (95% confidence interval, 72.4-214 microM) in the presence of cyclothiazide. In contrast, 100 microM GYKI-52466 did not alter the EC50 of cyclothiazide at GluRBi/Di receptors nor did it markedly change the maximal potentiation induced by cyclothiazide. At GluRBi/Di receptors transiently expressed in human embryonic kidney 293 cells, 30 microM GYKI-52466 inhibited the steady state and the peak current evoked by 300 microns L-glutamate to the same extent (34.5 +/- 12% and 27.3 +/- 13.0%, respectively; five experiments), and GYKI-52466 did not alter the apparent rate of desensitization (tau = 15.7 +/- 4.7 and 17.5 +/- 8.3 msec in the absence and presence of GYKI-52466, respectively; five experiments). GYKI-52466 inhibited L-glutamate currents in the presence and absence of 10 microM cyclothiazide, but GYKI-52466 never restored the desensitization that was blocked by cyclothiazide
Jin, Zhe; Bhandage, Amol K; Bazov, Igor; Kononenko, Olga; Bakalkin, Georgy; Korpi, Esa R; Birnir, Bryndis
2014-01-01
The central amygdala (CeA) has a role for mediating fear and anxiety responses. It is also involved in emotional imbalance caused by alcohol abuse and dependence and in regulating relapse to alcohol abuse. Growing evidences suggest that excitatory glutamatergic and inhibitory γ-aminobutyric acid-ergic (GABAergic) transmissions in the CeA are affected by chronic alcohol exposure. Human post-mortem CeA samples from male alcoholics (n = 9) and matched controls (n = 9) were assayed for the expression level of ionotropic glutamate and GABA-A receptors subunit mRNAs using quantitative real-time reverse transcription-PCR (RT-qPCR). Our data revealed that out of the 16 ionotropic glutamate receptor subunits, mRNAs encoding two AMPA [2-amino-3-(3-hydroxy-5-methyl-isoxazol-4-yl)propanoic acid] receptor subunits GluA1 and GluA4; one kainate receptor subunit GluK2; one NMDA (N-methyl-D-aspartate) receptor subunit GluN2D and one delta receptor subunit GluD2 were significantly decreased in the CeA of alcoholics. In contrast, of the 19 GABA-A receptor subunits, only the mRNA encoding the α2 subunit was significantly down-regulated in the CeA of the alcoholics as compared with control subjects. Our findings imply that the down-regulation of specific ionotropic glutamate and GABA-A receptor subunits in the CeA of alcoholics may represent one of the molecular substrates underlying the new balance between excitatory and inhibitory neurotransmission in alcohol dependence.
Jin, Zhe; Bhandage, Amol K.; Bazov, Igor; Kononenko, Olga; Bakalkin, Georgy; Korpi, Esa R.; Birnir, Bryndis
2014-01-01
The central amygdala (CeA) has a role for mediating fear and anxiety responses. It is also involved in emotional imbalance caused by alcohol abuse and dependence and in regulating relapse to alcohol abuse. Growing evidences suggest that excitatory glutamatergic and inhibitory γ-aminobutyric acid-ergic (GABAergic) transmissions in the CeA are affected by chronic alcohol exposure. Human post-mortem CeA samples from male alcoholics (n = 9) and matched controls (n = 9) were assayed for the expression level of ionotropic glutamate and GABA-A receptors subunit mRNAs using quantitative real-time reverse transcription-PCR (RT-qPCR). Our data revealed that out of the 16 ionotropic glutamate receptor subunits, mRNAs encoding two AMPA [2-amino-3-(3-hydroxy-5-methyl-isoxazol-4-yl)propanoic acid] receptor subunits GluA1 and GluA4; one kainate receptor subunit GluK2; one NMDA (N-methyl-D-aspartate) receptor subunit GluN2D and one delta receptor subunit GluD2 were significantly decreased in the CeA of alcoholics. In contrast, of the 19 GABA-A receptor subunits, only the mRNA encoding the α2 subunit was significantly down-regulated in the CeA of the alcoholics as compared with control subjects. Our findings imply that the down-regulation of specific ionotropic glutamate and GABA-A receptor subunits in the CeA of alcoholics may represent one of the molecular substrates underlying the new balance between excitatory and inhibitory neurotransmission in alcohol dependence. PMID:25278838
Mapping Kainate Activation of Inner Neurons in the Rat Retina
Nivison-Smith, Lisa; Sun, Daniel; Fletcher, Erica L.; Marc, Robert E.; Kalloniatis, Michael
2014-01-01
Kainate receptors mediate fast, excitatory synaptic transmission for a range of inner neurons in the mammalian retina. However, allocation of functional kainate receptors to known cell types and their sensitivity remains unresolved. Using the cation channel probe 1-amino-4-guanidobutane agmatine (AGB), we investigated kainate sensitivity of neurochemically identified cell populations within the structurally intact rat retina. Most inner retinal neuron populations responded to kainate in a concentration-dependent manner. OFF cone bipolar cells demonstrated the highest sensitivity of all inner neurons to kainate. Immunocytochemical localization of AGB and macromolecular markers confirmed that type 2 bipolar cells were part of this kainate-sensitive population. The majority of amacrine (ACs) and ganglion cells (GCs) showed kainate responses with different sensitivities between major neurochemical classes (γ-aminobutyric acid [GABA]/glycine ACs > glycine ACs > GABA ACs; glutamate [Glu]/weakly GABA GCs > Glu GCs). Conventional and displaced cholinergic ACs were highly responsive to kainate, whereas dopaminergic ACs do not appear to express functional kainate receptors. These findings further contribute to our understanding of neuronal networks in complex multicellular tissues. PMID:23348566
Modulation of ionotropic glutamate receptor function by vertebrate galectins
Copits, Bryan A; Vernon, Claire G; Sakai, Ryuichi; Swanson, Geoffrey T
2014-01-01
AMPA and kainate receptors are glutamate-gated ion channels whose function is known to be altered by a variety of plant oligosaccharide-binding proteins, or lectins, but the physiological relevance of this activity has been uncertain because no lectins with analogous allosteric modulatory effects have been identified in animals. We report here that members of the prototype galectin family, which are β-galactoside-binding lectins, exhibit subunit-specific allosteric modulation of desensitization of recombinant homomeric and heteromeric AMPA and kainate receptors. Galectin modulation of GluK2 kainate receptors was dependent upon complex oligosaccharide processing of N-glycosylation sites in the amino-terminal domain and downstream linker region. The sensitivity of GluA4 AMPA receptors to human galectin-1 could be enhanced by supplementation of culture media with uridine and N-acetylglucosamine (GlcNAc), precursors for the hexosamine pathway that supplies UDP-GlcNAc for synthesis of complex oligosaccharides. Neuronal kainate receptors in dorsal root ganglia were sensitive to galectin modulation, whereas AMPA receptors in cultured hippocampal neurons were insensitive, which could be a reflection of differential N-glycan processing or receptor subunit selectivity. Because glycan content of integral proteins can be modified dynamically, we postulate that physiological or pathological conditions in the CNS could arise in which galectins alter excitatory neurotransmission or neuronal excitability through their actions on AMPA or kainate receptors. PMID:24614744
PSD-95 regulates synaptic kainate receptors at mouse hippocampal mossy fiber-CA3 synapses.
Suzuki, Etsuko; Kamiya, Haruyuki
2016-06-01
Kainate-type glutamate receptors (KARs) are the third class of ionotropic glutamate receptors whose activation leads to the unique roles in regulating synaptic transmission and circuit functions. In contrast to AMPA receptors (AMPARs), little is known about the mechanism of synaptic localization of KARs. PSD-95, a major scaffold protein of the postsynaptic density, is a candidate molecule that regulates the synaptic KARs. Although PSD-95 was shown to bind directly to KARs subunits, it has not been tested whether PSD-95 regulates synaptic KARs in intact synapses. Using PSD-95 knockout mice, we directly investigated the role of PSD-95 in the KARs-mediated components of synaptic transmission at hippocampal mossy fiber-CA3 synapse, one of the synapses with the highest density of KARs. Mossy fiber EPSCs consist of AMPA receptor (AMPAR)-mediated fast component and KAR-mediated slower component, and the ratio was significantly reduced in PSD-95 knockout mice. The size of KARs-mediated field EPSP reduced in comparison with the size of the fiber volley. Analysis of KARs-mediated miniature EPSCs also suggested reduced synaptic KARs. All the evidence supports critical roles of PSD-95 in regulating synaptic KARs. Copyright © 2015 Elsevier Ireland Ltd and Japan Neuroscience Society. All rights reserved.
Modulation of ionotropic glutamate receptor function by vertebrate galectins.
Copits, Bryan A; Vernon, Claire G; Sakai, Ryuichi; Swanson, Geoffrey T
2014-05-15
AMPA and kainate receptors are glutamate-gated ion channels whose function is known to be altered by a variety of plant oligosaccharide-binding proteins, or lectins, but the physiological relevance of this activity has been uncertain because no lectins with analogous allosteric modulatory effects have been identified in animals. We report here that members of the prototype galectin family, which are β-galactoside-binding lectins, exhibit subunit-specific allosteric modulation of desensitization of recombinant homomeric and heteromeric AMPA and kainate receptors. Galectin modulation of GluK2 kainate receptors was dependent upon complex oligosaccharide processing of N-glycosylation sites in the amino-terminal domain and downstream linker region. The sensitivity of GluA4 AMPA receptors to human galectin-1 could be enhanced by supplementation of culture media with uridine and N-acetylglucosamine (GlcNAc), precursors for the hexosamine pathway that supplies UDP-GlcNAc for synthesis of complex oligosaccharides. Neuronal kainate receptors in dorsal root ganglia were sensitive to galectin modulation, whereas AMPA receptors in cultured hippocampal neurons were insensitive, which could be a reflection of differential N-glycan processing or receptor subunit selectivity. Because glycan content of integral proteins can be modified dynamically, we postulate that physiological or pathological conditions in the CNS could arise in which galectins alter excitatory neurotransmission or neuronal excitability through their actions on AMPA or kainate receptors. © 2014 The Authors. The Journal of Physiology © 2014 The Physiological Society.
Villmann, Carmen; Hoffmann, Jutta; Werner, Markus; Kott, Sabine; Strutz-Seebohm, Nathalie; Nilsson, Tanja; Hollmann, Michael
2008-10-01
Although considerable progress has been made in characterizing the physiological function of the high-affinity kainate (KA) receptor subunits KA1 and KA2, no homomeric ion channel function has been shown. An ion channel transplantation approach was employed in this study to directly test if homomerically expressed KA1 and KA2 pore domains are capable of conducting currents. Transplantation of the ion pore of KA1 or KA2 into GluR6 generated perfectly functional ion channels that allowed characterization of those electrophysiological and pharmacological properties that are determined exclusively by the ion pore of KA1 or KA2. This demonstrates for the first time that KA1 and KA2 ion pore domains are intrinsically capable of conducting ions even in homomeric pore assemblies. NMDA receptors, similar to KA1- or KA2-containing receptors, function only as heteromeric complexes. They are composed of NR1 and NR2 subunits, which both are non-functional when expressed homomerically. In contrast to NR1, the homomeric NR2B ion pore failed to translate ligand binding into pore opening when transplanted into GluR6. Similarly, heteromeric coexpression of the ion channel domains of both NR1 and NR2 inserted into GluR6 failed to produce functional channels. Therefore, we conclude that the mechanism underlying the ion channel opening in the obligatorily heterotetrameric NMDA receptors differs significantly from that in the facultatively heterotetrameric alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate and KA receptors.
Channel-Opening Kinetic Mechanism of Wild-Type GluK1 Kainate Receptors and a C-Terminal Mutant
Han, Yan; Wang, Congzhou; Park, Jae Seon; Niu, Li
2012-01-01
GluK1 is a kainate receptor subunit in the ionotropic glutamate receptor family and can form functional channels when expressed, for instance, in HEK-293 cells. However, the channel-opening mechanism of GluK1 is poorly understood. One major challenge to studying the GluK1 channel is its apparent low surface expression, which results in a low whole-cell current response even to a saturating concentration of agonist. The low surface expression is thought to be contributed by an endoplasmic reticulum (ER) retention signal sequence. When this sequence motif is present as in the wild-type GluK1-2b C-terminus, the receptor is significantly retained in the ER. Conversely, when this sequence is lacking, as in wild-type GluK1-2a (i.e., a different alternatively spliced isoform at the C-terminus) and in a GluK1-2b mutant (i.e., R896A, R897A, R900A and K901A) that disrupts the ER retention signal, there is higher surface expression and greater whole-cell current response. Here we characterize the channel-opening kinetic mechanism for these three GluK1 receptors expressed in HEK-293 cells by using a laser-pulse photolysis technique. Our results show that the wild-type GluK1-2a, wild-type GluK1-2b and the mutant GluK1-2b have identical channel-opening and channel-closing rate constants. These results indicate that the C-terminal ER retention signal sequence, which affects receptor trafficking/expression, does not affect channel-gating properties. Furthermore, as compared with the GluK2 kainate receptor, the GluK1 channel is faster to open, close, and desensitize by at least two-fold, yet the EC50 value of GluK1 is similar to that of GluK2. PMID:22191429
de Freitas, Renato Leonardo; Salgado-Rohner, Carlos José; Biagioni, Audrey Francisco; Medeiros, Priscila; Hallak, Jaime Eduardo Cecílio; Crippa, José Alexandre S; Coimbra, Norberto Cysne
2014-06-01
The aim of the present study was to investigate the involvement of N-methyl-d-aspartate (NMDA) and amino-3-hydroxy-5-methyl-isoxazole-4-proprionate (AMPA)/kainate receptors of the prelimbic (PL) division of the medial prefrontal cortex (MPFC) on the panic attack-like reactions evoked by γ-aminobutyric acid-A receptor blockade in the medial hypothalamus (MH). Rats were pretreated with NaCl 0.9%, LY235959 (NMDA receptor antagonist), and NBQX (AMPA/kainate receptor antagonist) in the PL at 3 different concentrations. Ten minutes later, the MH was treated with bicuculline, and the defensive responses were recorded for 10 min. The antagonism of NMDA receptors in the PL decreased the frequency and duration of all defensive behaviors evoked by the stimulation of the MH and reduced the innate fear-induced antinociception. However, the pretreatment of the PL cortex with NBQX was able to decrease only part of defensive responses and innate fear-induced antinociception. The present findings suggest that the NMDA-glutamatergic system of the PL is critically involved in panic-like responses and innate fear-induced antinociception and those AMPA/kainate receptors are also recruited during the elaboration of fear-induced antinociception and in panic attack-related response. The activation of the glutamatergic neurotransmission of PL division of the MPFC during the elaboration of oriented behavioral reactions elicited by the chemical stimulation of the MH recruits mainly NMDA receptors in comparison with AMPA/kainate receptors.
AMPA Receptors Mediate Acetylcholine Release from Starburst Amacrine Cells in the Rabbit Retina
FIRTH, SALLY I.; LI, WEI; MASSEY, STEPHEN C.; MARSHAK, DAVID W.
2012-01-01
The light response of starburst amacrine cells is initiated by glutamate released from bipolar cells. To identify the receptors that mediate this response, we used a combination of anatomical and physiological techniques. An in vivo, rabbit eyecup was preloaded with [3H]-choline, and the [3H]-acetylcholine (ACh) released into the superfusate was monitored. A photopic, 3 Hz flashing light increased ACh release, and the selective AMPA receptor antagonist, GYKI 53655, blocked this light-evoked response. Nonselective AMPA/kainate agonists increased the release of ACh, but the specific kainate receptor agonist, SYM 2081, did not increase ACh release. Selective AMPA receptor antagonists, GYKI 53655 or GYKI 52466, also blocked the responses to agonists. We conclude that the predominant excitatory input to starburst amacrine cells is mediated by AMPA receptors. We also labeled lightly fixed rabbit retinas with antisera to choline acetyltransferase (ChAT), AMPA receptor subunits GluR1, GluR2/3, or GluR4, and kainate receptor subunits GluR6/7 and KA2. Labeled puncta were observed in the inner plexiform layer with each of these antisera to glutamate receptors, but only GluR2/3-IR puncta and GluR4-IR puncta were found on the ChAT-IR processes. The same was true of starburst cells injected intracellularly with Neurobiotin, and these AMPA receptor subunits were localized to two populations of puncta. The AMPA receptors are expected to desensitize rapidly, enhancing the sensitivity of starburst amacrine cells to moving or other rapidly changing stimuli. PMID:14515241
Watase, K; Sekiguchi, M; Matsui, T A; Tagawa, Y; Wada, K
1997-01-01
We reported that a 33-amino-acid deletion (from tyrosine-715 to glycine-747) in a putative extracellular loop of GluR3 produced a mutant that exhibited dominant negative effects upon the functional expression of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors [Sekiguchi et al. (1994) J. Biol. Chem. 269, 14559-14565]. In this study, we searched for a key residue in the dominant negative effects to explore the mechanism and examined the role of the residue in the function of the AMPA receptor. We prepared 20 GluR3 mutants with amino acid substitutions within the 33-amino-acid-region, and dominant negative effects were tested electrophysiologically in Xenopus oocytes co-expressing the mutant and normal subunits. Among the mutants, only a GluR3 mutant in which an original cysteine (Cys)-722 was replaced by alanine exhibited a dominant negative effect comparable with that of the original mutant in which the entire 33-amino-acid segment is deleted. The co-expression of the Cys-722 mutant did not inhibit the translation of normal subunits in oocytes. The Cys-722 mutant formed a functional homomeric receptor with significantly higher affinity for glutamate or kainate than a homomeric GluR3 receptor. The Cys-722 mutation greatly enhanced the sensitivity of GluR3 for aniracetam, which alters kinetic properties of AMPA receptors. The kainate-induced currents in oocytes expressing the Cys-722 mutant alone showed strong inward rectification. These results suggest that the Cys-722 in GluR3 is important for dominant negative effects and plays a crucial role in the determination of pharmacological properties in AMPA receptor function. PMID:9065754
Mori, Yasunori; Fukuda, Mitsunori; Henley, Jeremy M.
2014-01-01
Glutamate receptors are fundamental for control synaptic transmission, synaptic plasticity, and neuronal excitability. However, many of the molecular mechanisms underlying their trafficking remain elusive. We previously demonstrated that the small GTPase Rab17 regulates dendritic trafficking in hippocampal neurons. Here, we investigated the role(s) of Rab17 in AMPA receptor (AMPAR) and kainate receptor (KAR) trafficking. Although Rab17 knockdown did not affect surface expression of the AMPAR subunit GluA1 under basal or chemically induced long term potentiation conditions, it significantly reduced surface expression of the KAR subunit GluK2. Rab17 co-localizes with Syntaxin-4 in the soma, dendritic shaft, the tips of developing hippocampal neurons, and in spines. Rab17 knockdown caused Syntaxin-4 redistribution away from dendrites and into axons in developing hippocampal neurons. Syntaxin-4 knockdown reduced GluK2 but had no effect on GluA1 surface expression. Moreover, overexpression of constitutively active Rab17 promoted dendritic surface expression of GluK2 by enhancing Syntaxin-4 translocation to dendrites. These data suggest that Rab17 mediates the dendritic trafficking of Syntaxin-4 to selectively regulate dendritic surface insertion of GluK2-containing KARs in rat hippocampal neurons. PMID:24895134
Negrete-Díaz, José Vicente; Duque-Feria, Paloma; Andrade-Talavera, Yuniesky; Carrión, Miriam; Flores, Gonzalo; Rodríguez-Moreno, Antonio
2012-04-01
Kainate receptors (KARs) have been described as modulators of synaptic transmission at different synapses. However, this role of KARs has not been well characterized in the amygdala. We have explored the effect of kainate receptor activation at the synapse established between fibers originating at medial geniculate nucleus and the principal cells in the lateral amygdala. We have observed an inhibition of evoked excitatory postsynaptic currents (eEPSCs) amplitude after a brief application of KARs agonists KA and ATPA. Paired-pulse recordings showed a clear pair pulse facilitation that was enhanced after KA or ATPA application. When postsynaptic cells were loaded with BAPTA, the depression of eEPSC amplitude observed after the perfusion of KAR agonists was not prevented. We have also observed that the inhibition of the eEPSCs by KARs agonists was prevented by protein kinase A but not by protein kinase C inhibitors. Taken together our results indicate that KARs present at this synapse are pre-synaptic and their activation mediate the inhibition of glutamate release through a mechanism that involves the activation of protein kinase A. © 2012 The Authors. Journal of Neurochemistry © 2012 International Society for Neurochemistry.
Wang, Linxiao; Liu, Yanyan; Lu, Rulan; Dong, Guoying; Chen, Xia; Yun, Wenwei; Zhou, Xianju
2018-02-01
Epilepsy is a chronic brain disease affecting millions of individuals. Kainate receptors, especially kainate-type of ionotropic glutamate receptor 2 (GluK2), play an important role in epileptogenesis. Recent data showed that GluK2 could undergo post-translational modifications in terms of S-nitrosylation (SNO), and affect the signaling pathway of cell death in cerebral ischemia-reperfusion. However, it is unclear whether S-nitrosylation of GluK2 (SNO-GluK2) contributes to cell death induced by epilepsy. Here, we report that kainic acid-induced SNO-GluK2 is mediated by GluK2 itself, regulated by neuronal nitric oxide synthase (nNOS) and the level of cytoplasmic calcium in vivo and in vitro hippocampus neurons. The whole-cell patch clamp recordings showed the influence of SNO-GluK2 on ion channel characterization of GluK2-Kainate receptors. Moreover, immunohistochemistry staining results showed that inhibition of SNO-GluK2 by blocking nNOS or GluK2 or by reducing the level of cytoplasmic calcium-protected hippocampal neurons from kainic acid-induced injury. Finally, immunoprecipitation and western blotting data revealed the involvement of assembly of a GluK2-PSD95-nNOS signaling complex in epilepsy. Taken together, our results showed that the SNO-GluK2 plays an important role in neuronal injury of epileptic rats by forming GluK2-PSD95-nNOS signaling module in a cytoplasmic calcium-dependent way, suggesting a potential therapeutic target site for epilepsy. © 2017 International Society for Neurochemistry.
Genetic analysis of neuronal ionotropic glutamate receptor subunits
Granger, Adam J; Gray, John A; Lu, Wei; Nicoll, Roger A
2011-01-01
Abstract In the brain, fast, excitatory synaptic transmission occurs primarily through AMPA- and NMDA-type ionotropic glutamate receptors. These receptors are composed of subunit proteins that determine their biophysical properties and trafficking behaviour. Therefore, determining the function of these subunits and receptor subunit composition is essential for understanding the physiological properties of synaptic transmission. Here, we discuss and evaluate various genetic approaches that have been used to study AMPA and NMDA receptor subunits. These approaches have demonstrated that the GluA1 AMPA receptor subunit is required for activity-dependent trafficking and contributes to basal synaptic transmission, while the GluA2 subunit regulates Ca2+ permeability, homeostasis and trafficking to the synapse under basal conditions. In contrast, the GluN2A and GluN2B NMDA receptor subunits regulate synaptic AMPA receptor content, both during synaptic development and plasticity. Ongoing research in this field is focusing on the molecular interactions and mechanisms that control these functions. To accomplish this, molecular replacement techniques are being used, where native subunits are replaced with receptors containing targeted mutations. In this review, we discuss a single-cell molecular replacement approach which should arguably advance our physiological understanding of ionotropic glutamate receptor subunits, but is generally applicable to study of any neuronal protein. PMID:21768264
Genetic analysis of neuronal ionotropic glutamate receptor subunits.
Granger, Adam J; Gray, John A; Lu, Wei; Nicoll, Roger A
2011-09-01
In the brain, fast, excitatory synaptic transmission occurs primarily through AMPA- and NMDA-type ionotropic glutamate receptors. These receptors are composed of subunit proteins that determine their biophysical properties and trafficking behaviour. Therefore, determining the function of these subunits and receptor subunit composition is essential for understanding the physiological properties of synaptic transmission. Here, we discuss and evaluate various genetic approaches that have been used to study AMPA and NMDA receptor subunits. These approaches have demonstrated that the GluA1 AMPA receptor subunit is required for activity-dependent trafficking and contributes to basal synaptic transmission, while the GluA2 subunit regulates Ca(2+) permeability, homeostasis and trafficking to the synapse under basal conditions. In contrast, the GluN2A and GluN2B NMDA receptor subunits regulate synaptic AMPA receptor content, both during synaptic development and plasticity. Ongoing research in this field is focusing on the molecular interactions and mechanisms that control these functions. To accomplish this, molecular replacement techniques are being used, where native subunits are replaced with receptors containing targeted mutations. In this review, we discuss a single-cell molecular replacement approach which should arguably advance our physiological understanding of ionotropic glutamate receptor subunits, but is generally applicable to study of any neuronal protein.
Subunit arrangement in P2X receptors.
Jiang, Lin-Hua; Kim, Miran; Spelta, Valeria; Bo, Xuenong; Surprenant, Annmarie; North, R Alan
2003-10-01
ATP-gated ionotropic receptors (P2X receptors) are distributed widely in the nervous system. For example, a hetero-oligomeric receptor containing both P2X2 and P2X3 subunits is involved in primary afferent sensation. Each subunit has two membrane-spanning domains. We have used disulfide bond formation between engineered cysteines to demonstrate close proximity between the outer ends of the first transmembrane domain of one subunit and the second transmembrane domain of another. After expression in HEK 293 cells of such modified P2X2 or P2X4 subunits, the disulfide bond formation is evident because an ATP-evoked channel opening requires previous reduction with dithiothreitol. In the hetero-oligomeric P2X2/3 receptor the coexpression of doubly substituted subunits with wild-type partners allows us to deduce that the hetero-oligomeric channel contains adjacent P2X3 subunits but does not contain adjacent P2X2 subunits. The results suggest a "head-to-tail" subunit arrangement in the quaternary structure of P2X receptors and show that a trimeric P2X2/3 receptor would have the composition P2X2(P2X3)2.
Gene expression of ionotropic glutamate receptor subunits in the tectofugal pathway of the pigeon.
Atoji, Y
2016-03-01
The tectofugal pathway in birds consists of four stations, the retina, optic tectum, rotundal nucleus, and entopallium, and it conveys visual information via three ascending pathways. These pathways consist of retino-tectal, tecto-rotundal and rotundo-entopallial cells, all of which are glutamatergic. The present study examined the localization of ionotropic glutamate receptors (iGluRs) to identify the target areas of glutamatergic projections in the tectofugal pathway in pigeons. Nine subunits of iGluRs were analyzed using in situ hybridization as follows: AMPA receptors (GluA1, GluA2, GluA3, and GluA4), kainate receptors (GluK1, GluK2, and GluK4), and NMDA receptors (GluN1 and GluN2A). Hybridization signals of subunits showed various intensities in different cells. In the optic tectum, a strong to moderate expression was observed in layer 10 (GluA2, GluA3, GluK4, and GluN1) and layer 13 (GluA2, GluK4, GluN1, and GluN2A). The rotundal nucleus intensely expressed GluA3, GluA4, GluK1, and GluK4. In the entopallium, an intense to moderate expression of GluK1 and GluK4, and a moderate to weak expression of AMPA and NMDA receptors were observed. Furthermore, the parvocellular and magnocellular parts of the isthmic nuclei showed a strong expression of GluA2, GluA3, GluK4, and GluN1. The present findings demonstrate the expression of iGluRs in glutamatergic projection targets of the tectofugal pathway in birds and suggest a diversity of iGluRs in the transmission of visual information. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.
Slattery, James A; Page, Amanda J; Dorian, Camilla L; Brierley, Stuart M; Blackshaw, L Ashley
2006-01-01
Glutamate acts at central synapses via ionotropic (iGluR – NMDA, AMPA and kainate) and metabotropic glutamate receptors (mGluRs). Group I mGluRs are excitatory whilst group II and III are inhibitory. Inhibitory mGluRs also modulate peripherally the mechanosensitivity of gastro-oesophageal vagal afferents. Here we determined the potential of excitatory GluRs to play an opposing role in modulating vagal afferent mechanosensitivity, and investigated expression of receptor subunit mRNA within the nodose ganglion. The responses of mouse gastro-oesophageal vagal afferents to graded mechanical stimuli were investigated before and during application of selective GluR ligands to their peripheral endings. Two types of vagal afferents were tested: tension receptors, which respond to circumferential tension, and mucosal receptors, which respond only to mucosal stroking. The selective iGluR agonists NMDA and AMPA concentration-dependently potentiated afferent responses. Their corresponding antagonists AP-5 and NBQX alone attenuated mechanosensory responses as did the non-selective antagonist kynurenate. The kainate selective agonist SYM-2081 had minor effects on mechanosensitivity, and the antagonist UBP 302 was ineffective. The mGluR5 antagonist MTEP concentration-dependently inhibited mechanosensitivity. Efficacy of agonists and antagonists differed on mucosal and tension receptors. We conclude that excitatory modulation of afferent mechanosensitivity occurs mainly via NMDA, AMPA and mGlu5 receptors, and the role of each differs according to afferent subtypes. PCR data indicated that all NMDA, kainate and AMPA receptor subunits plus mGluR5 are expressed, and are therefore candidates for the neuromodulation we observed. PMID:16945965
Slattery, James A; Page, Amanda J; Dorian, Camilla L; Brierley, Stuart M; Blackshaw, L Ashley
2006-11-15
Glutamate acts at central synapses via ionotropic (iGluR--NMDA, AMPA and kainate) and metabotropic glutamate receptors (mGluRs). Group I mGluRs are excitatory whilst group II and III are inhibitory. Inhibitory mGluRs also modulate peripherally the mechanosensitivity of gastro-oesophageal vagal afferents. Here we determined the potential of excitatory GluRs to play an opposing role in modulating vagal afferent mechanosensitivity, and investigated expression of receptor subunit mRNA within the nodose ganglion. The responses of mouse gastro-oesophageal vagal afferents to graded mechanical stimuli were investigated before and during application of selective GluR ligands to their peripheral endings. Two types of vagal afferents were tested: tension receptors, which respond to circumferential tension, and mucosal receptors, which respond only to mucosal stroking. The selective iGluR agonists NMDA and AMPA concentration-dependently potentiated afferent responses. Their corresponding antagonists AP-5 and NBQX alone attenuated mechanosensory responses as did the non-selective antagonist kynurenate. The kainate selective agonist SYM-2081 had minor effects on mechanosensitivity, and the antagonist UBP 302 was ineffective. The mGluR5 antagonist MTEP concentration-dependently inhibited mechanosensitivity. Efficacy of agonists and antagonists differed on mucosal and tension receptors. We conclude that excitatory modulation of afferent mechanosensitivity occurs mainly via NMDA, AMPA and mGlu5 receptors, and the role of each differs according to afferent subtypes. PCR data indicated that all NMDA, kainate and AMPA receptor subunits plus mGluR5 are expressed, and are therefore candidates for the neuromodulation we observed.
Radial symmetry in a chimeric glutamate receptor pore
NASA Astrophysics Data System (ADS)
Wilding, Timothy J.; Lopez, Melany N.; Huettner, James E.
2014-02-01
Ionotropic glutamate receptors comprise two conformationally different A/C and B/D subunit pairs. Closed channels exhibit fourfold radial symmetry in the transmembrane domain (TMD) but transition to twofold dimer-of-dimers symmetry for extracellular ligand binding and N-terminal domains. Here, to evaluate symmetry in open pores we analysed interaction between the Q/R editing site near the pore loop apex and the transmembrane M3 helix of kainate receptor subunit GluK2. Chimeric subunits that combined the GluK2 TMD with extracellular segments from NMDA receptors, which are obligate heteromers, yielded channels made up of A/C and B/D subunit pairs with distinct substitutions along M3 and/or Q/R site editing status, in an otherwise identical homotetrameric TMD. Our results indicate that Q/R site interaction with M3 occurs within individual subunits and is essentially the same for both A/C and B/D subunit conformations, suggesting that fourfold pore symmetry persists in the open state.
Akinshola, B Emmanuel
2001-01-01
The effects of n-alcohols (methanol to 1-decanol) on kainate-activated AMPA receptor subunit GluR1 and GluR3 ion currents were studied in Xenopus oocytes using the two-electrode voltage-clamp recording technique. For short-chain alcohols from methanol to 1-hexanol, potency for inhibition of GluR1 and GluR3 receptor-mediated current increased in proportion to the chain length or hydrophobicity of the alcohol. The IC50 values of these alcohols for GluR1 were: methanol, 702 mM; ethanol, 170 mM; 1-propanol, 69 mM; 1-butanol, 20 mM; 1-pentanol, 17 mM; and 1-hexanol, 10 mM. For GluR3, IC50 values were: methanol, 712 mM; ethanol, 238 mM; 1-propanol, 50 mM; 1-butanol, 32 mM; 1-pentanol, 13 mM; and 1-hexanol, 7 mM. For long-chain alcohols, 1-heptanol was less potent than 1-hexanol (estimated IC50: 19 mM for GluR1 and 18 mM for GluR3), 1-octanol had little effect only on GluR3, and 1-nonanol and 1-decanol did not significantly inhibit both GluR1 and GluR3 responses. The observations indicate that straight-chain n-alcohols exhibit a cutoff in their potency for inhibition of the function of non-NMDA glutamate receptor subunits, GluR1 and GluR3. The cutoff in potency of n-alcohols for inhibition of non-NMDA glutamate receptor function is consistent with the interpretation that alcohols affect the function of these receptor-channels by interacting with an alcohol binding site of specific dimensions on the receptor protein. PMID:11429388
Specific Roles of NMDA Receptor Subunits in Mental Disorders.
Yamamoto, H; Hagino, Y; Kasai, S; Ikeda, K
2015-01-01
N-methyl-D-aspartate (NMDA) receptor plays important roles in learning and memory. NMDA receptors are a tetramer that consists of two glycine-binding subunits GluN1, two glutamate-binding subunits (i.e., GluN2A, GluN2B, GluN2C, and GluN2D), a combination of a GluN2 subunit and glycine-binding GluN3 subunit (i.e., GluN3A or GluN3B), or two GluN3 subunits. Recent studies revealed that the specific expression and distribution of each subunit are deeply involved in neural excitability, plasticity, and synaptic deficits. The present article summarizes reports on the dysfunction of NMDA receptors and responsible subunits in various neurological and psychiatric disorders, including schizophrenia, autoimmune-induced glutamatergic receptor dysfunction, mood disorders, and autism. A key role for the GluN2D subunit in NMDA receptor antagonist-induced psychosis has been recently revealed.
Sherwood, John L; Amici, Mascia; Dargan, Sheila L; Culley, Georgia R; Fitzjohn, Stephen M; Jane, David E; Collingridge, Graham L; Lodge, David; Bortolotto, Zuner A
2012-09-01
Long-term potentiation (LTP) is a well-established experimental model used to investigate the synaptic basis of learning and memory. LTP at mossy fibre - CA3 synapses in the hippocampus is unusual because it is normally N-methyl-d-aspartate (NMDA) receptor-independent. Instead it seems that the trigger for mossy fibre LTP involves kainate receptors (KARs). Although it is generally accepted that pre-synaptic KARs play an essential role in frequency facilitation and LTP, their subunit composition remains a matter of significant controversy. We have reported previously that both frequency facilitation and LTP can be blocked by selective antagonism of GluK1 (formerly GluR5/Glu(K5))-containing KARs, but other groups have failed to reproduce this effect. Moreover, data from receptor knockout and mRNA expression studies argue against a major role of GluK1, supporting a more central role for GluK2 (formerly GluR6/Glu(K6)). A potential reason underlying the controversy in the pharmacological experiments may reside in differences in the preparations used. Here we show differences in pharmacological sensitivity of synaptic plasticity at mossy fibre - CA3 synapses depend critically on slice orientation. In transverse slices, LTP of fEPSPs was invariably resistant to GluK1-selective antagonists whereas in parasagittal slices LTP was consistently blocked by GluK1-selective antagonists. In addition, there were pronounced differences in the magnitude of frequency facilitation and the sensitivity to the mGlu2/3 receptor agonist DCG-IV. Using anterograde labelling of granule cells we show that slices of both orientations possess intact mossy fibres and both large and small presynaptic boutons. Transverse slices have denser fibre tracts but a smaller proportion of giant mossy fibre boutons. These results further demonstrate a considerable heterogeneity in the functional properties of the mossy fibre projection. Copyright © 2012 Elsevier Ltd. All rights reserved.
The N-terminal domain of GluR6-subtype glutamate receptor ion channels
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumar, Janesh; Schuck, Peter; Jin, Rongsheng
2009-09-25
The amino-terminal domain (ATD) of glutamate receptor ion channels, which controls their selective assembly into AMPA, kainate and NMDA receptor subtypes, is also the site of action of NMDA receptor allosteric modulators. Here we report the crystal structure of the ATD from the kainate receptor GluR6. The ATD forms dimers in solution at micromolar protein concentrations and crystallizes as a dimer. Unexpectedly, each subunit adopts an intermediate extent of domain closure compared to the apo and ligand-bound complexes of LIVBP and G protein-coupled glutamate receptors (mGluRs), and the dimer assembly has a markedly different conformation from that found in mGluRs.more » This conformation is stabilized by contacts between large hydrophobic patches in the R2 domain that are absent in NMDA receptors, suggesting that the ATDs of individual glutamate receptor ion channels have evolved into functionally distinct families.« less
Greger, Ingo H; Watson, Jake F; Cull-Candy, Stuart G
2017-05-17
AMPA receptors (AMPARs) are tetrameric ion channels that together with other ionotropic glutamate receptors (iGluRs), the NMDA and kainate receptors, mediate a majority of excitatory neurotransmission in the central nervous system. Whereas NMDA receptors gate channels with slow kinetics, responsible primarily for generating long-term synaptic potentiation and depression, AMPARs are the main fast transduction elements at synapses and are critical for the expression of plasticity. The kinetic and conductance properties of AMPARs are laid down during their biogenesis and are regulated by post-transcriptional RNA editing, splice variation, post-translational modification, and subunit composition. Furthermore, AMPAR assembly, trafficking, and functional heterogeneity depends on a large repertoire of auxiliary subunits-a feature that is particularly striking for this type of iGluR. Here, we discuss how the subunit structure, stoichiometry, and auxiliary subunits generate a heterogeneous plethora of receptors, each tailored to fulfill a vital role in fast synaptic signaling and plasticity. Copyright © 2017 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Neish, Calum S.; Martin, Ian L.; Davies, Martin; Henderson, Robert M.; Edwardson, J. Michael
2003-08-01
We have developed an atomic force microscopy (AFM)-based method for the determination of the subunit architecture of ionotropic receptors, and tested the method using the GABAA receptor as a model system. The most common form of the GABAA receptor probably consists of 2alpha1-, 2beta2- and 1gamma2-subunits. We show here that the arrangement of subunits around the central Cl- ion channel can be deduced by AFM of receptors tagged with subunit-specific antibodies. Transfection of cells with DNA encoding alpha1-, beta2- and gamma2-subunits resulted in the production of receptors containing all three subunits, as judged by both immunoblot analysis and the binding of [3H]-Ro15-1788, a specific radioligand for the GABAA receptor. A His6-tag on the alpha1-subunit was used to purify the receptor from membrane fractions of transfected cells. After incubation with anti-His6 immunoglobulin G, some receptors became tagged with either one or two antibody molecules. AFM analysis of complexes containing two bound antibodies showed that the most common angle between the two tags was 135°, close to the value of 144° expected if the two alpha-subunits are separated by a third subunit. This method is applicable to the complete elucidation of the subunit arrangement around the GABAA receptor rosette, and can also be applied to other ionotropic receptors.
Butini, Stefania; Pickering, Darryl S; Morelli, Elena; Coccone, Salvatore Sanna; Trotta, Francesco; De Angelis, Meri; Guarino, Egeria; Fiorini, Isabella; Campiani, Giuseppe; Novellino, Ettore; Schousboe, Arne; Christensen, Jeppe K; Gemma, Sandra
2008-10-23
(S)-CPW399 ((S)-1) is a potent and excitotoxic AMPA receptor partial agonist. Modifying the cyclopentane ring of (S)-1, we developed two of the most potent and selective functional antagonists (5 and 7) for kainate receptor (KA-R) subunit iGluR5. Derivatives 5 and 7, with their unique pharmacological profile, may lead to a better understanding of the different roles and modes of action of iGluR1-5 subunits, paving the way for the synthesis of new potent, subunit selective iGluR5 modulators.
Baude, A; Nusser, Z; Molnár, E; McIlhinney, R A; Somogyi, P
1995-12-01
The cellular and subcellular localization of the GluRA, GluRB/C and GluRD subunits of the alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) type glutamate receptor was determined in the rat hippocampus using polyclonal antipeptide antibodies in immunoperoxidase and immunogold procedures. For the localization of the GluRD subunit a new polyclonal antiserum was developed using the C-terminal sequence of the protein (residues 869-881), conjugated to carrier protein and absorbed to colloidal gold for immunization. The purified antibodies immunoprecipitated about 25% of 3[H]AMPA binding activity from the hippocampus, cerebellum or whole brain, but very little from neocortex. These antibodies did not precipitate a significant amount of 3[H]kainate binding activity. The antibodies also recognize the GluRD subunit, but not the other AMPA receptor subunits, when expressed in transfected COS-7 cells and only when permeabilized with detergent, indicating an intracellular epitope. All subunits were enriched in the neuropil of the dendritic layers of the hippocampus and in the molecular layer of the dentate gyrus. The cellular distribution of the GluRD subunit was studied more extensively. The strata radiatum, oriens and the dentate molecular layer were more strongly immunoreactive than the stratum lacunosum moleculare, the stratum lucidum and the hilus. However, in the stratum lucidum of the CA3 area and in the hilus the weakly reacting dendrites were surrounded by immunopositive rosettes, shown in subsequent electron microscopic studies to correspond to complex dendritic spines. In the stratum radiatum, the weakly reacting apical dendrites contrasted with the surrounding intensely stained neuropil. The cell bodies of pyramidal and granule cells were moderately reactive. Some non-principal cells and their dendrites in the pyramidal cell layer and in the alveus also reacted very strongly for the GluRD subunit. At the subcellular level, silver intensified immunogold
Immunocytochemical localization of the NMDA-R2A receptor subunit in the cat retina.
Goebel, D J; Aurelia, J L; Tai, Q; Jojich, L; Poosch, M S
1998-10-19
Immunocytochemical studies were performed to determine the distribution and cellular localization of the NMDA-R2A receptor subunit (R2A) in the cat retina. R2A-immunoreactivity (R2A-IR) was noted in all layers of the retina, with specific localizations in the outer segments of red/green and blue cone photoreceptors, B-type horizontal cells, several types of amacrine cells, Müller cells and the majority of cells in the ganglion cell layer. In the inner nuclear layer, 48% of all cells residing in the amacrine cell layer were R2A-IR including a cell resembling the GABAergic A17 amacrine cell. Interestingly, the AII rod amacrine cell was devoid of R2A-IR. Although the localization of the R2A subunit was anticipated in ganglion cells, amacrines and Müller cells, the presence of this receptor subunit to the cells in the outer retina was not expected. Here, both the R2A and the R2B subunits were found to be present in the outer segments of cone photoreceptors and to the tips of rod outer segments. Although the function of these receptor subunits in rod and cone photoreceptors remains to be determined, the fact that both R2A and R2B receptor subunits are localized to cone outer segments suggests a possible alternative pathway for calcium entry into a region where this cation plays such a crucial role in the process of phototransduction. To further classify the cells that display NR2A-IR, we performed dual labeling experiments showing the relationship between R2A-labeled cells with GABA. Results showed that all GABAergic-amacrines and displaced amacrines express the R2A-subunit protein. In addition, approximately 11% of the NR2A-labeled amacrines, did not stain for GABA. These findings support pharmacological data showing that NMDA directly facilitates GABA release in retina and retinal cultures [I.L. Ferreira, C.B. Duarte, P.F. Santos, C.M. Carvalho, A.P. Carvalho, Release of [3H]GABA evoked by glutamate receptor agonist in cultured chick retinal cells: effect of Ca2
Andrade-Talavera, Yuniesky; Duque-Feria, Paloma; Negrete-Díaz, José Vicente; Sihra, Talvinder S; Flores, Gonzalo; Rodríguez-Moreno, Antonio
2012-09-01
Presynaptic kainate receptors (KARs) modulate the release of glutamate at synapses established between mossy fibers (MF) and CA3 pyramidal cells in the hippocampus. The activation of KAR by low, nanomolar, kainate concentrations facilitates glutamate release. KAR-mediated facilitation of glutamate release involves the activation of an adenylate cyclase/cyclic adenosine monophosphate/protein kinase A cascade at MF-CA3 synapses. Here, we studied the mechanisms by which KAR activation produces this facilitation of glutamate release in slices and synaptosomes. We find that the facilitation of glutamate release mediated by KAR activation requires an increase in Ca(2+) levels in the cytosol and the formation of a Ca(2+) -calmodulin complex to activate adenylate cyclase. The increase in cytosolic Ca(2+) underpinning this modulation is achieved, both, by Ca(2+) entering via Ca(2+) -permeable KARs and, by the mobilization of intraterminal Ca(2+) stores. Finally, we find that, congruent with the Ca(2+) -calmodulin support of KAR-mediated facilitation of glutamate release, induction of long-term potentiation at MF-CA3 synapses has an obligate requirement for Ca(2+) -calmodulin activity. © 2012 The Authors. Journal of Neurochemistry © 2012 International Society for Neurochemistry.
Leedman, P J; Newman, J D; Harrison, L C
1989-07-01
We studied the subunit structure of the human TSH receptor in thyroid tissue from patients with Graves' disease and multinodular goiter by TSH affinity chromatography, immunoprecipitation with Graves' immunoglobulins (Igs), and a modified technique of Western blotting. Human TSH receptor-binding activity was purified about 1,270-fold by sequential affinity chromatography on wheat germ lectin-agarose and TSH-agarose. Analysis by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of nonreduced affinity-purified receptors eluted in sodium dodecyl sulfate sample buffer revealed three noncovalently linked subunits of 70,000, 50,000, and 35,000 mol wt. When reduced, a major subunit of 25,000 mol wt was identified. When 3 mol/L NaCl was used to elute affinity-purified receptors only the 50,000 mol wt nonreduced subunit was detected. This subunit bound [125I]bovine TSH and was precipitated by Graves' Igs. Modifications to the conventional Western blotting technique enabled thyroglobulin components (approximately 220,000 mol wt), thyroid microsomal antigen (a doublet of approximately 110,000 mol wt), and putative TSH receptor subunits of 70,000 and 50,000 mol wt to be identified in thyroid particulate membranes by Graves' Igs. Blotting of affinity-purified receptors eluted in sodium dodecyl sulfate sample buffer revealed subunits of either 70,000 or 50,000 mol wt, with a minority of Graves' serum samples. We conclude that the nonreduced human TSH receptor is an oligomeric complex comprising three different subunits of 70,000, 50,000, and 35,000 mol wt. The reduced receptor exists as a single subunit of 25,000 mol wt, which may be disulfide linked to form the higher mol wt forms. The 70,000 and 50,000 mol wt subunits contain epitopes that bind Graves' Igs in modified Western blots, thus directly confirming that the human TSH receptor is a target for Graves' Igs.
Rectification properties and Ca2+ permeability of glutamate receptor channels in hippocampal cells.
Lerma, J; Morales, M; Ibarz, J M; Somohano, F
1994-07-01
Excitatory amino acids exert a depolarizing action on central nervous system cells through an increase in cationic conductances. Non-NMDA receptors have been considered to be selectively permeable to Na+ and K+, while Ca2+ influx has been thought to occur through the NMDA receptor subtype. Recently, however, the expression of cloned non-NMDA receptor subunits has shown that alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors are permeable to Ca2+ whenever the receptor lacks a particular subunit (edited GluR-B). The behaviour of recombinant glutamate receptor channels predicts that Ca2+ would only permeate through receptors that show strong inward rectification and vice versa, i.e. AMPA receptors with linear current-voltage relationships would be impermeable to Ca2+. Using the whole-cell configuration of the patch-clamp technique, we have studied the Ca2+ permeability and the rectifying properties of AMPA receptors, when activated by kainate, in hippocampal neurons kept in culture or acutely dissociated from differentiated hippocampus. Cells were classified according to whether they showed outward rectifying (type I), inward rectifying (type II) or almost linear (type III) current-voltage relationships for kainate-activated responses. AMPA receptors of type I cells (52.2%) were mostly Ca(2+)-impermeable (PCa/PCs = 0.1), while type II cells (6.5%) expressed Ca(2+)-permeable receptors (PCa/PCs = 0.9). Type III cells (41.3%) showed responses with low but not negligible Ca2+ permeability (PCa/PCs = 0.18). The degree of Ca2+ permeability and inward rectification were well correlated in cultured cells, i.e. more inward rectification corresponded to higher Ca2+ permeability.(ABSTRACT TRUNCATED AT 250 WORDS)
Immunohistochemical localization of ionotropic glutamate receptors in the rat red nucleus
Minbay, Zehra; Kocoglu, Sema Serter; Yurtseven, Duygu Gok; Eyigor, Ozhan
2017-01-01
In this study, we aimed to determine the presence as well as the diverse distribution of N-methyl-D-aspartate (NMDA) and non-NMDA glutamate receptor subunits in the rat red nucleus. Using adult Sprague-Dawley rats as the experimental animals, immunohistochemistry was performed on 30 µm thick coronal brain sections with antibodies against α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (GluA1-4), kainate (GluK1, GluK2/3, and GluK5), and NMDA (GluN1 and GluN2A) receptor subunits. The results showed that all ionotropic glutamate receptor subunits are expressed in the red nucleus. Specific staining was localized in the neuron bodies and processes. However, the pattern of immunoreactivity and the number of labeled neurons changed depending on the type of ionotropic glutamate receptor subunits and the localization of neurons in the red nucleus. The neurons localized in the magnocellular part of the red nucleus were particularly immunopositive for GluA2, GluA4, GluK2/3, GluK5, GluN1, and GluN2A receptor proteins. In the parvocellular part of the red nucleus, ionotropic glutamate receptor subunit immunoreactivity of variable intensity (lightly to moderately stained) was detected in the neurons. These results suggest that red nucleus neurons in rat heterogeneously express ionotropic glutamate receptor subunits to form functional receptor channels. In addition, the likelihood of the coexpression of different subunits in the same subgroup of neurons suggests the formation of receptor channels with diverse structure by way of different subunit combination, and the possibility of various neuronal functions through these channels in the red nucleus. PMID:28027456
Immunohistochemical localization of ionotropic glutamate receptors in the rat red nucleus.
Minbay, Zehra; Serter Kocoglu, Sema; Gok Yurtseven, Duygu; Eyigor, Ozhan
2017-02-21
In this study, we aimed to determine the presence as well as the diverse distribution of N-methyl-D-aspartate (NMDA) and non-NMDA glutamate receptor subunits in the rat red nucleus. Using adult Sprague-Dawley rats as the experimental animals, immunohistochemistry was performed on 30 µm thick coronal brain sections with antibodies against α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (GluA1-4), kainate (GluK1, GluK2/3, and GluK5), and NMDA (GluN1 and GluN2A) receptor subunits. The results showed that all ionotropic glutamate receptor subunits are expressed in the red nucleus. Specific staining was localized in the neuron bodies and processes. However, the pattern of immunoreactivity and the number of labeled neurons changed depending on the type of ionotropic glutamate receptor subunits and the localization of neurons in the red nucleus. The neurons localized in the magnocellular part of the red nucleus were particularly immunopositive for GluA2, GluA4, GluK2/3, GluK5, GluN1, and GluN2A receptor proteins. In the parvocellular part of the red nucleus, ionotropic glutamate receptor subunit immunoreactivity of variable intensity (lightly to moderately stained) was detected in the neurons. These results suggest that red nucleus neurons in rat heterogeneously express ionotropic glutamate receptor subunits to form functional receptor channels. In addition, the likelihood of the coexpression of different subunits in the same subgroup of neurons suggests the formation of receptor channels with diverse structure by way of different subunit combination, and the possibility of various neuronal functions through these channels in the red nucleus.
Potentiation of tonic GABAergic inhibition by activation of postsynaptic kainate receptors.
Jiang, L; Kang, D; Kang, J
2015-07-09
Presynaptic kainate-type glutamate ionotropic receptors (KARs) that mediate either the depression or the facilitation of GABA release have been intensively studied. Little attention has been given to the modulation of GABAA receptors (GABAARs) by postsynaptic KARs. Recent studies suggest that two GABAAR populations, synaptic (sGABAAR) and extrasynaptic (eGABAAR) GABAARs, mediate phasic and tonic forms of inhibition, respectively. Tonic inhibition plays an important role in the excitability of neuronal circuits and the occurrence of epileptic seizures. For this study, we are the first to report that the activation of postsynaptic KARs by the KAR agonist, Kainic acid (KA, 5 μM), enhanced tonic inhibition by potentiating eGABAARs. KA enhanced THIP-induced eGABAAR currents and prolonged the rise and decay time of muscimol-induced sGABAAR/eGABAAR currents, but also depressed the amplitude of evoked inhibitory postsynaptic currents (IPSCs), unitary IPSCs (uIPSCs), and muscimol-induced sGABAAR/eGABAAR currents. The PKC inhibitor, staurosporine (1 μM), in the patch pipette solution fully blocked the KA-induced potentiation of tonic inhibition, suggesting the involvement of an intracellular PKC pathway. Our study suggests that the activation of postsynaptic KARs potentiates eGABAARs but depresses sGABAARs. By activating postsynaptic KARs, synaptically released glutamate depresses phasic inhibition to facilitate neuronal plasticity, but potentiates tonic inhibition to protect neurons from over-excitation. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.
Santangelo Freel, Rose M.; Ogden, Kevin K.; Strong, Katie L.; Khatri, Alpa; Chepiga, Kathryn M.; Jensen, Henrik S.; Traynelis, Stephen F.; Liotta, Dennis C.
2015-01-01
We describe here the synthesis and evaluation of a series of tetrahydroisoquinolines that show subunit-selective potentiation of NMDA receptors containing the GluN2C or GluN2D subunits. Bischler-Napieralski conditions were employed in the key step for the conversion of acyclic amides to the corresponding tetrahydroisoquinoline containing analogs. Compounds were evaluated using both two electrode voltage clamp recordings from Xenopus laevis oocytes and imaging of mammalian BHK cells loaded with Ca2+-sensitive dyes. The most potent analogues had EC50 values of 300 nM and showed over 2-fold potentiation of the response to maximally effective concentrations of glutamate and glycine, but had no effect on responses from NMDA receptors containing the GluN2A or GluN2B subunits, AMPA, kainate, GABA, or glycine receptors or a variety of other potential targets. These compounds represent a potent class of small molecule subunit-selective potentiators of NMDA receptors. PMID:23627311
GABAA receptors: Various stoichiometrics of subunit arrangement in α1β3 and α1β3ε receptors.
Has, Ahmad Tarmizi Che; Chebib, Mary
2018-05-15
GABAA receptors (GABAARs) are members of the Cys-loop ligand-gated ion channel (LGIC) superfamily, which includes nicotinic acetylcholine, glycine, and serotonin (5HT3) receptors [1,2,3,4]. LGICs typically mediate fast synaptic transmission via the movement of ions through channels gated by neurotransmitters, such as acetylcholine for nicotinic receptors and GABA for GABAARs [5]. The term Cys-loop receptors originates from the presence of a conserved disulphide bond (or bridge) which holds together two cysteine amino acids of the loop that forms from the structure of polypeptides in the extracellular domain of the receptor's subunit [6]. GABAARs are pentameric transmembrane protein complexes consisting of five subunits from a variety of polypeptide subunits [7,8]. All of these subunits are pseudo-symmetrically organized in the plane of the membrane, with a Cl--selective channel in the middle of the complex. To date, nineteen GABAAR subunits have been identified and categorized into eight classes, α1-6, β1-3, γ1-3, δ, ε, θ, π and ρ1-3, but their variety is further broadened by the existence of several splice forms for certain subunits (e.g., α6, β2 and γ2) [9,10,11,12]. The subunits within each class have an amino acid sequence homology of 70% or more, whereas those with a sequence homology of 30% or less are grouped into different classes [13,14]. A subunit consists of four transmembrane domains (TM1-TM4), each forming an α-helix; a large extracellular N-terminal domain that incorporates part of the orthosteric agonist/antagonist binding site; a large intracellular loop between the TM3 and TM4; a small intracellular loop between TM1 and TM2; a small extracellular loop between TM2 and TM3; and a C-terminal extracellular domain [15,16]. Each subunit is arranged in such a way as to create principal and complementary interfaces with the other subunits, and in a position such that the TM2 of each subunit forms the wall of the channel pore [17,18,19]. The
Nimmich, Mitchell L.; Heidelberg, Laura S.; Fisher, Janet L.
2009-01-01
RNA editing provides a post-transcriptional mechanism to increase structural heterogeneity of gene products. Recently, the α3 subunit of the GABAA receptors has been shown to undergo RNA editing. As a result, a highly conserved isoleucine residue in the third transmembrane domain is replaced with a methionine. To determine the effect of this structural change on receptor function, we compared the GABA sensitivity, pharmacological properties and macroscopic kinetics of recombinant receptors containing either the edited or unedited forms of the α3 subunit along with β3 and γ2L. Editing substantially altered the GABA sensitivity and deactivation rate of the receptors, with the unedited form showing a lower GABA EC50 and slower decay. Comparable effects were observed with a mutation at the homologous location in the α1 subunit, suggesting a common role for this site in regulation of channel gating. Except for the response to GABA, the pharmacological properties of the receptor were unaffected by editing, with similar enhancement by a variety of modulators. Since RNA editing of the α3 subunit increases through development, our findings suggest that GABAergic neurotransmission may be more effective early in development, with greater GABA sensitivity and slower decay rates conferred by the unedited α3 subunit. PMID:19367790
Jayaraman, Anusha; Christensen, Amy; Moser, V. Alexandra; Vest, Rebekah S.; Miller, Chris P.; Hattersley, Gary
2014-01-01
The decline in testosterone levels in men during normal aging increases risks of dysfunction and disease in androgen-responsive tissues, including brain. The use of testosterone therapy has the potential to increase the risks for developing prostate cancer and or accelerating its progression. To overcome this limitation, novel compounds termed “selective androgen receptor modulators” (SARMs) have been developed that lack significant androgen action in prostate but exert agonist effects in select androgen-responsive tissues. The efficacy of SARMs in brain is largely unknown. In this study, we investigate the SARM RAD140 in cultured rat neurons and male rat brain for its ability to provide neuroprotection, an important neural action of endogenous androgens that is relevant to neural health and resilience to neurodegenerative diseases. In cultured hippocampal neurons, RAD140 was as effective as testosterone in reducing cell death induced by apoptotic insults. Mechanistically, RAD140 neuroprotection was dependent upon MAPK signaling, as evidenced by elevation of ERK phosphorylation and inhibition of protection by the MAPK kinase inhibitor U0126. Importantly, RAD140 was also neuroprotective in vivo using the rat kainate lesion model. In experiments with gonadectomized, adult male rats, RAD140 was shown to exhibit peripheral tissue-specific androgen action that largely spared prostate, neural efficacy as demonstrated by activation of androgenic gene regulation effects, and neuroprotection of hippocampal neurons against cell death caused by systemic administration of the excitotoxin kainate. These novel findings demonstrate initial preclinical efficacy of a SARM in neuroprotective actions relevant to Alzheimer's disease and related neurodegenerative diseases. PMID:24428527
Receptor-binding region in human choriogonadotropin/lutropin. beta. subunit
DOE Office of Scientific and Technical Information (OSTI.GOV)
Keutmann, H.T.; Charlesworth, M.C.; Mason, K.A.
1987-04-01
Synthetic fragments have not been widely used thus far to evaluate structure-activity relations in the glycoprotein hormones. The authors prepared a series of peptides representing the intercysteine loop sequence (residues 38-57) in human choriogonadotropin (hCG) and lutropin (hLH) ..beta.. subunits, anticipating that it might be oriented toward the surface and accessible to receptors. The peptides were characterized chemically and tested for bioactivity by binding to rat ovarian membrane receptor and stimulation of Leydig cell testosterone production. The hCG..beta..-(38-57) and hLH..beta..-(38-57) peptides inhibited binding of /sup 125/I-labeled hCG half-maximally at 1.51 x 10/sup -4/ and 2.03 x 10/sup -5/ M, respectively,more » while other peptide hormones and fragments from elsewhere in the ..beta.. subunit were inactive. Both peptides stimulated testosterone production, with half-maximal responses at 3.55 x 10/sup -5/ M (hCG) and 2.18 x 10/sup -5/ M (hLH). By radioimmunoassay with an antibody to thyroglobulin-conjugated hCG..beta..-(38-57) peptide, native hCG and ..beta.. subunit were highly reactive, as were the reduced and carboxymethylated subunit and peptide. These results indicate that the 38-57 region of ..beta.. subunit is exposed on the surface and constitutes a component in the receptor-binding domain for hCG and hLH. A region of amphipathic-helical structure in the 38-57 sequence may promote hormone-receptor interactions in a manner proposed for several other peptide hormones.« less
Glycosylation of β2 Subunits Regulates GABAA Receptor Biogenesis and Channel Gating*
Lo, Wen-yi; Lagrange, Andre H.; Hernandez, Ciria C.; Harrison, Rebecca; Dell, Anne; Haslam, Stuart M.; Sheehan, Jonathan H.; Macdonald, Robert L.
2010-01-01
γ-Aminobutyric acid type A (GABAA) receptors are heteropentameric glycoproteins. Based on consensus sequences, the GABAA receptor β2 subunit contains three potential N-linked glycosylation sites, Asn-32, Asn-104, and Asn-173. Homology modeling indicates that Asn-32 and Asn-104 are located before the α1 helix and in loop L3, respectively, near the top of the subunit-subunit interface on the minus side, and that Asn-173 is located in the Cys-loop near the bottom of the subunit N-terminal domain. Using site-directed mutagenesis, we demonstrated that all predicted β2 subunit glycosylation sites were glycosylated in transfected HEK293T cells. Glycosylation of each site, however, produced specific changes in α1β2 receptor surface expression and function. Although glycosylation of Asn-173 in the Cys-loop was important for stability of β2 subunits when expressed alone, results obtained with flow cytometry, brefeldin A treatment, and endo-β-N-acetylglucosaminidase H digestion suggested that glycosylation of Asn-104 was required for efficient α1β2 receptor assembly and/or stability in the endoplasmic reticulum. Patch clamp recording revealed that mutation of each site to prevent glycosylation decreased peak α1β2 receptor current amplitudes and altered the gating properties of α1β2 receptor channels by reducing mean open time due to a reduction in the proportion of long open states. In addition to functional heterogeneity, endo-β-N-acetylglucosaminidase H digestion and glycomic profiling revealed that surface β2 subunit N-glycans at Asn-173 were high mannose forms that were different from those of Asn-32 and N104. Using a homology model of the pentameric extracellular domain of α1β2 channel, we propose mechanisms for regulation of GABAA receptors by glycosylation. PMID:20639197
van Oorschot, Ruud; Korte, S. Mechiel; Olivier, Berend; Groenink, Lucianne
2010-01-01
Rationale Stress-related disorders are associated with dysfunction of both serotonergic and GABAergic pathways, and clinically effective anxiolytics act via both neurotransmitter systems. As there is evidence that the GABAA and the serotonin receptor system interact, a serotonergic component in the anxiolytic actions of benzodiazepines could be present. Objectives The main aim of the present study was to investigate whether the anxiolytic effects of (non-)selective α subunit GABAA receptor agonists could be reversed with 5-HT1A receptor blockade using the stress-induced hyperthermia (SIH) paradigm. Results The 5-HT1A receptor antagonist WAY-100635 (0.1–1 mg/kg) reversed the SIH-reducing effects of the non-α-subunit selective GABAA receptor agonist diazepam (1–4 mg/kg) and the GABAA receptor α3-subunit selective agonist TP003 (1 mg/kg), whereas WAY-100635 alone was without effect on the SIH response or basal body temperature. At the same time, co-administration of WAY-100635 with diazepam or TP003 reduced basal body temperature. WAY-100635 did not affect the SIH response when combined with the preferential α1-subunit GABAA receptor agonist zolpidem (10 mg/kg), although zolpidem markedly reduced basal body temperature. Conclusions The present study suggests an interaction between GABAA receptor α-subunits and 5-HT1A receptor activation in the SIH response. Specifically, our data indicate that benzodiazepines affect serotonergic signaling via GABAA receptor α3-subunits. Further understanding of the interactions between the GABAA and serotonin system in reaction to stress may be valuable in the search for novel anxiolytic drugs. PMID:20535452
Cloning and characterization of two novel zebrafish P2X receptor subunits.
Diaz-Hernandez, Miguel; Cox, Jane A; Migita, Keisuke; Haines, William; Egan, Terrance M; Voigt, Mark M
2002-07-26
In this report we describe the cloning and characterization of two P2X receptor subunits cloned from the zebrafish (Danio rerio). Primary sequence analysis suggests that one cDNA encodes an ortholog of the mammalian P2X(4) subunit and the second cDNA encodes the ortholog of the mammalian P2X(5) subunit. The zP2X(4) subunit forms a homo-oligomeric receptor that displays a low affinity for ATP (EC(50)=274+/-48 microM) and very low affinity (EC(50)>500 microM) for other purinergic ligands such as alphabetameATP, suramin, and PPADS. As seen with the mammalian orthologs, the zP2X(5) subunit forms a homo-oligomeric receptor that yields very small whole-cell currents (<20pA), making determination of an EC(50) problematic. Both subunit genes were physically mapped onto the zebrafish genome using radiation hybrid analysis of the T51 panel, with the zp2x4 localized to LG21 and zp2x5 to LG5.
Matsuda, K; Buckingham, S D; Freeman, J C; Squire, M D; Baylis, H A; Sattelle, D B
1998-01-01
Imidacloprid is a new insecticide with selective toxicity for insects over vertebrates. Recombinant (α4β2) chicken neuronal nicotinic acetylcholine receptors (AChRs) and a hybrid nicotinic AChR formed by co-expression of a Drosophila melanogaster neuronal α subunit (SAD) with the chicken β2 subunit were heterologously expressed in Xenopus oocytes by nuclear injection of cDNAs. The agonist actions of imidacloprid and other nicotinic AChR ligands ((+)-epibatidine, (−)-nicotine and acetylcholine) were compared on both recombinant nicotinic AChRs by use of two-electrode, voltage-clamp electrophysiology. Imidacloprid alone of the 4 agonists behaved as a partial agonist on the α4β2 receptor; (+)-epibatidine, (−)-nicotine and acetylcholine were all full, or near full, agonists. Imidacloprid was also a partial agonist of the hybrid Drosophila SAD chicken β2 receptor, as was (−)-nicotine, whereas (+)-epibatidine and acetylcholine were full agonists. The EC50 of imidacloprid was decreased by replacing the chicken α4 subunit with the Drosophila SAD α subunit. This α subunit substitution also resulted in an increase in the EC50 for (+)-epibatidine, (−)-nicotine and acetylcholine. Thus, the Drosophila (SAD) α subunit contributes to the greater apparent affinity of imidacloprid for recombinant insect/vertebrate nicotinic AChRs. Imidacloprid acted as a weak antagonist of ACh-mediated responses mediated by SADβ2 hybrid receptors and as a weak potentiator of ACh responses mediated by α4β2 receptors. This suggests that imidacloprid has complex effects upon these recombinant receptors, determined at least in part by the α subunit. PMID:9504393
Expression of functional receptors by the human γ-aminobutyric acid A γ2 subunit
Martínez-Torres, Ataúlfo; Miledi, Ricardo
2004-01-01
γ-Aminobutyric acid A (GABAA) receptors are heteromeric membrane proteins formed mainly by various combinations of α, β, and γ subunits; and it is commonly thought that the γ2 subunit alone does not form functional receptors. In contrast, we found that cDNA encoding the γ2L subunit of the human GABAA receptor, injected alone into Xenopus oocytes, expressed functional GABA receptors whose properties were investigated by using the two-microelectrode voltage-clamp technique. GABA elicited desensitizing membrane currents that recovered after a few minutes' wash. Repetitive applications of GABA induced a “run-up” of GABA currents that nearly doubled the amplitude of the first response. The GABA currents inverted direction at about -30 mV, indicating that they are carried mainly by Cl- ions. The homomeric γ2L receptors were also activated by β-alanine > taurine > glycine, and, like some types of heteromeric GABAA receptors, the γ2L receptors were blocked by bicuculline and were potentiated by pentobarbital and flunitrazepam. These results indicate that the human γ2L subunit is capable of forming fully functional GABA receptors by itself in Xenopus oocytes and suggest that the roles proposed for the various subunits that make up the heteromeric GABAA receptors in situ require further clarification. PMID:14981251
Shu, Hong-Jin; Bracamontes, John; Taylor, Amanda; Wu, Kyle; Eaton, Megan M; Akk, Gustav; Manion, Brad; Evers, Alex S; Krishnan, Kathiresan; Covey, Douglas F; Zorumski, Charles F; Steinbach, Joe Henry; Mennerick, Steven
2012-01-01
BACKGROUND AND PURPOSE GABAA receptors mediate both synaptic and extrasynaptic actions of GABA. In several neuronal populations, α4 and δ subunits are key components of extrasynaptic GABAA receptors that strongly influence neuronal excitability and could mediate the effects of neuroactive agents including neurosteroids and ethanol. However, these receptors can be difficult to study in native cells and recombinant δ subunits can be difficult to express in heterologous systems. EXPERIMENTAL APPROACH We engineered concatemeric (fused) subunits to ensure δ and α4 subunit expression. We tested the pharmacology of the concatemeric receptors, compared with a common synaptic-like receptor subunit combination (α1 +β2 +γ2L), and with free-subunit α4/δ receptors, expressed in Xenopus oocytes. KEY RESULTS δ-β2 −α4 +β2-α4 cRNA co-injected into Xenopus oocytes resulted in GABA-gated currents with the expected pharmacological properties of α4/δ-containing receptors. Criteria included sensitivity to agonists of different efficacy, sensitivity to the allosteric activator pentobarbital, and modulation of agonist responses by DS2 (4-chloro-N-[2-(2-thienyl)imidazo[1,2-a]pyridine-3-yl benzamide; a δ-selective positive modulator), furosemide, and Zn2+. We used the concatemers to examine neurosteroid sensitivity of extrasynaptic-like, δ-containing receptors. We found no qualitative differences between extrasynaptic-like receptors and synaptic-like receptors in the actions of either negative or positive neurosteroid modulators of receptor function. Quantitative differences were explained by the partial agonist effects of the natural agonist GABA and by a mildly increased sensitivity to low steroid concentrations. CONCLUSIONS AND IMPLICATIONS The neurosteroid structure-activity profile for α4/δ-containing extrasynaptic receptors is unlikely to differ from that of synaptic-like receptors such as α1/β2/γ2-containing receptors. PMID:21950777
Jia, Yousheng; Jeng, Jade-Ming; Sensi, Stefano L; Weiss, John H
2002-01-01
Permeation of the endogenous cation Zn2+ through calcium-permeable AMPA/kainate receptor-gated (Ca-A/K) channels might subserve pathological and/or physiological signalling roles. Voltage-clamp recording was used to directly assess Zn2+ flux through these channels on cultured murine hippocampal neurones. Ca-A/K channels were present in large numbers only on a minority of neurones (Ca-A/K(+) neurones), many of which were GABAergic. The presence of these channels was assessed in whole-cell or outside-out patch recording as the degree of inward rectification of kainate-activated currents, quantified via a rectification index (RI = G+40/G-60), which ranged from <0.4 (strongly inwardly rectifying) to >2 (outwardly rectifying). The specificity of a low RI as an indication of robust Ca-A/K channel expression was verified by two other techniques, kainate-stimulated cobalt-uptake labelling, and fluorescence imaging of kainate-induced increases in intracellular Ca2+. In addition, the degree of inward rectification of kainate-activated currents correlated strongly with the positive shift of the reversal potential (Vrev) upon switching to a sodium-free, 10 mm Ca2+ buffer. With Zn2+ (3 mm) as the only permeant extracellular cation, kainate-induced inward currents were only observed in neurones that had previously been identified as Ca-A/K(+). A comparison between the Vrev observed with 3 mm Zn2+ and that observed with Ca2+ as the permeant cation revealed a PCa/PZn of ≈1.8. Inward currents recorded in 3 mm Ca2+ were unaffected by the addition of 0.3 mm Zn2+, while microfluorimetrically detected increases in the intracellular concentration of Zn2+ in Ca-A/K(+) neurones upon kainate exposure in the presence of 0.3 mm Zn2+ were only mildly attenuated by the addition of 1.8 mm Ca2+. These results provide direct evidence that Zn2+ can carry currents through Ca-A/K channels, and that there is little interference between Ca2+ and Zn2+ in permeating these channels. PMID:12181280
Ionotropic glutamate receptors: regulation by G-protein-coupled receptors.
Rojas, Asheebo; Dingledine, Raymond
2013-04-01
The function of many ion channels is under dynamic control by coincident activation of G-protein-coupled receptors (GPCRs), particularly those coupled to the Gαs and Gαq family members. Such regulation is typically dependent on the subunit composition of the ionotropic receptor or channel as well as the GPCR subtype and the cell-specific panoply of signaling pathways available. Because GPCRs and ion channels are so highly represented among targets of U.S. Food and Drug Administration-approved drugs, functional cross-talk between these drug target classes is likely to underlie many therapeutic and adverse effects of marketed drugs. GPCRs engage a myriad of signaling pathways that involve protein kinases A and C (PKC) and, through PKC and interaction with β-arrestin, Src kinase, and hence the mitogen-activated-protein-kinase cascades. We focus here on the control of ionotropic glutamate receptor function by GPCR signaling because this form of regulation can influence the strength of synaptic plasticity. The amino acid residues phosphorylated by specific kinases have been securely identified in many ionotropic glutamate (iGlu) receptor subunits, but which of these sites are GPCR targets is less well known even when the kinase has been identified. N-methyl-d-aspartate, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid, and heteromeric kainate receptors are all downstream targets of GPCR signaling pathways. The details of GPCR-iGlu receptor cross-talk should inform a better understanding of how synaptic transmission is regulated and lead to new therapeutic strategies for neuropsychiatric disorders.
de Souza Silva, Maria A; Huston, Joseph P; Wang, An-Li; Petri, David; Chao, Owen Yuan-Hsin
2016-07-01
We asked whether episodic-like memory requires neural mechanisms independent of those that mediate its component memories for "what," "when," and "where," and if neuronal connectivity between the medial prefrontal cortex (mPFC) and the hippocampus (HPC) CA3 subregion is essential for episodic-like memory. Unilateral lesion of the mPFC was combined with unilateral lesion of the CA3 in the ipsi- or contralateral hemispheres in rats. Episodic-like memory was tested using a task, which assesses the integration of memories for "what, where, and when" concomitantly. Tests for novel object recognition (what), object place (where), and temporal order memory (when) were also applied. Bilateral disconnection of the mPFC-CA3 circuit by N-methyl-d-aspartate (NMDA) lesions disrupted episodic-like memory, but left the component memories for object, place, and temporal order, per se, intact. Furthermore, unilateral NMDA lesion of the CA3 plus injection of (6-cyano-7-nitroquinoxaline-2,3-dione) (CNQX) (AMPA/kainate receptor antagonist), but not AP-5 (NMDA receptor antagonist), into the contralateral mPFC also disrupted episodic-like memory, indicating the mPFC AMPA/kainate receptors as critical for this circuit. These results argue for a selective neural system that specifically subserves episodic memory, as it is not critically involved in the control of its component memories for object, place, and time. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Extrasynaptic αβ subunit GABAA receptors on rat hippocampal pyramidal neurons
Mortensen, Martin; Smart, Trevor G
2006-01-01
Extrasynaptic GABAA receptors that are tonically activated by ambient GABA are important for controlling neuronal excitability. In hippocampal pyramidal neurons, the subunit composition of these extrasynaptic receptors may include α5βγ and/or α4βδ subunits. Our present studies reveal that a component of the tonic current in the hippocampus is highly sensitive to inhibition by Zn2+. This component is probably not mediated by either α5βγ or α4βδ receptors, but might be explained by the presence of αβ isoforms. Using patch-clamp recording from pyramidal neurons, a small tonic current measured in the absence of exogenous GABA exhibited both high and low sensitivity to Zn2+ inhibition (IC50 values, 1.89 and 223 μm, respectively). Using low nanomolar and micromolar GABA concentrations to replicate tonic currents, we identified two components that are mediated by benzodiazepine-sensitive and -insensitive receptors. The latter indicated that extrasynaptic GABAA receptors exist that are devoid of γ2 subunits. To distinguish whether the benzodiazepine-insensitive receptors were αβ or αβδ isoforms, we used single-channel recording. Expressing recombinant α1β3γ2, α5β3γ2, α4β3δ and α1β3 receptors in human embryonic kidney (HEK) or mouse fibroblast (Ltk) cells, revealed similar openings with high main conductances (∼25–28 pS) for γ2 or δ subunit-containing receptors whereas αβ receptors were characterized by a lower main conductance state (∼11 pS). Recording from pyramidal cell somata revealed a similar range of channel conductances, indicative of a mixture of GABAA receptors in the extrasynaptic membrane. The lowest conductance state (∼11 pS) was the most sensitive to Zn2+ inhibition in accord with the presence of αβ receptors. This receptor type is estimated to account for up to 10% of all extrasynaptic GABAA receptors on hippocampal pyramidal neurons. PMID:17023503
Andrade-Talavera, Yuniesky; Duque-Feria, Paloma; Sihra, Talvinder S; Rodríguez-Moreno, Antonio
2013-09-01
We have investigated the mechanisms underlying the facilitatory modulation mediated by kainate receptor (KAR) activation in the cortex, using isolated nerve terminals (synaptosomes) and slice preparations. In cortical nerve terminals, kainate (KA, 100 μM) produced an increase in 4-aminopyridine (4-AP)-evoked glutamate release. In thalamocortical slices, KA (1 μM) produced an increase in the amplitude of evoked excitatory post-synaptic currents (eEPSCs) at synapses established between thalamic axon terminals from the ventrobasal nucleus onto stellate neurons of L4 of the somatosensory cortex. In both, synaptosomes and slices, the effect of KA was antagonized by 6-cyano-7-nitroquinoxaline-2,3-dione, and persisted after pre-treatment with a cocktail of antagonists of other receptors whose activation could potentially have produced facilitation of release indirectly. Mechanistically, the observed effects of KA appear to be congruent in synaptosomal and slice preparations. Thus, the facilitation by KA of synaptosomal glutamate release and thalamocortical synaptic transmission were suppressed by the inhibition of protein kinase A and occluded by the stimulation of adenylyl cyclase. Dissecting this G-protein-independent regulation further in thalamocortical slices, the KAR-mediated facilitation of synaptic transmission was found to be sensitive to the block of Ca(2+) permeant KARs by philanthotoxin. Intriguingly, the synaptic facilitation was abrogated by depletion of intracellular Ca(2+) stores by thapsigargin, or inhibition of Ca(2+) -induced Ca(2+) -release by ryanodine. Thus, the KA-mediated modulation was contingent on both Ca(2+) entry through Ca(2+) -permeable KARs and liberation of intracellular Ca(2+) stores. Finally, sensitivity to W-7 indicated that the increased cytosolic [Ca(2+) ] underpinning KAR-mediated regulation of synaptic transmission at thalamocortical synapses, requires downstream activation of calmodulin. We conclude that neocortical pre
Valkova, Christina; Albrizio, Marina; Röder, Ira V; Schwake, Michael; Betto, Romeo; Rudolf, Rüdiger; Kaether, Christoph
2011-01-11
The nicotinic acetylcholine receptor of skeletal muscle is composed of five subunits that are assembled in a stepwise manner. Quality control mechanisms ensure that only fully assembled receptors reach the cell surface. Here, we show that Rer1, a putative Golgi-ER retrieval receptor, is involved in the biogenesis of acetylcholine receptors. Rer1 is expressed in the early secretory pathway in the myoblast line C2C12 and in mouse skeletal muscle, and up-regulated during myogenesis. Upon down-regulation of Rer1 in C2C12 cells, unassembled acetylcholine receptor α-subunits escape from the ER and are transported to the plasma membrane and lysosomes, where they are degraded. As a result, the amount of fully assembled receptor at the cell surface is reduced. In vivo Rer1 knockdown and genetic inactivation of one Rer1 allele lead to significantly smaller neuromuscular junctions in mice. Our data show that Rer1 is a functionally important unique factor that controls surface expression of muscle acetylcholine receptors by localizing unassembled α-subunits to the early secretory pathway.
McCulloch, P. F.; DiNovo, K. M.; Westerhaus, D. J.; Vizinas, T. A.; Peevey, J. F.; Lach, M. A.; Czarnocki, P.
2013-01-01
Afferent information initiating the cardiorespiratory responses during nasal stimulation projects from the nasal passages to neurons within the trigeminal medullary dorsal horn (MDH) via the anterior ethmoidal nerve (AEN). Central AEN terminals are thought to release glutamate to activate the MDH neurons. This study was designed to determine which neurotransmitter receptors (AMPA, kainate, or NMDA glutamate receptor subtypes or the Substance P receptor NK1) are expressed by these activated MDH neurons. Fos was used as a neuronal marker of activated neurons, and immunohistochemistry combined with epifluorescent microscopy was used to determine which neurotransmitter receptor subunits were coexpressed by activated MDH neurons. Results indicate that, during nasal stimulation with ammonia vapors in urethane-anesthetized Sprague-Dawley rats, activated neurons within the superficial MDH coexpress the AMPA glutamate receptor subunits GluA1 (95.8%) and GluA2/3 (88.2%), the NMDA glutamate receptor subunits GluN1 (89.1%) and GluN2A (41.4%), and NK1 receptors (64.0%). It is therefore likely that during nasal stimulation the central terminals of the AEN release glutamate and substance P that then produces activation of these MDH neurons. The involvement of AMPA and NMDA receptors may mediate fast and slow neurotransmission, respectively, while NK1 receptor involvement may indicate activation of a nociceptive pathway. PMID:24967301
Subetta increases phosphorylation of insulin receptor β-subunit alone and in the presence of insulin
Gorbunov, E A; Nicoll, J; Kachaeva, E V; Tarasov, S A; Epstein, O I
2015-01-01
It has been previously shown that Subetta (a drug containing released-active forms of antibodies to the insulin receptor β-subunit and antibodies to endothelial nitric oxide synthase) stimulated insulin-induced adiponectin production by mature human adipocytes in the absence of insulin. Therefore, it was assumed that Subetta could activate the insulin receptor. To confirm this hypothesis, the capacity of Subetta to activate the insulin receptor in mature human adipocytes in the absence or presence of the insulin was investigated. Cells were incubated either with Subetta or with vehicle, or with basal medium for 3 days. Then, adipocytes were treated with water or insulin (100 nm) for 15 min. Following treatment, lysates were prepared and phosphorylation of insulin receptor β-subunits was analyzed by western blot analysis. It was shown that Subetta significantly increased (P<0.001) the ‘phosphorylated-insulin receptor β-subunit/total insulin receptor β-subunit' ratios in both the presence and the absence of insulin. These results support previously published data and indicate that Subetta could activate the insulin receptor through the effect on its β-subunits, whose conformational state is essential for insulin receptor activation. This action might serve as one of the primary mechanisms of the drug's antidiabetic effect. PMID:26148148
Development of N-Methyl-D-Aspartate Receptor Subunits in Avian Auditory Brainstem
TANG, YE-ZHONG; CARR, CATHERINE E.
2012-01-01
N-methyl-D-aspartate (NMDA) receptor subunit-specific probes were used to characterize developmental changes in the distribution of excitatory amino acid receptors in the chicken’s auditory brainstem nuclei. Although NR1 subunit expression does not change greatly during the development of the cochlear nuclei in the chicken (Tang and Carr [2004] Hear. Res 191:79 – 89), there are significant developmental changes in NR2 subunit expression. We used in situ hybridization against NR1, NR2A, NR2B, NR2C, and NR2D to compare NR1 and NR2 expression during development. All five NMDA subunits were expressed in the auditory brainstem before embryonic day (E) 10, when electrical activity and synaptic responses appear in the nucleus magnocellularis (NM) and the nucleus laminaris (NL). At this time, the dominant form of the receptor appeared to contain NR1 and NR2B. NR2A appeared to replace NR2B by E14, a time that coincides with synaptic refinement and evoked auditory responses. NR2C did not change greatly during auditory development, whereas NR2D increased from E10 and remained at fairly high levels into adulthood. Thus changes in NMDA NR2 receptor subunits may contribute to the development of auditory brainstem responses in the chick. PMID:17366608
Atanasova, Dimitrinka; Tchekalarova, Jana; Ivanova, Natasha; Nenchovska, Zlatina; Pavlova, Ekaterina; Atanassova, Nina; Lazarov, Nikolai
2018-01-15
Experimental and clinical studies have demonstrated that components of renin-angiotensin system are elevated in the hippocampus in epileptogenic conditions. In the present work, we explored the changes in the expression of angiotensin II receptor, type 1 (AT 1 receptor) in limbic structures, as well as the effect of the AT1 receptor antagonist losartan in a model of comorbid hypertension and epilepsy. The expression of AT 1 receptors was compared between spontaneously hypertensive rats (SHRs) and Wistar rats by using immunohistochemistry in the kainate (KA) model of temporal lobe epilepsy (TLE). The effect of losartan was studied on AT 1 receptor expression in epileptic rats that were treated for a period of 4weeks after status epilepticus. The naive and epileptic SHRs were characterized by stronger protein expression of AT 1 receptor than normotensive Wistar rats in the CA1, CA3a, CA3b, CA3c field and the hilus of the dentate gyrus of the dorsal hippocampus but fewer cells were immunostained in the piriform cortex. Increased AT 1 immunostaining was observed in the basolateral amygdala of epileptic SHRs but not of epileptic Wistar rats. Losartan exerted stronger and structure-dependent suppression of AT 1 receptor expression in SHRs compared to Wistar rats. Our results confirm the important role of AT 1 receptor in epilepsy and suggest that the AT 1 receptor antagonists could be used as a therapeutic strategy for treatment of comorbid hypertension and epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.
