Developmental regulation of N-methyl-D-aspartate- and kainate-type glutamate receptor expression in the rat spinal cord

NASA Technical Reports Server (NTRS)

Stegenga, S. L.; Kalb, R. G.

2001-01-01

Spinal motor neurons undergo experience-dependent development during a critical period in early postnatal life. It has been suggested that the repertoire of glutamate receptor subunits differs between young and mature motor neurons and contributes to this activity-dependent development. In the present study we examined the expression patterns of N-methyl-D-aspartate- and kainate-type glutamate receptor subunits during the postnatal maturation of the spinal cord. Young motor neurons express much higher levels of the N-methyl-D-aspartate receptor subunit NR1 than do adult motor neurons. Although there are eight potential splice variants of NR1, only a subgroup is expressed by motor neurons. With respect to NR2 receptor subunits, young motor neurons express NR2A and C, while adult motor neurons express only NR2A. Young motor neurons express kainate receptor subunits GluR5, 6 and KA2 but we are unable to detect these or any other kainate receptor subunits in the adult spinal cord. Other spinal cord regions display a distinct pattern of developmental regulation of N-methyl-D-aspartate and kainate receptor subunit expression in comparison to motor neurons. Our findings indicate a precise spatio-temporal regulation of individual subunit expression in the developing spinal cord. Specific combinations of subunits in developing neurons influence their excitable properties and could participate in the emergence of adult neuronal form and function.

The role of S-nitrosylation of kainate-type of ionotropic glutamate receptor 2 in epilepsy induced by kainic acid.

PubMed

Wang, Linxiao; Liu, Yanyan; Lu, Rulan; Dong, Guoying; Chen, Xia; Yun, Wenwei; Zhou, Xianju

2018-02-01

Epilepsy is a chronic brain disease affecting millions of individuals. Kainate receptors, especially kainate-type of ionotropic glutamate receptor 2 (GluK2), play an important role in epileptogenesis. Recent data showed that GluK2 could undergo post-translational modifications in terms of S-nitrosylation (SNO), and affect the signaling pathway of cell death in cerebral ischemia-reperfusion. However, it is unclear whether S-nitrosylation of GluK2 (SNO-GluK2) contributes to cell death induced by epilepsy. Here, we report that kainic acid-induced SNO-GluK2 is mediated by GluK2 itself, regulated by neuronal nitric oxide synthase (nNOS) and the level of cytoplasmic calcium in vivo and in vitro hippocampus neurons. The whole-cell patch clamp recordings showed the influence of SNO-GluK2 on ion channel characterization of GluK2-Kainate receptors. Moreover, immunohistochemistry staining results showed that inhibition of SNO-GluK2 by blocking nNOS or GluK2 or by reducing the level of cytoplasmic calcium-protected hippocampal neurons from kainic acid-induced injury. Finally, immunoprecipitation and western blotting data revealed the involvement of assembly of a GluK2-PSD95-nNOS signaling complex in epilepsy. Taken together, our results showed that the SNO-GluK2 plays an important role in neuronal injury of epileptic rats by forming GluK2-PSD95-nNOS signaling module in a cytoplasmic calcium-dependent way, suggesting a potential therapeutic target site for epilepsy. © 2017 International Society for Neurochemistry.

Structure and assembly mechanism for heteromeric kainate receptors.

PubMed

Kumar, Janesh; Schuck, Peter; Mayer, Mark L

2011-07-28

Native glutamate receptor ion channels are tetrameric assemblies containing two or more different subunits. NMDA receptors are obligate heteromers formed by coassembly of two or three divergent gene families. While some AMPA and kainate receptors can form functional homomeric ion channels, the KA1 and KA2 subunits are obligate heteromers which function only in combination with GluR5-7. The mechanisms controlling glutamate receptor assembly involve an initial step in which the amino terminal domains (ATD) assemble as dimers. Here, we establish by sedimentation velocity that the ATDs of GluR6 and KA2 coassemble as a heterodimer of K(d) 11 nM, 32,000-fold lower than the K(d) for homodimer formation by KA2; we solve crystal structures for the GluR6/KA2 ATD heterodimer and heterotetramer assemblies. Using these structures as a guide, we perform a mutant cycle analysis to probe the energetics of assembly and show that high-affinity ATD interactions are required for biosynthesis of functional heteromeric receptors. Copyright © 2011 Elsevier Inc. All rights reserved.

Xenon reduces glutamate-, AMPA-, and kainate-induced membrane currents in cortical neurones.

PubMed

Dinse, A; Föhr, K J; Georgieff, M; Beyer, C; Bulling, A; Weigt, H U

2005-04-01

The anaesthetic, analgesic, and neuroprotective effects of xenon (Xe) are believed to be mediated by a block of the NMDA (N-methyl-D-aspartate) receptor channel. Interestingly, the clinical profile of the noble gas differs markedly from that of specific NMDA receptor antagonists. The aim of this study was, therefore, to investigate whether Xe might be less specific, also inhibiting the two other subtypes of glutamate receptor channels, such as the alpha-amino-3-hydroxy-5-methyl-4-isoxazolole propionate (AMPA) and kainate receptors. The study was performed on voltage-clamped cortical neurones from embryonic mice and SH-SY5Y cells expressing GluR6 kainate receptors. Drugs were applied by a multi-barreled fast perfusion system. Xe, dissolved at approximately 3.45 mM in aqueous solution, diminished the peak and even more the plateau of AMPA and glutamate induced currents. At the control EC(50) value for AMPA (29 microM) these reductions were by about 40 and 56% and at 3 mM glutamate the reductions were by 45 and 66%, respectively. Currents activated at the control EC(50) value for kainate (57 microM) were inhibited by 42%. Likewise, Xe showed an inhibitory effect on kainate-induced membrane currents of SH-SY5Y cells transfected with the GluR6 subunit of the kainate receptor. Xe reduced kainate-induced currents by between 35 and 60%, depending on the kainate concentration. Xe blocks not only NMDA receptors, but also AMPA and kainate receptors in cortical neurones as well as GluR6-type receptors expressed in SH-SY5Y cells. Thus, Xe seems to be rather non-specific as a channel blocker and this may contribute to the analgesic and anaesthetic potency of Xe.

NMDA and AMPA/kainate glutamatergic receptors in the prelimbic medial prefrontal cortex modulate the elaborated defensive behavior and innate fear-induced antinociception elicited by GABAA receptor blockade in the medial hypothalamus.

PubMed

de Freitas, Renato Leonardo; Salgado-Rohner, Carlos José; Biagioni, Audrey Francisco; Medeiros, Priscila; Hallak, Jaime Eduardo Cecílio; Crippa, José Alexandre S; Coimbra, Norberto Cysne

2014-06-01

The aim of the present study was to investigate the involvement of N-methyl-d-aspartate (NMDA) and amino-3-hydroxy-5-methyl-isoxazole-4-proprionate (AMPA)/kainate receptors of the prelimbic (PL) division of the medial prefrontal cortex (MPFC) on the panic attack-like reactions evoked by γ-aminobutyric acid-A receptor blockade in the medial hypothalamus (MH). Rats were pretreated with NaCl 0.9%, LY235959 (NMDA receptor antagonist), and NBQX (AMPA/kainate receptor antagonist) in the PL at 3 different concentrations. Ten minutes later, the MH was treated with bicuculline, and the defensive responses were recorded for 10 min. The antagonism of NMDA receptors in the PL decreased the frequency and duration of all defensive behaviors evoked by the stimulation of the MH and reduced the innate fear-induced antinociception. However, the pretreatment of the PL cortex with NBQX was able to decrease only part of defensive responses and innate fear-induced antinociception. The present findings suggest that the NMDA-glutamatergic system of the PL is critically involved in panic-like responses and innate fear-induced antinociception and those AMPA/kainate receptors are also recruited during the elaboration of fear-induced antinociception and in panic attack-related response. The activation of the glutamatergic neurotransmission of PL division of the MPFC during the elaboration of oriented behavioral reactions elicited by the chemical stimulation of the MH recruits mainly NMDA receptors in comparison with AMPA/kainate receptors.