NASA Technical Reports Server (NTRS)
Akbarian, S.; Huntsman, M. M.; Kim, J. J.; Tafazzoli, A.; Potkin, S. G.; Bunney, W. E. Jr; Jones, E. G.; Bloom, F. E. (Principal Investigator)
1995-01-01
The prefrontal cortex of schizophrenics is hypoactive and displays changes related to inhibitory, GABAergic neurons, and GABAergic synapses. These changes include decreased levels of glutamic acid decarboxylase (GAD), the enzyme for GABA synthesis, upregulation of muscimol binding, and downregulation of benzodiazepine binding to GABAA receptors. Studies in the visual cortex of nonhuman primates have demonstrated that gene expression for GAD and for several GABAA receptor subunit polypeptides is under control of neuronal activity, raising the possibility that similar mechanisms in the hypoactive prefrontal cortex of schizophrenics may explain the abnormalities in GAD and in GABAA receptor regulation. In the present study, which is the first of its type on human cerebral cortex, levels of mRNAs for six GABAA receptor subunits (alpha 1, alpha 2, alpha 5, beta 1, beta 2, gamma 2) and their laminar expression patterns were analyzed in the prefrontal cortex of schizophrenics and matched controls, using in situ hybridization histochemistry and densitometry. Three types of laminar expression pattern were observed: mRNAs for the alpha 1, beta 2, and gamma 2 subunits, which are the predominant receptor subunits expressed in the mature cortex, were expressed at comparatively high levels by cells of all six cortical layers, but most intensely by cells in lower layer III and layer IV. mRNAs for the alpha 2, alpha 5, and beta 1 subunits were expressed at lower levels; alpha 2 and beta 1 were expressed predominantly by cells in layers II, III, and IV; alpha 5 was expressed predominantly in layers IV, V, and VI. There were no significant changes in overall mRNA levels for any of the receptor subunits in the prefrontal cortex of schizophrenics, and the laminar expression pattern of all six receptor subunit mRNAs did not differ between schizophrenics and controls. Because gene expression for GABAA receptor subunits is not consistently altered in the prefrontal cortex of
Akgül, Gülcan; McBain, Chris J
2016-10-01
Glutamate receptor-mediated recruitment of GABAergic inhibitory interneurons is a critical determinant of network processing. Early studies observed that many, but not all, interneuron glutamatergic synapses contain AMPA receptors that are GluA2-subunit lacking and Ca(2+) permeable, making them distinct from AMPA receptors at most principal cell synapses. Subsequent studies demonstrated considerable alignment of synaptic AMPA and NMDA receptor subunit composition within specific subtypes of interneurons, suggesting that both receptor expression profiles are developmentally and functionally linked. Indeed glutamate receptor expression profiles are largely predicted by the embryonic origins of cortical interneurons within the medial and caudal ganglionic eminences of the developing telencephalon. Distinct complements of AMPA and NMDA receptors within different interneuron subpopulations contribute to the differential recruitment of functionally divergent interneuron subtypes by common afferent inputs for appropriate feed-forward and feedback inhibitory drive and network entrainment. In contrast, the lesser-studied kainate receptors, which are often present at both pre- and postsynaptic sites, appear to follow an independent developmental expression profile. Loss of specific ionotropic glutamate receptor (iGluR) subunits during interneuron development has dramatic consequences for both cellular and network function, often precipitating circuit inhibition-excitation imbalances and in some cases lethality. Here we briefly review recent findings highlighting the roles of iGluRs in interneuron development. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.
Khiroug, Serguei S; Harkness, Patricia C; Lamb, Patricia W; Sudweeks, Sterling N; Khiroug, Leonard; Millar, Neil S; Yakel, Jerrel L
2002-01-01
Rat hippocampal interneurons express diverse subtypes of functional nicotinic acetylcholine receptors (nAChRs), including α7-containing receptors that have properties unlike those expected for homomeric α7 nAChRs. We previously reported a strong correlation between expression of the α7 and of the β2 subunits in individual neurons. To explore whether co-assembly of the α7 and β2 subunits might occur, these subunits were co-expressed in Xenopus oocytes and the functional properties of heterologously expressed nAChRs were characterized by two-electrode voltage clamp. Co-expression of the β2 subunit, both wild-type and mutant forms, with the α7 subunit significantly slowed the rate of nAChR desensitization and altered the pharmacological properties. Whereas ACh, carbachol and choline were full or near-full agonists for homomeric α7 receptor channels, both carbachol and choline were only partial agonists in oocytes expressing both α7 and β2 subunits. In addition the EC50 values for all three agonists significantly increased when the β2 subunit was co-expressed with the α7 subunit. Co-expression with the β2 subunit did not result in any significant change in the current-voltage curve. Biochemical evidence for the co-assembly of the α7 and β2 subunits was obtained by co-immunoprecipitation of these subunits from transiently transfected human embryonic kidney (TSA201) cells. These data provide direct biophysical and molecular evidence that the nAChR α7 and β2 subunits co-assemble to form a functional heteromeric nAChR with functional and pharmacological properties different from those of homomeric α7 channels. This co-assembly may help to explain nAChR channel diversity in rat hippocampal interneurons, and perhaps in other areas of the nervous system. PMID:11956333
Heidelberg, Laura S.; Warren, James W.
2013-01-01
Many drugs used to treat anxiety are positive modulators of GABAA receptors, which mediate fast inhibitory neurotransmission. The GABAA receptors can be assembled from a combination of at least 16 different subunits. The receptor’s subunit composition determines its pharmacologic and functional properties, and subunit expression varies throughout the brain. A primary goal for new treatments targeting GABAA receptors is the production of subunit-selective modulators acting upon a discrete population of receptors. The anxiolytic 4-amino-7-hydroxy-2-methyl-5,6,7,8,-tetrahydrobenzo[b]thieno[2,3-b]pyridine-3-carboxylic acid, but-2-ynyl ester (SB-205384) is widely considered to be selective for α3-containing GABAA receptors. However, it has been tested only on α1-, α2-, and α3-containing receptors. We examined the activity of SB-205384 at recombinant receptors containing the six different α subunits and found that receptors containing the α3, α5, and α6 subunits were potentiated by SB-205384, with the α6 subunit conferring the greatest responsiveness. Properties associated with chimeric α1/α6 subunits suggested that multiple structural domains influence sensitivity to SB-205384. Point mutations of residues within the extracellular N-terminal domain identified a leucine residue located in loop E of the agonist binding site as an important determinant of high sensitivity to modulation. In the α6 subunit the identity of this residue is species-dependent, with the leucine found in rat subunits but not in human. Our results indicate that SB-205384 is not an α3-selective modulator, and instead acts at several GABAA receptor isoforms. These findings have implications for the side-effect profile of this anxiolytic as well as for its use in neuronal and animal studies as a marker for contribution from α3-containing receptors. PMID:23902941
McElduff, A; Watkinson, A; Hedo, J A; Gorden, P
1986-11-01
The insulin receptor is synthesized as a 190,000-Mr single-chain precursor that contains exclusively asparagine-N-linked high-mannose-type carbohydrate chains. In this study we have characterized the structure of the pro-receptor oligosaccharides. IM-9 lymphocytes were pulse-chase-labelled with [3H]mannose, and the insulin pro-receptor was isolated by immunoprecipitation and SDS/polyacrylamide-gel electrophoresis. The pro-receptor oligosaccharides were removed from the protein backbone with endoglycosidase H and analysed by h.p.l.c. Immediately after a [3H]mannose pulse the largest oligosaccharide found in the pro-receptor was Glc1Man9GlcNAc2; this structure represented only a small fraction (3%) of the total. The predominant oligosaccharides present in the pro-receptor were Man9GlcNAc2 (25%) and Man8GlcNAc2 (48%). Smaller oligosaccharides were also detected: Man7GlcNAc2 (18%), Man6GlcNAc2 (3%) and Man5GlcNAc2 (3%). The relative distribution of the different oligosaccharides did not change at 1, 2 or 3 h after the pulse with the exception of the rapid disappearance of the Glc1Man9GlcNAc2 component. The mature alpha- and beta-subunits of the insulin receptor are known to contain both high-mannose-type and complex-type oligosaccharides. We have also examined here the structure of the high-mannose chains of these subunits. The predominant species in the alpha-subunit was Man8GlcNAc2 whereas in the beta-subunit it was Man7GlcNAc2. These results demonstrate that most (approx. 75%) oligosaccharides of the insulin pro-receptor are chains of the type Man8GlcNAc2 or Man9GlcNAc2. Thus, assuming that a Glc3Man9GlcNAc2 species is transferred co-translationally, carbohydrate processing of the pro-receptor appears to be very rapid and limited to the removal of the three glucose residues and one mannose residue. Further mannose removal does not occur until the pro-receptor has been proteolytically cleaved. In addition, the degree of mannose trimming appears to be different in the
McElduff, A; Watkinson, A; Hedo, J A; Gorden, P
1986-01-01
The insulin receptor is synthesized as a 190,000-Mr single-chain precursor that contains exclusively asparagine-N-linked high-mannose-type carbohydrate chains. In this study we have characterized the structure of the pro-receptor oligosaccharides. IM-9 lymphocytes were pulse-chase-labelled with [3H]mannose, and the insulin pro-receptor was isolated by immunoprecipitation and SDS/polyacrylamide-gel electrophoresis. The pro-receptor oligosaccharides were removed from the protein backbone with endoglycosidase H and analysed by h.p.l.c. Immediately after a [3H]mannose pulse the largest oligosaccharide found in the pro-receptor was Glc1Man9GlcNAc2; this structure represented only a small fraction (3%) of the total. The predominant oligosaccharides present in the pro-receptor were Man9GlcNAc2 (25%) and Man8GlcNAc2 (48%). Smaller oligosaccharides were also detected: Man7GlcNAc2 (18%), Man6GlcNAc2 (3%) and Man5GlcNAc2 (3%). The relative distribution of the different oligosaccharides did not change at 1, 2 or 3 h after the pulse with the exception of the rapid disappearance of the Glc1Man9GlcNAc2 component. The mature alpha- and beta-subunits of the insulin receptor are known to contain both high-mannose-type and complex-type oligosaccharides. We have also examined here the structure of the high-mannose chains of these subunits. The predominant species in the alpha-subunit was Man8GlcNAc2 whereas in the beta-subunit it was Man7GlcNAc2. These results demonstrate that most (approx. 75%) oligosaccharides of the insulin pro-receptor are chains of the type Man8GlcNAc2 or Man9GlcNAc2. Thus, assuming that a Glc3Man9GlcNAc2 species is transferred co-translationally, carbohydrate processing of the pro-receptor appears to be very rapid and limited to the removal of the three glucose residues and one mannose residue. Further mannose removal does not occur until the pro-receptor has been proteolytically cleaved. In addition, the degree of mannose trimming appears to be different in the
Both α and β Subunits of Human Choriogonadotropin Photoaffinity Label the Hormone Receptor
NASA Astrophysics Data System (ADS)
Ji, Inhae; Ji, Tae H.
1981-09-01
It has been shown that a photoactivable derivative of human choriogonadotropin (hCG) labels the lutropin receptor on porcine granulosa cells [Ji, I. & Ji, T. H. (1980) Proc. Natl. Acad. Sci. USA 77, 7167-7170]. In an attempt to identify which of the hCG subunits labeled the receptor, three sets of different hCG derivatives were prepared. In the first set, hCG was coupled to the N-hydroxysuccinimide ester of 4-azidobenzoylglycine and radioiodinated. In the second set, only one of the subunits was radioiodinated, but both subunits were allowed to react with the reagent. In the third set, both the reagent and [125I]iodine were coupled to only one of the subunits. The binding activity of each hormone derivative was comparable to that of 125I-labeled hCG. After binding of these hormone derivatives to the granulosa cell surface, they were photolyzed. After solubilization, autoradiographs of sodium dodecyl sulfate/polyacrylamide gels of each sample revealed a number of labeled bands; the hCG derivatives containing 125I-labeled alpha subunit produced four bands (molecular weights 120,000 +/- 6,000, 96,000 +/- 5,000, 76,000 +/- 4,000, and 73,000 +/- 4,000) and those containing 125I-labeled beta subunit produced three bands (molecular weights 106,000 +/- 6,000, 88,000 +/- 5,000, and 83,000 +/- 4,000). Results were the same when the hormone-receptor complexes were solubilized in 0.5% Triton X-100 and then photolyzed or when the hormone was derivatized with a family of reagents having arms of various lengths. We conclude that both the alpha subunit and the beta subunit of hCG photoaffinity labeled certain membrane polypeptides and that these polypeptides are related to the hormone receptor.
Raman, I M; Trussell, L O
1995-01-01
We have examined the mechanisms underlying the voltage sensitivity of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptors in voltage-clamped outside-out patches and whole cells taken from the nucleus magnocellularis of the chick. Responses to either glutamate or kainate had outwardly rectifying current-voltage relations. The rate and extent of desensitization during prolonged exposure to agonist, and the rate of deactivation after brief exposure to agonist, decreased at positive potentials, suggesting that a kinetic transition was sensitive to membrane potential. Voltage dependence of the peak conductance and of the deactivation kinetics persisted when desensitization was reduced with aniracetam or blocked with cyclothiazide. Furthermore, the rate of recovery from desensitization to glutamate was not voltage dependent. Upon reduction of extracellular divalent cation concentration, kainate-evoked currents increased but preserved rectifying current-voltage relations. Rectification was strongest at lower kainate concentrations. Surprisingly, nonstationary variance analysis of desensitizing responses to glutamate or of the current deactivation after kainate removal revealed an increase in the mean single-channel conductance with more positive membrane potentials. These data indicate that the rectification of the peak response to a high agonist concentration reflects an increase in channel conductance, whereas rectification of steady-state current is dominated by voltage-sensitive channel kinetics. Images FIGURE 2 FIGURE 3 PMID:8580330
McEown, K; Treit, D
2013-11-12
Temporary neuronal inactivation of the ventral hippocampus with the GABAA agonist muscimol suppresses unconditioned fear behavior (anxiety) but inactivation of the dorsal hippocampus does not. On the other hand, inactivating the dorsal hippocampus disrupts fear memory, while inactivating the ventral hippocampus does not. Here we investigate the roles of hippocampal GABAA receptor sub-units in mediating these anxiolytic and amnesic effects of GABAA receptor agonists. We microinfused TPA023 (α2 agonist) or TB-21007 (inverse α5 agonist) into the dorsal or ventral hippocampus prior to testing rats in two animal models of anxiety: the elevated plus-maze and shock-probe burying test. Twenty-four hours later rats were re-tested in the shock-probe chamber with a non-electrified probe to assess their memory of the initial shock-probe experience (i.e., fear memory). We found that TPA023 was anxiolytic in the plus-maze and shock-probe burying tests when microinfused into the ventral hippocampus. However, TPA023 did not affect anxiety-related behavior when infused into the dorsal hippocampus. Conversely, we found that the α5 sub-unit inverse agonist TB-21007 impaired rats' memory of the initial shock-probe experience when infused into the dorsal hippocampus, but not when infused into the ventral hippocampus. This double dissociation suggests that α2 GABAA receptor sub-units in the ventral hippocampus mediate unconditioned fear or anxiety, while α5 GABAA receptor sub-units in the dorsal hippocampus mediate conditioned fear memory. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.
Churn, Severn B; Rana, Aniruddha; Lee, Kangmin; Parsons, J Travis; De Blas, Angel; Delorenzo, Robert J
2002-09-01
gamma-Aminobutyric acid (GABA) is the primary neurotransmitter that is responsible for the fast inhibitory synaptic transmission in the central nervous system. A major post-translational mechanism that can rapidly regulate GABAAR function is receptor phosphorylation. This study was designed to test the effect of endogenous calcium and calmodulin-dependent kinase II (CaM kinase II) activation on both allosteric modulator binding and GABAA receptor subunit phosphorylation. Endogenous CaM kinase II activity was stimulated, and GABAA receptors were subsequently analyzed for bothallosteric modulator binding properties and immunoprecipitated and analyzed for subunit phosphorylation levels. A significant increase in allosteric-modulator binding of the GABAAR was observed under conditions maximal for CaM kinase II activation. In addition, CaM kinase II activation resulted in a direct increase in phosphorylation of the GABAA receptor alpha1 subunit. The data suggest that the CaM kinase II-dependent phosphorylation of the GABAA receptor alpha1 subunit modulated allosteric modulator binding to the GABAA receptor.
Fragrant Dioxane Derivatives Identify β1-Subunit-containing GABAA Receptors*
Sergeeva, Olga A.; Kletke, Olaf; Kragler, Andrea; Poppek, Anja; Fleischer, Wiebke; Schubring, Stephan R.; Görg, Boris; Haas, Helmut L.; Zhu, Xin-Ran; Lübbert, Hermann; Gisselmann, Günter; Hatt, Hanns
2010-01-01
Nineteen GABAA receptor (GABAAR) subunits are known in mammals with only a restricted number of functionally identified native combinations. The physiological role of β1-subunit-containing GABAARs is unknown. Here we report the discovery of a new structural class of GABAAR positive modulators with unique β1-subunit selectivity: fragrant dioxane derivatives (FDD). At heterologously expressed α1βxγ2L (x-for 1,2,3) GABAAR FDD were 6 times more potent at β1- versus β2- and β3-containing receptors. Serine at position 265 was essential for the high sensitivity of the β1-subunit to FDD and the β1N286W mutation nearly abolished modulation; vice versa the mutation β3N265S shifted FDD sensitivity toward the β1-type. In posterior hypothalamic neurons controlling wakefulness GABA-mediated whole-cell responses and GABAergic synaptic currents were highly sensitive to FDD, in contrast to β1-negative cerebellar Purkinje neurons. Immunostaining for the β1-subunit and the potency of FDD to modulate GABA responses in cultured hypothalamic neurons was drastically diminished by β1-siRNA treatment. In conclusion, with the help of FDDs we reveal a functional expression of β1-containing GABAARs in the hypothalamus, offering a new tool for studies on the functional diversity of native GABAARs. PMID:20511229
Behavioural endophenotypes in mice lacking the auxiliary GABAB receptor subunit KCTD16.
Cathomas, Flurin; Sigrist, Hannes; Schmid, Luca; Seifritz, Erich; Gassmann, Martin; Bettler, Bernhard; Pryce, Christopher R
2017-01-15
Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the brain and is implicated in the pathophysiology of a number of neuropsychiatric disorders. The GABA B receptors are G-protein coupled receptors consisting of principle subunits and auxiliary potassium channel tetramerization domain (KCTD) subunits. The KCTD subunits 8, 12, 12b and 16 are cytosolic proteins that determine the kinetics of the GABA B receptor response. Previously, we demonstrated that Kctd12 null mutant mice (Kctd12 -/- ) exhibit increased auditory fear learning and that Kctd12 +/- mice show altered circadian activity, as well as increased intrinsic excitability in hippocampal pyramidal neurons. KCTD16 has been demonstrated to influence neuronal excitability by regulating GABA B receptor-mediated gating of postsynaptic ion channels. In the present study we investigated for behavioural endophenotypes in Kctd16 -/- and Kctd16 +/- mice. Compared with wild-type (WT) littermates, auditory and contextual fear conditioning were normal in both Kctd16 -/- and Kctd16 +/- mice. When fear memory was tested on the following day, Kctd16 -/- mice exhibited less extinction of auditory fear memory relative to WT and Kctd16 +/- mice, as well as more contextual fear memory relative to WT and, in particular, Kctd16 +/- mice. Relative to WT, both Kctd16 +/- and Kctd16 -/- mice exhibited normal circadian activity. This study adds to the evidence that auxillary KCTD subunits of GABA B receptors contribute to the regulation of behaviours that could constitute endophenotypes for hyper-reactivity to aversive stimuli in neuropsychiatric disorders. Copyright © 2016 Elsevier B.V. All rights reserved.
Fumagalli, Fabio; Pasini, Matteo; Sartorius, Alexander; Scherer, Rosine; Racagni, Giorgio; Riva, Marco A; Gass, Peter
2010-10-01
Glutamate and its receptors are involved in the pathophysiology of mood disorders and have recently emerged as potential targets for the pharmacotherapy of depression. In rats, we investigated plasticity changes of the glutamatergic system evoked by electroconvulsive shock (ECS), which represents the most effective therapy for patients who are refractory to antidepressants. Chronic ECS produced a marked increase in the phosphorylation of the regulatory NMDA receptor subunit NR2B (Ser1303) and the AMPA receptor subunit GluR-A (Ser831) in the hippocampus, with no effects on the obligatory subunit NR1. No effects were found on total receptor subunit expression levels. We suggest that, at least in part, ECS exerts its clinical activity through the modulation of the glutamatergic synapses, via potentiation of AMPA currents mediated by GluR-A (Ser831) phosphorylation, and a reduction of NMDA receptor activity through the phosphorylation of NR2B (Ser1303), presumably uncoupling NR2B from its signalling partner CaMKII. These effects functionally resemble the recently described antidepressant effects of ketamine.
The multifaceted subunit interfaces of ionotropic glutamate receptors.
Green, Tim; Nayeem, Naushaba
2015-01-01
The past fifteen years has seen a revolution in our understanding of ionotropic glutamate receptor (iGluR) structure, starting with the first view of the ligand binding domain (LBD) published in 1998, and in many ways culminating in the publication of the full-length structure of GluA2 in 2009. These reports have revealed not only the central role played by subunit interfaces in iGluR function, but also myriad binding sites within interfaces for endogenous and exogenous factors. Changes in the conformation of inter-subunit interfaces are central to transmission of ligand gating into pore opening (itself a rearrangement of interfaces), and subsequent closure through desensitization. With the exception of the agonist binding site, which is located entirely within individual subunits, almost all modulatory factors affecting iGluRs appear to bind to sites in subunit interfaces. This review seeks to summarize what we currently understand about the diverse roles interfaces play in iGluR function, and to highlight questions for future research. © 2014 The Authors. The Journal of Physiology © 2014 The Physiological Society.
Drexel, Meinrad; Puhakka, Noora; Kirchmair, Elke; Hörtnagl, Heide; Pitkänen, Asla; Sperk, Günther
2015-01-01
Traumatic brain injury is a major cause of death and disability worldwide and often associated with post-traumatic epilepsy. We recently demonstrated that TBI induces acquired GABAA receptors channelopathy that associates with hyperexcitability in granule cell layer (GCL). We now assessed the expression of GABAA and GABAB receptor subunit mRNAs between 6 h and 6 months post-TBI in the hippocampus and thalamus. The expression of major GABAA receptor subunit mRNAs (α1, α2, α5, β2, β3, γ2 and δ) was, often bilaterally, down-regulated in the GCL and in the CA3 pyramidal cells. Instead, expression of α4 (GCL, CA3, CA1), α5 (CA1) and γ2 (GCL, CA3, CA1) mRNA was up-regulated after 10 d and/or 4 months. Many of these changes were reversible. In the thalamus, we found decreases in α1, α4, β2, γ2 and δ mRNAs in the laterodorsal thalamus and in the area combining the posterior thalamic nuclear group, ventroposterolateral and ventroposteromedial complex at 6 h to 4 months post-TBI. Unlike in the hippocampus, thalamic subunit down-regulations were irreversible and limited to the ipsilateral side. However, contralaterally there was up-regulation of the subunits δ and α4 6 h and 4 months after TBI, respectively. PCR array analysis suggested a mild long-lasting GABAA receptor channelopathy in the GCL and thalamus after TBI. Whereas TBI induces transient changes in the expression of GABAA receptor subunits in the hippocampus (presumably representing compensatory mechanisms), alterations of GABAA receptor subunit mRNAs in the thalamus are long-lasting and related to degeneration of receptor-containing neurons in thalamo-cortical relay nuclei. This article is part of the Special Issue entitled ‘GABAergic Signaling in Health and Disease’. PMID:25229716
Drexel, Meinrad; Puhakka, Noora; Kirchmair, Elke; Hörtnagl, Heide; Pitkänen, Asla; Sperk, Günther
2015-01-01
Traumatic brain injury is a major cause of death and disability worldwide and often associated with post-traumatic epilepsy. We recently demonstrated that TBI induces acquired GABAA receptors channelopathy that associates with hyperexcitability in granule cell layer (GCL). We now assessed the expression of GABAA and GABAB receptor subunit mRNAs between 6 h and 6 months post-TBI in the hippocampus and thalamus. The expression of major GABAA receptor subunit mRNAs (α1, α2, α5, β2, β3, γ2 and δ) was, often bilaterally, down-regulated in the GCL and in the CA3 pyramidal cells. Instead, expression of α4 (GCL, CA3, CA1), α5 (CA1) and γ2 (GCL, CA3, CA1) mRNA was up-regulated after 10 d and/or 4 months. Many of these changes were reversible. In the thalamus, we found decreases in α1, α4, β2, γ2 and δ mRNAs in the laterodorsal thalamus and in the area combining the posterior thalamic nuclear group, ventroposterolateral and ventroposteromedial complex at 6 h to 4 months post-TBI. Unlike in the hippocampus, thalamic subunit down-regulations were irreversible and limited to the ipsilateral side. However, contralaterally there was up-regulation of the subunits δ and α4 6 h and 4 months after TBI, respectively. PCR array analysis suggested a mild long-lasting GABAA receptor channelopathy in the GCL and thalamus after TBI. Whereas TBI induces transient changes in the expression of GABAA receptor subunits in the hippocampus (presumably representing compensatory mechanisms), alterations of GABAA receptor subunit mRNAs in the thalamus are long-lasting and related to degeneration of receptor-containing neurons in thalamo-cortical relay nuclei. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Fragrant dioxane derivatives identify beta1-subunit-containing GABAA receptors.
Sergeeva, Olga A; Kletke, Olaf; Kragler, Andrea; Poppek, Anja; Fleischer, Wiebke; Schubring, Stephan R; Görg, Boris; Haas, Helmut L; Zhu, Xin-Ran; Lübbert, Hermann; Gisselmann, Günter; Hatt, Hanns
2010-07-30
Nineteen GABA(A) receptor (GABA(A)R) subunits are known in mammals with only a restricted number of functionally identified native combinations. The physiological role of beta1-subunit-containing GABA(A)Rs is unknown. Here we report the discovery of a new structural class of GABA(A)R positive modulators with unique beta1-subunit selectivity: fragrant dioxane derivatives (FDD). At heterologously expressed alpha1betaxgamma2L (x-for 1,2,3) GABA(A)R FDD were 6 times more potent at beta1- versus beta2- and beta3-containing receptors. Serine at position 265 was essential for the high sensitivity of the beta1-subunit to FDD and the beta1N286W mutation nearly abolished modulation; vice versa the mutation beta3N265S shifted FDD sensitivity toward the beta1-type. In posterior hypothalamic neurons controlling wakefulness GABA-mediated whole-cell responses and GABAergic synaptic currents were highly sensitive to FDD, in contrast to beta1-negative cerebellar Purkinje neurons. Immunostaining for the beta1-subunit and the potency of FDD to modulate GABA responses in cultured hypothalamic neurons was drastically diminished by beta1-siRNA treatment. In conclusion, with the help of FDDs we reveal a functional expression of beta1-containing GABA(A)Rs in the hypothalamus, offering a new tool for studies on the functional diversity of native GABA(A)Rs.
Lasala, Matías; Corradi, Jeremías; Bruzzone, Ariana; Esandi, María Del Carmen; Bouzat, Cecilia
2018-05-21
The cholinergic α7 nicotinic receptor gene, CHRNA7, encodes a subunit that forms the homopentameric α7 receptor, involved in learning and memory. In humans, exons 5-10 in CHRNA7 are duplicated and fused to the FAM7A genetic element, giving rise to the hybrid gene CHRFAM7A. Its product, dupα7, is a truncated subunit lacking part of the N-terminal extracellular ligand-binding domain and is associated with neurological disorders, including schizophrenia, and immunomodulation.We combined dupα7 expression on mammalian cells with patch clamp recordings to understand its functional role. Transfected cells expressed dupα7 protein, but they exhibited neither surface binding of the α7 antagonist α-bungarotoxin nor responses to acetylcholine (ACh) or to an allosteric agonist that binds to the conserved transmembrane region. To determine if dupα7 assembles with α7, we generated receptors comprising α7 and dupα7 subunits, one of which was tagged with conductance substitutions that report subunit stoichiometry and monitored ACh-elicited channel openings elicited by ACh in the presence of a positive allosteric α7 modulator. We found that α7 and dupα7 subunits co-assemble into functional heteromeric receptors, that at least two α7 subunits are required for channel opening, and that dupα7's presence in the pentameric arrangement does not affect the duration of the potentiated events compare with that of α7. Using an α7 subunit mutant, we found that activation of (α7)2(dupα7)3 receptors occurs through ACh binding at the α7/α7 interfacial binding site. Our study contributes to the understanding of the modulation of α7 function by the human specific, duplicated subunit, associated with human disorders. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.
Tabor, Rico; Friedrich, Rainer W.
2008-01-01
Although synaptic functions of ionotropic glutamate receptors in the olfactory bulb have been studied in vitro, their roles in pattern processing in the intact system remain controversial. We therefore examined the functions of ionotropic glutamate receptors during odor processing in the intact olfactory bulb of zebrafish using pharmacological manipulations. Odor responses of mitral cells and interneurons were recorded by electrophysiology and 2-photon Ca2+ imaging. The combined blockade of AMPA/kainate and NMDA receptors abolished odor-evoked excitation of mitral cells. The blockade of AMPA/kainate receptors alone, in contrast, increased the mean response of mitral cells and decreased the mean response of interneurons. The blockade of NMDA receptors caused little or no change in the mean responses of mitral cells and interneurons. However, antagonists of both receptor types had diverse effects on the magnitude and time course of individual mitral cell and interneuron responses and, thus, changed spatio-temporal activity patterns across neuronal populations. Oscillatory synchronization was abolished or reduced by AMPA/kainate and NMDA receptor antagonists, respectively. These results indicate that (1) interneuron responses depend mainly on AMPA/kainate receptor input during an odor response, (2) interactions among mitral cells and interneurons regulate the total olfactory bulb output activity, (3) AMPA/kainate receptors participate in the synchronization of odor-dependent neuronal ensembles, and (4) ionotropic glutamate receptor-containing synaptic circuits shape odor-specific patterns of olfactory bulb output activity. These mechanisms are likely to be important for the processing of odor-encoding activity patterns in the olfactory bulb. PMID:18183297
Fractionating spatial memory with glutamate receptor subunit-knockout mice.
Bannerman, David M
2009-12-01
In recent years, the contribution that different glutamate receptor subtypes and subunits make to spatial learning and memory has been studied extensively using genetically modified mice in which key proteins are knocked out. This has revealed dissociations between different aspects of spatial memory that were not previously apparent from lesion studies. For example, studies with GluA1 AMPAR [AMPA (alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid) receptor] subunit-knockout mice have revealed the presence of a GluA1-dependent, non-associative short-term memory mechanism that is important for performance on spatial working memory tasks, and a GluA1-independent, long-term associative memory mechanism which underlies performance on spatial reference memory tasks. Within this framework we have also studied the contributions of different GluN2-containing NMDARs [NMDA (N-methyl-D-aspartate) receptors] to spatial memory. Studies with GluN2 NMDAR mutants have revealed different contributions from GluN2A- and GluN2B-containing NMDARs to spatial learning. Furthermore, comparison of forebrain- and hippocampus-specific GluN2B-knockout mice has demonstrated that both hippocampal and extra-hippocampal NMDARs make important contributions to spatial memory performance.
The NMDA receptor NR2A subunit regulates proliferation of MKN45 human gastric cancer cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Watanabe, Kanako; Department of Anesthesiology, Hyogo College of Medicine, 1-1 Mukogawa-cho, Nishinomiya 663-8501; Kanno, Takeshi
2008-03-07
The present study investigated proliferation of MKN28 and MKN45 human gastric cancer cells regulated by the N-methyl-D-aspartate (NMDA) receptor subunit. The NMDA receptor antagonist DL-2-amino-5-phosphonovaleric acid (AP5) inhibited proliferation of MKN45 cells, but not MKN28 cells. Of the NMDA subunits such as NR1, NR2 (2A, 2B, 2C, and 2D), and NR3 (3A and 3B), all the NMDA subunit mRNAs except for the NR2B subunit mRNA were expressed in both MKN28 and MKN45 cells. MKN45 cells were characterized by higher expression of the NR2A subunit mRNA and lower expression of the NR1 subunit mRNA, but MKN28 otherwise by higher expression ofmore » the NR1 subunit mRNA and lower expression of the NR2A subunit mRNA. MKN45 cell proliferation was also inhibited by silencing the NR2A subunit-targeted gene. For MKN45 cells, AP5 or knocking-down the NR2A subunit increased the proportion of cells in the G{sub 1} phase of cell cycling and decreased the proportion in the S/G{sub 2} phase. The results of the present study, thus, suggest that blockage of NMDA receptors including the NR2A subunit suppresses MKN45 cell proliferation due to cell cycle arrest at the G{sub 1} phase; in other words, the NR2A subunit promotes MKN45 cell proliferation by accelerating cell cycling.« less
High Concentrations of Tranexamic Acid Inhibit Ionotropic Glutamate Receptors.
Lecker, Irene; Wang, Dian-Shi; Kaneshwaran, Kirusanthy; Mazer, C David; Orser, Beverley A
2017-07-01
The antifibrinolytic drug tranexamic acid is structurally similar to the amino acid glycine and may cause seizures and myoclonus by acting as a competitive antagonist of glycine receptors. Glycine is an obligatory co-agonist of the N-methyl-D-aspartate (NMDA) subtype of glutamate receptors. Thus, it is plausible that tranexamic acid inhibits NMDA receptors by acting as a competitive antagonist at the glycine binding site. The aim of this study was to determine whether tranexamic acid inhibits NMDA receptors, as well as α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid and kainate subtypes of ionotropic glutamate receptors. Tranexamic acid modulation of NMDA, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid, and kainate receptors was studied using whole cell voltage-clamp recordings of current from cultured mouse hippocampal neurons. Tranexamic acid rapidly and reversibly inhibited NMDA receptors (half maximal inhibitory concentration = 241 ± 45 mM, mean ± SD; 95% CI, 200 to 281; n = 5) and shifted the glycine concentration-response curve for NMDA-evoked current to the right. Tranexamic acid also inhibited α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (half maximal inhibitory concentration = 231 ± 91 mM; 95% CI, 148 to 314; n = 5 to 6) and kainate receptors (half maximal inhibitory concentration = 90 ± 24 mM; 95% CI, 68 to 112; n = 5). Tranexamic acid inhibits NMDA receptors likely by reducing the binding of the co-agonist glycine and also inhibits α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid and kainate receptors. Receptor blockade occurs at high millimolar concentrations of tranexamic acid, similar to the concentrations that occur after topical application to peripheral tissues. Glutamate receptors in tissues including bone, heart, and nerves play various physiologic roles, and tranexamic acid inhibition of these receptors may contribute to adverse drug effects.
Ionotropic GABA and Glutamate Receptor Mutations and Human Neurologic Diseases.
Yuan, Hongjie; Low, Chian-Ming; Moody, Olivia A; Jenkins, Andrew; Traynelis, Stephen F
2015-07-01
The advent of whole exome/genome sequencing and the technology-driven reduction in the cost of next-generation sequencing as well as the introduction of diagnostic-targeted sequencing chips have resulted in an unprecedented volume of data directly linking patient genomic variability to disorders of the brain. This information has the potential to transform our understanding of neurologic disorders by improving diagnoses, illuminating the molecular heterogeneity underlying diseases, and identifying new targets for therapeutic treatment. There is a strong history of mutations in GABA receptor genes being involved in neurologic diseases, particularly the epilepsies. In addition, a substantial number of variants and mutations have been found in GABA receptor genes in patients with autism, schizophrenia, and addiction, suggesting potential links between the GABA receptors and these conditions. A new and unexpected outcome from sequencing efforts has been the surprising number of mutations found in glutamate receptor subunits, with the GRIN2A gene encoding the GluN2A N-methyl-d-aspartate receptor subunit being most often affected. These mutations are associated with multiple neurologic conditions, for which seizure disorders comprise the largest group. The GluN2A subunit appears to be a locus for epilepsy, which holds important therapeutic implications. Virtually all α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor mutations, most of which occur within GRIA3, are from patients with intellectual disabilities, suggesting a link to this condition. Similarly, the most common phenotype for kainate receptor variants is intellectual disability. Herein, we summarize the current understanding of disease-associated mutations in ionotropic GABA and glutamate receptor families, and discuss implications regarding the identification of human mutations and treatment of neurologic diseases. Copyright © 2015 by The American Society for Pharmacology and Experimental
Ionotropic GABA and Glutamate Receptor Mutations and Human Neurologic Diseases
Yuan, Hongjie; Low, Chian-Ming; Moody, Olivia A.; Jenkins, Andrew
2015-01-01
The advent of whole exome/genome sequencing and the technology-driven reduction in the cost of next-generation sequencing as well as the introduction of diagnostic-targeted sequencing chips have resulted in an unprecedented volume of data directly linking patient genomic variability to disorders of the brain. This information has the potential to transform our understanding of neurologic disorders by improving diagnoses, illuminating the molecular heterogeneity underlying diseases, and identifying new targets for therapeutic treatment. There is a strong history of mutations in GABA receptor genes being involved in neurologic diseases, particularly the epilepsies. In addition, a substantial number of variants and mutations have been found in GABA receptor genes in patients with autism, schizophrenia, and addiction, suggesting potential links between the GABA receptors and these conditions. A new and unexpected outcome from sequencing efforts has been the surprising number of mutations found in glutamate receptor subunits, with the GRIN2A gene encoding the GluN2A N-methyl-d-aspartate receptor subunit being most often affected. These mutations are associated with multiple neurologic conditions, for which seizure disorders comprise the largest group. The GluN2A subunit appears to be a locus for epilepsy, which holds important therapeutic implications. Virtually all α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor mutations, most of which occur within GRIA3, are from patients with intellectual disabilities, suggesting a link to this condition. Similarly, the most common phenotype for kainate receptor variants is intellectual disability. Herein, we summarize the current understanding of disease-associated mutations in ionotropic GABA and glutamate receptor families, and discuss implications regarding the identification of human mutations and treatment of neurologic diseases. PMID:25904555
Harvey, Victoria L; Duguid, Ian C; Krasel, Cornelius; Stephens, Gary J
2006-01-01
Ionotropic γ-amino butyric acid (GABA) receptors composed of heterogeneous molecular subunits are major mediators of inhibitory responses in the adult CNS. Here, we describe a novel ionotropic GABA receptor in mouse cerebellar Purkinje cells (PCs) using agents reported to have increased affinity for ρ subunit-containing GABAC over other GABA receptors. Exogenous application of the GABAC-preferring agonist cis-4-aminocrotonic acid (CACA) evoked whole-cell currents in PCs, whilst equimolar concentrations of GABA evoked larger currents. CACA-evoked currents had a greater sensitivity to the selective GABAC antagonist (1,2,5,6-tetrahydropyridin-4-yl)methylphosphinic acid (TPMPA) than GABA-evoked currents. Focal application of agonists produced a differential response profile; CACA-evoked currents displayed a much more pronounced attenuation with increasing distance from the PC soma, displayed a slower time-to-peak and exhibited less desensitization than GABA-evoked currents. However, CACA-evoked currents were also completely blocked by bicuculline, a selective agent for GABAA receptors. Thus, we describe a population of ionotropic GABA receptors with a mixed GABAA/GABAC pharmacology. TPMPA reduced inhibitory synaptic transmission at interneurone–Purkinje cell (IN–PC) synapses, causing clear reductions in miniature inhibitory postsynaptic current (mIPSC) amplitude and frequency. Combined application of NO-711 (a selective GABA transporter subtype 1 (GAT-1) antagonist) and SNAP-5114 (a GAT-(2)/3/4 antagonist) induced a tonic GABA conductance in PCs; however, TPMPA had no effect on this current. Immunohistochemical studies suggest that ρ subunits are expressed predominantly in PC soma and proximal dendritic compartments with a lower level of expression in more distal dendrites; this selective immunoreactivity contrasted with a more uniform distribution of GABAA α1 subunits in PCs. Finally, co-immunoprecipitation studies suggest that ρ subunits can form complexes
Mehta, Ashok K; Marutha Ravindran, C R; Ticku, Maharaj K
2007-08-24
In the present study, we investigated the co-localization pattern of the delta subunit with other subunits of GABA(A) receptors in the rat brain using immunoprecipitation and Western blotting techniques. Furthermore, we investigated whether low concentrations of ethanol affect the delta-subunit-containing GABA(A) receptor assemblies in the rat brain using radioligand binding to the rat brain membrane homogenates as well as to the immunoprecipitated receptor assemblies. Our results revealed that delta subunit is not co-localized with gamma(2) subunit but it is associated with the alpha(1), alpha(4) or alpha(6), beta(2) and/or beta(3) subunit(s) of GABA(A) receptors in the rat brain. Ethanol (1-50 mM) neither affected [(3)H]muscimol (3 nM) binding nor diazepam-insensitive [(3)H]Ro 15-4513 (2 nM) binding in the rat cerebellum and cerebral cortex membranes. However, a higher concentration of ethanol (500 mM) inhibited the binding of these radioligands to the GABA(A) receptors partially in the rat cerebellum and cerebral cortex. Similarly, ethanol (up to 50 mM) did not affect [(3)H]muscimol (15 nM) binding to the immunoprecipitated delta-subunit-containing GABA(A) receptor assemblies in the rat cerebellum and hippocampus but it inhibited the binding partially at a higher concentration (500 mM). These results suggest that the native delta-subunit-containing GABA(A) receptors do not play a major role in the pharmacology of clinically relevant low concentrations of ethanol.
Concas, A; Imperatore, R; Santoru, F; Locci, A; Porcu, P; Cristino, L; Pierobon, P
2016-11-01
γ-aminobutyric acid (GABA) receptors, responding to GABA positive allosteric modulators, are present in the freshwater polyp Hydra vulgaris (Cnidaria, Hydrozoa), one of the most primitive metazoans to develop a nervous system. We examined the occurrence and distribution of GABA A receptor subunits in Hydra tissues by western blot and immunohistochemistry. Antibodies against different GABA A receptor subunits were used in Hydra membrane preparations. Unique protein bands, inhibited by the specific peptide, appeared at 35, 60, ∼50 and ∼52 kDa in membranes incubated with α3, β1, γ3 or δ antibodies, respectively. Immunohistochemical screening of whole mount Hydra preparations revealed diffuse immunoreactivity to α3, β1 or γ3 antibodies in tentacles, hypostome, and upper part of the gastric region; immunoreactive fibers were also present in the lower peduncle. By contrast, δ antibodies revealed a strong labeling in the lower gastric region and peduncle, as well as in tentacles. Double labeling showed colocalization of α3/β1, α3/γ3 and α3/δ immunoreactivity in granules or cells in tentacles and gastric region. In the peduncle, colocalization of both α3/β1 and α3/γ3 immunoreactivity was found in fibers running horizontally above the foot. These data indicate that specific GABA A receptor subunits are present and differentially distributed in Hydra body regions. Subunit colocalization suggests that Hydra GABA receptors are heterologous multimers, possibly sub-serving different physiological activities.
Ladépêche, Laurent; Planagumà, Jesús; Thakur, Shreyasi; Suárez, Irina; Hara, Makoto; Borbely, Joseph Steven; Sandoval, Angel; Laparra-Cuervo, Lara; Dalmau, Josep; Lakadamyali, Melike
2018-06-26
Anti-N-methyl-D-aspartate receptor (NMDAR) encephalitis is a severe neuropsychiatric disorder mediated by autoantibodies against the GluN1 subunit of the NMDAR. Patients' antibodies cause cross-linking and internalization of NMDAR, but the synaptic events leading to depletion of NMDAR are poorly understood. Using super-resolution microscopy, we studied the effects of the autoantibodies on the nanoscale distribution of NMDAR in cultured neurons. Our findings show that, under control conditions, NMDARs form nanosized objects and patients' antibodies increase the clustering of synaptic and extrasynaptic receptors inside the nano-objects. This clustering is subunit specific and predominantly affects GluN2B-NMDARs. Following internalization, the remaining surface NMDARs return to control clustering levels but are preferentially retained at the synapse. Monte Carlo simulations using a model in which antibodies induce NMDAR cross-linking and disruption of interactions with other proteins recapitulated these results. Finally, activation of EphB2 receptor partially antagonized the antibody-mediated disorganization of the nanoscale surface distribution of NMDARs. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Wilkins, Megan E; Hosie, Alastair M; Smart, Trevor G
2005-01-01
Regulation of GABAA receptors by extracellular pH exhibits a dependence on the receptor subunit composition. To date, the molecular mechanism responsible for the modulation of GABAA receptors at alkaline pH has remained elusive. We report here that the GABA-activated current can be potentiated at pH 8.4 for both αβ and αβγ subunit-containing receptors, but only at GABA concentrations below the EC40. Site-specific mutagenesis revealed that a single lysine residue, K279 in the β subunit TM2–TM3 linker, was critically important for alkaline pH to modulate the function of both α1β2 and α1β2γ2 receptors. The ability of low concentrations of GABA to reveal different pH titration profiles for GABAA receptors was also examined at acidic pH. At pH 6.4, GABA activation of αβγ receptors was enhanced at low GABA concentrations. This effect was ablated by the mutation H267A in the β subunit. Decreasing the pH further to 5.4 inhibited GABA responses via αβγ receptors, whereas those responses recorded from αβ receptors were potentiated. Inserting homologous β subunit residues into the γ2 subunit to recreate, in αβγ receptors, the proton modulatory profile of αβ receptors, established that in the presence of β2H267, the mutation γ2T294K was necessary to potentiate the GABA response at pH 5.4. This residue, T294, is homologous to K279 in the β subunit and suggests that a lysine at this position is an important residue for mediating the allosteric effects of both acidic and alkaline pH changes, rather than forming a direct site for protonation within the GABAA receptor. PMID:15946973
Shen, Wen; Slaughter, Malcolm M
1998-01-01
Glutamate suppressed high-voltage-activated barium currents (IBa,HVA) in tiger salamander retinal ganglion cells. Both ionotropic (iGluR) and metabotropic (mGluR) receptors contributed to this calcium channel inhibition. Trans-ACPD (1-aminocyclopentane-trans-1S,3R-dicarboxylic acid), a broad-spectrum metabotropic glutamate receptor agonist, suppressed a dihydropyridine-sensitive barium current. Kainate, an ionotropic glutamate receptor agonist, reduced an ω-conotoxin GVIA-sensitive current. The relative effectiveness of selective agonists indicated that the predominant metabotropic receptor was the L-2-amino-4-phosphonobutyrate (l-AP4)-sensitive, group III receptor. This receptor reversed the action of forskolin, but this was not responsible for calcium channel suppression. l-AP4 raised internal calcium concentration. Antagonists of phospholipase C, inositol trisphosphate (IP3) receptors and ryanodine receptors inhibited the action of metabotropic agonists, indicating that group III receptor transduction was linked to this pathway. The action of kainate was partially suppressed by BAPTA, by calmodulin antagonists and by blockers of calmodulin-dependent phosphatase. Suppression by kainate of the calcium channel current was more rapid when calcium was the charge carrier, instead of barium. The results indicate that calcium influx through kainate-sensitive glutamate receptors can activate calmodulin, which stimulates phosphatases that may directly suppress voltage-sensitive calcium channels. Thus, ionotropic and metabotropic glutamate receptors inhibit distinct calcium channels. They could act synergistically, since both increase internal calcium. These pathways provide negative feedback that can reduce calcium influx when ganglion cells are depolarized. PMID:9660896
Wang, Ningshan; Orr-Urtreger, Avi; Chapman, Joab; Rabinowitz, Ruth; Korczyn, Amos D
2004-07-15
Neuronal nicotinic acetylcholine receptors (nAChRs) are composed of 12 subunits (alpha2-alpha10 and beta2-beta4). alpha5 Subunits, expressed throughout the central nervous system (CNS) and the autonomic nervous system (ANS), possess unique pharmacological properties. The effects of oxotremorine (OXO) on autonomic functions and tremor were examined in mice lacking alpha5 nAChR subunits (alpha5-/-) and compared with those in wild-type (WT) control mice. The alpha5-/- mice showed significantly increased salivation and tremor responses to OXO. The hypothermia, bradycardia and defecation induced by OXO were of similar magnitudes in the two mouse strains. The enhanced OXO effects in alpha5-/- mice indicate inhibitory effects of alpha5 subunits in autonomic ganglia, and support the participation of these subunits in cholinergic transmission in autonomic ganglia.
Zhu, Shujia; Riou, Morgane; Yao, C Andrea; Carvalho, Stéphanie; Rodriguez, Pamela C; Bensaude, Olivier; Paoletti, Pierre; Ye, Shixin
2014-04-22
Reprogramming receptors to artificially respond to light has strong potential for molecular studies and interrogation of biological functions. Here, we design a light-controlled ionotropic glutamate receptor by genetically encoding a photoreactive unnatural amino acid (UAA). The photo-cross-linker p-azido-L-phenylalanine (AzF) was encoded in NMDA receptors (NMDARs), a class of glutamate-gated ion channels that play key roles in neuronal development and plasticity. AzF incorporation in the obligatory GluN1 subunit at the GluN1/GluN2B N-terminal domain (NTD) upper lobe dimer interface leads to an irreversible allosteric inhibition of channel activity upon UV illumination. In contrast, when pairing the UAA-containing GluN1 subunit with the GluN2A subunit, light-dependent inactivation is completely absent. By combining electrophysiological and biochemical analyses, we identify subunit-specific structural determinants at the GluN1/GluN2 NTD dimer interfaces that critically dictate UV-controlled inactivation. Our work reveals that the two major NMDAR subtypes differ in their ectodomain-subunit interactions, in particular their electrostatic contacts, resulting in GluN1 NTD coupling more tightly to the GluN2B NTD than to the GluN2A NTD. It also paves the way for engineering light-sensitive ligand-gated ion channels with subtype specificity through the genetic code expansion.
Nani, Francesca; Bright, Damian P.; Revilla-Sanchez, Raquel; Tretter, Verena; Moss, Stephen J.
2013-01-01
GABA-mediated tonic and phasic inhibition of thalamic relay neurons of the dorsal lateral geniculate nucleus (dLGN) was studied after ablating tyrosine (Y) phosphorylation of receptor γ2-subunits. As phosphorylation of γ2 Y365 and Y367 reduces receptor internalization, to understand their importance for inhibition we created a knock-in mouse in which these residues are replaced by phenylalanines. On comparing wild-type (WT) and γ2Y365/367F+/− (HT) animals (homozygotes are not viable in utero), the expression levels of GABAA receptor α4-subunits were increased in the thalamus of female, but not male mice. Raised δ-subunit expression levels were also observed in female γ2Y365/367F +/− thalamus. Electrophysiological analyses revealed no difference in the level of inhibition in male WT and HT dLGN, while both the spontaneous inhibitory postsynaptic activity and the tonic current were significantly augmented in female HT relay cells. The sensitivity of tonic currents to the δ-subunit superagonist THIP, and the blocker Zn2+, were higher in female HT relay cells. This is consistent with upregulation of extrasynaptic GABAA receptors containing α4- and δ-subunits to enhance tonic inhibition. In contrast, the sensitivity of GABAA receptors mediating inhibition in the female γ2Y356/367F +/− to neurosteroids was markedly reduced compared with WT. We conclude that disrupting tyrosine phosphorylation of the γ2-subunit activates a sex-specific increase in tonic inhibition, and this most likely reflects a genomic-based compensation mechanism for the reduced neurosteroid sensitivity of inhibition measured in female HT relay neurons. PMID:23904608
Kainate-induced network activity in the anterior cingulate cortex.
Shinozaki, R; Hojo, Y; Mukai, H; Hashizume, M; Murakoshi, T
2016-06-14
Anterior cingulate cortex (ACC) plays a pivotal role in higher order processing of cognition, attention and emotion. The network oscillation is considered an essential means for integration of these CNS functions. The oscillation power and coherence among related areas are often dis-regulated in several psychiatric and pathological conditions with a hemispheric asymmetric manner. Here we describe the network-based activity of field potentials recorded from the superficial layer of the mouse ACC in vitro using submerged type recordings. A short activation by kainic acid administration to the preparation induced populational activities ranging over several frequency bands including theta (3-8Hz), alpha (8-12Hz), beta (13-30Hz), low gamma (30-50Hz) and high gamma (50-80Hz). These responses were repeatable and totally abolished by tetrodotoxin, and greatly diminished by inhibitors of ionotropic and metabotropic glutamate receptors, GABAA receptor or gap-junctions. These observations suggest that the kainate-induced network activity can be a useful model of the network oscillation in the ACC circuit. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.
Lu, Y-G; Tang, Z-Q; Ye, Z-Y; Wang, H-T; Huang, Y-N; Zhou, K-Q; Zhang, M; Xu, T-L; Chen, L
2009-01-01
Background and purpose: Aspirin or its metabolite sodium salicylate is widely prescribed and has many side effects. Previous studies suggest that targeting neuronal receptors/ion channels is one of the pathways by which salicylate causes side effects in the nervous system. The present study aimed to investigate the functional action of salicylate on glycine receptors at a molecular level. Experimental approach: Whole-cell patch-clamp and site-directed mutagenesis were deployed to examine the effects of salicylate on the currents mediated by native glycine receptors in cultured neurones of rat inferior colliculus and by glycine receptors expressed in HEK293T cells. Key results: Salicylate effectively inhibited the maximal current mediated by native glycine receptors without altering the EC50 and the Hill coefficient, demonstrating a non-competitive action of salicylate. Only when applied simultaneously with glycine and extracellularly, could salicylate produce this antagonism. In HEK293T cells transfected with either α1-, α2-, α3-, α1β-, α2β- or α3β-glycine receptors, salicylate only inhibited the current mediated by those receptors that contained the α1-subunit. A single site mutation of I240V in the α1-subunit abolished inhibition by salicylate. Conclusions and implications: Salicylate is a non-competitive antagonist specifically on glycine receptors containing α1-subunits. This action critically involves the isoleucine-240 in the first transmembrane segment of the α1-subunit. Our findings may increase our understanding of the receptors involved in the side effects of salicylate on the central nervous system, such as seizures and tinnitus. PMID:19594751
Glycine Receptors Containing α2 or α3 Subunits Regulate Specific Ethanol-Mediated Behaviors
Blednov, Yuri A.; Benavidez, Jillian M.; Black, Mendy; Leiter, Courtney R.; Osterndorff-Kahanek, Elizabeth
2015-01-01
Glycine receptors (GlyRs) are broadly expressed in the central nervous system. Ethanol enhances the function of brain GlyRs, and the GlyRα1 subunit is associated with some of the behavioral actions of ethanol, such as loss of righting reflex. The in vivo role of GlyRα2 and α3 subunits in alcohol responses has not been characterized despite high expression levels in the nucleus accumbens and amygdala, areas that are important for the rewarding properties of drugs of abuse. We used an extensive panel of behavioral tests to examine ethanol actions in mice lacking Glra2 (the gene encoding the glycine receptor alpha 2 subunit) or Glra3 (the gene encoding the glycine receptor alpha 3 subunit). Deletion of Glra2 or Glra3 alters specific ethanol-induced behaviors. Glra2 knockout mice demonstrate reduced ethanol intake and preference in the 24-hour two-bottle choice test and increased initial aversive responses to ethanol and lithium chloride. In contrast, Glra3 knockout mice show increased ethanol intake and preference in the 24-hour intermittent access test and increased development of conditioned taste aversion to ethanol. Mutants and wild-type mice consumed similar amounts of ethanol in the limited access drinking in the dark test. Other ethanol effects, such as anxiolysis, motor incoordination, loss of righting reflex, and acoustic startle response, were not altered in the mutants. The behavioral changes in mice lacking GlyRα2 or α3 subunits were distinct from effects previously observed in mice with knock-in mutations in the α1 subunit. We provide evidence that GlyRα2 and α3 subunits may regulate ethanol consumption and the aversive response to ethanol. PMID:25678534
Shin, Eun-Joo; Nah, Seung-Yeol; Kim, Won-Ki; Ko, Kwang Ho; Jhoo, Wang-Kee; Lim, Yong-Kwang; Cha, Joo Young; Chen, Chieh-Fu; Kim, Hyoung-Chun
2005-01-01
In a previous study, we demonstrated that a dextromethorphan analog, dimemorfan, has neuroprotective effects. Dextromethorphan and dimemorfan are high-affinity ligands at σ1 receptors. Dextromethorphan has moderate affinities for phencyclidine sites, while dimemorfan has very low affinities for such sites, suggesting that these sites are not essential for the anticonvulsant actions of dimemorfan. Kainate (KA) administration (10 mg kg−1, i.p.) produced robust convulsions lasting 4–6 h in rats. Pre-treatment with dimemorfan (12 or 24 mg kg−1) reduced seizures in a dose-dependent manner. Dimemorfan pre-treatment also attenuated the KA-induced increases in c-fos/c-jun expression, activator protein (AP)-1 DNA-binding activity, and loss of cells in the CA1 and CA3 fields of the hippocampus. These effects of dimemorfan were comparable to those of dextromethorphan. The anticonvulsant action of dextromethorphan or dimemorfan was significantly counteracted by a selective σ1 receptor antagonist BD 1047, suggesting that the anticonvulsant action of dextromethorphan or dimemorfan is, at least in part, related to σ1 receptor-activated modulation of AP-1 transcription factors. We asked whether dimemorfan produces the behavioral side effects seen with dextromethorphan or dextrorphan (a phencyclidine-like metabolite of dextromethorphan). Conditioned place preference and circling behaviors were significantly increased in mice treated with phencyclidine, dextrorphan or dextromethorphan, while mice treated with dimemorfan showed no behavioral side effects. Our results suggest that dimemorfan is equipotent to dextromethorphan in preventing KA-induced seizures, while it may lack behavioral effects, such as psychotomimetic reactions. PMID:15723099
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hwang, J.; Menon, K.N.J.
1986-05-29
The level of hCG/LH receptor has been shown to undergo marked changes during the life span of rat corpus luteum. To evaluate whether these fluctuations are due to changes in the receptor subunit structure or receptor protein content, the /sup 125/I-hCG binding activity and the receptor subunit structure were determined during different time periods of pseudopregnancy. The maximum /sup 125/I-hCG binding activity was observed on day 7, after which it decreased by 20 and 45% on day 11 and day 14, respectively. The Scatchard analysis of /sup 125/I-hCG binding data showed that the decrease in binding activity was caused bymore » a change in the number of binding sites rather than a change in the binding affinity. The LH/hCG receptor in ovarian membranes obtained on days 7, 11 and 14 were characterized by the method of affinity cross-linking. All four subunits of the LH/hCG receptor were detected in the ovarian membranes at all stages while the intensity decreased parallel to a decrease in hCG binding from day 7 to day 14.« less
Akgoz, Muslum; Kalyanaraman, Vani; Gautam, N.
2008-01-01
On activation of a receptor the G protein βγ complex translocates away from the receptor on the plasma membrane to the Golgi complex. The rate of translocation is influenced by the type of γ subunit associated with the G protein. Complementary approaches — imaging living cells expressing fluorescent protein tagged G proteins and assaying reconstituted receptors and G proteins in vitro — were used to identify mechanisms at the basis of the translocation process. Translocation of Gβγ containing mutant γ subunits with altered prenyl moieties showed that the differences in the prenyl moieties were not sufficient to explain the differential effects of geranylgeranylated γ5 and farnesylated γ11 on the translocation process. The translocation properties of Gβγ were altered dramatically by mutating the C terminal tail region of the γ subunit. The translocation characteristics of these mutants suggest that after receptor activation, Gβγ retains contact with a receptor through the γ subunit C terminal domain and that differential interaction of the activated receptor with this domain controls Gβγ translocation from the plasma membrane. PMID:16517125
Relative positioning of classical benzodiazepines to the γ2-subunit of GABAA receptors.
Middendorp, Simon J; Hurni, Evelyn; Schönberger, Matthias; Stein, Marco; Pangerl, Michael; Trauner, Dirk; Sigel, Erwin
2014-08-15
GABAA receptors are the major inhibitory neurotransmitter receptors in the brain. Benzodiazepine exert their action via a high affinity-binding site at the α/γ subunit interface on some of these receptors. Diazepam has sedative, hypnotic, anxiolytic, muscle relaxant, and anticonvulsant effects. It acts by potentiating the current evoked by the agonist GABA. Understanding specific interaction of benzodiazepines in the binding pocket of different GABAA receptor isoforms might help to separate these divergent effects. As a first step, we characterized the interaction between diazepam and the major GABAA receptor isoform α1β2γ2. We mutated several amino acid residues on the γ2-subunit assumed to be located near or in the benzodiazepine binding pocket individually to cysteine and studied the interaction with three ligands that are modified with a cysteine-reactive isothiocyanate group (-NCS). When the reactive NCS group is in apposition to the cysteine residue this leads to a covalent reaction. In this way, three amino acid residues, γ2Tyr58, γ2Asn60, and γ2Val190 were located relative to classical benzodiazepines in their binding pocket on GABAA receptors.
Eaton, Megan M.; Bracamontes, John; Shu, Hong-Jin; Li, Ping; Mennerick, Steven; Steinbach, Joe Henry
2014-01-01
Native γ-aminobutyric acid (GABA)A receptors consisting of α4, β1–3, and δ subunits mediate responses to the low, tonic concentration of GABA present in the extracellular milieu. Previous studies on heterologously expressed α4βδ receptors have shown a large degree of variability in functional properties, including sensitivity to the transmitter. We studied properties of α4β2δ receptors employing free subunits and concatemeric constructs, expressed in Xenopus oocytes, HEK 293 cells, and cultured hippocampal neurons. The expression system had a strong effect on the properties of receptors containing free subunits. The midpoint of GABA activation curve was 10 nM for receptors in oocytes versus 2300 nM in HEK cells. Receptors activated by the steroid alfaxalone had an estimated maximal open probability of 0.6 in oocytes and 0.01 in HEK cells. Irrespective of the expression system, receptors resulting from combining the tandem construct β2-δ and a free α4 subunit exhibited large steroid responses. We propose that free α4, β2, and δ subunits assemble in different configurations with distinct properties in oocytes and HEK cells, and that subunit linkage can overcome the expression system-dependent preferential assembly of free subunits. Hippocampal neurons transfected with α4 and the picrotoxin-resistant δ(T269Y) subunit showed large responses to alfaxalone in the presence of picrotoxin, suggesting that α4βδ receptors may assemble in a similar configuration in neurons and oocytes. PMID:25238745
Glutamate mediates platelet activation through the AMPA receptor
Morrell, Craig N.; Sun, Henry; Ikeda, Masahiro; Beique, Jean-Claude; Swaim, Anne Marie; Mason, Emily; Martin, Tanika V.; Thompson, Laura E.; Gozen, Oguz; Ampagoomian, David; Sprengel, Rolf; Rothstein, Jeffrey; Faraday, Nauder; Huganir, Richard; Lowenstein, Charles J.
2008-01-01
Glutamate is an excitatory neurotransmitter that binds to the kainate receptor, the N-methyl-D-aspartate (NMDA) receptor, and the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor (AMPAR). Each receptor was first characterized and cloned in the central nervous system (CNS). Glutamate is also present in the periphery, and glutamate receptors have been identified in nonneuronal tissues, including bone, heart, kidney, pancreas, and platelets. Platelets play a central role in normal thrombosis and hemostasis, as well as contributing greatly to diseases such as stroke and myocardial infarction. Despite the presence of glutamate in platelet granules, the role of glutamate during hemostasis is unknown. We now show that activated platelets release glutamate, that platelets express AMPAR subunits, and that glutamate increases agonist-induced platelet activation. Furthermore, we demonstrate that glutamate binding to the AMPAR increases intracellular sodium concentration and depolarizes platelets, which are important steps in platelet activation. In contrast, platelets treated with the AMPAR antagonist CNQX or platelets derived from GluR1 knockout mice are resistant to AMPA effects. Importantly, mice lacking GluR1 have a prolonged time to thrombosis in vivo. Our data identify glutamate as a regulator of platelet activation, and suggest that the AMPA receptor is a novel antithrombotic target. PMID:18283118
Saini, Deepak Kumar; Kalyanaraman, Vani; Chisari, Mariangela; Gautam, Narasimhan
2008-01-01
The present model of G protein activation by G protein-coupled receptors exclusively localizes their activation and function to the plasma membrane (PM). Observation of the spatiotemporal response of G protein subunits in a living cell to receptor activation showed that 6 of the 12 members of the G protein γ subunit family translocate specifically from the PM to endomembranes. The γ subunits translocate as βγ complexes, whereas the α subunit is retained on the PM. Depending on the γ subunit, translocation occurs predominantly to the Golgi complex or the endoplasmic reticulum. The rate of translocation also varies with the γ subunit type. Different γ subunits, thus, confer distinct spatiotemporal properties to translocation. A striking relationship exists between the amino acid sequences of various γ subunits and their translocation properties. γ subunits with similar translocation properties are more closely related to each other. Consistent with this relationship, introducing residues conserved in translocating subunits into a non-translocating subunit results in a gain of function. Inhibitors of vesicle-mediated trafficking and palmitoylation suggest that translocation is diffusion-mediated and controlled by acylation similar to the shuttling of G protein subunits (Chisari, M., Saini, D. K., Kalyanaraman, V., and Gautam, N. (2007) J. Biol. Chem. 282, 24092–24098). These results suggest that the continual testing of cytosolic surfaces of cell membranes by G protein subunits facilitates an activated cell surface receptor to direct potentially active G protein βγ subunits to intracellular membranes. PMID:17581822
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lind, Genevieve E.; Mou, Tung-Chung; Tamborini, Lucia
NMDA-type glutamate receptors are ligand-gated ion channels that contribute to excitatory neurotransmission in the central nervous system (CNS). Most NMDA receptors comprise two glycine-binding GluN1 and two glutamate-binding GluN2 subunits (GluN2A–D). We describe highly potent (S)-5-[(R)-2-amino-2-carboxyethyl]-4,5-dihydro-1H-pyrazole-3-carboxylic acid (ACEPC) competitive GluN2 antagonists, of which ST3 has a binding affinity of 52 nM at GluN1/2A and 782 nM at GluN1/2B receptors. This 15-fold preference of ST3 for GluN1/2A over GluN1/2B is improved compared with NVP-AAM077, a widely used GluN2A-selective antagonist, which we show has 11-fold preference for GluN1/2A over GluN1/2B. Crystal structures of the GluN1/2A agonist binding domain (ABD) heterodimer with boundmore » ACEPC antagonists reveal a binding mode in which the ligands occupy a cavity that extends toward the subunit interface between GluN1 and GluN2A ABDs. Mutational analyses show that the GluN2A preference of ST3 is primarily mediated by four nonconserved residues that are not directly contacting the ligand, but positioned within 12 Å of the glutamate binding site. Two of these residues influence the cavity occupied by ST3 in a manner that results in favorable binding to GluN2A, but occludes binding to GluN2B. Thus, we reveal opportunities for the design of subunit-selective competitive NMDA receptor antagonists by identifying a cavity for ligand binding in which variations exist between GluN2A and GluN2B subunits. This structural insight suggests that subunit selectivity of glutamate-site antagonists can be mediated by mechanisms in addition to direct contributions of contact residues to binding affinity.« less
Lind, Genevieve E.; Mou, Tung-Chung; Tamborini, Lucia; Pomper, Martin G.; De Micheli, Carlo; Conti, Paola; Pinto, Andrea
2017-01-01
NMDA-type glutamate receptors are ligand-gated ion channels that contribute to excitatory neurotransmission in the central nervous system (CNS). Most NMDA receptors comprise two glycine-binding GluN1 and two glutamate-binding GluN2 subunits (GluN2A–D). We describe highly potent (S)-5-[(R)-2-amino-2-carboxyethyl]-4,5-dihydro-1H-pyrazole-3-carboxylic acid (ACEPC) competitive GluN2 antagonists, of which ST3 has a binding affinity of 52 nM at GluN1/2A and 782 nM at GluN1/2B receptors. This 15-fold preference of ST3 for GluN1/2A over GluN1/2B is improved compared with NVP-AAM077, a widely used GluN2A-selective antagonist, which we show has 11-fold preference for GluN1/2A over GluN1/2B. Crystal structures of the GluN1/2A agonist binding domain (ABD) heterodimer with bound ACEPC antagonists reveal a binding mode in which the ligands occupy a cavity that extends toward the subunit interface between GluN1 and GluN2A ABDs. Mutational analyses show that the GluN2A preference of ST3 is primarily mediated by four nonconserved residues that are not directly contacting the ligand, but positioned within 12 Å of the glutamate binding site. Two of these residues influence the cavity occupied by ST3 in a manner that results in favorable binding to GluN2A, but occludes binding to GluN2B. Thus, we reveal opportunities for the design of subunit-selective competitive NMDA receptor antagonists by identifying a cavity for ligand binding in which variations exist between GluN2A and GluN2B subunits. This structural insight suggests that subunit selectivity of glutamate-site antagonists can be mediated by mechanisms in addition to direct contributions of contact residues to binding affinity. PMID:28760974
Walls, Anne B; Eyjolfsson, Elvar M; Schousboe, Arne; Sonnewald, Ursula; Waagepetersen, Helle S
2014-08-01
Despite the well-established use of kainate as a model for seizure activity and temporal lobe epilepsy, most studies have been performed at doses giving rise to general limbic seizures and have mainly focused on neuronal function. Little is known about the effect of lower doses of kainate on cerebral metabolism and particularly that associated with astrocytes. We investigated astrocytic and neuronal metabolism in the cerebral cortex of adult mice after treatment with saline (controls), a subconvulsive or a mildly convulsive dose of kainate. A combination of [1,2-(13)C]acetate and [1-(13)C]glucose was injected and subsequent nuclear magnetic resonance spectroscopy of cortical extracts was employed to distinctively map astrocytic and neuronal metabolism. The subconvulsive dose of kainate led to an instantaneous increase in the cortical lactate content, a subsequent reduction in the amount of [4,5-(13)C]glutamine and an increase in the calculated astrocytic TCA cycle activity. In contrast, the convulsive dose led to decrements in the cortical content and (13)C labeling of glutamate, glutamine, GABA, and aspartate. Evidence is provided that astrocytic metabolism is affected by a subconvulsive dose of kainate, whereas a higher dose is required to affect neuronal metabolism. The cerebral glycogen content was dose-dependently reduced by kainate supporting a role for glycogen during seizure activity.
Walls, Anne B; Eyjolfsson, Elvar M; Schousboe, Arne; Sonnewald, Ursula; Waagepetersen, Helle S
2014-01-01
Despite the well-established use of kainate as a model for seizure activity and temporal lobe epilepsy, most studies have been performed at doses giving rise to general limbic seizures and have mainly focused on neuronal function. Little is known about the effect of lower doses of kainate on cerebral metabolism and particularly that associated with astrocytes. We investigated astrocytic and neuronal metabolism in the cerebral cortex of adult mice after treatment with saline (controls), a subconvulsive or a mildly convulsive dose of kainate. A combination of [1,2-13C]acetate and [1-13C]glucose was injected and subsequent nuclear magnetic resonance spectroscopy of cortical extracts was employed to distinctively map astrocytic and neuronal metabolism. The subconvulsive dose of kainate led to an instantaneous increase in the cortical lactate content, a subsequent reduction in the amount of [4,5-13C]glutamine and an increase in the calculated astrocytic TCA cycle activity. In contrast, the convulsive dose led to decrements in the cortical content and 13C labeling of glutamate, glutamine, GABA, and aspartate. Evidence is provided that astrocytic metabolism is affected by a subconvulsive dose of kainate, whereas a higher dose is required to affect neuronal metabolism. The cerebral glycogen content was dose-dependently reduced by kainate supporting a role for glycogen during seizure activity. PMID:24824917
Differential Expression of Glutamate Receptors in Avian Neural Pathways for Learned Vocalization
WADA, KAZUHIRO; SAKAGUCHI, HIRONOBU; JARVIS, ERICH D.; HAGIWARA, MASATOSHI
2008-01-01
Learned vocalization, the substrate for human language, is a rare trait. It is found in three distantly related groups of birds—parrots, hummingbirds, and songbirds. These three groups contain cerebral vocal nuclei for learned vocalization not found in their more closely related vocal nonlearning relatives. Here, we cloned 21 receptor subunits/subtypes of all four glutamate receptor families (AMPA, kainate, NMDA, and metabotropic) and examined their expression in vocal nuclei of songbirds. We also examined expression of a subset of these receptors in vocal nuclei of hummingbirds and parrots, as well as in the brains of dove species as examples of close vocal nonlearning relatives. Among the 21 subunits/subtypes, 19 showed higher and/or lower prominent differential expression in songbird vocal nuclei relative to the surrounding brain subdivisions in which the vocal nuclei are located. This included relatively lower levels of all four AMPA subunits in lMAN, strikingly higher levels of the kainite subunit GluR5 in the robust nucleus of the arcopallium (RA), higher and lower levels respectively of the NMDA subunits NR2A and NR2B in most vocal nuclei and lower levels of the metabotropic group I subtypes (mGluR1 and -5) in most vocal nuclei and the group II subtype (mGluR2), showing a unique expression pattern of very low levels in RA and very high levels in HVC. The splice variants of AMPA subunits showed further differential expression in vocal nuclei. Some of the receptor subunits/subtypes also showed differential expression in hummingbird and parrot vocal nuclei. The magnitude of differential expression in vocal nuclei of all three vocal learners was unique compared with the smaller magnitude of differences found for nonvocal areas of vocal learners and vocal nonlearners. Our results suggest that evolution of vocal learning was accompanied by differential expression of a conserved gene family for synaptic transmission and plasticity in vocal nuclei. They also
Vandenberg, R J; French, C R; Barry, P H; Shine, J; Schofield, P R
1992-01-01
The inhibitory glycine receptor (GlyR) is a member of the ligand-gated ion channel receptor superfamily. Glycine activation of the receptor is antagonized by the convulsant alkaloid strychnine. Using in vitro mutagenesis and functional analysis of the cDNA encoding the alpha 1 subunit of the human GlyR, we have identified several amino acid residues that form the strychnine-binding site. These residues were identified by transient expression of mutated cDNAs in mammalian (293) cells and examination of resultant [3H]strychnine binding, glycine displacement of [3H]strychnine, and electrophysiological responses to the application of glycine and strychnine. This mutational analysis revealed that residues from two separate domains within the alpha 1 subunit form the binding site for the antagonist strychnine. The first domain includes the amino acid residues Gly-160 and Tyr-161, and the second domain includes the residues Lys-200 and Tyr-202. These results, combined with analyses of other ligand-gated ion channel receptors, suggest a conserved tertiary structure and a common mechanism for antagonism in this receptor superfamily. PMID:1311851
Overexpression of α3/α5/β4 nicotinic receptor subunits modifies impulsive-like behavior.
Viñals, Xavier; Molas, Susanna; Gallego, Xavier; Fernández-Montes, Rubén D; Robledo, Patricia; Dierssen, Mara; Maldonado, Rafael
2012-05-01
Recent studies have revealed that sequence variants in genes encoding the α3/α5/β4 nicotinic acetylcholine receptor subunits are associated with nicotine dependence. In this study, we evaluated two specific aspects of executive functioning related to drug addiction (impulsivity and working memory) in transgenic mice over expressing α3/α5/β4 nicotinic receptor subunits. Impulsivity and working memory were evaluated in an operant delayed alternation task, where mice must inhibit responding between 2 and 8s in order to receive food reinforcement. Working memory was also evaluated in a spontaneous alternation task in an open field. Transgenic mice showed less impulsive-like behavior than wild-type controls, and this behavioral phenotype was related to the number of copies of the transgene. Thus, transgenic Line 22 (16-28 copies) showed a more pronounced phenotype than Line 30 (4-5 copies). Overexpression of these subunits in Line 22 reduced spontaneous alternation behavior suggesting deficits in working memory processing in this particular paradigm. These results reveal the involvement of α3/α5/β4 nicotinic receptor subunits in working memory and impulsivity, two behavioral traits directly related to the vulnerability to develop nicotine dependence. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Azpiazu, Inaki; Akgoz, Muslum; Kalyanaraman, Vani; Gautam, N.
2008-01-01
G protein activation by Gi/Go coupling M2 muscarinic receptors, Gq coupling M3 receptors and Gs coupling β2 adrenergic receptors causes rapid reversible translocation of the G protein γ11 subunit from the plasma membrane to the Golgi complex. Co-translocation of the β1 subunit suggests that γ11 translocates as a βγ complex. Pertussis toxin ADP ribosylation of the αi subunit type or substitution of the C terminal domain of αo with the corresponding region of αs inhibits γ11 translocation demonstrating that α subunit interaction with a receptor and its activation are requirements for the translocation. The rate of γ11 translocation is sensitive to the rate of activation of the G protein α subunit. α subunit types that show high receptor activated rates of guanine nucleotide exchange in vitro support high rates of γ11 translocation compared to α subunit types that have a relatively lower rate of guanine nucleotide exchange. The results suggest that the receptor induced translocation of γ11 is controlled by the rate of cycling of the G protein through active and inactive forms. They also demonstrate that imaging of γ11 translocation can be used as a non-invasive tool to measure the relative activities of wild type or mutant receptor and α subunit types in a live cell. PMID:16242307
Smothers, C. Thetford; Jin, Chun; Woodward, John J.
2013-01-01
Background Ethanol inhibition of NMDA receptors is poorly understood due in part to the organizational complexity of the receptor that provides ample locations for sites of action. Among these the N-terminal domain of NMDA receptor subunits contains binding sites for a variety of modulatory agents including zinc, protons and GluN2B selective antagonists such as ifenprodil or Ro-25–6981. Ethanol inhibition of neuronal NMDA receptors expressed in some brain areas has been reported to be occluded by the presence of ifenprodil or similar compounds suggesting that the N-terminal domain may be important in regulating the ethanol sensitivity of NMDA receptors. Methods Wild-type GluN1 and GluN2 subunits and those in which the coding sequence for the N-terminal domain was deleted were expressed in HEK293 cells. Whole-cell voltage-clamp recording was used to assess ethanol inhibition of wild-type and mutant receptors lacking the N-terminal domain. Results As compared to wild-type GluN1/GluN2A receptors, ethanol inhibition was slightly greater in cells expressing GluN2A subunits lacking the N-terminal domain. In contrast, GluN2B N-terminal deletion mutants showed normal ethanol inhibition while those lacking the N-terminal domain in both GluN1 and GluN2B subunits had decreased ethanol inhibition as compared to wild-type receptors. N-terminal domain lacking GluN2B receptors were insensitive to ifenprodil but retained normal sensitivity to ethanol. Conclusions These findings indicate that the N-terminal domain modestly influences the ethanol sensitivity of NMDA receptors in a subunit-dependent manner. They also show that ifenprodil’s actions on GluN2B containing receptors can be dissociated from those of ethanol. These results suggest that while the N-terminal domain is not a primary site of action for ethanol on NMDA receptors, it likely affects sensitivity via actions on intrinsic channel properties. PMID:23905549
M1 muscarinic receptor facilitates cognitive function by interplay with AMPA receptor GluA1 subunit.
Zhao, Lan-Xue; Ge, Yan-Hui; Xiong, Cai-Hong; Tang, Ling; Yan, Ying-Hui; Law, Ping-Yee; Qiu, Yu; Chen, Hong-Zhuan
2018-03-06
M1 muscarinic acetylcholine receptors (M1 mAChRs) are the most abundant muscarinic receptors in the hippocampus and have been shown to have procognitive effects. AMPA receptors (AMPARs), an important subtype of ionotropic glutamate receptors, are key components in neurocognitive networks. However, the role of AMPARs in procognitive effects of M1 mAChRs and how M1 mAChRs affect the function of AMPARs remain poorly understood. Here, we found that basal expression of GluA1, a subunit of AMPARs, and its phosphorylation at Ser845 were maintained by M1 mAChR activity. Activation of M1 mAChRs promoted membrane insertion of GluA1, especially to postsynaptic densities. Impairment of hippocampus-dependent learning and memory by antagonism of M1 mAChRs paralleled the reduction of GluA1 expression, and improvement of learning and memory by activation of M1 mAChRs was accompanied by the synaptic insertion of GluA1 and its increased phosphorylation at Ser845. Furthermore, abrogation of phosphorylation of Ser845 residue of GluA1 ablated M1 mAChR-mediated improvement of learning and memory. Taken together, these results show a functional correlation of M1 mAChRs and GluA1 and the essential role of GluA1 in M1 mAChR-mediated cognitive improvement.-Zhao, L.-X., Ge, Y.-H., Xiong, C.-H., Tang, L., Yan, Y.-H., Law, P.-Y., Qiu, Y., Chen, H.-Z. M1 muscarinic receptor facilitates cognitive function by interplay with AMPA receptor GluA1 subunit.
Witt, M R; Westh-Hansen, S E; Rasmussen, P B; Hastrup, S; Nielsen, M
1996-11-01
It has been shown previously that unsaturated free fatty acids (FFAs) strongly enhance the binding of agonist benzodiazepine receptor ligands and GABAA receptor ligands in the CNS in vitro. To investigate the selectivity of this effect, recombinant human GABAA/benzodiazepine receptor complexes formed by different subunit compositions (alpha x beta y gamma 2, x = 1, 2, 3, and 5; y = 1, 2, and 3) were expressed using the baculovirus-transfected Sf9 insect cell system. At 10(-4) M, unsaturated FFAs, particularly arachidonic (20:4) and docosahexaenoic (22:6) acids, strongly stimulated (> 200% of control values) the binding of [3H]flunitrazepam ([3H]FNM) to the alpha 3 beta 2 gamma 2 receptor combination in whole cell preparations. No effect or small increases in levels of unsaturated FFAs on [3H]FNM binding to alpha 1 beta x gamma 2 and alpha 2 beta x gamma 2 receptor combinations were observed, and weak effects (130% of control values) were detected using the alpha 5 beta 2 gamma 2 receptor combination. The saturated FFAs, stearic and palmitic acids, were without effect on [3H]FNM binding to any combination of receptor complexes. The hydroxylated unsaturated FFAs, ricinoleic and ricinelaidic acids, were shown to decrease the binding of [3H]FNM only if an alpha 1 beta 2 gamma 2 receptor combination was used. Given the heterogeneity of the GABAA/ benzodiazepine receptor subunit distribution in the CNS, the effects of FFAs on the benzodiazepine receptor can be assumed to vary at both cellular and regional levels.
Activity-dependent control of NMDA receptor subunit composition at hippocampal mossy fibre synapses.
Carta, Mario; Srikumar, Bettadapura N; Gorlewicz, Adam; Rebola, Nelson; Mulle, Christophe
2018-02-15
CA3 pyramidal cells display input-specific differences in the subunit composition of synaptic NMDA receptors (NMDARs). Although at low density, GluN2B contributes significantly to NMDAR-mediated EPSCs at mossy fibre synapses. Long-term potentiation (LTP) of NMDARs triggers a modification in the subunit composition of synaptic NMDARs by insertion of GluN2B. GluN2B subunits are essential for the expression of LTP of NMDARs at mossy fibre synapses. Single neurons express NMDA receptors (NMDARs) with distinct subunit composition and biophysical properties that can be segregated in an input-specific manner. The dynamic control of the heterogeneous distribution of synaptic NMDARs is crucial to control input-dependent synaptic integration and plasticity. In hippocampal CA3 pyramidal cells from mice of both sexes, we found that mossy fibre (MF) synapses display a markedly lower proportion of GluN2B-containing NMDARs than associative/commissural synapses. The mechanism involved in such heterogeneous distribution of GluN2B subunits is not known. Here we show that long-term potentiation (LTP) of NMDARs, which is selectively expressed at MF-CA3 pyramidal cell synapses, triggers a modification in the subunit composition of synaptic NMDARs by insertion of GluN2B. This activity-dependent recruitment of GluN2B at mature MF-CA3 pyramidal cell synapses contrasts with the removal of GluN2B subunits at other glutamatergic synapses during development and in response to activity. Furthermore, although expressed at low levels, GluN2B is necessary for the expression of LTP of NMDARs at MF-CA3 pyramidal cell synapses. Altogether, we reveal a previously unknown activity-dependent regulation and function of GluN2B subunits that may contribute to the heterogeneous plasticity induction rules in CA3 pyramidal cells. © 2017 Centre Nationnal de la Recherche Scientifique. The Journal of Physiology © 2017 The Physiological Society.
Expression of ionotropic glutamate receptors, AMPA, kainite and NMDA, in the pigeon retina.
Atoji, Yasuro
2015-07-01
Glutamate is an excitatory neurotransmitter in the vertebrate retina. A previous study found vesicular glutamate transporter 2 (vGluT2) mRNA in the pigeon retina, suggesting that bipolar and ganglion cells are glutamatergic. The present study examined the localization of ionotropic glutamate receptors to identify receptor cells in the pigeon retina using in situ hybridization histochemistry. Nine subunits of AMPA receptor (GluA1, GluA2, GluA3, and GluA4), kainate receptor (GluK1, GluK2, and GluK4), and NMDA receptor (GluN1 and GluN2A) were found to be expressed in the inner nuclear layer (INL) and ganglion cell layers. GluA1, GluA2, GluA3, and GluA4 were primarily expressed in the inner half of INL, and the signal intensity was strong for GluA2, GluA3, and GluA4. GluK1 was intensely expressed in the outer half of INL, whereas GluK2 and GluK4 were mainly localized in the inner half of INL. GluN1 and GluN2A were moderately expressed in the inner half of INL. Horizontal cells expressed GluA3 and GluA4, and ganglion cells expressed all subunits examined. These results suggest that the glutamatergic neurotransmission in the pigeon retina is similar to that in mammals. Copyright © 2015 Elsevier Ltd. All rights reserved.