Channel-Opening Kinetic Mechanism of Wild-Type GluK1 Kainate Receptors and a C-Terminal Mutant

PubMed Central

Han, Yan; Wang, Congzhou; Park, Jae Seon; Niu, Li

2012-01-01

GluK1 is a kainate receptor subunit in the ionotropic glutamate receptor family and can form functional channels when expressed, for instance, in HEK-293 cells. However, the channel-opening mechanism of GluK1 is poorly understood. One major challenge to studying the GluK1 channel is its apparent low surface expression, which results in a low whole-cell current response even to a saturating concentration of agonist. The low surface expression is thought to be contributed by an endoplasmic reticulum (ER) retention signal sequence. When this sequence motif is present as in the wild-type GluK1-2b C-terminus, the receptor is significantly retained in the ER. Conversely, when this sequence is lacking, as in wild-type GluK1-2a (i.e., a different alternatively spliced isoform at the C-terminus) and in a GluK1-2b mutant (i.e., R896A, R897A, R900A and K901A) that disrupts the ER retention signal, there is higher surface expression and greater whole-cell current response. Here we characterize the channel-opening kinetic mechanism for these three GluK1 receptors expressed in HEK-293 cells by using a laser-pulse photolysis technique. Our results show that the wild-type GluK1-2a, wild-type GluK1-2b and the mutant GluK1-2b have identical channel-opening and channel-closing rate constants. These results indicate that the C-terminal ER retention signal sequence, which affects receptor trafficking/expression, does not affect channel-gating properties. Furthermore, as compared with the GluK2 kainate receptor, the GluK1 channel is faster to open, close, and desensitize by at least two-fold, yet the EC50 value of GluK1 is similar to that of GluK2. PMID:22191429

Distinct subunits in heteromeric kainate receptors mediate ionotropic and metabotropic function at hippocampal mossy fiber synapses.

PubMed

Ruiz, Arnaud; Sachidhanandam, Shankar; Utvik, Jo Kristian; Coussen, Françoise; Mulle, Christophe

2005-12-14

Heteromeric kainate receptors (KARs) containing both glutamate receptor 6 (GluR6) and KA2 subunits are involved in KAR-mediated EPSCs at mossy fiber synapses in CA3 pyramidal cells. We report that endogenous glutamate, by activating KARs, reversibly inhibits the slow Ca2+-activated K+ current I(sAHP) and increases neuronal excitability through a G-protein-coupled mechanism. Using KAR knockout mice, we show that KA2 is essential for the inhibition of I(sAHP) in CA3 pyramidal cells by low nanomolar concentrations of kainate, in addition to GluR6. In GluR6(-/-) mice, both ionotropic synaptic transmission and inhibition of I(sAHP) by endogenous glutamate released from mossy fibers was lost. In contrast, inhibition of I(sAHP) was absent in KA2(-/-) mice despite the preservation of KAR-mediated EPSCs. These data indicate that the metabotropic action of KARs did not rely on the activation of a KAR-mediated inward current. Biochemical analysis of knock-out mice revealed that KA2 was required for the interaction of KARs with Galpha(q/11)-proteins known to be involved in I(sAHP) modulation. Finally, the ionotropic and metabotropic actions of KARs at mossy fiber synapses were differentially sensitive to the competitive glutamate receptor ligands kainate (5 nM) and kynurenate (1 mM). We propose a model in which KARs could operate in two modes at mossy fiber synapses: through a direct ionotropic action of GluR6, and through an indirect G-protein-coupled mechanism requiring the binding of glutamate to KA2.

Platelet Kainate Receptor Signaling Promotes Thrombosis by Stimulating Cyclooxygenase Activation

PubMed Central

Sun, Henry; Swaim, AnneMarie; Herrera, Jesus Enrique; Becker, Diane; Becker, Lewis; Srivastava, Kalyan; Thompson, Laura E.; Shero, Michelle R.; Perez-Tamayo, Alita; Suktitpat, Bhoom; Mathias, Rasika; Contractor, Anis; Faraday, Nauder; Morrell, Craig N.