Studer, Remo; von Boehmer, Lotta; Haenggi, Tatjana; Schweizer, Claude; Benke, Dietmar; Rudolph, Uwe; Fritschy, Jean-Marc
2006-09-01
Multiple GABAA-receptor subtypes are assembled from alpha, beta and gamma subunit variants. GABAA receptors containing the alpha3 subunit represent a minor population with a restricted distribution in the CNS. In addition, they predominate in monoaminergic neurons and in the nucleus reticularis thalami (nRT), suggesting a role in the regulation of cortical function and sleep. Mice with a targeted deletion of the alpha3 subunit gene (alpha3(0/0)) are viable and exhibit a subtle behavioural phenotype possibly related to dopaminergic hyperfunction. Here, we investigated immunohistochemically the consequences of the loss of alpha3 subunit for maturation of GABAA receptors and formation of GABAergic synapses in the nRT. Throughout postnatal development, the regional distribution of the alpha1, alpha2, or alpha5 subunit was unaltered in alpha3(0/0) mice and the prominent alpha3 subunit staining of nRT neurons in wildtype mice was not replaced. Subcellularly, as seen by double immunofluorescence, the alpha3 and gamma2 subunit were clustered at postsynaptic sites in the nRT of adult wildtype mice along with the scaffolding protein gephyrin. In alpha3(0/0) mice, gamma2 subunit clustering was disrupted and gephyrin formed large aggregates localized at the cell surface, but unrelated to postsynaptic sites, indicating that nRT neurons lack postsynaptic GABAA receptors in mutant mice. Furthermore, GABAergic terminals were enlarged and reduced in number, suggesting a partial deficit of GABAergic synapses. Therefore, GABAA receptors are required for gephyrin clustering and long-term synapse maintenance. The absence of GABAA-mediated transmission in the nRT may have a significant impact on the function of the thalamo-cortical loop of alpha3(0/0) mice.
ERIC Educational Resources Information Center
Babiec, Walter E.; Guglietta, Ryan; O'Dell, Thomas J.
2016-01-01
Dephosphorylation of AMPA receptor (AMPAR) GluA1 subunits at two sites, serine 845 (S845) and threonine 840 (T840), is thought to be involved in NMDA receptor-dependent forms of long-term depression (LTD). Importantly, the notion that dephosphorylation of these sites contributes to LTD assumes that a significant fraction of GluA1 subunits are…
Sadat-Shirazi, Mitra-Sadat; Vousooghi, Nasim; Alizadeh, Bentolhoda; Makki, Seyed Mohammad; Zarei, Seyed Zeinolabedin; Nazari, Shahrzad; Zarrindast, Mohammad Reza
2018-05-23
Background and aims Repeated performance of some behaviors such as playing computer games could result in addiction. The NMDA receptor is critically involved in the development of behavioral and drug addictions. It has been claimed that the expression level of neurotransmitter receptors in the brain may be reflected in peripheral blood lymphocytes (PBLs). Methods Here, using a real-time PCR method, we have investigated the mRNA expression of GluN2A, GluN2D, GluN3A, and GluN3B subunits of the NMDA receptor in PBLs of male online computer game addicts (n = 25) in comparison with normal subjects (n = 26). Results Expression levels of GluN2A, GluN2D, and GluN3B subunits were not statistically different between game addicts and the control group. However, the mRNA expression of the GluN3A subunit was downregulated in PBLs of game addicts. Discussion and conclusions Transcriptional levels of GluN2A and GluN2D subunits in online computer game addicts are similar to our previously reported data of opioid addiction and are not different from the control group. However, unlike our earlier finding of drug addiction, the mRNA expression levels of GluN3A and GluN3B subunits in PBLs of game addicts are reduced and unchanged, respectively, compared with control subjects. It seems that the downregulated state of the GluN3A subunit of NMDA receptor in online computer game addicts is a finding that deserves more studies in the future to see whether it can serve as a peripheral biomarker in addiction studies, where the researcher wants to rule out the confusing effects of abused drugs.
Distinct Contributions of T1R2 and T1R3 Taste Receptor Subunits to the Detection of Sweet Stimuli
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nie,Y.; Vigues, S.; Hobbs, J.
2005-01-01
The molecular mechanisms by which G protein-coupled receptor (GPCR)-type chemosensory receptors of animals selectively interact with their cognate ligands remain poorly understood. There is growing evidence that many chemosensory receptors exist in multimeric complexes, though little is known about the relative contributions of individual subunits to receptor functions. This study showed that each of the two subunits in the mammalian heteromeric T1R2:T1R3 sweet taste receptor binds sweet stimuli, though with distinct affinities and conformational changes. Furthermore, ligand affinities for T1R3 are drastically reduced by the introduction of a single amino acid change associated with decreased sweet taste sensitivity in mice.more » Thus, individual T1R subunits increase the receptive range of the sweet taste receptor, offering a functional mechanism for phenotypic variations in sweet taste.« less
Gurd, J W; Bissoon, N
1997-08-01
The NMDA receptor has recently been found to be phosphorylated on tyrosine. To assess the possible connection between tyrosine phosphorylation of the NMDA receptor and signaling pathways in the postsynaptic cell, we have investigated the relationship between tyrosine phosphorylation and the binding of NMDA receptor subunits to the SH2 domains of phospholipase C-gamma (PLC-gamma). A glutathione S-transferase (GST) fusion protein containing both the N- and the C-proximal SH2 domains of PLC-gamma was bound to glutathione-agarose and reacted with synaptic junctional proteins and glycoproteins. Tyrosine-phosphorylated PSD-GP180, which has been identified as the NR2B subunit of the NMDA receptor, bound to the SH2-agarose beads in a phosphorylation-dependent fashion. Immunoblot analysis with antibodies specific for individual NMDA receptor subunits showed that both NR2A and NR2B subunits bound to the SH2-agarose. No binding occurred to GST-agarose lacking an associated SH2 domain, indicating that binding was specific for the SH2 domains. The binding of receptor subunits increased after the incubation of synaptic junctions with ATP and decreased after treatment of synaptic junctions with exogenous protein tyrosine phosphatase. Immunoprecipitation experiments confirmed that NR2A and NR2B were phosphorylated on tyrosine and further that tyrosine phosphorylation of each of the subunits was increased after incubation with ATP. The results demonstrate that NMDA receptor subunits NR2A and NR2B will bind to the SH2 domains of PLC-gamma and that isolated synaptic junctions contain endogenous protein tyrosine kinase(s) that can phosphorylate both NR2A and NR2B receptor subunits, and suggest that interaction of the tyrosine-phosphorylated NMDA receptor with proteins that contain SH2 domains may serve to link it to signaling pathways in the postsynaptic cell.
Emerging structural insights into the function of ionotropic glutamate receptors
Karakas, Erkan; Regan, Michael C.; Furukawa, Hiro
2015-01-01
Summary Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that mediate excitatory neurotransmission crucial for brain development and function including learning and memory formation. Recently a wealth of structural studies on iGluRs, including AMPA receptors (AMPARs), kainate receptors, and NMDA receptors (NMDARs) became available.. These studies showed structures of non-NMDARs including AMPAR and kainate receptor in various functional states, thereby providing the first visual sense of how non-NMDAR iGluRs may function in the context of homotetramers. Furthermore, they provided the first view of heterotetrameric NMDAR ion channels, which illuminated the similarities with and differences from non-NMDARs, thus raising a mechanistic distinction between the two groups of iGluRs. Here we review mechanistic insights into iGluR functions gained through structural studies of multiple groups. PMID:25941168
Emerging structural insights into the function of ionotropic glutamate receptors.
Karakas, Erkan; Regan, Michael C; Furukawa, Hiro
2015-06-01
Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that mediate excitatory neurotransmission crucial for brain development and function, including learning and memory formation. Recently a wealth of structural studies on iGluRs including AMPA receptors (AMPARs), kainate receptors, and NMDA receptors (NMDARs) became available. These studies showed structures of non-NMDARs including AMPAR and kainate receptor in various functional states, thereby providing the first visual sense of how non-NMDAR iGluRs may function in the context of homotetramers. Furthermore, they provided the first view of heterotetrameric NMDAR ion channels, and this illuminated the similarities with and differences from non-NMDARs, thus raising a mechanistic distinction between the two groups of iGluRs. We review mechanistic insights into iGluR functions gained through structural studies of multiple groups. Copyright © 2015 Elsevier Ltd. All rights reserved.
Nguyen, Quoc-Thang; Matute, Carlos; Miledi, Ricardo
1998-01-01
It has been postulated that, in the adult visual cortex, visual inputs modulate levels of mRNAs coding for neurotransmitter receptors in an activity-dependent manner. To investigate this possibility, we performed a monocular enucleation in adult rabbits and, 15 days later, collected their left and right visual cortices. Levels of mRNAs coding for voltage-activated sodium channels, and for receptors for kainate/α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA), N-methyl-d-aspartate (NMDA), γ-aminobutyric acid (GABA), and glycine were semiquantitatively estimated in the visual cortices ipsilateral and contralateral to the lesion by the Xenopus oocyte/voltage-clamp expression system. This technique also allowed us to study some of the pharmacological and physiological properties of the channels and receptors expressed in the oocytes. In cells injected with mRNA from left or right cortices of monocularly enucleated and control animals, the amplitudes of currents elicited by kainate or AMPA, which reflect the abundance of mRNAs coding for kainate and AMPA receptors, were similar. There was no difference in the sensitivity to kainate and in the voltage dependence of the kainate response. Responses mediated by NMDA, GABA, and glycine were unaffected by monocular enucleation. Sodium channel peak currents, activation, steady-state inactivation, and sensitivity to tetrodotoxin also remained unchanged after the enucleation. Our data show that mRNAs for major neurotransmitter receptors and ion channels in the adult rabbit visual cortex are not obviously modified by monocular deafferentiation. Thus, our results do not support the idea of a widespread dynamic modulation of mRNAs coding for receptors and ion channels by visual activity in the rabbit visual system. PMID:9501250
Novel Functional Properties of Drosophila CNS Glutamate Receptors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Yan; Dharkar, Poorva; Han, Tae-Hee
Phylogenetic analysis reveals AMPA, kainate, and NMDA receptor families in insect genomes, suggesting conserved functional properties corresponding to their vertebrate counterparts. However, heterologous expression of the Drosophila kainate receptor DKaiR1D and the AMPA receptor DGluR1A revealed novel ligand selectivity at odds with the classification used for vertebrate glutamate receptor ion channels (iGluRs). DKaiR1D forms a rapidly activating and desensitizing receptor that is inhibited by both NMDA and the NMDA receptor antagonist AP5; crystallization of the KaiR1D ligand-binding domain reveals that these ligands stabilize open cleft conformations, explaining their action as antagonists. Surprisingly, the AMPA receptor DGluR1A shows weak activation bymore » its namesake agonist AMPA and also by quisqualate. Crystallization of the DGluR1A ligand-binding domain reveals amino acid exchanges that interfere with binding of these ligands. The unexpected ligand-binding profiles of insect iGluRs allows classical tools to be used in novel approaches for the study of synaptic regulation.« less
Novel Functional Properties of Drosophila CNS Glutamate Receptors.
Li, Yan; Dharkar, Poorva; Han, Tae-Hee; Serpe, Mihaela; Lee, Chi-Hon; Mayer, Mark L
2016-12-07
Phylogenetic analysis reveals AMPA, kainate, and NMDA receptor families in insect genomes, suggesting conserved functional properties corresponding to their vertebrate counterparts. However, heterologous expression of the Drosophila kainate receptor DKaiR1D and the AMPA receptor DGluR1A revealed novel ligand selectivity at odds with the classification used for vertebrate glutamate receptor ion channels (iGluRs). DKaiR1D forms a rapidly activating and desensitizing receptor that is inhibited by both NMDA and the NMDA receptor antagonist AP5; crystallization of the KaiR1D ligand-binding domain reveals that these ligands stabilize open cleft conformations, explaining their action as antagonists. Surprisingly, the AMPA receptor DGluR1A shows weak activation by its namesake agonist AMPA and also by quisqualate. Crystallization of the DGluR1A ligand-binding domain reveals amino acid exchanges that interfere with binding of these ligands. The unexpected ligand-binding profiles of insect iGluRs allows classical tools to be used in novel approaches for the study of synaptic regulation. VIDEO ABSTRACT. Published by Elsevier Inc.
Tong, Gary; Takahashi, Hiroto; Tu, Shichun; Shin, Yeonsook; Talantova, Maria; Zago, Wagner; Xia, Peng; Nie, Zhiguo; Goetz, Thomas; Zhang, Dongxian; Lipton, Stuart A.; Nakanishi, Nobuki
2015-01-01
Expression of the NR3A subunit with NR1/NR2 in Xenopus oocytes or mammalian cell lines leads to a reduction in N-methyl-D-aspartate (NMDA)-induced currents and decreased Mg2+ sensitivity and Ca2+ permeability compared with NR1/NR2 receptors. Consistent with these findings, neurons from NR3A knockout (KO) mice exhibit enhanced NMDA-induced currents. Recombinant NR3A can also form excitatory glycine receptors with NR1 in the absence of NR2. However, the effects of NR3A on channel properties in neurons and synaptic transmission have not been fully elucidated. To study physiological roles of NR3A subunits, we generated NR3A transgenic (Tg) mice. Cultured NR3A Tg neurons exhibited two populations of NMDA receptor (NMDAR) channels, reduced Mg2+ sensitivity, and decreased Ca2+ permeability in response to NMDA/glycine, but glycine alone did not elicit excitatory currents. In addition, NMDAR-mediated excitatory postsynaptic currents (EPSCs) in NR3A Tg hippocampal slices showed reduced Mg2+ sensitivity, consistent with the notion that NR3A subunits incorporated into synaptic NMDARs. To study the function of endogenous NR3A subunits, we compared NMDAR-mediated EPSCs in NR3A KO and WT control mice. In NR3A KO mice, the ratio of the amplitudes of the NMDAR-mediated component to α-amino-3-hydroxy-5-methyl-4-isox-azolepropionic acid receptor-mediated component of the EPSC was significantly larger than that seen in WT littermates. This result suggests that NR3A subunits contributed to the NMDAR-mediated component of the EPSC in WT mice. Taken together, these results show that NR3A subunits contribute to NMDAR responses from both synaptic and extra-synaptic receptors, likely composed of NR1, NR2, and NR3 subunits. PMID:18003876
Differential regulation of the androgen receptor by protein phosphatase regulatory subunits
Grey, James; Jones, Dominic; Wilson, Laura; Nakjang, Sirintra; Clayton, Jake; Temperley, Richard; Clark, Emma; Gaughan, Luke; Robson, Craig
2018-01-01
The Androgen Receptor (AR) is a key molecule in the development, maintenance and progression of prostate cancer (PC). However, the relationship between the AR and co-regulatory proteins that facilitate AR activity in castrate resistant settings remain understudied. Here we show that protein phosphatase 1 regulatory subunits, identified from a phosphatase RNAi screen, direct PP1 catalytic subunits to a varied yet significant response in AR function. As such, we have characterised the PP1β holoenzyme, myosin phosphatase (MLCP), as a novel ligand independent regulator of the AR. Sustained MLCP activity through down-regulation of the MLCP inhibitory subunit, PPP1R14C, results in impaired AR nuclear translocation, protein stability and transcriptional activity in distinct models of PC progression, culminating in restoration of a non-malignant prostate genotype. Phenotypically, a marked reduction in cell proliferation and migration, characterised by G1 cell cycle arrest is observed, confirming PP1 holoenzyme disruption as a novel treatment approach in PC. PMID:29423094
Screening for AMPA receptor auxiliary subunit specific modulators
Azumaya, Caleigh M.; Days, Emily L.; Vinson, Paige N.; Stauffer, Shaun; Sulikowski, Gary; Weaver, C. David; Nakagawa, Terunaga
2017-01-01
AMPA receptors (AMPAR) are ligand gated ion channels critical for synaptic transmission and plasticity. Their dysfunction is implicated in a variety of psychiatric and neurological diseases ranging from major depressive disorder to amyotrophic lateral sclerosis. Attempting to potentiate or depress AMPAR activity is an inherently difficult balancing act between effective treatments and debilitating side effects. A newly explored strategy to target subsets of AMPARs in the central nervous system is to identify compounds that affect specific AMPAR-auxiliary subunit complexes. This exploits diverse spatio-temporal expression patterns of known AMPAR auxiliary subunits, providing means for designing brain region-selective compounds. Here we report a high-throughput screening-based pipeline that can identify compounds that are selective for GluA2-CNIH3 and GluA2-stargazin complexes. These compounds will help us build upon the growing library of AMPAR-auxiliary subunit specific inhibitors, which have thus far all been targeted to TARP γ-8. We used a cell-based assay combined with a voltage-sensitive dye (VSD) to identify changes in glutamate-gated cation flow across the membranes of HEK cells co-expressing GluA2 and an auxiliary subunit. We then used a calcium flux assay to further validate hits picked from the VSD assay. VU0612951 and VU0627849 are candidate compounds from the initial screen that were identified as negative and positive allosteric modulators (NAM and PAM), respectively. They both have lower IC50/EC50s on complexes containing stargazin and CNIH3 than GSG1L or the AMPAR alone. We have also identified a candidate compound, VU0539491, that has NAM activity in GluA2(R)-CNIH3 and GluA2(Q) complexes and PAM activity in GluA2(Q)-GSG1L complexes. PMID:28358902
Shen, Y; Lu, T; Yang, X L
1999-03-01
In horizontal cells freshly dissociated from crucian carp (Carassius auratus) retina, we examined the effects of modulators of glutamate receptor desensitization, concanavalin A, cyclothiazide, aniracetam and 4-[2-(phenylsulfonylamino)ethylthio]-2,6-difluoro-phenoxyacetam ide (PEPA), on responses to rapid application of glutamate and kainate, using whole-cell voltage-clamp techniques. Incubation of concanavalin A suppressed the peak response but weakly potentiated the equilibrium response of horizontal cells to glutamate. Cyclothiazide blocked glutamate-induced desensitization in a dose-dependent manner, which resulted in a steady increase of the equilibrium current. The concentration of cyclothiazide causing a half-maximal potentiation for the equilibrium response was 85 microM. Furthermore, cyclothiazide shifted the dose-response relationship of the equilibrium current to the right, but slightly suppressed the kainate-induced sustained current. These effects of concanavalin A and cyclothiazide are consistent with the supposition that glutamate receptors of carp horizontal cells may be an alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate (AMPA)-preferring subtype. In order to further characterize the AMPA receptors of horizontal cells, modulation by aniracetam and PEPA of glutamate- and kainate-induced currents was studied. Aniracetam, a preferential modulator of flop variants of AMPA receptors, considerably blocked desensitization of glutamate-induced currents, but only slightly potentiated kainate-induced currents. It was further found that PEPA, a flop-preferring allosteric modulator of AMPA receptor desensitization, slightly suppressed the peak current, while it dramatically potentiated the equilibrium current induced by glutamate in a dose-dependent manner. PEPA was much potent than aniracetam at these receptors and showed the effect on glutamate-induced desensitization even at a concentration as low as 3 microM. PEPA also potentiated non
Xie, Meilan; Yan, Jie; He, Chao; Yang, Li; Tan, Gang; Li, Chao; Hu, Zhian; Wang, Jiali
2015-06-01
Hippocampus-dependent learning memory is sensitive to sleep deprivation (SD). Although the ionotropic glutamate receptors play a vital role in synaptic plasticity and learning and memory, however, whether the expression of these receptor subunits is modulated by sleep loss remains unclear. In the present study, western blotting was performed by probing with specific antibodies against the ionotropic α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunits GluA1, GluA2, GluA3, and against the N-methyl-d-aspartate (NMDA) glutamate receptor subunits GluN1, GluN2A, GluN2B. In hippocampus, down regulation of surface GluA1 and GluN2A surface expression were observed in both SD groups. However, surface expression level of GluA2, GluA3, GluN1 and GluN2B was significantly up-regulated in 8h-SD rats when compared to the 4h-SD rats. In parallel with the complex changes in AMPA and NMDA receptor subunit expressions, we found the 8h-SD impaired rat spatial working memory in 30-s-delay T-maze task, whereas no impairment of spatial learning was observed in 4h-SD rats. These results indicate that sleep loss alters the relative expression levels of the AMPA and NMDA receptors, thus affects the synaptic strength and capacity for plasticity and partially contributes to spatial memory impairment. Copyright © 2015. Published by Elsevier B.V.
The AMPA receptor subunit GluR1 regulates dendritic architecture of motor neurons
NASA Technical Reports Server (NTRS)
Inglis, Fiona M.; Crockett, Richard; Korada, Sailaja; Abraham, Wickliffe C.; Hollmann, Michael; Kalb, Robert G.
2002-01-01
The morphology of the mature motor neuron dendritic arbor is determined by activity-dependent processes occurring during a critical period in early postnatal life. The abundance of the AMPA receptor subunit GluR1 in motor neurons is very high during this period and subsequently falls to a negligible level. To test the role of GluR1 in dendrite morphogenesis, we reintroduced GluR1 into rat motor neurons at the end of the critical period and quantitatively studied the effects on dendrite architecture. Two versions of GluR1 were studied that differed by the amino acid in the "Q/R" editing site. The amino acid occupying this site determines single-channel conductance, ionic permeability, and other essential electrophysiologic properties of the resulting receptor channels. We found large-scale remodeling of dendritic architectures in a manner depending on the amino acid occupying the Q/R editing site. Alterations in the distribution of dendritic arbor were not prevented by blocking NMDA receptors. These observations suggest that the expression of GluR1 in motor neurons modulates a component of the molecular substrate of activity-dependent dendrite morphogenesis. The control of these events relies on subunit-specific properties of AMPA receptors.
Zhang, Yixi; Liu, Yang; Bao, Haibo; Sun, Huahua; Liu, Zewen
2017-01-18
Due to the great abundance within insect central nervous system (CNS), nicotinic acetylcholine receptors (nAChRs) play key roles in insect CNS, which makes it to be the targets of several classes of insecticides, such as neonicotinoids. Insect nAChRs are pentameric complexes consisting of five subunits, and a dozen subunits in one insect species can theoretically comprise diverse nAChRs. The alternative splicing in insect nAChR subunits may increase the diversity of insect nAChRs. In the oriental migratory locust (Locusta migratoria manilensis Meyen), a model insect species with agricultural importance, the alternative splicing was found in six α subunits among nine α and two β subunits, such as missing conserved residues in Loop D from Locα1, Locα6 and Locα9, a 34-residue insertion in Locα8 cytoplasmic loop, and truncated transcripts for Locα4, Locα7 and Locα9. Hybrid nAChRs were successfully constructed in Xenopus oocytes through co-expression with rat β2 and one α subunit from L. migratoria, which included Locα1, Locα2, Locα3, Locα4, Locα5, Locα8 and Locα9. Influences of alternative splicing in Locα1, Locα8 and Locα9 on acetylcholine potency were tested on hybrid nAChRs. The alternative splicing in Locα1 and Locα9 could increase acetylcholine sensitivities on recombinant receptors, while the splicing in Locα8 showed significant influences on the current amplitudes of oocytes. The results revealed that the alternative splicing at or close to the ligand-binding sites, as well as at cytoplasmic regions away from the ligand-binding sites, in insect nAChR subunits would change the agonist potencies on the receptors, which consequently increased nAChR diversity in functional and pharmacological properties. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Glutamate receptor activation in the kindled dentate gyrus.
Behr, J; Heinemann, U; Mody, I
2000-01-01
The contribution of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA), N-methyl-D-aspartate (NMDA), and kainate receptor activation to the enhanced seizure susceptibility of the dentate gyrus was investigated in an experimental model of temporal lobe epilepsy. Using the specific NMDA and AMPA receptor antagonists D-APV and SYM 2206, we examined alterations in glutamate receptor-dependent synaptic currents 48 hours and 28 days after kindling in field-potential and voltage-clamp recordings. Forty-eight hours after kindling, the fractions of AMPA and NMDA receptor-mediated excitatory postsynaptic current components shifted dramatically in favor of the NMDA receptor-mediated response. Four weeks after kindling, however, AMPA and NMDA receptor-mediated excitatory postsynaptic currents reverted to control-like values. Neither single nor repetitive perforant path stimuli evoked kainate receptor-mediated excitatory postsynaptic currents in dentate gyrus granule cells of control or kindled rats. The enhanced excitability of the kindled dentate gyrus 48 hours after the last seizure most likely results from transiently enhanced NMDA receptor activation. The NMDA receptor seems to play a critical role in the induction of the kindled state rather than in the persistence of the enhanced seizure susceptibility.
Crystal Structures of the Glutamate Receptor Ion Channel GluK3 and GluK5 Amino-Terminal Domains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumar, Janesh; Mayer, Mark L.
2010-11-30
Ionotropic glutamate receptors (iGluRs) mediate the majority of fast excitatory synaptic neurotransmission in the central nervous system. The selective assembly of iGluRs into AMPA, kainate, and N-methyl-d-aspartic acid (NMDA) receptor subtypes is regulated by their extracellular amino-terminal domains (ATDs). Kainate receptors are further classified into low-affinity receptor families (GluK1-GluK3) and high-affinity receptor families (GluK4-GluK5) based on their affinity for the neurotoxin kainic acid. These two families share a 42% sequence identity for the intact receptor but only a 27% sequence identity at the level of ATD. We have determined for the first time the high-resolution crystal structures of GluK3 andmore » GluK5 ATDs, both of which crystallize as dimers but with a strikingly different dimer assembly at the R1 interface. By contrast, for both GluK3 and GluK5, the R2 domain dimer assembly is similar to those reported previously for other non-NMDA iGluRs. This observation is consistent with the reports that GluK4-GluK5 cannot form functional homomeric ion channels and require obligate coassembly with GluK1-GluK3. Our analysis also reveals that the relative orientation of domains R1 and R2 in individual non-NMDA receptor ATDs varies by up to 10{sup o}, in contrast to the 50{sup o} difference reported for the NMDA receptor GluN2B subunit. This restricted domain movement in non-NMDA receptor ATDs seems to result both from extensive intramolecular contacts between domain R1 and domain R2 and from their assembly as dimers, which interact at both R1 and R2 domains. Our results provide the first insights into the structure and function of GluK4-GluK5, the least understood family of iGluRs.« less
Caldwell, George B.; Howe, Alan K.; Nickl, Christian K.; Dostmann, Wolfgang R.; Ballif, Bryan A.; Deming, Paula B.
2011-01-01
The cyclic-AMP-dependent protein kinase A (PKA) regulates processes such as cell proliferation and migration following activation of growth factor receptor tyrosine kinases (RTKs), yet the signaling mechanisms that link PKA with growth factor receptors remain largely undefined. Here we report that RTKs can directly modulate the function of the catalytic subunit of PKA (PKA-C) through post-translational modification. In vitro kinase assays revealed that both the epidermal growth factor and platelet derived growth factor receptors (EGFR and PDGFR, respectively) tyrosine phosphorylate PKA-C. Mass spectrometry identified tyrosine 330 (Y330) as a receptor-mediated phosphorylation site and mutation of Y330 to phenylalanine (Y330F) all but abolished the RTK-mediated phosphorylation of PKA-C in vitro. Y330 resides within a conserved region at the C-terminal tail of PKA-C that allosterically regulates enzymatic activity. Therefore, the effect of phosphorylation at Y330 on the activity of PKA-C was investigated. The Km for a peptide substrate was markedly decreased when PKA-C subunits were tyrosine phosphorylated by the receptors as compared to un-phosphorylated controls. Importantly, tyrosine-phosphorylated PKA-C subunits were detected in cells stimulated with EGF, PDGF and FGF2 and in fibroblasts undergoing PDGF-mediated chemotaxis. These results demonstrate a direct, functional interaction between RTKs and PKA-C and identify tyrosine phosphorylation as a novel mechansim for regulating PKA activity. PMID:21866565
Jones, Brian L; Whiting, Paul J; Henderson, Leslie P
2006-01-01
GABAergic transmission regulates the activity of gonadotrophin-releasing hormone (GnRH) neurons in the preoptic area/hypothalamus that control the onset of puberty and the expression of reproductive behaviours. One of the hallmarks of illicit use of anabolic androgenic steroids (AAS) is disruption of behaviours under neuroendocrine control. GnRH neurons are among a limited population of cells that express high levels of the ɛ-subunit of the GABAA receptor. To better understand the actions of AAS on neuroendocrine mechanisms, we have characterized modulation of GABAA receptor-mediated currents in mouse native GnRH neurons and in heterologous cells expressing recombinant α2β3ɛ-receptors. GnRH neurons exhibited robust currents in response to millimolar concentrations of GABA and a picrotoxin (PTX)-sensitive, bicuculline-insensitive current that probably arises from spontaneous openings of GABAA receptors. The AAS 17α-methyltestosterone (17α-MeT) inhibited spontaneous and GABA-evoked currents in GnRH neurons. For recombinant α2β3ɛ-receptors, 17α-MeT inhibited phasic and tonic GABA-elicited responses, accelerated desensitization and slowed paired pulse response recovery. Single channel analysis indicated that GABA-evoked events could be described by three open dwell components and that 17α-MeT enhanced residence in the intermediate dwell state. This AAS also inhibited a PTX-sensitive, spontaneous current (open probability, ∼0.15–0.2) in a concentration-dependent fashion (IC50 ≈ 9 μm). Kinetic modelling indicated that the inhibition induced by 17α-MeT occurs by an allosteric block in which the AAS interacts preferentially with a closed state and promotes accumulation in that state. Finally, studies with a G302S mutant ɛ-subunit suggest that this residue within the transmembrane domain TM2 plays a role in mediating AAS binding and modulation. In sum, our results indicate that inclusion of the ɛ-subunit significantly alters the profile of AAS
Oren, Iris; Nissen, Wiebke; Kullmann, Dimitri M.; Somogyi, Peter; Lamsa, Karri P.
2009-01-01
Some interneurons of the hippocampus exhibit NMDA receptor-independent long-term potentiation (LTP) that is induced by presynaptic glutamate release when the postsynaptic membrane potential is hyperpolarized. This ‘anti-Hebbian’ form of LTP is prevented by postsynaptic depolarization or by blocking AMPA and kainate receptors. Although both AMPA and kainate receptors are expressed in hippocampal interneurons, their relative roles in anti-Hebbian LTP are not known. Because interneuron diversity potentially conceals simple rules underlying different forms of plasticity, we focus on glutamatergic synapses onto a subset of interneurons with dendrites in stratum oriens and a main ascending axon that projects to stratum lacunosum-moleculare, the O-LM cells. We show that anti-Hebbian LTP in O-LM interneurons has consistent induction and expression properties, and is prevented by selective inhibition of AMPA receptors. The majority of the ionotropic glutamatergic synaptic current in these cells is mediated by inwardly rectifying Ca2+ -permeable AMPA receptors. Although GluR5-containing kainate receptors contribute to synaptic currents at high stimulus frequency, they are not required for LTP induction. Glutamatergic synapses on O-LM cells thus behave in a homogeneous manner, and exhibit LTP dependent on Ca2+-permeable AMPA receptors. PMID:19176803
Memory in aged mice is rescued by enhanced expression of the GluN2B subunit of the NMDA receptor
Brim, B. L.; Haskell, R.; Awedikian, R.; Ellinwood, N.M.; Jin, L.; Kumar, A.; Foster, T.C.; Magnusson, K.
2012-01-01
The GluN2B subunit of the N-methyl-D-aspartate (NMDA) receptor shows age-related declines in expression across the frontal cortex and hippocampus. This decline is strongly correlated to age-related memory declines. This study was designed to determine if increasing GluN2B subunit expression in the frontal lobe or hippocampus would improve memory in aged mice. Mice were injected bilaterally with either the GluN2B vector, containing cDNA specific for the GluN2B subunit and enhanced Green Fluorescent Protein (eGFP); a control vector or vehicle. Spatial memory, cognitive flexibility, and associative memory were assessed using the Morris water maze. Aged mice, with increased GluN2B subunit expression, exhibited improved long-term spatial memory, comparable to young mice. However, memory was rescued on different days in the Morris water maze; early for hippocampal GluN2B subunit enrichment and later for the frontal lobe. A higher concentration of the GluN2B antagonist, Ro 25-6981, was required to impair long-term spatial memory in aged mice with enhanced GluN2B expression, as compared to aged controls, suggesting there was an increase in the number of GluN2B-containing NMDA receptors. In addition, hippocampal slices from aged mice with increased GluN2B subunit expression exhibited enhanced NMDA receptor-mediated excitatory post-synaptic potentials (EPSP). Treatment with Ro 25-6981 showed that a greater proportion of the NMDA receptor-mediated EPSP was due to the GluN2B subunit in these animals, as compared to aged controls. These results suggest that increasing the production of the GluN2B subunit in aged animals enhances memory and synaptic transmission. Therapies that enhance GluN2B subunit expression within the aged brain may be useful for ameliorating age-related memory declines. PMID:23103326
Wang, Henglin; Wang, Zhuoqiang; Mi, Weidong; Zhao, Cong; Liu, Yanqin; Wang, Yongan; Sun, Haipeng
2012-01-01
Status epilepticus was induced via intraperitoneal injection of lithium-pilocarpine. The inhibitory effects of propofol on status epilepticus in rats were judged based on observation of behavior, electroencephalography and 24-hour survival rate. Propofol (12.5–100 mg/kg) improved status epilepticus in a dose-dependent manner, and significantly reduced the number of deaths within 24 hours of lithium-pilocarpine injection. Western blot results showed that, 24 hours after induction of status epilepticus, the levels of N-methyl-D-aspartate receptor 2A and 2B subunits were significantly increased in rat cerebral cortex and hippocampus. Propofol at 50 mg/kg significantly suppressed the increase in N-methyl-D-aspartate receptor 2B subunit levels, but not the increase in N-methyl-D-aspartate receptor 2A subunit levels. The results suggest that propofol can effectively inhibit status epilepticus induced by lithium-pilocarpine. This effect may be associated with downregulation of N-methyl-D-aspartate receptor 2B subunit expression after seizures. PMID:25737709
Ionotropic glutamate receptors activate cell signaling in response to glutamate in Schwann cells.
Campana, Wendy M; Mantuano, Elisabetta; Azmoon, Pardis; Henry, Kenneth; Banki, Michael A; Kim, John H; Pizzo, Donald P; Gonias, Steven L
2017-04-01
In the peripheral nervous system, Schwann cells (SCs) demonstrate surveillance activity, detecting injury and undergoing trans -differentiation to support repair. SC receptors that detect peripheral nervous system injury remain incompletely understood. We used RT-PCR to profile ionotropic glutamate receptor expression in cultured SCs. We identified subunits required for assembly of N -methyl-d-aspartic acid (NMDA) receptors (NMDA-Rs), α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors, and kainate receptors. Treatment of SCs with 40-100 µM glutamate or with 0.5-1.0 µM NMDA robustly activated Akt and ERK1/2. The response was transient and bimodal; glutamate concentrations that exceeded 250 µM failed to activate cell signaling. Phosphoprotein profiling identified diverse phosphorylated proteins in glutamate-treated SCs in addition to ERK1/2 and Akt, including p70 S6-kinase, glycogen synthase kinase-3, ribosomal S6 kinase, c-Jun, and cAMP response element binding protein. Activation of SC signaling by glutamate was blocked by EGTA and dizocilpine and by silencing expression of the NMDA-R NR1 subunit. Phosphoinositide 3-kinase/PI3K functioned as an essential upstream activator of Akt and ERK1/2 in glutamate-treated SCs. When glutamate or NMDA was injected directly into crush-injured rat sciatic nerves, ERK1/2 phosphorylation was observed in myelinated and nonmyelinating SCs. Glutamate promoted SC migration by a pathway that required PI3K and ERK1/2. These results identified ionotropic glutamate receptors and NMDA-Rs, specifically, as potentially important cell signaling receptors in SCs.-Campana, W. M., Mantuano, E., Azmoon, P., Henry, K., Banki, M. A., Kim, J. H., Pizzo, D. P., Gonias, S. L. Ionotropic glutamate receptors activate cell signaling in response to glutamate in Schwann cells. © FASEB.
The role of nicotinic receptor alpha 7 subunits in nicotine discrimination.
Stolerman, I P; Chamberlain, S; Bizarro, L; Fernandes, C; Schalkwyk, L
2004-03-01
The subtypes of nicotinic receptors at which the behavioural effects of nicotine originate are not fully understood. The experiments described here use mice lacking the alpha7 subunit of nicotinic receptors to investigate the role of alpha7-containing receptors in nicotine discrimination. Wild-type and alpha7-knockout mice were trained in a two-lever nicotine discrimination procedure using a tandem schedule of food reinforcement. Mutant mice exhibited baseline rates of lever-pressing as low as 52.2% of rates in wild-type controls (n=21-24). Mutant and wild-type mice acquired discrimination of nicotine (0.4 or 0.8 mg/kg) at a similar rate (n=10-12) and reached similar final levels of accuracy (71.9 +/- 4.4% and 90.8 +/- 3.1% after 60 training sessions for 0.4 and 0.8 mg/kg training doses, respectively, in mutant mice, as compared with 75.0 +/- 6.5% and 87.6 +/- 4.8% for wild types). The genotypes exhibited similar steep dose-response curves for nicotine discrimination. In both genotypes, dose-response curves for mice trained with 0.8 mg/kg of nicotine were displaced three- to four-fold to the right as compared with those for the mice trained with the smaller dose. The predominant effect of nicotine on the overall rate of responding was a reduction at the largest doses tested and there was no difference between the genotypes. The results suggest that nicotinic receptors containing the alpha7 subunit do not contribute to the discriminative stimulus or response-rate-depressant effects of nicotine, although they may regulate baseline rates of operant responding.
The GluN2A Subunit Regulates Neuronal NMDA receptor-Induced Microglia-Neuron Physical Interactions.
Eyo, Ukpong B; Bispo, Ashley; Liu, Junting; Sabu, Sruchika; Wu, Rong; DiBona, Victoria L; Zheng, Jiaying; Murugan, Madhuvika; Zhang, Huaye; Tang, Yamei; Wu, Long-Jun
2018-01-16
Microglia are known to engage in physical interactions with neurons. However, our understanding of the detailed mechanistic regulation of microglia-neuron interactions is incomplete. Here, using high resolution two photon imaging, we investigated the regulation of NMDA receptor-induced microglia-neuron physical interactions. We found that the GluN2A inhibitor NVPAAM007, but not the GluN2B inhibitor ifenprodil, blocked the occurrence of these interactions. Consistent with the well-known developmental regulation of the GluN2A subunit, these interactions are absent in neonatal tissues. Furthermore, consistent with a preferential synaptic localization of GluN2A subunits, there is a differential sensitivity of their occurrence between denser (stratum radiatum) and less dense (stratum pyramidale) synaptic sub-regions of the CA1. Finally, consistent with differentially expressed GluN2A subunits in the CA1 and DG areas of the hippocampus, these interactions could not be elicited in the DG despite robust microglial chemotactic capabilities. Together, these results enhance our understanding of the mechanistic regulation of NMDA receptor-dependent microglia-neuronal physical interactions phenomena by the GluN2A subunit that may be relevant in the mammalian brain during heightened glutamatergic neurotransmission such as epilepsy and ischemic stroke.
Woll, Kellie A; Murlidaran, Sruthi; Pinch, Benika J; Hénin, Jérôme; Wang, Xiaoshi; Salari, Reza; Covarrubias, Manuel; Dailey, William P; Brannigan, Grace; Garcia, Benjamin A; Eckenhoff, Roderic G
2016-09-23
Propofol, an intravenous anesthetic, is a positive modulator of the GABAA receptor, but the mechanistic details, including the relevant binding sites and alternative targets, remain disputed. Here we undertook an in-depth study of alkylphenol-based anesthetic binding to synaptic membranes. We designed, synthesized, and characterized a chemically active alkylphenol anesthetic (2-((prop-2-yn-1-yloxy)methyl)-5-(3-(trifluoromethyl)-3H-diazirin-3-yl)phenol, AziPm-click (1)), for affinity-based protein profiling (ABPP) of propofol-binding proteins in their native state within mouse synaptosomes. The ABPP strategy captured ∼4% of the synaptosomal proteome, including the unbiased capture of five α or β GABAA receptor subunits. Lack of γ2 subunit capture was not due to low abundance. Consistent with this, independent molecular dynamics simulations with alchemical free energy perturbation calculations predicted selective propofol binding to interfacial sites, with higher affinities for α/β than γ-containing interfaces. The simulations indicated hydrogen bonding is a key component leading to propofol-selective binding within GABAA receptor subunit interfaces, with stable hydrogen bonds observed between propofol and α/β cavity residues but not γ cavity residues. We confirmed this by introducing a hydrogen bond-null propofol analogue as a protecting ligand for targeted-ABPP and observed a lack of GABAA receptor subunit protection. This investigation demonstrates striking interfacial GABAA receptor subunit selectivity in the native milieu, suggesting that asymmetric occupancy of heteropentameric ion channels by alkylphenol-based anesthetics is sufficient to induce modulation of activity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Woll, Kellie A.; Murlidaran, Sruthi; Pinch, Benika J.; Hénin, Jérôme; Wang, Xiaoshi; Salari, Reza; Covarrubias, Manuel; Dailey, William P.; Brannigan, Grace; Garcia, Benjamin A.; Eckenhoff, Roderic G.
2016-01-01
Propofol, an intravenous anesthetic, is a positive modulator of the GABAA receptor, but the mechanistic details, including the relevant binding sites and alternative targets, remain disputed. Here we undertook an in-depth study of alkylphenol-based anesthetic binding to synaptic membranes. We designed, synthesized, and characterized a chemically active alkylphenol anesthetic (2-((prop-2-yn-1-yloxy)methyl)-5-(3-(trifluoromethyl)-3H-diazirin-3-yl)phenol, AziPm-click (1)), for affinity-based protein profiling (ABPP) of propofol-binding proteins in their native state within mouse synaptosomes. The ABPP strategy captured ∼4% of the synaptosomal proteome, including the unbiased capture of five α or β GABAA receptor subunits. Lack of γ2 subunit capture was not due to low abundance. Consistent with this, independent molecular dynamics simulations with alchemical free energy perturbation calculations predicted selective propofol binding to interfacial sites, with higher affinities for α/β than γ-containing interfaces. The simulations indicated hydrogen bonding is a key component leading to propofol-selective binding within GABAA receptor subunit interfaces, with stable hydrogen bonds observed between propofol and α/β cavity residues but not γ cavity residues. We confirmed this by introducing a hydrogen bond-null propofol analogue as a protecting ligand for targeted-ABPP and observed a lack of GABAA receptor subunit protection. This investigation demonstrates striking interfacial GABAA receptor subunit selectivity in the native milieu, suggesting that asymmetric occupancy of heteropentameric ion channels by alkylphenol-based anesthetics is sufficient to induce modulation of activity. PMID:27462076
Wu, Guofeng; Yu, Jinpeng; Wang, Likun; Ren, Siying; Zhang, Yixia
2018-02-01
To investigate the potential effects of the PKC/CREB pathway on the expressions of GABA A receptor subunits α1, γ2, and δ in cultured hippocampal neurons using a model of epilepsy that employed conditions of low magnesium (Mg 2+ ). A total of 108 embryonic rats at the age of 18 embryonic days (E18)prepared from adult female SD rats were used as experimental subjects. Primary rat hippocampal cultures were prepared from the embryonic 18 days rats. The cultured hippocampal neurons were then treated with artificial cerebrospinal fluid containing low Mg 2+ solutions to generate a low Mg 2+ model of epilepsy. The low Mg 2+ stimulation lasted for 3 h and then returned to in maintenance medium for 20 h. The changes of the GABA A receptor subunit α1, γ2, δ were observed by blocking or activating the function of the CREB. The quantification of the GABA A receptor subunit α1, γ2, δ and the CREB were determined by a qRT-PCR and a Western blot method. After the neurons were exposed to a low-Mg 2+ solution for 3 h, GABA A receptor mRNA expression markedly increased compared to the control, and then gradually decreased. In contrast, CREB mRNA levels exhibited a dramatic down-regulation 3 h after terminating low-Mg 2+ treatment, and then peaked at 9 h. Western blot analyses verified that staurosporine suppressed CREB phosphorylation (p-CREB). The mRNA expression of GABA A receptor subunit α1 increased only in the presence of staurosporine, whereas the expressions of subunits γ2 and δ significantly increased in the presence of either KG-501 or staurosporine. Furthermore, phorbol 12-myristate 13-acetate (PMA) decreased the expressions of GABA A subunits α1, γ2, and δ when administered alone. However, the administration of either KG-501 or staurosporine reversed the inhibitory effects of PMA. The PKC/CREB pathway may negatively regulate the expressions of GABA A receptor subunits α1, γ2, and δ in cultured hippocampal neurons in low Mg 2+ model of
2015-01-01
NMDA receptors are tetrameric complexes composed of GluN1 and GluN2A–D subunits that mediate a slow Ca2+-permeable component of excitatory synaptic transmission. NMDA receptors have been implicated in a wide range of neurological diseases and thus represent an important therapeutic target. We herein describe a novel series of pyrrolidinones that selectively potentiate only NMDA receptors that contain the GluN2C subunit. The most active analogues tested were over 100-fold selective for recombinant GluN2C-containing receptors over GluN2A/B/D-containing NMDA receptors as well as AMPA and kainate receptors. This series represents the first class of allosteric potentiators that are selective for diheteromeric GluN2C-containing NMDA receptors. PMID:24512267
Identification and cloning of a gamma 3 subunit splice variant of the human GABA(A) receptor.
Poulsen, C F; Christjansen, K N; Hastrup, S; Hartvig, L
2000-05-31
cDNA sequences encoding two forms of the GABA(A) gamma 3 receptor subunit were cloned from human hippocampus. The nucleotide sequences differ by the absence (gamma 3S) or presence (gamma 3L) of 18 bp located in the presumed intracellular loop between transmembrane region (TM) III and IV. The extra 18 bp in the gamma 3L subunit generates a consensus site for phosphorylation by protein kinase C (PKC). Analysis of human genomic DNA encoding the gamma 3 subunit reveals that the 18 bp insert is contiguous with the upstream proximal exon.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harford, N.; De Wilde, M.
1987-05-19
A recombinant DNA molecule is described comprising at least a portion coding for subunits A and B of cholera toxin, or a fragment or derivative of the portion wherein the fragment or derivative codes for a polypeptide have an activity which can induce an immune response to subunit A; can induce an immune response to subunit A and cause epithelial cell penetration and the enzymatic effect leading to net loss of fluid into the gut lumen; can bind to the membrane receptor for the B subunit of cholera toxin; can induce an immune response to subunit B; can induce anmore » immune response to subunit B and bind to the membrane receptor; or has a combination of the activities.« less
Antinociceptive effects of MSVIII-19, a functional antagonist of the GluK1 kainate receptor
Qiu, Chang-Shen; Wyhe, Leanne Lash-Van; Sasaki, Makoto; Sakai, Ryuichi; Swanson, Geoffrey T.; Gereau, Robert W.
2011-01-01
The ionotropic glutamate receptor subunit, GluK1 (GluR5), is expressed in many regions of nervous system related to sensory transmission. Recently, a selective ligand for the GluK1 receptor, MSVIII-19 (8,9-dideoxy-neodysiherbaine), was synthesized as a derivative of dysiherbaine, a toxin isolated from the marine sponge Lendenfeldia chodrodes. MSVIII-19 potently desensitizes GluK1 receptors without channel activation, rendering it useful as a functional antagonist. Given the high selectivity for GluK1 and the proposed role for this glutamate receptor in nociception, we sought to test the analgesic potential of MSVIII-19 in a series of models of inflammatory, neuropathic, and visceral pain in mice. MSVIII-19 delivered intrathecally (i.t.) dose-dependently reduced formalin-induced spontaneous behaviors and reduced thermal hypersensitivity 3 hours after formalin injection and 24 hours after complete freund’s adjuvant-induced inflammation, but had no effect on mechanical sensitivity in the same models. I.T. MSVIII-19 significantly reduced both thermal hyperalgesia and mechanical hypersensitivity in the chronic constriction injury model of neuropathic pain, but had no effect in the acetic acid model of visceral pain. Peripheral administration of MSVIII-19 had no analgesic efficacy in any of these models. Finally, i.t. MSVIII-19 did not alter responses in tail flick tests or performance on the accelerating RotaRod. These data suggest that spinal administration of MSVIII-19 reverses hypersensitivity in several models of pain in mice, supporting the clinical potential of GluK1 antagonists for the management of pain. PMID:21324591
McCracken, Mandy L.; Borghese, Cecilia M.; Trudell, James R.
2010-01-01
Alcohols and inhaled anesthetics enhance the function of GABAA receptors containing α, β, and γ subunits. Molecular analysis has focused on the role of the α subunits; however, there is evidence that the β subunits may also be important. The goal of our study was to determine whether Asn265, which is homologous to the site implicated in the α subunit (Ser270), contributes to an alcohol and volatile anesthetic binding site in the GABAA receptor β2 subunit. We substituted cysteine for Asn265 and exposed the mutant to the sulfhydryl-specific reagent octyl methanethiosulfonate (OMTS). We used two-electrode voltage-clamp electrophysiology in Xenopus laevis oocytes and found that, after OMTS application, GABA-induced currents were irreversibly potentiated in mutant α1β2(N265C)γ2S receptors [but not α1β2(I264C)γ2S], presumably because of the covalent linking of octanethiol to the thiol group in the substituted cysteine. It is noteworthy that this effect was blocked when OMTS was applied in the presence of octanol. We found that potentiation by butanol, octanol, or isoflurane in the N265C mutant was nearly abolished after the application of OMTS, suggesting that an alcohol and volatile anesthetic binding site at position 265 of the β2 subunit was irreversibly occupied by octanethiol and consequently prevented butanol or isoflurane from binding and producing their effects. OMTS did not affect modulation or direct activation by pentobarbital, but there was a partial reduction of allosteric modulation by flunitrazepam and alphaxalone in mutant α1β2(N265C)γ2S receptors after OMTS was applied. Our findings provide evidence that Asn265 may contribute to an alcohol and anesthetic binding site. PMID:20826568
Liu, Xiao; Li, Jitao; Guo, Chunmei; Wang, Hongli; Sun, Yaxin; Wang, Han; Su, Yun-Ai; Li, Keqing; Si, Tianmei
2018-01-01
Cognitive dysfunction constitutes an essential component in schizophrenia for its early presence in the pathophysiology of the disease and close relatedness to life quality of patients. To develop effective treatment of cognitive deficits, it is important to understand their neurobiological causes and to identify potential therapeutic targets. In this study, adopting repeated MK-801 treatment as an animal model of schizophrenia, we investigated whether antipsychotic drugs, olanzapine and haloperidol, can reverse MK-801-induced cognitive deficits and how the reversal processes recruited proteins involved in glutamate neurotransmission in rat medial prefrontal cortex (mPFC) and hippocampus. We found that low-dose chronic MK-801 treatment impaired object-in-context recognition memory and reversal learning in the Morris water maze, leaving reference memory relatively unaffected, and that these cognitive deficits can be partially reversed by olanzapine, not haloperidol, treatment. At the molecular level, chronic MK-801 treatment resulted in the reduction of multiple N-methyl-D-aspartate (NMDA) receptor subunits in rat mPFC and olanzapine, not haloperidol, treatment restored the levels of GluN1 and phosphorylated GluN2B in this region. Taken together, MK-801-induced cognitive deficits may be associated with region-specific changes in NMDA receptor subunits and the reversal of specific NMDA receptor subunits may underlie the cognition-enhancing effects of olanzapine. PMID:29375333
GABAA Receptors Containing ρ1 Subunits Contribute to In Vivo Effects of Ethanol in Mice
Blednov, Yuri A.; Benavidez, Jillian M.; Black, Mendy; Leiter, Courtney R.; Osterndorff-Kahanek, Elizabeth; Johnson, David; Borghese, Cecilia M.; Hanrahan, Jane R.; Johnston, Graham A. R.; Chebib, Mary; Harris, R. Adron
2014-01-01
GABAA receptors consisting of ρ1, ρ2, or ρ3 subunits in homo- or hetero-pentamers have been studied mainly in retina but are detected in many brain regions. Receptors formed from ρ1 are inhibited by low ethanol concentrations, and family-based association analyses have linked ρ subunit genes with alcohol dependence. We determined if genetic deletion of ρ1 in mice altered in vivo ethanol effects. Null mutant male mice showed reduced ethanol consumption and preference in a two-bottle choice test with no differences in preference for saccharin or quinine. Null mutant mice of both sexes demonstrated longer duration of ethanol-induced loss of righting reflex (LORR), and males were more sensitive to ethanol-induced motor sedation. In contrast, ρ1 null mice showed faster recovery from acute motor incoordination produced by ethanol. Null mutant females were less sensitive to ethanol-induced development of conditioned taste aversion. Measurement of mRNA levels in cerebellum showed that deletion of ρ1 did not change expression of ρ2, α2, or α6 GABAA receptor subunits. (S)-4-amino-cyclopent-1-enyl butylphosphinic acid (“ρ1” antagonist), when administered to wild type mice, mimicked the changes that ethanol induced in ρ1 null mice (LORR and rotarod tests), but the ρ1 antagonist did not produce these effects in ρ1 null mice. In contrast, (R)-4-amino-cyclopent-1-enyl butylphosphinic acid (“ρ2” antagonist) did not change ethanol actions in wild type but produced effects in mice lacking ρ1 that were opposite of the effects of deleting (or inhibiting) ρ1. These results suggest that ρ1 has a predominant role in two in vivo effects of ethanol, and a role for ρ2 may be revealed when ρ1 is deleted. We also found that ethanol produces similar inhibition of function of recombinant ρ1 and ρ2 receptors. These data indicate that ethanol action on GABAA receptors containing ρ1/ρ2 subunits may be important for specific effects of ethanol in vivo. PMID:24454882
Xu, Jinghong; Yu, Liping; Zhang, Jiping; Cai, Rui; Sun, Xinde
2010-02-15
Auditory experience during the postnatal critical period is essential for the normal maturation of auditory function. Previous studies have shown that rearing infant rat pups under conditions of continuous moderate-level noise delayed the emergence of adult-like topographic representational order and the refinement of response selectivity in the primary auditory cortex (A1) beyond normal developmental benchmarks and indefinitely blocked the closure of a brief, critical-period window. To gain insight into the molecular mechanisms of these physiological changes after noise rearing, we studied expression of the AMPA receptor subunit GluR2 and GABA(A) receptor subunit beta3 in the auditory cortex after noise rearing. Our results show that continuous moderate-level noise rearing during the early stages of development decreases the expression levels of GluR2 and GABA(A)beta3. Furthermore, noise rearing also induced a significant decrease in the level of GABA(A) receptors relative to AMPA receptors. However, in adult rats, noise rearing did not have significant effects on GluR2 and GABA(A)beta3 expression or the ratio between the two units. These changes could have a role in the cellular mechanisms involved in the delayed maturation of auditory receptive field structure and topographic organization of A1 after noise rearing. Copyright 2009 Wiley-Liss, Inc.
Zhou, Xiaojuan; Desai, Rooma; Zhang, Yinghui; Stec, Wojciech J; Miller, Keith W; Jounaidi, Youssef
2018-01-01
The inhibitory γ-aminobutyric acid type A receptors are implicated in numerous physiological processes, including cognition and inhibition of neurotransmission, rendering them important molecular targets for many classes of drugs. Functionally, the entire GABAAR family of receptors can be subdivided into phasic, fast acting synaptic receptors, composed of α-, β- and γ-subunits, and tonic extrasynaptic receptors, many of which contain the δ-subunit in addition to α- and β-subunits. Whereas the subunit arrangement of the former group is agreed upon, that of the αβδ GABAARs remains unresolved by electrophysiological and pharmacological research. To resolve such issues will require biophysical techniques that demand quantities of receptor that have been previously unavailable. Therefore, we have engineered a stable cell line with tetracycline inducible expression of human α4-, β3- and N-terminally Flag-tagged δ-subunits. This cell line achieved a specific activity between 15 and 20 pmol [3H]muscimol sites/mg of membrane protein, making it possible to obtain 1 nmole of purified α4β3δ GABAAR from sixty 15-cm culture dishes. When induced, these cells exhibited agonist-induced currents with characteristics comparable to those previously reported for this receptor and a pharmacology that included strong modulation by etomidate and the δ-subunit-specific ligand, DS2. Immunoaffinity purification and reconstitution in CHAPS/asolectin micelles resulted in the retention of equilibrium allosteric interactions between the separate agonist, anesthetic and DS2 sites. Moreover, all three subunits retained glycosylation. The establishment of this well-characterized cell line will allow molecular level studies of tonic receptors to be undertaken.
Kiasalari, Zahra; Khalili, Mohsen; Shafiee, Samaneh; Roghani, Mehrdad
2016-01-01
Since temporal lobe epilepsy (TLE) is associated with learning and memory impairment, we investigated the beneficial effect of Vitamin E on the impaired learning and memory in the intrahippocampal kainate model of TLE in rats. Rats were divided into sham, Vitamin E-treated sham, kainate, and Vitamin E-treated kainate. Intrahippocampal kainate was used for induction of epilepsy. Vitamin E was injected intraperitoneal (i.p.) at a dose of 200 mg/kg/day started 1 week before surgery until 1 h presurgery. Initial and step-through latencies in the passive avoidance test and alternation behavior percentage in Y-maze were finally determined in addition to measurement of some oxidative stress markers. Kainate injection caused a higher severity and rate of seizures and deteriorated learning and memory performance in passive avoidance paradigm and spontaneous alternation as an index of spatial recognition memory in Y-maze task. Intrahippocampal kainate also led to the elevation of malondialdehyde (MDA) and nitrite and reduced activity of superoxide dismutase (SOD). Vitamin E pretreatment significantly attenuated severity and incidence rate of seizures, significantly improved retrieval and recall in passive avoidance, did not ameliorate spatial memory deficit in Y-maze, and lowered MDA and enhanced SOD activity. Vitamin E improves passive avoidance learning and memory and part of its beneficial effect is due to its potential to mitigate hippocampal oxidative stress.
The Barley Magnesium Chelatase 150-kD Subunit Is Not an Abscisic Acid Receptor1[OA
Müller, André H.; Hansson, Mats
2009-01-01
Magnesium chelatase is the first unique enzyme of the chlorophyll biosynthetic pathway. It is composed of three gene products of which the largest is 150 kD. This protein was recently identified as an abscisic acid receptor in Arabidopsis (Arabidopsis thaliana). We have evaluated whether the barley (Hordeum vulgare) magnesium chelatase large subunit, XanF, could be a receptor for the phytohormone. The study involved analysis of recombinant magnesium chelatase protein as well as several induced chlorophyll-deficient magnesium chelatase mutants with defects identified at the gene and protein levels. Abscisic acid had no effect on magnesium chelatase activity and binding to the barley 150-kD protein could not be shown. Magnesium chelatase mutants showed a wild-type response in respect to postgermination growth and stomatal aperture. Our results question the function of the large magnesium chelatase subunit as an abscisic acid receptor. PMID:19176716
Baez, María Verónica; Cercato, Magalí Cecilia; Jerusalinsky, Diana Alicia
2018-01-01
NMDA ionotropic glutamate receptors (NMDARs) are crucial in activity-dependent synaptic changes and in learning and memory. NMDARs are composed of two GluN1 essential subunits and two regulatory subunits which define their pharmacological and physiological profile. In CNS structures involved in cognitive functions as the hippocampus and prefrontal cortex, GluN2A and GluN2B are major regulatory subunits; their expression is dynamic and tightly regulated, but little is known about specific changes after plasticity induction or memory acquisition. Data strongly suggest that following appropriate stimulation, there is a rapid increase in surface GluN2A-NMDAR at the postsynapses, attributed to lateral receptor mobilization from adjacent locations. Whenever synaptic plasticity is induced or memory is consolidated, more GluN2A-NMDARs are assembled likely using GluN2A from a local translation and GluN1 from local ER. Later on, NMDARs are mobilized from other pools, and there are de novo syntheses at the neuron soma. Changes in GluN1 or NMDAR levels induced by synaptic plasticity and by spatial memory formation seem to occur in different waves of NMDAR transport/expression/degradation, with a net increase at the postsynaptic side and a rise in expression at both the spine and neuronal soma. This review aims to put together that information and the proposed hypotheses.
Han, Dong-Yun; Guan, Bo-Jhih; Wang, Ya-Juan; Hatzoglou, Maria; Mu, Ting-Wei
2015-09-18
Gamma-aminobutyric acid type A (GABAA) receptors are the primary inhibitory ion channels in the mammalian central nervous system and play an essential role in regulating inhibition-excitation balance in neural circuits. The α1 subunit harboring the D219N mutation of GABAA receptors was reported to be retained in the endoplasmic reticulum (ER) and traffic inefficiently to the plasma membrane, leading to a loss of function of α1(D219N) subunits and thus idiopathic generalized epilepsy (IGE). We present the use of small molecule proteostasis regulators to enhance the forward trafficking of α1(D219N) subunits to restore their function. We showed that treatment with verapamil (4 μM, 24 h), an L-type calcium channel blocker, substantially increases the α1(D219N) subunit cell surface level in both HEK293 cells and neuronal SH-SY5Y cells and remarkably restores the GABA-induced maximal chloride current in HEK293 cells expressing α1(D219N)β2γ2 receptors to a level that is comparable to wild type receptors. Our drug mechanism study revealed that verapamil treatment promotes the ER to Golgi trafficking of the α1(D219N) subunits post-translationally. To achieve that, verapamil treatment enhances the interaction between the α1(D219N) subunit and β2 subunit and prevents the aggregation of the mutant protein by shifting the protein from the detergent-insoluble fractions to detergent-soluble fractions. By combining (35)S pulse-chase labeling and MG-132 inhibition experiments, we demonstrated that verapamil treatment does not inhibit the ER-associated degradation of the α1(D219N) subunit. In addition, its effect does not involve a dynamin-1 dependent endocytosis. To gain further mechanistic insight, we showed that verapamil increases the interaction between the mutant protein and calnexin and calreticulin, two major lectin chaperones in the ER. Moreover, calnexin binding promotes the forward trafficking of the mutant subunit. Taken together, our data indicate that
Mellor, J R; Wisden, W; Randall, A D
2000-07-10
Electrophysiological investigation of cultured cerebellar murine granule cells revealed differences between the GABA(A) receptors at inhibitory synapses and those on the cell body. Specifically, mIPSCs decayed more rapidly than cell body receptors deactivated, the mean single channel conductance at the synapse (32 pS) was greater than that at cell body (21 pS) and only cell body receptors were sensitive to Zn(2+) (150 microM), which depressed response amplitude by 82+/-5% and almost doubled the rate of channel deactivation. The GABA(A) receptor alpha6 subunit is selectively expressed in cerebellar granule cells. Although concentrated at synapses, it is also found on extrasynaptic membranes. Using a mouse line (Deltaalpha6lacZ) lacking this subunit, we investigated its role in the somato-synaptic differences in GABA(A) receptor function. All differences between cell body and synaptic GABA(A) receptors observed in wild-type (WT) granule cells persisted in Deltaalpha6lacZ cells, thus demonstrating that they are not specifically due to the cellular distribution of the alpha6 subunit. However, mIPSCs from WT and Deltaalpha6lacZ cells differed in both their kinetics (faster decay in WT cells) and underlying single channel conductance (32 pS WT, 25 pS Deltaalpha6lacZ). This provides good evidence for a functional contribution of the alpha6 subunit to postsynaptic GABA(A) receptors in these cells. Despite this, deactivation kinetics of mIPSCs in WT and Deltaalpha6lacZ granule cells exhibited similar benzodiazepene (BDZ) sensitivity. This suggests that the enhanced BDZ-induced ataxia seen in Deltaalpha6lacZ mice may reflect physiological activity at extrasynaptic receptors which, unlike those at synapses, display differential BDZ-sensitivity in WT and Deltaalpha6lacZ granule cells (Jones, A.M., Korpi, E.R., McKernan, R.M., Nusser, Z., Pelz, R., Makela, R., Mellor, J.R., Pollard, S., Bahn, S., Stephenson, F.A., Randall, A.D., Sieghart, W., Somogyi, P., Smith, A.J.H., Wisden
Do specific NMDA receptor subunits act as gateways for addictive behaviors?
Hopf, F. W.
2016-01-01
Addiction to alcohol and drugs is a major social and economic problem, and there is considerable interest in understanding the molecular mechanisms that promote addictive drives. A number of proteins have been identified that contribute to expression of addictive behaviors. NMDA receptors (NMDARs), a subclass of ionotropic glutamate receptors, have been of particular interest because their physiological properties make them an attractive candidate for gating induction of synaptic plasticity, a molecular change thought to mediate learning and memory. NMDARs are generally inactive at the hyperpolarized resting potentials of many neurons. However, given sufficient depolarization, NMDARs are activated and exhibit long-lasting currents with significant calcium permeability. Also, in addition to stimulating neurons by direct depolarization, NMDARs and their calcium signaling can allow strong and/or synchronized inputs to produce long-term changes in other molecules (such as AMPA-type glutamate receptors) which can last from days to years, binding internal and external stimuli in a long-term memory trace. Such memories could allow salient drug-related stimuli to exert strong control over future behaviors and thus promote addictive drives. Finally, NMDARs may themselves undergo plasticity, which can alter subsequent neuronal stimulation and/or the ability to induce plasticity. This review will address recent and past findings suggesting that NMDAR activity promotes drug- and alcohol-related behaviors, with a particular focus on GluN2B subunits as possible central regulators of many addictive behaviors, as well as newer studies examining the importance of non-canonical NMDAR subunits and endogenous NMDAR cofactors. PMID:27706932
Somers, Jason; Luong, Hang Ngoc Bao; Batterham, Philip; Perry, Trent
2018-01-02
Nicotinic acetylcholine receptors (nAChRs) have vital functions in processes of neurotransmission that underpin key behaviors. These pentameric ligand-gated ion channels have been used as targets for insecticides that constitutively activate them, causing the death of insect pests. In examining a knockout of the Dα1 nAChR subunit gene, our study linked this one subunit with multiple traits. We were able to confirm previous work that had identified Dα1 as a target of the neonicotinoid class of insecticides. Further, we uncovered roles for the gene in influencing mating behavior and patterns of sleep. The knockout mutant was also observed to have a significant reduction in longevity. This study highlighted the severe fitness costs that appear to be associated with the loss of function of this gene in natural populations in the absence of insecticides targeting the Dα1 subunit. Such a fitness cost could explain why target site resistances to neonicotinoids in pest insect populations have been associated specific amino acid replacement mutations in nAChR subunits, rather than loss of function. That mutant phenotypes were observed for the two behaviors examined indicates that the functions of Dα1, and other nAChR subunits, need to be explored more broadly. It also remains to be established whether these phenotypes were due to loss of the Dα1 receptor and/or to compensatory changes in the expression levels of other nAChR subunits.
Leuba, Genevieve; Vernay, Andre; Kraftsik, Rudolf; Tardif, Eric; Riederer, Beat Michel; Savioz, Armand
2014-01-01
In Alzheimer's disease (AD), synaptic alterations play a major role and are often correlated with cognitive changes. In order to better understand synaptic modifications, we compared alterations in NMDA receptors and postsynaptic protein PSD-95 expression in the entorhinal cortex (EC) and frontal cortex (FC; area 9) of AD and control brains. We combined immunohistochemical and image analysis methods to quantify on consecutive sections the distribution of PSD-95 and NMDA receptors GluN1, GluN2A and GluN2B in EC and FC from 25 AD and control cases. The density of stained receptors was analyzed using multivariate statistical methods to assess the effect of neurodegeneration. In both regions, the number of neuronal profiles immunostained for GluN1 receptors subunit and PSD-95 protein was significantly increased in AD compared to controls (3-6 fold), while the number of neuronal profiles stained for GluN2A and GluN2B receptors subunits was on the contrary decreased (3-4 fold). The increase in marked neuronal profiles was more prominent in a cortical band corresponding to layers 3 to 5 with large pyramidal cells. Neurons positive for GluN1 or PSD-95 staining were often found in the same localization on consecutive sections and they were also reactive for the anti-tau antibody AD2, indicating a neurodegenerative process. Differences in the density of immunoreactive puncta representing neuropile were not statistically significant. Altogether these data indicate that GluN1 and PSD-95 accumulate in the neuronal perikarya, but this is not the case for GluN2A and GluN2B, while the neuropile compartment is less subject to modifications. Thus, important variations in the pattern of distribution of the NMDA receptors subunits and PSD-95 represent a marker in AD and by impairing the neuronal network, contribute to functional deterioration.
Shi, S; Hayashi, Y; Esteban, J A; Malinow, R
2001-05-04
AMPA-type glutamate receptors (AMPA-Rs) mediate a majority of excitatory synaptic transmission in the brain. In hippocampus, most AMPA-Rs are hetero-oligomers composed of GluR1/GluR2 or GluR2/GluR3 subunits. Here we show that these AMPA-R forms display different synaptic delivery mechanisms. GluR1/GluR2 receptors are added to synapses during plasticity; this requires interactions between GluR1 and group I PDZ domain proteins. In contrast, GluR2/GluR3 receptors replace existing synaptic receptors continuously; this occurs only at synapses that already have AMPA-Rs and requires interactions by GluR2 with NSF and group II PDZ domain proteins. The combination of regulated addition and continuous replacement of synaptic receptors can stabilize long-term changes in synaptic efficacy and may serve as a general model for how surface receptor number is established and maintained.
Impaired Discrimination Learning in Mice Lacking the NMDA Receptor NR2A Subunit
ERIC Educational Resources Information Center
Brigman, Jonathan L.; Feyder, Michael; Saksida, Lisa M.; Bussey, Timothy J.; Mishina, Masayoshi; Holmes, Andrew
2008-01-01
N-Methyl-D-aspartate receptors (NMDARs) mediate certain forms of synaptic plasticity and learning. We used a touchscreen system to assess NR2A subunit knockout mice (KO) for (1) pairwise visual discrimination and reversal learning and (2) acquisition and extinction of an instrumental response requiring no pairwise discrimination. NR2A KO mice…
Leppä, Elli; Linden, Anni-Maija; Vekovischeva, Olga Y.; Swinny, Jerome D.; Rantanen, Ville; Toppila, Esko; Höger, Harald; Sieghart, Werner; Wulff, Peer; Wisden, William; Korpi, Esa R.
2011-01-01
We investigated the behavioral significance of fast synaptic inhibition by αβγ2-type GABAA receptors on parvalbumin (Pv) cells. The GABAA receptor γ2 subunit gene was selectively inactivated in Pv-positive neurons by Cre/loxP recombination. The resulting Pv-Δγ2 mice were relatively healthy in the first postnatal weeks; but then as Cre started to be expressed, the mice progressively developed wide-ranging phenotypic alterations including low body weight, motor deficits and tremor, decreased anxiety levels, decreased pain sensitivity and deficient prepulse inhibition of the acoustic startle reflex and impaired spatial learning. Nevertheless, the deletion was not lethal, and mice did not show increased mortality even after one year. Autoradiography with t-butylbicyclophosphoro[35S]thionate suggested an increased amount of GABAA receptors with only α and β subunits in central nervous system regions that contained high levels of parvalbumin neurons. Using BAC-transgenesis, we reduced some of the Pv-Δγ2 phenotype by selectively re-expressing the wild-type γ2 subunit back into some Pv cells (reticular thalamic neurons and cerebellar Pv-positive neurons). This produced less severe impairments of motor skills and spatial learning compared with Pv-Δγ2 mice, but all other deficits remained. Our results reveal the widespread significance of fast GABAergic inhibition onto Pv-positive neurons for diverse behavioral modalities, such as motor coordination, sensorimotor integration, emotional behavior and nociception. PMID:21912668
Mihalek, Robert M.; Banerjee, Pradeep K.; Korpi, Esa R.; Quinlan, Joseph J.; Firestone, Leonard L.; Mi, Zhi-Ping; Lagenaur, Carl; Tretter, Verena; Sieghart, Werner; Anagnostaras, Stephan G.; Sage, Jennifer R.; Fanselow, Michael S.; Guidotti, Alessandro; Spigelman, Igor; Li, Zhiwei; DeLorey, Timothy M.; Olsen, Richard W.; Homanics, Gregg E.
1999-01-01
γ-Aminobutyric acid (GABA) type A receptors mediate fast inhibitory synaptic transmission and have been implicated in responses to sedative/hypnotic agents (including neuroactive steroids), anxiety, and learning and memory. Using gene targeting technology, we generated a strain of mice deficient in the δ subunit of the GABA type A receptors. In vivo testing of various behavioral responses revealed a strikingly selective attenuation of responses to neuroactive steroids, but not to other modulatory drugs. Electrophysiological recordings from hippocampal slices revealed a significantly faster miniature inhibitory postsynaptic current decay time in null mice, with no change in miniature inhibitory postsynaptic current amplitude or frequency. Learning and memory assessed with fear conditioning were normal. These results begin to illuminate the novel contributions of the δ subunit to GABA pharmacology and sedative/hypnotic responses and behavior and provide insights into the physiology of neurosteroids. PMID:10536021
Blatt, G J; Fitzgerald, C M; Guptill, J T; Booker, A B; Kemper, T L; Bauman, M L
2001-12-01
Neuropathological studies in autistic brains have shown small neuronal size and increased cell packing density in a variety of limbic system structures including the hippocampus, a change consistent with curtailment of normal development. Based on these observations in the hippocampus, a series of quantitative receptor autoradiographic studies were undertaken to determine the density and distribution of eight types of neurotransmitter receptors from four neurotransmitter systems (GABAergic, serotoninergic [5-HT], cholinergic, and glutamatergic). Data from these single concentration ligand binding studies indicate that the GABAergic receptor system (3[H]-flunitrazepam labeled benzodiazepine binding sites and 3[H]-muscimol labeled GABA(A) receptors) is significantly reduced in high binding regions, marking for the first time an abnormality in the GABA system in autism. In contrast, the density and distribution of the other six receptors studied (3[H]-80H-DPAT labeled 5-HT1A receptors, 3[H]-ketanserin labeled 5-HT2 receptors, 3[H]-pirenzepine labled M1 receptors, 3[H]-hemicholinium labeled high affinity choline uptake sites, 3[H]-MK801 labeled NMDA receptors, and 3[H]-kainate labeled kainate receptors) in the hippocampus did not demonstrate any statistically significant differences in binding.
Geracitano, Raffaella; Fischer, David; Kasugai, Yu; Ferraguti, Francesco; Capogna, Marco
2012-01-01
In the amygdala, GABAergic neurons in the intercalated medial paracapsular cluster (Imp) have been suggested to play a key role in fear learning and extinction. These neurons project to the central (CE) amygdaloid nucleus and to other areas within and outside the amygdala. In addition, they give rise to local collaterals that innervate other neurons in the Imp. Several drugs, including benzodiazepines (BZ), are allosteric modulators of GABAA receptors. BZ has both anxiolytic and sedative actions, which are mediated through GABAA receptors containing α2/α3 and α1 subunits, respectively. To establish whether α1 or α2/α3 subunits are expressed at Imp cell synapses, we used paired recordings of anatomically identified Imp neurons and high resolution immunocytochemistry in the mouse. We observed that a selective α3 subunit agonist, TP003 (100 nM), significantly increased the decay time constant of the unitary IPSCs. A similar effect was also induced by zolpidem (10 μM) or by diazepam (1 μM). In contrast, lower doses of zolpidem (0.1–1 μM) did not significantly alter the kinetics of the unitary IPSCs. Accordingly, immunocytochemical experiments established that the α2 and α3, but not the α1 subunits of the GABAA receptors, were present at Imp cell synapses of the mouse amygdala. These results define, for the first time, some of the functional GABAA receptor subunits expressed at synapses of Imp cells. The data also provide an additional rationale to prompt the search of GABAA receptor α3 selective ligands as improved anxiolytic drugs. PMID:22666188
Lyddon, Rebecca; Navarrett, Scott; Dracheva, Stella
2012-07-01
Dysfunction of glutamate neurotransmission has been implicated in the pathology of schizophrenia and bipolar disorder, and one mechanism by which glutamate signalling can be altered is through RNA editing of ionotropic glutamate receptors (iGluRs). The objectives of the present study were to evaluate the editing status of iGluRs in the human prefrontal cortex, determine whether iGluR editing is associated with psychiatric disease or suicide and evaluate a potential association between editing and alternative splicing in the α-amino-3-hydroxy-5-methylisoxazole-4-propionate (AMPA) iGluR subunits' pre-mRNA. We studied specimens derived from patients with antemortem diagnoses of bipolar disorder (n = 31) or schizophrenia (n = 34) who died by suicide or other causes, and from psychiatrically healthy controls (n = 34) who died from causes other than suicide. The RNA editing at all 8 editing sites within AMPA (GluA2-4 subunits) and kainate (GluK1-2 subunits) iGluRs was analyzed using a novel real-time quantitative polymerase chain reaction assay. No differences in editing were detected among schizophrenia, bipolar or control groups or between suicide completers and patients who died from causes other than suicide. The editing efficiency was significantly higher in the flop than in the flip splicoforms of GluA3-4 AMPA subunits (all p < 0.001). The study is limited by the near absence of specimens from medicationnaive psychiatric patients and considerable variation in medication regimens among individuals, both of which introduce considerable uncertainty into the analysis of potential medication effects. We found that iGluR RNA editing status was not associated with bipolar disorder, schizophrenia or suicide. Differences in editing between flip and flop splicoforms suggest that glutamate sensitivity of receptors containing GluA3 and/or GluA4 flop subunits is moderated as a result of increased editing.
Do specific NMDA receptor subunits act as gateways for addictive behaviors?
Hopf, F W
2017-01-01
Addiction to alcohol and drugs is a major social and economic problem, and there is considerable interest in understanding the molecular mechanisms that promote addictive drives. A number of proteins have been identified that contribute to expression of addictive behaviors. NMDA receptors (NMDARs), a subclass of ionotropic glutamate receptors, have been of particular interest because their physiological properties make them an attractive candidate for gating induction of synaptic plasticity, a molecular change thought to mediate learning and memory. NMDARs are generally inactive at the hyperpolarized resting potentials of many neurons. However, given sufficient depolarization, NMDARs are activated and exhibit long-lasting currents with significant calcium permeability. Also, in addition to stimulating neurons by direct depolarization, NMDARs and their calcium signaling can allow strong and/or synchronized inputs to produce long-term changes in other molecules (such as AMPA-type glutamate receptors) which can last from days to years, binding internal and external stimuli in a long-term memory trace. Such memories could allow salient drug-related stimuli to exert strong control over future behaviors and thus promote addictive drives. Finally, NMDARs may themselves undergo plasticity, which can alter subsequent neuronal stimulation and/or the ability to induce plasticity. This review will address recent and past findings suggesting that NMDAR activity promotes drug- and alcohol-related behaviors, with a particular focus on GluN2B subunits as possible central regulators of many addictive behaviors, as well as newer studies examining the importance of non-canonical NMDAR subunits and endogenous NMDAR cofactors. © 2016 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.
Westh-Hansen, S E; Rasmussen, P B; Hastrup, S; Nabekura, J; Noguchi, K; Akaike, N; Witt, M R; Nielsen, M
1997-06-25
Recombinant human GABA(A) receptors were investigated in vitro by coexpression of cDNAs coding for alpha1, beta2, and gamma2 subunits in the baculovirus/Sf-9 insect cell system. We report that a single amino acid exchange (isoleucine 121 to valine 121) in the N-terminal, extracellular part of the alpha1 subunit induces a marked decrease in agonist GABA(A) receptor ligand sensitivity. The potency of muscimol and GABA to inhibit the binding of the GABA(A) receptor antagonist [3H]SR 95531 (2-(3-carboxypropyl)-3-amino-6-(4-methoxyphenyl)pyridazinium bromide) was higher in receptor complexes of alpha1(ile 121) beta2gamma2 than in those of alpha1(val 121) beta2gamma2 (IC50 values were 32-fold and 26-fold lower for muscimol and GABA, respectively). The apparent affinity of the GABA(A) receptor antagonist bicuculline methiodide to inhibit the binding of [3H]SR 95531 did not differ between the two receptor complex variants. Electrophysiological measurements of GABA induced whole-cell Cl- currents showed a ten-fold decrease in the GABA(A) receptor sensitivity of alpha1 (val 121) beta2gamma2 as compared to alpha1(ile 121) beta2gamma2 receptor complexes. Thus, a relatively small change in the primary structure of the alpha1 subunit leads to a decrease selective for GABA(A) receptor sensitivity to agonist ligands, since no changes were observed in a GABA(A) receptor antagonist affinity and benzodiazepine receptor binding.
Wegner, Florian; Kraft, Robert; Busse, Kathy; Härtig, Wolfgang; Ahrens, Jörg; Leffler, Andreas; Dengler, Reinhard; Schwarz, Johannes
2012-01-01
Human fetal midbrain-derived neural progenitor cells (NPCs) may deliver a tissue source for drug screening and regenerative cell therapy to treat Parkinson's disease. While glutamate and GABA(A) receptors play an important role in neurogenesis, the involvement of glycine receptors during human neurogenesis and dopaminergic differentiation as well as their molecular and functional characteristics in NPCs are largely unknown. Here we investigated NPCs in respect to their glycine receptor function and subunit expression using electrophysiology, calcium imaging, immunocytochemistry, and quantitative real-time PCR. Whole-cell recordings demonstrate the ability of NPCs to express functional strychnine-sensitive glycine receptors after differentiation for 3 weeks in vitro. Pharmacological and molecular analyses indicate a predominance of glycine receptor heteromers containing α2β subunits. Intracellular calcium measurements of differentiated NPCs suggest that glycine evokes depolarisations mediated by strychnine-sensitive glycine receptors and not by D-serine-sensitive excitatory glycine receptors. Culturing NPCs with additional glycine, the glycine-receptor antagonist strychnine, or the Na(+)-K(+)-Cl(-) co-transporter 1 (NKCC1)-inhibitor bumetanide did not significantly influence cell proliferation and differentiation in vitro. These data indicate that NPCs derived from human fetal midbrain tissue acquire essential glycine receptor properties during neuronal maturation. However, glycine receptors seem to have a limited functional impact on neurogenesis and dopaminergic differentiation of NPCs in vitro.
Wegner, Florian; Kraft, Robert; Busse, Kathy; Härtig, Wolfgang; Ahrens, Jörg; Leffler, Andreas; Dengler, Reinhard; Schwarz, Johannes
2012-01-01
Background Human fetal midbrain-derived neural progenitor cells (NPCs) may deliver a tissue source for drug screening and regenerative cell therapy to treat Parkinson’s disease. While glutamate and GABAA receptors play an important role in neurogenesis, the involvement of glycine receptors during human neurogenesis and dopaminergic differentiation as well as their molecular and functional characteristics in NPCs are largely unknown. Methodology/Principal Findings Here we investigated NPCs in respect to their glycine receptor function and subunit expression using electrophysiology, calcium imaging, immunocytochemistry, and quantitative real-time PCR. Whole-cell recordings demonstrate the ability of NPCs to express functional strychnine-sensitive glycine receptors after differentiation for 3 weeks in vitro. Pharmacological and molecular analyses indicate a predominance of glycine receptor heteromers containing α2β subunits. Intracellular calcium measurements of differentiated NPCs suggest that glycine evokes depolarisations mediated by strychnine-sensitive glycine receptors and not by D-serine-sensitive excitatory glycine receptors. Culturing NPCs with additional glycine, the glycine-receptor antagonist strychnine, or the Na+-K+-Cl− co-transporter 1 (NKCC1)-inhibitor bumetanide did not significantly influence cell proliferation and differentiation in vitro. Conclusions/Significance These data indicate that NPCs derived from human fetal midbrain tissue acquire essential glycine receptor properties during neuronal maturation. However, glycine receptors seem to have a limited functional impact on neurogenesis and dopaminergic differentiation of NPCs in vitro. PMID:22606311
Expression Profile of the Integrin Receptor Subunits in the Guinea Pig Sclera.
Wang, Kevin K; Metlapally, Ravikanth; Wildsoet, Christine F
2017-06-01
The ocular dimensional changes in myopia reflect increased scleral remodeling, and in high myopia, loss of scleral integrity leads to biomechanical weakening and continued scleral creep. As integrins, a type of cell surface receptors, have been linked to scleral remodeling, they represent potential targets for myopia therapies. As a first step, this study aimed to characterize the integrin subunits at the messenger RNA level in the sclera of the guinea pig, a more recently added but increasingly used animal model for myopia research. Primers for α and β integrin subunits were designed using NCBI/UCSC Genome Browser and Primer3 software tools. Total RNA was extracted from normal scleral tissue and isolated cultured scleral fibroblasts, as well as liver and lung, as reference tissues, all from guinea pig. cDNA was produced by reverse transcription, PCR was used to amplify products of predetermined sizes, and products were sequenced using standard methods. Guinea pig scleral tissue expressed all known integrin alpha subunits except αD and αE. The latter integrin subunits were also not expressed by cultured guinea pig scleral fibroblasts; however, their expression was confirmed in guinea pig liver. In addition, isolated cultured fibroblasts did not express integrin subunits αL, αM, and αX. This difference between results for cultured cells and intact sclera presumably reflects the presence in the latter of additional cell types. Both guinea pig scleral tissue and isolated scleral fibroblasts expressed all known integrin beta subunits. All results were verified through sequencing. The possible contributions of integrins to scleral remodeling make them plausible targets for myopia prevention. Data from this study will help guide future ex vivo and in vitro studies directed at understanding the relationship between scleral integrins and ocular growth regulation in the guinea pig model for myopia.