2009-01-01

Rationale Glutamate is a major signaling molecule that binds to glutamate receptors including the ionotropic glutamate receptors; kainate (KA) receptor (KAR), the N-methyl-D-aspartate (NMDA) receptor (NMDAR), and the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor (AMPAR). Each is well characterized in the central nervous system (CNS), but glutamate has important signaling roles in peripheral tissues as well, including a role in regulating platelet function. Objective Our previous work has demonstrated that glutamate is released by platelets in high concentrations within a developing thrombus and increases platelet activation and thrombosis. We now show that platelets express a functional KAR that drives increased agonist induced platelet activation. Methods and Results KAR induced increase in platelet activation is in part the result of activation of platelet cyclooxygenase (COX) in a Mitogen Activated Protein Kinase (MAPK) dependent manner. Platelets derived from KA receptor subunit knockout mice (GluR6−/−) are resistant to KA effects and have a prolonged time to thrombosis in vivo. Importantly, we have also identified polymorphisms in KA receptor subunits that are associated with phenotypic changes in platelet function in a large group of Caucasians and African Americans. Conclusion Our data demonstrate that glutamate regulation of platelet activation is in part COX dependent, and suggest that the KA receptor is a novel anti-thrombotic target. PMID:19679838

Kainate receptor-mediated depression of glutamatergic transmission involving protein kinase A in the lateral amygdala.

PubMed

Negrete-Díaz, José Vicente; Duque-Feria, Paloma; Andrade-Talavera, Yuniesky; Carrión, Miriam; Flores, Gonzalo; Rodríguez-Moreno, Antonio

2012-04-01

Kainate receptors (KARs) have been described as modulators of synaptic transmission at different synapses. However, this role of KARs has not been well characterized in the amygdala. We have explored the effect of kainate receptor activation at the synapse established between fibers originating at medial geniculate nucleus and the principal cells in the lateral amygdala. We have observed an inhibition of evoked excitatory postsynaptic currents (eEPSCs) amplitude after a brief application of KARs agonists KA and ATPA. Paired-pulse recordings showed a clear pair pulse facilitation that was enhanced after KA or ATPA application. When postsynaptic cells were loaded with BAPTA, the depression of eEPSC amplitude observed after the perfusion of KAR agonists was not prevented. We have also observed that the inhibition of the eEPSCs by KARs agonists was prevented by protein kinase A but not by protein kinase C inhibitors. Taken together our results indicate that KARs present at this synapse are pre-synaptic and their activation mediate the inhibition of glutamate release through a mechanism that involves the activation of protein kinase A. © 2012 The Authors. Journal of Neurochemistry © 2012 International Society for Neurochemistry.

Type II and III Taste Bud Cells Preferentially Expressed Kainate Glutamate Receptors in Rats.

PubMed

Lee, Sang-Bok; Lee, Cil-Han; Kim, Se-Nyun; Chung, Ki-Myung; Cho, Young-Kyung; Kim, Kyung-Nyun

2009-12-01

Glutamate-induced cobalt uptake reveals that non-NMDA glutamate receptors (GluRs) are present in rat taste bud cells. Previous studies involving glutamate induced cobalt staining suggest this uptake mainly occurs via kainate type GluRs. It is not known which of the 4 types of taste bud cells express subunits of kainate GluR. Circumvallate and foliate papillae of Sprague-Dawley rats (45~60 days old) were used to search for the mRNAs of subunits of non-NMDA GluRs using RT-PCR with specific primers for GluR1-7, KA1 and KA2. We also performed RT-PCR for GluR5, KA1, PLCbeta2, and NCAM/SNAP 25 in isolated single cells from taste buds. Taste epithelium, including circumvallate or foliate papilla, express mRNAs of GluR5 and KA1. However, non-taste tongue epithelium expresses no subunits of non-NMDA GluRs. Isolated single cell RT-PCR reveals that the mRNAs of GluR5 and KA1 are preferentially expressed in Type II and Type III cells over Type I cells.

Kainate receptors coming of age: milestones of two decades of research.

PubMed

Contractor, Anis; Mulle, Christophe; Swanson, Geoffrey T

2011-03-01

Two decades have passed since the first report of the cloning of a kainate-type glutamate receptor (KAR) subunit. The intervening years have seen a rapid growth in our understanding of the biophysical properties and function of KARs in the brain. This research has led to an appreciation that KARs play very distinct roles at synapses relative to other members of the glutamate-gated ion channel receptor family, despite structural and functional commonalities. The surprisingly diverse and complex nature of KAR signaling underlies their unique impact upon neuronal networks through their direct and indirect effects on synaptic transmission, and their prominent role in regulating cell excitability. This review pieces together highlights from the two decades of research subsequent to the cloning of the first subunit, and provides an overview of our current understanding of the role of KARs in the CNS and their potential importance to neurological and neuropsychiatric disorders. Copyright © 2011 Elsevier Ltd. All rights reserved.