Werner, D. F.; Swihart, A.; Rau, V.; Jia, F.; Borghese, C. M.; McCracken, M. L.; Iyer, S.; Fanselow, M. S.; Oh, I.; Sonner, J. M.; Eger, E. I.; Harrison, N. L.; Harris, R. A.
2011-01-01
The mechanism by which the inhaled anesthetic isoflurane produces amnesia and immobility is not understood. Isoflurane modulates GABAA receptors (GABAA-Rs) in a manner that makes them plausible targets. We asked whether GABAA-R α2 subunits contribute to a site of anesthetic action in vivo. Previous studies demonstrated that Ser270 in the second transmembrane domain is involved in the modulation of GABAA-Rs by volatile anesthetics and alcohol, either as a binding site or a critical allosteric residue. We engineered GABAA-Rs with two mutations in the α2 subunit, changing Ser270 to His and Leu277 to Ala. Recombinant receptors with these mutations demonstrated normal affinity for GABA, but substantially reduced responses to isoflurane. We then produced mutant (knockin) mice in which this mutated subunit replaced the wild-type α2 subunit. The adult mutant mice were overtly normal, although there was evidence of enhanced neonatal mortality and fear conditioning. Electrophysiological recordings from dentate granule neurons in brain slices confirmed the decreased actions of isoflurane on mutant receptors contributing to inhibitory synaptic currents. The loss of righting reflex EC50 for isoflurane did not differ between genotypes, but time to regain the righting reflex was increased in N2 generation knockins. This effect was not observed at the N4 generation. Isoflurane produced immobility (as measured by tail clamp) and amnesia (as measured by fear conditioning) in both wild-type and mutant mice, and potencies (EC50) did not differ between the strains for these actions of isoflurane. Thus, immobility or amnesia does not require isoflurane potentiation of the α2 subunit. PMID:20807777
The α5 subunit-containing GABAA receptors contribute to chronic pain
Bravo-Hernández, Mariana; Corleto, José A.; Barragán-Iglesias, Paulino; González-Ramírez, Ricardo; Pineda-Farias, Jorge B.; Felix, Ricardo; Calcutt, Nigel A.; Delgado-Lezama, Rodolfo; Marsala, Martin; Granados-Soto, Vinicio
2016-01-01
It has been recently proposed that α5-subunit containing GABAA receptors (α5-GABAA receptors) that mediate tonic inhibition might be involved in pain. The purpose of this study was to investigate the contribution of α5-GABAA receptors in the loss of GABAergic inhibition and in formalin-, Complete Freund’s adjuvant (CFA)- and L5/L6 spinal nerve ligation-induced long-lasting hypersensitivity. Formalin or CFA injection and L5/L6 spinal nerve ligation produced long-lasting allodynia and hyperalgesia. Moreover, formalin injection impaired the rate-dependent depression (RDD) of the Hofmann reflex. Peripheral and intrathecal pre-treatment or post-treatment with the α5-GABAA receptor antagonist, L-655,708 (0.15–15 nmol) prevented and reversed, respectively, these long-lasting behaviors. Formalin injection increased α5-GABAA receptors mRNA expression in the spinal cord and dorsal root ganglia (DRG) mainly at 3 days. α5-GABAA receptors were localized in the dorsal spinal cord and DRG co-labeling with NeuN, CGRP and IB4 suggesting their presence in peptidergic and non-peptidergic neurons. These receptors were found mainly in small- and medium-size neurons. Formalin injection enhanced α5-GABAA receptors fluorescence intensity in spinal cord and DRG at 3 and 6 days. Intrathecal administration of L-655,708 (15 nmol) prevented and reversed formalin-induced impairment of RDD. These results suggest that α5-GABAA receptors play a role in the loss of GABAergic inhibition and contribute to long-lasting secondary allodynia and hyperalgesia. PMID:26545088
McGlade, C J; Ellis, C; Reedijk, M; Anderson, D; Mbamalu, G; Reith, A D; Panayotou, G; End, P; Bernstein, A; Kazlauskas, A
1992-01-01
The binding of cytoplasmic signaling proteins such as phospholipase C-gamma 1 and Ras GTPase-activating protein to autophosphorylated growth factor receptors is directed by their noncatalytic Src homology region 2 (SH2) domains. The p85 alpha regulatory subunit of phosphatidylinositol (PI) 3-kinase, which associates with several receptor protein-tyrosine kinases, also contains two SH2 domains. Both p85 alpha SH2 domains, when expressed individually as fusion proteins in bacteria, bound stably to the activated beta receptor for platelet-derived growth factor (PDGF). Complex formation required PDGF stimulation and was dependent on receptor tyrosine kinase activity. The bacterial p85 alpha SH2 domains recognized activated beta PDGF receptor which had been immobilized on a filter, indicating that SH2 domains contact autophosphorylated receptors directly. Several receptor tyrosine kinases within the PDGF receptor subfamily, including the colony-stimulating factor 1 receptor and the Steel factor receptor (Kit), also associate with PI 3-kinase in vivo. Bacterially expressed SH2 domains derived from the p85 alpha subunit of PI 3-kinase bound in vitro to the activated colony-stimulating factor 1 receptor and to Kit. We infer that the SH2 domains of p85 alpha bind to high-affinity sites on these receptors, whose creation is dependent on receptor autophosphorylation. The SH2 domains of p85 are therefore primarily responsible for the binding of PI 3-kinase to activated growth factor receptors. Images PMID:1372092
d Subunit-Containing GABA[subscript A] Receptor Prevents Overgeneralization of Fear in Adult Mice
ERIC Educational Resources Information Center
Zhang, Wen-Hua; Zhou, Jin; Pan, Han-Qing; Wang, Xiao-Yang; Liu, Wei-Zhu; Zhang, Jun-Yu; Yin, Xiao-Ping; Pan, Bing-Xing
2017-01-01
The role of d subunit-containing GABA[subscript A] receptor (GABA[subscript A](d)R) in fear generalization is uncertain. Here, by using mice with or without genetic deletion of GABA[subscript A](d)R and using protocols in which the conditioned tone stimuli were cross presented with different nonconditioned stimuli, we observed that when the two…
Jia, Yuzhi; Viswakarma, Navin; Reddy, Janardan K
2014-01-01
Several nuclear receptors regulate diverse metabolic functions that impact on critical biological processes, such as development, differentiation, cellular regeneration, and neoplastic conversion. In the liver, some members of the nuclear receptor family, such as peroxisome proliferator-activated receptors (PPARs), constitutive androstane receptor (CAR), farnesoid X receptor (FXR), liver X receptor (LXR), pregnane X receptor (PXR), glucocorticoid receptor (GR), and others, regulate energy homeostasis, the formation and excretion of bile acids, and detoxification of xenobiotics. Excess energy burning resulting from increases in fatty acid oxidation systems in liver generates reactive oxygen species, and the resulting oxidative damage influences liver regeneration and liver tumor development. These nuclear receptors are important sensors of exogenous activators as well as receptor-specific endogenous ligands. In this regard, gene knockout mouse models revealed that some lipid-metabolizing enzymes generate PPARα-activating ligands, while others such as ACOX1 (fatty acyl-CoA oxidase1) inactivate these endogenous PPARα activators. In the absence of ACOX1, the unmetabolized ACOX1 substrates cause sustained activation of PPARα, and the resulting increase in energy burning leads to hepatocarcinogenesis. Ligand-activated nuclear receptors recruit the multisubunit Mediator complex for RNA polymerase II-dependent gene transcription. Evidence indicates that the Med1 subunit of the Mediator is essential for PPARα, PPARγ, CAR, and GR signaling in liver. Med1 null hepatocytes fail to respond to PPARα activators in that these cells do not show induction of peroxisome proliferation and increases in fatty acid oxidation enzymes. Med1-deficient hepatocytes show no increase in cell proliferation and do not give rise to liver tumors. Identification of nuclear receptor-specific coactivators and Mediator subunits should further our understanding of the complexities of metabolic
Peng, X; Katz, M; Gerzanich, V; Anand, R; Lindstrom, J
1994-03-01
The alpha-bungarotoxin-binding acetylcholine receptors from the human neuroblastoma cell line SH-SY5Y were found to cross-react with some monoclonal antibodies to alpha 7 subunits of nicotinic acetylcholine receptors from chicken brain. The human alpha 7 subunit cDNA from SH-SY5Y was cloned, revealing 94% amino acid sequence identity to rat alpha 7 subunits and 92% identity to chicken alpha 7 subunits. Native human alpha 7 receptors showed affinities for some ligands similar to those previously observed with native chicken alpha 7 receptors, but for other ligands there were large species-specific differences in binding affinity. These results paralleled properties of alpha 7 homomers expressed in Xenopus oocytes. Human alpha 7 homomers exhibited rapidly desensitizing, inwardly rectifying, agonist-induced, cation currents that triggered Ca(2+)-sensitive Cl- channels in the oocytes. A change in efficacy from partial agonist for chicken alpha 7 homomers to full agonist for human alpha 7 homomers was exhibited by 1,1-dimethyl-4-phenylpiperazinium. This result reveals a large species-specific pharmacological difference, despite small differences in alpha 7 sequences. This is important for understanding the effects of these drugs in humans and for identifying amino acids that may contribute to the acetylcholine binding site, for analysis by in vitro mutagenesis. These results also characterize properties of native alpha 7 receptors and alpha 7 homomers that will provide criteria for functional properties expected of structural subunits, when these can be identified, cloned, and coexpressed with alpha 7 subunits.
Jiménez-González, Cristina; Pirttimaki, Tiina; Cope, David W; Parri, H R
2011-01-01
The rodent ventrobasal (VB) thalamus contains a relatively uniform population of thalamocortical (TC) neurons that receive glutamatergic input from the vibrissae and the somatosensory cortex, and inhibitory input from the nucleus reticularis thalami (nRT). In this study we describe γ-aminobutyric acid (GABA)A receptor-dependent slow outward currents (SOCs) in TC neurons that are distinct from fast inhibitory postsynaptic currents (IPSCs) and tonic currents. SOCs occurred spontaneously or could be evoked by hypo-osmotic stimulus, and were not blocked by tetrodotoxin, removal of extracellular Ca2+ or bafilomycin A1, indicating a non-synaptic, non-vesicular GABA origin. SOCs were more common in TC neurons of the VB compared with the dorsal lateral geniculate nucleus, and were rarely observed in nRT neurons, whilst SOC frequency in the VB increased with age. Application of THIP, a selective agonist at δ-subunit-containing GABAA receptors, occluded SOCs, whereas the benzodiazepine site inverse agonist β-CCB had no effect, but did inhibit spontaneous and evoked IPSCs. In addition, the occurrence of SOCs was reduced in mice lacking the δ-subunit, and their kinetics were also altered. The anti-epileptic drug vigabatrin increased SOC frequency in a time-dependent manner, but this effect was not due to reversal of GABA transporters. Together, these data indicate that SOCs in TC neurons arise from astrocytic GABA release, and are mediated by δ-subunit-containing GABAA receptors. Furthermore, these findings suggest that the therapeutic action of vigabatrin may occur through the augmentation of this astrocyte–neuron interaction, and highlight the importance of glial cells in CNS (patho) physiology. PMID:21395866
Modulation of Gain-of-function α6*-Nicotinic Acetylcholine Receptor by β3 Subunits*
Dash, Bhagirathi; Lukas, Ronald J.
2012-01-01
We previously have shown that β3 subunits either eliminate (e.g. for all-human (h) or all-mouse (m) α6β4β3-nAChR) or potentiate (e.g. for hybrid mα6hβ4hβ3- or mα6mβ4hβ3-nAChR containing subunits from different species) function of α6*-nAChR expressed in Xenopus oocytes, and that nAChR hα6 subunit residues Asn-143 and Met-145 in N-terminal domain loop E are important for dominant-negative effects of nAChR hβ3 subunits on hα6*-nAChR function. Here, we tested the hypothesis that these effects of β3 subunits would be preserved even if nAChR α6 subunits harbored gain-of-function, leucine- or valine-to-serine mutations at 9′ or 13′ positions (L9′S or V13′S) in their second transmembrane domains, yielding receptors with heightened functional activity and more amenable to assessment of effects of β3 subunit incorporation. However, coexpression with β3 subunits potentiates rather than suppresses function of all-human, all-mouse, or hybrid α6(L9′S or V13′S)β4*- or α6(N143D+M145V)L9′Sβ2*-nAChR. This contrasts with the lack of consistent function when α6(L9′S or V13′S) and β2 subunits are expressed alone or in the presence of wild-type β3 subunits. These results provide evidence that gain-of-function hα6hβ2*-nAChR (i.e. hα6(N143D+M145V)L9′Shβ2hβ3 nAChR) could be produced in vitro. These studies also indicate that nAChR β3 subunits can be assembly partners in functional α6*-nAChR and that 9′ or 13′ mutations in the nAChR α6 subunit second transmembrane domain can act as gain-of-function and/or reporter mutations. Moreover, our findings suggest that β3 subunit coexpression promotes function of α6*-nAChR. PMID:22315221
Hajishengallis, George; Tapping, Richard I.; Martin, Michael H.; Nawar, Hesham; Lyle, Elizabeth A.; Russell, Michael W.; Connell, Terry D.
2005-01-01
The type II heat-labile enterotoxins (LT-IIa and LT-IIb) of Escherichia coli have an AB5 subunit structure similar to that of cholera toxin (CT) and other type I enterotoxins, despite significant differences in the amino acid sequences of their B subunits and different ganglioside receptor specificities. LT-II holotoxins and their nontoxic B subunits display unique properties as immunological adjuvants distinct from those of CT and its B subunits. In contrast to type II holotoxins, the corresponding pentameric B subunits, LT-IIaB and LT-IIbB, stimulated cytokine release in both human and mouse cells dependent upon Toll-like receptor 2 (TLR2). Induction of interleukin-1β (IL-1β), IL-6, IL-8, or tumor necrosis factor alpha in human THP-1 cells by LT-IIaB or LT-IIbB was inhibited by anti-TLR2 but not by anti-TLR4 antibody. Furthermore, transient expression of TLR1 and TLR2 in human embryonic kidney 293 cells resulted in activation of a nuclear factor-κB-dependent luciferase gene in response to LT-IIaB or LT-IIbB. Moreover, peritoneal macrophages from TLR2-deficient mice failed to respond to LT-IIaB or LT-IIbB, in contrast to wild-type or TLR4-deficient cells. These results demonstrate that besides their established binding to gangliosides, the B subunits of type II enterotoxins also interact with TLR2. Although a ganglioside-nonbinding mutant (T34I) of LT-IIaB effectively induced cytokine release, a phenotypically similar point mutation (T13I) in LT-IIbB abrogated cytokine induction, suggesting a variable requirement for gangliosides as coreceptors in TLR2 agonist activity. TLR2-dependent activation of mononuclear cells by type II enterotoxin B subunits appears to be a novel mechanism whereby these molecules may exert their immunomodulatory and adjuvant activities. PMID:15731031
Bonnet, Cleo S; Williams, Anwen S; Gilbert, Sophie J; Harvey, Ann K; Evans, Bronwen A; Mason, Deborah J
2015-01-01
Objectives Synovial fluid glutamate concentrations increase in arthritis. Activation of kainate (KA) and α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) glutamate receptors (GluRs) increase interleukin-6 (IL-6) release and cause arthritic pain, respectively. We hypothesised that AMPA and KA GluRs are expressed in human arthritis, and that intra-articular NBQX (AMPA/KA GluR antagonist) prevents pain and pathology in antigen-induced arthritis (AIA). Methods GluR immunohistochemistry was related to synovial inflammation and degradation in osteoarthritis (OA) and rheumatoid arthritis (RA). A single intra-articular NBQX injection was given at induction, and knee swelling and gait of AIA and AIA+NBQX rats compared over 21 days, before imaging, RT-qPCR, histology and immunohistochemistry of joints. Effects of NBQX on human primary osteoblast (HOB) activity were determined. Results AMPAR2 and KA1 immunolocalised to remodelling bone, cartilage and synovial cells in human OA and RA, and rat AIA. All arthritic tissues showed degradation and synovial inflammation. NBQX reduced GluR abundance, knee swelling (p<0.001, days 1–21), gait abnormalities (days 1–2), end-stage joint destruction (p<0.001), synovial inflammation (p<0.001), and messenger RNA expression of meniscal IL-6 (p<0.05) and whole joint cathepsin K (p<0.01). X-ray and MRI revealed fewer cartilage and bone erosions, and less inflammation after NBQX treatment. NBQX reduced HOB number and prevented mineralisation. Conclusions AMPA/KA GluRs are expressed in human OA and RA, and in AIA, where a single intra-articular injection of NBQX reduced swelling by 33%, and inflammation and degeneration scores by 34% and 27%, respectively, exceeding the efficacy of approved drugs in the same model. AMPA/KA GluR antagonists represent a potential treatment for arthritis. PMID:24130267
Mascias, Paula; Scheede, Manuela; Bloms-Funke, Petra; Chizh, Boris
2002-09-01
GluR5 receptors modulate spinal nociception, however, their role in nociceptive hypersensitivity remains unclear. Using behavioural and electrophysiological approaches, we have investigated several GluR5 ligands in acute and hyperalgesic states. Furthermore, as the GABAergic system plays a role in GluR5 mediated effects in the brain, we also analysed the interaction between GluR5 agonists and GABA(A) antagonists in the spinal cord. In young rats in vivo, the GluR5 selective agonist ATPA was antinociceptive and antihyperalgesic in a model of inflammatory hyperalgesia (ED(50) approximately 4.6 and approximately 5.2 mg/kg, respectively), whereas the GluR5/GluR6 agonist SYM2081 was only antihyperalgesic. ATPA, but not SYM2081, was also able to inhibit nociceptive motoneurone responses in anaesthetised adult rats after intrathecal administration. In hemisected spinal cords in vitro, SYM2081 was inactive, whereas ATPA and another GluR5 agonist, (S)-5-iodowillardiine, inhibited nociceptive reflexes (EC(50) 1.1+/-0.4 micro M and 0.36+/-0.05 micro M, respectively). Both GluR5 agonists also inhibited motoneurone responses to repetitive dorsal root stimulation and their cumulative depolarisation, a correlate of wind-up. The GABA(A) antagonists bicuculline (10 micro M) and SR95531 (1 micro M) enhanced polysynaptic responses to single stimuli but abolished the cumulative depolarisation. Both bicuculline and SR95531 significantly attenuated the inhibition of nociceptive responses by 1 micro M ATPA (by approximately 50%). We conclude that selective GluR5 kainate receptor activation inhibits spinal nociception and its sensitisation caused by ongoing peripheral nociceptive drive. GABA(A) receptors are involved in tonic inhibition of segmental responses, but contribute to their sensitisation by repetitive primary afferent stimulation. Furthermore, there is a cross-talk between the two systems, presumably due to GluR5-mediated activation of GABAergic inhibitory interneurones in the
Gallego, Xavier; Ruiz, Jessica; Valverde, Olga; Molas, Susanna; Robles, Noemí; Sabrià, Josefa; Crabbe, John C.; Dierssen, Mara
2012-01-01
Abuse of alcohol and smoking are extensively co-morbid. Some studies suggest partial commonality of action of alcohol and nicotine mediated through nicotinic acetylcholine receptors (nAChRs). We tested mice with transgenic over expression of the alpha 5, alpha 3, beta 4 receptor subunit genes, which lie in a cluster on human chromosome 15, that were previously shown to have increased nicotine self-administration, for several responses to ethanol. Transgenic and wild-type mice did not differ in sensitivity to several acute behavioral responses to ethanol. However, transgenic mice drank less ethanol than wild-type in a two-bottle (ethanol vs. water) preference test. These results suggest a complex role for this receptor subunit gene cluster in the modulation of ethanol’s as well as nicotine’s effects. PMID:22459873
Gallego, Xavier; Ruiz-Medina, Jessica; Valverde, Olga; Molas, Susanna; Robles, Noemí; Sabrià, Josefa; Crabbe, John C; Dierssen, Mara
2012-05-01
Abuse of alcohol and smoking are extensively co-morbid. Some studies suggest partial commonality of action of alcohol and nicotine mediated through nicotinic acetylcholine receptors (nAChRs). We tested mice with transgenic over expression of the alpha 5, alpha 3, beta 4 receptor subunit genes, which lie in a cluster on human chromosome 15, that were previously shown to have increased nicotine self-administration, for several responses to ethanol. Transgenic and wild-type mice did not differ in sensitivity to several acute behavioral responses to ethanol. However, transgenic mice drank less ethanol than wild-type in a two-bottle (ethanol vs. water) preference test. These results suggest a complex role for this receptor subunit gene cluster in the modulation of ethanol's as well as nicotine's effects. Copyright © 2012. Published by Elsevier Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu Xiaohong, E-mail: xuxh63@zjnu.cn; Ye Yinping; Li Tao
Bisphenol-A (BPA) is known to be a potent endocrine disrupter. Evidence is emerging that estrogen exerts a rapid influence on hippocampal synaptic plasticity and the dendritic spine density, which requires activation of NMDA receptors. In the present study, we investigated the effects of BPA (ranging from 1 to 1000 nM), focusing on the rapid dynamic changes in dendritic filopodia and the expressions of estrogen receptor (ER) {beta} and NMDA receptor, as well as the phosphorylation of NMDA receptor subunit NR2B in the cultured hippocampal neurons. A specific ER antagonist ICI 182,780 was used to examine the potential involvement of ERs.more » The results demonstrated that exposure to BPA (ranging from 10 to 1000 nM) for 30 min rapidly enhanced the motility and the density of dendritic filopodia in the cultured hippocampal neurons, as well as the phosphorylation of NR2B (pNR2B), though the expressions of NMDA receptor subunits NR1, NR2B, and ER{beta} were not changed. The antagonist of ERs completely inhibited the BPA-induced increases in the filopodial motility and the number of filopodia extending from dendrites. The increased pNR2B induced by BPA (100 nM) was also completely eliminated. Furthermore, BPA attenuated the effects of 17{beta}-estradiol (17{beta}-E{sub 2}) on the dendritic filopodia outgrowth and the expression of pNR2B when BPA was co-treated with 17{beta}-E{sub 2}. The present results suggest that BPA, like 17{beta}-E{sub 2}, rapidly results in the enhanced motility and density of dendritic filopodia in the cultured hippocampal neurons with the concomitant activation of NMDA receptor subunit NR2B via an ER-mediated signaling pathway. Meanwhile, BPA suppressed the enhancement effects of 17{beta}-E{sub 2} when it coexists with 17{beta}-E{sub 2}. These results provided important evidence suggesting the neurotoxicity of the low levels of BPA during the early postnatal development of the brain.« less
A Residue in Loop 9 of the β2-Subunit Stabilizes the Closed State of the GABAA Receptor*
Williams, Carrie A.; Bell, Shannon V.; Jenkins, Andrew
2010-01-01
In γ-aminobutyric acid type A (GABAA) receptors, the structural elements that couple ligand binding to channel opening remain poorly defined. Here, site-directed mutagenesis was used to determine if Loop 9 on the non-GABA binding site interface of the β2-subunit may be involved in GABAA receptor activation. Specifically, residues Gly170-Gln185 of the β2-subunit were mutated to alanine, co-expressed with wild-type α1- and γ2S-subunits in human embryonic kidney (HEK) 293 cells and assayed for their activation by GABA, the intravenous anesthetic propofol and the endogenous neurosteroid pregnanolone using whole cell macroscopic recordings. Three mutants, G170A, V175A, and G177A, produced 2.5-, 6.7-, and 5.6-fold increases in GABA EC50 whereas one mutant, Q185A, produced a 5.2-fold decrease in GABA EC50. None of the mutations affected the ability of propofol or pregnanolone to potentiate a submaximal GABA response, but the Q185A mutant exhibited 8.3- and 3.5-fold increases in the percent direct activation by propofol and pregnanolone, respectively. Mutant Q185A receptors also had an increased leak current that was sensitive to picrotoxin, indicating an increased gating efficiency. Further Q185E, Q185L, and Q185W substitutions revealed a strong correlation between the hydropathy of the amino acid at this position and the GABA EC50. Taken together, these results indicate that β2 Loop 9 is involved in receptor activation by GABA, propofol, and pregnanolone and that β2(Q185) participates in hydrophilic interactions that are important for stabilizing the closed state of the GABAA receptor. PMID:20007704
Blednov, Y.A.; Benavidez, J.M.; Black, M.; Chandra, D.; Homanics, G.E.; Rudolph, U.; Harris, R.A.
2012-01-01
GABA type A receptors (GABAA-R) are important for ethanol actions and it is of interest to link individual subunits with specific ethanol behaviors. We studied null mutant mice for six different GABAA-R subunits (α1, α2, α3, α4, α5 and δ). Only mice lacking the α2 subunit showed reduction of conditioned taste aversion (CTA) to ethanol. These results are in agreement with data from knock-in mice with mutation of the ethanol-sensitive site in the α2-subunit (Blednov et al., 2011) and indicate this aversive property of ethanol is dependent on ethanol action on α2-containing GABAA-R. Deletion of the α2-subunit led to faster recovery whereas absence of the α3-subunit slowed recovery from ethanol-induced incoordination (rotarod). Deletion of the other four subunits did not affect this behavior. Similar changes in this behavior for the α2 and α3 null mutants were found for flurazepam motor-incoordination. However, no differences in recovery were found in motor-incoordinating effects of an α1-selective modulator (zolpidem) or an α4-selective agonist (gaboxadol). Therefore, recovery of rotarod incoordination is under control of two GABAA-R subunits: α2 and α3. For motor activity, α3 null mice demonstrated higher activation by ethanol (1 g/kg) whereas both α2 and α3 (-/-) knockout mice were less sensitive to ethanol-induced reduction of motor activity (1.5 g/kg). These studies demonstrate that the effects of ethanol at GABAergic synapses containing α2 subunit are important for specific behavioral effects of ethanol which may be relevant to the genetic linkage of the α2 subunit with human alcoholism. PMID:23147414
Núñez-Acuña, Gustavo; Valenzuela-Muñoz, Valentina; Marambio, Jorge Pino; Wadsworth, Simon; Gallardo-Escárate, Cristian
2014-10-01
Although various elements of the olfactory system have been elucidated in insects, it remains practically unstudied in crustaceans at a molecular level. Among crustaceans, some species are classified as ectoparasites that impact the finfish aquaculture industry. Thus, there is an urgent need to identify and comprehend the signaling pathways used by these in host recognition. The present study, through RNA-seq and qPCR analyses, found novel transcripts involved in the olfactory system of Caligus rogercresseyi, in addition to the transcriptomic patterns expressed during different stages of salmon lice development. From a transcriptomic library generated by Illumina sequencing, contigs that annotated for ionotropic receptors and other genes implicated in the olfactory system were identified and extracted. Full length mRNA was obtained for the ionotropic glutamate receptor 25, which had 3923 bp, and for the glutamate receptor ionotropic kainate 2, which had 2737 bp. Furthermore, two other transcripts identified as glutamate receptor, ionotropic kainate 2-like were found. In silico analysis was performed for the transcription expression from different stages of development in C. rogercresseyi, and clusters according to RPKM values were constructed. Gene transcription data were validated through qPCR assays in ionotropic receptors, and showed an expression of glutamate receptor 25 associated with the copepodid stage whereas adults, especially male adults, were associated with the kainate 2 and kainate 2-like transcripts. Additionally, gene transcription analysis of the ionotropic receptors showed an overexpression in response to the presence of masking compounds and immunostimulant in salmon diets. This response correlated to a reduction in sea lice infection following in vivo challenge. Diets with masking compounds showed a decrease of lice infestation of up to 25%. This work contributes to the available knowledge on chemosensory systems in this ectoparasite, providing
Takehara, Akio; Hosokawa, Masayo; Eguchi, Hidetoshi; Ohigashi, Hiroaki; Ishikawa, Osamu; Nakamura, Yusuke; Nakagawa, Hidewaki
2007-10-15
Gamma-aminobutyric acid (GABA) functions primarily as an inhibitory neurotransmitter in the mature central nervous system, and GABA/GABA receptors are also present in nonneural tissues, including cancer, but their precise function in nonneuronal or cancerous cells has thus far been poorly defined. Through the genome-wide cDNA microarray analysis of pancreatic ductal adenocarcinoma (PDAC) cells as well as subsequent reverse transcription-PCR and Northern blot analyses, we identified the overexpression of GABA receptor pi subunit (GABRP) in PDAC cells. We also found the expression of this peripheral type GABAA receptor subunit in few adult human organs. Knockdown of endogenous GABRP expression in PDAC cells by small interfering RNA attenuated PDAC cell growth, suggesting its essential role in PDAC cell viability. Notably, the addition of GABA into the cell culture medium promoted the proliferation of GABRP-expressing PDAC cells, but not GABRP-negative cells, and GABAA receptor antagonists inhibited this growth-promoting effect by GABA. The HEK293 cells constitutively expressing exogenous GABRP revealed the growth-promoting effect of GABA treatment. Furthermore, GABA treatment in GABRP-positive cells increased intracellular Ca2+ levels and activated the mitogen-activated protein kinase/extracellular signal-regulated kinase (MAPK/Erk) cascade. Clinical PDAC tissues contained a higher level of GABA than normal pancreas tissues due to the up-regulation of glutamate decarboxylase 1 expression, suggesting their autocrine/paracrine growth-promoting effect in PDACs. These findings imply that GABA and GABRP could play important roles in PDAC development and progression, and that this pathway can be a promising molecular target for the development of new therapeutic strategies for PDAC.
Borbély, Sándor; Jócsák, Gergely; Moldován, Kinga; Sedlák, Éva; Preininger, Éva; Boldizsár, Imre; Tóth, Attila; Atlason, Palmi T; Molnár, Elek; Világi, Ildikó
2016-07-01
Lignans are biologically active phenolic compounds related to lignin, produced in different plants. Arctigenin, a dibenzylbutyrolactone-type lignan, has been used as a neuroprotective agent for the treatment of encephalitis. Previous studies of cultured rat cerebral cortical neurones raised the possibility that arctigenin inhibits kainate-induced excitotoxicity. The aims of the present study were: 1) to analyse the effect of arctigenin on normal synaptic activity in ex vivo brain slices, 2) to determine its receptor binding properties and test the effect of arctigenin on AMPA/kainate receptor activation and 3) to establish its effects on neuronal activity in vivo. Arctigenin inhibited glutamatergic transmission and reduced the evoked field responses. The inhibitory effect of arctigenin on the evoked field responses proved to be substantially dose dependent. Our results indicate that arctigenin exerts its effects under physiological conditions and not only on hyper-excited neurons. Furthermore, arctigenin can cross the blood-brain barrier and in the brain it interacts with kainate sensitive ionotropic glutamate receptors. These results indicate that arctigenin is a potentially useful new pharmacological tool for the inhibition of glutamate-evoked responses in the central nervous system in vivo. Copyright © 2016 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCormick, D.J.; Griesmann, G.E.; Huang, Z.
1986-03-05
A synthetic peptide corresponding to residues 125-147 of the Torpedo acetylcholine receptor (AChR) ..cap alpha.. subunit proved to be a major antigenic region of the AChR. Rats inoculated with 50 ..mu..g of peptide (T ..cap alpha.. 125-147) developed T cell immunity and antibodies to native AChR and signs of experimental autoimmune myasthenia gravis. They report the synthesis and preliminary testing of a disulfide-looped peptide comprising residues 125-147 of the human AChR ..cap alpha.. subunit. Peptide H ..cap alpha.. 125-147 differs from T ..cap alpha.. 125-147 at residues 139 (Glu for Gln) and 143 (Ser for Thr). In immunoprecipitation assays, antibodiesmore » to Torpedo AChR bound /sup 125/I-labelled H..cap alpha.. 125-147 antibody bound H..cap alpha.. 125-147, but monoclonal antibodies to an immunodominant region of native AChR bound neither H..cap alpha.. 125-147 nor T ..cap alpha.. 125-147. Rats immunized with H ..cap alpha.. 125-147 produced anti-mammalian muscle AChR antibodies that induced modulation of AChRs from cultured human myotubes. Thus, region 125-147 of the human AChR ..cap alpha.. subunit is extracellular in muscle, and is both antigenic and immunogenic. It remains to be determined whether or not autoantibodies to this region may in part cause the weakness or myasthenia gravis in man.« less
Hellier, J L; Patrylo, P R; Buckmaster, P S; Dudek, F E
1998-06-01
Human temporal lobe epilepsy is associated with complex partial seizures that can produce secondarily generalized seizures and motor convulsions. In some patients with temporal lobe epilepsy, the seizures and convulsions occur following a latent period after an initial injury and may progressively increase in frequency for much of the patient's life. Available animal models of temporal lobe epilepsy are produced by acute treatments that often have high mortality rates and/or are associated with a low proportion of animals developing spontaneous chronic motor seizures. In this study, rats were given multiple low-dose intraperitoneal (i.p.) injections of kainate in order to minimize the mortality rate usually associated with single high-dose injections. We tested the hypothesis that these kainate-treated rats consistently develop a chronic epileptic state (i.e. long-term occurrence of spontaneous, generalized seizures and motor convulsions) following a latent period after the initial treatment. Kainate (5 mg/kg per h, i.p.) was administered to rats every hour for several hours so that class III-V seizures were elicited for > or = 3 h, while control rats were treated similarly with saline. This treatment protocol had a relatively low mortality rate (15%). After acute treatment, rats were observed for the occurrence of motor seizures for 6-8 h/week. Nearly all of the kainate-treated rats (97%) had two or more spontaneous motor seizures months after treatment. With this observation protocol, the average latency for the first spontaneous motor seizure was 77+/-38 (+/-S.D.) days after treatment. Although variability was observed between rats, seizure frequency initially increased with time after treatment, and nearly all of the kainate-treated rats (91%) had spontaneous motor seizures until the time of euthanasia (i.e. 5-22 months after treatment). Therefore, multiple low-dose injections of kainate, which cause recurrent motor seizures for > or = 3 h, lead to the
Motaghinejad, Majid; Motevalian, Manijeh; Fatima, Sulail; Beiranvand, Tabassom; Mozaffari, Shiva
2017-11-01
Chronic abuse of methylphenidate (MPH) often causes neuronal cell death. Topiramate (TPM) carries neuroprotective effects, but its exact mechanism of action remains unclear. In the present study, the role of various doses of TPM and its possible mechanisms, receptors and signaling pathways involved against MPH-induced hippocampal neurodegeneration were evaluated in vivo. Thus, domoic acid (DOM) was used as AMPA/kainate receptor agonist, bicuculline (BIC) as GABA A receptor antagonist, ketamine (KET) as NMDA receptor antagonist, yohimbine (YOH) as α 2 adrenergic receptor antagonist and haloperidol (HAL) was used as dopamine D 2 receptor antagonist. Open field test (OFT) was used to investigate the disturbances in motor activity. Hippocampal neurodegenerative parameters were evaluated. Protein expressions of CREB/BDNF and Akt/GSK3 signaling pathways were also evaluated. Cresyl violet staining was performed to show and confirm the changes in the shape of the cells. TPM (70 and 100 mg/kg) reduced MPH-induced rise in lipid peroxidation, oxidized form of glutathione (GSSG), IL-1β and TNF-α levels, Bax expression and motor activity disturbances. In addition, TPM treatment increased Bcl-2 expression, the level of reduced form of glutathione (GSH) and the levels and activities of superoxide dismutase, glutathione peroxidase and glutathione reductase enzymes. TPM also inhibited MPH-induced hippocampal degeneration. Pretreatment of animals with DOM, BIC, KET and YOH inhibited TPM-induced neuroprotection and increased oxidative stress, neuroinflammation, neuroapoptosis and neurodegeneration while reducing CREB, BDNF and Akt protein expressions. Also pretreatment with DOM, BIC, KET and YOH inhibited TPM-induced decreases in GSK3. It can be concluded that the mentioned receptors by modulation of CREB/BDNF and Akt/GSK3 pathways, are involved in neuroprotection of TPM against MPH-induced neurodegeneration.
Daneshparvar, Hamidreza; Sadat-Shirazi, Mitra-Sadat; Fekri, Monir; Khalifeh, Solmaz; Ziaie, Ali; Esfahanizadeh, Nasrin; Vousooghi, Nasim; Zarrindast, Mohammad-Reza
2018-05-16
Addiction is a chronic relapsing disorder and is one of the most important issues in the world. Changing the level of neurotransmitters and the activities of their receptors, play a major role in the pathophysiology of substance abuse disorders. It is well-established that N-methyl-D-aspartate receptors (NMDARs) play a significant role in the molecular basis of addiction. NMDAR has two obligatory GluN1 and two regionally localized GluN2 subunits. This study investigated changes in the protein level of GluN1, GluN2A, and GluN2B in the prefrontal cortex of drug abusers. The medial prefrontal cortex (mPFC), lateral prefrontal cortex (lPFC), and orbitofrontal cortex (OFC) were dissected from the brain of 101 drug addicts brains and were compared with the brains of non-addicts (N = 13). Western blotting technique was used to show the alteration in NMDAR subunits level. Data obtained using Western blotting technique showed a significant increase in the level of GluN1 and GluN2B, but not in GluN2A subunits in all the three regions (mPFC, lPFC, and OFC) of men whom suffered from addiction as compared to the appropriate controls. These findings showed a novel role for GluN1, GluN2B subunits, rather than the GluN2A subunit of NMDARs, in the pathophysiology of addiction and suggested their role in the drug-induced plasticity of NMDARs.
Lipsky, Robert H
2015-01-01
For more than 40 years following its approval by the Food and Drug Administration (FDA) as an anesthetic, ketamine, a non-competitive N-methyl-d-aspartic acid (NMDA) receptor antagonist, has been used as a tool of psychiatric research. As a psychedelic drug, ketamine induces psychotic symptoms, cognitive impairment, and mood elevation, which resemble some symptoms of schizophrenia. Recreational use of ketamine has been increasing in recent years. However, little is known of the underlying molecular mechanisms responsible for ketamine-associated psychosis. Recent animal studies have shown that repeated ketamine administration significantly increases NMDA receptor subunit gene expression, in particular subunit 1 (NR1 or GluN1) levels. This results in neurodegeneration, supporting a potential mechanism where up-regulation of NMDA receptors could produce cognitive deficits in chronic ketamine abuse patients. In other studies, NMDA receptor gene variants are associated with addictive behavior. Here, we focus on the roles of NMDA receptor gene subunits in ketamine abuse and ketamine psychosis and propose that full sequencing of NMDA receptor genes may help explain individual vulnerability to ketamine abuse and ketamine-associated psychosis. PMID:25245072
Saransaari, P; Oja, S S
1997-12-30
The inhibitory amino acid taurine has been held to function as a modulator and osmoregulator in the brain, being of particular importance in the immature brain. The release of preloaded [3H]taurine was now studied in hippocampal slices from developing (7-day-old), adult (3-month-old) and ageing (6-24-month-old) mice focussing on the effects of agonists of ionotropic glutamate receptors. N-methyl-D-aspartate (NMDA), kainate and 2-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) potentiated taurine release concentration-dependently at each age, more so in the immature than in the adult and ageing hippocampus. The effect of kainate was blocked by 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) in the developing and aged hippocampus and those of AMPA and NMDA by 6-nitro-7-sulphamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and dizocilpine a(MK-801) at every age studied. This indicates the involvement of NMDA and AMPA receptors in taurine release throughout the life-span of mice, while the kainate-receptor-mediated release does not appear to function in adults. The increased hippocampal taurine release evoked by ionotropic glutamate receptors could act neuroprotectively, counteracting by several mechanisms the harmful effects of the simultaneous release of excitatory amino acids. The substantial release of taurine in the immature hippocampus might be particularly significant in view of the vulnerability of brain tissue to excitotoxicity at early age.
An, Kwang Wook; Lee, Jehee; Choi, Cheol Young
2010-08-01
To quantify the sex-change progression from male to female in the cinnamon clownfish, Amphiprion melanopus, we divided gonadal development into three stages (I, mature male; II, male at 90 days after removal of the female; and III, mature female), and the expression of GTH subunits and GTH receptors during each of these stages was investigated. The mRNA of the three GTH subunits and their receptors increased with progression from male to female. To understand the effect of gonadotropin-releasing hormone (GnRH) on this progression, we examined expression of genes encoding the GTH subunit mRNA in the pituitary and the GTH-receptor mRNA in the gonads in addition to investigating changes in plasma E(2) levels after GnRH analogue (GnRHa) injection. GnRHa treatment increased mRNA expression levels of these genes, as well as plasma E(2) levels, indicating that GnRH plays an important regulatory role in the brain-pituitary-gonad axis of immature cinnamon clownfish. Copyright (c) 2010 Elsevier Inc. All rights reserved.
Identification of an inhibitory Zn2+ binding site on the human glycine receptor α1 subunit
Harvey, Robert J; Thomas, Philip; James, Colin H; Wilderspin, Andrew; Smart, Trevor G
1999-01-01
Whole-cell glycine-activated currents were recorded from human embryonic kidney (HEK) cells expressing wild-type and mutant recombinant homomeric glycine receptors (GlyRs) to locate the inhibitory binding site for Zn2+ ions on the human α1 subunit. Glycine-activated currents were potentiated by low concentrations of Zn2+ (<10 μm) and inhibited by higher concentrations (>100 μm) on wild-type α1 subunit GlyRs. Lowering the external pH from 7.4 to 5.4 inhibited the glycine responses in a competitive manner. The inhibition caused by Zn2+ was abolished leaving an overt potentiating effect at 10 μm Zn2+ that was exacerbated at 100 μm Zn2+. The identification of residues involved in the formation of the inhibitory binding site was also assessed using diethylpyrocarbonate (DEPC), which modifies histidines. DEPC (1 mm) abolished Zn2+-induced inhibition and also the potentiation of glycine-activated currents by Zn2+. The reduction in glycine-induced whole-cell currents in the presence of high (100 μm) concentrations of Zn2+ did not increase the rate of glycine receptor desensitisation. Systematic mutation of extracellular histidine residues in the GlyR α1 subunit revealed that mutations H107A or H109A completely abolished inhibition of glycine-gated currents by Zn2+. However, mutation of other external histidines, H210, H215 and H419, failed to prevent inhibition by Zn2+ of glycine-gated currents. Thus, H107 and H109 in the extracellular domain of the human GlyR α1 subunit are major determinants of the inhibitory Zn2+ binding site. An examination of Zn2+ co-ordination in metalloenzymes revealed that the histidine- hydrophobic residue-histidine motif found to be responsible for binding Zn2+ in the human GlyR α1 subunit is also shared by some of these enzymes. Further comparison of the structure and location of this motif with a generic model of the GlyR α1 subunit suggests that H107 and H109 participate in the formation of the inhibitory Zn2+ binding site at the
Nivison-Smith, Lisa; Khoo, Pauline; Acosta, Monica L; Kalloniatis, Michael
2018-02-01
Retinal ischemia is involved in the pathogenesis of many major vision threatening diseases. Vinpocetine is a natural drug, which has a range of neuroprotective actions against retinal ischemia including modulating cation flow, improving metabolic activity and preventing apoptosis. The exact mechanism behind these actions remains unknown but may involve glutamate receptors, major components of the ischemic cascade. This study examined the effects of vinpocetine in association with specific ionotropic glutamate receptor agonists: N-methyl-D-aspartate (NMDA) and kainate. Vinpocetine's actions to improve cation channel permeability and cell marker immunoreactivity following ischemia appeared to be limited to NMDA activation with no changes observed following kainate stimulation. Vinpocetine's actions were lost in the presence of an NMDA receptor inhibitor further suggesting they may be secondary to NMDA receptor activation. NMDA receptor function was also necessary for vinpocetine's actions on glucose availability during ischemia but not lactate dehydrogenase (LDH) activity in the ischemic retina suggesting not all of vinpocetine's actions are linked to NMDA receptor function. These results may explain vinpocetine's effectiveness as a neuroprotective agent as the NMDA receptor is implicated in the pathogenesis of ischemia in a range of tissues of the central nervous system. Copyright © 2017 Elsevier Ltd. All rights reserved.
Fernández-Cabrera, Mónica R; Selvas, Abraham; Miguéns, Miguel; Higuera-Matas, Alejandro; Vale-Martínez, Anna; Ambrosio, Emilio; Martí-Nicolovius, Margarita; Guillazo-Blanch, Gemma
2017-04-21
The rodent parafascicular nucleus (PFn) or the centromedian-parafascicular complex of primates is a posterior intralaminar nucleus of the thalamus related to cortical activation and maintenance of states of consciousness underlying attention, learning and memory. Deep brain stimulation (DBS) of the PFn has been proved to restore arousal and consciousness in humans and to enhance performance in learning and memory tasks in rats. The primary expected effect of PFn DBS is to induce plastic changes in target neurons of brain areas associated with cognitive function. In this study, Wistar rats were stimulated for 20mins in the PFn following a DBS protocol that had previously facilitated memory in rats. NMDA and GABA B receptor binding, and gene expression of the GluN1subunit of the NMDA receptor (NMDAR) were assessed in regions related to cognitive functions, such as the prefrontal cortex and hippocampus. The results showed that PFn DBS induced a decrease in NMDAR GluN1 subunit gene expression in the cingulate and prelimbic cortices, but no significant statistical differences were found in the density of NMDA or GABA B receptors in any of the analyzed regions. Taken together, our findings suggest a possible role for the NMDAR GluN1 subunit in the prefrontal cortex in the procognitive actions of the PFn DBS. Copyright © 2017 IBRO. Published by Elsevier Ltd. All rights reserved.
Savić, Miroslav M.; Clayton, Terry; Furtmüller, Roman; Gavrilović, Ivana; Samardžić, Janko; Savić, Snežana; Huck, Sigismund; Sieghart, Werner; Cook, James M.
2008-01-01
Benzodiazepine (BZ) site ligands affect vigilance, anxiety, memory processes, muscle tone and epileptogenic propensity through modulation of neurotransmission at GABAA receptors containing α1, α2, α3 or α5 subunits, and may have numerous experimental and clinical applications. The ability of nonselective BZ site inverse agonists to enhance cognition, documented in animal models and human studies, is clinically not feasible due to potentially unacceptable psychomotor effects. Most investigations to date have proposed the α1 and/or α5 subunit-containing GABAA receptors as comprising the memory-modulating population of these receptors. The novel ligand PWZ-029, which we synthesised and characterized electrophysiologically, possesses in vitro binding selectivity and moderate inverse agonist functional selectivity at α5-containing GABAA receptors. This ligand has also been examined in rats in the passive and active avoidance, spontaneous locomotor activity, elevated plus maze and grip strength tests, primarily predictive of the effects on the memory acquisition, basal locomotor activity, anxiety level and muscle tone, respectively. The improvement of task learning was detected at the dose of 5 mg/kg in the passive, but not active avoidance test. The inverse agonist PWZ-029 had no effect on anxiety or muscle tone, whereas at higher doses (10 and 20 mg/kg) it decreased locomotor activity. This effect was antagonized by flumazenil and also by the lower (but not the higher) dose of an agonist (SH-053-R-CH3-2’F) selective for GABAA receptors containing the α5 subunit. The hypolocomotor effect of PWZ-029 was not antagonized by the antagonist β-CCt exhibiting a preferential affinity for α1-subunit containing receptors. These data suggest that moderate negative modulation at GABAA receptors containing the α5 subunit is a sufficient condition for eliciting enhanced encoding/consolidation of declarative memory, while the influence of higher doses of modulators at
Structure of the Zinc-Bound Amino-Terminal Domain of the NMDA Receptor NR2B Subunit
DOE Office of Scientific and Technical Information (OSTI.GOV)
Karakas, E.; Simorowski, N; Furukawa, H
2009-01-01
N-methyl-D-aspartate (NMDA) receptors belong to the family of ionotropic glutamate receptors (iGluRs) that mediate the majority of fast excitatory synaptic transmission in the mammalian brain. One of the hallmarks for the function of NMDA receptors is that their ion channel activity is allosterically regulated by binding of modulator compounds to the extracellular amino-terminal domain (ATD) distinct from the L-glutamate-binding domain. The molecular basis for the ATD-mediated allosteric regulation has been enigmatic because of a complete lack of structural information on NMDA receptor ATDs. Here, we report the crystal structures of ATD from the NR2B NMDA receptor subunit in the zinc-freemore » and zinc-bound states. The structures reveal the overall clamshell-like architecture distinct from the non-NMDA receptor ATDs and molecular determinants for the zinc-binding site, ion-binding sites, and the architecture of the putative phenylethanolamine-binding site.« less
Deletion of the GluA1 AMPA Receptor Subunit Alters the Expression of Short-Term Memory
ERIC Educational Resources Information Center
Sanderson, David J.; Sprengel, Rolf; Seeburg, Peter H.; Bannerman, David M.
2011-01-01
Deletion of the GluA1 AMPA receptor subunit selectively impairs short-term memory for spatial locations. We further investigated this deficit by examining memory for discrete nonspatial visual stimuli in an operant chamber. Unconditioned suppression of magazine responding to visual stimuli was measured in wild-type and GluA1 knockout mice.…
Blednov, Y A; Benavidez, J M; Black, M; Chandra, D; Homanics, G E; Rudolph, U; Harris, R A
2013-04-01
GABA type A receptors (GABA(A)-R) are important for ethanol actions and it is of interest to link individual subunits with specific ethanol behaviors. We studied null mutant mice for six different GABA(A)-R subunits (α1, α2, α3, α4, α5 and δ). Only mice lacking the α2 subunit showed reduction of conditioned taste aversion (CTA) to ethanol. These results are in agreement with data from knock-in mice with mutation of the ethanol-sensitive site in the α2-subunit (Blednov et al., 2011). All together, they indicate that aversive property of ethanol is dependent on ethanol action on α2-containing GABA(A)-R. Deletion of the α2-subunit led to faster recovery whereas absence of the α3-subunit slowed recovery from ethanol-induced incoordination (rotarod). Deletion of the other four subunits did not affect this behavior. Similar changes in this behavior for the α2 and α3 null mutants were found for flurazepam motor incoordination. However, no differences in recovery were found in motor-incoordinating effects of an α1-selective modulator (zolpidem) or an α4-selective agonist (gaboxadol). Therefore, recovery of rotarod incoordination is under control of two GABA(A)-R subunits: α2 and α3. For motor activity, α3 null mice demonstrated higher activation by ethanol (1 g/kg) whereas both α2 (-/-) and α3 (-/Y) knockout mice were less sensitive to ethanol-induced reduction of motor activity (1.5 g/kg). These studies demonstrate that the effects of ethanol at GABAergic synapses containing α2 subunit are important for specific behavioral effects of ethanol which may be relevant to the genetic linkage of the α2 subunit with human alcoholism. Copyright © 2012 Elsevier Ltd. All rights reserved.
Taste responses in mice lacking taste receptor subunit T1R1
Kusuhara, Yoko; Yoshida, Ryusuke; Ohkuri, Tadahiro; Yasumatsu, Keiko; Voigt, Anja; Hübner, Sandra; Maeda, Katsumasa; Boehm, Ulrich; Meyerhof, Wolfgang; Ninomiya, Yuzo
2013-01-01
The T1R1 receptor subunit acts as an umami taste receptor in combination with its partner, T1R3. In addition, metabotropic glutamate receptors (brain and taste variants of mGluR1 and mGluR4) are thought to function as umami taste receptors. To elucidate the function of T1R1 and the contribution of mGluRs to umami taste detection in vivo, we used newly developed knock-out (T1R1−/−) mice, which lack the entire coding region of the Tas1r1 gene and express mCherry in T1R1-expressing cells. Gustatory nerve recordings demonstrated that T1R1−/− mice exhibited a serious deficit in inosine monophosphate-elicited synergy but substantial residual responses to glutamate alone in both chorda tympani and glossopharyngeal nerves. Interestingly, chorda tympani nerve responses to sweeteners were smaller in T1R1−/− mice. Taste cell recordings demonstrated that many mCherry-expressing taste cells in T1R1+/− mice responded to sweet and umami compounds, whereas those in T1R1−/− mice responded to sweet stimuli. The proportion of sweet-responsive cells was smaller in T1R1−/− than in T1R1+/− mice. Single-cell RT-PCR demonstrated that some single mCherry-expressing cells expressed all three T1R subunits. Chorda tympani and glossopharyngeal nerve responses to glutamate were significantly inhibited by addition of mGluR antagonists in both T1R1−/− and T1R1+/− mice. Conditioned taste aversion tests demonstrated that both T1R1−/− and T1R1+/− mice were equally capable of discriminating glutamate from other basic taste stimuli. Avoidance conditioned to glutamate was significantly reduced by addition of mGluR antagonists. These results suggest that T1R1-expressing cells mainly contribute to umami taste synergism and partly to sweet sensitivity and that mGluRs are involved in the detection of umami compounds. PMID:23339178
Jiang, Yan; Jakovcevski, Mira; Bharadwaj, Rahul; Connor, Caroline; Schroeder, Frederick A.; Lin, Cong L.; Straubhaar, Juerg; Martin, Gilles; Akbarian, Schahram
2010-01-01
Histone methyltransferases specific for the histone H3-lysine 9 (H3K9) residue, including Setdb1 (Set domain, bifurcated 1)/Eset/Kmt1e are associated with repressive chromatin remodeling and expressed in adult brain, but potential effects on neuronal function and behavior remain unexplored. Here, we report that transgenic mice with increased Setdb1 expression in adult forebrain neurons show antidepressant-like phenotypes in behavioral paradigms for anhedonia, despair and learned helplessness. Chromatin immunoprecipitation in conjunction with DNA tiling arrays (ChIP-chip) revealed that genomic occupancies of neuronal Setdb1 are limited to less than 1% of annotated genes, which include the NMDA receptor subunit NR2B/Grin2B and other ionotropic glutamate receptor genes. Chromatin conformation capture (“3C”) and Setdb1-ChIP revealed a loop formation tethering the NR2B/Grin2b promoter to the Setdb1 target site positioned 30Kb downstream of the transcription start site. In hippocampus and ventral striatum, two key structures in the neuronal circuitry regulating mood-related behaviors, Setdb1-mediated repressive histone methylation at NR2B/Grin2b was associated with decreased NR2B expression and EPSP insensitivity to pharmacological blockade of NR2B, and accelerated NMDA receptor desensitization consistent with a shift in NR2A/B subunit ratios. In wildtype mice, systemic treatment with the NR2B antagonist, Ro-256981, and hippocampal siRNA-mediated NR2B/Grin2b knockdown, resulted in behavioral changes similar to those elicited by the Setdb1 transgene. Together, these findings point to a role for neuronal Setdb1 in the regulation of affective and motivational behaviors through repressive chromatin remodeling at a select set of target genes, resulting in altered NMDA receptor subunit composition and other molecular adaptations. PMID:20505083
Shoaib, M; Gommans, J; Morley, A; Stolerman, I P; Grailhe, R; Changeux, J-P
2002-03-01
The subtypes of nicotinic receptors at which the behavioural effects of nicotine originate are not fully understood. These experiments use mice lacking the beta2 subunit of nicotinic receptors to investigate its role in nicotine discrimination and conditioned taste aversion (CTA). Wild-type and mutant mice were trained either in a two-lever nicotine discrimination procedure using a tandem schedule of food reinforcement, or in a counterbalanced two-flavour CTA procedure. Rates of lever-pressing of wild-type and mutant mice did not differ. Wild-type mice acquired discrimination of nicotine (0.4 or 0.8 mg/kg) rapidly and exhibited steep dose-response curves. Mutant mice failed to acquire these nicotine discriminations and exhibited flat dose-response curves. Both wild-type and mutant mice acquired discrimination of nicotine (1.6 mg/kg) although discrimination performance was weak in the mutants. Nicotine initially reduced response rates in wild-type and mutant mice, and tolerance developed to this effect in each genotype. Both genotypes acquired discrimination of morphine (3 mg/kg) with similar degrees of accuracy, and dose-response curves for morphine discrimination in the two genotypes were indistinguishable. Nicotine produced dose-related CTA in both genotypes, but the magnitude of the effect was less in the mutants than in the wild-type controls. It is concluded that nicotinic receptors containing the beta2 subunit play a major role in the discriminative stimulus and taste aversion effects of nicotine that may reflect psychological aspects of tobacco dependence. Such receptors appear to have a less crucial role in the response-rate, reducing effects of nicotine and in nicotine tolerance.
Osgood, Doreen B; Harrington, William F; Kenney, Elizabeth V; Harrington, J Frederick
2013-01-01
The authors have previously demonstrated that human herniated disc material contains high concentrations of free glutamate. In an experimental model, elevated epidural glutamate concentrations in the lumbar spine can cause a focal hyperesthetic state. Rats underwent epidural glutamate infusion in the lumbar spine by a miniosmotic pump over a 72-hour period. Some rats underwent coinfusion with glutamate and ionotropic glutamate antagonists. Nociception was assessed by von Frey fibers and by assessment of glutamate receptor expression in the corresponding dorsal horn of the spinal cord. The kainic acid antagonist, UBP 301, decreased epidural glutamate-based hyperesthesia in a dose dependent manner. Concordant with these findings, there was significant decrease in kainate receptor expression in the dorsal horn. The N-Methyl-4-isoxazoleproionic acid (NMDA) antagonist Norketamine also significantly diminished hyperesthesia and decreased receptor expression in the dorsal horn. Both UBP 301, the kainic acid receptor antagonist and Norketamine, an NMDA receptor antagonist, dampened epidural glutamate-based nociception. Focal epidural injections of Kainate or NMDA receptor antagonists could be effective treatments for disc herniation-based lumbar radiculopathy.
Variant ionotropic glutamate receptors as chemosensory receptors in Drosophila
Benton, Richard; Vannice, Kirsten S.; Gomez-Diaz, Carolina; Vosshall, Leslie B.
2009-01-01
Summary Ionotropic glutamate receptors (iGluRs) mediate neuronal communication at synapses throughout vertebrate and invertebrate nervous systems. We have characterized a novel family of iGluR-related genes in Drosophila, which we name Ionotropic Receptors (IRs). These receptors do not belong to the well-described Kainate, AMPA, or NMDA classes of iGluRs, and have divergent ligand-binding domains that lack their characteristic glutamate-interacting residues. IRs are expressed in a combinatorial fashion in sensory neurons that respond to many distinct odors but do not express either insect odorant receptors (ORs) or gustatory receptors (GRs). IR proteins accumulate in sensory dendrites and not at synapses. Mis-expression of IRs induces novel odor responses in ectopic neurons. Together, these results lead us to propose that the IRs comprise a novel family of chemosensory receptors. Conservation of IR/iGluR-related proteins in bacteria, plants, and animals suggests that this receptor family represents an evolutionarily ancient mechanism for sensing both internal and external chemical cues. PMID:19135896
Amino acid sequence of the human fibronectin receptor
1987-01-01
The amino acid sequence deduced from cDNA of the human placental fibronectin receptor is reported. The receptor is composed of two subunits: an alpha subunit of 1,008 amino acids which is processed into two polypeptides disulfide bonded to one another, and a beta subunit of 778 amino acids. Each subunit has near its COOH terminus a hydrophobic segment. This and other sequence features suggest a structure for the receptor in which the hydrophobic segments serve as transmembrane domains anchoring each subunit to the membrane and dividing each into a large ectodomain and a short cytoplasmic domain. The alpha subunit ectodomain has five sequence elements homologous to consensus Ca2+- binding sites of several calcium-binding proteins, and the beta subunit contains a fourfold repeat strikingly rich in cysteine. The alpha subunit sequence is 46% homologous to the alpha subunit of the vitronectin receptor. The beta subunit is 44% homologous to the human platelet adhesion receptor subunit IIIa and 47% homologous to a leukocyte adhesion receptor beta subunit. The high degree of homology (85%) of the beta subunit with one of the polypeptides of a chicken adhesion receptor complex referred to as integrin complex strongly suggests that the latter polypeptide is the chicken homologue of the fibronectin receptor beta subunit. These receptor subunit homologies define a superfamily of adhesion receptors. The availability of the entire protein sequence for the fibronectin receptor will facilitate studies on the functions of these receptors. PMID:2958481
Differential agonist sensitivity of glycine receptor α2 subunit splice variants
Miller, Paul S; Harvey, Robert J; Smart, Trevor G
2004-01-01
The glycine receptor (GlyR) α2A and α2B splice variants differ by a dual, adjacent amino acid substitution from α2AV58,T59 to α2BI58,A59 in the N-terminal extracellular domain. Comparing the effects of the GlyR agonists, glycine, β-alanine and taurine, on the GlyR α2 isoforms, revealed a significant increase in potency for all three agonists at the α2B variant. The sensitivities of the splice variants to the competitive antagonist, strychnine, and to the biphasic modulator Zn2+, were comparable. In contrast, the allosteric inhibitor picrotoxin was more potent on GlyR α2A compared to GlyR α2B receptors. Coexpression of α2A or α2B subunits with the GlyR β subunit revealed that the higher agonist potencies observed with the α2B homomer were retained for the α2Bβ heteromer. The identical sensitivity to strychnine combined with a reduction in the maximum current induced by the partial agonist taurine at the GlyR α2A homomer, suggested that the changed sensitivity to agonists is in accordance with a modulation of agonist efficacy rather than agonist affinity. An effect on agonist efficacy was also supported by using a structural model of the GlyR, localising the region of splice variation to the proposed docking region between GlyR loop 2 and the TM2-3 loop, an area associated with channel activation. The existence of a spasmodic mouse phenotype linked to a GlyR α1A52S mutation, the equivalent position to the source of the α2 splice variation, raises the possibility that the GlyR α2 splice variants may be responsible for distinct roles in neuronal function. PMID:15302677
Tong, Xiaoping; Peng, Zechun; Zhang, Nianhui; Cetina, Yliana; Huang, Christine S.; Wallner, Martin; Otis, Thomas S.
2015-01-01
The role of GABAA receptor (GABAAR)-mediated tonic inhibition in interneurons remains unclear and may vary among subgroups. Somatostatin (SOM) interneurons in the hilus of the dentate gyrus show negligible expression of nonsynaptic GABAAR subunits and very low tonic inhibition. To determine the effects of ectopic expression of tonic GABAAR subtypes in these neurons, Cre-dependent viral vectors were used to express GFP-tagged GABAAR subunits (α6 and δ) selectively in hilar SOM neurons in SOM-Cre mice. In single-transfected animals, immunohistochemistry demonstrated strong expression of either the α6 or δ subunit; in cotransfected animals, both subunits were consistently expressed in the same neurons. Electrophysiology revealed a robust increase of tonic current, with progressively larger increases following transfection of δ, α6, and α6/δ subunits, respectively, indicating formation of functional receptors in all conditions and likely coassembly of the subunits in the same receptor following cotransfection. An in vitro model of repetitive bursting was used to determine the effects of increased tonic inhibition in hilar SOM interneurons on circuit activity in the dentate gyrus. Upon cotransfection, the frequency of GABAAR-mediated bursting in granule cells was reduced, consistent with a reduction in synchronous firing among hilar SOM interneurons. Moreover, in vivo studies of Fos expression demonstrated reduced activation of α6/δ-cotransfected neurons following acute seizure induction by pentylenetetrazole. The findings demonstrate that increasing tonic inhibition in hilar SOM interneurons can alter dentate gyrus circuit activity during strong stimulation and suggest that tonic inhibition of interneurons could play a role in regulating excessive synchrony within the network. SIGNIFICANCE STATEMENT In contrast to many hippocampal interneurons, somatostatin (SOM) neurons in the hilus of the dentate gyrus have very low levels of nonsynaptic GABAARs and exhibit
Crockett, Sara; Baur, Roland; Kunert, Olaf; Belaj, Ferdinand; Sigel, Erwin
2016-02-15
A phytochemical investigation of the lipophilic extract of Hypericum lissophloeus (smoothbark St. John's wort, Hypericaceae) was conducted, resulting in the isolation and identification of a new chromanone derivative: 5,7-dihydroxy-2,3-dimethyl-6-(3-methyl-but-2-enyl)-chroman-4-one (1). This compound was demonstrated to act as a potent stimulator of currents elicited by GABA in recombinant α1β2γ2 GABAA receptors, with a half-maximal potentiation observed at a concentration of about 4μM and a maximal potentiation of >4000%. Significant potentiation was already evident at a concentration as low as 0.1μM. Extent of potentiation strongly depends on the type of α subunit, the type of β subunit and the presence of the γ subunit. Copyright © 2016 Elsevier Ltd. All rights reserved.
Ihara, Makoto; Hikida, Mai; Matsushita, Hiroyuki; Yamanaka, Kyosuke; Kishimoto, Yuya; Kubo, Kazuki; Watanabe, Shun; Sakamoto, Mifumi; Matsui, Koutaro; Yamaguchi, Akihiro; Okuhara, Daiki; Furutani, Shogo; Sattelle, David B; Matsuda, Kazuhiko
2018-06-01
Neonicotinoid insecticides interact with the orthosteric site formed at subunit interfaces of insect nicotinic ACh (nACh) receptors. However, their interactions with the orthosteric sites at α-non α and α-α subunit interfaces remain poorly understood. The aim of this study was to elucidate the mechanism of neonicotinoid actions using the Drosophila Dα1-chicken β2 hybrid nACh receptor. Computer models of the (Dα1) 3 (β2) 2 nACh receptor in complex with imidacloprid and thiacloprid were generated. Amino acids in the Dα1 subunit were mutated to corresponding amino acids in the human α4 subunit to examine their effects on the agonist actions of neonicotinoids on (Dα1) 3 (β2) 2 and (Dα1) 2 (β2) 3 nACh receptors expressed in Xenopus laevis oocytes using voltage-clamp electrophysiology. The (Dα1) 3 (β2) 2 nACh receptor models indicated that amino acids in loops D, E and G probably determine the effects of neonicotinoids. The amino acid mutations tested had minimal effects on the EC 50 for ACh. However, the R57S mutation in loop G, although having minimal effect on imidacloprid's actions, reduced the affinity of thiacloprid for the (Dα1) 3 (β2) 2 nACh receptor, while scarcely affecting thiacloprid's action on the (Dα1) 2 (β2) 3 nACh receptor. Both the K140T and the combined R57S;K140T mutations reduced neonicotinoid efficacy but only for the (Dα1) 3 (β2) 2 nACh receptor. Combining the E78K mutation with the R57S;K140T mutations resulted in a selective reduction of thiacloprid's affinity for the (Dα1) 3 (β2) 2 nACh receptor. These findings suggest that a triangle of residues from loops D, E and G contribute to the selective actions of neonicotinoids on insect-vertebrate hybrid nACh receptors. This article is part of a themed section on Nicotinic Acetylcholine Receptors. To view the other articles in this section visit http://onlinelibrary.wiley.com/doi/10.1111/bph.v175.11/issuetoc. © 2017 The British Pharmacological Society.
Analysis of the Subunit Stoichiometries in Viral Entry
Magnus, Carsten; Regoes, Roland R.
2012-01-01
Virions of the Human Immunodeficiency Virus (HIV) infect cells by first attaching with their surface spikes to the CD4 receptor on target cells. This leads to conformational changes in the viral spikes, enabling the virus to engage a coreceptor, commonly CCR5 or CXCR4, and consecutively to insert the fusion peptide into the cellular membrane. Finally, the viral and the cellular membranes fuse. The HIV spike is a trimer consisting of three identical heterodimers composed of the gp120 and gp41 envelope proteins. Each of the gp120 proteins in the trimer is capable of attaching to the CD4 receptor and the coreceptor, and each of the three gp41 units harbors a fusion domain. It is still under debate how many of the envelope subunits within a given trimer have to bind to the CD4 receptors and to the coreceptors, and how many gp41 protein fusion domains are required for fusion. These numbers are referred to as subunit stoichiometries. We present a mathematical framework for estimating these parameters individually by analyzing infectivity assays with pseudotyped viruses. We find that the number of spikes that are engaged in mediating cell entry and the distribution of the spike number play important roles for the estimation of the subunit stoichiometries. Our model framework also shows why it is important to subdivide the question of the number of functional subunits within one trimer into the three different subunit stoichiometries. In a second step, we extend our models to study whether the subunits within one trimer cooperate during receptor binding and fusion. As an example for how our models can be applied, we reanalyze a data set on subunit stoichiometries. We find that two envelope proteins have to engage with CD4-receptors and coreceptors and that two fusion proteins must be revealed within one trimer for viral entry. Our study is motivated by the mechanism of HIV entry but the experimental technique and the model framework can be extended to other viral systems
Zwart, R; Abraham, D; Oortgiesen, M; Vijverberg, H P
1994-08-22
Pharmacological characteristics of native neuronal nicotinic acetylcholine receptor-mediated ion currents in mouse N1E-115 neuroblastoma cells have been investigated by superfusion of voltage clamped cells with known concentrations of the agonists acetylcholine, nicotine and cytisine, and the antagonists alpha-bungarotoxin and neuronal bungarotoxin. The sensitivity of the nicotinic acetylcholine receptor for agonists followed the agonist potency rank-order: nicotine approximately acetylcholine > cytisine. The EC50 values of acetylcholine and nicotine are 78 microM and 76 microM, respectively. Equal concentrations of acetylcholine and nicotine induce inward currents with approximately the same peak amplitude whereas cytisine induces much smaller inward currents. Acetylcholine-induced currents are unaffected by high concentrations of alpha-bungarotoxin. Conversely, at 10 and 90 nM neuronal bungarotoxin reduces the amplitude of the 1 mM acetylcholine-induced inward current to 47% and 11% of control values, respectively. Both the agonist potency rank-order and the differential sensitivity to snake toxins of nicotinic receptors in N1E-115 cells are consistent with the known pharmacological profile of alpha 4 beta 2 nicotinic receptors expressed in Xenopus oocytes and distinct from those of all other nicotinic acetylcholine receptors of known functional subunit compositions. All data indicate that the native nicotinic acetylcholine receptor in N1E-115 cells is an assembly of alpha 4 and beta 2 subunits, the putative major subtype of nicotinic acetylcholine receptor in the brain.
Dobó, Endre; Török, Ibolya; Mihály, András; Károly, Norbert; Krisztin-Péva, Beáta
2015-01-01
Rodent strains used in epilepsy research have various neurological characteristics. These differences were suggested to be attributed to the diverse densities of the ionotropic glutamate receptor (iGluR) subunits. However, previous studies failed to find interstrain differences in the hippocampal receptor levels. We supposed that a detailed layer-to-layer analysis of the iGluR subunits in the hippocampus might reveal strain-dependent differences in their base lines and reactions induced by pilocarpine (PILO) between two mouse strains without documented ancestors. Levels of iGluR subunits in Balb/c and NMRI mice were compared using semiquantitative immunohistochemistry. The alterations in the neuronal circuitry were validated by neuropeptide Y (NPY) and neuronal nuclear antigen (NeuN) immunostainings. Immunohistochemistry showed interstrain laminar differences in some subunits of both the control and PILO-treated animals. The seizure-induced irreversible neuronal changes were accompanied by reduced GluA1 and GluA2 levels. Their changes were inversely correlated in the individual NMRI mice by Pearson's method. Increase in NPY immunoreactivity showed positive correlation with GluA1, and negative correlation with GluA2. The NMRI strain was susceptible to PILO-induced hippocampal sclerosis, while the Balb/c animals showed resistance. Basal levels of iGluRs differ in mouse strains, which may account for the interstrain differences in their reactions to the convulsant. Copyright © 2015 Elsevier B.V. All rights reserved.
Christensen, Mark H; Kohlmeier, Kristi A
2016-03-01
The earlier an individual initiates cigarette smoking, the higher the likelihood of development of dependency to nicotine, the addictive ingredient in cigarettes. One possible mechanism underlying this higher addiction liability is an ontogenetically differential cellular response induced by nicotine in neurons mediating the reinforcing or euphoric effects of this drug, which could arise from age-related differences in the composition of nicotinic acetylcholine receptor (nAChR) subunits. In the current study, we examined whether the subunit composition of nAChRs differed between neurons within the laterodorsal tegmentum (LDT), a nucleus importantly involved in drug addiction associated behaviours, across two periods of ontogeny in which nicotine-mediated excitatory responses were shown to depend on age. To this end, whole-cell patch-clamp recordings in mouse brain slices from identified LDT neurons, in combination with nAChR subunit-specific receptor antagonists, were conducted. Comparison of the contribution of different nAChR subunits to acetylcholine (ACh)-induced inward currents indicated that the contributions of the β2 and/or β4 and α7 nAChR subunits alter across age. Taken together, we conclude that across a limited ontogenetic period, there is plasticity in the subunit composition of nAChRs in LDT neurons. In addition, our data indicate, for the first time, functional presence of α6 nAChR subunits in LDT neurons within the age ranges studied. Changes in subunit composition of nAChRs across ontogeny could contribute to the age-related differential excitability induced by nicotine. Differences in the subunit composition of nAChRs within the LDT would be expected to contribute to ontogenetic-dependent outflow from the LDT to target regions, which include reward-related circuitry. © 2014 Society for the Study of Addiction.
Undifferentiated embryonic stem cells express ionotropic glutamate receptor mRNAs
Pachernegg, Svenja; Joshi, Illah; Muth-Köhne, Elke; Pahl, Steffen; Münster, Yvonne; Terhag, Jan; Karus, Michael; Werner, Markus; Ma-Högemeier, Zhan-Lu; Körber, Christoph; Grunwald, Thomas; Faissner, Andreas; Wiese, Stefan; Hollmann, Michael
2013-01-01
Ionotropic glutamate receptors (iGluRs) do not only mediate the majority of excitatory neurotransmission in the vertebrate CNS, but also modulate pre- and postnatal neurogenesis. Most of the studies on the developmental role of iGluRs are performed on neural progenitors and neural stem cells (NSCs). We took a step back in our study by examining the role of iGluRs in the earliest possible cell type, embryonic stem cells (ESCs), by looking at the mRNA expression of the major iGluR subfamilies in undifferentiated mouse ESCs. For that, we used two distinct murine ES cell lines, 46C ESCs and J1 ESCs. Regarding 46C ESCs, we found transcripts of kainate receptors (KARs) (GluK2 to GluK5), AMPA receptors (AMPARs) (GluA1, GluA3, and GluA4), and NMDA receptors (NMDARs) (GluN1, and GluN2A to GluN2D). Analysis of 46C-derived cells of later developmental stages, namely neuroepithelial precursor cells (NEPs) and NSCs, revealed that the mRNA expression of KARs is significantly upregulated in NEPs and, subsequently, downregulated in NSCs. However, we could not detect any protein expression of any of the KAR subunits present on the mRNA level either in ESCs, NEPs, or NSCs. Regarding AMPARs and NMDARs, GluN2A is weakly expressed at the protein level only in NSCs. Matching our findings for iGluRs, all three cell types were found to weakly express pre- and postsynaptic markers of glutamatergic synapses only at the mRNA level. Finally, we performed patch-clamp recordings of 46C ESCs and could not detect any current upon iGluR agonist application. Similar to 46C ESCs, J1 ESCs express KARs (GluK2 to GluK5), AMPARs (GluA3), and NMDARs (GluN1, and GluN2A to GluN2D) at the mRNA level, but these transcripts are not translated into receptor proteins either. Thus, we conclude that ESCs do not contain functional iGluRs, although they do express an almost complete set of iGluR subunit mRNAs. PMID:24348335
Roshanravan, Hila; Kim, Eun Young; Dryer, Stuart E
2016-10-01
N-methyl-d-aspartate (NMDA) receptors are expressed throughout the kidney, and the abundance of these receptors and some of their endogenous agonists are increased in diabetes. Moreover, sustained activation of podocyte NMDA receptors induces Ca(2+) influx, oxidative stress, loss of slit diaphragm proteins, and apoptosis. We observed that NMDA receptor subunits and their transcripts are increased in podocytes and mesangial cells cultured in elevated glucose compared with controls. A similar increase in NMDA subunits, especially NR1, NR2A, and NR2C, was observed in glomeruli and tubules of Akita mice. Sustained continuous treatment with the strong NMDA receptor antagonist dizocilpine (MK-801) for 28 days starting at 8 weeks of age reduced 24-h albumin excretion and mesangial matrix expansion and improved glomerular ultrastructure in Akita mice. MK-801 did not alleviate reduced Akita mouse body weight and had no effect on kidney histology or ultrastructure in DBA/2J controls. The structurally dissimilar NMDA antagonist memantine also reduced diabetic nephropathy, although it was less effective than MK-801. Inhibition of NMDA receptors may represent a valid therapeutic approach to reduce renal complications of diabetes, and it is possible to develop well-tolerated agents with minimal central nervous system effects. Two such agents, memantine and dextromethorphan, are already in widespread clinical use. © 2016 by the American Diabetes Association.
Rudell, Jolene Chang; Borges, Lucia S; Rudell, John B; Beck, Kenneth A; Ferns, Michael J
2014-01-03
The molecular determinants that govern nicotinic acetylcholine receptor (AChR) assembly and trafficking are poorly defined, and those identified operate largely during initial receptor biogenesis in the endoplasmic reticulum. To identify determinants that regulate later trafficking steps, we performed an unbiased screen using chimeric proteins consisting of CD4 fused to the muscle AChR subunit cytoplasmic loops. In C2 mouse muscle cells, we found that CD4-β and δ subunit loops were expressed at very low levels on the cell surface, whereas the other subunit loops were robustly expressed on the plasma membrane. The low surface expression of CD4-β and δ loops was due to their pronounced retention in the Golgi apparatus and also to their rapid internalization from the plasma membrane. Both retention and recovery were mediated by the proximal 25-28 amino acids in each loop and were dependent on an ordered sequence of charged and hydrophobic residues. Indeed, βK353L and δK351L mutations increased surface trafficking of the CD4-subunit loops by >6-fold and also decreased their internalization from the plasma membrane. Similarly, combined βK353L and δK351L mutations increased the surface levels of assembled AChR expressed in HEK cells to 138% of wild-type levels. This was due to increased trafficking to the plasma membrane and not decreased AChR turnover. These findings identify novel Golgi retention signals in the β and δ subunit loops that regulate surface trafficking of assembled AChR and may help prevent surface expression of unassembled subunits. Together, these results define molecular determinants that govern a Golgi-based regulatory step in nicotinic AChR trafficking.
Semenov, Iurii; Wang, Bin; Herlihy, Jeremiah T; Brenner, Robert
2011-04-01
The large conductance calcium- and voltage-activated potassium channel (BK channel) and its smooth muscle-specific β1 subunit regulate excitation–contraction coupling in many types of smooth muscle cells. However, the relative contribution of BK channels to control of M2- or M3-muscarinic acetylcholine receptor mediated airway smooth muscle contraction is poorly understood. Previously, we showed that knockout of the BK channel β1 subunit enhances cholinergic-evoked trachea contractions. Here, we demonstrate that the enhanced contraction of the BK β1 knockout can be ascribed to a defect in BK channel opposition of M2 receptor-mediated contractions. Indeed, the enhanced contraction of β1 knockout is eliminated by specific M2 receptor antagonism. The role of BK β1 to oppose M2 signalling is evidenced by a greater than fourfold increase in the contribution of L-type voltage-dependent calcium channels to contraction that otherwise does not occur with M2 antagonist or with β1 containing BK channels. The mechanism through which BK channels oppose M2-mediated recruitment of calcium channels is through a negative shift in resting voltage that offsets, rather than directly opposes, M2-mediated depolarization. The negative shift in resting voltage is reduced to similar extents by BK β1 knockout or by paxilline block of BK channels. Normalization of β1 knockout baseline voltage with low external potassium eliminated the enhanced M2-receptor mediated contraction. In summary, these findings indicate that an important function of BK/β1 channels is to oppose cholinergic M2 receptor-mediated depolarization and activation of calcium channels by restricting excitation–contraction coupling to more negative voltage ranges.
Antiseizure Activity of Midazolam in Mice Lacking δ-Subunit Extrasynaptic GABAA Receptors
Reddy, Sandesh D.; Younus, Iyan; Clossen, Bryan L.
2015-01-01
Midazolam is a benzodiazepine anticonvulsant with rapid onset and short duration of action. Midazolam is the current drug of choice for acute seizures and status epilepticus, including those caused by organophosphate nerve agents. The antiseizure activity of midazolam is thought to result from its allosteric potentiation of synaptic GABAA receptors in the brain. However, there are indications that benzodiazepines promote neurosteroid synthesis via the 18-kDa cholesterol transporter protein (TSPO). Therefore, we investigated the role of neurosteroids and their extrasynaptic GABAA receptor targets in the antiseizure activity of midazolam. Here, we used δ-subunit knockout (DKO) mice bearing a targeted deletion of the extrasynaptic receptors to investigate the contribution of the extrasynaptic receptors to the antiseizure activity of midazolam using the 6-Hz and hippocampus kindling seizure models. In both models, midazolam produced rapid and dose-dependent protection against seizures (ED50, 0.4 mg/kg). Moreover, the antiseizure potency of midazolam was undiminished in DKO mice compared with control mice. Pretreatment with PK11195 [1-(2-chlorophenyl)-N-methyl-N-(1-methylpropyl)-3-isoquinolinecarboxamide], a TSPO blocker, or finasteride, a 5α-reductase neurosteroid inhibitor, did not affect the antiseizure effect of midazolam. The antiseizure activity of midazolam was significantly reversed by pretreatment with flumazenil, a benzodiazepine antagonist. Plasma and brain levels of the neurosteroid allopregnanolone were not significantly greater in midazolam-treated animals. These studies therefore provide strong evidence that neurosteroids and extrasynaptic GABAA receptors are not involved in the antiseizure activity of midazolam, which mainly occurs through synaptic GABAA receptors via direct binding to benzodiazepine sites. This study reaffirms midazolam’s use for controlling acute seizures and status epilepticus. PMID:25784648
Bates, Ryan C.; Stith, Bradley J.; Stevens, Karen E.; Adams, Catherine E.
2014-01-01
Decreased expression of CHRNA7, the gene encoding the α7* subtype of nicotinic receptor, may contribute to the cognitive dysfunction observed in schizophrenia by disrupting the inhibitory/excitatory balance in the hippocampus. C3H mice with reduced Chrna7 expression have significant reductions in hippocampal α7* receptor density, deficits in hippocampal auditory gating, increased hippocampal activity as well as significant decreases in hippocampal glutamate decarboxylase-65 (GAD65) and γ-aminobutyric acid-A (GABAA) receptor levels. The current study investigated whether altered Chrna7 expression is associated with changes in the levels of parvalbumin, GAD67 and/or GABAA receptor subunits in hippocampus from male and female C3H Chrna7 wildtype, C3H Chrna7 heterozygous and C3H Chrna7 knockout mice using quantitative western immunoblotting. Reduced Chrna7 expression was associated with significant increases in hippocampal parvalbumin and GAD67 and with complex alterations in GABAA receptor subunits. A decrease in α3 subunit protein was seen in both female C3H Chrna7 Het and KO mice while a decrease in α4 subunit protein was also detected in C3H Chrna7 KO mice with no sex difference. In contrast, an increase in δ subunit protein was observed in C3H Chrna7 Het mice while a decrease in this subunit was observed in C3H Chrna7 KO mice, with δ subunit protein levels being greater in males than in females. Finally, an increase in γ2 subunit protein was found in C3H Chrna7 KO mice with the levels of this subunit again being greater in males than in females. The increases in hippocampal parvalbumin and GAD67 observed in C3H Chrna7 mice are contrary to reports of reductions in these proteins in postmortem hippocampus from schizophrenic individuals. We hypothesize that the disparate results may occur because of the influence of factors other than CHRNA7 that have been found to be abnormal in schizophrenia. PMID:24836856
Holbrook, Joanna D; Gill, Catherine H; Zebda, Noureddine; Spencer, Jon P; Leyland, Rebecca; Rance, Kim H; Trinh, Han; Balmer, Gemma; Kelly, Fiona M; Yusaf, Shahnaz P; Courtenay, Nicola; Luck, Jane; Rhodes, Andrew; Modha, Sundip; Moore, Stephen E; Sanger, Gareth J; Gunthorpe, Martin J
2009-01-01
The 5-HT(3) receptor is a member of the 'Cys-loop' family of ligand-gated ion channels that mediate fast excitatory and inhibitory transmission in the nervous system. Current evidence points towards native 5-HT(3) receptors originating from homomeric assemblies of 5-HT(3A) or heteromeric assembly of 5-HT(3A) and 5-HT(3B). Novel genes encoding 5-HT(3C), 5-HT(3D), and 5-HT(3E) have recently been described but the functional importance of these proteins is unknown. In the present study, in silico analysis (confirmed by partial cloning) indicated that 5-HT(3C), 5-HT(3D), and 5-HT(3E) are not human-specific as previously reported: they are conserved in multiple mammalian species but are absent in rodents. Expression profiles of the novel human genes indicated high levels in the gastrointestinal tract but also in the brain, Dorsal Root Ganglion (DRG) and other tissues. Following the demonstration that these subunits are expressed at the cell membrane, the functional properties of the recombinant human subunits were investigated using patch clamp electrophysiology. 5-HT(3C), 5-HT(3D), and 5-HT(3E) were all non-functional when expressed alone. Co-transfection studies to determine potential novel heteromeric receptor interactions with 5-HT(3A) demonstrated that the expression or function of the receptor was modified by 5-HT(3C) and 5-HT(3E), but not 5-HT(3D). The lack of distinct effects on current rectification, kinetics or pharmacology of 5-HT(3A) receptors does not however provide unequivocal evidence to support a direct contribution of 5-HT(3C) or 5-HT(3E) to the lining of the ion channel pore of novel heteromeric receptors. The functional and pharmacological contributions of these novel subunits to human biology and diseases such as irritable bowel syndrome for which 5-HT(3) receptor antagonists have major clinical usage, therefore remains to be fully determined.
Differential targeting of Gbetagamma-subunit signaling with small molecules.