Kainate receptor pore‐forming and auxiliary subunits regulate channel block by a novel mechanism

PubMed Central

Brown, Patricia M. G. E.; Aurousseau, Mark R. P.; Musgaard, Maria; Biggin, Philip C.

2016-01-01

Key points Kainate receptor heteromerization and auxiliary subunits, Neto1 and Neto2, attenuate polyamine ion‐channel block by facilitating blocker permeation.Relief of polyamine block in GluK2/GluK5 heteromers results from a key proline residue that produces architectural changes in the channel pore α‐helical region.Auxiliary subunits exert an additive effect to heteromerization, and thus relief of polyamine block is due to a different mechanism.Our findings have broad implications for work on polyamine block of other cation‐selective ion channels. Abstract Channel block and permeation by cytoplasmic polyamines is a common feature of many cation‐selective ion channels. Although the channel block mechanism has been studied extensively, polyamine permeation has been considered less significant as it occurs at extreme positive membrane potentials. Here, we show that kainate receptor (KAR) heteromerization and association with auxiliary proteins, Neto1 and Neto2, attenuate polyamine block by enhancing blocker permeation. Consequently, polyamine permeation and unblock occur at more negative and physiologically relevant membrane potentials. In GluK2/GluK5 heteromers, enhanced permeation is due to a single proline residue in GluK5 that alters the dynamics of the α‐helical region of the selectivity filter. The effect of auxiliary proteins is additive, and therefore the structural basis of polyamine permeation and unblock is through a different mechanism. As native receptors are thought to assemble as heteromers in complex with auxiliary proteins, our data identify an unappreciated impact of polyamine permeation in shaping the signalling properties of neuronal KARs and point to a structural mechanism that may be shared amongst other cation‐selective ion channels. PMID:26682513

Enhanced susceptibility of Prnp-deficient mice to kainate-induced seizures, neuronal apoptosis, and death: Role of AMPA/kainate receptors.

PubMed

Rangel, Alejandra; Burgaya, Ferran; Gavín, Rosalina; Soriano, Eduardo; Aguzzi, Adriano; Del Río, José A

2007-09-01

Normal physiologic functions of the cellular prion protein (PrPc) are still elusive. This GPI-anchored protein exerts many functions, including roles in neuron proliferation, neuroprotection or redox homeostasis. There are, however, conflicting data concerning its role in synaptic transmission. Although several studies report that PrPc participates in NMDA-mediated neurotransmission, parallel studies describe normal behavior of PrPc-mutant mice. Abnormal axon connections have been described in the dentate gyrus of the hippocampi of PrPc-deficient mice similar to those observed in epilepsy. A study indicates increased susceptibility to kainate (KA) in these mutant mice. We extend the observation of these studies by means of several histologic and biochemical analyses of KA-treated mice. PrPc-deficient mice showed increased sensitivity to KA-induced seizures in vivo and in vitro in organotypic slices. In addition, we show that this sensitivity is cell-specific because interference experiments to abolish PrPc expression increased susceptibility to KA in PrPc-expressing cells. We indicate a correlation of susceptibility to KA in cells lacking PrPc with the differential expression of GluR6 and GluR7 KA receptor subunits using real-time RT-PCR methods. These results indicate that PrPc exerts a neuroprotective role against KA-induced neurotoxicity, probably by regulating the expression of KA receptor subunits. (c) 2007 Wiley-Liss, Inc.

PSD-95 regulates synaptic kainate receptors at mouse hippocampal mossy fiber-CA3 synapses.