Bonacci, Tabetha M; Mathews, Jennifer L; Yuan, Chujun; Lehmann, David M; Malik, Sundeep; Wu, Dianqing; Font, Jose L; Bidlack, Jean M; Smrcka, Alan V
2006-04-21
G protein betagamma subunits have potential as a target for therapeutic treatment of a number of diseases. We performed virtual docking of a small-molecule library to a site on Gbetagamma subunits that mediates protein interactions. We hypothesized that differential targeting of this surface could allow for selective modulation of Gbetagamma subunit functions. Several compounds bound to Gbetagamma subunits with affinities from 0.1 to 60 muM and selectively modulated functional Gbetagamma-protein-protein interactions in vitro, chemotactic peptide signaling pathways in HL-60 leukocytes, and opioid receptor-dependent analgesia in vivo. These data demonstrate an approach for modulation of G protein-coupled receptor signaling that may represent an important therapeutic strategy.
Nedd4 is a Specific E3 Ubiquitin Ligase for the NMDA Receptor Subunit GluN2D
Gautam, Vivek; Trinidad, Jonathan C.; Rimerman, Ronald A.; Costa, Blaise M.; Burlingame, Alma L.; Monaghan, Daniel T.
2013-01-01
NMDA receptors are a family of glutamate-gated ion channels that regulate various CNS functions such as synaptic plasticity and learning. However hypo-or hyper-activation of NMDA receptors is critically involved in many neurological and psychiatric conditions such as pain, stroke, epilepsy, neurodegeneration, schizophrenia, and depression. Thus, it is important to identify mechanisms (such as by targeted ubiquitination) that regulate the levels of individual subtypes of NMDA receptors. In this study, we used a series of tagged, carboxy terminal constructs of GluN2D to identify associating proteins from rat brain. Of seven different GluN2D C-terminal fragments used as bait, only the construct containing amino acids 983-1097 associated with an E3 ligase, Nedd4. A direct interaction between GluN2D and Nedd4 was confirmed both in vivo and in vitro. This association is mediated by an interaction between GluN2D's C-terminal PPXY motif and the 2nd and 3rd WW domains of Nedd4. Of the four GluN2 subunits, Nedd4 directly interacted with GluN2D and also weakly with GluN2A. Nedd4 coexpression with GluN2D enhances GluN2D ubiquitination and reduces GluN1/GluN2D NMDA receptor responses. These results identify Nedd4 as a novel binding partner for GluN2D and suggest a mechanism for the regulation of NMDA receptors that contains GluN2D subunit through ubiquitination-dependent downregulation. PMID:23639431
Lagranha, Valeska Lizzi; Matte, Ursula; de Carvalho, Talita Giacomet; Seminotti, Bianca; Pereira, Carolina Coffi; Koeller, David M.; Woontner, Michael; Goodman, Stephen I.; de Souza, Diogo Onofre Gomes; Wajner, Moacir
2014-01-01
We determined mRNA expression of the ionotropic glutamate receptors NMDA (NR1, NR2A and NR2B subunits), AMPA (GluR2 subunit) and kainate (GluR6 subunit), as well as of the glutamate transporters GLAST and GLT1 in cerebral cortex and striatum of wild type (WT) and glutaryl-CoA dehydrogenase deficient (Gchh -/-) mice aged 7, 30 and 60 days. The protein expression levels of some of these membrane proteins were also measured. Overexpression of NR2A and NR2B in striatum and of GluR2 and GluR6 in cerebral cortex was observed in 7-day-old Gcdh -/-. There was also an increase of mRNA expression of all NMDA subunits in cerebral cortex and of NR2A and NR2B in striatum of 30-day-old Gcdh -/- mice. At 60 days of life, all ionotropic receptors were overexpressed in cerebral cortex and striatum of Gcdh -/- mice. Higher expression of GLAST and GLT1 transporters was also verified in cerebral cortex and striatum of Gcdh -/- mice aged 30 and 60 days, whereas at 7 days of life GLAST was overexpressed only in striatum from this mutant mice. Furthermore, high lysine intake induced mRNA overexpression of NR2A, NR2B and GLAST transcripts in striatum, as well as of GluR2 and GluR6 in both striatum and cerebral cortex of Gcdh -/- mice. Finally, we found that the protein expression of NR2A, NR2B, GLT1 and GLAST were significantly greater in cerebral cortex of Gcdh -/- mice, whereas NR2B and GLT1 was similarly enhanced in striatum, implying that these transcripts were translated into their products. These results provide evidence that glutamate receptor and transporter expression is higher in Gcdh -/- mice and that these alterations may be involved in the pathophysiology of GA I and possibly explain, at least in part, the vulnerability of striatum and cerebral cortex to injury in patients affected by GA I. PMID:24594605
Lagranha, Valeska Lizzi; Matte, Ursula; de Carvalho, Talita Giacomet; Seminotti, Bianca; Pereira, Carolina Coffi; Koeller, David M; Woontner, Michael; Goodman, Stephen I; de Souza, Diogo Onofre Gomes; Wajner, Moacir
2014-01-01
We determined mRNA expression of the ionotropic glutamate receptors NMDA (NR1, NR2A and NR2B subunits), AMPA (GluR2 subunit) and kainate (GluR6 subunit), as well as of the glutamate transporters GLAST and GLT1 in cerebral cortex and striatum of wild type (WT) and glutaryl-CoA dehydrogenase deficient (Gchh-/-) mice aged 7, 30 and 60 days. The protein expression levels of some of these membrane proteins were also measured. Overexpression of NR2A and NR2B in striatum and of GluR2 and GluR6 in cerebral cortex was observed in 7-day-old Gcdh-/-. There was also an increase of mRNA expression of all NMDA subunits in cerebral cortex and of NR2A and NR2B in striatum of 30-day-old Gcdh-/- mice. At 60 days of life, all ionotropic receptors were overexpressed in cerebral cortex and striatum of Gcdh-/- mice. Higher expression of GLAST and GLT1 transporters was also verified in cerebral cortex and striatum of Gcdh-/- mice aged 30 and 60 days, whereas at 7 days of life GLAST was overexpressed only in striatum from this mutant mice. Furthermore, high lysine intake induced mRNA overexpression of NR2A, NR2B and GLAST transcripts in striatum, as well as of GluR2 and GluR6 in both striatum and cerebral cortex of Gcdh-/- mice. Finally, we found that the protein expression of NR2A, NR2B, GLT1 and GLAST were significantly greater in cerebral cortex of Gcdh-/- mice, whereas NR2B and GLT1 was similarly enhanced in striatum, implying that these transcripts were translated into their products. These results provide evidence that glutamate receptor and transporter expression is higher in Gcdh-/- mice and that these alterations may be involved in the pathophysiology of GA I and possibly explain, at least in part, the vulnerability of striatum and cerebral cortex to injury in patients affected by GA I.
Kim, Na Na; Habibi, Hamid R; Lee, Jehee; Choi, Cheol Young
2012-08-01
Gonadotropins (GTHs) are the key regulators of reproduction in vertebrates. The present study investigated autoregulatory effects of gonadotropins, using recombinant FSH (rFSH) and LH (rLH) in cinnamon clownfish (Amphiprion melanopus). Experiments were carried out to investigate the actions of cinnamon clownfish rFSH and rLH on expression of GTH subunits, GTH receptors, and vitellogenin (Vtg) mRNA in vivo and in vitro. Plasma estradiol-17β (E(2)) level was also measured in immature fish following treatments with rFSH and rLH. The results demonstrate increasing levels of GTH subunits, GTH-receptors, Vtg mRNA levels, as well as plasma E(2) levels following injection with rFSH and rLH. The findings support the hypothesis that LH and FSH stimulate reproduction, in part, by autoregulatory mechanisms leading to upregulation of GTH receptors and GTH hormone production in cinnamon clownfish. The results provide a framework for better understanding of the mechanisms of GTH-mediated control of reproduction in cinnamon clownfish and other vertebrates. Copyright © 2012 Elsevier Inc. All rights reserved.
Dopamine Modulation of Avoidance Behavior in Caenorhabditis elegans Requires the NMDA Receptor NMR-1
Baidya, Melvin; Genovez, Marx; Torres, Marissa; Chao, Michael Y.
2014-01-01
The nematode C. elegans utilizes a relatively simple neural circuit to mediate avoidance responses to noxious stimuli such as the volatile odorant octanol. This avoidance behavior is modulated by dopamine. cat-2 mutant animals that are deficient in dopamine biosynthesis have an increased response latency to octanol compared to wild type animals, and this defect can be fully restored with the application of exogenous dopamine. Because this avoidance behavior is mediated by glutamatergic signaling between sensory neurons and premotor interneurons, we investigated the genetic interactions between dopaminergic signaling and ionotropic glutamate receptors. cat-2 mutant animals lacking either the GLR-1 or GLR-2 AMPA/kainate receptors displayed an increased response latency to octanol, which could be restored via exogenous dopamine. However, whereas cat-2 mutant animals lacking the NMR-1 NMDA receptor had increased response latency to octanol they were insensitive to exogenous dopamine. Mutants that lacked both AMPA/kainate and NMDA receptors were also insensitive to exogenous dopamine. Our results indicate that dopamine modulation of octanol avoidance requires NMR-1, consistent with NMR-1 as a potential downstream signaling target for dopamine. PMID:25089710
Immunochemical Proof that a Novel Rearranging Gene Encodes the T Cell Receptor δ Subunit
NASA Astrophysics Data System (ADS)
Band, Hamid; Hochstenbach, Frans; McLean, Joanne; Hata, Shingo; Krangel, Michael S.; Brenner, Michael B.
1987-10-01
The T cell receptor (TCR) δ protein is expressed as part of a heterodimer with TCR γ , in association with the CD3 polypeptides on a subset of functional peripheral blood T lymphocytes, thymocytes, and certain leukemic T cell lines. A monoclonal antibody directed against TCR δ was produced that binds specifically to the surface of several TCR γ δ cell lines and immunoprecipitates the TCR γ δ as a heterodimer from Triton X-100 detergent lysates and also immunoprecipitates the TCR δ subunit alone after chain separation. A candidate human TCR δ complementary DNA clone (IDP2 O-240/38), reported in a companion paper, was isolated by the subtractive library approach from a TCR γ δ cell line. This complementary DNA clone was used to direct the synthesis of a polypeptide that is specifically recognized by the monoclonal antibody to TCR δ . This complementary DNA clone thus corresponds to the gene that encodes the TCR δ subunit.
Bache, Kristi G.; Stuffers, Susanne; Malerød, Lene; Slagsvold, Thomas; Raiborg, Camilla; Lechardeur, Delphine; Wälchli, Sébastien; Lukacs, Gergely L.; Brech, Andreas; Stenmark, Harald
2006-01-01
The endosomal sorting complexes required for transport, ESCRT-I, -II, and -III, are thought to mediate the biogenesis of multivesicular endosomes (MVEs) and endosomal sorting of ubiquitinated membrane proteins. Here, we have compared the importance of the ESCRT-I subunit tumor susceptibility gene 101 (Tsg101) and the ESCRT-III subunit hVps24/CHMP3 for endosomal functions and receptor signaling. Like Tsg101, endogenous hVps24 localized mainly to late endosomes. Depletion of hVps24 by siRNA showed that this ESCRT subunit, like Tsg101, is important for degradation of the epidermal growth factor (EGF) receptor (EGFR) and for transport of the receptor from early endosomes to lysosomes. Surprisingly, however, whereas depletion of Tsg101 caused sustained EGF activation of the mitogen-activated protein kinase pathway, depletion of hVps24 had no such effect. Moreover, depletion of Tsg101 but not of hVps24 caused a major fraction of internalized EGF to accumulate in nonacidified endosomes. Electron microscopy of hVps24-depleted cells showed an accumulation of EGFRs in MVEs that were significantly smaller than those in control cells, probably because of an impaired fusion with lyso-bisphosphatidic acid-positive late endosomes/lysosomes. Together, our results reveal functional differences between ESCRT-I and ESCRT-III in degradative protein trafficking and indicate that degradation of the EGFR is not required for termination of its signaling. PMID:16554368
Bache, Kristi G; Stuffers, Susanne; Malerød, Lene; Slagsvold, Thomas; Raiborg, Camilla; Lechardeur, Delphine; Wälchli, Sébastien; Lukacs, Gergely L; Brech, Andreas; Stenmark, Harald
2006-06-01
The endosomal sorting complexes required for transport, ESCRT-I, -II, and -III, are thought to mediate the biogenesis of multivesicular endosomes (MVEs) and endosomal sorting of ubiquitinated membrane proteins. Here, we have compared the importance of the ESCRT-I subunit tumor susceptibility gene 101 (Tsg101) and the ESCRT-III subunit hVps24/CHMP3 for endosomal functions and receptor signaling. Like Tsg101, endogenous hVps24 localized mainly to late endosomes. Depletion of hVps24 by siRNA showed that this ESCRT subunit, like Tsg101, is important for degradation of the epidermal growth factor (EGF) receptor (EGFR) and for transport of the receptor from early endosomes to lysosomes. Surprisingly, however, whereas depletion of Tsg101 caused sustained EGF activation of the mitogen-activated protein kinase pathway, depletion of hVps24 had no such effect. Moreover, depletion of Tsg101 but not of hVps24 caused a major fraction of internalized EGF to accumulate in nonacidified endosomes. Electron microscopy of hVps24-depleted cells showed an accumulation of EGFRs in MVEs that were significantly smaller than those in control cells, probably because of an impaired fusion with lyso-bisphosphatidic acid-positive late endosomes/lysosomes. Together, our results reveal functional differences between ESCRT-I and ESCRT-III in degradative protein trafficking and indicate that degradation of the EGFR is not required for termination of its signaling.
Uttl, Libor; Petrasek, Tomas; Sengul, Hilal; Svojanovska, Marketa; Lobellova, Veronika; Vales, Karel; Radostova, Dominika; Tsenov, Grygoriy; Kubova, Hana; Mikulecka, Anna; Svoboda, Jan; Stuchlik, Ales
2018-01-01
The role of NMDA receptors in learning, memory and hippocampal function has long been recognized. Post-mortem studies have indicated that the expression or subunit composition of the NMDA glutamate receptor subtype might be related to the impaired cognitive functions found in schizophrenia patients. NMDA receptor antagonists have been used to develop animal models of this disorder. There is accumulating evidence showing that not only the acute but also the chronic application of NMDA receptor antagonists may induce schizophrenia-like alterations in behavior and brain functions. However, limited evidence is available regarding the consequences of NMDA receptor blockage during periods of adolescence and early adulthood. This study tested the hypothesis that a 2-week treatment of male Long-Evans and Wistar rats with dizocilpine (MK-801; 0.5 mg/kg daily) starting at postnatal days (PD) 30 and 60 would cause a long-term cognitive deficit and changes in the levels of NMDA receptor subunits. The working memory version of the Morris water maze (MWM) and active place avoidance with reversal on a rotating arena (Carousel) requiring cognitive coordination and flexibility probed cognitive functions and an elevated-plus maze (EPM) was used to measure anxiety-like behavior. The western blot method was used to determine changes in NMDA receptor subunit levels in the hippocampus. Our results showed no significant changes in behaviors in Wistar rats. Slightly elevated anxiety-like behavior was observed in the EPM in Long-Evans rats with the onset of treatment on PD 30. Furthermore, Long-Evans rats treated from PD 60 displayed impaired working memory in the MWM. There were; however, no significant changes in the levels of NMDA receptor subunits because of MK-801 administration. These findings suggest that a 2-week treatment starting on PD 60 in Long-Evans rats leads to long-term changes in working memory, but this deficit is not paralleled by changes in NMDA receptor subunits. These
Uttl, Libor; Petrasek, Tomas; Sengul, Hilal; Svojanovska, Marketa; Lobellova, Veronika; Vales, Karel; Radostova, Dominika; Tsenov, Grygoriy; Kubova, Hana; Mikulecka, Anna; Svoboda, Jan; Stuchlik, Ales
2018-01-01
The role of NMDA receptors in learning, memory and hippocampal function has long been recognized. Post-mortem studies have indicated that the expression or subunit composition of the NMDA glutamate receptor subtype might be related to the impaired cognitive functions found in schizophrenia patients. NMDA receptor antagonists have been used to develop animal models of this disorder. There is accumulating evidence showing that not only the acute but also the chronic application of NMDA receptor antagonists may induce schizophrenia-like alterations in behavior and brain functions. However, limited evidence is available regarding the consequences of NMDA receptor blockage during periods of adolescence and early adulthood. This study tested the hypothesis that a 2-week treatment of male Long-Evans and Wistar rats with dizocilpine (MK-801; 0.5 mg/kg daily) starting at postnatal days (PD) 30 and 60 would cause a long-term cognitive deficit and changes in the levels of NMDA receptor subunits. The working memory version of the Morris water maze (MWM) and active place avoidance with reversal on a rotating arena (Carousel) requiring cognitive coordination and flexibility probed cognitive functions and an elevated-plus maze (EPM) was used to measure anxiety-like behavior. The western blot method was used to determine changes in NMDA receptor subunit levels in the hippocampus. Our results showed no significant changes in behaviors in Wistar rats. Slightly elevated anxiety-like behavior was observed in the EPM in Long-Evans rats with the onset of treatment on PD 30. Furthermore, Long-Evans rats treated from PD 60 displayed impaired working memory in the MWM. There were; however, no significant changes in the levels of NMDA receptor subunits because of MK-801 administration. These findings suggest that a 2-week treatment starting on PD 60 in Long-Evans rats leads to long-term changes in working memory, but this deficit is not paralleled by changes in NMDA receptor subunits. These
ERIC Educational Resources Information Center
Moody, Teena D.; Watabe, Ayako M.; Indersmitten, Tim; Komiyama, Noboru H.; Grant, Seth G. N.; O'Dell, Thomas J.
2011-01-01
Through protein interactions mediated by their cytoplasmic C termini the GluN2A and GluN2B subunits of NMDA receptors (NMDARs) have a key role in the formation of NMDAR signaling complexes at excitatory synapses. Although these signaling complexes are thought to have a crucial role in NMDAR-dependent forms of synaptic plasticity such as long-term…
Wu, Xiaorong; Tuzun, Erdem; Saini, Shamsher S; Wang, Jun; Li, Jing; Aguilera-Aguirre, Leopoldo; Huda, Ruksana; Christadoss, Premkumar
2015-12-01
Extraocular muscles (EOM) are preferentially involved in myasthenia gravis (MG) and acetylcholine receptor (AChR) antibody positive MG patients may occasionally present with isolated ocular symptoms. Although experimental autoimmune myasthenia gravis (EAMG) induced by whole AChR immunization closely mimics clinical and immunopathological aspects of MG, EOM are usually not affected. We have previously developed an EAMG model, which imitates EOM symptoms of MG by immunization of human leukocyte antigen (HLA) transgenic mice with α or γ-subunits of human AChR (H-AChR). To investigate the significance of the ϵ-subunit in ocular MG, we immunized HLA-DR3 and HLA-DQ8 transgenic mice with recombinant H-AChR ϵ-subunit expressed in Escherichia coli. HLA-DR3 transgenic mice showed significantly higher clinical ocular and generalized MG severity scores and lower grip strength values than HLA-DQ8 mice. H-AChR ϵ-subunit-immunized HLA-DR3 transgenic mice had higher serum anti-AChR antibody (IgG, IgG1, IgG2b, IgG2c and IgM) levels, neuromuscular junction IgG and complement deposit percentages than ϵ-subunit-immunized HLA-DQ8 transgenic mice. Control mice immunized with E. coli extract or complete Freund adjuvant (CFA) did not show clinical and immunopathological features of ocular and generalized EAMG. Lymph node cells of ϵ-subunit-immunized HLA-DR3 mice showed significantly higher proliferative responses than those of ϵ-subunit-immunized HLA-DQ8 mice, crude E. coli extract-immunized and CFA-immunized transgenic mice. Our results indicate that the human AChR ϵ-subunit is capable of inducing myasthenic muscle weakness. Diversity of the autoimmune responses displayed by mice expressing different HLA class II molecules suggests that the interplay between HLA class II alleles and AChR subunits might have a profound impact on the clinical course of MG. Copyright © 2015 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.
Semenov, Iurii; Wang, Bin; Herlihy, Jeremiah T; Brenner, Robert
2011-01-01
Abstract The large conductance calcium- and voltage-activated potassium channel (BK channel) and its smooth muscle-specific β1 subunit regulate excitation–contraction coupling in many types of smooth muscle cells. However, the relative contribution of BK channels to control of M2- or M3-muscarinic acetylcholine receptor mediated airway smooth muscle contraction is poorly understood. Previously, we showed that knockout of the BK channel β1 subunit enhances cholinergic-evoked trachea contractions. Here, we demonstrate that the enhanced contraction of the BK β1 knockout can be ascribed to a defect in BK channel opposition of M2 receptor-mediated contractions. Indeed, the enhanced contraction of β1 knockout is eliminated by specific M2 receptor antagonism. The role of BK β1 to oppose M2 signalling is evidenced by a greater than fourfold increase in the contribution of L-type voltage-dependent calcium channels to contraction that otherwise does not occur with M2 antagonist or with β1 containing BK channels. The mechanism through which BK channels oppose M2-mediated recruitment of calcium channels is through a negative shift in resting voltage that offsets, rather than directly opposes, M2-mediated depolarization. The negative shift in resting voltage is reduced to similar extents by BK β1 knockout or by paxilline block of BK channels. Normalization of β1 knockout baseline voltage with low external potassium eliminated the enhanced M2-receptor mediated contraction. In summary, these findings indicate that an important function of BK/β1 channels is to oppose cholinergic M2 receptor-mediated depolarization and activation of calcium channels by restricting excitation–contraction coupling to more negative voltage ranges. PMID:21300746
Subunit profiling and functional characteristics of acetylcholine receptors in GT1-7 cells.
Arai, Yuki; Ishii, Hirotaka; Kobayashi, Makito; Ozawa, Hitoshi
2017-03-01
GnRH neurons form a final common pathway for the central regulation of reproduction. Although the involvement of acetylcholine in GnRH secretion has been reported, direct effects of acetylcholine and expression profiles of acetylcholine receptors (AChRs) still remain to be studied. Using immortalized GnRH neurons (GT1-7 cells), we analyzed molecular expression and functionality of AChRs. Expression of the mRNAs were identified in the order α7 > β2 = β1 ≧ α4 ≧ α5 = β4 = δ > α3 for nicotinic acetylcholine receptor (nAChR) subunits and m4 > m2 for muscarinic acetylcholine receptor (mAChR) subtypes. Furthermore, this study revealed that α7 nAChRs contributed to Ca 2+ influx and GnRH release and that m2 and m4 mAChRs inhibited forskolin-induced cAMP production and isobutylmethylxanthine-induced GnRH secretion. These findings demonstrate the molecular profiles of AChRs, which directly contribute to GnRH secretion in GT1-7 cells, and provide one possible regulatory action of acetylcholine in GnRH neurons.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Machaalani, R., E-mail: rita.machaalani@sydney.edu.au; Bosch Institute, The University of Sydney, NSW 2006; The Children's Hospital at Westmead, NSW 2145
Smoking during pregnancy is associated with low birth weight, premature delivery, and neonatal morbidity and mortality. Nicotine, a major pathogenic compound of cigarette smoke, binds to the nicotinic acetylcholine receptors (nAChRs). A total of 16 nAChR subunits have been identified in mammals (9 α, 4 β, and 1 δ, γ and ε subunits). The effect of cigarette smoking on the expression of these subunits in the placenta has not yet been determined, thus constituting the aim of this study. Using RT-qPCR and western blotting, this study investigated all 16 mammalian nAChR subunits in the normal healthy human placenta, and comparedmore » mRNA and protein expressions in the placentas from smokers (n = 8) to controls (n = 8). Our data show that all 16 subunit mRNAs are expressed in the normal, non-diseased human placenta and that the expression of α2, α3, α4, α9, β2 and β4 subunits is greater than the other subunits. For mRNA, cigarette smoke exposure was associated with increased expression of the α9 subunit, and decreased expression of the δ subunit. At the protein level, expression of both α9 and δ was increased. Thus, cigarette smoking in pregnancy is sufficient to regulate nAChR subunits in the placenta, specifically α9 and δ subunits, and could contribute to the adverse effects of vasoconstriction and decreased re-epithelialisation (α9), and increased calcification and apoptosis (δ), seen in the placentas of smoking women. - Highlights: • All 16 mammalian nAChR subunits are expressed in the human placenta. • Cigarette smoking increases α9 mRNA and protein in the placenta. • Cigarette smoking decreases δ mRNA but increases δ protein in the placenta.« less
Kiselycznyk, Carly; Jury, Nicholas; Halladay, Lindsay; Nakazawa, Kazu; Mishina, Masayoshi; Sprengel, Rolf; Grant, Seth G.N.; Svenningsson, Per; Holmes, Andrew
2015-01-01
Drugs targeting the glutamate N-methyl-D-aspartate receptor (NMDAR) may be efficacious for treating mood disorders, as exemplified by the rapid antidepressant effects produced by single administration of the NMDAR antagonist ketamine. Though the precise mechanisms underlying the antidepressant-related effects of NMDAR antagonism remain unclear, recent studies implicate specific NMDAR subunits, including GluN2A and GluN2B, as well as the alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptor (AMPAR) subunit glutamate receptor interacting molecule, PSD-95. Here, integrating mutant and pharmacological in mice, we investigated the contribution of these subunits and molecules to antidepressant-related behaviors and the antidepressant-related effects of the GluN2B blocker, Ro 25-6981. We found that global deletion of GluA1 or PSD-95 reduced forced swim test (FST) immobility, mimicking the antidepressant-related effect produced by systemically administered Ro 25-6981 in C57BL/6J mice. Moreover, the FST antidepressant-like effects of systemic Ro 25-6981 were intact in mutants with global GluA1 deletion or GluN1 deletion in forebrain interneurons, but were absent in mutants constitutively lacking GluN2A or PSD-95. Next, we found that microinfusing Ro 25-6981 into the medial prefrontal cortex (mPFC), but not basolateral amygdala, of C57BL/6J mice was sufficient to produce an antidepressant-like effect. Together, these findings extend and refine current understanding of the mechanisms mediating antidepressant-like effects produced by NMDAR-GluN2B antagonists, and may inform the development of a novel class of medications for treating depression that target the GluN2B subtype of NMDAR. PMID:25800971
Schiapparelli, L; Simón, A M; Del Río, J; Frechilla, D
2006-06-01
It has been suggested that antagonists at serotonin 5-HT1A receptors may exert a procognitive effect by facilitating glutamatergic neurotransmission. Here we further explored this issue by looking for the ability of a 5-HT1A antagonist to prevent the learning deficit induced by AMPA receptor blockade in two behavioural procedures in rats, and for concomitant molecular changes presumably involved in memory formation in the hippocampus. Pretraining administration of the competitive AMPA receptor antagonist, NBQX, produced a dose-related retention impairment in a passive avoidance task 24h later, and also impaired retention in a novel object recognition test when an intertrial interval of 3h was selected. Pretreatment with the selective 5-HT1A receptor antagonist, WAY-100635, prevented the learning deficit induced by NBQX in the two behavioural procedures. In biochemical studies performed on rat hippocampus after the retention tests, we found that learning increased the membrane levels of AMPA receptor GluR1 and GluR2/3 subunits, as well as the phosphorylated forms of GluR1, effects that were abolished by NBQX administration before the training session. Pretreatment with WAY-100635 counteracted the NBQX effects and restored the initial learning-specific increase in Ca2+/calmodulin-dependent protein kinase II (CaMKII) function and the later increase in GluR2/3 and phosphorylated GluR1 surface expression. Moreover, administration of WAY-100635 before object recognition training improved recognition memory 24h later and potentiated the learning-associated increase in AMPA receptor subunits. The results support the proposed utility of 5-HT1A antagonists in the treatment of cognitive disorders.
Makiuchi, Takashi; Mi-ichi, Fumika; Nakada-Tsukui, Kumiko; Nozaki, Tomoyoshi
2013-01-01
Under anaerobic environments, the mitochondria have undergone remarkable reduction and transformation into highly reduced structures, referred as mitochondrion-related organelles (MROs), which include mitosomes and hydrogenosomes. In agreement with the concept of reductive evolution, mitosomes of Entamoeba histolytica lack most of the components of the TOM (translocase of the outer mitochondrial membrane) complex, which is required for the targeting and membrane translocation of preproteins into the canonical aerobic mitochondria. Here we showed, in E. histolytica mitosomes, the presence of a 600-kDa TOM complex composed of Tom40, a conserved pore-forming subunit, and Tom60, a novel lineage-specific receptor protein. Tom60, containing multiple tetratricopeptide repeats, is localized to the mitosomal outer membrane and the cytosol, and serves as a receptor of both mitosomal matrix and membrane preproteins. Our data indicate that Entamoeba has invented a novel lineage-specific shuttle receptor of the TOM complex as a consequence of adaptation to an anaerobic environment. PMID:23350036
Makiuchi, Takashi; Mi-ichi, Fumika; Nakada-Tsukui, Kumiko; Nozaki, Tomoyoshi
2013-01-01
Under anaerobic environments, the mitochondria have undergone remarkable reduction and transformation into highly reduced structures, referred as mitochondrion-related organelles (MROs), which include mitosomes and hydrogenosomes. In agreement with the concept of reductive evolution, mitosomes of Entamoeba histolytica lack most of the components of the TOM (translocase of the outer mitochondrial membrane) complex, which is required for the targeting and membrane translocation of preproteins into the canonical aerobic mitochondria. Here we showed, in E. histolytica mitosomes, the presence of a 600-kDa TOM complex composed of Tom40, a conserved pore-forming subunit, and Tom60, a novel lineage-specific receptor protein. Tom60, containing multiple tetratricopeptide repeats, is localized to the mitosomal outer membrane and the cytosol, and serves as a receptor of both mitosomal matrix and membrane preproteins. Our data indicate that Entamoeba has invented a novel lineage-specific shuttle receptor of the TOM complex as a consequence of adaptation to an anaerobic environment.
Heteromeric assembly of P2X subunits
Saul, Anika; Hausmann, Ralf; Kless, Achim; Nicke, Annette
2013-01-01
Transcripts and/or proteins of P2X receptor (P2XR) subunits have been found in virtually all mammalian tissues. Generally more than one of the seven known P2X subunits have been identified in a given cell type. Six of the seven cloned P2X subunits can efficiently form functional homotrimeric ion channels in recombinant expression systems. This is in contrast to other ligand-gated ion channel families, such as the Cys-loop or glutamate receptors, where homomeric assemblies seem to represent the exception rather than the rule. P2XR mediated responses recorded from native tissues rarely match exactly the biophysical and pharmacological properties of heterologously expressed homomeric P2XRs. Heterotrimerization of P2X subunits is likely to account for this observed diversity. While the existence of heterotrimeric P2X2/3Rs and their role in physiological processes is well established, the composition of most other P2XR heteromers and/or the interplay between distinct trimeric receptor complexes in native tissues is not clear. After a description of P2XR assembly and the structure of the intersubunit ATP-binding site, this review summarizes the distribution of P2XR subunits in selected mammalian cell types and the biochemically and/or functionally characterized heteromeric P2XRs that have been observed upon heterologous co-expression of P2XR subunits. We further provide examples where the postulated heteromeric P2XRs have been suggested to occur in native tissues and an overview of the currently available pharmacological tools that have been used to discriminate between homo- and heteromeric P2XRs. PMID:24391538
Oh, I; Rau, V; Lor, C; Laha, KT; Jurd, R; Rudolph, U; Eger, EI; Pearce, RA
2015-01-01
Enhancement of tonic inhibition mediated by extrasynaptic α5-subunit containing GABAA receptors (GABAARs) has been proposed as the mechanism by which a variety of anesthetics, including the general anesthetic etomidate, impair learning and memory. Since α5 subunits preferentially partner with β3 subunits, we tested the hypothesis that etomidate acts through β3-subunit containing GABAARs to enhance tonic inhibition, block LTP, and impair memory. We measured the effects of etomidate in wild type mice and in mice carrying a point mutation in the GABAAR β3-subunit (β3-N265M) that renders these receptors insensitive to etomidate. Etomidate enhanced tonic inhibition in CA1 pyramidal cells of the hippocampus in wild type but not in mutant mice, demonstrating that tonic inhibition is mediated by β3-subunit containing GABAARs. However, despite its inability to enhance tonic inhibition, etomidate did block LTP in brain slices from mutant mice as well as in those from wild type mice. Etomidate also impaired fear conditioning to context, with no differences between genotypes. In studies of recombinant receptors expressed in HEK293 cells, α5β1γ2L GABAARs were insensitive to amnestic concentrations of etomidate (1 [.proportional]M and below), whereas α5β2γ2L and α5β3γ2L GABAARs were enhanced. We conclude that etomidate enhances tonic inhibition in pyramidal cells through its action on α5β3-containing GABAA receptors, but blocks LTP and impairs learning by other means - most likely by modulating α5β2-containing GABAA receptors. The critical anesthetic targets underlying amnesia might include other forms of inhibition imposed on pyramidal neurons (e.g. slow phasic inhibition), or inhibitory processes on non-pyramidal cells (e.g. interneurons). PMID:25680234
Kumar, Manoj; Kumar, Manish; Freund, John M; Dillon, Glenn H
2017-09-01
The muscle relaxant carisoprodol has recently been controlled at the federal level as a Schedule IV drug due to its high abuse potential and consequences of misuse, such as withdrawal syndrome, delusions, seizures, and even death. Recent work has shown that carisoprodol can directly gate and allosterically modulate the type A GABA (GABA A ) receptor. These actions are subunit-dependent; compared with other GABA A receptors, carisoprodol has nominal direct gating effects in α 3 β 2 γ 2 receptors. Here, using site-directed mutagenesis and whole-cell patch-clamp electrophysiology in transiently transfected human embryonic kidney 293 cells, we examined the role of GABA A receptor α subunit transmembrane domain 4 (TM4) amino acids in direct gating and allosteric modulatory actions of carisoprodol. Mutation of α 3 valine at position 440 to leucine (present in the equivalent position in the α 1 subunit) significantly increased the direct gating effects of carisoprodol without affecting its allosteric modulatory effects. The corresponding reverse mutation, α 1(L415V), decreased carisoprodol direct gating potency and efficacy. Analysis of a series of amino acid mutations at the 415 position demonstrated that amino acid volume correlated positively with carisoprodol efficacy, whereas polarity inversely correlated with carisoprodol efficacy. We conclude that α 1(415) of TM4 is involved in the direct gating, but not allosteric modulatory, actions of carisoprodol. In addition, the orientation of alkyl or hydroxyl groups at this position influences direct gating effects. These findings support the likelihood that the direct gating and allosteric modulatory effects of carisoprodol are mediated via distinct binding sites. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.
Polan, Michelle B; Pastore, Matthew T; Steingass, Katherine; Hashimoto, Sayaka; Thrush, Devon L; Pyatt, Robert; Reshmi, Shalini; Gastier-Foster, Julie M; Astbury, Caroline; McBride, Kim L
2014-01-01
Recent studies have shown that certain copy number variations (CNV) are associated with a wide range of neurodevelopmental disorders, including autism spectrum disorders (ASD), bipolar disorder and intellectual disabilities. Implicated regions and genes have comprised a variety of post synaptic complex proteins and neurotransmitter receptors, including gamma-amino butyric acid A (GABAA). Clusters of GABAA receptor subunit genes are found on chromosomes 4p12, 5q34, 6q15 and 15q11-13. Maternally inherited 15q11-13 duplications among individuals with neurodevelopmental disorders are well described, but few case reports exist for the other regions. We describe a family with a 2.42 Mb duplication at chromosome 4p13 to 4p12, identified in the index case and other family members by oligonucleotide array comparative genomic hybridization, that contains 13 genes including a cluster of four GABAA receptor subunit genes. Fluorescent in-situ hybridization was used to confirm the duplication. The duplication segregates with a variety of neurodevelopmental disorders in this family, including ASD (index case), developmental delay, dyspraxia and ADHD (brother), global developmental delays (brother), learning disabilities (mother) and bipolar disorder (maternal grandmother). In addition, we identified and describe another individual unrelated to this family, with a similar duplication, who was diagnosed with ASD, ADHD and borderline intellectual disability. The 4p13 to 4p12 duplication appears to confer a susceptibility to a variety of neurodevelopmental disorders in these two families. We hypothesize that the duplication acts through a dosage effect of GABAA receptor subunit genes, adding evidence for alterations in the GABAergic system in the etiology of neurodevelopmental disorders. PMID:23695283
Differential Targeting of Gβγ-Subunit Signaling with Small Molecules
NASA Astrophysics Data System (ADS)
Bonacci, Tabetha M.; Mathews, Jennifer L.; Yuan, Chujun; Lehmann, David M.; Malik, Sundeep; Wu, Dianqing; Font, Jose L.; Bidlack, Jean M.; Smrcka, Alan V.
2006-04-01
G protein βγ subunits have potential as a target for therapeutic treatment of a number of diseases. We performed virtual docking of a small-molecule library to a site on Gβγ subunits that mediates protein interactions. We hypothesized that differential targeting of this surface could allow for selective modulation of Gβγ subunit functions. Several compounds bound to Gβγ subunits with affinities from 0.1 to 60 μM and selectively modulated functional Gβγ-protein-protein interactions in vitro, chemotactic peptide signaling pathways in HL-60 leukocytes, and opioid receptor-dependent analgesia in vivo. These data demonstrate an approach for modulation of G protein-coupled receptor signaling that may represent an important therapeutic strategy.
Crystal structure and association behaviour of the GluR2 amino-terminal domain
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jin, Rongsheng; Singh, Satinder K.; Gu, Shenyan
2009-09-02
Fast excitatory neurotransmission is mediated largely by ionotropic glutamate receptors (iGluRs), tetrameric, ligand-gated ion channel proteins comprised of three subfamilies, AMPA, kainate and NMDA receptors, with each subfamily sharing a common, modular-domain architecture. For all receptor subfamilies, active channels are exclusively formed by assemblages of subunits within the same subfamily, a molecular process principally encoded by the amino-terminal domain (ATD). However, the molecular basis by which the ATD guides subfamily-specific receptor assembly is not known. Here we show that AMPA receptor GluR1- and GluR2-ATDs form tightly associated dimers and, by the analysis of crystal structures of the GluR2-ATD, propose mechanismsmore » by which the ATD guides subfamily-specific receptor assembly.« less
ERIC Educational Resources Information Center
Fatemi, S. Hossein; Reutiman, Teri J.; Folsom, Timothy D.; Rustan, Oyvind G.; Rooney, Robert J.; Thuras, Paul D.
2014-01-01
We measured protein and mRNA levels for nine gamma-aminobutyric acid A (GABA[subscript A]) receptor subunits in three brain regions (cerebellum, superior frontal cortex, and parietal cortex) in subjects with autism versus matched controls. We observed changes in mRNA for a number of GABA[subscript A] and GABA[subscript B] subunits and overall…
Waldvogel, H J; Kubota, Y; Trevallyan, S C; Kawaguchi, Y; Fritschy, J M; Mohler, H; Faull, R L
1997-10-01
The distribution, morphology and chemical characteristics of neurons immunoreactive for the alpha1-subunit of the GABA(A) receptor in the striatum of the basal ganglia in the rat brain were investigated at the light, confocal and electron microscope levels using single, double and triple immunohistochemical labelling techniques. The results showed that alpha1-subunit immunoreactive neurons were sparsely distributed throughout the rat striatum. Double and triple labelling results showed that all the alpha1-subunit-immunoreactive neurons were positive for glutamate decarboxylase and immunoreactive for the beta2,3 and gamma2 subunits of the GABA(A) receptor. Three types of alpha1-subunit-immunoreactive neurons were identified in the striatum on the basis of cellular morphology and chemical characteristics. The most numerous alpha1-subunit-immunoreactive neurons were medium-sized, aspiny neurons with a widely branching dendritic tree. They were parvalbumin-negative and were located mainly in the dorsolateral regions of the striatum. Electron microscopy showed that these neurons had an indented nuclear membrane, typical of striatal interneurons, and were surrounded by small numbers of axon terminals which established alpha1-subunit-immunoreactive synaptic contacts with the soma and dendrites. These cells were classified as type 1 alpha1-subunit-immunoreactive neurons and comprised 75% of the total population of alpha1-subunit-immunoreactive neurons in the striatum. The remaining alpha1-subunit-immunoreactive neurons comprised of a heterogeneous population of large-sized neurons localized in the ventral and medial regions of the striatum. The most numerous large-sized cells were parvalbumin-negative, had two to three relatively short branching dendrites and were designated type 2 alpha1-subunit-immunoreactive neurons. Electron microscopy showed that the type 2 neurons were characterized by a highly convoluted nuclear membrane and were sparsely covered with small axon
Williamson, Sally M.; Robertson, Alan P.; Brown, Laurence; Williams, Tracey; Woods, Debra J.; Martin, Richard J.; Sattelle, David B.; Wolstenholme, Adrian J.
2009-01-01
Parasitic nematodes are of medical and veterinary importance, adversely affecting human health and animal welfare. Ascaris suum is a gastrointestinal parasite of pigs; in addition to its veterinary significance it is a good model of the human parasite Ascaris lumbricoides, estimated to infect ∼1.4 billion people globally. Anthelmintic drugs are essential to control nematode parasites, and nicotinic acetylcholine receptors (nAChRs) on nerve and muscle are the targets of cholinergic anthelmintics such as levamisole and pyrantel. Previous genetic analyses of nematode nAChRs have been confined to Caenorhabditis elegans, which is phylogenetically distinct from Ascaris spp. and many other important parasites. Here we report the cloning and expression of two nAChR subunit cDNAs from A. suum. The subunits are very similar in sequence to C. elegans UNC-29 and UNC-38, are expressed on muscle cells and can be expressed robustly in Xenopus oocytes to form acetylcholine-, nicotine-, levamisole- and pyrantel-sensitive channels. We also demonstrate that changing the stoichiometry of the receptor by injecting different ratios of the subunit cRNAs can reproduce two of the three pharmacological subtypes of nAChR present in A. suum muscle cells. When the ratio was 5∶1 (Asu-unc-38∶Asu-unc-29), nicotine was a full agonist and levamisole was a partial agonist, and oocytes responded to oxantel, but not pyrantel. At the reverse ratio (1∶5 Asu-unc-38∶Asu-unc-29), levamisole was a full agonist and nicotine was a partial agonist, and the oocytes responded to pyrantel, but not oxantel. These results represent the first in vitro expression of any parasitic nicotinic receptor and show that their properties are substantially different from those of C. elegans. The results also show that changing the expression level of a single receptor subunit dramatically altered the efficacy of some anthelmintic drugs. In vitro expression of these subunits may permit the development of parasite
Sensi, Stefano L.; Yin, Hong Z.; Carriedo, Sean G.; Rao, Shyam S.; Weiss, John H.
1999-01-01
Synaptically released Zn2+ can enter and cause injury to postsynaptic neurons. Microfluorimetric studies using the Zn2+-sensitive probe, Newport green, examined levels of [Zn2+]i attained in cultured cortical neurons on exposure to N-methyl-d-asparte, kainate, or high K+ (to activate voltage-sensitive Ca2+ channels) in the presence of 300 μM Zn2+. Indicating particularly high permeability through Ca2+-permeable α-amino3-hydroxy-5-methyl-4-isoxazolepropionic-acid/kainate (Ca-A/K) channels, micromolar [Zn2+]i rises were observed only after kainate exposures and only in neurons expressing these channels [Ca-A/K(+) neurons]. Further studies using the oxidation-sensitive dye, hydroethidine, revealed Zn2+-dependent reactive oxygen species (ROS) generation that paralleled the [Zn2+]i rises, with rapid oxidation observed only in the case of Zn2+ entry through Ca-A/K channels. Indicating a mitochondrial source of this ROS generation, hydroethidine oxidation was inhibited by the mitochondrial electron transport blocker, rotenone. Additional evidence for a direct interaction between Zn2+ and mitochondria was provided by the observation that the Zn2+ entry through Ca-A/K channels triggered rapid mitochondrial depolarization, as assessed by using the potential-sensitive dye tetramethylrhodamine ethylester. Whereas Ca2+ influx through Ca-A/K channels also triggers ROS production, the [Zn2+]i rises and subsequent ROS production are of more prolonged duration. PMID:10051656
Zheng, Zhaoqing; Sabirzhanov, Boris
2012-01-01
Previously, we proposed a two-stage model for an in vitro neural correlate of eyeblink classical conditioning involving the initial synaptic incorporation of glutamate receptor A1 (GluA1)-containing α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid type receptors (AMPARs) followed by delivery of GluA4-containing AMPARs that support acquisition of conditioned responses. To test specific elements of our model for conditioning, selective knockdown of GluA4 AMPAR subunits was used using small-interfering RNAs (siRNAs). Recently, we sequenced and characterized the GluA4 subunit and its splice variants from pond turtles, Trachemys scripta elegans (tGluA4). Analysis of the relative abundance of mRNA expression by real-time RT-PCR showed that the flip/flop variants of tGluA4, tGluA4c, and a novel truncated variant tGluA4trc1 are major isoforms in the turtle brain. Here, transfection of in vitro brain stem preparations with anti-tGluA4 siRNA suppressed conditioning, tGluA4 mRNA and protein expression, and synaptic delivery of tGluA4-containing AMPARs but not tGluA1 subunits. Significantly, transfection of abducens motor neurons by nerve injections of tGluA4 flop rescue plasmid prior to anti-tGluA4 siRNA application restored conditioning and synaptic incorporation of tGluA4-containing AMPARs. In contrast, treatment with rescue plasmids for tGluA4 flip or tGluA4trc1 failed to rescue conditioning. Finally, treatment with a siRNA directed against GluA1 subunits inhibited conditioning and synaptic delivery of tGluA1-containing AMPARs and importantly, those containing tGluA4. These data strongly support our two-stage model of conditioning and our hypothesis that synaptic incorporation of tGluA4-containing AMPARs underlies the acquisition of in vitro classical conditioning. Furthermore, they suggest that tGluA4 flop may have a critical role in conditioning mechanisms compared with the other tGluA4 splice variants. PMID:22490558
Antiseizure Activity of Midazolam in Mice Lacking δ-Subunit Extrasynaptic GABA(A) Receptors.
Reddy, Sandesh D; Younus, Iyan; Clossen, Bryan L; Reddy, Doodipala Samba
2015-06-01
Midazolam is a benzodiazepine anticonvulsant with rapid onset and short duration of action. Midazolam is the current drug of choice for acute seizures and status epilepticus, including those caused by organophosphate nerve agents. The antiseizure activity of midazolam is thought to result from its allosteric potentiation of synaptic GABA(A) receptors in the brain. However, there are indications that benzodiazepines promote neurosteroid synthesis via the 18-kDa cholesterol transporter protein (TSPO). Therefore, we investigated the role of neurosteroids and their extrasynaptic GABA(A) receptor targets in the antiseizure activity of midazolam. Here, we used δ-subunit knockout (DKO) mice bearing a targeted deletion of the extrasynaptic receptors to investigate the contribution of the extrasynaptic receptors to the antiseizure activity of midazolam using the 6-Hz and hippocampus kindling seizure models. In both models, midazolam produced rapid and dose-dependent protection against seizures (ED50, 0.4 mg/kg). Moreover, the antiseizure potency of midazolam was undiminished in DKO mice compared with control mice. Pretreatment with PK11195 [1-(2-chlorophenyl)-N-methyl-N-(1-methylpropyl)-3-isoquinolinecarboxamide], a TSPO blocker, or finasteride, a 5α-reductase neurosteroid inhibitor, did not affect the antiseizure effect of midazolam. The antiseizure activity of midazolam was significantly reversed by pretreatment with flumazenil, a benzodiazepine antagonist. Plasma and brain levels of the neurosteroid allopregnanolone were not significantly greater in midazolam-treated animals. These studies therefore provide strong evidence that neurosteroids and extrasynaptic GABA(A) receptors are not involved in the antiseizure activity of midazolam, which mainly occurs through synaptic GABA(A) receptors via direct binding to benzodiazepine sites. This study reaffirms midazolam's use for controlling acute seizures and status epilepticus. Copyright © 2015 by The American Society for
Taillebois, Emiliane; Beloula, Abdelhamid; Quinchard, Sophie; Jaubert-Possamai, Stéphanie; Daguin, Antoine; Servent, Denis; Tagu, Denis
2014-01-01
Neonicotinoid insecticides act on nicotinic acetylcholine receptor and are particularly effective against sucking pests. They are widely used in crops protection to fight against aphids, which cause severe damage. In the present study we evaluated the susceptibility of the pea aphid Acyrthosiphon pisum to the commonly used neonicotinoid insecticides imidacloprid (IMI), thiamethoxam (TMX) and clothianidin (CLT). Binding studies on aphid membrane preparations revealed the existence of high and low-affinity binding sites for [3H]-IMI (Kd of 0.16±0.04 nM and 41.7±5.9 nM) and for the nicotinic antagonist [125I]-α-bungarotoxin (Kd of 0.008±0.002 nM and 1.135±0.213 nM). Competitive binding experiments demonstrated that TMX displayed a higher affinity than IMI for [125I]-α-bungarotoxin binding sites while CLT affinity was similar for both [125I]-α-bungarotoxin and [3H]-IMI binding sites. Interestingly, toxicological studies revealed that at 48 h, IMI (LC50 = 0.038 µg/ml) and TMX (LC50 = 0.034 µg/ml) were more toxic than CLT (LC50 = 0.118 µg/ml). The effect of TMX could be associated to its metabolite CLT as demonstrated by HPLC/MS analysis. In addition, we found that aphid larvae treated either with IMI, TMX or CLT showed a strong variation of nAChR subunit expression. Using semi-quantitative PCR experiments, we detected for all insecticides an increase of Apisumα10 and Apisumβ1 expressions levels, whereas Apisumβ2 expression decreased. Moreover, some other receptor subunits seemed to be differently regulated according to the insecticide used. Finally, we also demonstrated that nAChR subunit expression differed during pea aphid development. Altogether these results highlight species specificity that should be taken into account in pest management strategies. PMID:24801634
Zhang, Jun; Diamond, Jeffrey S.
2014-01-01
Retinal ganglion cells (RGCs) receive excitatory glutamatergic input from ON and OFF bipolar cells in distinct sublaminae of the inner plexiform layer (IPL). AMPA and NMDA receptors (AMPARs and NMDARs) mediate excitatory inputs in both synaptic layers, but specific roles for NMDARs at RGC synapses remain unclear. NMDARs comprise NR1 and NR2 subunits and are anchored by membrane associated guanylate kinases (MAGUKs), but it is unknown whether particular NR2 subunits associate preferentially with particular NR1 splice variants and MAGUKs. Here, we used postembedding immunogold electron microscopy (EM) techniques to examine the subsynaptic localization of NMDAR subunits and MAGUKs at ON and OFF synapses onto rat RGCs. We found that the NR2A subunit, the NR1C2‘ splice variant and MAGUKs PSD-95 and PSD-93 are localized to the postsynaptic density (PSD), preferentially at OFF synapses, whereas the NR2B subunit, the NR1C2 splice variant and the MAGUK SAP102 are localized perisynaptically, with NR2B exhibiting a preference for ON synapses. Consistent with these anatomical data, spontaneous EPSCs (sEPSCs) recorded from OFF cells exhibited an NMDAR component that was insensitive to the NR2B antagonist Ro 25-6981. In ON cells, sEPSCs expressed an NMDAR component, partially sensitive to Ro 25-6981, only when glutamate transport was inhibited, indicating perisynaptic expression of NR2B NMDARs. These results provide the first evidence for preferential association of particular NR1 splice variants, NR2 subunits and MAGUKs at central synapses and suggest that different NMDAR subtypes may play specific roles at functionally distinct synapses in the retinal circuitry. PMID:19339621
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu Xiaohong, E-mail: xuxh63@zjnu.cn; Li Tao; Luo Qingqing
Bisphenol-A (BPA), an endocrine disruptor, is found to influence development of brain and behaviors in rodents. The previous study indicated that perinatal exposure to BPA impaired learning-memory and inhibited N-methyl-D-aspartate receptor (NMDAR) subunits expressions in hippocampus during the postnatal development in rats; and in cultured hippocampal neurons, BPA rapidly promotes dynamic changes in dendritic morphology through estrogen receptor-mediated pathway by concomitant phosphorylation of NMDAR subunit NR2B. In the present study, we examined the rapid effect of BPA on passive avoidance memory and NMDAR in the developing hippocampus of Sprague-Dawley rats at the age of postnatal day 18. The results showedmore » that BPA or estradiol benzoate (EB) rapidly extended the latency to step down from the platform 1 h after footshock and increased the phosphorylation levels of NR1, NR2B, and mitogen-activated extracellular signal-regulated kinase (ERK) in hippocampus within 1 h. While 24 h after BPA or EB treatment, the improved memory and the increased phosphorylation levels of NR1, NR2B, ERK disappeared. Furthermore, pre-treatment with an estrogen receptors (ERs) antagonist, ICI182,780, or an ERK-activating kinase inhibitor, U0126, significantly attenuated EB- or BPA-induced phosphorylations of NR1, NR2B, and ERK within 1 h. These data suggest that BPA rapidly enhanced short-term passive avoidance memory in the developing rats. A non-genomic effect via ERs may mediate the modulation of the phosphorylation of NMDAR subunits NR1 and NR2B through ERK signaling pathway. - Highlights: > BPA rapidly extended the latency to step down from platform 1 h after footshock. > BPA rapidly increased pNR1, pNR2B, and pERK in hippocampus within 1 h. > ERs antagonist or MEK inhibitor attenuated BPA-induced pNR1, pNR2B, and pERK.« less
Schrattenholz, A; Roth, U; Godovac-Zimmermann, J; Maelicke, A
1997-10-28
Using 2,8,5'-[3H]ATP as a direct photoaffinity label for membrane-bound nicotinic acetylcholine receptor (nAChR) from Torpedo marmorata, we have identified a binding site for ATP in the extracellular region of the beta-subunit of the receptor. Photolabeling was completely inhibited in the presence of saturating concentrations of nonradioactive ATP, whereas neither the purinoreceptor antagonists suramin, theophyllin, and caffeine nor the nAChR antagonists alpha-bungarotoxin and d-tubocurarine affected the labeling reaction. Competitive and noncompetitive nicotinic agonists and Ca2+ increased the yield of the photoreaction by up to 50%, suggesting that the respective binding sites are allosterically linked with the ATP site. The dissociation constant KD of binding of ATP to the identified site on the nAChR was of the order of 10(-4) M. Sites of labeling were found in the sequence regions Leu11-Pro17 and Asp152-His163 of the nAChR beta-subunit. These regions may represent parts of a single binding site for ATP, which is discontinuously distributed within the primary structure of the N-terminal extracellular domain. The existence of an extracellular binding site for ATP confirms, on the molecular level, that this nucleotide can directly act on nicotinic receptors, as has been suggested from previous electrophysiological and biochemical studies.
Role of NMDA receptor GluN2D subunit in the antidepressant effects of enantiomers of ketamine.
Ide, Soichiro; Ikekubo, Yuiko; Mishina, Masayoshi; Hashimoto, Kenji; Ikeda, Kazutaka
2017-11-01
We investigated the rapid and sustained antidepressant effects of enantiomers of ketamine in N-methyl-d-aspartate (NMDA) receptor GluN2D subunit knockout (GluN2D-KO) mice. Intraperitoneal administration of ketamine or its enantiomers 10 min before the tail-suspension test exerted significant antidepressant effects on restraint stress-induced depression in both wildtype and GluN2D-KO mice. The antidepressant effects of (RS)-ketamine and (S)-ketamine were sustained 96 h after the injection in both wildtype and GluN2D-KO mice, but such sustained antidepressant effects of (R)-ketamine were only observed in wildtype mice. These data suggest that the GluN2D subunit is critical for the sustained antidepressant effects of (R)-ketamine. Copyright © 2017 The Authors. Production and hosting by Elsevier B.V. All rights reserved.
Schmidt, Mathias V; Trümbach, Dietrich; Weber, Peter; Wagner, Klaus; Scharf, Sebastian H; Liebl, Claudia; Datson, Nicole; Namendorf, Christian; Gerlach, Tamara; Kühne, Claudia; Uhr, Manfred; Deussing, Jan M; Wurst, Wolfgang; Binder, Elisabeth B; Holsboer, Florian; Müller, Marianne B
2010-12-15
Increased vulnerability to aversive experiences is one of the main risk factors for stress-related psychiatric disorders as major depression. However, the molecular bases of vulnerability, on the one hand, and stress resilience, on the other hand, are still not understood. Increasing clinical and preclinical evidence suggests a central involvement of the glutamatergic system in the pathogenesis of major depression. Using a mouse paradigm, modeling increased stress vulnerability and depression-like symptoms in a genetically diverse outbred strain, and we tested the hypothesis that differences in AMPA receptor function may be linked to individual variations in stress vulnerability. Vulnerable and resilient animals differed significantly in their dorsal hippocampal AMPA receptor expression and AMPA receptor binding. Treatment with an AMPA receptor potentiator during the stress exposure prevented the lasting effects of chronic social stress exposure on physiological, neuroendocrine, and behavioral parameters. In addition, spatial short-term memory, an AMPA receptor-dependent behavior, was found to be predictive of individual stress vulnerability and response to AMPA potentiator treatment. Finally, we provide evidence that genetic variations in the AMPA receptor subunit GluR1 are linked to the vulnerable phenotype. Therefore, we propose genetic variations in the AMPA receptor system to shape individual stress vulnerability. Those individual differences can be predicted by the assessment of short-term memory, thereby opening up the possibility for a specific treatment by enhancing AMPA receptor function.
Dubovyk, Valentyna; Manahan-Vaughan, Denise
2018-04-10
Psychosis is a mental condition that is characterized by hallucinations, delusions, disordered thought, as well as socio-emotional and cognitive impairments. Once developed, it tends to progress into a chronic psychotic illness. Here, the duration of untreated psychosis plays a crucial role: the earlier the treatment begins, relative to the first episode of the disease, the better the patient's functional prognosis. To what extent the success of early interventions relate to progressive changes at the neurotransmitter receptor level is as yet unclear. In fact, very little is known as to how molecular changes develop, transform, and become established following the first psychotic event. One neurotransmitter receptor for which a specific role in psychosis has been discussed is the N-methyl-d-aspartate receptor (NMDAR). This receptor is especially important for information encoding in the hippocampus. The hippocampus is one of the loci of functional change in psychosis, to which a role in the pathophysiology of psychosis has been ascribed. Here, we examined whether changes in NMDAR subunit expression occur along the dorsoventral axis of the hippocampus 1 week and 3 months after systemic treatment with an NMDAR antagonist (MK801) that initiates a psychosis-like state in adult rats. We found early (1 week) upregulation of the GluN2B levels in the dorso-intermediate hippocampus and late (3 month) downregulation of GluN2A expression across the entire CA1 region. The ventral hippocampus did not exhibit subunit expression changes. These data suggest that a differing vulnerability of the hippocampal longitudinal axis may occur in response to MK801-treatment and provide a time-resolved view of the putative development of pathological changes of NMDAR subunit expression in the hippocampus that initiate with an emulated first episode and progress through to the chronic stabilization of a psychosis-like state in rodents.
Kainate Receptors in the Striatum: Implications for Excitotoxicity in Huntington’s Disease
2005-08-01
called ionotropic glutamate receptors. Using specific antibodies and glutamate-related compounds, we have achieved successfully a series of studies of the...them from AMPA receptors. However, the recent development of specific antibodies and selective AMPA receptor antagonists allowed various groups to...highly specific antibodies and/or cDNA probes allowed the better characterization of the cellular localization of various GABA and glutamate receptor
Boudreau, Amy C.; Milovanovic, Mike; Conrad, Kelly L.; Nelson, Christopher; Ferrario, Carrie R.; Wolf, Marina E.
2012-01-01
Trafficking of neurotransmitter receptors between intracellular and cell surface compartments is important for regulating neurotransmission. We developed a method for determining if an in vivo treatment has altered receptor distribution in a particular region of rodent brain. After the treatment, brain slices are rapidly prepared from the region of interest. Then cell surface-expressed receptors are covalently crosslinked to nearby proteins using the membrane-impermeable, bifunctional crosslinker bis(sulfosuccinimidyl)suberate (BS3). This increases the apparent molecular weight of surface receptors, while intracellular receptors are not modified. Thus, surface and intracellular receptor pools can be separated and quantified using SDS-PAGE and immunoblotting. This method is particularly useful for analyzing AMPA receptor subunits, offering advantages in accuracy, efficiency and cost compared to biotinylation. A disadvantage is that some antibodies no longer recognize their target protein after crosslinking. We have used this method to quantify changes in receptor distribution after acute and chronic exposure to psychomotor stimulants. PMID:22470150
Rodríguez-Muñoz, María; de la Torre-Madrid, Elena; Sánchez-Blázquez, Pilar; Garzón, Javier
2007-01-01
Background In general, opioids that induce the recycling of μ-opioid receptors (MORs) promote little desensitization, although morphine is one exception to this rule. While morphine fails to provoke significant internalization of MORs in cultured cells, it does stimulate profound desensitization. In contrast, morphine does promote some internalization of MORs in neurons although this does not prevent this opioid from inducing strong antinociceptive tolerance. Results In neurons, morphine stimulates the long-lasting transfer of MOR-activated Gα subunits to proteins of the RGS-R7 and RGS-Rz subfamilies. We investigated the influence of this regulatory process on the capacity of morphine to promote desensitization and its association with MOR recycling in the mature nervous system. In parallel, we also studied the effects of [D-Ala2, N-MePhe4, Gly-ol5] encephalin (DAMGO), a potent inducer of MOR internalization that promotes little tolerance. We observed that the initial exposure to icv morphine caused no significant internalization of MORs but rather, a fraction of the Gα subunits was stably transferred to RGS proteins in a time-dependent manner. As a result, the antinociception produced by a second dose of morphine administered 6 h after the first was weaker. However, this opioid now stimulated the phosphorylation, internalization and recycling of MORs, and further exposure to morphine promoted little tolerance to this moderate antinociception. In contrast, the initial dose of DAMGO stimulated intense phosphorylation and internalization of the MORs associated with a transient transfer of Gα subunits to the RGS proteins, recovering MOR control shortly after the effects of the opioid had ceased. Accordingly, the recycled MORs re-established their association with G proteins and the neurons were rapidly resensitized to DAMGO. Conclusion In the nervous system, morphine induces a strong desensitization before promoting the phosphorylation and recycling of MORs. The
Takeda, Atsushi; Itagaki, Kosuke; Ando, Masaki; Oku, Naoto
2012-03-01
Zinc is an endogenous N-methyl-D-aspartate (NMDA) receptor blocker. It is possible that zinc-mediated modification of hippocampal CA1 long-term potentiation (LTP) is linked to the expression of NMDA receptor subunits, which varies with postnatal development. In the present study, the effect of ZnCl(2) and CaEDTA, a membrane-impermeable zinc chelator, on CA1 LTP induction was examined in hippocampal slices from immature (3-week-old) and young (6-week-old) rats. Tetanus (10-100 Hz, 1 sec)-induced CA1 LTP was more greatly enhanced in 3-week-old rats. CA1 LTP was inhibited in the presence of 2-amino-5-phosphonovalerate (APV), an NMDA receptor antagonist, and CaEDTA in 3-week-old rats, as in the case of 6-week-old rats reported previously. In 3-week-old rats, on the other hand, 5 μM ZnCl(2) attenuated NMDA receptor-mediated EPSPs more than in 6-week-old rats and significantly attenuated CA1 LTP. Moreover, 5 μM ZnCl(2) significantly attenuated CA1 LTP in the presence of (2R,4S)-4-(3-phosphonopropyl)-2-piperidinecarboxylic acid (PPPA), an NR2A antagonist, in 3-week-old rats, but not that in the presence of ifenprodil, an NR2B antagonist, suggesting that zinc-mediated attenuation of CA1 LTP is associated with the preferential expression of NR2B subunit in 3-week-old rats. In 6-week-old rats, however, 5 μM ZnCl(2) significantly potentiated CA1 LTP and also CA1 LTP in the presence of PPPA. The present study demonstrates that endogenous zinc may participate in the induction of CA1 LTP. It is likely that the changes in expression of NMDA receptor subunits are involved in the zinc-mediated modification of CA1 LTP in the developing hippocampus. Copyright © 2011 Wiley Periodicals, Inc.
Kakegawa, Wataru; Tsuzuki, Keisuke; Yoshida, Yukari; Kameyama, Kimihiko; Ozawa, Seiji
2004-07-01
Hippocampal CA3 pyramidal neurons receive synaptic inputs from both mossy fibres (MFs) and associational fibres (AFs). Long-term potentiation (LTP) at these synapses differs in its induction sites and N-methyl-D-aspartate receptor (NMDAR) dependence. Most evidence favours the presynaptic and postsynaptic mechanisms for induction of MF LTP and AF LTP, respectively. This implies that molecular and functional properties differ between MF and AF synapses at both presynaptic and postsynaptic sites. In this study, we focused on the difference in the postsynaptic trafficking of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) between these synapses. To trace the subunit-specific trafficking of AMPARs at each synapse, GluR1 and GluR2 subunits were introduced into CA3 pyramidal neurons in hippocampal organotypic cultures using the Sindbis viral expression system. The electrophysiologically-tagged GluR2 AMPARs, produced by the viral-mediated transfer of the unedited form of GluR2 (GluR2Q), were inserted into both MF and AF postsynaptic sites in a neuronal activity-independent manner. Endogenous Ca(2+)-impermeable AMPARs at these synapses were replaced with exogenous Ca(2+)-permeable receptors, and Ca(2+) influx via the newly expressed postsynaptic AMPARs induced NMDAR-independent LTP at AF synapses. In contrast, no GluR1 AMPAR produced by the gene transfer was constitutively incorporated into AF postsynaptic sites, and only a small amount into MF postsynaptic sites. The synaptic trafficking of GluR1 AMPARs was triggered by the activity of Ca(2+)/calmodulin-dependent kinase II or high-frequency stimulation to induce LTP at AF synapses, but not at MF synapses. These results indicate that MF and AF postsynaptic sites possess distinct properties for AMPAR trafficking in CA3 pyramidal neurons.
Catts, Vibeke Sørensen; Derminio, Dominique Suzanne; Hahn, Chang-Gyu; Weickert, Cynthia Shannon
2015-01-01
There is converging evidence of involvement of N-methyl-d-aspartate (NMDA) receptor hypofunction in the pathophysiology of schizophrenia. Our group recently identified a decrease in total NR1 mRNA and protein expression in the dorsolateral prefrontal cortex in a case-control study of individuals with schizophrenia (n=37/group). The NR1 subunit is critical to NMDA receptor function at the postsynaptic density, a cellular structure rich in the scaffolding protein, PSD-95. The extent to which the NMDA receptor NR1 subunit is altered at the site of action, in the postsynaptic density, is not clear. To extend our previous results by measuring levels of NR1 and PSD-95 protein in postsynaptic density-enriched fractions of prefrontal cortex from the same individuals in the case-control study noted above. Postsynaptic density-enriched fractions were isolated from fresh-frozen prefrontal cortex (BA10) and subjected to western blot analysis for NR1 and PSD-95. We found a 20% decrease in NR1 protein (t(66)=-2.874, P=0.006) and a 30% decrease in PSD-95 protein (t(63)=-2.668, P=0.010) in postsynaptic density-enriched fractions from individuals with schizophrenia relative to unaffected controls. Individuals with schizophrenia have less NR1 protein, and therefore potentially fewer functional NMDA receptors, at the postsynaptic density. The associated decrease in PSD-95 protein at the postsynaptic density suggests that not only are glutamate receptors compromised in individuals with schizophrenia, but the overall spine architecture and downstream signaling supported by PSD-95 may also be deficient.
Yamamoto, Hideko; Kamegaya, Etsuko; Hagino, Yoko; Takamatsu, Yukio; Sawada, Wakako; Matsuzawa, Maaya; Ide, Soichiro; Yamamoto, Toshifumi; Mishina, Masayoshi; Ikeda, Kazutaka
2017-01-01
The N-methyl-d-aspartate (NMDA) receptor channel is involved in various physiological functions, including learning and memory. The GluN2D subunit of the NMDA receptor has low expression in the mature brain, and its role is not fully understood. In the present study, the effects of GluN2D subunit deficiency on emotional and cognitive function were investigated in GluN2D knockout (KO) mice. We found a reduction of motility (i.e., a depressive-like state) in the tail suspension test and a reduction of sucrose preference (i.e., an anhedonic state) in GluN2D KO mice that were group-housed with littermates. Despite apparently normal olfactory function and social interaction, GluN2D KO mice exhibited a decrease in preference for social novelty, suggesting a deficit in social recognition or memory. Golgi-Cox staining revealed a reduction of the complexity of dendritic trees in the accessory olfactory bulb in GluN2D KO mice, suggesting a deficit in pheromone processing pathway activation, which modulates social recognition. The deficit in social recognition may result in social stress in GluN2D KO mice. Isolation housing is a procedure that has been shown to reduce stress in mice. Interestingly, 3-week isolation and treatment with agomelatine or the 5-hydroxytryptamine-2C (5-HT 2C ) receptor antagonist SB242084 reversed the anhedonic-like state in GluN2D KO mice. In contrast, treatment with the 5-HT 2C receptor agonist CP809101 induced depressive- and anhedonic-like states in isolated GluN2D KO mice. These results suggest that social stress that is caused by a deficit in social recognition desensitizes 5-HT 2c receptors, followed by an anhedonic- and depressive-like state, in GluN2D KO mice. The GluN2D subunit of the NMDA receptor appears to be important for the recognition of individuals and development of normal emotionality in mice. 5-HT 2C receptor antagonism may be a therapeutic target for treating social stress-induced anhedonia. This article is part of the Special
Kessler, J P; Baude, A
1999-10-01
The dorsal vagal complex, localized in the dorsomedial medulla, includes the nucleus tractus solitarii (NTS), the dorsal motor nucleus of the vagus nerve (DMN) and the area postrema (AP). The distribution of AMPA-preferring glutamate receptors (AMPA receptors) within this region was investigated using immunohistochemistry and antibodies recognizing either one (GluR1 or GluR4) or two (GluR2 and GluR3) AMPA receptors subunits. The distribution of GluR1 immunoreactivity showed high contrast of staining between strongly and lightly labeled areas. Labeling was intense in the AP and weak in the NTS, except for its medial and dorsalmost parts which exhibited moderate staining. Almost no GluR1 immunoreactivity was found in the DMN. GluR2/3 immunolabeling was present in the entire dorsal vagal complex. This labeling was strong in the AP, the DMN and the medial half of the NTS and moderate in the lateral half of the NTS, except for the interstitial subdivision which exhibited intense staining. Labeling induced by the GluR4 antibody was very weak throughout the dorsal vagal complex. Ultrastructural examination showed that GluR1 and GluR2/3 immunoreactivity was localized in neuronal cell bodies and dendrites. No labeled axon terminal or glial cell body was found. Immunoperoxidase staining in labeled cell bodies and dendrites was associated with intracellular organelles (microtubules, mitochondria, cisternae of the endoplasmic reticulum,.) and/or parts of the plasma membrane. Plasma membrane labeling was often associated with asymmetrical synaptic differentiations. No labeled symmetrical synapse was found using either GluR1 or GluR2/3 antibody. The present results show that AMPA receptors have a widespread distribution in neuronal perikarya and dendrites of the rat dorsal vagal complex. They suggest differences in subunit composition between AMPA receptors localized in the NTS, the DMN and the AP. Ultrastructural data are consistent with the fact that AMPA receptors associated
LaPolla, R J; Mayne, K M; Davidson, N
1984-01-01
A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870
Kachel, Hamid S.; Patel, Rohit N.; Franzyk, Henrik; Mellor, Ian R.
2016-01-01
Philanthotoxin-433 (PhTX-433) is an active component of the venom from the Egyptian digger wasp, Philanthus triangulum. PhTX-433 inhibits several excitatory ligand-gated ion channels, and to improve selectivity two synthetic analogues, PhTX-343 and PhTX-12, were developed. Previous work showed a 22-fold selectivity of PhTX-12 over PhTX-343 for embryonic muscle-type nicotinic acetylcholine receptors (nAChRs) in TE671 cells. We investigated their inhibition of different neuronal nAChR subunit combinations as well as of embryonic muscle receptors expressed in Xenopus oocytes. Whole-cell currents in response to application of acetylcholine alone or co-applied with PhTX analogue were studied by using two-electrode voltage-clamp. α3β4 nAChRs were most sensitive to PhTX-343 (IC50 = 12 nM at −80 mV) with α4β4, α4β2, α3β2, α7 and α1β1γδ being 5, 26, 114, 422 and 992 times less sensitive. In contrast α1β1γδ was most sensitive to PhTX-12 along with α3β4 (IC50 values of 100 nM) with α4β4, α4β2, α3β2 and α7 being 3, 3, 26 and 49 times less sensitive. PhTX-343 inhibition was strongly voltage-dependent for all subunit combinations except α7, whereas this was not the case for PhTX-12 for which weak voltage dependence was observed. We conclude that PhTX-343 mainly acts as an open-channel blocker of nAChRs with strong subtype selectivity. PMID:27901080
Cyto- and receptor architecture of area 32 in human and macaque brains.
Palomero-Gallagher, Nicola; Zilles, Karl; Schleicher, Axel; Vogt, Brent A
2013-10-01
Human area 32 plays crucial roles in emotion and memory consolidation. It has subgenual (s32), pregenual (p32), dorsal, and midcingulate components. We seek to determine whether macaque area 32 has subgenual and pregenual subdivisions and the extent to which they are comparable to those in humans by means of NeuN immunohistochemistry and multireceptor analysis of laminar profiles. The macaque has areas s32 and p32. In s32, layer IIIa/b neurons are larger than those of layer IIIc. This relationship is reversed in p32. Layer Va is thicker and Vb thinner in s32. Area p32 contains higher kainate, benzodiazepine (BZ), and serotonin (5-HT)1A but lower N-methyl-D-aspartate (NMDA) and α2 receptor densities. Most differences were found in layers I, II, and VI. Together, these differences support the dual nature of macaque area 32. Comparative analysis of human and macaque s32 and p32 supports equivalences in cyto- and receptor architecture. Although there are differences in mean areal receptor densities, there are considerable similarities at the layer level. Laminar receptor distribution patterns in each area are comparable in the two species in layers III-Va for kainate, NMDA, γ-aminobutyric acid (GABA)B , BZ, and 5-HT1A receptors. Multivariate statistical analysis of laminar receptor densities revealed that human s32 is more similar to macaque s32 and p32 than to human p32. Thus, macaque 32 is more complex than hitherto known. Our data suggest a homologous neural architecture in anterior cingulate s32 and p32 in human and macaque brains. © 2013 Wiley Periodicals, Inc.
Peckys, Diana B; Baudoin, Jean-Pierre; Eder, Magdalena; Werner, Ulf; de Jonge, Niels
2013-01-01
Imaging single epidermal growth factor receptors (EGFR) in intact cells is presently limited by the available microscopy methods. Environmental scanning electron microscopy (ESEM) of whole cells in hydrated state in combination with specific labeling with gold nanoparticles was used to localize activated EGFRs in the plasma membranes of COS7 and A549 cells. The use of a scanning transmission electron microscopy (STEM) detector yielded a spatial resolution of 3 nm, sufficient to identify the locations of individual EGFR dimer subunits. The sizes and distribution of dimers and higher order clusters of EGFRs were determined. The distance between labels bound to dimers amounted to 19 nm, consistent with a molecular model. A fraction of the EGFRs was found in higher order clusters with sizes ranging from 32-56 nm. ESEM can be used for quantitative whole cell screening studies of membrane receptors, and for the study of nanoparticle-cell interactions in general.
Peckys, Diana B.; Baudoin, Jean-Pierre; Eder, Magdalena; Werner, Ulf; de Jonge, Niels
2013-01-01
Imaging single epidermal growth factor receptors (EGFR) in intact cells is presently limited by the available microscopy methods. Environmental scanning electron microscopy (ESEM) of whole cells in hydrated state in combination with specific labeling with gold nanoparticles was used to localize activated EGFRs in the plasma membranes of COS7 and A549 cells. The use of a scanning transmission electron microscopy (STEM) detector yielded a spatial resolution of 3 nm, sufficient to identify the locations of individual EGFR dimer subunits. The sizes and distribution of dimers and higher order clusters of EGFRs were determined. The distance between labels bound to dimers amounted to 19 nm, consistent with a molecular model. A fraction of the EGFRs was found in higher order clusters with sizes ranging from 32–56 nm. ESEM can be used for quantitative whole cell screening studies of membrane receptors, and for the study of nanoparticle-cell interactions in general. PMID:24022088
The A-Current Modulates Learning via NMDA Receptors Containing the NR2B Subunit
Fontán-Lozano, Ángela; Suárez-Pereira, Irene; González-Forero, David; Carrión, Ángel Manuel
2011-01-01
Synaptic plasticity involves short- and long-term events, although the molecular mechanisms that underlie these processes are not fully understood. The transient A-type K+ current (IA) controls the excitability of the dendrites from CA1 pyramidal neurons by regulating the back-propagation of action potentials and shaping synaptic input. Here, we have studied how decreases in IA affect cognitive processes and synaptic plasticity. Using wild-type mice treated with 4-AP, an IA inhibitor, and mice lacking the DREAM protein, a transcriptional repressor and modulator of the IA, we demonstrate that impairment of IA decreases the stimulation threshold for learning and the induction of early-LTP. Hippocampal electrical recordings in both models revealed alterations in basal electrical oscillatory properties toward low-theta frequencies. In addition, we demonstrated that the facilitated learning induced by decreased IA requires the activation of NMDA receptors containing the NR2B subunit. Together, these findings point to a balance between the IA and the activity of NR2B-containing NMDA receptors in the regulation of learning. PMID:21966384
DOE Office of Scientific and Technical Information (OSTI.GOV)
Culia, C.T.; Stubbs, L.J.; Montgomery, C.S.
1994-03-29
Three genes (Gabrg3, Gabra5, and Gabrb3) encoding the {gamma}{sub 3}, {alpha}{sub 5}, and {beta}{sub 3} subunits of the type A {gamma}-aminobutyric acid receptor, respectively, are known to map near the pink-eyed dilution (p) locus in mouse chromosome 7. This region shares homology with a segment of human chromosome 15 that is implicated in Angelman syndrome, an inherited neurobehavioral disorder. By mapping Gabrg3-Gabra5-Gabrb3-telomere. Like Gabrb3, neither the Gabra5 nor Gabrg3 gene is functionally imprinted in adult mouse brain. Mice deleted for all three subunits die at birth with a cleft palate, although there are rare survivors ({approximately} 5%) that do notmore » have a cleft palate but do exhibit a neurological abnormality characterized by tremor, jerky gait, and runtiness. The authors have previously suggested that deficiency of the {beta}{sub 3} subunit may be responsible for the clefting defect. Most notably, however, in this report they describe mice carrying two overlapping, complementing p deletions that fail to express the {gamma}{sub 3} transcript, as well as mice from another line that express neither the {gamma}{sub 3} nor {alpha}{sub 5} transcripts. Surprisingly, mice from both of these lines are phenotypically normal and do not exhibit any of the neurological symptoms characteristic of the rare survivors that are deleted for all three ({gamma}{sub 3}, {alpha}{sub 5}, and {beta}{sub 3}) subunits. These mice therefore provide a whole-organism type A {gamma}-aminobutyric-acid receptor background that is devoid of any receptor subtypes that normally contain the {gamma}{sub 3} and/or {alpha}{sub 5} subunits. The absence of an overt neurological phenotype in mice lacking the {gamma}{sub 3} and/or {alpha}{sub 5} subunits also suggests that mutations in these genes are unlikely to provide useful animal models for Angelman syndrome in humans.« less
Albers, Kathryn M; Zhang, Xiu Lin; Diges, Charlotte M; Schwartz, Erica S; Yang, Charles I; Davis, Brian M; Gold, Michael S
2014-05-22
Artemin (Artn), a member of the glial cell line-derived growth factor (GDNF) family, supports the development and function of a subpopulation of peptidergic, TRPV1-positive sensory neurons. Artn (enovin, neublastin) is elevated in inflamed tissue and its injection in skin causes transient thermal hyperalgesia. A genome wide expression analysis of trigeminal ganglia of mice that overexpress Artn in the skin (ART-OE mice) showed elevation in nicotinic acetylcholine receptor (nAChR) subunits, suggesting these ion channels contribute to Artn-induced sensitivity. Here we have used gene expression, immunolabeling, patch clamp electrophysiology and behavioral testing assays to investigate the link between Artn, nicotinic subunit expression and thermal hypersensitivity. Reverse transcriptase-PCR validation showed increased levels of mRNAs encoding the nAChR subunits α3 (13.3-fold), β3 (4-fold) and β4 (7.7-fold) in trigeminal ganglia and α3 (4-fold) and β4 (2.8-fold) in dorsal root ganglia (DRG) of ART-OE mice. Sensory ganglia of ART-OE mice had increased immunoreactivity for nAChRα3 and exhibited increased overlap in labeling with GFRα3-positive neurons. Patch clamp analysis of back-labeled cutaneous afferents showed that while the majority of nicotine-evoked currents in DRG neurons had biophysical and pharmacological properties of α7-subunit containing nAChRs, the Artn-induced increase in α3 and β4 subunits resulted in functional channels. Behavioral analysis of ART-OE and wildtype mice showed that Artn-induced thermal hyperalgesia can be blocked by mecamylamine or hexamethonium. Complete Freund's adjuvant (CFA) inflammation of paw skin, which causes an increase in Artn in the skin, also increased the level of nAChR mRNAs in DRG. Finally, the increase in nAChRs transcription was not dependent on the Artn-induced increase in TRPV1 or TRPA1 in ART-OE mice since nAChRs were elevated in ganglia of TRPV1/TRPA1 double knockout mice. These findings suggest that Artn
Catts, Vibeke Sørensen; Derminio, Dominique Suzanne; Hahn, Chang-Gyu; Weickert, Cynthia Shannon
2015-01-01
Background: There is converging evidence of involvement of N-methyl-d-aspartate (NMDA) receptor hypofunction in the pathophysiology of schizophrenia. Our group recently identified a decrease in total NR1 mRNA and protein expression in the dorsolateral prefrontal cortex in a case-control study of individuals with schizophrenia (n=37/group). The NR1 subunit is critical to NMDA receptor function at the postsynaptic density, a cellular structure rich in the scaffolding protein, PSD-95. The extent to which the NMDA receptor NR1 subunit is altered at the site of action, in the postsynaptic density, is not clear. Aims: To extend our previous results by measuring levels of NR1 and PSD-95 protein in postsynaptic density-enriched fractions of prefrontal cortex from the same individuals in the case-control study noted above. Methods: Postsynaptic density-enriched fractions were isolated from fresh-frozen prefrontal cortex (BA10) and subjected to western blot analysis for NR1 and PSD-95. Results: We found a 20% decrease in NR1 protein (t(66)=−2.874, P=0.006) and a 30% decrease in PSD-95 protein (t(63)=−2.668, P=0.010) in postsynaptic density-enriched fractions from individuals with schizophrenia relative to unaffected controls. Conclusions: Individuals with schizophrenia have less NR1 protein, and therefore potentially fewer functional NMDA receptors, at the postsynaptic density. The associated decrease in PSD-95 protein at the postsynaptic density suggests that not only are glutamate receptors compromised in individuals with schizophrenia, but the overall spine architecture and downstream signaling supported by PSD-95 may also be deficient. PMID:27336043
Prut, L; Prenosil, G; Willadt, S; Vogt, K; Fritschy, J-M; Crestani, F
2010-07-01
The memory for location of objects, which binds information about objects to discrete positions or spatial contexts of occurrence, is a form of episodic memory particularly sensitive to hippocampal damage. Its early decline is symptomatic for elderly dementia. Substances that selectively reduce alpha5-GABA(A) receptor function are currently developed as potential cognition enhancers for Alzheimer's syndrome and other dementia, consistent with genetic studies implicating these receptors that are highly expressed in hippocampus in learning performance. Here we explored the consequences of reduced GABA(A)alpha5-subunit contents, as occurring in alpha5(H105R) knock-in mice, on the memory for location of objects. This required the behavioral characterization of alpha5(H105R) and wild-type animals in various tasks examining learning and memory retrieval strategies for objects, locations, contexts and their combinations. In mutants, decreased amounts of alpha5-subunits and retained long-term potentiation in hippocampus were confirmed. They exhibited hyperactivity with conserved circadian rhythm in familiar actimeters, and normal exploration and emotional reactivity in novel places, allocentric spatial guidance, and motor pattern learning acquisition, inhibition and flexibility in T- and eight-arm mazes. Processing of object, position and context memories and object-guided response learning were spared. Genotype difference in object-in-place memory retrieval and in encoding and response learning strategies for object-location combinations manifested as a bias favoring object-based recognition and guidance strategies over spatial processing of objects in the mutants. These findings identify in alpha5(H105R) mice a behavioral-cognitive phenotype affecting basal locomotion and the memory for location of objects indicative of hippocampal dysfunction resulting from moderately decreased alpha5-subunit contents.
Pizzi, M; Fallacara, C; Arrighi, V; Memo, M; Spano, P F
1993-08-01
Activation of glutamate ionotropic receptors represents the primary event in the neurotoxicity process triggered by excitatory amino acids. We demonstrate here that the concentration-dependent stimulation of metabotropic glutamate receptor (mGluR) by the selective agonist trans-1-aminocyclopentane-1,3-dicarboxylate or by quisqualate counteracts both glutamate- and kainate-induced neurotoxicity in primary cultures of rat cerebellar granule cells. The mGluR-evoked responses are potentiated by aniracetam, which per se also elicits neuroprotection. Aniracetam concentration-dependently counteracted glutamate-, kainate-, or alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid-induced cell death and greatly facilitated neuroprotective response achieved by different concentrations of both quisqualate and trans-1-aminocyclopentane-1,3-dicarboxylate. In addition, aniracetam potentiated the mGluR-coupled stimulation of phospholipase C, as revealed by the measurement of 3H-inositol phosphate formation. Thus, mGluRs could be a suitable target for novel pharmacological strategies pointing to the treatment of neurodegenerative diseases.
Localization of a gene for a glutamate binding subunit of a NMDA receptor (GRINA) to 8q24
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lewis, T.B.; DuPont, B.R.; Leach, R.
1996-02-15
This article reports on the localization of a gene for a glutamate binding subunit of an N-methyl-D-aspartate (NMDA) receptor, called GRINA, to human chromosome 8q24 using fluorescence in situ hybridization and radiation hybridization mapping. This gene mapped outside the critical region for benign familial neonatal convulsions (BFNC), a rare form of epilepsy; however, GRINA could be the causative genetic factor inducing idiopathic generalized epilepsy. Further studies need to be conducted. 15 refs., 2 figs.
Porcu, Patrizia; Mostallino, Maria Cristina; Sogliano, Cristiana; Santoru, Francesca; Berretti, Roberta; Concas, Alessandra
2012-08-01
Fluctuations in the concentrations of the neuroactive steroid allopregnanolone are thought to influence γ-amino-butyric acid type A (GABA(A)) receptor gene expression and function. Long-term treatment with ethinyl estradiol (EE) plus levonorgestrel (LNG), two of the most widely used steroids in the hormonal contraceptive pill, decreases allopregnanolone levels in rat cerebral cortex and plasma, alters GABA(A) receptor expression and induces anxiety-like behavior. We evaluated which component of the hormonal contraceptive pill is responsible for the aforementioned changes. Female rats were injected subcutaneously (s.c.) with EE (0.030 mg) or LNG (0.125 mg) once a day for 4 weeks. Compared to the respective vehicle-treated control groups, EE decreased cerebral cortical levels of allopregnanolone, progesterone and pregnenolone by 76, 72 and 33%, respectively and hippocampal levels by 52, 56 and 50%, respectively. Likewise, LNG decreased cerebral cortical levels of allopregnanolone, progesterone and pregnenolone by 75, 68 and 33%, respectively, and hippocampal levels by 55, 65 and 60%, respectively. Administration of LNG, but not EE, increased the abundance of the γ2 subunit peptide in cerebral cortex and hippocampus by 38 and 59%, respectively. Further, LNG, but not EE, decreased the time spent and the number of entries into the open arms of the elevated plus maze by 56 and 43%, respectively, an index of anxiety-like behavior. These results suggest that alterations in GABA(A) receptor subunit expression and anxiety-like behavior induced by long-term treatment with combined EE/LNG appear to be caused by LNG. Given that both EE and LNG decrease allopregnanolone levels in a similar manner, these results further suggest that changes in allopregnanolone levels are not associated with GABA(A) receptor expression. Copyright © 2012 Elsevier Inc. All rights reserved.
GABA(C) receptors: a molecular view.
Enz, R
2001-08-01
In the central nervous system inhibitory neurotransmission is primarily achieved through activation of receptors for gamma-aminobutyric acid (GABA). Three types of GABA receptors have been identified on the basis of their pharmacological and electrophysiological properties. The predominant type, termed GABA(A), and a recently identified GABA(C) type, form ligand-gated chloride channels, whereas GABA(B) receptors activate separate cation channels via G proteins. Based on their homology to nicotinic acetylcholine receptors, GABA(C) receptors are believed to be oligomeric protein complexes composed of five subunits in a pentameric arrangement. To date up to five different GABA(C) receptors subunits have been identified in various species. Recent studies have shed new light on the biological characteristics of GABA(C) receptors, including the chromosomal localization of its subunit genes and resulting links to deseases, the cloning of new splice variants, the identification of GABA(C) receptor-associated proteins, the identification of domains involved in subunit assembly, and finally structure/function studies examining functional consequences of introduced mutations. This review summarizes recent data in view of the molecular structure of GABA(C) receptors and presents new insights into the biological function of this protein in the retina.
Harlow, Danielle E.; Saul, Katherine E.; Komuro, Hitoshi
2015-01-01
In previous studies, stimulation of ionotropic AMPA/kainate glutamate receptors on cultured oligodendrocyte cells induced the formation of a signaling complex that includes the AMPA receptor, integrins, calcium-binding proteins, and, surprisingly, the myelin proteolipid protein (PLP). AMPA stimulation of cultured oligodendrocyte progenitor cells (OPCs) also caused an increase in OPC migration. The current studies focused primarily on the formation of the PLP–αv integrin–AMPA receptor complex in vivo and whether complex formation impacts OPC migration in the brain. We found that in wild-type cerebellum, PLP associates with αv integrin and the calcium-impermeable GluR2 subunit of the AMPA receptor, but in mice lacking PLP, αv integrin did not associate with GluR2. Live imaging studies of OPC migration in ex vivo cerebellar slices demonstrated altered OPC migratory responses to neurotransmitter stimulation in the absence of PLP and GluR2 or when αv integrin levels were reduced. Chemotaxis assays of purified OPCs revealed that AMPA stimulation was neither attractive nor repulsive but clearly increased the migration rate of wild-type but not PLP null OPCs. AMPA receptor stimulation of wild-type OPCs caused decreased cell-surface expression of the GluR2 AMPA receptor subunit and increased intracellular Ca2+ signaling, whereas PLP null OPCs did not reduce GluR2 at the cell surface or increase Ca2+ signaling in response to AMPA treatment. Together, these studies demonstrate that PLP is critical for OPC responses to glutamate signaling and has important implications for OPC responses when levels of glutamate are high in the extracellular space, such as following demyelination. SIGNIFICANCE STATEMENT After demyelination, such as occurs in multiple sclerosis, remyelination of axons is often incomplete, leading to loss of neuronal function and clinical disability. Remyelination may fail because oligodendrocyte precursor cells (OPCs) do not completely migrate into
Schurr, A; Rigor, B M
1993-06-18
The effects of kainate (KA) on the recovery of neuronal function in rat hippocampal slices after hypoxia or glucose deprivation (GD) were investigated and compared to those of (R,S)-alpha-amino-3-hydroxy-5-methyl-4- isoxazoleproprionate (AMPA). KA and AMPA were found to be more toxic than either N-methyl-D-aspartate (NMDA), quinolinate, or glutamate, both under normal conditions and under states of energy deprivation. Doses as low as 1 microM KA or AMPA were sufficient to significantly reduce the recovery rate of neuronal function in slices after a standardized period of hypoxia or GD. The enhancement of hypoxic neuronal damage by both agonists could be partially blocked by the antagonist kynurenate, by the NMDA competitive antagonist AP5, and by elevating [Mg2+] in or by omitting Ca2+ from the perfusion medium. The AMPA antagonist glutamic acid diethyl ester was ineffective in preventing the enhanced hypoxic neuronal damage by either KA or AMPA. The antagonist of the glycine modulatory site on the NMDA receptor, 7-chlorokynurenate, did not block the KA toxicity but was able to block the toxicity of AMPA. 2,3-Dihydroxyquinoxaline completely blocked the KA- and AMPA-enhanced hypoxic neuronal damage. The KA-enhanced, GD-induced neuronal damage was prevented by Ca2+ depletion and partially antagonized by kynurenate but not by AP5 or elevated [Mg2+]. The results of the present study indicate that the KA receptor is involved in the mechanism of neuronal damage induced by hypoxia and GD, probably allowing Ca2+ influx and subsequent intracellular Ca2+ overload.(ABSTRACT TRUNCATED AT 250 WORDS)
Tumkosit, Prem; Kuryatov, Alexander; Luo, Jie; Lindstrom, Jon
2006-10-01
Nicotinic acetylcholine receptors (AChRs) containing alpha6 subunits are typically found at aminergic nerve endings where they play important roles in nicotine addiction and Parkinson's disease. alpha6* AChRs usually contain beta3 subunits. beta3 subunits are presumed to assemble only in the accessory subunit position within AChRs where they do not participate in forming acetylcholine binding sites. Assembly of subunits in the accessory position may be a critical final step in assembly of mature AChRs. Human alpha6 AChRs subtypes were permanently transfected into human tsA201 human embryonic kidney (HEK) cell lines. alpha6beta2beta3 and alpha6beta4beta3 cell lines were found to express much larger amounts of AChRs and were more sensitive to nicotine-induced increase in the amount of AChRs than were alpha6beta2 or alpha6beta4 cell lines. The increased sensitivity to nicotine-induced up-regulation was due not to a beta3-induced increase in affinity for nicotine but probably to a direct effect on assembly of AChR subunits. HEK cells express only a small amount of mature alpha6beta2 AChRs, but many of these subunits are on the cell surface. This contrasts with Xenopus laevis oocytes, which express a large amount of incorrectly assembled alpha6beta2 subunits that bind cholinergic ligands but form large amorphous intracellular aggregates. Monoclonal antibodies (mAbs) were made to the alpha6 and beta3 subunits to aid in the characterization of these AChRs. The alpha6 mAbs bind to epitopes C-terminal of the extracellular domain. These data demonstrate that both cell type and the accessory subunit beta3 can play important roles in alpha6* AChR expression, stability, and up-regulation by nicotine.
Abe, Tetsuya; Matsumura, Shinji; Katano, Tayo; Mabuchi, Tamaki; Takagi, Kunio; Xu, Li; Yamamoto, Akitsugu; Hattori, Kotaro; Yagi, Takeshi; Watanabe, Masahiko; Nakazawa, Takanobu; Yamamoto, Tadashi; Mishina, Masayoshi; Nakai, Yoshihide; Ito, Seiji
2005-09-01
Despite abundant evidence implicating the importance of N-methyl-D-aspartate (NMDA) receptors in the spinal cord for pain transmission, the signal transduction coupled to NMDA receptor activation is largely unknown for the neuropathic pain state that lasts over periods of weeks. To address this, we prepared mice with neuropathic pain by transection of spinal nerve L5. Wild-type, NR2A-deficient, and NR2D-deficient mice developed neuropathic pain; in addition, phosphorylation of NR2B subunits of NMDA receptors at Tyr1472 was observed in the superficial dorsal horn of the spinal cord 1 week after nerve injury. Neuropathic pain and NR2B phosphorylation at Tyr1472 were attenuated by the NR2B-selective antagonist CP-101,606 and disappeared in mice lacking Fyn kinase, a Src-family tyrosine kinase. Concomitant with the NR2B phosphorylation, an increase in neuronal nitric oxide synthase activity was visualized in the superficial dorsal horn of neuropathic pain mice by NADPH diaphorase histochemistry. Electron microscopy showed that the phosphorylated NR2B was localized at the postsynaptic density in the spinal cord of mice with neuropathic pain. Indomethacin, an inhibitor of prostaglandin (PG) synthesis, and PGE receptor subtype EP1-selective antagonist reduced the NR2B phosphorylation in these mice. Conversely, EP1-selective agonist stimulated Fyn kinase-dependent nitric oxide formation in the spinal cord. The present study demonstrates that Tyr1472 phosphorylation of NR2B subunits by Fyn kinase may have dual roles in the retention of NMDA receptors in the postsynaptic density and in activation of nitric oxide synthase, and suggests that PGE2 is involved in the maintenance of neuropathic pain via the EP1 subtype.
Fatemi, S. Hossein; Folsom, Timothy D.
2016-01-01
Gamma-aminobutyric acid (GABA) is the main inhibitory neurotransmitter in the brain. GABAergic receptor abnormalities have been documented in several major psychiatric disorders including schizophrenia, mood disorders, and autism. Abnormal expression of mRNA and protein for multiple GABA receptors has also been observed in multiple brain regions leading to alterations in the balance between excitatory/inhibitory signaling in the brain with potential profound consequences for normal cognition and maintenance of mood and perception. Altered expression of GABAA receptor subunits has been documented in Fragile X mental retardation 1 (FMR1) knockout mice, suggesting that loss of its protein product, fragile X mental retardation protein (FMRP), impacts GABAA subunit expression. Recent postmortem studies from our laboratory have shown reduced expression of FMRP in brains of subjects with schizophrenia, bipolar disorder, major depression, and autism. FMRP acts as a translational repressor and, under normal conditions, inhibits metabotropic glutamate receptor 5 (mGluR5)-mediated signaling. In fragile X syndrome (FXS), absence of FMRP is hypothesized to lead to unregulated mGluR5 signaling, ultimately resulting in the behavioral and intellectual impairments associated with this disorder. Our laboratory has identified changes in mGluR5 expression in autism, schizophrenia, and mood disorders. In the current review article, we discuss our postmortem data on GABA receptors, FMRP, and mGluR5 levels and compare our results with other laboratories. Finally, we discuss the interactions between these molecules and the potential for new therapeutic interventions that target these interconnected signaling systems. PMID:25432637
Fatemi, S Hossein; Folsom, Timothy D
2015-09-01
Gamma-aminobutyric acid (GABA) is the main inhibitory neurotransmitter in the brain. GABAergic receptor abnormalities have been documented in several major psychiatric disorders including schizophrenia, mood disorders, and autism. Abnormal expression of mRNA and protein for multiple GABA receptors has also been observed in multiple brain regions leading to alterations in the balance between excitatory/inhibitory signaling in the brain with potential profound consequences for normal cognition and maintenance of mood and perception. Altered expression of GABAA receptor subunits has been documented in fragile X mental retardation 1 (FMR1) knockout mice, suggesting that loss of its protein product, fragile X mental retardation protein (FMRP), impacts GABAA subunit expression. Recent postmortem studies from our laboratory have shown reduced expression of FMRP in the brains of subjects with schizophrenia, bipolar disorder, major depression, and autism. FMRP acts as a translational repressor and, under normal conditions, inhibits metabotropic glutamate receptor 5 (mGluR5)-mediated signaling. In fragile X syndrome (FXS), the absence of FMRP is hypothesized to lead to unregulated mGluR5 signaling, ultimately resulting in the behavioral and intellectual impairments associated with this disorder. Our laboratory has identified changes in mGluR5 expression in autism, schizophrenia, and mood disorders. In the current review article, we discuss our postmortem data on GABA receptors, FMRP, and mGluR5 levels and compare our results with other laboratories. Finally, we discuss the interactions between these molecules and the potential for new therapeutic interventions that target these interconnected signaling systems. Copyright © 2014 Elsevier B.V. All rights reserved.
Asher, O; Jensen, B S; Lupu-Meiri, M; Oron, Y; Fuchs, S
1998-04-17
The mongoose AChR alpha-subunit has been cloned and shown to be highly homologous to other AChR alpha-subunits, with only six differences in amino acid residues at positions that are conserved in animal species that bind alpha-bungarotoxin (alpha-BTX). Four of these six substitutions cluster in the ligand binding site, and one of them, Asn-187, forms a consensus N-glycosylation site. The mongoose glycosylated alpha-subunit has a higher apparent molecular mass than that of the rat glycosylated alpha-subunit, probably resulting from the additional glycosylation at Asn-187 of the mongoose subunit. The in vitro translated mongoose alpha-subunit, in a glycosylated or non-glycosylated form, does not bind alpha-BTX, indicating that lack of alpha-BTX binding can be achieved also in the absence of glycosylation.
Suga, Hinako; Haga, Tatsuya
2007-01-01
G protein-coupled receptors (GPCRs) constitute one of the largest families of genes in the human genome, and are the largest targets for drug development. Although a large number of GPCR genes have recently been identified, ligands have not yet been identified for many of them. Various assay systems have been employed to identify ligands for orphan GPCRs, but there is still no simple and general method to screen for ligands of such GPCRs, particularly of G(i)-coupled receptors. We have examined whether fusion proteins of GPCRs with G protein alpha subunit (Galpha) could be utilized for ligand screening and showed that the fusion proteins provide an effective method for the purpose. This article focuses on the followings: (1) characterization of GPCR genes and GPCRs, (2) identification of ligands for orphan GPCRs, (3) characterization of GPCR-Galpha fusion proteins, and (4) identification of ligands for orphan GPCRs using GPCR-Galpha fusion proteins.
NASA Astrophysics Data System (ADS)
Huss, Anja; Ramírez, Omar; Santibáñez, Felipe; Couve, Andrés.; Härtel, Steffen; Enderlein, Jörg
2013-02-01
The synaptic efficacy of neurons depends on the number of neurotransmitter receptors in the plasma membrane. The availability of these receptors is controlled by their specific intracellular trafficking routes. γ-Aminobutyric acid type B receptors (GABABRs) are heteromeric proteins consisting of GABABR1 and GABABR2 subunits. These receptors are found at the plasma membrane of somatodendritic postsynaptic sites and in axons. It is unknown whether the assembly of the subunits occurs directly in the somatic endoplasmic reticulum (ER) followed by vesicular transport, or whether the assembly occurs after the separate transport of the subunits to the dendritic ER compartment. To address this question we have studied the assembly of the GABABRs in hippocampal neurons with dual-color, 3D super-resolution optical fluctuation imaging (SOFI). SOFI is a fluorescence imaging modality which yields superresolved spatial resolution, 3D-sectioning and high image contrast. We will use the SOFI images to quantify the distribution of the GABABR subunits in the plasma membrane and in the dendritic intracellular compartments. Finally, we want to apply quantitative co-localization analysis to determine the compartments in which the assembly of the GABABR subunits occurs.
Yi, Jung-Sun; Lee, Soon-Keum; Sato, Taka-Aki; Koh, Jae-Young
2003-08-21
Zinc induces in cultured cortical neurons both p75(NTR) and p75(NTR)-associated death executor (NADE), which together contribute to caspase-dependent neuronal apoptosis. Since zinc neurotoxicity may contribute to neuronal death following seizures, we examined whether p75(NTR) and NADE are co-induced also in rat hippocampal neurons degenerating after seizures. Staining of brain sections with a zinc-specific fluorescent dye (N-(6-methoxy-8-quinolyl)-p-carboxybenzoylsulphonamide) and acid fuchsin revealed zinc accumulation in degenerating neuronal cell bodies in CA1 and CA3 of hippocampus 24 h after kainate injection. Both anti-p75(NTR) and anti-NADE immunoreactivities appeared in zinc-accumulating/degenerating neurons in both areas. Intraventricular injection of CaEDTA, without altering the severity or time course of kainate-induced seizures, markedly attenuated the induction of p75(NTR)/NADE in hippocampus, which correlated with the decrease of caspase-3 activation and zinc accumulation/cell death. The present study has demonstrated that p75(NTR) and NADE are co-induced in neurons degenerating after kainate-induced seizures in rats, likely in a zinc-dependent manner.
How theories evolved concerning the mechanism of action of barbiturates.
Löscher, Wolfgang; Rogawski, Michael A
2012-12-01
The barbiturate phenobarbital has been in use in the treatment of epilepsy for 100 years. It has long been recognized that barbiturates act by prolonging and potentiating the action of γ-aminobutyric acid (GABA) on GABA(A) receptors and at higher concentrations directly activating the receptors. A large body of data supports the concept that GABA(A) receptors are the primary central nervous system target for barbiturates, including the finding that transgenic mice with a point mutation in the β3 GABA(A) -receptor subunit exhibit diminished sensitivity to the sedative and immobilizing actions of the anesthetic barbiturate pentobarbital. Although phenobarbital is only modestly less potent as a GABA(A) -receptor modulator than pentobarbital, phenobarbital is minimally sedating at effective anticonvulsant doses. Possible explanations for the reduced sedative effect of phenobarbital include more regionally restricted action; partial agonist activity; reduced propensity to directly activate GABA(A) receptors (possibly including extrasynaptic receptors containing δ subunits); and reduced activity at other ion channel targets, including voltage-gated calcium channels. In recent years, substantial progress has been made in defining the structural features of GABA(A) receptors responsible for gating and allosteric modulation by drugs. Although the precise sites of action of barbiturates have not yet been defined, the second and third transmembrane domains of the β subunit appear to be critical; binding may involve a pocket formed by β-subunit methionine 286 as well as α-subunit methionine 236. In addition to effects on GABA(A) receptors, barbiturates block AMPA/kainate receptors, and they inhibit glutamate release through an effect on P/Q-type high-voltage activated calcium channels. The combination of these various actions likely accounts for their diverse clinical activities. Despite the remarkable progress of the last century, there is still much to learn about the
Epley, Kimberly E.; Urban, Jason M.; Ikenaga, Takanori; Ono, Fumihito
2008-01-01
The contraction of skeletal muscle is dependent upon synaptic transmission through acetylcholine receptors (AChRs) at the neuromuscular junction (NMJ). The lack of an AChR subunit causes a fetal akinesia in humans, leading to death in the first trimester and characteristic features of Fetal Akinesia Deformation Sequences (FADS). A corresponding null mutation of the δ-subunit in zebrafish (sofa potato; sop−/−) leads to the death of embryos around 5 days post-fertilization (dpf). In sop−/− mutants, we expressed modified δ-subunits, with one (δ1YFP) or two yellow fluorescent protein (δ2YFP) molecules fused at the intracellular loop, under the control of an α-actin promoter. AChRs containing these fusion proteins are fluorescent, assemble on the plasma membrane, make clusters under motor neuron endings, and generate synaptic current. We screened for germ-line transmission of the transgene and established a line of sop−/− fish stably expressing the δ2YFP. These δ2YFP/sop−/− embryos can mount escape behavior close to that of their wild type siblings. Synaptic currents in these embryos had a smaller amplitude, slower rise time, and slower decay when compared to wild type fish. Remarkably, these embryos grow to adulthood and display complex behaviors such as feeding and breeding. To the best of our knowledge, this is the first case of a mutant animal corresponding to first trimester lethality in human that has been rescued by a transgene and survived to adulthood. In the rescued fish, a foreign promoter drove the transgene expression and the NMJ had altered synaptic strength. The survival of the transgenic animal delineates requirements for gene therapies of NMJ. PMID:19052214
Effects of ibuprofen on cognition and NMDA receptor subunit expression across aging.
Márquez Loza, Alejandra; Elias, Valerie; Wong, Carmen P; Ho, Emily; Bermudez, Michelle; Magnusson, Kathy R
2017-03-06
Age-related declines in long- and short-term memory show relationships to decreases in N-methyl-d-aspartate (NMDA) receptor expression, which may involve inflammation. This study was designed to determine effects of an anti-inflammatory drug, ibuprofen, on cognitive function and NMDA receptor expression across aging. Male C57BL/6 mice (ages 5, 14, 20, and 26months) were fed ibuprofen (375ppm) in NIH31 diet or diet alone for 6weeks prior to testing. Behavioral testing using the Morris water maze showed that older mice performed significantly worse than younger in spatial long-term memory, reversal, and short-term memory tasks. Ibuprofen enhanced overall performance in the short-term memory task, but this appeared to be more related to improved executive function than memory. Ibuprofen induced significant decreases over all ages in the mRNA densities for GluN2B subunit, all GluN1 splice variants, and GluN1-1 splice forms in the frontal cortex and in protein expression of GluN2A, GluN2B and GluN1 C2' cassettes in the hippocampus. GluN1-3 splice form mRNA and C2' cassette protein were significantly increased across ages in frontal lobes of ibuprofen-treated mice. Ibuprofen did not alter expression of pro-inflammatory cytokines IL-1β and TNFα, but did reduce the area of reactive astrocyte immunostaining in frontal cortex of aged mice. Enhancement in executive function showed a relationship to increased GluN1-3 mRNA and decreased gliosis. These findings suggest that inflammation may play a role in executive function declines in aged animals, but other effects of ibuprofen on NMDA receptors appeared to be unrelated to aging or inflammation. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.
Effects of Ibuprofen on Cognition and NMDA Receptor Subunit Expression Across Aging
Loza, Alejandra Márquez; Elias, Valerie; Wong, Carmen P.; Ho, Emily; Bermudez, Michelle; Magnusson, Kathy R.
2017-01-01
Age-related declines in long- and short-term memory show relationships to decreases in N-methyl-D-aspartate (NMDA) receptor expression, which may involve inflammation. This study was designed to determine effects of an anti-inflammatory drug, ibuprofen, on cognitive function and NMDA receptor expression across aging. Male C57BL/6 mice (ages 5, 14, 20, and 26 months) were fed ibuprofen (375 ppm) in NIH31 diet or diet alone for 6 weeks prior to testing. Behavioral testing using the Morris water maze showed that older mice performed significantly worse than younger in spatial long-term memory, reversal, and short-term memory tasks. Ibuprofen enhanced overall performance in the short-term memory task, but this appeared to be more related to improved executive function than memory. Ibuprofen induced significant decreases over all ages in the mRNA densities for GluN2B subunit, all GluN1 splice variants, and GluN1-1 splice forms in the frontal cortex and in protein expression of GluN2A, GluN2B and GluN1 C2′ cassettes in the hippocampus. GluN1-3 splice form mRNA and C2′ cassette protein were significantly increased across ages in frontal lobes of ibuprofen-treated mice. Ibuprofen did not alter expression of pro-inflammatory cytokines IL-1β and TNFα, but did reduce the area of reactive astrocyte immunostaining in frontal cortex of aged mice. Enhancement in executive function showed a relationship to increased GluN1-3 mRNA and decreased gliosis. These findings suggest that inflammation may play a role in executive function declines in aged animals, but other effects of ibuprofen on NMDA receptors appeared to be unrelated to aging or inflammation. PMID:28057539
Properties of GluR3 receptors tagged with GFP at the amino or carboxyl terminus
Limon, Agenor; Reyes-Ruiz, Jorge Mauricio; Eusebi, Fabrizio; Miledi, Ricardo
2007-01-01
Anatomical visualization of neurotransmitter receptor localization is facilitated by tagging receptors, but this process can alter their functional properties. We have evaluated the distribution and properties of WT glutamate receptor 3 (GluR3) α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (WT GluR3) and two receptors in which GFP was tagged to the amino terminus (GFP-GluR3) or to the carboxyl terminus (GluR3-GFP). Although the fluorescence in Xenopus oocytes was stronger in the vegetal hemisphere because of localization of internal structures (probable sites of production, storage or recycling of receptors), the insertion of receptors into the plasma membrane was polarized to the animal hemisphere. The fluorescence intensity of oocytes injected with GluR3-GFP RNA was approximately double that of oocytes injected with GFP-GluR3 RNA. Accordingly, GluR3-GFP oocytes generated larger kainate-induced currents than GFP-GluR3 oocytes, with similar EC50 values. Currents elicited by glutamate, or AMPA coapplied with cyclothiazide, were also larger in GluR3-GFP oocytes. The glutamate- to kainate-current amplitude ratios differed, with GluR3-GFP being activated more efficiently by glutamate than the WT or GFP-GluR3 receptors. This pattern correlates with the slower decay of glutamate-induced currents generated by GluR3-GFP receptors. These changes were not observed when GFP was tagged to the amino terminus, and these receptors behaved like the WT. The antagonistic effects of 6-nitro-7-sulfamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) were not altered in any of the tagged receptors. We conclude that GFP is a useful and convenient tag for visualizing these proteins. However, the effects of different sites of tag insertion on receptor characteristics must be taken into account in assessing the roles played by these receptor proteins. PMID:17881566
Properties of GluR3 receptors tagged with GFP at the amino or carboxyl terminus.
Limon, Agenor; Reyes-Ruiz, Jorge Mauricio; Eusebi, Fabrizio; Miledi, Ricardo
2007-09-25
Anatomical visualization of neurotransmitter receptor localization is facilitated by tagging receptors, but this process can alter their functional properties. We have evaluated the distribution and properties of WT glutamate receptor 3 (GluR3) alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (WT GluR3) and two receptors in which GFP was tagged to the amino terminus (GFP-GluR3) or to the carboxyl terminus (GluR3-GFP). Although the fluorescence in Xenopus oocytes was stronger in the vegetal hemisphere because of localization of internal structures (probable sites of production, storage or recycling of receptors), the insertion of receptors into the plasma membrane was polarized to the animal hemisphere. The fluorescence intensity of oocytes injected with GluR3-GFP RNA was approximately double that of oocytes injected with GFP-GluR3 RNA. Accordingly, GluR3-GFP oocytes generated larger kainate-induced currents than GFP-GluR3 oocytes, with similar EC(50) values. Currents elicited by glutamate, or AMPA coapplied with cyclothiazide, were also larger in GluR3-GFP oocytes. The glutamate- to kainate-current amplitude ratios differed, with GluR3-GFP being activated more efficiently by glutamate than the WT or GFP-GluR3 receptors. This pattern correlates with the slower decay of glutamate-induced currents generated by GluR3-GFP receptors. These changes were not observed when GFP was tagged to the amino terminus, and these receptors behaved like the WT. The antagonistic effects of 6-nitro-7-sulfamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) were not altered in any of the tagged receptors. We conclude that GFP is a useful and convenient tag for visualizing these proteins. However, the effects of different sites of tag insertion on receptor characteristics must be taken into account in assessing the roles played by these receptor proteins.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wilden, P.A.; Treadway, J.L.; Morrison, B.D.
1989-12-12
Examination of {sup 125}I-IGF-1 affinity cross-linking and {beta}-subunit autophosphorylation has indicated that IGF-1 induces a covalent association of isolated {alpha}{beta} heterodimeric IGF-1 receptors into an {alpha}{sub 2}{beta}{sub 2} heterotetrameric state, in a similar manner to that observed for the insulin receptor. The formation of the {alpha}{sub 2}{beta}{sub 2} heterotetrameric IGF-1 receptor complex from the partially purified {alpha}{beta} heterodimers was time dependent with half-maximal formation in approximately 30 min at saturating IGF-1 concentrations. The IGF-1-dependent association of the partially purified {alpha}{beta} heterodimers into an {alpha}{sub 2}{beta}{sub 2} heterotetrameric state was specific for the IGF-1 receptors since IGF-1 was unable to stimulatemore » the protein kinase activity of the purified {alpha}{beta} heterodimeric insulin receptor complex. Incubation of the {alpha}{sub 2}{beta}{sub 2} heterotetrameric IGF-1 holoreceptor with the specific sulfhydryl agent iodoacetamide (IAN) did not alter {sup 125}I-IGF-1 binding or IGF-1 stimulation of protein kinase activity. However, IAN treatment of the {alpha}{beta} heterodimeric IGF-1 receptors inhibited the IGF-1 dependent covalent formation of the disulfide-linked {alpha}{sub 2}{beta}{sub 2} heterotetrameric complex. These data indicate that IGF-1 induces the covalent association of isolated {alpha}{beta} heterodimeric IGF-1 receptor complexes into a disulfide-linked {alpha}{sub 2}{beta}{sub 2} heterotetrameric state whereas Mn/MgATP induces a noncovalent association. Therefore, unlike the insulin receptor in which noncovalent association is sufficient for kinase activation, only the covalent assembly of the IGF-1 receptor {alpha}{beta} heterodimers into the {alpha}{sub 2}{beta}{sub 2} heterotetrameric holoreceptor complex is associated with ligand-stimulated protein kinase activation.« less
Loss of Hippocampal Neurons after Kainate Treatment Correlates with Behavioral Deficits
Maia, Gisela H.; Quesado, José L.; Soares, Joana I.; do Carmo, Joana M.; Andrade, Pedro A.; Andrade, José P.; Lukoyanov, Nikolai V.
2014-01-01
Treating rats with kainic acid induces status epilepticus (SE) and leads to the development of behavioral deficits and spontaneous recurrent seizures later in life. However, in a subset of rats, kainic acid treatment does not induce overt behaviorally obvious acute SE. The goal of this study was to compare the neuroanatomical and behavioral changes induced by kainate in rats that developed convulsive SE to those who did not. Adult male Wistar rats were treated with kainic acid and tested behaviorally 5 months later. Rats that had experienced convulsive SE showed impaired performance on the spatial water maze and passive avoidance tasks, and on the context and tone retention tests following fear conditioning. In addition, they exhibited less anxiety-like behaviors than controls on the open-field and elevated plus-maze tests. Histologically, convulsive SE was associated with marked neuron loss in the hippocampal CA3 and CA1 fields, and in the dentate hilus. Rats that had not experienced convulsive SE after kainate treatment showed less severe, but significant impairments on the spatial water maze and passive avoidance tasks. These rats had fewer neurons than control rats in the dentate hilus, but not in the hippocampal CA3 and CA1 fields. Correlational analyses revealed significant relationships between spatial memory indices of rats and neuronal numbers in the dentate hilus and CA3 pyramidal field. These results show that a part of the animals that do not display intense behavioral seizures (convulsive SE) immediately after an epileptogenic treatment, later in life, they may still have noticeable structural and functional changes in the brain. PMID:24409306
Risueño, Ruth M.; Schamel, Wolfgang W. A.; Alarcón, Balbino
2008-01-01
How the T cell antigen receptor (TCR) discriminates between molecularly related peptide/Major Histocompatibility Complex (pMHC) ligands and converts this information into different possible signaling outcomes is still not understood. One current model proposes that strong pMHC ligands, but not weak ones, induce a conformational change in the TCR. Evidence supporting this comes from a pull-down assay that detects ligand-induced binding of the TCR to the N-terminal SH3 domain of the adapter protein Nck, and also from studies with a neoepitope-specific antibody. Both methods rely on the exposure of a polyproline sequence in the CD3ε subunit of the TCR, and neither indicates whether the conformational change is transmitted to other CD3 subunits. Using a protease-sensitivity assay, we now show that the cytoplasmic tails of CD3ε and CD3ζ subunits become fully protected from degradation upon TCR triggering. These results suggest that the TCR conformational change is transmitted to the tails of CD3ε and CD3ζ, and perhaps all CD3 subunits. Furthermore, the resistance to protease digestion suggests that CD3 cytoplasmic tails adopt a compact structure in the triggered TCR. These results are consistent with a model in which transduction of the conformational change induced upon TCR triggering promotes condensation and shielding of the CD3 cytoplasmic tails. PMID:18320063
Ionotropic and metabotropic glutamate receptor antagonism attenuates cue-induced cocaine seeking.
Bäckström, Pia; Hyytiä, Petri
2006-04-01
Neuroanatomical and pharmacological evidence implicates glutamate transmission in drug-environment conditioning that partly controls drug seeking and relapse. Glutamate receptors could be targets for pharmacological attenuation of the motivational properties of drug-paired cues and for relapse prevention. The purpose of the present study was therefore to investigate the involvement of ionotropic and metabotropic glutamate receptor subtypes in cue-induced reinstatement of cocaine-seeking behavior. Rats were trained to self-administer cocaine using a second-order schedule of reinforcement (FR4(FR5:S)) under which a compound stimulus (light and tone) associated with cocaine infusions was presented contingently. Following extinction, the effects of the competitive NMDA receptor antagonist CGP 39551 (0, 2.5, 5, 10 mg/kg intraperitoneally (i.p.)), two competitive AMPA/kainate antagonists, CNQX (0, 0.75, 1.5, 3 mg/kg i.p.) and NBQX (0, 1.25, 2.5, 5 mg/kg i.p.), the NMDA/glycine site antagonist L-701,324 (0, 0.63, 1.25, 2.5 mg/kg i.p.), and the mGluR5 antagonist MPEP (0, 1.25, 2.5, 5 mg/kg i.p.) on cue-induced reinstatement of cocaine seeking were examined. The AMPA/kainate receptor antagonists CNQX and NBQX, the NMDA/glycine site antagonist L-701,324, and the mGluR5 antagonist MPEP attenuated significantly cue-induced reinstatement. The NMDA antagonist CGP 39551 failed to affect reinstatement. Additional control experiments indicated that attenuation of cue-induced reinstatement by CNQX, NBQX, L-701,324, and MPEP was not accompanied by significant suppression of spontaneous locomotor activity. These results suggest that conditioned influences on cocaine seeking depend on glutamate transmission. Accordingly, drugs with antagonist properties at various glutamate receptor subtypes could be useful in prevention of relapse induced by conditioned stimuli.
Ionotropic crustacean olfactory receptors.
Corey, Elizabeth A; Bobkov, Yuriy; Ukhanov, Kirill; Ache, Barry W
2013-01-01
The nature of the olfactory receptor in crustaceans, a major group of arthropods, has remained elusive. We report that spiny lobsters, Panulirus argus, express ionotropic receptors (IRs), the insect chemosensory variants of ionotropic glutamate receptors. Unlike insects IRs, which are expressed in a specific subset of olfactory cells, two lobster IR subunits are expressed in most, if not all, lobster olfactory receptor neurons (ORNs), as confirmed by antibody labeling and in situ hybridization. Ligand-specific ORN responses visualized by calcium imaging are consistent with a restricted expression pattern found for other potential subunits, suggesting that cell-specific expression of uncommon IR subunits determines the ligand sensitivity of individual cells. IRs are the only type of olfactory receptor that we have detected in spiny lobster olfactory tissue, suggesting that they likely mediate olfactory signaling. Given long-standing evidence for G protein-mediated signaling in activation of lobster ORNs, this finding raises the interesting specter that IRs act in concert with second messenger-mediated signaling.
Jain, Akansha; Kuryatov, Alexander; Wang, Jingyi; Kamenecka, Theodore M; Lindstrom, Jon
2016-11-04
All nicotinic acetylcholine receptors (nAChRs) evolved from homomeric nAChRs in which all five subunits are involved in forming acetylcholine (ACh) binding sites at their interfaces. Heteromeric α4β2* nAChRs typically have two ACh binding sites at α4/β2 interfaces and a fifth accessory subunit surrounding the central cation channel. β2 accessory subunits do not form ACh binding sites, but α4 accessory subunits do at the α4/α4 interface in (α4β2) 2 α4 nAChRs. α5 and β3 are closely related subunits that had been thought to act only as accessory subunits and not take part in forming ACh binding sites. The effect of agonists at various subunit interfaces was determined by blocking homologous sites at these interfaces using the thioreactive agent 2-((trimethylammonium)ethyl) methanethiosulfonate (MTSET). We found that α5/α4 and β3/α4 interfaces formed ACh binding sites in (α4β2) 2 α5 and (α4β2) 2 β3 nAChRs. The α4/α5 interface in (β2α4) 2 α5 nAChRs also formed an ACh binding site. Blocking of these sites with MTSET reduced the maximal ACh evoked responses of these nAChRs by 30-50%. However, site-selective agonists NS9283 (for the α4/α4 site) and sazetidine-A (for the α4/β2 site) did not act on the ACh sites formed by the α5/α4 or β3/α4 interfaces. This suggests that unorthodox sites formed by α5 and β3 subunits have unique ligand selectivity. Agonists or antagonists for these unorthodox sites might be selective and effective drugs for modulating nAChR function to treat nicotine addiction and other disorders. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cote, Marceline; Zheng, Yi-Min; Albritton, Lorraine M.
2011-12-20
Jaagsiekte sheep retrovirus (JSRV) and enzootic nasal tumor virus (ENTV) are two closely related oncogenic retroviruses that share the same cellular receptor yet exhibit distinct fusogenicity and infectivity. Here, we find that the low fusogenicity of ENTV envelope protein (Env) is not because of receptor binding, but lies in its intrinsic insensitivity to receptor-mediated triggering for fusion at low pH. Distinct from JSRV, shedding of ENTV surface (SU) subunit into culture medium was not enhanced by a soluble form of receptor, Hyal2 (sHyal2), and sHyal2 was unable to effectively inactivate the ENTV pseudovirions. Remarkably, replacing either of the two aminomore » acid residues, N191 or S195, located in the ENTV SU with the corresponding JSRV residues, H191 or G195, markedly increased the Env-mediated membrane fusion activity and infection. Reciprocal amino acid substitutions also partly switched the sensitivities of ENTV and JSRV pseudovirions to sHyal2-mediated SU shedding and inactivation. While N191 is responsible for an extra N-linked glycosylation of ENTV SU relative to that of JSRV, S195 possibly forms a hydrogen bond with a surrounding amino acid residue. Molecular modeling of the pre-fusion structure of JSRV Env predicts that the segment of SU that contains H191 to G195 contacts the fusion peptide and suggests that the H191N and G195S changes seen in ENTV may stabilize its pre-fusion structure against receptor priming and therefore modulate fusion activation by Hyal2. In summary, our study reveals critical determinants in the SU subunits of JSRV and ENTV Env proteins that likely regulate their local structures and thereby differential receptor-mediated fusion activation at low pH, and these findings explain, at least in part, their distinct viral infectivity.« less
McLachlan, Sandra M; Aliesky, Holly A; Chen, Chun-Rong; Chong, Gao; Rapoport, Basil
2012-01-01
Transgenic mice with the human thyrotropin-receptor (TSHR) A-subunit targeted to the thyroid are tolerant of the transgene. In transgenics that express low A-subunit levels (Lo-expressors), regulatory T cell (Treg) depletion using anti-CD25 before immunization with adenovirus encoding the A-subunit (A-sub-Ad) breaks tolerance, inducing extensive thyroid lymphocytic infiltration, thyroid damage and antibody spreading to other thyroid proteins. In contrast, no thyroiditis develops in Hi-expressor transgenics or wild-type mice. Our present goal was to determine if thyroiditis could be induced in Hi-expressor transgenics using a more potent immunization protocol: Treg depletion, priming with Complete Freund's Adjuvant (CFA) + A-subunit protein and further Treg depletions before two boosts with A-sub-Ad. As controls, anti-CD25 treated Hi- and Lo-expressors and wild-type mice were primed with CFA+ mouse thyroglobulin (Tg) or CFA alone before A-sub-Ad boosting. Thyroiditis developed after CFA+A-subunit protein or Tg and A-sub-Ad boosting in Lo-expressor transgenics but Hi- expressors (and wild-type mice) were resistant to thyroiditis induction. Importantly, in Lo-expressors, thyroiditis was associated with the development of antibodies to the mouse TSHR downstream of the A-subunit. Unexpectedly, we observed that the effect of bacterial products on the immune system is a "double-edged sword". On the one hand, priming with CFA (mycobacteria emulsified in oil) plus A-subunit protein broke tolerance to the A-subunit in Hi-expressor transgenics leading to high TSHR antibody levels. On the other hand, prior treatment with CFA in the absence of A-subunit protein inhibited responses to subsequent immunization with A-sub-Ad. Consequently, adjuvant activity arising in vivo after bacterial infections combined with a protein autoantigen can break self-tolerance but in the absence of the autoantigen, adjuvant activity can inhibit the induction of immunity to autoantigens (like the
Chandra, Dev; Korpi, Esa R; Miralles, Celia P; De Blas, Angel L; Homanics, Gregg E
2005-01-01
Background Gamma-aminobutyric acid type A receptors (GABAA-Rs) are the major inhibitory receptors in the mammalian brain and are modulated by a number of sedative/hypnotic drugs including benzodiazepines and anesthetics. The significance of specific GABAA-Rs subunits with respect to behavior and in vivo drug responses is incompletely understood. The γ2 subunit is highly expressed throughout the brain. Global γ2 knockout mice are insensitive to the hypnotic effects of diazepam and die perinatally. Heterozygous γ2 global knockout mice are viable and have increased anxiety-like behaviors. To further investigate the role of the γ2 subunit in behavior and whole animal drug action, we used gene targeting to create a novel mouse line with attenuated γ2 expression, i.e., γ2 knockdown mice. Results Knockdown mice were created by inserting a neomycin resistance cassette into intron 8 of the γ2 gene. Knockdown mice, on average, showed a 65% reduction of γ2 subunit mRNA compared to controls; however γ2 gene expression was highly variable in these mice, ranging from 10–95% of normal. Immunohistochemical studies demonstrated that γ2 protein levels were also variably reduced. Pharmacological studies using autoradiography on frozen brain sections demonstrated that binding of the benzodiazepine site ligand Ro15-4513 was decreased in mutant mice compared to controls. Behaviorally, knockdown mice displayed enhanced anxiety-like behaviors on the elevated plus maze and forced novelty exploration tests. Surprisingly, mutant mice had an unaltered response to hypnotic doses of the benzodiazepine site ligands diazepam, midazolam and zolpidem as well as ethanol and pentobarbital. Lastly, we demonstrated that the γ2 knockdown mouse line can be used to create γ2 global knockout mice by crossing to a general deleter cre-expressing mouse line. Conclusion We conclude that: 1) insertion of a neomycin resistance gene into intron 8 of the γ2 gene variably reduced the amount of γ2
Mallozzi, Cinzia; Parravano, Mariacristina; Gaddini, Lucia; Villa, Marika; Pricci, Flavia; Malchiodi-Albedi, Fiorella; Matteucci, Andrea
2018-05-30
Curcumin is one of the major compounds contained in turmeric, the powdered rhizome of Curcuma longa. Results obtained in various experimental models indicate that curcumin has the potential to treat a large variety of neuronal diseases. Excitotoxicity, the toxicity due to pathological glutamate receptors stimulation, has been considered to be involved in several ocular pathologies including ischemia, glaucoma, and diabetic retinopathy. The NMDA receptor (NMDAR), a heteromeric ligand-gated ion channel, is composed of GluN1 and GluN2 subunits. There are four GluN2 subunits (GluN2A-D), which are major determinants of the functional properties of NMDARs. It is widely accepted that GluN2B has a pivotal role in excitotoxicity while the role of GluN2A remains controversial. We previously demonstrated that curcumin is neuroprotective against NMDA-induced excitotoxicity with a mechanism involving an increase of GluN2A subunit activity. In this paper, we investigate the mechanisms involved in curcumin-induced GluN2A increase in retinal cultures. Our results show that curcumin treatment activated CaMKII with a time-course that paralleled those of GluN2A increase. Moreover, KN-93, a CaMKII inhibitor, was able to block the effect of curcumin on GluN2A expression. Finally, in our experimental model, curcumin reduced ser/thr phosphatases activity. Using okadaic acid, a specific PP1 and PP2A blocker, we observed an increase in GluN2A levels in cultures. The ability of okadaic acid to mimic the effect of curcumin on GluN2A expression suggests that curcumin might regulate GluN2A expression through a phosphatase-dependent mechanism. In conclusion, our findings indicate curcumin modulation of CaMKII and/or ser/thr phosphatases activities as a mechanism involved in GluN2A expression and neuroprotection against excitotoxicity.
Markussen, Mette D K; Kristensen, Michael
2010-11-01
Neonicotinoid action as well as resistance involves interaction with nicotinic acetylcholine receptors (nAChRs). In the housefly, neonicotinoid resistance also involves cytochrome P450, as indicated by bioassay with synergist as well as altered expression. In bioassay, synergism was only partial and indicated possible target-site resistance. The nAChR α2 subunit is important in neonicotinoid toxicity to insects, and gene expression of the Mdα2 subunit was investigated in field populations and laboratory strains of neonicotinoid-resistant and insecticide-susceptible houseflies, Musca domestica L. The genomic sequence covering exon III-VII of Mdα2 was analysed for mutations. Gene expression profiling of Mdα2 revealed notable differences between neonicotinoid-resistant and insecticide-susceptible houseflies. On average, the neonicotinoid-resistant field population 766b and the imidacloprid selected strain 791imi had 60% lower copy numbers of Mdα2 compared with the susceptible reference strain. Sequencing of exon III-VII of the Mdα2, encoding acetylcholine binding-site regions and three out of four transmembrane domains, did not reveal any mutations explaining the increased neonicotinoid tolerance in the strains examined. Previous discoveries and the results of this study suggest that the neonicotinoid resistance mechanism in Danish houseflies involves both cytochrome P450 monooxygenase-mediated detoxification and reduced expression of the nAChR subunit α2. Copyright © 2010 Society of Chemical Industry.
Kuryatov, Alexandre
2011-01-01
α6β2β3* acetylcholine receptors (AChRs) on dopaminergic neurons are important targets for drugs to treat nicotine addiction and Parkinson's disease. However, it has not been possible to efficiently express functional α6β2β3* AChRs in oocytes or transfected cells. α6/α3 subunit chimeras permit expression of functional AChRs and reveal that parts of the α6 M1 transmembrane domain and large cytoplasmic domain impair assembly. Concatameric subunits permit assembly of functional α6β2β3* AChRs with defined subunit compositions and subunit orders. Assembly of accessory subunits is limiting in formation of mature AChRs. A single linker between the β3 accessory subunit and an α4 or α6 subunit is sufficient to permit assembly of complex β3-(α4β2)(α6β2) or β3-(α6β2)(α4β2) AChRs. Concatameric pentamers such as β3-α6-β2-α4-β2 have been functionally characterized. α6β2β3* AChRs are sensitive to activation by drugs used for smoking cessation therapy (nicotine, varenicline, and cytisine) and by sazetidine. All these are partial agonists. (α6β2)(α4β2)β3 AChRs are most sensitive to agonists. (α6β2)2β3 AChRs have the greatest Ca2+ permeability. (α4β2)(α6β2)β3 AChRs are most efficiently transported to the cell surface, whereas (α6β2)2β3 AChRs are the least efficiently transported. Dopaminergic neurons may have special chaperones for assembling accessory subunits with α6 subunits and for transporting (α6β2)2β3 AChRs to the cell surface. Concatameric pentamers and pentamers formed from combinations of trimers, dimers, and monomers exhibit similar properties, indicating that the linkers between subunits do not alter their functional properties. For the first time, these concatamers allow analysis of functional properties of α6β2β3* AChRs. These concatamers should enable selection of drugs specific for α6β2β3* AChRs. PMID:20923852
Importance of GluA1 Subunit-Containing AMPA Glutamate Receptors for Morphine State-Dependency
Aitta-aho, Teemu; Möykkynen, Tommi P.; Panhelainen, Anne E.; Vekovischeva, Olga Yu.; Bäckström, Pia; Korpi, Esa R.
2012-01-01
In state-dependency, information retrieval is most efficient when the animal is in the same state as it was during the information acquisition. State-dependency has been implicated in a variety of learning and memory processes, but its mechanisms remain to be resolved. Here, mice deficient in AMPA-type glutamate receptor GluA1 subunits were first conditioned to morphine (10 or 20 mg/kg s.c. during eight sessions over four days) using an unbiased procedure, followed by testing for conditioned place preference at morphine states that were the same as or different from the one the mice were conditioned to. In GluA1 wildtype littermate mice the same-state morphine dose produced the greatest expression of place preference, while in the knockout mice no place preference was then detected. Both wildtype and knockout mice expressed moderate morphine-induced place preference when not at the morphine state (saline treatment at the test); in this case, place preference was weaker than that in the same-state test in wildtype mice. No correlation between place preference scores and locomotor activity during testing was found. Additionally, as compared to the controls, the knockout mice showed unchanged sensitization to morphine, morphine drug discrimination and brain regional μ-opioid receptor signal transduction at the G-protein level. However, the knockout mice failed to show increased AMPA/NMDA receptor current ratios in the ventral tegmental area dopamine neurons of midbrain slices after a single injection of morphine (10 mg/kg, s.c., sliced prepared 24 h afterwards), in contrast to the wildtype mice. The results indicate impaired drug-induced state-dependency in GluA1 knockout mice, correlating with impaired opioid-induced glutamate receptor neuroplasticity. PMID:22675452
DOE Office of Scientific and Technical Information (OSTI.GOV)
King, K.; Caron, M.G.; Lefkowitz, R.J.
1990-10-05
To facilitate functional and mechanistic studies of receptor-G protein interactions by expression of the human {beta}{sub 2}-adrenergic receptor (h{beta}-AR) has been expressed in Saccharomyces cerevisiae. This was achieved by placing a modified h{beta}-AR gene under control of the galactose-inducible GAL1 promoter. After induction by galactose, functional h{beta}-AR was expressed at a concentration several hundred times as great as that found in any human tissue. As determined from competitive ligand binding experiments, h{beta}-AR expressed in yeast displayed characteristic affinities, specificity, and stereoselectivity. Partial activation of the yeast pheromone response pathway by {beta}-adrenergic receptor agonists was achieved in cells coexpressing h{beta}-AR andmore » a mammalian G protein (G{sub s}) {alpha} subunit - demonstrating that these components can couple to each other and to downstream effectors when expressed in yeast. This in vivo reconstitution system provides a new approach for examining ligand binding and G protein coupling to cell surface receptors.« less
Kimmich, Tanja; Brüning, Ansgar; Käufl, Stephanie D; Makovitzky, Josef; Kuhn, Christina; Jeschke, Udo; Friese, Klaus; Mylonas, Ioannis
2010-08-01
Inhibins and activins are important regulators of the female reproductive system. Recently, two novel inhibin subunits, named betaC and betaE, have been identified and shown to be expressed in several human tissues. However, only limited data on the expression of these novel inhibin subunits in normal human endometrial tissue and endometrial adenocarcinoma cell lines exist. Samples of proliferative and secretory human endometrium were obtained from five premenopausal, non-pregnant patients undergoing gynecological surgery for benign diseases. Normal endometrial tissue and Ishikawa endometrial adenocarcinoma cell lines were analyzed by immunohistochemistry, immunofluorescence and RT-PCR. Expression of the inhibin betaC and betaE subunits could be demonstrated at the protein level by means of immunohistochemical evaluation and at the transcriptional level by establishing a betaC- and betaE-specific RT-PCR analysis in normal human endometrial tissue and the parental Ishikawa cell line. Interestingly, in a highly de-differentiated subclone of the Ishikawa cell line lacking estrogen receptor expression, the expression of the inhibin-betaC subunit appeared strongly reduced. Here, we show for the first time that the novel inhibin/activin-betaC and -betaE subunits are expressed in normal human endometrium and the estrogen receptor positive human endometrial carcinoma cell line Ishikawa using RT-PCR and immunohistochemical detection methods. Interestingly, the Ishikawa minus cell line (lacking estrogen receptor expression) demonstrated no to minimal expression of the betaC subunit as observed with immunofluorescence and RT-PCR, suggesting a possible hormone- dependency of this subunit in human endometrial cancer cells. Moreover, because the Ishikawa cell line minus is thought to be a more malignant endometrial cell line than its estrogen receptor positive counterpart, inhibin-betaC subunit might be substantially involved in the pathogenesis and malignant transformation in
Piantadosi, Sean C.; French, Beverly J.; Poe, Michael M.; Timić, Tamara; Marković, Bojan D.; Pabba, Mohan; Seney, Marianne L.; Oh, Hyunjung; Orser, Beverley A.; Savić, Miroslav M.; Cook, James M.; Sibille, Etienne
2016-01-01
Rationale: Current first-line treatments for stress-related disorders such as major depressive disorder (MDD) act on monoaminergic systems and take weeks to achieve a therapeutic effect with poor response and low remission rates. Recent research has implicated the GABAergic system in the pathophysiology of depression, including deficits in interneurons targeting the dendritic compartment of cortical pyramidal cells. Objectives: The present study evaluates whether SH-053-2’F-R-CH3 (denoted “α5-PAM”), a positive allosteric modulator selective for α5-subunit containing GABAA receptors found predominantly on cortical pyramidal cell dendrites, has anti-stress effects. Methods: Female and male C57BL6/J mice were exposed to unpredictable chronic mild stress (UCMS) and treated with α5-PAM acutely (30 min prior to assessing behavior) or chronically before being assessed behaviorally. Results: Acute and chronic α5-PAM treatments produce a pattern of decreased stress-induced behaviors (denoted as “behavioral emotionality”) across various tests in female, but not in male mice. Behavioral Z-scores calculated across a panel of tests designed to best model the range and heterogeneity of human symptomatology confirmed that acute and chronic α5-PAM treatments consistently produce significant decreases in behavioral emotionality in several independent cohorts of females. The behavioral responses to α5-PAM could not be completely accounted for by differences in drug brain disposition between female and male mice. In mice exposed to UCMS, expression of the Gabra5 gene was increased in the frontal cortex after acute treatment and in the hippocampus after chronic treatment with α5-PAM in females only, and these expression changes correlated with behavioral emotionality. Conclusion: We showed that acute and chronic positive modulation of α5 subunit-containing GABAA receptors elicit anti-stress effects in a sex-dependent manner, suggesting novel therapeutic modalities
2004-09-01
hippocampus and hypothalamus. J Neurosci Res 63:200-208. Thorpe GH et al. (1989) Chemiluminescent enzyme immunoassay of alpha - fetoprotein based on an...cells. Proc Natl Acad Sci USA 83:6213-6215. Montpied Pet al. (1991) Prolonged ethanol inhalation decreases gamma-aminobutyric acidA receptor alpha ...potentials mediated via alpha -bungarotoxin-sensitive nico- tinic acetylcholine receptors in rat hippocampal interneurons. J Neurosci 18:8228- 8235
Biggs, Katie; Seidel, Jason S; Wilson, Alex; Martyniuk, Christopher J
2013-09-01
γ-Amino-butyric acid (GABA) is the major inhibitory neurotransmitter in the vertebrate central nervous system. GABA receptors and synthesizing enzymes have also been localized to peripheral tissues including the liver, oviduct, uterus and ovary of mammals but the distribution and role of GABA in peripheral tissues of fish has not been fully investigated. The objectives of this study were to (1) determine if mRNA encoding GABA synthesizing enzymes (glutamic acid decarboxylase 65 and 67; gad65 and gad67), GABA transporters, and GABAA receptor subunits are localized to liver and gonad of fathead minnow (Pimephales promelas) (FHM) (2) investigate the effects of GABA on ovarian 17β-estradiol (E2) production, and (3) measure transcript responses in the ovary after in vitro incubation to GABA. Real-time PCR assays were developed for gad65, gad67, vesicular GABA transporter (vgat) and GABA transporter 1 (gat1), and select GABAA receptor subunits (gabra1, gabra5, gabrb1, gabrb2, gabrg1, gabrg2). All transcripts were localized to the brain as expected; however transcripts were also detected in the liver, ovary, and testis of FHMs. In the female liver, gad65 mRNA was significantly higher in expression compared to the male liver. Transcripts for gad67 were the highest in the brain>gonad>liver and in the gonads, gad67 was significantly higher in expression than gad65 mRNA. In the liver and gonad, the relative abundance of the subunits followed a general trend of gabrb1>gabrb2=gabrg1=gabrg2>gabra1=gabra5. To explore the effects of GABA in the ovary, tissue explants from reproductive female FHMs were treated with GABA (10(-10), 10(-8) and 10(-6)M) for 12h. GABA had no significant effect on 17β-estradiol production or on mRNA abundance for genes involved in ovarian steroidogenesis (e.g., 11βhsd, cyp17, cyp19a). There was a significant decrease in estrogen receptor 2a (esr2a) mRNA with 10(-10)M GABA. This study begins to investigate the GABA system in non-neural tissues of
Use of polyclonal and monoclonal antibodies to study hCG-receptor interactions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Milius, R.P.
1985-01-01
Although the glycoprotein hormones lutropin (LH), follitropin (FSH), and thyrotropin (TSH) bind to different receptors, each contains an identical alpha subunit. Specificity is somehow endowed by theta subunits which are distinct for each hormone. Human choriogonadotropin (hCG) is a natural LH analog that contains a beta subunit nearly identical to that of LH. The roles of these subunits in the recognition and high affinity binding of hCG to receptor was examined. Polyclonal and monoclonal antibodies specific for the individual subunits of hCG were used to probe the hormone-receptor interaction. Conformation-specific and sequence-specific antibodies were examined for their abilities to bindmore » Triton X-100-solubilized /sup 125/I-hCG-receptor complex and to inhibit hormone binding to crude rat ovarian membranes containing receptor. Even though the immunoreactive sites are not located on the receptor binding surface of the beta subunit, most, but not all, of these polyclonal and monoclonal antibodies were able to inhibit /sup 125/I-hCG binding to receptor. Although the inhibition of binding may be due to steric interference due to the size of the antibody molecules, a two-step model for hCG binding to receptor is presented that also explains these results. In this model, the beta subunit initially binds with the receptor with a highly specific but low affinity interaction. This activates a site for the high affinity binding of the alpha subunit and stabilization of the complex. This is an attractive model as it may be applied to other glycoprotein hormones sharing an alpha subunit.« less
Rubio, María E; Matsui, Ko; Fukazawa, Yugo; Kamasawa, Naomi; Harada, Harumi; Itakura, Makoto; Molnár, Elek; Abe, Manabu; Sakimura, Kenji; Shigemoto, Ryuichi
2017-11-01
The neurotransmitter receptor subtype, number, density, and distribution relative to the location of transmitter release sites are key determinants of signal transmission. AMPA-type ionotropic glutamate receptors (AMPARs) containing GluA3 and GluA4 subunits are prominently expressed in subsets of neurons capable of firing action potentials at high frequencies, such as auditory relay neurons. The auditory nerve (AN) forms glutamatergic synapses on two types of relay neurons, bushy cells (BCs) and fusiform cells (FCs) of the cochlear nucleus. AN-BC and AN-FC synapses have distinct kinetics; thus, we investigated whether the number, density, and localization of GluA3 and GluA4 subunits in these synapses are differentially organized using quantitative freeze-fracture replica immunogold labeling. We identify a positive correlation between the number of AMPARs and the size of AN-BC and AN-FC synapses. Both types of AN synapses have similar numbers of AMPARs; however, the AN-BC have a higher density of AMPARs than AN-FC synapses, because the AN-BC synapses are smaller. A higher number and density of GluA3 subunits are observed at AN-BC synapses, whereas a higher number and density of GluA4 subunits are observed at AN-FC synapses. The intrasynaptic distribution of immunogold labeling revealed that AMPAR subunits, particularly GluA3, are concentrated at the center of the AN-BC synapses. The central distribution of AMPARs is absent in GluA3-knockout mice, and gold particles are evenly distributed along the postsynaptic density. GluA4 gold labeling was homogenously distributed along both synapse types. Thus, GluA3 and GluA4 subunits are distributed at AN synapses in a target-cell-dependent manner.
Transcriptional regulators of Na,K-ATPase subunits
Li, Zhiqin; Langhans, Sigrid A.
2015-01-01
The Na,K-ATPase classically serves as an ion pump creating an electrochemical gradient across the plasma membrane that is essential for transepithelial transport, nutrient uptake and membrane potential. In addition, Na,K-ATPase also functions as a receptor, a signal transducer and a cell adhesion molecule. With such diverse roles, it is understandable that the Na,K-ATPase subunits, the catalytic α-subunit, the β-subunit and the FXYD proteins, are controlled extensively during development and to accommodate physiological needs. The spatial and temporal expression of Na,K-ATPase is partially regulated at the transcriptional level. Numerous transcription factors, hormones, growth factors, lipids, and extracellular stimuli modulate the transcription of the Na,K-ATPase subunits. Moreover, epigenetic mechanisms also contribute to the regulation of Na,K-ATPase expression. With the ever growing knowledge about diseases associated with the malfunction of Na,K-ATPase, this review aims at summarizing the best-characterized transcription regulators that modulate Na,K-ATPase subunit levels. As abnormal expression of Na,K-ATPase subunits has been observed in many carcinoma, we will also discuss transcription factors that are associated with epithelial-mesenchymal transition, a crucial step in the progression of many tumors to malignant disease. PMID:26579519
Xiao, Min-Yi; Gustafsson, Bengt; Niu, Yin-Ping
2006-01-01
The trafficking of ionotropic glutamate (AMPA, NMDA and kainate) and GABAA receptors in and out of, or laterally along, the postsynaptic membrane has recently emerged as an important mechanism in the regulation of synaptic function, both under physiological and pathological conditions, such as information processing, learning and memory formation, neuronal development, and neurodegenerative diseases. Non-ionotropic glutamate receptors, primarily group I metabotropic glutamate receptors (mGluRs), co-exist with the postsynaptic ionotropic glutamate and GABAA receptors. The ability of mGluRs to regulate postsynaptic phosphorylation and Ca2+ concentration, as well as their interactions with postsynaptic scaffolding/signaling proteins, makes them well suited to influence the trafficking of ionotropic glutamate and GABAA receptors. Recent studies have provided insights into how mGluRs may impose such an influence at central synapses, and thus how they may affect synaptic signaling and the maintenance of long-term synaptic plasticity. In this review we will discuss some of the recent progress in this area: i) long-term synaptic plasticity and the involvement of mGluRs; ii) ionotropic glutamate receptor trafficking and long-term synaptic plasticity; iii) the involvement of postsynaptic group I mGluRs in regulating ionotropic glutamate receptor trafficking; iv) involvement of postsynaptic group I mGluRs in regulating GABAA receptor trafficking; v) and the trafficking of postsynaptic group I mGluRs themselves. PMID:18615134
McLachlan, Sandra M.; Aliesky, Holly A.; Chen, Chun-Rong; Chong, Gao; Rapoport, Basil
2012-01-01
Transgenic mice with the human thyrotropin-receptor (TSHR) A-subunit targeted to the thyroid are tolerant of the transgene. In transgenics that express low A-subunit levels (Lo-expressors), regulatory T cell (Treg) depletion using anti-CD25 before immunization with adenovirus encoding the A-subunit (A-sub-Ad) breaks tolerance, inducing extensive thyroid lymphocytic infiltration, thyroid damage and antibody spreading to other thyroid proteins. In contrast, no thyroiditis develops in Hi-expressor transgenics or wild-type mice. Our present goal was to determine if thyroiditis could be induced in Hi-expressor transgenics using a more potent immunization protocol: Treg depletion, priming with Complete Freund's Adjuvant (CFA) + A-subunit protein and further Treg depletions before two boosts with A-sub-Ad. As controls, anti-CD25 treated Hi- and Lo-expressors and wild-type mice were primed with CFA+ mouse thyroglobulin (Tg) or CFA alone before A-sub-Ad boosting. Thyroiditis developed after CFA+A-subunit protein or Tg and A-sub-Ad boosting in Lo-expressor transgenics but Hi- expressors (and wild-type mice) were resistant to thyroiditis induction. Importantly, in Lo-expressors, thyroiditis was associated with the development of antibodies to the mouse TSHR downstream of the A-subunit. Unexpectedly, we observed that the effect of bacterial products on the immune system is a “double-edged sword”. On the one hand, priming with CFA (mycobacteria emulsified in oil) plus A-subunit protein broke tolerance to the A-subunit in Hi-expressor transgenics leading to high TSHR antibody levels. On the other hand, prior treatment with CFA in the absence of A-subunit protein inhibited responses to subsequent immunization with A-sub-Ad. Consequently, adjuvant activity arising in vivo after bacterial infections combined with a protein autoantigen can break self-tolerance but in the absence of the autoantigen, adjuvant activity can inhibit the induction of immunity to autoantigens (like the
2017-01-01
The objective is to examine how the flux of neurotransmitter glutamate from neurons to the extracellular fluid, as measured by the rate of 13C enrichment of extracellular glutamate (GLUECF), changes in response to seizures in the kainate-induced rat model of temporal-lobe epilepsy. Following unilateral intrahippocampal injection of kainate, GLUECF was collected by microdialysis from the CA1/CA3 region of awake rats, in combination with EEG recording of chronic-phase recurrent seizures and intravenous infusion of [2,5-13C]glucose. The 13C enrichment of GLUECF C5 at ~ 10 picomol level was measured by gas-chromatography mass-spectrometry. The rate of 13C enrichment, expressed as the increase of the fractional enrichment/min, was 0.0029 ± 0.0001/min in frequently seizing rats (n = 4); this was significantly higher (p < 0.01) than in the control (0.00167 ± 0.0001/min; n = 6) or in rats with infrequent seizures (0.00172 ± 0.0001/min; n = 6). This result strongly suggests that the flux of the excitatory neurotransmitter from neurons to the extracellular fluid is significantly increased by frequent seizures. The extracellular [12C + 13C]glutamate concentration increased progressively in frequently seizing rats. Taken together, these results strongly suggest that the observed seizure-induced high flux of glutamate overstimulated glutamate receptors, which triggered a chain reaction of excitation in the CA3 recurrent glutamatergic networks. The rate of 13C enrichment of extracellular glutamine (GLNECF) at C5 was 0.00299 ± 0.00027/min in frequently seizing rats, which was higher (p < 0.05) than in controls (0.00227 ± 0.00008/min). For the first time in vivo, this study examined the effects of epileptic seizures on fluxes of the neurotransmitter glutamate and its precursor glutamine in the extracellular fluid of the hippocampus. The advantages, limitations and the potential for improvement of this approach for pre-clinical and clinical studies of temporal-lobe epilepsy
Nmd3p Is a Crm1p-Dependent Adapter Protein for Nuclear Export of the Large Ribosomal Subunit
Ho, Jennifer Hei-Ngam; Kallstrom, George; Johnson, Arlen W.
2000-01-01
In eukaryotic cells, nuclear export of nascent ribosomal subunits through the nuclear pore complex depends on the small GTPase Ran. However, neither the nuclear export signals (NESs) for the ribosomal subunits nor the receptor proteins, which recognize the NESs and mediate export of the subunits, have been identified. We showed previously that Nmd3p is an essential protein from yeast that is required for a late step in biogenesis of the large (60S) ribosomal subunit. Here, we show that Nmd3p shuttles and that deletion of the NES from Nmd3p leads to nuclear accumulation of the mutant protein, inhibition of the 60S subunit biogenesis, and inhibition of the nuclear export of 60S subunits. Moreover, the 60S subunits that accumulate in the nucleus can be coimmunoprecipitated with the NES-deficient Nmd3p. 60S subunit biogenesis and export of truncated Nmd3p were restored by the addition of an exogenous NES. To identify the export receptor for Nmd3p we show that Nmd3p shuttling and 60S export is blocked by the Crm1p-specific inhibitor leptomycin B. These results identify Crm1p as the receptor for Nmd3p export. Thus, export of the 60S subunit is mediated by the adapter protein Nmd3p in a Crm1p-dependent pathway. PMID:11086007
Calcium permeable AMPA receptors and autoreceptors in external tufted cells of rat olfactory bulb
Ma, Jie; Lowe, Graeme
2007-01-01
Glomeruli are functional units of the olfactory bulb responsible for early processing of odor information encoded by single olfactory receptor genes. Glomerular neural circuitry includes numerous external tufted (ET) cells whose rhythmic burst firing may mediate synchronization of bulbar activity with the inhalation cycle. Bursting is entrained by glutamatergic input from olfactory nerve terminals, so specific properties of ionotropic glutamate receptors on ET cells are likely to be important determinants of olfactory processing. Particularly intriguing is recent evidence that α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptors of juxta-glomerular neurons may permeate calcium. This could provide a novel pathway for regulating ET cell signaling. We tested the hypothesis that ET cells express functional calcium-permeable AMPA receptors. In rat olfactory bulb slices, excitatory postsynaptic currents (EPSCs) in ET cells were evoked by olfactory nerve shock, and by uncaging glutamate. We found attenuation of AMPA/kainate EPSCs by 1-naphthyl acetyl-spermine (NAS), an open-channel blocker specific for calcium permeable AMPA receptors. Cyclothiazide strongly potentiated EPSCs, indicating a major contribution from AMPA receptors. The current-voltage (I-V) relation of uncaging EPSCs showed weak inward rectification which was lost after > ~ 10 min of whole-cell dialysis, and was absent in NAS. In kainate-stimulated slices, Co2+ ions permeated cells of the glomerular layer. Large AMPA EPSCs were accompanied by fluorescence signals in fluo-4 loaded cells, suggesting calcium permeation. Depolarizing pulses evoked slow tail currents with pharmacology consistent with involvement of calcium permeable AMPA autoreceptors. Tail currents were abolished by Cd2+ and NBQX, and were sensitive to NAS block. Glutamate autoreceptors were confirmed by uncaging intracellular calcium to evoke a large inward current. Our results provide evidence that calcium permeable AMPA
Xiao, Min-Yi; Gustafsson, Bengt; Niu, Yin-Ping
2006-01-01
The trafficking of ionotropic glutamate (AMPA, NMDA and kainate) and GABA(A) receptors in and out of, or laterally along, the postsynaptic membrane has recently emerged as an important mechanism in the regulation of synaptic function, both under physiological and pathological conditions, such as information processing, learning and memory formation, neuronal development, and neurodegenerative diseases. Non-ionotropic glutamate receptors, primarily group I metabotropic glutamate receptors (mGluRs), co-exist with the postsynaptic ionotropic glutamate and GABA(A) receptors. The ability of mGluRs to regulate postsynaptic phosphorylation and Ca(2+) concentration, as well as their interactions with postsynaptic scaffolding/signaling proteins, makes them well suited to influence the trafficking of ionotropic glutamate and GABA(A) receptors. Recent studies have provided insights into how mGluRs may impose such an influence at central synapses, and thus how they may affect synaptic signaling and the maintenance of long-term synaptic plasticity. In this review we will discuss some of the recent progress in this area: i) long-term synaptic plasticity and the involvement of mGluRs; ii) ionotropic glutamate receptor trafficking and long-term synaptic plasticity; iii) the involvement of postsynaptic group I mGluRs in regulating ionotropic glutamate receptor trafficking; iv) involvement of postsynaptic group I mGluRs in regulating GABA(A) receptor trafficking; v) and the trafficking of postsynaptic group I mGluRs themselves.
Moraga-Amaro, Rodrigo; González, Hugo; Ugalde, Valentina; Donoso-Ramos, Juan Pablo; Quintana-Donoso, Daisy; Lara, Marcelo; Morales, Bernardo; Rojas, Patricio; Pacheco, Rodrigo; Stehberg, Jimmy
2016-04-01
Pharmacological evidence associates type I dopamine receptors, including subtypes D1 and D5, with learning and memory. Analyses using genetic approaches have determined the relative contribution of dopamine receptor D1 (D1R) in cognitive tasks. However, the lack of drugs that can discriminate between D1R and D5R has made the pharmacological distinction between the two receptors difficult. Here, we aimed to determine the role of D5R in learning and memory. In this study we tested D5R knockout mice and wild-type littermates in a battery of behavioral tests, including memory, attention, locomotion, anxiety and motivational evaluations. Our results show that genetic deficiency of D5R significantly impairs performance in the Morris water maze paradigm, object location and object recognition memory, indicating a relevant role for D5R in spatial memory and recognition memory. Moreover, the lack of D5R resulted in decreased exploration and locomotion. In contrast, D5R deficiency had no impact on working memory, anxiety and depressive-like behavior, measured using the spontaneous alternation, open-field, tail suspension test, and forced swimming test. Electrophysiological analyses performed on hippocampal slices showed impairment in long-term-potentiation in mice lacking D5R. Further analyses at the molecular level showed that genetic deficiency of D5R results in a strong and selective reduction in the expression of the NMDA receptor subunit NR2B in the hippocampus. These findings demonstrate the relevant contribution of D5R in memory and suggest a functional interaction of D5R with hippocampal glutamatergic pathways. Copyright © 2015 Elsevier Ltd. All rights reserved.
O-linked oligosaccharides on insulin receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Collier, E.; Gorden, P.
1991-02-01
The insulin receptor, an integral membrane glycoprotein, is synthesized as a single-chain precursor that is cleaved to produce two mature subunits, both of which contain N-linked oligosaccharide chains and covalently linked fatty acids. We report that the beta-subunit also contains O-linked oligosaccharides. The proreceptor, alpha-subunit, and beta-subunit were labeled with (3H)mannose and (3H)galactose in the presence or absence of an inhibitor of O-linked glycosylation. Tryptic peptides from each component were separated by reverse-phase high-performance liquid chromatography. N- and O-linked oligosaccharide chains were identified on these peptides by specific enzymatic digestions. The proreceptor and alpha-subunit contained only N-linked oligosaccharides, whereas themore » beta-subunit contained both N- and O-linked oligosaccharides. The O-linked oligosaccharide chains were attached to a single tryptic fraction of the beta-subunit, which also contained N-linked chains. This fraction was further localized to the NH2-terminal tryptic peptide of the beta-subunit by specific immunoprecipitation with an anti-peptide antibody with specificity for this region. Binding of insulin and autophosphorylation of the beta-subunit were not dependent on O-linked glycosylation, because cells grown in the presence of the inhibitor exhibited a normal dose response to insulin. Therefore, the insulin receptor contains O-linked oligosaccharides on the NH2-terminal tryptic peptide of the beta-subunit, and these O-linked oligosaccharides are not necessary to the binding or autophosphorylation function of the receptor.« less
Arias, Clorinda; Montiel, Teresa; Peña, Fernando; Ferrera, Patricia; Tapia, Ricardo
2002-09-01
Overactivation of N-methyl-D-aspartate (NMDA) glutamate receptors is closely related to epilepsy and excitotoxicity, and the phosphorylation of these receptors may facilitate glutamate-mediated synaptic transmission. Here we show that in awake rats the microinjection into the hippocampus of okadaic acid, a potent inhibitor of protein phosphatases 1 and 2A, induces in about 20 min intense electroencephalographic and behavioral limbic-type seizures, which are suppressed by the systemic administration of the NMDA receptor antagonist (+)-5-methyl-10,11-dihydro-5H-dibenzo-[a,d]cyclohepten-5,10-imine hydrogen maleate and by the intrahippocampal administration of 1-(5-isoquinolinesulfonyl)-2-methylpiperazine, an inhibitor of protein kinases. Two hours after okadaic acid, when the EEG seizures were intense, an increased serine phosphorylation of some hippocampal proteins, including an enhancement of the serine phosphorylation of the NMDA receptor subunit NR2B, was detected by immunoblotting. Twenty-four hours after okadaic acid a marked destruction of hippocampal CA1 region was observed, which was not prevented by the receptor antagonists. These findings suggest that hyperphosphorylation of glutamate receptors in vivo may result in an increased sensitivity to the endogenous transmitter and therefore induce neuronal hyperexcitability and epilepsy.
Nelson, Mackenzie E.; Krimmel, Samuel R.; Georgiou, Polymnia; Gould, Todd D.
2017-01-01
Abstract New antidepressant pharmacotherapies that provide rapid relief of depressive symptoms are needed. The NMDA receptor antagonist ketamine exerts rapid antidepressant actions in depressed patients but also side effects that complicate its clinical utility. Ketamine promotes excitatory synaptic strength, likely by producing high-frequency correlated activity in mood-relevant regions of the forebrain. Negative allosteric modulators of GABA-A receptors containing α5 subunits (α5 GABA-NAMs) should also promote high-frequency correlated electroencephalogram (EEG) activity and should therefore exert rapid antidepressant responses. Because α5 subunits display a restricted expression in the forebrain, we predicted that α5 GABA-NAMs would produce activation of principle neurons but exert fewer side effects than ketamine. We tested this hypothesis in male mice and observed that the α5 GABA-NAM MRK-016 exerted an antidepressant-like response in the forced swim test at 1 and 24 h after administration and an anti-anhedonic response after chronic stress in the female urine sniffing test (FUST). Like ketamine, MRK-016 produced a transient increase in EEG γ power, and both the increase in γ power and its antidepressant effects in the forced swim test were blocked by prior administration of the AMPA-type glutamate receptor antagonist 2,3-dioxo-6-nitro-1,2,3,4-tetrahydrobenzo[f]quinoxaline-7-sulfonamide (NBQX). Unlike ketamine, however, MRK-016 produced no impairment of rota-rod performance, no reduction of prepulse inhibition (PPI), no conditioned-place preference (CPP), and no change in locomotion. α5 GABA-NAMs, thus reproduce the rapid antidepressant-like actions of ketamine, perhaps via an AMPA receptor (AMPAR)-dependent increase in coherent neuronal activity, but display fewer potential negative side effects. These compounds thus demonstrate promise as clinically useful fast-acting antidepressants. PMID:28275719
ERIC Educational Resources Information Center
Sanderson, David J.; Good, Mark A.; Skelton, Kathryn; Sprengel, Rolf; Seeburg, Peter H.; Rawlins, J. Nicholas P.; Bannerman, David M.
2009-01-01
The GluA1 AMPA receptor subunit is a key mediator of hippocampal synaptic plasticity and is especially important for a rapidly-induced, short-lasting form of potentiation. GluA1 gene deletion impairs hippocampus-dependent, spatial working memory, but spares hippocampus-dependent spatial reference memory. These findings may reflect the necessity of…
Ionotropic Glutamate Receptors & CNS Disorders
Bowie, Derek
2008-01-01
Disorders of the central nervous system (CNS) are complex disease states that represent a major challenge for modern medicine. Although etiology is often unknown, it is established that multiple factors such as defects in genetics and/or epigenetics, the environment as well as imbalance in neurotransmitter receptor systems are all at play in determining an individual’s susceptibility to disease. Gene therapy is currently not available and therefore, most conditions are treated with pharmacological agents that modify neurotransmitter receptor signaling. Here, I provide a review of ionotropic glutamate receptors (iGluRs) and the roles they fulfill in numerous CNS disorders. Specifically, I argue that our understanding of iGluRs has reached a critical turning point to permit, for the first time, a comprehensive re-evaluation of their role in the cause of disease. I illustrate this by highlighting how defects in AMPA receptor trafficking are important to Fragile X mental retardation and ectopic expression of kainate (KA) receptor synapses contributes to the pathology of temporal lobe epilepsy. Finally, I discuss how parallel advances in studies of other neurotransmitter systems may allow pharmacologists to work towards a cure for many CNS disorders rather than developing drugs to treat their symptoms. PMID:18537642
Evolution of specificity in cartilaginous fish glycoprotein hormones and receptors.
Buechi, Hanna B; Bridgham, Jamie T
2017-05-15
Glycoprotein hormones (GpH) interact very specifically with their receptors to mediate hypothalamic-pituitary-peripheral gland endocrine signaling. Vertebrates typically have three functionally distinct GpH endocrine signaling complexes: follicle-stimulating hormone, luteinizing hormone, and thyroid-stimulating hormone, and their receptors. Each hormone consists of a common α subunit bound to one of three different β subunits. Individual hormone subunits and receptors are present in genomes of early metazoans, and a subset of hormone subunits and receptors has been recently characterized in sea lamprey. However, it remains unclear when the full complement of hormone and receptor protein families first appeared, and when specificity of interactions between GpH hormones and receptors first evolved. Here we present phylogenetic analyses showing that the elephant shark (Callorhinchus milii) genome contains sequences representing the current diversity of all hormone subunits and receptors in these co-evolving protein families. We examined specificity of hormone and receptor interactions using functional assays testing reporter gene activation by elephant shark follicle-stimulating hormone, luteinizing hormone, and thyroid-stimulating hormone receptors. We show highly specific, dose-responsive hormone interactions for all three complexes. Our results suggest that co-evolution of specificity between proteins in these endocrine signaling complexes occurred prior to the divergence of Chondrichthyes from the chordate lineage. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Interneuron- and GABAA receptor-specific inhibitory synaptic plasticity in cerebellar Purkinje cells
NASA Astrophysics Data System (ADS)
He, Qionger; Duguid, Ian; Clark, Beverley; Panzanelli, Patrizia; Patel, Bijal; Thomas, Philip; Fritschy, Jean-Marc; Smart, Trevor G.
2015-07-01
Inhibitory synaptic plasticity is important for shaping both neuronal excitability and network activity. Here we investigate the input and GABAA receptor subunit specificity of inhibitory synaptic plasticity by studying cerebellar interneuron-Purkinje cell (PC) synapses. Depolarizing PCs initiated a long-lasting increase in GABA-mediated synaptic currents. By stimulating individual interneurons, this plasticity was observed at somatodendritic basket cell synapses, but not at distal dendritic stellate cell synapses. Basket cell synapses predominantly express β2-subunit-containing GABAA receptors; deletion of the β2-subunit ablates this plasticity, demonstrating its reliance on GABAA receptor subunit composition. The increase in synaptic currents is dependent upon an increase in newly synthesized cell surface synaptic GABAA receptors and is abolished by preventing CaMKII phosphorylation of GABAA receptors. Our results reveal a novel GABAA receptor subunit- and input-specific form of inhibitory synaptic plasticity that regulates the temporal firing pattern of the principal output cells of the cerebellum.
The role of striatal NMDA receptors in drug addiction.
Ma, Yao-Ying; Cepeda, Carlos; Cui, Cai-Lian
2009-01-01
The past decade has witnessed an impressive accumulation of evidence indicating that the excitatory amino acid glutamate and its receptors, in particular the N-methyl-D-aspartate (NMDA) receptor subtype, play an important role in drug addiction. Various lines of research using animal models of drug addiction have demonstrated that drug-induced craving is accompanied by significant upregulation of NR2B subunit expression. Furthermore, selective blockade of NR2B-containing NMDA receptors in the striatum, especially in the nucleus accumbens (NAc) can inhibit drug craving and reinstatement. The purpose of this review is to examine the role of striatal NMDA receptors in drug addiction. After a brief description of glutamatergic innervation and NMDA receptor subunit distribution in the striatum, we discuss potential mechanisms to explain the role of striatal NMDA receptors in drug addiction by elucidating signaling cascades involved in the regulation of subunit expression and redistribution, phosphorylation of receptor subunits, as well as activation of intracellular signals triggered by drug experience. Understanding the mechanisms regulating striatal NMDA receptor changes in drug addiction will provide more specific and rational targets to counteract the deleterious effects of drug addiction.