PubMed

Suzuki, Etsuko; Kamiya, Haruyuki

2016-06-01

Kainate-type glutamate receptors (KARs) are the third class of ionotropic glutamate receptors whose activation leads to the unique roles in regulating synaptic transmission and circuit functions. In contrast to AMPA receptors (AMPARs), little is known about the mechanism of synaptic localization of KARs. PSD-95, a major scaffold protein of the postsynaptic density, is a candidate molecule that regulates the synaptic KARs. Although PSD-95 was shown to bind directly to KARs subunits, it has not been tested whether PSD-95 regulates synaptic KARs in intact synapses. Using PSD-95 knockout mice, we directly investigated the role of PSD-95 in the KARs-mediated components of synaptic transmission at hippocampal mossy fiber-CA3 synapse, one of the synapses with the highest density of KARs. Mossy fiber EPSCs consist of AMPA receptor (AMPAR)-mediated fast component and KAR-mediated slower component, and the ratio was significantly reduced in PSD-95 knockout mice. The size of KARs-mediated field EPSP reduced in comparison with the size of the fiber volley. Analysis of KARs-mediated miniature EPSCs also suggested reduced synaptic KARs. All the evidence supports critical roles of PSD-95 in regulating synaptic KARs. Copyright © 2015 Elsevier Ireland Ltd and Japan Neuroscience Society. All rights reserved.

Presynaptic kainate receptor-mediated facilitation of glutamate release involves Ca2+ -calmodulin at mossy fiber-CA3 synapses.

PubMed

Andrade-Talavera, Yuniesky; Duque-Feria, Paloma; Negrete-Díaz, José Vicente; Sihra, Talvinder S; Flores, Gonzalo; Rodríguez-Moreno, Antonio

2012-09-01

Presynaptic kainate receptors (KARs) modulate the release of glutamate at synapses established between mossy fibers (MF) and CA3 pyramidal cells in the hippocampus. The activation of KAR by low, nanomolar, kainate concentrations facilitates glutamate release. KAR-mediated facilitation of glutamate release involves the activation of an adenylate cyclase/cyclic adenosine monophosphate/protein kinase A cascade at MF-CA3 synapses. Here, we studied the mechanisms by which KAR activation produces this facilitation of glutamate release in slices and synaptosomes. We find that the facilitation of glutamate release mediated by KAR activation requires an increase in Ca(2+) levels in the cytosol and the formation of a Ca(2+) -calmodulin complex to activate adenylate cyclase. The increase in cytosolic Ca(2+) underpinning this modulation is achieved, both, by Ca(2+) entering via Ca(2+) -permeable KARs and, by the mobilization of intraterminal Ca(2+) stores. Finally, we find that, congruent with the Ca(2+) -calmodulin support of KAR-mediated facilitation of glutamate release, induction of long-term potentiation at MF-CA3 synapses has an obligate requirement for Ca(2+) -calmodulin activity. © 2012 The Authors. Journal of Neurochemistry © 2012 International Society for Neurochemistry.

A subconvulsive dose of kainate selectively compromises astrocytic metabolism in the mouse brain in vivo.

PubMed

Walls, Anne B; Eyjolfsson, Elvar M; Schousboe, Arne; Sonnewald, Ursula; Waagepetersen, Helle S

2014-08-01

Despite the well-established use of kainate as a model for seizure activity and temporal lobe epilepsy, most studies have been performed at doses giving rise to general limbic seizures and have mainly focused on neuronal function. Little is known about the effect of lower doses of kainate on cerebral metabolism and particularly that associated with astrocytes. We investigated astrocytic and neuronal metabolism in the cerebral cortex of adult mice after treatment with saline (controls), a subconvulsive or a mildly convulsive dose of kainate. A combination of [1,2-(13)C]acetate and [1-(13)C]glucose was injected and subsequent nuclear magnetic resonance spectroscopy of cortical extracts was employed to distinctively map astrocytic and neuronal metabolism. The subconvulsive dose of kainate led to an instantaneous increase in the cortical lactate content, a subsequent reduction in the amount of [4,5-(13)C]glutamine and an increase in the calculated astrocytic TCA cycle activity. In contrast, the convulsive dose led to decrements in the cortical content and (13)C labeling of glutamate, glutamine, GABA, and aspartate. Evidence is provided that astrocytic metabolism is affected by a subconvulsive dose of kainate, whereas a higher dose is required to affect neuronal metabolism. The cerebral glycogen content was dose-dependently reduced by kainate supporting a role for glycogen during seizure activity.