Cockayne, Debra A; Dunn, Philip M; Zhong, Yu; Rong, Weifang; Hamilton, Sara G; Knight, Gillian E; Ruan, Huai-Zhen; Ma, Bei; Yip, Ping; Nunn, Philip; McMahon, Stephen B; Burnstock, Geoffrey; Ford, Anthony PDW
2005-01-01
Extracellular ATP plays a role in nociceptive signalling and sensory regulation of visceral function through ionotropic receptors variably composed of P2X2 and P2X3 subunits. P2X2 and P2X3 subunits can form homomultimeric P2X2, homomultimeric P2X3, or heteromultimeric P2X2/3 receptors. However, the relative contribution of these receptor subtypes to afferent functions of ATP in vivo is poorly understood. Here we describe null mutant mice lacking the P2X2 receptor subunit (P2X2−/−) and double mutant mice lacking both P2X2 and P2X3 subunits (P2X2/P2X3Dbl−/−), and compare these with previously characterized P2X3−/− mice. In patch-clamp studies, nodose, coeliac and superior cervical ganglia (SCG) neurones from wild-type mice responded to ATP with sustained inward currents, while dorsal root ganglia (DRG) neurones gave predominantly transient currents. Sensory neurones from P2X2−/− mice responded to ATP with only transient inward currents, while sympathetic neurones had barely detectable responses. Neurones from P2X2/P2X3Dbl−/− mice had minimal to no response to ATP. These data indicate that P2X receptors on sensory and sympathetic ganglion neurones involve almost exclusively P2X2 and P2X3 subunits. P2X2−/− and P2X2/P2X3Dbl−/− mice had reduced pain-related behaviours in response to intraplantar injection of formalin. Significantly, P2X3−/−, P2X2−/−, and P2X2/P2X3Dbl−/− mice had reduced urinary bladder reflexes and decreased pelvic afferent nerve activity in response to bladder distension. No deficits in a wide variety of CNS behavioural tests were observed in P2X2−/− mice. Taken together, these data extend our findings for P2X3−/− mice, and reveal an important contribution of heteromeric P2X2/3 receptors to nociceptive responses and mechanosensory transduction within the urinary bladder. PMID:15961431
Jücker, M; Feldman, R A
1995-11-17
Binding of human granulocyte/macrophage colony-stimulating factor (hGM-CSF) to its receptor induces the rapid activation of phosphatidylinositol-3 kinase (PI 3-kinase). As hGM-CSF receptor (hGMR) does not contain a consensus sequence for binding of PI 3-kinase, hGMR must use a distinct mechanism for its association with and activation of PI 3-kinase. Here, we describe the identification of a tyrosine-phosphorylated protein of 76-85 kDa (p80) that associates with the common beta subunit of hGMR and with the SH2 domains of the p85 subunit of PI 3-kinase in hGM-CSF-stimulated cells. Src/Yes and Lyn were tightly associated with the p80.PI 3-kinase complex, suggesting that p80 and other phosphotyrosyl proteins present in the complex were phosphorylated by Src family kinases. Tyrosine phosphorylation of p80 was only detected in hGM-CSF or human interleukin-3-stimulated cells, suggesting that activation of p80 might be specific for signaling via the common beta subunit. We postulate that p80 functions as an adapter protein that may participate in linking the hGM-CSF receptor to the PI 3-kinase signaling pathway.
Profiling neurotransmitter receptor expression in the Ambystoma mexicanum brain.
Reyes-Ruiz, Jorge Mauricio; Limon, Agenor; Korn, Matthew J; Nakamura, Paul A; Shirkey, Nicole J; Wong, Jamie K; Miledi, Ricardo
2013-03-22
Ability to regenerate limbs and central nervous system (CNS) is unique to few vertebrates, most notably the axolotl (Ambystoma sp.). However, despite the fact the neurotransmitter receptors are involved in axonal regeneration, little is known regarding its expression profile. In this project, RT-PCR and qPCR were performed to gain insight into the neurotransmitter receptors present in Ambystoma. Its functional ability was studied by expressing axolotl receptors in Xenopus laevis oocytes by either injection of mRNA or by direct microtransplantation of brain membranes. Oocytes injected with axolotl mRNA expressed ionotropic receptors activated by GABA, aspartate+glycine and kainate, as well as metabotropic receptors activated by acetylcholine and glutamate. Interestingly, we did not see responses following the application of serotonin. Membranes from the axolotl brain were efficiently microtransplanted into Xenopus oocytes and two types of native GABA receptors that differed in the temporal course of their responses and affinities to GABA were observed. Results of this study are necessary for further characterization of axolotl neurotransmitter receptors and may be useful for guiding experiments aimed at understanding activity-dependant limb and CNS regeneration. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Role of gabra2, GABAA receptor alpha-2 subunit, in CNS development.
Gonzalez-Nunez, Veronica
2015-09-01
gabra2 gene codes for the alpha-2 subunit of the GABA A receptor, one of the ionotropic receptors which has been related to anxiety, depression and other behavioural disorders, including drug dependence and schizophrenia. GABAergic signalling also plays a role during development, by promoting neural stem cell maintenance and renewal. To investigate the role of gabra2 in CNS development, gabra2 deficient zebrafish were generated. The pattern of proliferation during the embryonic development was disrupted in morphant embryos, which also displayed an increase in the number of apoptotic nuclei mainly at the mid- and hindbrain regions. The expression of several genes ( notch1, pax2, fgf8 and wnt1 ) known to contribute to the development of the central nervous system was also affected in gabra2 morpholino-injected embryos, although no changes were found for pax6a and shh a expression. The transcriptional activity of neuroD (a proneural gene involved in early neuronal determination) was down-regulated in gabra2 deficient embryos, and the expression pattern of gad1b (GABA-synthesising enzyme GAD67) was clearly reduced in injected fish. I propose that gabra2 might be interacting with those signalling pathways that regulate proliferation, differentiation and neurogenesis during the embryonic development; thus, gabra2 might be playing a role in the differentiation of the mesencephalon and cerebellum. Given that changes in GABAergic circuits during development have been related to several psychiatric disorders, such as autism and schizophrenia, this work might be helpful to understand the role of neurotransmitter systems during CNS development and to assess the developmental effects of several GABAergic drugs.
Li, Yue-Hui; Liu, Yan; Li, Yan-Dong; Liu, Yan-Hong; Li, Feng; Ju, Qiang; Xie, Ping-Li; Li, Guan-Cheng
2012-01-01
AIM: To investigate the function of gamma-aminobutyric acid (GABA) and gamma-aminobutyric acid A receptor θ subunit (GABRQ) in hepatocellular carcinoma (HCC). METHODS: Semiquantitative polymerase chain reaction was used for detecting the expression of GABRQ receptor among HCC cell line HepG2, normal liver cell line L-02, non-malignant Chang’s liver cells, 8 samples of HCC tissues and paired non-cancerous tissues. HepG2 cells were treated with GABA at serial concentrations (0, 1, 10, 20, 40 and 60 μmol/L), and their proliferating abilities were analyzed with the methyl thiazolyl tetrazolium assay, cell cycle analysis and tumor implanted in nude mice. Small interfering RNA was used for knocking down the endogenous GABRQ in HepG2. Proliferating abilities of these cells treated with or without GABA were analyzed. RESULTS: We identified the overexpression of GABRQ in HCC cell lines and half of the tested HCC tissues. Knockdown of endogenous GABRQ expression in HepG2 attenuated HCC cell growth, suggesting its role in HCC cell viability. We studied the effect of GABA in the proliferation of GABRQ-positive cell lines in vitro and in vivo, and found that GABA increased HCC growth in a dose-dependent manner. Notably, the addition of GABA into the cell culture medium promoted the proliferation of GABRQ-expressing HepG2 cells, but not GABRQ-knockdown HepG2 cells, which means that GABA stimulates HepG2 cell growth through GABRQ. CONCLUSION: GABRQ play important roles in HCC development and progression and could be a promising molecular target for the development of new diagnostic and therapeutic strategies of HCC. PMID:22690081
Cui, Jie; Yu, Siyuan; Li, Yihui; Li, Pan; Liu, Feng
2018-03-01
Microglia, the primary immune cells in the brain, are the predominant cells regulating inflammation-mediated neuronal damage. In response to immunological challenges, such as lipopolysaccharide (LPS), microglia are activated and the inflammatory process is subsequently initiated. The aim of the present study was to determine whether LPS induces interactions between the Toll-like receptor 4 (TLR4) and the ionotropic glutamate receptor N-methyl-D‑aspartate subunit 1 (GluN1) in N9 and EOC 20 microglial cells. Immunocytochemistry demonstrated co-localization of TLR4 and GluN1 in response to LPS, and the direct binding of TLR4 and GluN1 was further validated by antibody-based Fluorescence Resonance Energy Transfer technology. Inhibition of the group I metabotropic glutamate receptor 5 with its selective antagonist, MTEP, abolished LPS-induced direct binding of TLR4 to GluN1. Therefore, these data demonstrated that GluN1 and TLR4 act reciprocally in response to LPS in N9 and EOC 20 microglial cells.
Maffucci, Jacqueline A.; Walker, Deena M.; Ikegami, Aiko; Woller, Michael J.; Gore, Andrea C.
2008-01-01
The loss of reproductive capacity during aging involves changes in the neural regulation of the hypothalamic gonadotropin-releasing hormone (GnRH) neurons controlling reproduction. This neuronal circuitry includes glutamate receptors on GnRH neurons. Previously, we reported an increase in the expression of the NR2b subunit protein of the NMDA receptor on GnRH neurons in middle-aged compared to young female rats. Here, we examined the functional implications of the NR2b subunit on the onset of reproductive aging, using an NR2b-specific antagonist ifenprodil. Young (3–5 mos.) and middle-aged (10–13 mos.) female rats were ovariectomized (OVX), 17β-estradiol (E2) or vehicle (cholesterol) treated, and implanted with a jugular catheter. Serial blood sampling was undertaken every 10 minutes for 4 hours, with ifenprodil (10mg/kg) or vehicle injected (i.p.) after one hour of baseline sampling. The pulsatile release of pituitary LH and levels of GnRH mRNA in hypothalamus were quantified as indices of the reproductive axis. Our results showed effects of ifenprodil on both endpoints. In OVX rats given cholesterol, neither age nor ifenprodil had any effects on LH release. In E2-treated rats, aging was associated with significant decreases in pulsatile LH release. Additionally, ifenprodil stimulated parameters of pulsatile LH release in both young and middle-aged animals. Ifenprodil had few effects on GnRH mRNA; the only significant effect of ifenprodil was found in the middle-aged, cholesterol group. Together, these findings support a role for the NR2b subunit of the NMDAR in GnRH/LH regulation. Because most of these effects were exhibited on pituitary LH release in the absence of a concomitant change in GnRH gene expression, it is likely that NMDA receptors containing the NR2b subunit plays a role in GnRH-induced LH release, independent of de novo GnRH gene expression. PMID:18025808
Nothdurfter, Caroline; Tanasic, Sascha; Di Benedetto, Barbara; Uhr, Manfred; Wagner, Eva-Maria; Gilling, Kate E; Parsons, Chris G; Rein, Theo; Holsboer, Florian; Rupprecht, Rainer; Rammes, Gerhard
2013-07-01
Lipid rafts have been shown to play an important role for G-protein mediated signal transduction and the function of ligand-gated ion channels including their modulation by psychopharmacological compounds. In this study, we investigated the functional significance of the membrane distribution of NMDA and GABAA receptor subunits in relation to the accumulation of the tricyclic antidepressant desipramine (DMI) and the benzodiazepine diazepam (Diaz). In the presence of Triton X-100, which allowed proper separation of the lipid raft marker proteins caveolin-1 and flotillin-1 from the transferrin receptor, all receptor subunits were shifted to the non-raft fractions. In contrast, under detergent-free conditions, NMDA and GABAA receptor subunits were detected both in raft and non-raft fractions. Diaz was enriched in non-raft fractions without Triton X-100 in contrast to DMI, which preferentially accumulated in lipid rafts. Impairment of lipid raft integrity by methyl-β-cyclodextrine (MβCD)-induced cholesterol depletion did not change the inhibitory effect of DMI at the NMDA receptor, whereas it enhanced the potentiating effect of Diaz at the GABAA receptor at non-saturating concentrations of GABA. These results support the hypothesis that the interaction of benzodiazepines with the GABAA receptor likely occurs outside of lipid rafts while the antidepressant DMI acts on ionotropic receptors both within and outside these membrane microdomains.
α2-containing GABAA receptors expressed in hippocampal region CA3 control fast network oscillations
Heistek, Tim S; Ruiperez-Alonso, Marta; Timmerman, A Jaap; Brussaard, Arjen B; Mansvelder, Huibert D
2013-01-01
GABAA receptors are critically involved in hippocampal oscillations. GABAA receptor α1 and α2 subunits are differentially expressed throughout the hippocampal circuitry and thereby may have distinct contributions to oscillations. It is unknown which GABAA receptor α subunit controls hippocampal oscillations and where these receptors are expressed. To address these questions we used transgenic mice expressing GABAA receptor α1 and/or α2 subunits with point mutations (H101R) that render these receptors insensitive to allosteric modulation at the benzodiazepine binding site, and tested how increased or decreased function of α subunits affects hippocampal oscillations. Positive allosteric modulation by zolpidem prolonged decay kinetics of hippocampal GABAergic synaptic transmission and reduced the frequency of cholinergically induced oscillations. Allosteric modulation of GABAergic receptors in CA3 altered oscillation frequency in CA1, while modulation of GABA receptors in CA1 did not affect oscillations. In mice having a point mutation (H101R) at the GABAA receptor α2 subunit, zolpidem effects on cholinergically induced oscillations were strongly reduced compared to wild-type animals, while zolpidem modulation was still present in mice with the H101R mutation at the α1 subunit. Furthermore, genetic knockout of α2 subunits strongly reduced oscillations, whereas knockout of α1 subunits had no effect. Allosteric modulation of GABAergic receptors was strongly reduced in unitary connections between fast spiking interneurons and pyramidal neurons in CA3 of α2H101R mice, but not of α1H101R mice, suggesting that fast spiking interneuron to pyramidal neuron synapses in CA3 contain α2 subunits. These findings suggest that α2-containing GABAA receptors expressed in the CA3 region provide the inhibition that controls hippocampal rhythm during cholinergically induced oscillations. PMID:23109109
Lu, Cui Yan; Liu, De Xiang; Jiang, Hong; Ho, Cyrus S. H.; Ho, Roger C. M.
2017-01-01
Studies have found that early traumatic experience significantly increases the risk of posttraumatic stress disorder (PTSD). Gamma-aminobutyric acid (GABA) deficits were proposed to be implicated in development of PTSD, but the alterations of GABA receptor A (GABAAR) subunits induced by early traumatic stress have not been fully elucidated. Furthermore, previous studies suggested that exercise could be more effective than medications in reducing severity of anxiety and depression but the mechanism is unclear. This study used inescapable foot-shock to induce PTSD in juvenile rats and examined their emotional changes using open-field test and elevated plus maze, memory changes using Morris water maze, and the expression of GABAAR subunits (γ2, α2, and α5) in subregions of the brain in the adulthood using western blotting and immunohistochemistry. We aimed to observe the role of GABAAR subunits changes induced by juvenile trauma in the pathogenesis of subsequent PTSD in adulthood. In addition, we investigated the protective effects of exercise for 6 weeks and benzodiazepine (clonazepam) for 2 weeks. This study found that juvenile traumatic stress induced chronic anxiety and spatial memory loss and reduced expression of GABAAR subunits in the adult rat brains. Furthermore, exercise led to significant improvement as compared to short-term BZ treatment. PMID:28352479
Ray, M A; Graham, A J; Lee, M; Perry, R H; Court, J A; Perry, E K
2005-08-01
The cholinergic system has been implicated in the development of autism on the basis of neuronal nicotinic acetylcholine receptor (nAChR) losses in cerebral and cerebellar cortex. In the present study, the first to explore nAChRs in the thalamus in autism, alpha4, alpha7 and beta2 nAChR subunit expression in thalamic nuclei of adult individuals with autism (n=3) and age-matched control cases (n=3) was investigated using immunochemical methods. Loss of alpha7- and beta2- (but not alpha4-) immunoreactive neurons occurred in the paraventricular nucleus (PV) and nucleus reuniens in autism. Preliminary results indicated glutamic acid decarboxylase immunoreactivity occurred at a low level in PV, co-expressed with alpha7 in normal and autistic cases and was not reduced in autism. This suggested loss of neuronal alpha7 in autism is not caused by loss of GABAergic neurons. These findings indicate nicotinic abnormalities that occur in the thalamus in autism which may contribute to sensory or attentional deficits.
Fang, Hong; Wang, Ze-Hua; Bu, Ying-Jiang; Yuan, Zhi-Jun; Wang, Guo-Qiang; Guo, Yan; Cheng, Xiao-Yun; Qiu, Wen-Jie
2018-01-01
General anesthesia is widely used in pediatric surgery, although the influence of general anesthesia on cerebellar information transmission and motor function is unclear. In the present study, neonatal mice received repeated inhalation of sevoflurane, and electrophysiological alterations in Purkinje cells (PCs) and the development of motor functions were detected. In addition, γ‑aminobutyric acidA receptor ε (GABAA‑R ε) subunit knockout mice were used to investigate the mechanism of action of sevoflurane on cerebellar function. In the neonatal mice, the field potential response of PCs induced by sensory stimulation and the motor function indices were markedly inhibited by sevoflurane, and the inhibitory effect was positively associated with the number of repetitions of anesthesia. In additional the GABAA‑R ε subunit level of PCs was promoted by sevoflurane in a dose‑dependent manner, and the inhibitory effects of sevoflurane on PC field potential response and motor function were alleviated in GABAA‑R ε subunit knockout mice. The GABAA‑R ε subunit was activated by sevoflurane, leading to inhibition of sensory information transmission in the cerebellar cortex, field potential responses of PCs and the development of cerebellar motor function. The present study provided experimental evidence for the safe usage of sevoflurane in clinical anesthesia, and suggested that GABAA‑R ε subunit antagonists may be considered for combined application with general anesthesia with repeated inhalation of sevoflurane, for adverse effect prevention in the clinic.
Peristalsis is impaired in the small intestine of mice lacking the P2X3 subunit
Bian, Xiaochun; Ren, Jianhua; De Vries, Matthew; Schnegelsberg, Birthe; Cockayne, Debra A; Ford, Anthony P D W; Galligan, James J
2003-01-01
P2X receptors are ATP-gated cation channels composed of one or more of seven different subunits. P2X receptors participate in intestinal neurotransmission but the subunit composition of enteric P2X receptors is unknown. In this study, we used tissues from P2X3 wild-type (P2X3+/+) mice and mice in which the P2X3 subunit gene had been deleted (P2X3−/−) to investigate the role of this subunit in neurotransmission in the intestine. RT-PCR analysis of mRNA from intestinal tissues verified P2X3 gene deletion. Intracellular electrophysiological methods were used to record synaptic and drug-induced responses from myenteric neurons in vitro. Drug-induced longitudinal muscle contractions were studied in vitro. Intraluminal pressure-induced reflex contractions (peristalsis) of ileal segments were studied in vitro using a modified Trendelenburg preparation. Gastrointestinal transit was measured as the progression in 30 min of a liquid radioactive marker administered by gavage to fasted mice. Fast excitatory postsynaptic potentials recorded from S neurons (motoneurons and interneurons) were similar in tissues from P2X3+/+ and P2X3−/− mice. S neurons from P2X3+/+ and P2X3−/− mice were depolarized by application of ATP but not α,β-methylene ATP, an agonist of P2X3 subunit-containing receptors. ATP and α,β-methylene ATP induced depolarization of AH (sensory) neurons from P2X3+/+ mice. ATP, but not α,β-methylene ATP, caused depolarization of AH neurons from P2X3−/− mice. Peristalsis was inhibited in ileal segments from P2X3−/− mice but longitudinal muscle contractions caused by nicotine and bethanechol were similar in segments from P2X3+/+ and P2X3−/− mice. Gastrointestinal transit was similar in P2X3+/+ and P2X3−/− mice. It is concluded that P2X3 subunit-containing receptors participate in neural pathways underlying peristalsis in the mouse intestine in vitro. P2X3 subunits are localized to AH (sensory) but not S neurons. P2X3 receptors may
Glutamate as a neurotransmitter in the brain: review of physiology and pathology.
Meldrum, B S
2000-04-01
Glutamate is the principal excitatory neurotransmitter in brain. Our knowledge of the glutamatergic synapse has advanced enormously in the last 10 years, primarily through application of molecular biological techniques to the study of glutamate receptors and transporters. There are three families of ionotropic receptors with intrinsic cation permeable channels [N-methyl-D-aspartate (NMDA), alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) and kainate]. There are three groups of metabotropic, G protein-coupled glutamate receptors (mGluR) that modify neuronal and glial excitability through G protein subunits acting on membrane ion channels and second messengers such as diacylglycerol and cAMP. There are also two glial glutamate transporters and three neuronal transporters in the brain. Glutamate is the most abundant amino acid in the diet. There is no evidence for brain damage in humans resulting from dietary glutamate. A kainate analog, domoate, is sometimes ingested accidentally in blue mussels; this potent toxin causes limbic seizures, which can lead to hippocampal and related pathology and amnesia. Endogenous glutamate, by activating NMDA, AMPA or mGluR1 receptors, may contribute to the brain damage occurring acutely after status epilepticus, cerebral ischemia or traumatic brain injury. It may also contribute to chronic neurodegeneration in such disorders as amyotrophic lateral sclerosis and Huntington's chorea. In animal models of cerebral ischemia and traumatic brain injury, NMDA and AMPA receptor antagonists protect against acute brain damage and delayed behavioral deficits. Such compounds are undergoing testing in humans, but therapeutic efficacy has yet to be established. Other clinical conditions that may respond to drugs acting on glutamatergic transmission include epilepsy, amnesia, anxiety, hyperalgesia and psychosis.
HOMEOSTATIC REGULATION OF KCC2 ACTIVITY BY THE ZINC RECEPTOR mZnR/GPR39 DURING SEIZURES
Gilad, David; Shorer, Sharon; Ketzef, Maya; Friedman, Alon; Sekler, Israel; Aizenman, Elias; Hershfinkel, Michal
2015-01-01
The aim of this study was to investigate the role of the synaptic metabotropic zinc receptor mZnR/GPR39 in physiological adaptation to epileptic seizures. We previously demonstrated that synaptic activation of mZnR/GPR39 enhances inhibitory drive in the hippocampus by upregulating neuronal K+/Cl− co-transporter 2 (KCC2) activity. Here, we first show that mZnR/GPR39 knockout (KO) adult mice have dramatically enhanced susceptibility to seizures triggered by a single intraperitoneal injection of kainic acid, when compared to wild type (WT) littermates. Kainate also substantially enhances seizure-associated gamma oscillatory activity in juvenile mZnR/GPR39 KO hippocampal slices, a phenomenon that can be reproduced in WT tissue by extracellular Zn2+ chelation. Importantly, kainate-induced synaptic Zn2+ release enhances surface expression and transport activity of KCC2 in WT, but not mZnR/GPR39 KO hippocampal neurons. Kainate-dependent upregulation of KCC2 requires mZnR/GPR39 activation of the Gαq/phospholipase C/extracellular regulated kinase (ERK1/2) signaling cascade. We suggest that mZnR/GPR39-dependent upregulation of KCC2 activity provides homeostatic adaptation to an excitotoxic stimulus by increasing inhibition. As such, mZnR/GPR39 may provide a novel pharmacological target for dampening epileptic seizure activity. PMID:25562657
Vidal, Verónica; García-Cerro, Susana; Martínez, Paula; Corrales, Andrea; Lantigua, Sara; Vidal, Rebeca; Rueda, Noemí; Ozmen, Laurence; Hernández, Maria-Clemencia; Martínez-Cué, Carmen
2018-06-01
Trisomy 21 or Down syndrome (DS) is the most common cause of intellectual disability of a genetic origin. The Ts65Dn (TS) mouse, which is the most commonly used and best-characterized mouse model of DS, displays many of the cognitive, neuromorphological, and biochemical anomalies that are found in the human condition. One of the mechanisms that have been proposed to be responsible for the cognitive deficits in this mouse model is impaired GABA-mediated inhibition. Because of the well-known modulatory role of GABA A α5 subunit-containing receptors in cognitive processes, these receptors are considered to be potential targets for improving the intellectual disability in DS. The chronic administration of GABA A α5-negative allosteric modulators has been shown to be procognitive without anxiogenic or proconvulsant side effects. In the present study, we use a genetic approach to evaluate the contribution of GABA A α5 subunit-containing receptors to the cognitive, electrophysiological, and neuromorphological deficits in TS mice. We show that reducing the expression of GABA A α5 receptors by deleting one or two copies of the Gabra5 gene in TS mice partially ameliorated the cognitive impairments, improved long-term potentiation, enhanced neural differentiation and maturation, and normalized the density of the GABAergic synapse markers. Reducing the gene dosage of Gabra5 in TS mice did not induce motor alterations and anxiety or affect the viability of the mice. Our results provide further evidence of the role of GABA A α5 receptor-mediated inhibition in cognitive impairment in the TS mouse model of DS.
Cholesterol modulates open probability and desensitization of NMDA receptors
Korinek, Miloslav; Vyklicky, Vojtech; Borovska, Jirina; Lichnerova, Katarina; Kaniakova, Martina; Krausova, Barbora; Krusek, Jan; Balik, Ales; Smejkalova, Tereza; Horak, Martin; Vyklicky, Ladislav
2015-01-01
NMDA receptors (NMDARs) are glutamate-gated ion channels that mediate excitatory neurotransmission in the CNS. Although these receptors are in direct contact with plasma membrane, lipid–NMDAR interactions are little understood. In the present study, we aimed at characterizing the effect of cholesterol on the ionotropic glutamate receptors. Whole-cell current responses induced by fast application of NMDA in cultured rat cerebellar granule cells (CGCs) were almost abolished (reduced to 3%) and the relative degree of receptor desensitization was increased (by seven-fold) after acute cholesterol depletion by methyl-β-cyclodextrin. Both of these effects were fully reversible by cholesterol repletion. By contrast, the responses mediated by AMPA/kainate receptors were not affected by cholesterol depletion. Similar results were obtained in CGCs after chronic inhibition of cholesterol biosynthesis by simvastatin and acute enzymatic cholesterol degradation to 4-cholesten-3-one by cholesterol oxidase. Fluorescence anisotropy measurements showed that membrane fluidity increased after methyl-β-cyclodextrin pretreatment. However, no change in fluidity was observed after cholesterol enzymatic degradation, suggesting that the effect of cholesterol on NMDARs is not mediated by changes in membrane fluidity. Our data show that diminution of NMDAR responses by cholesterol depletion is the result of a reduction of the open probability, whereas the increase in receptor desensitization is the result of an increase in the rate constant of entry into the desensitized state. Surface NMDAR population, agonist affinity, single-channel conductance and open time were not altered in cholesterol-depleted CGCs. The results of our experiments show that cholesterol is a strong endogenous modulator of NMDARs. Key points NMDA receptors (NMDARs) are tetrameric cation channels permeable to calcium; they mediate excitatory synaptic transmission in the CNS and their excessive activation can lead to
Structure and symmetry inform gating principles of ionotropic glutamate receptors.
Zhu, Shujia; Gouaux, Eric
2017-01-01
Ionotropic glutamate receptors (iGluRs) transduce signals derived from release of the excitatory neurotransmitter glutamate from pre-synaptic neurons into excitation of post-synaptic neurons on a millisecond time-scale. In recent years, the elucidation of full-length iGluR structures of NMDA, AMPA and kainate receptors by X-ray crystallography and single particle cryo-electron microscopy has greatly enhanced our understanding of the interrelationships between receptor architecture and gating mechanism. Here we briefly review full-length iGluR structures and discuss the similarities and differences between NMDA receptors and non-NMDA iGluRs. We focus on distinct conformations, including ligand-free, agonist-bound active, agonist-bound desensitized and antagonist-bound conformations as well as modulator and auxiliary protein-bound states. These findings provide insights into structure-based mechanisms of iGluR gating and modulation which together shape the amplitude and time course of the excitatory postsynaptic potential. This article is part of the Special Issue entitled 'Ionotropic glutamate receptors'. Copyright © 2016 Elsevier Ltd. All rights reserved.
MacGregor, D. G.; Miller, W. J.; Stone, T. W.
1993-01-01
1. Systemic injections of kainic acid, 10 mg kg-1, into adult rats resulted in lesions in the hippocampus, as assessed by peripheral benzodiazepine ligand binding. Co-administration of clonazepam at 1 mg kg-1 or 0.2 mg kg-1 prevented major seizures associated with kainate injections, but did not alter significantly the production of hippocampal damage. 2. The co-administration of the adenosine A1 agonist R-phenylisopropyladenosine (R-PIA, 25 micrograms kg-1, i.p.) abolished the lesions induced by kainic acid. 3. The presence of the selective A1 antagonist, 8-cyclopentyl-1,3-dipropylxanthine (250 or 50 micrograms kg-1, i.p.) abolished the R-PIA neuroprotective action. 4. The A1/A2 antagonist, 8-(p-sulphophenyl)theophylline (20 mg kg-1, i.p.) which cannot cross the blood brain barrier, did not alter significantly the neuroprotective action of R-PIA, indicating that the neuroprotective action of the purine may be predominantly central. 5. The time course of the neuroprotection was also examined. R-PIA was effective when administered 2 h before or after kainate administration. 6. The results emphasise the potential utility of systemically active adenosine A1 receptor ligands in reducing CNS gliosis induced by the activation of excitatory amino acid receptors. PMID:8220909
Cross-linking of hCG to luteal receptors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ji, T.H.; Ji, I.
1985-01-01
Photoaffinity labeling of the lutropin/choriogonadotropin (LH/hCG) receptor system on porcine granulosa cells has demonstrated that both the ..cap alpha.. and ..beta.. subunits of hCG directly photoaffinity label the hormone receptor. Three new bands appear on SDS-PAGE as a consequence of photoaffinity labeling by each subunit: the molecular weights of the three bands (106K, 88K, and 83K) produced by the subunit are larger by approximately 10K than those of the three bands (96K, 76K, and 73K) labeled by the ..cap alpha.. subunit. Although it could be a coincidence that the molecular weight of the ..beta.. subunit is approximately 10K larger thanmore » that of the ..cap alpha.. subunit, the similarity in these differences suggests the possibility that both the ..cap alpha.. and ..beta.. subunits have labeled the same polypeptides.« less
Stoichiometry for α-bungarotoxin block of α7 acetylcholine receptors
NASA Astrophysics Data System (ADS)
Dacosta, Corrie J. B.; Free, Chris R.; Sine, Steven M.
2015-08-01
α-Bungarotoxin (α-Btx) binds to the five agonist binding sites on the homopentameric α7-acetylcholine receptor, yet the number of bound α-Btx molecules required to prevent agonist-induced channel opening remains unknown. To determine the stoichiometry for α-Btx blockade, we generate receptors comprised of wild-type and α-Btx-resistant subunits, tag one of the subunit types with conductance mutations to report subunit stoichiometry, and following incubation with α-Btx, monitor opening of individual receptor channels with defined subunit stoichiometry. We find that a single α-Btx-sensitive subunit confers nearly maximal suppression of channel opening, despite four binding sites remaining unoccupied by α-Btx and accessible to the agonist. Given structural evidence that α-Btx locks the agonist binding site in an inactive conformation, we conclude that the dominant mechanism of antagonism is non-competitive, originating from conformational arrest of the binding sites, and that the five α7 subunits are interdependent and maintain conformational symmetry in the open channel state.
Haghparast, Abbas; Soltani-Hekmat, Ava; Khani, Abbas; Komaki, Alireza
2007-10-29
Neurons in the nucleus cuneiformis (CnF), located just ventrolateral to the periaqueductal gray, project to medullary nucleus raphe magnus (NRM), which is a key medullary relay for descending pain modulation and is critically involved in opioid-induced analgesia. Previous studies have shown that antinociceptive response of CnF-microinjected morphine can be modulated by the specific subtypes of glutamatergic receptors within the CnF. In this study, we evaluated the role of NMDA and kainate/AMPA receptors that are widely distributed within the NRM on morphine-induced antinociception elicited from the CnF. Hundred and five male Wistar rats weighing 250-300 g were used. Morphine (10, 20 and 40 microg) and NMDA receptor antagonist, MK-801 (10 microg) or kainate/AMPA receptor antagonist, DNQX (0.5 microg) in 0.5 microl saline were stereotaxically microinjected into the CnF and NRM, respectively. The latency of tail-flick response was measured at set intervals (2, 7, 12, 17, 22, 27 min after microinjection) by using an automated tail-flick analgesiometer. The results showed that morphine microinjection into the CnF dose-dependently causes increase in tail-flick latency (TFL). MK-801 microinjected into the NRM, just 1 min before morphine injection into the CnF, significantly attenuated antinociceptive effects of morphine. On the other hand, DNQX microinjected into the NRM, significantly increased TFL after local application of morphine into the CnF. We suggest that morphine related antinociceptive effect elicited from the CnF is mediated, in part, by NMDA receptor at the level of the NRM whereas kainite/AMPA receptor has a net inhibitory influence at the same pathway.
Asher, O; Lupu-Meiri, M; Jensen, B S; Paperna, T; Fuchs, S; Oron, Y
1998-07-24
The mongoose is resistant to snake neurotoxins. The mongoose muscle nicotinic acetylcholine receptor (AChR) alpha-subunit contains a number of mutations in the ligand-binding domain and exhibits poor binding of alpha-bungarotoxin (alpha-BTX). We characterized the functional properties of a hybrid (alpha-mongoose/beta gamma delta-rat) AChR. Hybrid AChRs, expressed in Xenopus oocytes, respond to acetylcholine with depolarizing current, the mean maximal amplitude of which was greater than that mediated by the rat AChR. The IC50 of alpha-BTX to the hybrid AChR was 200-fold greater than that of the rat, suggesting much lower affinity for the toxin. Hybrid AChRs exhibited an apparent higher rate of desensitization and higher affinity for ACh (EC50 1.3 vs. 23.3 microM for the rat AChR). Hence, changes in the ligand-binding domain of AChR not only affect the binding properties of the receptor, but also result in marked changes in the characteristics of the current.
Allosteric modulation of ATP-gated P2X receptor channels
Coddou, Claudio; Stojilkovic, Stanko S.; Huidobro-Toro, J. Pablo
2013-01-01
Seven mammalian purinergic receptor subunits, denoted P2X1 to P2X7, and several spliced forms of these subunits have been cloned. When heterologously expressed, these cDNAs encode ATP-gated non-selective cation channels organized as trimers. All activated receptors produce cell depolarization and promote Ca2+ influx through their pores and indirectly by activating voltage-gated calcium channels. However, the biophysical and pharmacological properties of these receptors differ considerably, and the majority of these subunits are also capable of forming heterotrimers with other members of the P2X receptor family, which confers further different properties. These channels have three ATP binding domains, presumably located between neighboring subunits, and occupancy of at least two binding sites is needed for their activation. In addition to the orthosteric binding sites for ATP, these receptors have additional allosteric sites that modulate the agonist action at receptors, including sites for trace metals, protons, neurosteroids, reactive oxygen species and phosphoinositides. The allosteric regulation of P2X receptors is frequently receptor-specific and could be a useful tool to identify P2X members in native tissues and their roles in signaling. The focus of this review is on common and receptor-specific allosteric modulation of P2X receptors and the molecular base accounting for allosteric binding sites. PMID:21639805
Gong, Kerui; Bhargava, Aditi; Jasmin, Luc
2016-01-01
The contribution of the peripheral nervous system to opiate-induced hyperalgesia (OIH) is not well understood. In this study, we determined the changes in excitability of primary sensory neurons after sustained morphine administration for 7 days. Changes in the expression of glutamate receptors and glutamate transporters after morphine administration were ascertained in dorsal root ganglions. Patch clamp recordings from intact dorsal root ganglions (ex vivo preparation) of morphine-treated rats showed increased excitability of small diameter (≤30 μm) neurons with respect to rheobase and membrane threshold, whereas the excitability of large diameter (>30 μm) neurons remained unchanged. Small diameter neurons also displayed increased responses to glutamate, which were mediated mainly by GluN2B containing N-methyl-D-aspartate (NMDA) receptors, and to a lesser degree by the neuronal excitatory amino acid transporter 3/excitatory amino acid carrier 1. Coadministration in vivo of the GluN2B selective antagonist Ro 25-6981 with morphine for 7 days prevented the appearance of OIH and increased morphine-induced analgesia. Administration of morphine for 7 days led to an increased expression of GluN2B and excitatory amino acid transporter 3/excitatory amino acid carrier 1, but not of the α-amino-3-hydroxy-5-methyl-4-isoxazole propionate, kainate, or group I metabotropic glutamate receptors, or of the vesicular glutamate transporter 2. These results suggest that peripheral glutamatergic neurotransmission contributes to OIH and that GluN2B subunit of NMDA receptors in the periphery may be a target for therapy.
NASA Technical Reports Server (NTRS)
Good, P. F.; Morrison, J. H.; Bloom, F. E. (Principal Investigator)
1995-01-01
Projections of the entorhinal cortex to the hippocampus are well known from the classical studies of Cajal (Ramon y Cajal, 1904) and Lorente de No (1933). Projections from the entorhinal cortex to neocortical areas are less well understood. Such connectivity is likely to underlie the consolidation of long-term declarative memory in neocortical sites. In the present study, a projection arising in layer V of the entorhinal cortex and terminating in a polymodal association area of the superior temporal gyrus has been identified with the use of retrograde tracing. The dendritic arbors of neurons giving rise to this projection were further investigated by cell filling and confocal microscopy with computer reconstruction. This analysis demonstrated that the dendritic arbor of identified projection neurons was largely confined to layer V, with the exception of a solitary, simple apical dendrite occasionally ascending to superficial laminae but often confined to the lamina dissecans (layer IV). Finally, immunoreactivity for glutamate-receptor subunit proteins GluR 5/6/7 of the dendritic arbor of identified entorhinal projection neurons was examined. The solitary apical dendrite of identified entorhinal projection neurons was prominently immunolabeled for GluR 5/6/7, as was the dendritic arbor of basilar dendrites of these neurons. The restriction of the large bulk of the dendritic arbor of identified entorhinal projection neurons to layer V implies that these neurons are likely to be heavily influenced by hippocampal output arriving in the deep layers of the entorhinal cortex. Immunoreactivity for GluR 5/6/7 throughout the dendritic arbor of such neurons indicates that this class of glutamate receptor is in a position to play a prominent role in mediating excitatory neurotransmission within hippocampal-entorhinal circuits.
Kim, Soon Ae; Kim, Jong-Woo; Song, Ji-Young; Park, Sunny; Lee, Hee Jae; Chung, Joo-Ho
2004-01-01
Findings obtained from several studies indicate that ethanol enhances the activity of alpha4beta2 neuronal nicotinic acetylcholine receptor and support the possibility that a polymorphism of the nicotinic acetylcholine receptor alpha4 subunit gene (CHRNA4) modulates enhancement of nicotinic receptor function by ethanol. To identify the association between the CfoI polymorphism of the CHRNA4 and alcoholism, we examined distribution of genotypes and allele frequencies in Korean patients diagnosed with alcoholism (n = 127) and Korean control subjects without alcoholism (n = 185) with polymerase chain reaction-restriction fragment length polymorphism methods. We were able to detect the association between the CfoI polymorphism of the CHRNA4 and alcoholism in Korean patients (genotype P = .023; allele frequency P = .047). The genotypes and allele frequencies of known polymorphisms in other alcoholism candidate genes, such as alcohol metabolism-related genes [alcohol dehydrogenase 2 (ADH2), aldehyde dehydrogenase 2 (ALDH2), alcohol dehydrogenase 3 (ADH3), and cytochrome P450 2E1 (CYP2E1)] and mu-opioid receptor gene (OPRM1), were studied. The polymorphisms of ADH2, ALDH2, and CYP2E1 were significantly different in Korean patients with alcoholism and Korean control subjects without alcoholism, but ADH3 and OPRM1 did not differ between the two groups.
Expression of cholera toxin B subunit in transgenic tomato plants.
Jani, Dewal; Meena, Laxman Singh; Rizwan-ul-Haq, Quazi Mohammad; Singh, Yogendra; Sharma, Arun K; Tyagi, Akhilesh K
2002-10-01
Cholera toxin, secreted by Vibrio cholerae, consists of A and B subunits. The latter binds to G(M1)-ganglioside receptors as a pentamer (approximately 55 kDa). Tomato plants were transformed with the gene encoding cholera toxin B subunit (ctxB) along with an endoplasmic reticulum retention signal (SEKDEL) under the control of the CaMV 35S promoter via Agrobacterium-mediated transformation. PCR and Southern analysis confirmed the presence of the ctxB gene in transformed tomato plants. Northern analysis showed the presence of the ctxB-specific transcript. Immunoblot assays of the plant-derived protein extract showed the presence of cholera toxin subunit B (CTB) with mobility similar to purified CTB from V. cholerae. Both tomato leaves and fruits expressed CTB at levels up to 0.02 and 0.04% of total soluble protein, respectively. The G(M1)-ELISA showed that the plant-derived CTB bound specifically to G(M1)-ganglioside receptor, suggesting that it retained its native pentameric form. This study forms a basis for exploring the utility of CTB to develop tomato-based edible vaccines against cholera.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Potier, M.C.; Dutriaux, A.; Lambolez, B.
1993-03-01
Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less
Huang, Xuan; Zhou, Chengwen; Tian, Mengnan; Kang, Jing-Qiong; Shen, Wangzhen; Verdier, Kelienne; Pimenta, Aurea; MacDonald, Robert L
2017-08-01
The mutant γ-aminobutyric acid type A (GABA A ) receptor γ2(Q390X) subunit (Q351X in the mature peptide) has been associated with the epileptic encephalopathy, Dravet syndrome, and the epilepsy syndrome genetic epilepsy with febrile seizures plus (GEFS+). The mutation generates a premature stop codon that results in translation of a stable truncated and misfolded γ2 subunit that accumulates in neurons, forms intracellular aggregates, disrupts incorporation of γ2 subunits into GABA A receptors, and affects trafficking of partnering α and β subunits. Heterozygous Gabrg2 +/Q390X knock-in (KI) mice had reduced cortical inhibition, spike wave discharges on electroencephalography (EEG), a lower seizure threshold to the convulsant drug pentylenetetrazol (PTZ), and spontaneous generalized tonic-clonic seizures. In this proof-of-principal study, we attempted to rescue these deficits in KI mice using a γ2 subunit gene (GABRG2) replacement therapy. We introduced the GABRG2 allele by crossing Gabrg2 +/Q390X KI mice with bacterial artificial chromosome (BAC) transgenic mice overexpressing HA (hemagglutinin)-tagged human γ2 HA subunits, and compared GABA A receptor subunit expression by Western blot and immunohistochemical staining, seizure threshold by monitoring mouse behavior after PTZ-injection, and thalamocortical inhibition and network oscillation by slice recording. Compared to KI mice, adult mice carrying both mutant allele and transgene had increased wild-type γ2 and partnering α1 and β2/3 subunits, increased miniature inhibitory postsynaptic current (mIPSC) amplitudes recorded from layer VI cortical neurons, reduced thalamocortical network oscillations, and higher PTZ seizure threshold. Based on these results we suggest that seizures in a genetic epilepsy syndrome caused by epilepsy mutant γ2(Q390X) subunits with dominant negative effects could be rescued potentially by overexpression of wild-type γ2 subunits. Wiley Periodicals, Inc. © 2017 International
Wang, Jingyi; Kuryatov, Alexander; Jin, Zhuang; Norleans, Jack; Kamenecka, Theodore M.; Kenny, Paul J.; Lindstrom, Jon
2015-01-01
Positive allosteric modulators (PAMs) of nicotinic acetylcholine receptors (nAChR) are important therapeutic candidates as well as valuable research tools. We identified a novel type II PAM, (R)-7-bromo-N-(piperidin-3-yl)benzo[b]thiophene-2-carboxamide (Br-PBTC), which both increases activation and reactivates desensitized nAChRs. This compound increases acetylcholine-evoked responses of α2* and α4* nAChRs but is without effect on α3* or α6* nAChRs (* indicates the presence of other nAChR subunits). Br-BPTC acts from the C-terminal extracellular sequences of α4 subunits, which is also a PAM site for steroid hormone estrogens such as 17β-estradiol. Br-PBTC is much more potent than estrogens. Like 17β-estradiol, the non-steroid Br-PBTC only requires one α4 subunit to potentiate nAChR function, and its potentiation is stronger with more α4 subunits. This feature enables Br-BPTC to potentiate activation of (α4β2)(α6β2)β3 but not (α6β2)2β3 nAChRs. Therefore, this compound is potentially useful in vivo for determining functions of different α6* nAChR subtypes. Besides activation, Br-BPTC affects desensitization of nAChRs induced by sustained exposure to agonists. After minutes of exposure to agonists, Br-PBTC reactivated short term desensitized nAChRs that have at least two α4 subunits but not those with only one. Three α4 subunits were required for Br-BPTC to reactivate long term desensitized nAChRs. These data suggest that higher PAM occupancy promotes channel opening more efficiently and overcomes short and long term desensitization. This C-terminal extracellular domain could be a target for developing subtype or state-selective drugs for nAChRs. PMID:26432642
Zhang, Xi
2016-01-01
Neurotransmitter ligand-gated ion channels (LGICs) are widespread and pivotal in brain functions. Unveiling their structure-function mechanisms is crucial to drive drug discovery, and demands robust proteomic quantitation of expression, post-translational modifications (PTMs) and dynamic structures. Yet unbiased digestion of these modified transmembrane proteins—at high efficiency and peptide reproducibility—poses the obstacle. Targeting both enzyme-substrate contacts and PTMs for peptide formation and detection, we devised flow-and-detergent-facilitated protease and de-PTM digestions for deep sequencing (FDD) method that combined omni-compatible detergent, tandem immobilized protease/PNGase columns, and Cys-selective reduction/alkylation, to achieve streamlined ultradeep peptide preparation within minutes not days, at high peptide reproducibility and low abundance-bias. FDD transformed enzyme-protein contacts into equal catalytic travel paths through enzyme-excessive columns regardless of protein abundance, removed products instantly preventing inhibition, tackled intricate structures via sequential multiple micro-digestions along the flow, and precisely controlled peptide formation by flow rate. Peptide-stage reactions reduced steric bias; low contamination deepened MS/MS scan; distinguishing disulfide from M oxidation and avoiding gain/loss artifacts unmasked protein-endogenous oxidation states. Using a recent interactome of 285-kDa human GABA type A receptor, this pilot study validated FDD platform's applicability to deep sequencing (up to 99% coverage), H/D-exchange and TMT-based structural mapping. FDD discovered novel subunit-specific PTM signatures, including unusual nontop-surface N-glycosylations, that may drive subunit biases in human Cys-loop LGIC assembly and pharmacology, by redefining subunit/ligand interfaces and connecting function domains. PMID:27073180
Jorratt, Pascal; Delano, Paul H; Delgado, Carolina; Dagnino-Subiabre, Alexies; Terreros, Gonzalo
2017-01-01
The auditory efferent system is a neural network that originates in the auditory cortex and projects to the cochlear receptor through olivocochlear (OC) neurons. Medial OC neurons make cholinergic synapses with outer hair cells (OHCs) through nicotinic receptors constituted by α9 and α10 subunits. One of the physiological functions of the α9 nicotinic receptor subunit (α9-nAChR) is the suppression of auditory distractors during selective attention to visual stimuli. In a recent study we demonstrated that the behavioral performance of alpha-9 nicotinic receptor knock-out (KO) mice is altered during selective attention to visual stimuli with auditory distractors since they made less correct responses and more omissions than wild type (WT) mice. As the inhibition of the behavioral responses to irrelevant stimuli is an important mechanism of the selective attention processes, behavioral errors are relevant measures that can reflect altered inhibitory control. Errors produced during a cued attention task can be classified as premature, target and perseverative errors. Perseverative responses can be considered as an inability to inhibit the repetition of an action already planned, while premature responses can be considered as an index of the ability to wait or retain an action. Here, we studied premature, target and perseverative errors during a visual attention task with auditory distractors in WT and KO mice. We found that α9-KO mice make fewer perseverative errors with longer latencies than WT mice in the presence of auditory distractors. In addition, although we found no significant difference in the number of target error between genotypes, KO mice made more short-latency target errors than WT mice during the presentation of auditory distractors. The fewer perseverative error made by α9-KO mice could be explained by a reduced motivation for reward and an increased impulsivity during decision making with auditory distraction in KO mice.
Deciphering the function of the CNGB1b subunit in olfactory CNG channels.
Nache, Vasilica; Wongsamitkul, Nisa; Kusch, Jana; Zimmer, Thomas; Schwede, Frank; Benndorf, Klaus
2016-07-11
Olfactory cyclic nucleotide-gated (CNG) ion channels are key players in the signal transduction cascade of olfactory sensory neurons. The second messengers cAMP and cGMP directly activate these channels, generating a depolarizing receptor potential. Olfactory CNG channels are composed of two CNGA2 subunits and two modulatory subunits, CNGA4, and CNGB1b. So far the exact role of the modulatory subunits for channel activation is not fully understood. By measuring ligand binding and channel activation simultaneously, we show that in functional heterotetrameric channels not only the CNGA2 subunits and the CNGA4 subunit but also the CNGB1b subunit binds cyclic nucleotides and, moreover, also alone translates this signal to open the pore. In addition, we show that the CNGB1b subunit is the most sensitive subunit in a heterotetrameric channel to cyclic nucleotides and that it accelerates deactivation to a similar extent as does the CNGA4 subunit. In conclusion, the CNGB1b subunit participates in ligand-gated activation of olfactory CNG channels and, particularly, contributes to rapid termination of odorant signal in an olfactory sensory neuron.
Lennon, V A; Lambert, E H; Leiby, K R; Okarma, T B; Talib, S
1991-04-01
A synthetic gene encoding the 210 N-terminal residues of the alpha-subunit of the nicotinic acetylcholine receptor (AChR) of human skeletal muscle was cloned into an inducible expression plasmid to produce a fusion protein in high yield in Escherichia coli. Like native human AChR, the recombinant human alpha 1-210 protein induced AChR-binding, AChR-modulating, and AChR-blocking autoantibodies in rats when injected once intradermally as an emulsion in CFA, with Bordetella pertussis vaccine as supplementary adjuvant. The minimum dose of recombinant protein required to induce biochemical signs of experimental autoimmune myasthenia gravis (EAMG) with 100% incidence was 2.2 micrograms. With 6.6 to 22 micrograms, serum levels of autoantibodies were persistent, and clinically apparent EAMG lasted more than a month. Clinical, electrophysiological, and biochemical indices of EAMG induced by doses of 66 micrograms or more were more uniformly severe and persistent, with 33% fatality. Rats receiving a control extract of E. coli containing plasmid without the alpha 1-210 codon insert, with adjuvants, did not develop autoantibodies or signs of EAMG. This highly reproducible new model of EAMG induced by a recombinant human autoantigen should be valuable for testing Ag-specific immunotherapeutic strategies that might be applicable to treating acquired myasthenia gravis in humans.
Mechanism of Positive Allosteric Modulators Acting on AMPA Receptors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jin,R.; Clark, S.; Weeks, A.
2005-01-01
Ligand-gated ion channels involved in the modulation of synaptic strength are the AMPA, kainate, and NMDA glutamate receptors. Small molecules that potentiate AMPA receptor currents relieve cognitive deficits caused by neurodegenerative diseases such as Alzheimer's disease and show promise in the treatment of depression. Previously, there has been limited understanding of the molecular mechanism of action for AMPA receptor potentiators. Here we present cocrystal structures of the glutamate receptor GluR2 S1S2 ligand-binding domain in complex with aniracetam [1-(4-methoxybenzoyl)-2-pyrrolidinone] or CX614 (pyrrolidino-1, 3-oxazino benzo-1, 4-dioxan-10-one), two AMPA receptor potentiators that preferentially slow AMPA receptor deactivation. Both potentiators bind within the dimermore » interface of the nondesensitized receptor at a common site located on the twofold axis of molecular symmetry. Importantly, the potentiator binding site is adjacent to the 'hinge' in the ligand-binding core 'clamshell' that undergoes conformational rearrangement after glutamate binding. Using rapid solution exchange, patch-clamp electrophysiology experiments, we show that point mutations of residues that interact with potentiators in the cocrystal disrupt potentiator function. We suggest that the potentiators slow deactivation by stabilizing the clamshell in its closed-cleft, glutamate-bound conformation.« less
Taccola, G; Margaryan, G; Mladinic, M; Nistri, A
2008-08-13
Acute spinal cord injury evolves rapidly to produce secondary damage even to initially spared areas. The result is loss of locomotion, rarely reversible in man. It is, therefore, important to understand the early pathophysiological processes which affect spinal locomotor networks. Regardless of their etiology, spinal lesions are believed to include combinatorial effects of excitotoxicity and severe stroke-like metabolic perturbations. To clarify the relative contribution by excitotoxicity and toxic metabolites to dysfunction of locomotor networks, spinal reflexes and intrinsic network rhythmicity, we used, as a model, the in vitro thoraco-lumbar spinal cord of the neonatal rat treated (1 h) with either kainate or a pathological medium (containing free radicals and hypoxic/aglycemic conditions), or their combination. After washout, electrophysiological responses were monitored for 24 h and cell damage analyzed histologically. Kainate suppressed fictive locomotion irreversibly, while it reversibly blocked neuronal excitability and intrinsic bursting induced by synaptic inhibition block. This result was associated with significant neuronal loss around the central canal. Combining kainate with the pathological medium evoked extensive, irreversible damage to the spinal cord. The pathological medium alone slowed down fictive locomotion and intrinsic bursting: these oscillatory patterns remained throughout without regaining their control properties. This phenomenon was associated with polysynaptic reflex depression and preferential damage to glial cells, while neurons were comparatively spared. Our model suggests distinct roles of excitotoxicity and metabolic dysfunction in the acute damage of locomotor networks, indicating that different strategies might be necessary to treat the various early components of acute spinal cord lesion.
Tobi, Dror
2017-08-01
A new algorithm for comparison of protein dynamics is presented. Compared protein structures are superposed and their modes of motions are calculated using the anisotropic network model. The obtained modes are aligned using the dynamic programming algorithm of Needleman and Wunsch, commonly used for sequence alignment. Dynamical comparison of hemoglobin in the T and R2 states reveals that the dynamics of the allosteric effector 2,3-bisphosphoglycerate binding site is different in the two states. These differences can contribute to the selectivity of the effector to the T state. Similar comparison of the ionotropic glutamate receptor in the kainate+(R,R)-2b and ZK bound states reveals that the kainate+(R,R)-2b bound states slow modes describe upward motions of ligand binding domain and the transmembrane domain regions. Such motions may lead to the opening of the receptor. The upper lobes of the LBDs of the ZK bound state have a smaller interface with the amino terminal domains above them and have a better ability to move together. The present study exemplifies the use of dynamics comparison as a tool to study protein function. Proteins 2017; 85:1507-1517. © 2014 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Antigenic Structure of the Human Muscle Nicotinic Acetylcholine Receptor Main Immunogenic Region
Luo, Jie; Lindstrom, Jon
2009-01-01
The main immunogenic region on the α1 subunits of muscle nicotinic acetylcholine receptors provokes half or more of the autoantibodies in myasthenia gravis and its animal model. Many of these autoantibodies depend on the native conformation of the receptor for their ability to bind with high affinity. We mapped this region and explained the conformation-dependence of its epitopes by making chimeras in which sequences of human muscle α1 subunits were replaced in human neuronal α7 subunits or Aplysia acetylcholine binding protein. These chimeras also revealed that the main immunogenic region can play a major role in promoting conformational maturation, and, consequently, assembly of receptor subunits. PMID:19705087
Molecular analysis of nicotinic receptor expression in autism.
Martin-Ruiz, C M; Lee, M; Perry, R H; Baumann, M; Court, J A; Perry, E K
2004-04-07
Autism is a developmental disorder of unknown aetiopathology and lacking any specific pharmacological therapeutic intervention. Neurotransmitters such as serotonin, gamma-aminobutyric acid (GABA) and acetylcholine have been implicated. Abnormalities in nicotinic acetylcholine receptors have been identified including cortical loss of binding to the alpha4/beta2 subtype and increase in cerebellar alpha7 binding. Receptor expression (mRNA) has not so far been systematically examined. This study aims to further explore the role of nicotinic receptors in autism by analysing nicotinic receptor subunit mRNA in conjunction with protein levels and receptor binding in different brain areas. Quantitative RT-PCR for alpha4, alpha7 and beta2 subunit mRNA expression levels; alpha3, alpha4, alpha7 and beta2 subunit protein expression immunochemistry and specific radioligand receptor binding were performed in adult autism and control brain samples from cerebral cortex and cerebellum. Alpha4 and beta2 protein expression and receptor binding density as well as alpha4 mRNA levels were lower in parietal cortex in autism, while alpha7 did not change for any of these parameters. In cerebellum, alpha4 mRNA expression was increased, whereas subunit protein and receptor levels were decreased. Alpha7 receptor binding in cerebellum was increased alongside non-significant elevations in mRNA and protein expression levels. No significant changes were found for beta2 in cerebellum. The data obtained, using complementary measures of receptor expression, indicate that reduced gene expression of the alpha4beta2 nicotinic receptor in the cerebral cortex is a major feature of the neurochemical pathology of autism, whilst post-transcriptional abnormalities of both this and the alpha7 subtype are apparent in the cerebellum. The findings point to dendritic and/or synaptic nicotinic receptor abnormalities that may relate to disruptions in cerebral circuitry development.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Steinlein, O.; Weiland, S.; Stoodt, J.
1996-03-01
The human neuronal nicotinic acetylcholine receptor {alpha}4 subunit gene (CHRNA4) is located in the candidate region for three different phenotypes: benign familial neonatal convulsions, autosomal dominant nocturnal frontal lobe epilepsy, and low-voltage EEG. Recently, a missense mutation in transmembrane domain 2 of CHRNA4 was found to be associated with autosomal dominant nocturnal frontal lobe epilepsy in one extended pedigree. We have determined the genomic organization of CHRNA4, which consists of six exons distributed over approximately 17 kb of genomic DNA. The nucleotide sequence obtained from the genomic regions adjacent to the exon boundaries enabled us to develop a set ofmore » primer pairs for PCR amplification of the complete coding region. The sequence analysis provides the basis for a comprehensive mutation screening of CHRNA4 in the above-mentioned phenotypes and possibly in other types of idopathic epilepsies. 29 refs., 3 figs., 1 tab.« less
Proteasome subunit Rpn13 is a novel ubiquitin receptor
Husnjak, Koraljka; Elsasser, Suzanne; Zhang, Naixia; Chen, Xiang; Randles, Leah; Shi, Yuan; Hofmann, Kay; Walters, Kylie; Finley, Daniel; Dikic, Ivan
2010-01-01
Proteasomal receptors that recognize ubiquitin chains attached to substrates are key mediators of selective protein degradation in eukaryotes. Here we report the identification of a new ubiquitin receptor, Rpn13/ARM1, a known component of the proteasome. Rpn13 binds ubiquitin via a conserved N-terminal region termed the Pru domain (Pleckstrin-like receptor for ubiquitin), which binds K48-linked diubiquitin with an affinity of ∼90 nM. Like proteasomal ubiquitin receptor Rpn10/S5a, Rpn13 also binds ubiquitin-like domains of the UBL/UBA family of ubiquitin receptors. A synthetic phenotype results in yeast when specific mutations of the ubiquitin binding sites of Rpn10 and Rpn13 are combined, indicating functional linkage between these ubiquitin receptors. Since Rpn13 is also the proteasomal receptor for Uch37, a deubiquitinating enzyme, our findings suggest a coupling of chain recognition and disassembly at the proteasome. PMID:18497817
Regulation of AMPA receptors by phosphorylation.
Carvalho, A L; Duarte, C B; Carvalho, A P
2000-10-01
The AMPA receptors for glutamate are oligomeric structures that mediate fast excitatory responses in the central nervous system. Phosphorylation of AMPA receptors is an important mechanism for short-term modulation of their function, and is thought to play an important role in synaptic plasticity in different brain regions. Recent studies have shown that phosphorylation of AMPA receptors by cAMP-dependent protein kinase (PKA) and Ca2+- and calmodulin-dependent protein kinase II (CaMKII) potentiates their activity, but phosphorylation of the receptor subunits may also affect their interaction with intracellular proteins, and their expression at the plasma membrane. Phosphorylation of AMPA receptor subunits has also been investigated in relation to processes of synaptic plasticity. This review focuses on recent advances in understanding the molecular mechanisms of regulation of AMPA receptors, and their implications in synaptic plasticity.
Andhirka, Sai Krishna; Vignesh, Ravichandran; Aradhyam, Gopala Krishna
2017-08-01
Deciphering the mechanism of activation of heterotrimeric G proteins by their cognate receptors continues to be an intriguing area of research. The recently solved crystal structure of the ternary complex captured the receptor-bound α-subunit in an open conformation, without bound nucleotide has improved our understanding of the activation process. Despite these advancements, the mechanism by which the receptor causes GDP release from the α-subunit remains elusive. To elucidate the mechanism of activation, we studied guanine nucleotide-induced structural stability of the α-subunit (in response to thermal/chaotrope-mediated stress). Inherent stabilities of the inactive (GDP-bound) and active (GTP-bound) forms contribute antagonistically to the difference in conformational stability whereas the GDP-bound protein is able to switch to a stable intermediate state, GTP-bound protein loses this ability. Partial perturbation of the protein fold reveals the underlying influence of the bound nucleotide providing an insight into the mechanism of activation. An extra stable, pretransition intermediate, 'empty pocket' state (conformationally active-state like) in the unfolding pathway of GDP-bound protein mimics a gating system - the activation process having to overcome this stable intermediate state. We demonstrate that a relatively more complex conformational fold of the GDP-bound protein is at the core of the gating system. We report capturing this threshold, 'metastable empty pocket' conformation (the gate) of α-subunit of G protein and hypothesize that the receptor activates the G protein by enabling it to achieve this structure through mild structural perturbation. © 2017 Federation of European Biochemical Societies.
Priya, Anusha; Johar, Kaid; Wong-Riley, Margaret T T
2013-01-01
Neuronal activity and energy metabolism are tightly coupled processes. Previously, we found that nuclear respiratory factor 1 (NRF-1) transcriptionally co-regulates energy metabolism and neuronal activity by regulating all 13 subunits of the critical energy generating enzyme, cytochrome c oxidase (COX), as well as N-methyl-d-aspartate (NMDA) receptor subunits 1 and 2B, GluN1 (Grin1) and GluN2B (Grin2b). We also found that another transcription factor, nuclear respiratory factor 2 (NRF-2 or GA-binding protein) regulates all subunits of COX as well. The goal of the present study was to test our hypothesis that NRF-2 also regulates specific subunits of NMDA receptors, and that it functions with NRF-1 via one of three mechanisms: complementary, concurrent and parallel, or a combination of complementary and concurrent/parallel. By means of multiple approaches, including in silico analysis, electrophoretic mobility shift and supershift assays, in vivo chromatin immunoprecipitation of mouse neuroblastoma cells and rat visual cortical tissue, promoter mutations, real-time quantitative PCR, and western blot analysis, NRF-2 was found to functionally regulate Grin1 and Grin2b genes, but not any other NMDA subunit genes. Grin1 and Grin2b transcripts were up-regulated by depolarizing KCl, but silencing of NRF-2 prevented this up-regulation. On the other hand, over-expression of NRF-2 rescued the down-regulation of these subunits by the impulse blocker TTX. NRF-2 binding sites on Grin1 and Grin2b are conserved among species. Our data indicate that NRF-2 and NRF-1 operate in a concurrent and parallel manner in mediating the tight coupling between energy metabolism and neuronal activity at the molecular level. Copyright © 2012 Elsevier B.V. All rights reserved.
The Structure of the GM-CSF Receptor Complex Reveals a Distinct Mode of Cytokine Receptor Activation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hansen, Guido; Hercus, Timothy R.; McClure, Barbara J.
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a pleiotropic cytokine that controls the production and function of blood cells, is deregulated in clinical conditions such as rheumatoid arthritis and leukemia, yet offers therapeutic value for other diseases. Its receptors are heterodimers consisting of a ligand-specific {alpha} subunit and a {beta}c subunit that is shared with the interleukin (IL)-3 and IL-5 receptors. How signaling is initiated remains an enigma. We report here the crystal structure of the human GM-CSF/GM-CSF receptor ternary complex and its assembly into an unexpected dodecamer or higher-order complex. Importantly, mutagenesis of the GM-CSF receptor at the dodecamer interface andmore » functional studies reveal that dodecamer formation is required for receptor activation and signaling. This unusual form of receptor assembly likely applies also to IL-3 and IL-5 receptors, providing a structural basis for understanding their mechanism of activation and for the development of therapeutics.« less
Neuroplasticity and Calcium Signaling in Stressed Rat Amygdala
2005-02-01
kainate receptor and neuroplasticity in the amygdala. National Institute of aging, November, 2001. • He Li: GluR5 kainate receptor mediated synaptic...functions in the amygdala. National Institute of Mental Health, April, 2002. 50 " Maria F. M. Braga: Chronic Stress Causes Impairment of aI-Adrenoceptor...resistance All animal experiments were performed in accordance with of 1.5-5.0 Mf when filled with a solution containing (in our institutional guidelines
Girard, Beatrice M; Merriam, Laura A; Tompkins, John D; Vizzard, Margaret A; Parsons, Rodney L
2013-11-15
Quantitative real-time PCR was used to test whether cavernous nerve injury leads to a decrease in major pelvic ganglia (MPG) neuronal nicotinic ACh receptor (nAChR) subunit and postsynaptic density (PSD)-93 transcript levels. Subunits α3, β4, and α7, commonly expressed in the MPG, were selected for analysis. After 72 h in explant culture, MPG transcript levels for α3, β4, α7, and PSD-93 were significantly depressed. Three days after cavernous nerve axotomy or crush in vivo, transcript levels for α3, β4, and PSD-93, but not for α7, were significantly depressed. Three days after dissection of the cavernous nerve free of underlying tissue and application of a 5-mm lateral stretch (manipulation), transcript levels for α3 and PSD-93 were also significantly decreased. Seven days after all three surgical procedures, α3 transcript levels remained depressed, but PSD-93 transcript levels were still decreased only after axotomy or nerve crush. At 30 days postsurgery, transcript levels for the nAChR subunits and PSD-93 had recovered. ACh-induced currents were significantly smaller in MPG neurons dissociated from 3-day explant cultured ganglia than from those recorded in neurons dissociated from acutely isolated ganglia; this observation provides direct evidence showing that a decrease in nAChR function was coincident with a decrease in nAChR subunit transcript levels. We conclude that a downregulation of nAChR subunit and PSD-93 expression after cavernous nerve injury, or even manipulation, could interrupt synaptic transmission within the MPG and thus contribute to the loss of neural control of urogenital organs after pelvic surgeries.
Andrade, Susie; Arbo, Bruno D; Batista, Bruna A M; Neves, Alice M; Branchini, Gisele; Brum, Ilma S; Barros, Helena M T; Gomez, Rosane; Ribeiro, Maria Flavia M
2012-12-01
Progesterone is a neuroactive hormone with non-genomic effects on GABA(A) receptors (GABA(A)R). Changes in the expression of GABA(A)R subunits are related to depressive-like behaviors in rats. Moreover, sex differences and depressive behaviors have been associated with prefrontal brain asymmetry in rodents and humans. Thus, our objective was to investigate the effect of progesterone on the GABA(A)R α1 and γ2 subunits mRNA expression in the right and left prefrontal cortex of diestrus female and male rats exposed to the forced swimming test (FST). Male and female rats (n = 8/group) were randomly selected to receive a daily dose of progesterone (0·4 mg·kg⁻¹) or vehicle, during two complete female estrous cycles (8-10 days). On the experiment day, male rats or diestrus female rats were euthanized 30 min after the FST. Our results showed that progesterone significantly increased the α1 subunit mRNA in both hemispheres of male and female rats. Moreover, there was an inverse correlation between depressive-like behaviors and GABA(A)R α1 subunit mRNA expression in the right hemisphere in female rats. Progesterone decreased the GABA(A)R γ2 mRNA expression only in the left hemisphere of male rats. Therefore, we conclude that the GABA(A) system displays an asymmetric distribution according to sex and that progesterone, at lower doses, presents an antidepressant effect after increasing the GABA(A) R α1 subunit expression in the right prefrontal cortex of female rats. Copyright © 2012 John Wiley & Sons, Ltd.
Zhang, Nianhui; Peng, Zechun; Tong, Xiaoping; Lindemeyer, A Kerstin; Cetina, Yliana; Huang, Christine S; Olsen, Richard W; Otis, Thomas S; Houser, Carolyn R
2017-11-01
While numerous changes in the GABA system have been identified in models of Fragile X Syndrome (FXS), alterations in subunits of the GABA A receptors (GABA A Rs) that mediate tonic inhibition are particularly intriguing. Considering the key role of tonic inhibition in controlling neuronal excitability, reduced tonic inhibition could contribute to FXS-associated disorders such as hyperactivity, hypersensitivity, and increased seizure susceptibility. The current study has focused on the expression and function of the δ subunit of the GABA A R, a major subunit involved in tonic inhibition, in granule cells of the dentate gyrus in the Fmr1 knockout (KO) mouse model of FXS. Electrophysiological studies of dentate granule cells revealed a marked, nearly four-fold, decrease in tonic inhibition in the Fmr1 KO mice, as well as reduced effects of two δ subunit-preferring pharmacological agents, THIP and DS2, supporting the suggestion that δ subunit-containing GABA A Rs are compromised in the Fmr1 KO mice. Immunohistochemistry demonstrated a small but statistically significant decrease in δ subunit labeling in the molecular layer of the dentate gyrus in Fmr1 KO mice compared to wildtype (WT) littermates. The discrepancy between the large deficits in GABA-mediated tonic inhibition in granule cells in the Fmr1 KO mice and only modest reductions in immunolabeling of the δ subunit led to studies of surface expression of the δ subunit. Cross-linking experiments followed by Western blot analysis demonstrated a small, non-significant decrease in total δ subunit protein in the hippocampus of Fmr1 KO mice, but a four-fold decrease in surface expression of the δ subunit in these mice. No significant changes were observed in total or surface expression of the α4 subunit protein, a major partner of the δ subunit in the forebrain. Postembedding immunogold labeling for the δ subunit demonstrated a large, three-fold, decrease in the number of symmetric synapses with
Qualitative variation of photolabelled benzodiazepine receptors in different species.
Hebebrand, J; Friedl, W; Lentes, K U; Propping, P
1986-01-01
In order to examine whether species differences of benzodiazepine receptor subunits exist, we compared the fluorographic pattern of photoaffinity labelled subunits after SDS-PAGE in five species: fish, frog, chicken, mouse and calf. Each species showed a distinct pattern of specifically labelled proteins. We conclude that species variation of benzodiazepine receptor does indeed exist.
The 2.3 {angstrom} crystal structure of cholera toxin B subunit pentamer: Choleragenoid
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Rong-Guang; Westbrook, M.L.; Maulik, P.R.
1996-02-01
Cholera toxin, a heterohexameric AB{sub 5} enterotoxin released by Vibrio cholera, induces a profuse secretory diarrhea in susceptible hosts. Choleragenoid, the B subunit pentamer of cholera toxin, directs the enzymatic A subunit to its target by binding to GM{sub 1} gangliosides exposed on the luminal surface of intestinal epithelial cells. We have solved the crystal structure of choleragenoid at 2.3 {Angstrom} resolution by combining single isomorphous replacement with non-crystallographic symmetry averaging. The structure of the B subunits, and their pentameric arrangement, closely resembles that reported for the intact holotoxin (choleragen), the heat-labile enterotoxin from E. coli, and for a choleragenoid-GM{submore » 1} pentasaccharide complex. In the absence of the A subunit the central cavity of the B pentamer is a highly solvated channel. The binding of the A subunit or the receptor pentasaccharide to choleragenoid has only a modest effect on the local stereochemistry and does not perceptibly alter the subunit interface.« less
GABAB receptor attenuation of GABAA currents in neurons of the mammalian central nervous system.
Shen, Wen; Nan, Changlong; Nelson, Peter T; Ripps, Harris; Slaughter, Malcolm M
2017-03-01
Ionotropic receptors are tightly regulated by second messenger systems and are often present along with their metabotropic counterparts on a neuron's plasma membrane. This leads to the hypothesis that the two receptor subtypes can interact, and indeed this has been observed in excitatory glutamate and inhibitory GABA receptors. In both systems the metabotropic pathway augments the ionotropic receptor response. However, we have found that the metabotropic GABA B receptor can suppress the ionotropic GABA A receptor current, in both the in vitro mouse retina and in human amygdala membrane fractions. Expression of amygdala membrane microdomains in Xenopus oocytes by microtransplantation produced functional ionotropic and metabotropic GABA receptors. Most GABA A receptors had properties of α -subunit containing receptors, with ~5% having ρ -subunit properties. Only GABA A receptors with α -subunit-like properties were regulated by GABA B receptors. In mouse retinal ganglion cells, where only α -subunit-containing GABA A receptors are expressed, GABA B receptors suppressed GABA A receptor currents. This suppression was blocked by GABA B receptor antagonists, G-protein inhibitors, and GABA B receptor antibodies. Based on the kinetic differences between metabotropic and ionotropic receptors, their interaction would suppress repeated, rapid GABAergic inhibition. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.
Fedele, Laura; Newcombe, Joseph; Topf, Maya; Gibb, Alasdair; Harvey, Robert J; Smart, Trevor G
2018-03-06
Genetic and bioinformatic analyses have identified missense mutations in GRIN2B encoding the NMDA receptor GluN2B subunit in autism, intellectual disability, Lennox Gastaut and West Syndromes. Here, we investigated several such mutations using a near-complete, hybrid 3D model of the human NMDAR and studied their consequences with kinetic modelling and electrophysiology. The mutants revealed reductions in glutamate potency; increased receptor desensitisation; and ablation of voltage-dependent Mg 2+ block. In addition, we provide new views on Mg 2+ and NMDA channel blocker binding sites. We demonstrate that these mutants have significant impact on excitatory transmission in developing neurons, revealing profound changes that could underlie their associated neurological disorders. Of note, the NMDAR channel mutant GluN2B V618G unusually allowed Mg 2+ permeation, whereas nearby N615I reduced Ca 2+ permeability. By identifying the binding site for an NMDAR antagonist that is used in the clinic to rescue gain-of-function phenotypes, we show that drug binding may be modified by some GluN2B disease-causing mutations.
Zhang, Xi
2016-12-01
Neurotransmitter ligand-gated ion channels (LGICs) are widespread and pivotal in brain functions. Unveiling their structure-function mechanisms is crucial to drive drug discovery, and demands robust proteomic quantitation of expression, post-translational modifications (PTMs) and dynamic structures. Yet unbiased digestion of these modified transmembrane proteins-at high efficiency and peptide reproducibility-poses the obstacle. Targeting both enzyme-substrate contacts and PTMs for peptide formation and detection, we devised flow-and-detergent-facilitated protease and de-PTM digestions for deep sequencing (FDD) method that combined omni-compatible detergent, tandem immobilized protease/PNGase columns, and Cys-selective reduction/alkylation, to achieve streamlined ultradeep peptide preparation within minutes not days, at high peptide reproducibility and low abundance-bias. FDD transformed enzyme-protein contacts into equal catalytic travel paths through enzyme-excessive columns regardless of protein abundance, removed products instantly preventing inhibition, tackled intricate structures via sequential multiple micro-digestions along the flow, and precisely controlled peptide formation by flow rate. Peptide-stage reactions reduced steric bias; low contamination deepened MS/MS scan; distinguishing disulfide from M oxidation and avoiding gain/loss artifacts unmasked protein-endogenous oxidation states. Using a recent interactome of 285-kDa human GABA type A receptor, this pilot study validated FDD platform's applicability to deep sequencing (up to 99% coverage), H/D-exchange and TMT-based structural mapping. FDD discovered novel subunit-specific PTM signatures, including unusual nontop-surface N-glycosylations, that may drive subunit biases in human Cys-loop LGIC assembly and pharmacology, by redefining subunit/ligand interfaces and connecting function domains. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Zhang, Yueliang; Han, Yangchun; Yang, Qiong; Wang, Lihua; He, Peng; Liu, Zewen; Li, Zhong; Guo, Huifang; Fang, Jichao
2018-04-01
Cycloxaprid is a new oxabridged cis-configuration neonicotinoid insecticide, the resistance development potential and underlying resistance mechanism of which were investigated in the small brown planthopper, Laodelphax striatellus (Fallén), an important agricultural pest of rice. A cycloxaprid-resistant strain (YN-CPD) only achieved 10-fold higher resistance, in contrast to 106-fold higher resistance to buprofezin and 332-fold higher resistance to chlorpyrifos achieved after exposure to similar selection pressure, and the cycloxaprid selected line showed no cross-resistance to the buprofezin and chlorpyrifos-selected resistance strains. Moreover, we identified 10 nicotinic acetylcholine receptor (nAChR) subunits from the transcriptome of L. striatellus, and six segments had open reading frames (ORFs). While we did not find mutations in the nAChR genes of L. striatellus, subunits Lsα1 and Lsβ1 exhibited, respectively, 9.60-fold and 3.36-fold higher expression in the resistant strain, while Lsα8 exhibited 0.44-fold lower expression. Suppression of Lsα1 through ingestion of dsLsα1 led to an increase in susceptibility to cycloxaprid. The findings indicate that resistance to cycloxaprid develops slowly compared with resistance to other chemicals and without cross-resistance to chlorpyrifos or buprofezin; over-expressed Lsα1 is associated with low cycloxaprid resistance levels, but the importance of over-expressed Lsβ1 and reduced expression of Lsα8 could not be excluded. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Bloch, Yehudi; Bouchareychas, Laura; Merceron, Romain; Składanowska, Katarzyna; Van den Bossche, Lien; Detry, Sammy; Govindarajan, Srinath; Elewaut, Dirk; Haerynck, Filomeen; Dullaers, Melissa; Adamopoulos, Iannis E; Savvides, Savvas N
2018-01-16
Interleukin-23 (IL-23), an IL-12 family cytokine, plays pivotal roles in pro-inflammatory T helper 17 cell responses linked to autoimmune and inflammatory diseases. Despite intense therapeutic targeting, structural and mechanistic insights into receptor complexes mediated by IL-23, and by IL-12 family members in general, have remained elusive. We determined a crystal structure of human IL-23 in complex with its cognate receptor, IL-23R, and revealed that IL-23R bound to IL-23 exclusively via its N-terminal immunoglobulin domain. The structural and functional hotspot of this interaction partially restructured the helical IL-23p19 subunit of IL-23 and restrained its IL-12p40 subunit to cooperatively bind the shared receptor IL-12Rβ1 with high affinity. Together with structural insights from the interaction of IL-23 with the inhibitory antibody briakinumab and by leveraging additional IL-23:antibody complexes, we propose a mechanistic paradigm for IL-23 and IL-12 whereby cognate receptor binding to the helical cytokine subunits primes recruitment of the shared receptors via the IL-12p40 subunit. Copyright © 2017 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Glukhova, O. E.; Prytkova, T. R.; Shmygin, D. S.
2016-03-01
Nicotinic acetylcholine receptors (nAChRs) are neuron receptor proteins that provide a transmission of nerve impulse through the synapses. They are composed of a pentametric assembly of five homologous subunits (5 α7 subunits for α7nAChR, for example), oriented around the central pore. These receptors might be found in the chemical synapses of central and peripheral nervous system, and also in the neuromuscular synapses. Transmembrane domain of the one of such receptors constitutes ion channel. The conductive properties of ion channel strongly depend on the receptor conformation changes in the response of binding with some molecule, f.e. acetylcholine. Investigation of interaction between ligands and acetylcholine receptor is important for drug design. In this work we investigate theoretically the interaction between the set of different ligands (such as vanillin, thymoquinone, etc.) and the nicotinic acetylcholine receptor (primarily with subunit of the α7nAChR) by different methods and packages (AutodockVina, GROMACS, KVAZAR, HARLEM, VMD). We calculate interaction energy between different ligands in the subunit using molecular dynamics. On the base of obtained calculation results and using molecular docking we found an optimal location of different ligands in the subunit.
O'Neill, Patrick R; Karunarathne, W K Ajith; Kalyanaraman, Vani; Silvius, John R; Gautam, N
2012-12-18
Activation of G-protein heterotrimers by receptors at the plasma membrane stimulates βγ-complex dissociation from the α-subunit and translocation to internal membranes. This intermembrane movement of lipid-modified proteins is a fundamental but poorly understood feature of cell signaling. The differential translocation of G-protein βγ-subunit types provides a valuable experimental model to examine the movement of signaling proteins between membranes in a living cell. We used live cell imaging, mathematical modeling, and in vitro measurements of lipidated fluorescent peptide dissociation from vesicles to determine the mechanistic basis of the intermembrane movement and identify the interactions responsible for differential translocation kinetics in this family of evolutionarily conserved proteins. We found that the reversible translocation is mediated by the limited affinity of the βγ-subunits for membranes. The differential kinetics of the βγ-subunit types are determined by variations among a set of basic and hydrophobic residues in the γ-subunit types. G-protein signaling thus leverages the wide variation in membrane dissociation rates among different γ-subunit types to differentially control βγ-translocation kinetics in response to receptor activation. The conservation of primary structures of γ-subunits across mammalian species suggests that there can be evolutionary selection for primary structures that confer specific membrane-binding affinities and consequent rates of intermembrane movement.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chi, Seung-Wook; Lee, Si-Hyung; Kim, Do-Hyoung
2005-12-30
{alpha}-Conotoxin PIA is a novel nicotinic acetylcholine receptor (nAChR) antagonist isolated from Conus purpurascens that targets nAChR subtypes containing {alpha}6 and {alpha}3 subunits. {alpha}-conotoxin PIA displays 75-fold higher affinity for rat {alpha}6/{alpha}3{beta}2{beta}3 nAChRs than for rat {alpha}3{beta}2 nAChRs. We have determined the three-dimensional structure of {alpha}-conotoxin PIA by nuclear magnetic resonance spectroscopy. The {alpha}-conotoxin PIA has an '{omega}-shaped' overall topology as other {alpha}4/7 subfamily conotoxins. Yet, unlike other neuronally targeted {alpha}4/7-conotoxins, its N-terminal tail Arg{sup 1}-Asp{sup 2}-Pro{sup 3} protrudes out of its main molecular body because Asp{sup 2}-Pro{sup 3}-Cys{sup 4}-Cys{sup 5} forms a stable type I {beta}-turn. In addition, amore » kink introduced by Pro{sup 15} in the second loop of this toxin provides a distinct steric and electrostatic environment from those in {alpha}-conotoxins MII and GIC. By comparing the structure of {alpha}-conotoxin PIA with other functionally related {alpha}-conotoxins we suggest structural features in {alpha}-conotoxin PIA that may be associated with its unique receptor recognition profile.« less
Hou, Wenjie; Liu, Qiulei; Tian, Lixia; Wu, Qingjun; Zhang, Youjun; Xie, Wen; Wang, Shaoli; Miguel, Keri San; Funderburk, Joe; Scott, Jeffrey G
2014-05-01
Insects evolve resistance which constrains the sustainable use of insecticides. Spinosyns, a class of environmentally-friendly macrolide insecticides, is not an exception. The mode of inheritance and the mechanisms of resistance to spinosad (the most common spinosyn insecticide) in Frankliniella occidentalis (Western flower thrips, WFT) were investigated in this study. Resistance (170,000-fold) was autosomal and completely recessive. Recent studies showed that deletion of the nicotinic acetylcholine receptor α6 subunit gene resulted in strains of Drosophila melanogaster, Plutella xylostella and Bactrocera dorsalis that are resistant to spinosad, indicating that nAChRα6 subunit maybe important for the toxic action of this insecticide. Conversely, a G275E mutation of this subunit in F. occidentalis was recently proposed as the mechanism of resistance to spinosad. We cloned and characterized nAChRα6 from three susceptible and two spinosad resistant strains from China and the USA. The Foα6 cDNA is 1873bp and the open reading frame is 1458bp which encodes 485 amino acid residues with a predicted molecular weight of 53.5-kDa, the 5' and 3' UTRs are 121 and 294bp, respectively. There was no difference in the cDNA sequence between the resistant and susceptible thrips, suggesting the G275E mutation does not confer resistance in these populations. Ten isoforms of Foα6, arising from alternative splicing, were isolated and did not differ between the spinosad-susceptible and resistant strains. Quantitative real time PCR analysis showed Foα6 was highly expressed in the first instar larva, pupa and adult, and the expression levels were 3.67, 2.47, 1.38 times that of the second instar larva. The expression level was not significantly different between the susceptible and resistant strains. These results indicate that Foα6 is not involved in resistance to spinosad in F. occidentalis from China and the USA. Copyright © 2014 Elsevier Inc. All rights reserved.
Copper coordination in the Glycine receptor by electron spin resonance
NASA Astrophysics Data System (ADS)
Ruthstein, Sharon; Stone, Katherine; Cascio, Michael; Saxena, Sunil
2009-03-01
We describe the use of Electron Spin Resonance (ESR) to identify the coordination environment of copper in the extracellular domain of the protein, as well as the number of copper atoms that bind to Glycine receptor (GlyR). The GlyR channel mediates inhibitory neurotransmission in the central nervous system. It belongs to the superfamily of nicotincoid receptors. These receptors are formed by pentameric arrangement of subunits, each sharing a common topology having a large extracellular domain (ECD) and a transmembrane (TM) domain comprised of four membrane-spanning segments (TM1-TM4). For GlyR, four subunits (1-4) and one subunit have been identified to date, although the homomeric expression of just the α1 subunit of GlyR is sufficient to reconstitute native-like activity. The results are expected to shed light on the role of metals ion in modulating ion permeation in such receptor. In addition, an identification of copper binding sites will allow the measurement of large range distance constraints in the receptor by pulsed ESR. Such structural information on the GlyR in various allosteric states is essential in order to shed light on the gating mechanism of this protein membrane.