A subconvulsive dose of kainate selectively compromises astrocytic metabolism in the mouse brain in vivo

PubMed Central

Walls, Anne B; Eyjolfsson, Elvar M; Schousboe, Arne; Sonnewald, Ursula; Waagepetersen, Helle S

2014-01-01

Despite the well-established use of kainate as a model for seizure activity and temporal lobe epilepsy, most studies have been performed at doses giving rise to general limbic seizures and have mainly focused on neuronal function. Little is known about the effect of lower doses of kainate on cerebral metabolism and particularly that associated with astrocytes. We investigated astrocytic and neuronal metabolism in the cerebral cortex of adult mice after treatment with saline (controls), a subconvulsive or a mildly convulsive dose of kainate. A combination of [1,2-13C]acetate and [1-13C]glucose was injected and subsequent nuclear magnetic resonance spectroscopy of cortical extracts was employed to distinctively map astrocytic and neuronal metabolism. The subconvulsive dose of kainate led to an instantaneous increase in the cortical lactate content, a subsequent reduction in the amount of [4,5-13C]glutamine and an increase in the calculated astrocytic TCA cycle activity. In contrast, the convulsive dose led to decrements in the cortical content and 13C labeling of glutamate, glutamine, GABA, and aspartate. Evidence is provided that astrocytic metabolism is affected by a subconvulsive dose of kainate, whereas a higher dose is required to affect neuronal metabolism. The cerebral glycogen content was dose-dependently reduced by kainate supporting a role for glycogen during seizure activity. PMID:24824917

Potentiation of tonic GABAergic inhibition by activation of postsynaptic kainate receptors.

PubMed

Jiang, L; Kang, D; Kang, J

2015-07-09

Presynaptic kainate-type glutamate ionotropic receptors (KARs) that mediate either the depression or the facilitation of GABA release have been intensively studied. Little attention has been given to the modulation of GABAA receptors (GABAARs) by postsynaptic KARs. Recent studies suggest that two GABAAR populations, synaptic (sGABAAR) and extrasynaptic (eGABAAR) GABAARs, mediate phasic and tonic forms of inhibition, respectively. Tonic inhibition plays an important role in the excitability of neuronal circuits and the occurrence of epileptic seizures. For this study, we are the first to report that the activation of postsynaptic KARs by the KAR agonist, Kainic acid (KA, 5 μM), enhanced tonic inhibition by potentiating eGABAARs. KA enhanced THIP-induced eGABAAR currents and prolonged the rise and decay time of muscimol-induced sGABAAR/eGABAAR currents, but also depressed the amplitude of evoked inhibitory postsynaptic currents (IPSCs), unitary IPSCs (uIPSCs), and muscimol-induced sGABAAR/eGABAAR currents. The PKC inhibitor, staurosporine (1 μM), in the patch pipette solution fully blocked the KA-induced potentiation of tonic inhibition, suggesting the involvement of an intracellular PKC pathway. Our study suggests that the activation of postsynaptic KARs potentiates eGABAARs but depresses sGABAARs. By activating postsynaptic KARs, synaptically released glutamate depresses phasic inhibition to facilitate neuronal plasticity, but potentiates tonic inhibition to protect neurons from over-excitation. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

Interactions among GYKI-52466, cyclothiazide, and aniracetam at recombinant AMPA and kainate receptors.

PubMed

Johansen, T H; Chaudhary, A; Verdoorn, T A

1995-11-01

We examined the actions of cyclothiazide, aniracetam, and 1-(4-aminophenyl)-4-methyl-7,8-methylenedioxy-5H-2,3-benzodiazepine (GYKI-52466) on recombinant alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) and kainate receptors. Receptors expressed in Xenopus oocytes or human embryonic kidney 293 cells were characterized using voltage and patch-clamp electrophysiology. Aniracetam and cyclothiazide potentiated AMPA receptor currents by slowing or blocking desensitization. Cyclothiazide was more potent at receptors consisting of flip subunits compared with receptors consisting of flop subunits, whereas aniracetam appeared to be more efficacious at flop receptors. The potency of GYKI-52466 did not differ in heteromeric flip or flop containing AMPA receptors, but GYKI-52466 was less potent at homomeric GluRAi and GluRDi receptors. At heteromeric AMPA receptors, 50 microM cyclothiazide increased the IC50 value for GYKI-52466 significantly. The increase was largest in GluRBi/Di receptors where the IC50 value shifted from 21.9 microM (95% confidence interval, 12.0-39.8 microM) to 126 microM (95% confidence interval, 72.4-214 microM) in the presence of cyclothiazide. In contrast, 100 microM GYKI-52466 did not alter the EC50 of cyclothiazide at GluRBi/Di receptors nor did it markedly change the maximal potentiation induced by cyclothiazide. At GluRBi/Di receptors transiently expressed in human embryonic kidney 293 cells, 30 microM GYKI-52466 inhibited the steady state and the peak current evoked by 300 microns L-glutamate to the same extent (34.5 +/- 12% and 27.3 +/- 13.0%, respectively; five experiments), and GYKI-52466 did not alter the apparent rate of desensitization (tau = 15.7 +/- 4.7 and 17.5 +/- 8.3 msec in the absence and presence of GYKI-52466, respectively; five experiments). GYKI-52466 inhibited L-glutamate currents in the presence and absence of 10 microM cyclothiazide, but GYKI-52466 never restored the desensitization that was blocked by cyclothiazide