Cercato, Magali C; Vázquez, Cecilia A; Kornisiuk, Edgar; Aguirre, Alejandra I; Colettis, Natalia; Snitcofsky, Marina; Jerusalinsky, Diana A; Baez, María V
2016-01-01
It is widely accepted that NMDA receptors (NMDAR) are required for learning and memory formation, and for synaptic plasticity induction. We have previously shown that hippocampal GluN1 and GluN2A NMDAR subunits significantly increased following habituation of rats to an open field (OF), while GluN2B remained unchanged. Similar results were obtained after CA1-long-term potentiation (LTP) induction in rat hippocampal slices. Other studies have also shown NMDAR up regulation at earlier and later time points after LTP induction or learning acquisition. In this work, we have studied NMDAR subunits levels in the hippocampus and prefrontal cortex (PFC) after OF habituation and after object recognition (OR), to find out whether rising of NMDAR subunits is a general and structure-specific feature during memory formation. In 1, 2 and 3 month old rats there was an increase in hippocampal GluN1 and GluN2A, but not in GluN2B levels 70 min after OF habituation. This rise overlaps with early phase of memory consolidation, suggesting a putative relationship between them. The increases fell down to control levels 90 min after training. Similar results were obtained in the hippocampus of adult rats 70 min after OR training, without changes in PFC. Following OF test or OR discrimination phase, NMDAR subunits remained unchanged. Hence, rising of hippocampal GluN1 and GluN2A appears to be a general feature after novel "spatial/discrimination" memory acquisition. To start investigating the dynamics and possible mechanisms of these changes, we have studied hippocampal neuron cultures stimulated by KCl to induce plasticity. GluN1 and GluN2A increased both in dendrites and neuronal bodies, reaching a maximum 75 min later and returning to control levels at 90 min. Translation and/or transcription and mobilization differentially contribute to this rise in subunits in bodies and dendrites. Our results showed that the NMDAR subunits increase follows a similar time course both in vitro and in
Kadurin, Ivan; Rothwell, Simon W.; Lana, Beatrice; Nieto-Rostro, Manuela; Dolphin, Annette C.
2017-01-01
Voltage-gated Ca2+ (CaV) channels consist of a pore-forming α1 subunit, which determines the main functional and pharmacological attributes of the channel. The CaV1 and CaV2 channels are associated with auxiliary β- and α2δ-subunits. The molecular mechanisms involved in α2δ subunit trafficking, and the effect of α2δ subunits on trafficking calcium channel complexes remain poorly understood. Here we show that α2δ-1 is a ligand for the Low Density Lipoprotein (LDL) Receptor-related Protein-1 (LRP1), a multifunctional receptor which mediates trafficking of cargoes. This interaction with LRP1 is direct, and is modulated by the LRP chaperone, Receptor-Associated Protein (RAP). LRP1 regulates α2δ binding to gabapentin, and influences calcium channel trafficking and function. Whereas LRP1 alone reduces α2δ-1 trafficking to the cell-surface, the LRP1/RAP combination enhances mature glycosylation, proteolytic processing and cell-surface expression of α2δ-1, and also increase plasma-membrane expression and function of CaV2.2 when co-expressed with α2δ-1. Furthermore RAP alone produced a small increase in cell-surface expression of CaV2.2, α2δ-1 and the associated calcium currents. It is likely to be interacting with an endogenous member of the LDL receptor family to have these effects. Our findings now provide a key insight and new tools to investigate the trafficking of calcium channel α2δ subunits. PMID:28256585
Protective Effect of Resveratrol on the Brain in a Rat Model of Epilepsy.
Li, Zhen; You, Zhuyan; Li, Min; Pang, Liang; Cheng, Juan; Wang, Liecheng
2017-06-01
Accumulating evidence has suggested resveratrol as a promising drug candidate for the treatment of epilepsy. To validate this, we tested the protective effect of resveratrol on a kainic acid (KA)-induced epilepsy model in rats and investigated the underlying mechanism. We found that acute resveratrol application partially inhibited evoked epileptiform discharges in the hippocampal CA1 region. During acute, silent and chronic phases of epilepsy, the expression of hippocampal kainate glutamate receptor (GluK2) and the GABA A receptor alpha1 subunit (GABA A R-alpha1) was up-regulated and down-regulated, respectively. Resveratrol reversed these effects and induced an antiepileptic effect. Furthermore, in the chronic phase, resveratrol treatment inhibited the KA-induced increased glutamate/GABA ratio in the hippocampus. The antiepileptic effects of resveratrol may be partially attributed to the reduction of glutamate-induced excitotoxicity and the enhancement in GABAergic inhibition.
Herguedas, Beatriz; Krieger, James; Greger, Ingo H
2013-01-01
The composition and spatial arrangement of subunits in ion channels are essential for their function. Diverse stoichiometries are possible in a multitude of channels. These depend upon cell type-specific subunit expression, which can be tuned in a developmentally regulated manner and in response to activity, on subunit stability in the endoplasmic reticulum, intersubunit affinities, and potentially subunit diffusion within the ER membrane. In concert, these parameters shape channel biogenesis and ultimately tune cellular response properties. The complexity of this assembly process is particularly well illustrated by the ionotropic glutamate receptors, the main mediators of excitatory neurotransmission. These tetrameric cation channels predominantly assemble into heteromers, which is "obligatory" for some iGluR subfamilies but "preferential" for others. Here, we discuss recent insights into the rules underlying these two pathways, the role of individual domains based on an ever increasing list of crystal structures, and how these assembly parameters tune assembly across diverse receptor oligomers. Copyright © 2013 Elsevier Inc. All rights reserved.
Volkmann, Robert A; Fanger, Christopher M; Anderson, David R; Sirivolu, Venkata Ramana; Paschetto, Kathy; Gordon, Earl; Virginio, Caterina; Gleyzes, Melanie; Buisson, Bruno; Steidl, Esther; Mierau, Susanna B; Fagiolini, Michela; Menniti, Frank S
2016-01-01
GluN2A is the most abundant of the GluN2 NMDA receptor subunits in the mammalian CNS. Physiological and genetic evidence implicate GluN2A-containing receptors in susceptibility to autism, schizophrenia, childhood epilepsy and neurodevelopmental disorders such as Rett Syndrome. However, GluN2A-selective pharmacological probes to explore the therapeutic potential of targeting these receptors have been lacking. Here we disclose a novel series of pyrazine-containing GluN2A antagonists exemplified by MPX-004 (5-(((3-chloro-4-fluorophenyl)sulfonamido)methyl)-N-((2-methylthiazol-5-yl)methyl)pyrazine-2-carboxamide) and MPX-007 (5-(((3-fluoro-4-fluorophenyl)sulfonamido)methyl)-N-((2-methylthiazol-5-yl)methyl)methylpyrazine-2-carboxamide). MPX-004 and MPX-007 inhibit GluN2A-containing NMDA receptors expressed in HEK cells with IC50s of 79 nM and 27 nM, respectively. In contrast, at concentrations that completely inhibited GluN2A activity these compounds have no inhibitory effect on GluN2B or GluN2D receptor-mediated responses in similar HEK cell-based assays. Potency and selectivity were confirmed in electrophysiology assays in Xenopus oocytes expressing GluN2A-D receptor subtypes. Maximal concentrations of MPX-004 and MPX-007 inhibited ~30% of the whole-cell current in rat pyramidal neurons in primary culture and MPX-004 inhibited ~60% of the total NMDA receptor-mediated EPSP in rat hippocampal slices. GluN2A-selectivity at native receptors was confirmed by the finding that MPX-004 had no inhibitory effect on NMDA receptor mediated synaptic currents in cortical slices from GRIN2A knock out mice. Thus, MPX-004 and MPX-007 offer highly selective pharmacological tools to probe GluN2A physiology and involvement in neuropsychiatric and developmental disorders.
Molecular structure of P2X receptors.
Egan, Terrance M; Cox, Jane A; Voigt, Mark M
2004-01-01
P2X receptors are ligand-gated ion channels that transduce many of the physiological effects of extracellular ATP. There has been a dramatic increase in awareness of these receptors over the past 5 or so years, in great part due to their molecular cloning and characterization. The availability of cDNA clones for the various subunits has led to rapid progress in identifying their tissue-specific expression, resulting in new ideas concerning the functional roles these receptors might play in physiological and pathophysiological processes. In addition, molecular approaches have yielded much information regarding the structure and function of the receptor proteins themselves. In this review we seek to review recent findings concerning the molecular determinants of receptor-channel function, with particular focus on ligand binding and gating, ion selectivity, and subunit assembly.
Therapeutic potential of metabotropic glutamate receptor modulators.
Hovelsø, N; Sotty, F; Montezinho, L P; Pinheiro, P S; Herrik, K F; Mørk, A
2012-03-01
Glutamate is the main excitatory neurotransmitter in the central nervous system (CNS) and is a major player in complex brain functions. Glutamatergic transmission is primarily mediated by ionotropic glutamate receptors, which include NMDA, AMPA and kainate receptors. However, glutamate exerts modulatory actions through a family of metabotropic G-protein-coupled glutamate receptors (mGluRs). Dysfunctions of glutamatergic neurotransmission have been implicated in the etiology of several diseases. Therefore, pharmacological modulation of ionotropic glutamate receptors has been widely investigated as a potential therapeutic strategy for the treatment of several disorders associated with glutamatergic dysfunction. However, blockade of ionotropic glutamate receptors might be accompanied by severe side effects due to their vital role in many important physiological functions. A different strategy aimed at pharmacologically interfering with mGluR function has recently gained interest. Many subtype selective agonists and antagonists have been identified and widely used in preclinical studies as an attempt to elucidate the role of specific mGluRs subtypes in glutamatergic transmission. These studies have allowed linkage between specific subtypes and various physiological functions and more importantly to pathological states. This article reviews the currently available knowledge regarding the therapeutic potential of targeting mGluRs in the treatment of several CNS disorders, including schizophrenia, addiction, major depressive disorder and anxiety, Fragile X Syndrome, Parkinson's disease, Alzheimer's disease and pain.
Therapeutic Potential of Metabotropic Glutamate Receptor Modulators
Hovelsø, N; Sotty, F; Montezinho, L.P; Pinheiro, P.S; Herrik, K.F; Mørk, A
2012-01-01
Glutamate is the main excitatory neurotransmitter in the central nervous system (CNS) and is a major player in complex brain functions. Glutamatergic transmission is primarily mediated by ionotropic glutamate receptors, which include NMDA, AMPA and kainate receptors. However, glutamate exerts modulatory actions through a family of metabotropic G-protein-coupled glutamate receptors (mGluRs). Dysfunctions of glutamatergic neurotransmission have been implicated in the etiology of several diseases. Therefore, pharmacological modulation of ionotropic glutamate receptors has been widely investigated as a potential therapeutic strategy for the treatment of several disorders associated with glutamatergic dysfunction. However, blockade of ionotropic glutamate receptors might be accompanied by severe side effects due to their vital role in many important physiological functions. A different strategy aimed at pharmacologically interfering with mGluR function has recently gained interest. Many subtype selective agonists and antagonists have been identified and widely used in preclinical studies as an attempt to elucidate the role of specific mGluRs subtypes in glutamatergic transmission. These studies have allowed linkage between specific subtypes and various physiological functions and more importantly to pathological states. This article reviews the currently available knowledge regarding the therapeutic potential of targeting mGluRs in the treatment of several CNS disorders, including schizophrenia, addiction, major depressive disorder and anxiety, Fragile X Syndrome, Parkinson’s disease, Alzheimer’s disease and pain. PMID:22942876
Conformational dynamics of a G-protein α subunit is tightly regulated by nucleotide binding.
Goricanec, David; Stehle, Ralf; Egloff, Pascal; Grigoriu, Simina; Plückthun, Andreas; Wagner, Gerhard; Hagn, Franz
2016-06-28
Heterotrimeric G proteins play a pivotal role in the signal-transduction pathways initiated by G-protein-coupled receptor (GPCR) activation. Agonist-receptor binding causes GDP-to-GTP exchange and dissociation of the Gα subunit from the heterotrimeric G protein, leading to downstream signaling. Here, we studied the internal mobility of a G-protein α subunit in its apo and nucleotide-bound forms and characterized their dynamical features at multiple time scales using solution NMR, small-angle X-ray scattering, and molecular dynamics simulations. We find that binding of GTP analogs leads to a rigid and closed arrangement of the Gα subdomain, whereas the apo and GDP-bound forms are considerably more open and dynamic. Furthermore, we were able to detect two conformational states of the Gα Ras domain in slow exchange whose populations are regulated by binding to nucleotides and a GPCR. One of these conformational states, the open state, binds to the GPCR; the second conformation, the closed state, shows no interaction with the receptor. Binding to the GPCR stabilizes the open state. This study provides an in-depth analysis of the conformational landscape and the switching function of a G-protein α subunit and the influence of a GPCR in that landscape.
Conformational dynamics of a G-protein α subunit is tightly regulated by nucleotide binding
Goricanec, David; Stehle, Ralf; Egloff, Pascal; Grigoriu, Simina; Wagner, Gerhard; Hagn, Franz
2016-01-01
Heterotrimeric G proteins play a pivotal role in the signal-transduction pathways initiated by G-protein–coupled receptor (GPCR) activation. Agonist–receptor binding causes GDP-to-GTP exchange and dissociation of the Gα subunit from the heterotrimeric G protein, leading to downstream signaling. Here, we studied the internal mobility of a G-protein α subunit in its apo and nucleotide-bound forms and characterized their dynamical features at multiple time scales using solution NMR, small-angle X-ray scattering, and molecular dynamics simulations. We find that binding of GTP analogs leads to a rigid and closed arrangement of the Gα subdomain, whereas the apo and GDP-bound forms are considerably more open and dynamic. Furthermore, we were able to detect two conformational states of the Gα Ras domain in slow exchange whose populations are regulated by binding to nucleotides and a GPCR. One of these conformational states, the open state, binds to the GPCR; the second conformation, the closed state, shows no interaction with the receptor. Binding to the GPCR stabilizes the open state. This study provides an in-depth analysis of the conformational landscape and the switching function of a G-protein α subunit and the influence of a GPCR in that landscape. PMID:27298341
NMDA receptor GluN2A subunit deletion protects against dependence-like ethanol drinking.
Jury, Nicholas J; Radke, Anna K; Pati, Dipanwita; Kocharian, Adrina; Mishina, Masayoshi; Kash, Thomas L; Holmes, Andrew
2018-06-25
The N-methyl- D -aspartate receptor (NMDAR) is mechanistically involved in the behavioral and neurophysiological effects of alcohol, but the specific role of the GluN2A subunit remains unclear. Here, we exposed mice with constitutive GluN2A gene knockout (KO) to chronic intermittent ethanol vapor (CIE) and tested for EtOH consumption/preference using a two-bottle choice paradigm, as well as NMDAR-mediated transmission at basolateral amygdala synapses via ex vivo slice electrophysiology. Results showed that GluN2A KO mice attained comparable blood EtOH levels in response to CIE exposure, but did not exhibit the significant increase in EtOH drinking that was observed in CIE-exposed wildtypes. GluN2A KO mice also showed no alterations in BLA NMDAR-mediated synaptic transmission after CIE, relative to air-exposed, whereas C57BL/6 J mice showed an attenuated synaptic response to GluN2B antagonism. Taken together, these data add to mounting evidence supporting GluN2A-containing NMDARs as a mechanism underlying relative risk for developing EtOH dependence after repeated EtOH exposure. Copyright © 2018. Published by Elsevier B.V.
Yang, Mei; Omura, Satoshi; Bonifacino, Juan S.; Weissman, Allan M.
1998-01-01
Expression of the T cell antigen receptor (TCR) on the surface of thymocytes and mature T cells is dependent on the assembly of receptor subunits into TCRs in the endoplasmic reticulum (ER) and their successful traversal of the secretory pathway to the plasma membrane. TCR subunits that fail to exit the ER for the Golgi complex are degraded by nonlysosomal processes that have been referred to as “ER degradation”. The molecular basis for the loss of the TCR CD3-δ and TCR-α subunits from the ER was investigated in lymphocytes. For CD3-δ, we describe a process leading to its degradation that includes trimming of mannose residues from asparagine-linked (N-linked) oligosaccharides, generation of ubiquitinated membrane-bound intermediates, and proteasome-dependent removal from the ER membrane. When either mannosidase activity or the catalytic activity of proteasomes was inhibited, loss of CD3-δ was markedly curtailed and CD3-δ remained membrane bound in a complex with CD3-ε. TCR-α was also found to be degraded in a proteasome-dependent manner with ubiquitinated intermediates. However, no evidence of a role for mannosidases was found for TCR-α, and significant retrograde movement through the ER membrane took place even when proteasome function was inhibited. These findings provide new insights into mechanisms employed to regulate levels of TCRs, and underscore that cells use multiple mechanisms to target proteins from the ER to the cytosol for degradation. PMID:9500786
Schmidt, K F; Kruse, M; Hatt, H
1994-01-01
The patch-clamp technique in combination with a fast liquid filament application system was used to study the effect of dopamine on the glutamate receptor desensitization in horizontal cells of the perch (Perca fluviatilis). Kinetics of ligand-gated ion channels in fish horizontal cells are modulated by dopamine. This modulation is presumably mediated by a cAMP-dependent protein phosphorylation. Before incubation with dopamine, the glutamate receptors of horizontal cells activate and desensitize with fast time constants. In the whole-cell recording mode, fast application of the agonists L-glutamate, quisqualate, or alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid prior to the dopamine incubation gives rise to fast transient currents with peak values of about 200 pA that desensitize within 100 ms. Kainate as agonist produced higher steady-state currents but no transient currents. After incubation of the cells with dopamine for 3 min, the desensitization was significantly reduced and the agonists L-glutamate, quisqualate, or alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid induced steady-state currents with amplitudes that were similar to the previously observed transient currents. Kainate-induced currents were only slightly affected. Fast desensitizing currents upon fast application of L-glutamate were also recorded from outside-out patches that were excised from horizontal cells before incubation with dopamine. The currents from excised patches desensitized to a steady-state level of about 0.2 of the peak amplitude with time constants of less than 2 ms. When the outside-out patches were excised from cells after dopamine incubation, steady-state currents were enhanced and no transient currents were observed. The results may indicate that the dopamine-dependent modulation of glutamate-induced currents, which is presumably mediated by a protein phosphorylation, is due to an alteration of the desensitization of the glutamate receptors. PMID:7520178
Üner, Aykut; Gonçalves, Gabriel H M; Li, Wenjing; Porceban, Matheus; Caron, Nicole; Schönke, Milena; Delpire, Eric; Sakimura, Kenji; Bjørbæk, Christian
2015-10-01
Hypothalamic agouti-related peptide (AgRP) and pro-opiomelanocortin (POMC) expressing neurons play critical roles in control of energy balance. Glutamatergic input via n-methyl-d-aspartate receptors (NMDARs) is pivotal for regulation of neuronal activity and is required in AgRP neurons for normal body weight homeostasis. NMDARs typically consist of the obligatory GluN1 subunit and different GluN2 subunits, the latter exerting crucial differential effects on channel activity and neuronal function. Currently, the role of specific GluN2 subunits in AgRP and POMC neurons on whole body energy and glucose balance is unknown. We used the cre-lox system to genetically delete GluN2A or GluN2B only from AgRP or POMC neurons in mice. Mice were then subjected to metabolic analyses and assessment of AgRP and POMC neuronal function through morphological studies. We show that loss of GluN2B from AgRP neurons reduces body weight, fat mass, and food intake, whereas GluN2B in POMC neurons is not required for normal energy balance control. GluN2A subunits in either AgRP or POMC neurons are not required for regulation of body weight. Deletion of GluN2B reduces the number of AgRP neurons and decreases their dendritic length. In addition, loss of GluN2B in AgRP neurons of the morbidly obese and severely diabetic leptin-deficient Lep (ob/ob) mice does not affect body weight and food intake but, remarkably, leads to full correction of hyperglycemia. Lep (ob/ob) mice lacking GluN2B in AgRP neurons are also more sensitive to leptin's anti-obesity actions. GluN2B-containing NMDA receptors in AgRP neurons play a critical role in central control of body weight homeostasis and blood glucose balance via mechanisms that likely involve regulation of AgRP neuronal survival and structure, and modulation of hypothalamic leptin action.
Papadimitriou, G N; Dikeos, D G; Karadima, G; Avramopoulos, D; Daskalopoulou, E G; Stefanis, C N
2001-05-08
There is accumulated evidence that the genes coding for the receptor of gamma aminobutyric acid (GABA), the most important inhibitory neurotransmitter in the CNS, may be involved in the pathogenesis of affective disorders. In a previous study, we have found a genetic association between the GABA-A receptor alpha5 subunit gene locus (GABRA5) on chromosome 15q11-of 13 and bipolar affective disorder. The aim of the present study was to examine the same subjects to see if there exists a genetic association between bipolar affective disorder and the GABA receptor beta3 subunit gene (GABRB3), which is located within 100 kb from GABRA5. The sample consisted of 48 bipolar patients compared to 44 controls (blood donors). All subjects were Greek, unrelated, and personally interviewed. Diagnosis was based on DSM-IV and ICD-10 criteria. The marker used was a dinucleotide (CA) repeat polymorphism with 12 alleles 179 to 201 bp long; genotyping was successful in all patients and 43 controls. The distribution of GABRB3 genotypes among the controls did not deviate significantly from the Hardy-Weinberg equilibrium. No differences in allelic frequencies between bipolar patients and controls were found for GABRB3, while this locus and GABRA5 did not seem to be in significant linkage disequilibrium. In conclusion, the GABRB3 CA-repeat polymorphism we investigated does not present the observed association between bipolar affective illness and GABRA5. This could be due to higher mutation rate in the GABRB3 CA-repeat polymorphism, but it might also signify that GABRA5 is the gene actually associated with the disease. Copyright 2001 Wiley-Liss, Inc.
Characterization of Ganglionic Acetylcholine Receptor Autoantibodies
Vernino, Steven; Lindstrom, Jon; Hopkins, Steve; Wang, Zhengbei; Low, Phillip A.
2008-01-01
In myasthenia gravis (MG), autoantibodies bind to the α1 subunit and other subunits of the muscle nicotinic acetylcholine receptor (AChR). Autoimmune autonomic ganglionopathy (AAG) is an antibody-mediated neurological disorder caused by antibodies against neuronal AChRs in autonomic ganglia. Subunits of muscle and neuronal AChR are homologous. We examined the specificity of AChR antibodies in patients with MG and AAG. Ganglionic AChR autoantibodies found in AAG patients are specific for AChRs containing the α3 subunit. Muscle and ganglionic AChR antibody specificities are distinct. Antibody crossreactivity between AChRs with different α subunits is uncommon but can occur. PMID:18485491
Mikhailov, M V; Ashcroft, S J
2000-02-04
We have investigated protein interactions involved in pancreatic beta-cell ATP-sensitive potassium channel assembly. These channels, which are of key importance for control of insulin release, are a hetero-oligomeric complex of pore-forming Kir6.2 subunits and sulfonylurea receptor (SUR1) subunits with two nucleotide-binding domains (NBD1 and NBD2). We divided SUR1 into two halves at Pro-1042. Expression of either the individual N- or C-terminal domain in a baculovirus expression system did not lead to glibenclamide binding activity, although studies with green fluorescent protein fusion proteins showed that both half-molecules were inserted into the plasma membrane. However, significant glibenclamide binding activity was observed when the half-molecules were co-expressed (even when NBD2 was deleted from the C-terminal half-molecule). Simultaneous expression of Kir6.2 resulted in enhanced glibenclamide binding activity. We conclude that the glibenclamide-binding site includes amino acid residues from both halves of the molecule, that there is strong interaction between different regions of SUR1, that NBD2 is not essential for glibenclamide binding, and that interactions between Kir6.2 and SUR1 participate in ATP-sensitive potassium channel assembly. Investigation of NBD1-green fluorescent protein fusion protein distribution inside insect cells expressing C-terminal halves of SUR1 demonstrated strong interaction between NBD1 and NBD2. We also expressed and purified NBD1 from Escherichia coli. Purified NBD1 was found to exist as a tetramer indicating strong homomeric attractions and a possible role for NBD1 in SUR1 assembly.
Different Classes of Glutamate Receptors Mediate Distinct Behaviors in a Single Brainstem Nucleus
NASA Astrophysics Data System (ADS)
Dye, John; Heiligenberg, Walter; Keller, Clifford H.; Kawasaki, Masashi
1989-11-01
We have taken advantage of the increasing understanding of glutamate neuropharmacology to probe mechanisms of well-defined vertebrate behaviors. Here we report a set of experiments that suggests distinct roles for two major classes of glutamate receptors in a discrete premotor nucleus of the brainstem. The medullary pacemaker nucleus of weakly electric fish is an endogenous oscillator that controls the electric organ discharge (EOD). Its regular frequency of firing is modulated during several distinct behaviors. The pacemaker nucleus continues firing regularly when isolated in vitro, and modulatory behaviors can be reproduced by stimulating the descending input pathway. Glutamate agonists applied to the pacemaker in vitro produced increases in frequency, while glutamate antagonists selectively blocked stimulus-induced modulations. Experiments with glutamate antagonists in the intact animal resulted in specific effects on two well-characterized behaviors. Our data indicate that these behaviors are separately mediated in the pacemaker by receptors displaying characteristics of the kainate/quisqualate and N-methyl-D-aspartate subtypes of glutamate receptor, respectively.
Ma, Cheng; Yu, Li; Yan, Li-ping
2010-12-01
To observe the effect of electroacupuncture (EA) on the expression of ionotropic glutamate receptor (iGluR) subunits and their mRNAs in the lumbar segments of spinal cord in rats with neuropathic pain, so as to explore its underlying mechanism in relieving spinal hyperalgesia. Thirty SD rats were randomly divided into control, model, and EA groups, with 10 rats in each. The spared nerve injury (SNI) model was established by ligature of the sural nerve after cutting off the common peroneal nerve and anterior tibial nerve. EA (2 Hz, 1 mA) was applied to "Huantiao" (GB 30) and "Weizhong" (BL 40) for 30 min, once daily for 7 days. Mechanical pain threshold was detected before and after modeling and before and after EA treatment. The expression levels of N-methyl-d-aspartic acid (NMDA) receptor subunits NR1 and NR 2 B,and AMPA receptor subunit GluR 1 of iGluR and their genes were assayed by Western blot and reverse transcription polymerase chain reaction (RT-PCR) separately. In comparison with control group, the mechanical pain thresholds were decreased significantly on day 2, 7 and day 14 following modeling in the model group (P < 0.05, P < 0.01). While compared with the model group, the pain threshold was increased considerably on day 14 in the EA group (P < 0.01). Compared with the control group, the expression levels of lumbar spinal cord NR 2 B and NR 2 B mRNA in the model group were increased significantly (P < 0.05), and those of lumbar spinal cord NR 1 and NR 1 mRNA, GluR 1 and GluR 1 mRNA in the model group increased slightly (P > 0.05). In comparison with the model group, the expression levels of lumbar spinal cord NR 2 B and NR 2 B mRNA in the EA group were downregulated remarkably (P < 0.05), and those of lumbar spinal cord NR 1 and NR 1 mRNA, GluR 1 and GluR 1 mRNA in the EA group down-regulated slightly (P > 0.05). EA can significantly suppress pain reaction in rats with neuropathic pain probably through down-regulating the expression of lumbar spinal cord
Eltit, Jose M; Franzini-Armstrong, Clara; Perez, Claudio F
2014-12-26
The β1a subunit is a cytoplasmic component of the dihydropyridine receptor (DHPR) complex that plays an essential role in skeletal muscle excitation-contraction (EC) coupling. Here we investigate the role of the C-terminal end of this auxiliary subunit in the functional and structural communication between the DHPR and the Ca(2+) release channel (RyR1). Progressive truncation of the β1a C terminus showed that deletion of amino acid residues Gln(489) to Trp(503) resulted in a loss of depolarization-induced Ca(2+) release, a severe reduction of L-type Ca(2+) currents, and a lack of tetrad formation as evaluated by freeze-fracture analysis. However, deletion of this domain did not affect expression/targeting or density (Qmax) of the DHPR-α1S subunit to the plasma membrane. Within this motif, triple alanine substitution of residues Leu(496), Leu(500), and Trp(503), which are thought to mediate direct β1a-RyR1 interactions, weakened EC coupling but did not replicate the truncated phenotype. Therefore, these data demonstrate that an amino acid segment encompassing sequence (489)QVQVLTSLRRNLSFW(503) of β1a contains critical determinant(s) for the physical link of DHPR and RyR1, further confirming a direct correspondence between DHPR positioning and DHPR/RyR functional interactions. In addition, our data strongly suggest that the motif Leu(496)-Leu(500)-Trp(503) within the β1a C-terminal tail plays a nonessential role in the bidirectional DHPR/RyR1 signaling that supports skeletal-type EC coupling. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Zhang, Yixi; Wang, Xin; Yang, Baojun; Hu, Yuanyuan; Huang, Lixin; Bass, Chris; Liu, Zewen
2015-11-01
Target-site resistance is commonly caused by qualitative changes in insecticide target-receptors and few studies have implicated quantitative changes in insecticide targets in resistance. Here we show that resistance to imidacloprid in a selected strain of Nilaparvata lugens is associated with a reduction in expression levels of the nicotinic acetylcholine receptor (nAChR) subunit Nlα8. Synergism bioassays of the selected strain suggested resistance was conferred, in part, by a target-site mechanism. Sequencing of N. lugens nAChR subunit genes identified no mutations associated with resistance, however, a decrease in mRNA and protein levels of Nlα8 was observed during selection. RNA interference knockdown of Nlα8 decreased the sensitivity of N. lugens to imidacloprid, demonstrating that a decrease in Nlα8 expression is sufficient to confer resistance in vivo. Radioligand binding assays revealed that the affinity of the high-affinity imidacloprid-binding site of native nAChRs was reduced by selection, and reducing the amount of Nlα8 cRNA injected into Xenopus oocytes significantly decreased imidacloprid potency on recombinant receptors. Taken together, these results provide strong evidence that a decrease in Nlα8 levels confers resistance to imidacloprid in N. lugens, and thus provides a rare example of target-site resistance associated with a quantitative rather than qualitative change. In insects, target-site mutations often cause high resistance to insecticides, such as neonicotinoids acting on nicotinic acetylcholine receptors (nAChRs). Here we found that a quantitative change in target-protein level, decrease in mRNA and protein levels of Nlα8, contributed importantly to imidacloprid resistance in Nilaparvata lugens. This finding provides a new target-site mechanism of insecticide resistance. © 2015 International Society for Neurochemistry.
Suryavanshi, P S; Ugale, R R; Yilmazer-Hanke, D; Stairs, D J; Dravid, S M
2014-01-01
Background and Purpose Despite ample evidence supporting the N-methyl-d-aspartate receptor (NMDAR) hypofunction hypothesis of schizophrenia, progress in the development of effective therapeutics based on this hypothesis has been limited. Facilitation of NMDA receptor function by co-agonists (d-serine or glycine) only partially alleviates the symptoms in schizophrenia; other means to facilitate NMDA receptors are required. NMDA receptor sub-types differ in their subunit composition, with varied GluN2 subunits (GluN2A-GluN2D) imparting different physiological, biochemical and pharmacological properties. CIQ is a positive allosteric modulator that is selective for GluN2C/GluN2D-containing NMDA receptors (Mullasseril et al.). Experimental Approach The effect of systemic administration of CIQ was tested on impairment in prepulse inhibition (PPI), hyperlocomotion and stereotypy induced by i.p. administration of MK-801 and methamphetamine. The effect of CIQ was also tested on MK-801-induced impairment in working memory in Y-maze spontaneous alternation test. Key Results We found that systemic administration of CIQ (20 mg·kg−1, i.p.) in mice reversed MK-801 (0.15 mg·kg−1, i.p.)-induced, but not methamphetamine (3 mg·kg−1, i.p.)-induced, deficit in PPI. MK-801 increased the startle amplitude to pulse alone, which was not reversed by CIQ. In contrast, methamphetamine reduced the startle amplitude to pulse alone, which was reversed by CIQ. CIQ also partially attenuated MK-801- and methamphetamine-induced hyperlocomotion and stereotyped behaviours. Additionally, CIQ reversed the MK-801-induced working memory deficit in spontaneous alternation in a Y-maze. Conclusion and Implications Together, these results suggest that facilitation of GluN2C/GluN2D-containing receptors may serve as an important therapeutic strategy for treating positive and cognitive symptoms in schizophrenia. PMID:24236947
G-protein βγ subunits are positive regulators of Kv7.4 and native vascular Kv7 channel activity.
Stott, Jennifer B; Povstyan, Oleksandr V; Carr, Georgina; Barrese, Vincenzo; Greenwood, Iain A
2015-05-19
Kv7.4 channels are a crucial determinant of arterial diameter both at rest and in response to endogenous vasodilators. However, nothing is known about the factors that ensure effective activity of these channels. We report that G-protein βγ subunits increase the amplitude and activation rate of whole-cell voltage-dependent K(+) currents sensitive to the Kv7 blocker linopirdine in HEK cells heterologously expressing Kv7.4, and in rat renal artery myocytes. In excised patch recordings, Gβγ subunits (2-250 ng /mL) enhanced the open probability of Kv7.4 channels without changing unitary conductance. Kv7 channel activity was also augmented by stimulation of G-protein-coupled receptors. Gallein, an inhibitor of Gβγ subunits, prevented these stimulatory effects. Moreover, gallein and two other structurally different Gβγ subunit inhibitors (GRK2i and a β-subunit antibody) abolished Kv7 channel currents in the absence of either Gβγ subunit enrichment or G-protein-coupled receptor stimulation. Proximity ligation assay revealed that Kv7.4 and Gβγ subunits colocalized in HEK cells and renal artery smooth muscle cells. Gallein disrupted this colocalization, contracted whole renal arteries to a similar degree as the Kv7 inhibitor linopirdine, and impaired isoproterenol-induced relaxations. Furthermore, mSIRK, which disassociates Gβγ subunits from α subunits without stimulating nucleotide exchange, relaxed precontracted arteries in a linopirdine-sensitive manner. These results reveal that Gβγ subunits are fundamental for Kv7.4 activation and crucial for vascular Kv7 channel activity, which has major consequences for the regulation of arterial tone.
G-protein βγ subunits are positive regulators of Kv7.4 and native vascular Kv7 channel activity
Stott, Jennifer B.; Povstyan, Oleksandr V.; Carr, Georgina; Barrese, Vincenzo; Greenwood, Iain A.
2015-01-01
Kv7.4 channels are a crucial determinant of arterial diameter both at rest and in response to endogenous vasodilators. However, nothing is known about the factors that ensure effective activity of these channels. We report that G-protein βγ subunits increase the amplitude and activation rate of whole-cell voltage-dependent K+ currents sensitive to the Kv7 blocker linopirdine in HEK cells heterologously expressing Kv7.4, and in rat renal artery myocytes. In excised patch recordings, Gβγ subunits (2–250 ng /mL) enhanced the open probability of Kv7.4 channels without changing unitary conductance. Kv7 channel activity was also augmented by stimulation of G-protein–coupled receptors. Gallein, an inhibitor of Gβγ subunits, prevented these stimulatory effects. Moreover, gallein and two other structurally different Gβγ subunit inhibitors (GRK2i and a β-subunit antibody) abolished Kv7 channel currents in the absence of either Gβγ subunit enrichment or G-protein–coupled receptor stimulation. Proximity ligation assay revealed that Kv7.4 and Gβγ subunits colocalized in HEK cells and renal artery smooth muscle cells. Gallein disrupted this colocalization, contracted whole renal arteries to a similar degree as the Kv7 inhibitor linopirdine, and impaired isoproterenol-induced relaxations. Furthermore, mSIRK, which disassociates Gβγ subunits from α subunits without stimulating nucleotide exchange, relaxed precontracted arteries in a linopirdine-sensitive manner. These results reveal that Gβγ subunits are fundamental for Kv7.4 activation and crucial for vascular Kv7 channel activity, which has major consequences for the regulation of arterial tone. PMID:25941381
Pradhan, Subhashree; Khatlani, Tanvir; Nairn, Angus C; Vijayan, K Vinod
2017-08-11
Thrombosis is caused by the activation of platelets at the site of ruptured atherosclerotic plaques. This activation involves engagement of G protein-coupled receptors (GPCR) on platelets that promote their aggregation. Although it is known that protein kinases and phosphatases modulate GPCR signaling, how serine/threonine phosphatases integrate with G protein signaling pathways is less understood. Because the subcellular localization and substrate specificity of the catalytic subunit of protein phosphatase 1 (PP1c) is dictated by PP1c-interacting proteins, here we sought to identify new PP1c interactors. GPCRs signal via the canonical heterotrimeric Gα and Gβγ subunits. Using a yeast two-hybrid screen, we discovered an interaction between PP1cα and the heterotrimeric G protein Gβ 1 subunit. Co-immunoprecipitation studies with epitope-tagged PP1c and Gβ 1 revealed that Gβ 1 interacts with the PP1c α, β, and γ1 isoforms. Purified PP1c bound to recombinant Gβ 1 -GST protein, and PP1c co-immunoprecipitated with Gβ 1 in unstimulated platelets. Thrombin stimulation of platelets induced the dissociation of the PP1c-Gβ 1 complex, which correlated with an association of PP1c with phospholipase C β3 (PLCβ3), along with a concomitant dephosphorylation of the inhibitory Ser 1105 residue in PLCβ3. siRNA-mediated depletion of GNB1 (encoding Gβ 1 ) in murine megakaryocytes reduced protease-activated receptor 4, activating peptide-induced soluble fibrinogen binding. Thrombin-induced aggregation was decreased in PP1cα -/- murine platelets and in human platelets treated with a small-molecule inhibitor of Gβγ. Finally, disruption of PP1c-Gβ 1 complexes with myristoylated Gβ 1 peptides containing the PP1c binding site moderately decreased thrombin-induced human platelet aggregation. These findings suggest that Gβ 1 protein enlists PP1c to modulate GPCR signaling in platelets.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Loo, P.; Braunwalder, A.; Lehmann, J.
PCP and other dissociative anesthetica block the increase in neuronal firing rate evoked by the EAAR agonist, N-methyl-Daspartate. NMDA and other EAAs such as glutamate (glu) have not been previously shown to affect PCP ligand binding. In the present study, using once washed rat forebrain membranes, 10 ..mu..M-glu was found to increase the binding of (/sup 3/H)TCP, a PCP analog, to defined PCP recognition sites by 20%. Removal of glu and aspartate (asp) by extensive washing decreased TCP binding by 75-90%. In these membranes, 10 ..mu..M L-glu increased TCP binding 3-fold. This effect was stereospecific and evoked by other EAAsmore » with the order of activity, L-glu > D-asp > L- asp > NMDA > D-glu > quisqualate. Kainate, GABA, NE, DA, 5-HT, 2-chloroadenosine, oxotremorine and histamine had no effect on TCP binding at concentrations up to 100 ..mu..M. The effects of L-glu were attenuated by the NMDA-type receptor antagonist, 2-amino-7--phosphonoheptanoate (AP7; 10 ..mu..M-1 mM). These findings indicate that EAAS facilitate TCP binding, possibly through NMDA-type receptors. The observed interaction between the PCP receptor and EAARs may reflect the existence of a macromolecular receptor complex similar to that demonstrated for the benzodiazepines and GABA.« less
Three homologous subunits form a high affinity peptide-gated ion channel in Hydra.
Dürrnagel, Stefan; Kuhn, Anne; Tsiairis, Charisios D; Williamson, Michael; Kalbacher, Hubert; Grimmelikhuijzen, Cornelis J P; Holstein, Thomas W; Gründer, Stefan
2010-04-16
Recently, three ion channel subunits of the degenerin (DEG)/epithelial Na(+) channel (ENaC) gene family have been cloned from the freshwater polyp Hydra magnipapillata, the Hydra Na(+) channels (HyNaCs) 2-4. Two of them, HyNaC2 and HyNaC3, co-assemble to form an ion channel that is gated by the neuropeptides Hydra-RFamides I and II. The HyNaC2/3 channel is so far the only cloned ionotropic receptor from cnidarians and, together with the related ionotropic receptor FMRFamide-activated Na(+) channel (FaNaC) from snails, the only known peptide-gated ionotropic receptor. The HyNaC2/3 channel has pore properties, like a low Na(+) selectivity and a low amiloride affinity, that are different from other channels of the DEG/ENaC gene family, suggesting that a component of the native Hydra channel might still be lacking. Here, we report the cloning of a new ion channel subunit from Hydra, HyNaC5. The new subunit is closely related to HyNaC2 and -3 and co-localizes with HyNaC2 and -3 to the base of the tentacles. Coexpression in Xenopus oocytes of HyNaC5 with HyNaC2 and -3 largely increases current amplitude after peptide stimulation and affinity of the channel to Hydra-RFamides I and II. Moreover, the HyNaC2/3/5 channel has altered pore properties and amiloride affinity, more similarly to other DEG/ENaC channels. Collectively, our results suggest that the three homologous subunits HyNaC2, -3, and -5 form a peptide-gated ion channel in Hydra that could contribute to fast synaptic transmission.
Ishikawa, Chihiro; Shiga, Takashi
2017-08-01
Serotonin (5-HT) and the 5-HT 1A receptor during development are known to modulate anxiety and depression in later life. However, the brain mechanisms linking the postnatal 5-HT system and adult behavior remain unknown. Here, we examined the effects of pharmacological 5-HT 1A receptor activation during the postnatal period on anxiety and depression-like behavior in adult BALB/c male mice. To elucidate the underlying mechanisms, we measured mRNA expression of the 5-HT 1A receptor, brain-derived neurotrophic factor (BDNF), GABA A receptor subunits, and AMPA receptor subunits in the medial prefrontal cortex (mPFC), amygdala, and hippocampus. Treatment with the selective 5-HT reuptake inhibitor (fluoxetine) and 5-HT 1A receptor agonist (8-OH-DPAT) during the postnatal period decreased anxiety-like behavior in adulthood, whereas only 8-OH-DPAT treatment increased depression-like behavior. Concomitantly with the behavioral effects, postnatal treatment with fluoxetine and 8-OH-DPAT decreased the mRNA expression of the GABA A receptor α3 subunit in the mPFC and ventral hippocampus in adulthood, while 8-OH-DPAT, but not fluoxetine, decreased the mRNA expression of the 5-HT 1A receptor and BDNF in the mPFC and the GABA A receptor α2 subunit in the mPFC and ventral hippocampus. On the basis of the correlative changes between behavior and mRNA expression, these results suggest that the GABA A receptor α3 subunit in the mPFC and ventral hippocampus may regulate anxiety-like behavior. In contrast, depression-like behavior may be regulated by the 5-HT 1A receptor and BDNF in the mPFC and by the GABA A receptor α2 subunit in the mPFC and ventral hippocampus. In summary, activation of the 5-HT 1A receptor during the postnatal period may reduce anxiety levels, but increase depression levels during adulthood via different multiple molecules in the mPFC and ventral hippocampus. Copyright © 2017 Elsevier Inc. All rights reserved.
Zhou, Chengwen; Sun, Hongyu; Klein, Peter M.; Jensen, Frances E.
2015-01-01
Neonatal seizures are commonly caused by hypoxic and/or ischemic injury during birth and can lead to long-term epilepsy and cognitive deficits. In a rodent hypoxic seizure (HS) model, we have previously demonstrated a critical role for seizure-induced enhancement of the AMPA subtype of glutamate receptor (GluA) in epileptogenesis and cognitive consequences, in part due to GluA maturational upregulation of expression. Similarly, as the expression and function of the N-Methyl-D-aspartate (NMDA) subtype of glutamate receptor (GluN) is also developmentally controlled, we examined how early life seizures during the critical period of synaptogenesis could modify GluN development and function. In a postnatal day (P)10 rat model of neonatal seizures, we found that seizures could alter GluN2/3 subunit composition of GluNs and physiological function of synaptic GluNs. In hippocampal slices removed from rats within 48–96 h following seizures, the amplitudes of synaptic GluN-mediated evoked excitatory postsynaptic currents (eEPSCs) were elevated in CA1 pyramidal neurons. Moreover, GluN eEPSCs showed a decreased sensitivity to GluN2B selective antagonists and decreased Mg2+ sensitivity at negative holding potentials, indicating a higher proportion of GluN2A and GluN3A subunit function, respectively. These physiological findings were accompanied by a concurrent increase in GluN2A phosphorylation and GluN3A protein. These results suggest that altered GluN function and expression could potentially contribute to future epileptogenesis following neonatal seizures, and may represent potential therapeutic targets for the blockade of future epileptogenesis in the developing brain. PMID:26441533
Xi, Dong; Zhang, Wentong; Wang, Huai-Xing; Stradtman, George G; Gao, Wen-Jun
2009-11-01
N-methyl-D-aspartic acid receptor (NMDAR) hypofunction has long been implicated in schizophrenia and NMDARs on gamma-aminobutyric acid (GABA)ergic interneurons are proposed to play an essential role in the pathogenesis. However, controversial results have been reported regarding the regulation of NMDAR expression, and direct evidence of how NMDAR antagonists act on specific subpopulations of prefrontal interneurons is missing. We investigated the effects of the NMDAR antagonist dizocilpine (MK-801) on the expression of NMDAR subtypes in the identified interneurons in young adult rat prefrontal cortex (PFC) by using laser microdissection and real-time polymerase chain reaction, combined with Western blotting and immunofluorescent staining. We found that MK-801 induced distinct changes of NMDAR subunits in the parvalbumin-immunoreactive (PV-ir) interneurons vs. pyramidal neurons in the PFC circuitry. The messenger RNA (mRNA) expression of all NMDAR subtypes, including NR1 and NR2A to 2D, exhibited inverted-U dose-dependent changes in response to MK-801 treatment in the PFC. In contrast, subunit mRNAs of NMDARs in PV-ir interneurons were significantly down-regulated at low doses, unaltered at medium doses, and significantly decreased again at high doses, suggesting a biphasic dose response to MK-801. The differential effects of MK-801 in mRNA expression of NMDAR subunits were consistent with the protein expression of NR2A and NR2B subunits revealed with Western blotting and double immunofluorescent staining. These results suggest that PV-containing interneurons in the PFC exhibit a distinct responsiveness to NMDAR antagonism and that NMDA antagonist can differentially and dose-dependently regulate the functions of pyramidal neurons and GABAergic interneurons in the prefrontal cortical circuitry.
Kinetic Contributions to Gating by Interactions Unique to N-methyl-d-aspartate (NMDA) Receptors*
Borschel, William F.; Cummings, Kirstie A.; Tindell, LeeAnn K.; Popescu, Gabriela K.
2015-01-01
Among glutamate-gated channels, NMDA receptors produce currents that subside with unusually slow kinetics, and this feature is essential to the physiology of central excitatory synapses. Relative to the homologous AMPA and kainate receptors, NMDA receptors have additional intersubunit contacts in the ligand binding domain that occur at both conserved and non-conserved sites. We examined GluN1/GluN2A single-channel currents with kinetic analyses and modeling to probe these class-specific intersubunit interactions for their role in glutamate binding and receptor gating. We found that substitutions that eliminate such interactions at non-conserved sites reduced stationary gating, accelerated deactivation, and imparted sensitivity to aniracetam, an AMPA receptor-selective positive modulator. Abolishing unique contacts at conserved sites also reduced stationary gating and accelerated deactivation. These results show that contacts specific to NMDA receptors, which brace the heterodimer interface within the ligand binding domain, stabilize actively gating receptor conformations and result in longer bursts and slower deactivations. They support the view that the strength of the heterodimer interface modulates gating in both NMDA and non-NMDA receptors and that unique interactions at this interface are responsible in part for basic differences between the kinetics of NMDA and non-NMDA currents at glutamatergic synapses. PMID:26370091
Hagino, Yoko; Kasai, Shinya; Han, Wenhua; Yamamoto, Hideko; Nabeshima, Toshitaka; Mishina, Masayoshi; Ikeda, Kazutaka
2010-01-01
Phencyclidine (PCP), a noncompetitive N-methyl-D-aspartate (NMDA) receptor antagonist, increases locomotor activity in rodents and causes schizophrenia-like symptoms in humans. Although activation of the dopamine (DA) pathway is hypothesized to mediate these effects of PCP, the precise mechanisms by which PCP induces its effects remain to be elucidated. The present study investigated the effect of PCP on extracellular levels of DA (DAex) in the striatum and prefrontal cortex (PFC) using in vivo microdialysis in mice lacking the NMDA receptor channel ε1 or ε4 subunit (GluRε1 [GluN2A] or GluRε4 [GluN2D]) and locomotor activity. PCP significantly increased DAex in wildtype and GluRε1 knockout mice, but not in GluRε4 knockout mice, in the striatum and PFC. Acute and repeated administration of PCP did not increase locomotor activity in GluRε4 knockout mice. The present results suggest that PCP enhances dopaminergic transmission and increases locomotor activity by acting at GluRε4. PMID:21060893
Borghese, Cecilia M.; Xiong, Wei; Oh, S. Irene; Ho, Angel; Mihic, S. John; Zhang, Li; Lovinger, David M.; Homanics, Gregg E.; Eger, Edmond I; Harris, R. Adron
2012-01-01
Background Volatile anesthetics (VAs) alter the function of key central nervous system proteins but it is not clear which, if any, of these targets mediates the immobility produced by VAs in the face of noxious stimulation. A leading candidate is the glycine receptor, a ligand-gated ion channel important for spinal physiology. VAs variously enhance such function, and blockade of spinal GlyRs with strychnine affects the minimal alveolar concentration (an anesthetic EC50) in proportion to the degree of enhancement. Methods We produced single amino acid mutations into the glycine receptorα1 subunit that increased (M287L, third transmembrane region) or decreased (Q266I, second transmembrane region) sensitivity to isoflurane in recombinant receptors, and introduced such receptors into mice. The resulting knockin mice presented impaired glycinergic transmission, but heterozygous animals survived to adulthood, and we determined the effect of isoflurane on glycine-evoked responses of brain stem neurons from the knockin mice, and the minimal alveolar concentration for isoflurane and other VAs in the immature and mature knockin mice. Results Studies of glycine-evoked currents in brain stem neurons from knock-in mice confirmed the changes seen with recombinant receptors. No increases in the minimal alveolar concentration were found in knockin mice, but the minimal alveolar concentration for isoflurane and enflurane (but not halothane) decreased in 2-week-old Q266I mice. This change is opposite to the one expected for a mutation that decreases the sensitivity to volatile anesthetics. Conclusion Taken together, these results indicate that glycine receptors containing the α1 subunit are not likely to be crucial for the action of isoflurane and other VAs. PMID:22885675
Basic pharmacology of NMDA receptors.
Gonda, Xenia
2012-01-01
NMDA receptors are ionotropic receptors mediating glutamatergic neurotransmission and play a role in several basic functions in the central nervous system, from regulating neurodevelopment and synaptic plasticity, learning and memory formation, cognitive processes, rhythm generation necessary for locomotor activity and breathing, and excitotoxicity. Due to their complex involvement in the above processes, NMDA receptors have been established to play a role in the etiopathology of several neuropsychiatric disorders such as ischaemia and traumatic brain injury, neurodegenerative disorders, pain syndromes, addiction, affective disorders and such neurodevelopmental disorders as autism or schizophrenia. NMDA receptors contain multiple types of subunits with distinct functional and pharmacological properties making the picture more complex. These receptors also offer multiple binding sites to be targeted with pharmacons, however, early broad-spectrum NMDA receptor antagonists had limited clinical use due to their intolerable adverse effect profile. The discovery of several types of subunit selective NMDA receptor antagonists may offer valuable therapeutic possibilities for several disorders, with improved clinical efficacy and decreased side effects. However, in spite of our increasing knowledge concerning the involvement of NMDA receptors in pathological processes, molecules with a selective action, tolerable side effect profile and good clinical efficacy are still only in clinical development in the majority of cases. Nevertheless, NMDA receptors offer a novel opportunity in the treatment of various neuropsychiatric conditions.
Berrout, Liza; Isokawa, Masako
2018-01-01
Ghrelin and its receptor GHSR1a have been shown to exert numerous physiological functions in the brain, in addition to the well-established orexigenic role in the hypothalamus. Earlier work indicated that ghrelin stimulated the phosphorylation of the GluN1 subunit of the NMDA receptor (NMDAR) and enhanced synaptic transmission in the hippocampus. In the present study, we report that the exogenous application of ghrelin increased GluN2B phosphorylation. This increase was independent of GluN2B subunit activity or NMDAR channel activity. However, it depended on the activation of GHSR1a and Fyn as it was blocked by D-Lys3-GHRP-6 and PP2, respectively. Inhibitors for G-protein-regulated second messengers, such as Rp-cAMP, H89, TBB, ryanodine, and thapsigargin, unexpectedly enhanced GluN2B phosphorylation, suggesting that cAMP, PKA, casein kinase II, and cytosolic calcium signaling may oppose to the effect of ghrelin on the phosphorylation of GluN2B. Our findings suggest that 1) GluN2B is likely a molecular target of ghrelin and GHSR1a-driven signaling cascades, and 2) the ghrelin-mediated phosphorylation of GluN2B depends on Fyn activation under complex negative regulation by other second messengers. Copyright © 2017 Elsevier B.V. All rights reserved.
Therapeutic potential of Mediator complex subunits in metabolic diseases.
Ranjan, Amol; Ansari, Suraiya A
2018-01-01
The multisubunit Mediator is an evolutionary conserved transcriptional coregulatory complex in eukaryotes. It is needed for the transcriptional regulation of gene expression in general as well as in a gene specific manner. Mediator complex subunits interact with different transcription factors as well as components of RNA Pol II transcription initiation complex and in doing so act as a bridge between gene specific transcription factors and general Pol II transcription machinery. Specific interaction of various Mediator subunits with nuclear receptors (NRs) and other transcription factors involved in metabolism has been reported in different studies. Evidences indicate that ligand-activated NRs recruit Mediator complex for RNA Pol II-dependent gene transcription. These NRs have been explored as therapeutic targets in different metabolic diseases; however, they show side-effects as targets due to their overlapping involvement in different signaling pathways. Here we discuss the interaction of various Mediator subunits with transcription factors involved in metabolism and whether specific interaction of these transcription factors with Mediator subunits could be potentially utilized as therapeutic strategy in a variety of metabolic diseases. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Role of AMPA glutamate receptors in the conditioned rewarding effects of MDMA in mice.
García-Pardo, M P; Miñarro, J; Aguilar, M A
2018-07-16
Currently, there is not an effective treatment for 3,4-methylenedioxymethamphetamine (MDMA) dependence but pharmacotherapies targeting glutamate neurotransmission are a promising strategy. Previously, we showed that blockade of glutamate NMDA and AMPA receptors impairs the conditioned rewarding effects of MDMA and cocaine, respectively. In this study we evaluated the role of AMPA receptors in the rewarding effects of MDMA in mice using the conditioned place preference (CPP) paradigm. Mice were conditioned with MDMA (1.25 mg/kg) 60 min after the treatment with saline or different doses (0.25, 1 and 5 mg/kg) of the AMPA/kainate receptor antagonist, 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX). Mice conditioned with MDMA acquired CPP while those treated with any dose of CNQX + MDMA did not. These results supported the involvement of the glutamatergic system in the rewarding properties of MDMA, and suggest that AMPA receptor blockade could be a new therapeutic option for the treatment of those individuals that develop MDMA dependence. Copyright © 2018 Elsevier B.V. All rights reserved.
Grassi, Silvarosa; Frondaroli, Adele; Dieni, Cristina; Dutia, Mayank B; Pettorossi, Vito E
2007-07-01
In rat brainstem slices, we investigated the influence of the neurosteroids tetrahydrodeoxycorticosterone (THDOC) and allopregnanolone (ALLO) on the synaptically driven and spontaneous activity of vestibular neurons, by analysing their effects on the amplitude of the field potentials evoked in the medial vestibular nuclei (MVN) by vestibular afferent stimulation and on the spontaneous firing rate of MVN neurons. Furthermore, the interaction with gamma-aminobutyric acid (GABA) and glutamate receptors was analysed by using specific antagonists for GABA(A) (bicuculline), alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA)/ kainate [2,3-dioxo-6-nitro-1,2,3,4-tetrahydrobenzo(f)quinoxaline-7-sulphonamide disodium salt (NBQX)], N-methyl-D-aspartate (NMDA) [D-(-)-2-amino-5-phosphonopentanoic acid (AP-5)] and group I metabotropic glutamate receptors (mGlu-I) [(R,S)-1-aminoindan-1,5-dicarboxylic acid (AIDA)] receptors. THDOC and ALLO evoked two opposite long-lasting effects, consisting of either a potentiation or a reduction of field potential and firing rate, which showed early and late components, occurring in conjunction or separately after neurosteroid application. The depressions depended on GABA(A) receptors, as they were abolished by bicuculline, while early potentiation involved glutamate AMPA/kainate receptors, as NBQX markedly reduced the incidence of early firing rate enhancement and, in the case of ALLO, even provoked depression. This suggests that THDOC and ALLO enhance the GABA(A) inhibitory influence on the MVN neurons and facilitate the AMPA/kainate facilitatory one. Conversely, a late potentiation effect, which was still induced after glutamate and GABA(A) receptor blockade, might involve a different mechanism. We conclude that the modulation of neuronal activity in the MVN by THDOC and ALLO, through their actions on GABA(A) and AMPA/kainate receptors, may have a physiological role in regulating the vestibular system function under normal
Nicotinic receptor abnormalities in the cerebellar cortex in autism.
Lee, M; Martin-Ruiz, C; Graham, A; Court, J; Jaros, E; Perry, R; Iversen, P; Bauman, M; Perry, E
2002-07-01
Autism is a common developmental disorder associated with structural and inferred neurochemical abnormalities of the brain. Cerebellar abnormalities frequently have been identified, based on neuroimaging or neuropathology. Recently, the cholinergic neurotransmitter system has been implicated on the basis of nicotinic receptor loss in the cerebral cortex. Cerebellar cholinergic activities were therefore investigated in autopsy tissue from a series of autistic individuals. The presynaptic cholinergic enzyme, choline acetyltransferase, together with nicotinic and muscarinic receptor subtypes were compared in the cerebellum from age-matched mentally retarded autistic (eight), normal control (10) and non-autistic mentally retarded individuals (11). The nicotinic receptor binding the agonist epibatidine (the high affinity receptor subtype, consisting primarily of alpha3 and alpha4, together with beta2 receptor subunits) was significantly reduced by 40-50% in the granule cell, Purkinje and molecular layers in the autistic compared with the normal group (P < 0.05). There was an opposite increase (3-fold) in the nicotinic receptor binding alpha-bungarotoxin (to the alpha7 subunit) which reached significance in the granule cell layer (P < 0.05). These receptor changes were paralleled by a significant reduction (P < 0.05) and non-significant increase, respectively, of alpha4 and alpha7 receptor subunit immunoreactivity measured using western blotting. Immunohistochemically loss of alpha(4 )reactivity was apparent from Purkinje and the other cell layers, with increased alpha7 reactivity in the granule cell layer. There were no significant changes in choline acetyltransferase activity, or in muscarinic M1 and M2 receptor subtypes in autism. In the non-autistic mentally retarded group, the only significant abnormality was a reduction in epibatidine binding in the granule cell and Purkinje layers. In two autistic cases examined histologically, Purkinje cell loss was observed in
Park, Eon Joo; Grabińska, Kariona A; Guan, Ziqiang; Stránecký, Viktor; Hartmannová, Hana; Hodaňová, Kateřina; Barešová, Veronika; Sovová, Jana; Jozsef, Levente; Ondrušková, Nina; Hansíková, Hana; Honzík, Tomáš; Zeman, Jiří; Hůlková, Helena; Wen, Rong; Kmoch, Stanislav; Sessa, William C
2014-09-02
Dolichol is an obligate carrier of glycans for N-linked protein glycosylation, O-mannosylation, and GPI anchor biosynthesis. cis-prenyltransferase (cis-PTase) is the first enzyme committed to the synthesis of dolichol. However, the proteins responsible for mammalian cis-PTase activity have not been delineated. Here we show that Nogo-B receptor (NgBR) is a subunit required for dolichol synthesis in yeast, mice, and man. Moreover, we describe a family with a congenital disorder of glycosylation caused by a loss of function mutation in the conserved C terminus of NgBR-R290H and show that fibroblasts isolated from patients exhibit reduced dolichol profiles and enhanced accumulation of free cholesterol identically to fibroblasts from mice lacking NgBR. Mutation of NgBR-R290H in man and orthologs in yeast proves the importance of this evolutionarily conserved residue for mammalian cis-PTase activity and function. Thus, these data provide a genetic basis for the essential role of NgBR in dolichol synthesis and protein glycosylation. Copyright © 2014 Elsevier Inc. All rights reserved.
Marotta, Christopher B.; Dilworth, Crystal N.; Lester, Henry A.; Dougherty, Dennis A.
2014-01-01
Nicotinic acetylcholine receptors (nAChRs) containing the α5 subunit are of interest because genome-wide association studies and candidate gene studies have identified polymorphisms in the α5 gene that are linked to an increased risk for nicotine dependence, lung cancer, and/or alcohol addiction. To probe the functional impact of an α5 subunit on nAChRs, a method to prepare a homogeneous population of α5-containing receptors must be developed. Here we use a gain of function (9') mutation to isolate populations of α5-containing nAChRs for characterization by electrophysiology. We find that the α5 subunit modulates nAChR rectification when co-assembled with α4 and β2 subunits. We also probe the α5–α4 interface for possible ligand binding interactions. We find that mutations expected to ablate an agonist binding site involving the α5 subunit have no impact on receptor function. The most straightforward interpretation of this observation is that agonists do not bind at the α5–α4 interface, in contrast to what has recently been demonstrated for the α4–α4 interface in related receptors. In addition, our mutational results suggest that the α5 subunit does not replace the α4 or β2 subunits and is relegated to occupying only the auxiliary position of the pentameric receptor. PMID:24144909
Zhang, Rui-Xin; Li, Aihui; Liu, Bing; Wang, Linbo; Ren, Ke; Zhang, Haiqing; Berman, Brian M; Lao, Lixing
2008-04-01
Although it has been shown that pro-inflammatory cytokines such as interleukin-1beta (IL-1beta) facilitate perception of noxious inputs at the spinal level, the mechanisms have not been understood. This study determined the cell type that produces IL-1beta, the co-localization of IL-1 receptor type I (IL-1RI) and Fos and NR1 in the spinal cord, and the effects of IL-1 receptor antagonist (IL-1ra) on NR1 phosphorylation and hyperalgesia in a rat model of inflammatory pain. Phosphorylation of NR1, an essential subunit of the NMDA receptor (NMDAR), is known to modulate NMDAR activity and facilitate pain. Hyperalgesia was induced by injecting complete Freund's adjuvant (CFA, 0.08ml, 40microg Mycobacterium tuberculosis) into one hind paw of each rat. Paw withdrawal latency (PWL) was tested before CFA (-48h) for baseline and 2 and 24h after CFA to assess hyperalgesia. IL-1ra was given (i.t.) 24h before CFA to block the action of basal IL-1beta and 2h prior to each of two PWL tests to block CFA-induced IL-1beta. Spinal cords were removed for double immunostaining of IL-1beta/neuronal marker and IL-1beta/glial cell markers, IL-1RI/Fos and IL-1RI/NR1, and for Western blot to measure NR1 phosphorylation. The data showed that: (1) astrocytes produce IL-1beta, (2) IL-1RI is localized in Fos- and NR1-immunoreactive neurons within the spinal dorsal horn, and (3) IL-1ra at 0.01mg/rat significantly increased PWL (P<0.05) and inhibited NR1 phosphorylation compared to saline control. The results suggest that spinal IL-1beta is produced by astrocytes and enhances NR1 phosphorylation to facilitate inflammatory pain.
Takayama, S; White, M F; Kahn, C R
1988-03-05
The effect of 12-O-tetradecanoylphorbol-13-acetate (TPA) on the function of the insulin receptor was examined in intact hepatoma cells (Fao) and in solubilized extracts purified by wheat germ agglutinin chromatography. Incubation of ortho[32P]phosphate-labeled Fao cells with TPA increased the phosphorylation of the insulin receptor 2-fold after 30 min. Analysis of tryptic phosphopeptides from the beta-subunit of the receptor by reverse-phase high performance liquid chromatography and determination of their phosphoamino acid composition suggested that TPA predominantly stimulated phosphorylation of serine residues in a single tryptic peptide. Incubation of the Fao cells with insulin (100 nM) for 1 min stimulated 4-fold the phosphorylation of the beta-subunit of the insulin receptor. Prior treatment of the cells with TPA inhibited the insulin-stimulated tyrosine phosphorylation by 50%. The receptors extracted with Triton X-100 from TPA-treated Fao cells and purified on immobilized wheat germ agglutinin retained the alteration in kinase activity and exhibited a 50% decrease in insulin-stimulated tyrosine autophosphorylation and phosphotransferase activity toward exogenous substrates. This was due primarily to a decrease in the Vmax for these reactions. TPA treatment also decreased the Km of the insulin receptor for ATP. Incubation of the insulin receptor purified from TPA-treated cells with alkaline phosphatase decreased the phosphate content of the beta-subunit to the control level and reversed the inhibition, suggesting that the serine phosphorylation of the beta-subunit was responsible for the decreased tyrosine kinase activity. Our results support the notion that the insulin receptor is a substrate for protein kinase C in the Fao cell and that the increase in serine phosphorylation of the beta-subunit of the receptor produced by TPA treatment inhibited tyrosine kinase activity in vivo and in vitro. These data suggest that protein kinase C may regulate the function
Savić, Miroslav M.; Majumder, Samarpan; Huang, Shengming; Edwankar, Rahul V.; Furtmüller, Roman; Joksimović, Srđan; Clayton, Terry; Ramerstorfer, Joachim; Milinković, Marija M.; Roth, Bryan L.; Sieghart, Werner; Cook, James M.
2010-01-01
Over the last years, genetic studies have greatly improved our knowledge on the receptor subtypes mediating various pharmacological effects of positive allosteric modulators at GABAA receptors. This stimulated the development of new benzodiazepine (BZ)-like ligands, especially those inactive/low-active at GABAA receptors containing the α1 subunit, with the aim of generating more selective drugs. Hereby, the affinity and efficacy of four recently-synthesized BZ site ligands: SH-053-2’N, SH-053-S-CH3-2’F, SH-053-R-CH3-2’F and JY-XHe-053 were assessed. They were also studied in behavioral tests of spontaneous locomotor activity, elevated plus maze, and water maze in rats, which are considered predictive of, respectively, the sedative, anxiolytic, and amnesic influence of BZs. The novel ligands had moderately low to low affinity and mild to partial agonistic efficacy at GABAA receptors containing the α1 subunit, with variable, but more pronounced efficacy at other BZ-sensitive binding sites. While presumably α1 receptor-mediated sedative effects of GABAA modulation were not fully eliminated with any of the ligands tested, only SH-053-2’N and SH-053-S-CH3-2’F, both dosed at 30 mg/kg, exerted anxiolytic effects. The lack of clear anxiolytic-like activity of JY-XHe-053, despite its efficacy at α2- and α3-GABAA receptors, may have been partly connected with its preferential affinity at α5-GABAA receptors coupled with weak agonist activity at α1-containing subtypes. The memory impairment in water-maze experiments, generally reported with BZ site agonists, was completely circumvented with all four ligands. The results suggest that a substantial amount of activity at α1 GABAA receptors is needed for effecting spatial learning and memory impairments, while much weaker activity at α1- and α5-GABAA receptors is sufficient for eliciting sedation. PMID:20074611
Glutamate receptor mutations in psychiatric and neurodevelopmental disorders
Soto, David; Altafaj, Xavier; Sindreu, Carlos; Bayés, Àlex
2014-01-01
Alterations in glutamatergic neurotransmission have long been associated with psychiatric and neurodevelopmental disorders (PNDD), but only recent advances in high-throughput DNA sequencing have allowed interrogation of the prevalence of mutations in glutamate receptors (GluR) among afflicted individuals. In this review we discuss recent work describing GluR mutations in the context of PNDDs. Although there are no strict relationships between receptor subunit or type and disease, some interesting preliminary conclusions have arisen. Mutations in genes coding for ionotropic glutamate receptor subunits, which are central to synaptic transmission and plasticity, are mostly associated with intellectual disability and autism spectrum disorders. In contrast, mutations of metabotropic GluRs, having a role on modulating neural transmission, are preferentially associated with psychiatric disorders. Also, the prevalence of mutations among GluRs is highly heterogeneous, suggesting a critical role of certain subunits in PNDD pathophysiology. The emerging bias between GluR subtypes and specific PNDDs may have clinical implications. PMID:24605182
Glutamate receptor mutations in psychiatric and neurodevelopmental disorders.
Soto, David; Altafaj, Xavier; Sindreu, Carlos; Bayés, Alex
2014-01-01
Alterations in glutamatergic neurotransmission have long been associated with psychiatric and neurodevelopmental disorders (PNDD), but only recent advances in high-throughput DNA sequencing have allowed interrogation of the prevalence of mutations in glutamate receptors (GluR) among afflicted individuals. In this review we discuss recent work describing GluR mutations in the context of PNDDs. Although there are no strict relationships between receptor subunit or type and disease, some interesting preliminary conclusions have arisen. Mutations in genes coding for ionotropic glutamate receptor subunits, which are central to synaptic transmission and plasticity, are mostly associated with intellectual disability and autism spectrum disorders. In contrast, mutations of metabotropic GluRs, having a role on modulating neural transmission, are preferentially associated with psychiatric disorders. Also, the prevalence of mutations among GluRs is highly heterogeneous, suggesting a critical role of certain subunits in PNDD pathophysiology. The emerging bias between GluR subtypes and specific PNDDs may have clinical implications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gu, Y.
1989-01-01
The specificity of the antibodies in the serum of a patient with myasthenia gravis for a the {alpha}-bungarotoxin binding sites of the acetylcholine receptor (AChR) was examined using AChRs in the C2 mouse muscle cell line as a model. The antibodies were shown to be specific for one of the two toxin-binding sites. The effect of the antibodies in this myasthenic serum on the functional response of the receptor to cholinergic agonists was also examined using carbamylcholine-induced {sup 22}Na uptake into C2 myotubes as a measured of the receptor function. Antibodies specific for the {gamma}, {delta}, and {epsilon} subunit, respectively,more » of mammalian muscle AChRs were developed using subunit-specific synthetic peptides as antigens. Using these antibodies and monoclonal antibodies for other subunits as probes, I have identified four ({alpha}, {beta}, {gamma}, and {delta}) subunits of mammalian muscle AChRs on immunoblots. When AChRs from embryonic, neonatal, normal and denervated adult muscles were compared on immunoblots, the {alpha}, {beta}, and {delta} subunits were identical in all four receptor preparations, with or without endoglycosidase digestion. The spatial and temporal distribution of the {gamma}- and {epsilon}- AChRs in developing and in denervated muscles corresponds to the distribution of AChRs with slow and fast channels, respectively, and that the development changes in the channel properties of the receptor arise from a change in the subunit composition of the receptor, in which the {gamma} is replaced by {epsilon}.« less
Kamal, Fadia A; Travers, Joshua G; Schafer, Allison E; Ma, Qing; Devarajan, Prasad; Blaxall, Burns C
2017-01-01
Development of CKD secondary to chronic heart failure (CHF), known as cardiorenal syndrome type 2 (CRS2), clinically associates with organ failure and reduced survival. Heart and kidney damage in CRS2 results predominantly from chronic stimulation of G protein-coupled receptors (GPCRs), including adrenergic and endothelin (ET) receptors, after elevated neurohormonal signaling of the sympathetic nervous system and the downstream ET system, respectively. Although we and others have shown that chronic GPCR stimulation and the consequent upregulated interaction between the G-protein βγ-subunit (Gβγ), GPCR-kinase 2, and β-arrestin are central to various cardiovascular diseases, the role of such alterations in kidney diseases remains largely unknown. We investigated the possible salutary effect of renal GPCR-Gβγ inhibition in CKD developed in a clinically relevant murine model of nonischemic hypertrophic CHF, transverse aortic constriction (TAC). By 12 weeks after TAC, mice developed CKD secondary to CHF associated with elevated renal GPCR-Gβγ signaling and ET system expression. Notably, systemic pharmacologic Gβγ inhibition by gallein, which we previously showed alleviates CHF in this model, attenuated these pathologic renal changes. To investigate a direct effect of gallein on the kidney, we used a bilateral ischemia-reperfusion AKI mouse model, in which gallein attenuated renal dysfunction, tissue damage, fibrosis, inflammation, and ET system activation. Furthermore, in vitro studies showed a key role for ET receptor-Gβγ signaling in pathologic fibroblast activation. Overall, our data support a direct role for GPCR-Gβγ in AKI and suggest GPCR-Gβγ inhibition as a novel therapeutic approach for treating CRS2 and AKI. Copyright © 2016 by the American Society of Nephrology.
Chakraborty, Mukta; Chen, Liang-Fu; Fridel, Emma E; Klein, Marguerita E; Senft, Rebecca A; Sarkar, Abhra; Jarvis, Erich D
2017-04-21
Zebra finches (Taeniopygia guttata) learn to produce songs in a manner reminiscent of spoken language development in humans. One candidate gene implicated in influencing learning is the N-methyl-D-aspartate (NMDA) subtype 2B glutamate receptor (NR2B). Consistent with this idea, NR2B levels are high in the song learning nucleus LMAN (lateral magnocellular nucleus of the anterior nidopallium) during juvenile vocal learning, and decreases to low levels in adults after learning is complete and the song becomes more stereotyped. To test for the role of NR2B in generating song plasticity, we manipulated NR2B expression in LMAN of adult male zebra finches by increasing its protein levels to those found in juvenile birds, using a lentivirus containing the full-length coding sequence of the human NR2B subunit. We found that increased NR2B expression in adult LMAN induced increases in song sequence diversity and slower song tempo more similar to juvenile songs, but also increased syllable repetitions similar to stuttering. We did not observe these effects in control birds with overexpression of NR2B outside of LMAN or with the green fluorescent protein (GFP) in LMAN. Our results suggest that low NR2B subunit expression in adult LMAN is important in conserving features of stereotyped adult courtship song.
Negative Cooperativity in the EGF Receptor
Pike, Linda J.
2012-01-01
Scatchard analyses of the binding of EGF to its receptor yield concave up Scatchard plots, indicative of some type of heterogenity in ligand binding affinity. This was typically interpreted as being due to the presence of two independent binding site–one of high affinity representing ≤10% of the receptor population and one of low affinity making up the bulk of the receptors. However, the concept of two independent binding sites is difficult to reconcile with the X-ray structures of the dimerized EGF receptor that show symmetric binding of the two ligands. A new approach to the analysis of 125I-EGF binding data combined with the structure of the singly-occupied Drosophila EGF receptor have now shown that this heterogeneity is due to the presence of negative cooperativity in the EGF receptor. Concerns that negative cooperativity precludes ligand-induced dimerization of the EGF receptor confuse the concepts of linkage cooperativity. Linkage refers to the effect of ligand on the assembly of dimers while cooperativity refers to the effect of ligand binding to one subunit on ligand binding to the other subunit within a preassembled dimer. Binding of EGF to its receptor is positively linked with dimer assembly but shows negative cooperativity within the dimer. PMID:22260659
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bidart, J.M.; Troalen, F.; Salesse, R.
1987-06-25
We describe a first attempt to study the antibody-combining sites recognized by monoclonal antibodies raised against the beta-subunit of human choriogonadotropin (hCG). Two groups of antibodies were first defined by their ability to recognize only the free beta-subunit or the free and combined subunit. Antibodies FBT-11 and FBT-11-L bind only to hCG beta-subunit but not to hCG, whereas antibodies FBT-10 and D1E8 bind to both the beta-subunit and the hormone. In both cases, the antigenic determinants were localized to the core of the protein (residues 1-112), indicating the weak immunogenicity of the specific carboxyl-terminal extension of hCG-beta. Nine synthetic peptidesmore » spanning different regions of hCG-beta and lutropin-beta were assessed for their capacity to inhibit antibody binding. A synthetic peptide inclusive of the NH2-terminal region (residues 1-7) of the hCG beta-subunit was found to inhibit binding to the radiolabeled subunit of a monoclonal antibody specific for free hCG-beta (FBT-11). Further delineation of the antigenic site recognized by this antibody provided evidence for the involvement of fragment 82-92. Moreover, monoclonal antibody FBT-11 inhibited the recombination of hCG-beta to hCG-alpha, indicating that its antigenic determinant might be located nearby or in the hCG-beta portion interacting with the alpha-subunit. Binding of monoclonal antibody FBT-10, corresponding to the second antigenic determinant, was weakly inhibited by fragment 82-105 and did not impair the recombination of the hCG beta-subunit to the hCG alpha-subunit. Its combining site appeared to be located in a region of the intact native choriogonadotropin present at the surface of the hormone-receptor complex.« less
Tachibana, Naoko; Kinoshita, Michiaki; Kametani, Fuyuki; Tanaka, Keiko; Une, Yumi; Komatsu, Yotaro; Kobayashi, Yukihiro; Ikeda, Shu-ichi
2015-03-01
Autoimmune synaptic encephalitis is characterized by the presence of autoantibodies against synaptic constituent receptors and manifests as neurological and psychiatric disorders. Anti-N-methyl-D-aspartate receptor (NMDAR) encephalitis is such an autoimmune disorder that predominantly affects young women. It is associated with antibodies against the extracellular region of the NR1 subunit of postsynaptic NMDAR. Each NMDAR functions as a heterotetrameric complex that is composed of four subunits, including NR1 and NR2A, NR2B, or NR2C. Importantly, ovarian teratoma is a typical complication of anti-NMDAR encephalitis in female patients and may contain antigenic neural tissue; however, antigenic sites remain unknown in female patients without ovarian teratoma. The purpose of this study was to investigate the expression of NMDARs in the ovum. We detected NR1 and NR2B immunoreactivity in protein fractions extracted from the bovine ovary and ova by SDS-polyacrylamide gel electrophoresis and immunoblotting analysis. Immunoprecipitates digested with trypsin were analyzed by reverse phase liquid chromatography coupled to tandem mass spectrometry. We obtained the following five peptides: SPFGRFK and KNLQDR, which are consistent with partial sequences of human NR1, and GVEDALVSLK, QPTVAGAPK, and NEVMSSK, which correspond to those of NR2A, NR2B and NR2C, respectively. Immunocytochemical analysis revealed that the bovine ovum was stained with the immunoglobulin G purified from the serum of a patient with anti-NMDAR encephalitis. Taken together, we propose that the normal ovum expresses NMDARs that have strong affinity for the disease-specific IgG. The presence of NMDARs in ova may help explain why young females without ovarian teratomas are also affected by anti-NMDAR encephalitis.
Gating characteristics control glutamate receptor distribution and trafficking in vivo.
Petzoldt, Astrid G; Lee, Yü-Hien; Khorramshahi, Omid; Reynolds, Eric; Plested, Andrew J R; Herzel, Hanspeter; Sigrist, Stephan J
2014-09-08
Glutamate-releasing synapses dominate excitatory release in the brain. Mechanisms governing their assembly are of major importance for circuit development and long-term plasticity underlying learning and memory. AMPA/Kainate-type glutamate receptors (GluRs) are tetrameric ligand-gated ion channels that open their ion-conducting pores in response to binding of the neurotransmitter. Changes in subunit composition of postsynaptic GluRs are highly relevant for plasticity and development of glutamatergic synapses [1-4]. To date, posttranslational modifications, mostly operating via the intracellular C-terminal domains (CTDs) of GluRs, are presumed to be the major regulator of trafficking [5]. In recent years, structural and electrophysiological analyses have improved our understanding of GluR gating mechanism [6-11]. However, whether conformational changes subsequent to glutamate binding may per se be able to influence GluR trafficking has remained an unaddressed question. Using a Drosophila system allowing for extended visualization of GluR trafficking in vivo, we here provide evidence that mutations changing the gating behavior alter GluR distribution and trafficking. GluR mutants associated with reduced charge transfer segregated from coexpressed wild-type GluRs on the level of individual postsynaptic densities. Segregation was lost upon blocking of evoked glutamate release. Photobleaching experiments suggested increased mobility of mutants with reduced charge transfer, which accumulated prematurely during early steps of synapse assembly, but failed to further increase their level in accordance with assembly of the presynaptic scaffold. In summary, gating characteristics seem to be a new variable for the understanding of GluR trafficking relevant to both development and plasticity. Copyright © 2014 Elsevier Ltd. All rights reserved.
Cameron, Krasnodara; Bartle, Emily; Roark, Ryan; Fanelli, David; Pham, Melissa; Pollard, Beth; Borkowski, Brian; Rhoads, Sarah; Kim, Joon; Rocha, Monica; Kahlson, Martha; Kangala, Melinda; Gentile, Lisa
2012-06-01
The endogenous neurosteroids, pregnenolone sulfate (PS) and 3α-hydroxy-5β-pregnan-20-one sulfate (PREGAS), have been shown to differentially regulate the ionotropic glutamate receptor (iGluR) family of ligand-gated ion channels. Upon binding to these receptors, PREGAS decreases current flow through the channels. Upon binding to non-NMDA or NMDA receptors containing an GluN2C or GluN2D subunit, PS also decreases current flow through the channels, however, upon binding to NMDA receptors containing an GluN2A or GluN2B subunit, flow through the channels increases. To begin to understand this differential regulation, we have cloned the S1S2 and amino terminal domains (ATD) of the NMDA GluN2B and GluN2D and AMPA GluA2 subunits. Here we present results that show that PS and PREGAS bind to different sites in the ATD of the GluA2 subunit, which when combined with previous results from our lab, now identifies two binding domains for each neurosteroid. We also show both neurosteroids bind only to the ATD of the GluN2D subunit, suggesting that this binding is distinct from that of the AMPA GluA2 subunit, with both leading to iGluR inhibition. Finally, we provide evidence that both PS and PREGAS bind to the S1S2 domain of the NMDA GluN2B subunit. Neurosteroid binding to the S1S2 domain of NMDA subunits responsible for potentiation of iGluRs and to the ATD of NMDA subunits responsible for inhibition of iGluRs, provides an interesting option for therapeutic design. Copyright © 2012 Elsevier Inc. All rights reserved.
Oxytocin modulates GABAAR subunits to confer neuroprotection in stroke in vitro.
Kaneko, Yuji; Pappas, Colleen; Tajiri, Naoki; Borlongan, Cesar V
2016-10-21
Oxytocin protects against ischemia-induced inflammation and oxidative stress, and is associated with GABA (γ-aminobutyric acid, an inhibitory neurotransmitter) signaling transduction in neurons. However, the molecular mechanism by which oxytocin affords neuroprotection, especially the interaction between oxytocin receptor and GABA A receptor (GABA A R), remains to be elucidated. Primary rat neural cells were exposed to oxytocin before induction of experimental acute stroke model via oxygen-glucose deprivation-reperfusion (OGD/R) injury. Pretreatment with oxytocin increased cell viability, decreased the cell damage against oxidative stress, and prevented the release of high mobility group box1 during OGD/R. However, introduction of oxytocin during OGD/R did not induce neuroprotection. Although oxytocin did not affect the glutathione-related cellular metabolism before OGD, oxytocin modulated the expression levels of GABA A R subunits, which function to remove excessive neuronal excitability via chloride ion influx. Oxytocin-pretreated cells significantly increased the chloride ion influx in response to GABA and THIP (δ-GABA A R specific agonist). This study provides evidence that oxytocin regulated GABA A R subunits in affording neuroprotection against OGD/R injury.
Bullock, W Michael; Cardon, Karen; Bustillo, Juan; Roberts, Rosalinda C; Perrone-Bizzozero, Nora I
2008-12-01
Deficits in gamma-aminobutyric acid (GABA) signaling have been described in the prefrontal cortex, limbic system, and cerebellum in individuals with schizophrenia. The purpose of the present study was to further investigate cerebellar gene expression alterations as they relate to decreases in GABAergic transmission by examining the expression of GABAergic markers, N-methyl-d-aspartic-acid (NMDA) receptor subunits, and cerebellum neuromodulators in individuals with schizophrenia. Subjects were postmortem men with a diagnosis of schizophrenia (N=13) and a postmortem interval-matched non-psychiatric male comparison group (N=13). The authors utilized real-time-quantitative polymerase chain reaction (PCR) to measure mRNA levels of the following GABAergic markers: glutamic acid decarboxylase (GAD) 65 and 67; GABA plasma membrane transporter-1 (GAT-1); GABA type A (GABA(A)) receptor subunits alpha(6), beta(3), and delta; and parvalbumin. In addition, real-time-quantitative PCR was utilized to assess mRNA levels of the NMDA receptor (NR) subunits NR1, NR2-A, NR2-B, NR2-C, and NR2-D as well as the cerebellar neuromodulators glutamate receptor (GluR)-6, kainate-preferring glutamate receptor subunit-2 (KA2), metabotropic glutamate receptor (mGluR)-2 and mGluR3, and neuronal nitric oxide synthase. Measurements for mRNA levels were determined using lateral cerebellar hemisphere tissue from both schizophrenia and comparison subjects. Schizophrenia subjects showed significant decreases in mRNA levels of GAD(67), GAD(65), GAT-1, mGluR2, and neuronal nitric oxide synthase. Increases in GABA(A)-alpha(6 )and GABA(A)-delta as well as GluR6 and KA2 were also observed. Medication effects on the expression of the same genes were examined in rats treated with either haloperidol (Sprague-Dawley rats [N=16]) or clozapine (Long-Evans rats [N=20]). Both haloperidol and clozapine increased the levels of GAD(67) in the cerebellum and altered the expression of other cerebellar mRNAs. These
Progesterone Modulates a Neuronal Nicotinic Acetylcholine Receptor
NASA Astrophysics Data System (ADS)
Valera, S.; Ballivet, M.; Bertrand, D.
1992-10-01
The major brain nicotinic acetylcholine receptor is assembled from two subunits termed α 4 and nα 1. When expressed in Xenopus oocytes, these subunits reconstitute a functional acetylcholine receptor that is inhibited by progesterone levels similar to those found in serum. In this report, we show that the steroid interacts with a site located on the extracellular part of the protein, thus confirming that inhibition by progesterone is not due to a nonspecific perturbation of the membrane bilayer or to the activation of second messengers. Because inhibition by progesterone does not require the presence of agonist, is voltage-independent, and does not alter receptor desensitization, we conclude that the steroid is not an open channel blocker. In addition, we show that progesterone is not a competitive inhibitor but may interact with the acetylcholine binding site and that its effect is independent of the ionic permeability of the receptor.