Subunit-dependent postsynaptic expression of kainate receptors on hippocampal interneurons in area CA1

PubMed Central

Wondolowski, Joyce; Frerking, Matthew

2009-01-01

Kainate receptors (KARs) contribute to postsynaptic excitation in only a select subset of neurons. To define the parameters that specify the postsynaptic expression of KARs, we examined the contribution of KARs to EPSCs on hippocampal interneurons in area CA1. Interneurons in stratum radiatum/lacunosum-moleculare (SR/SLM) express KARs both with and without the GluR5 subunit, but KAR-mediated EPSCs are generated mainly, if not entirely, by GluR5-containing KARs. Extrasynaptic glutamate spillover profoundly recruits AMPARs with little effect on KARs, indicating that KARs are targeted at the synapse more precisely than AMPARs. However, spontaneous EPSCs with a conventional AMPAR component did not have a resolvable contribution of KARs, suggesting that the KARs that contribute to the evoked EPSCs are at a distinct set of synapses. GluR5-containing KARs on interneurons in stratum oriens do not contribute substantially to the EPSC. We conclude that KARs are localized to synapses by cell type-, synapse-, and subunit-selective mechanisms. PMID:19144856

Selective Androgen Receptor Modulator RAD140 Is Neuroprotective in Cultured Neurons and Kainate-Lesioned Male Rats

PubMed Central

Jayaraman, Anusha; Christensen, Amy; Moser, V. Alexandra; Vest, Rebekah S.; Miller, Chris P.; Hattersley, Gary

2014-01-01

The decline in testosterone levels in men during normal aging increases risks of dysfunction and disease in androgen-responsive tissues, including brain. The use of testosterone therapy has the potential to increase the risks for developing prostate cancer and or accelerating its progression. To overcome this limitation, novel compounds termed “selective androgen receptor modulators” (SARMs) have been developed that lack significant androgen action in prostate but exert agonist effects in select androgen-responsive tissues. The efficacy of SARMs in brain is largely unknown. In this study, we investigate the SARM RAD140 in cultured rat neurons and male rat brain for its ability to provide neuroprotection, an important neural action of endogenous androgens that is relevant to neural health and resilience to neurodegenerative diseases. In cultured hippocampal neurons, RAD140 was as effective as testosterone in reducing cell death induced by apoptotic insults. Mechanistically, RAD140 neuroprotection was dependent upon MAPK signaling, as evidenced by elevation of ERK phosphorylation and inhibition of protection by the MAPK kinase inhibitor U0126. Importantly, RAD140 was also neuroprotective in vivo using the rat kainate lesion model. In experiments with gonadectomized, adult male rats, RAD140 was shown to exhibit peripheral tissue-specific androgen action that largely spared prostate, neural efficacy as demonstrated by activation of androgenic gene regulation effects, and neuroprotection of hippocampal neurons against cell death caused by systemic administration of the excitotoxin kainate. These novel findings demonstrate initial preclinical efficacy of a SARM in neuroprotective actions relevant to Alzheimer's disease and related neurodegenerative diseases. PMID:24428527

N-linked glycosylation of cortical N-methyl-D-aspartate and kainate receptor subunits in schizophrenia.

PubMed

Tucholski, Janusz; Simmons, Micah S; Pinner, Anita L; McMillan, Laurence D; Haroutunian, Vahram; Meador-Woodruff, James H

2013-08-21

Dysfunctional glutamate neurotransmission has been implicated in the pathophysiology of schizophrenia. Abnormal expressions in schizophrenia of ionotropic glutamate receptors (iGluRs) and the proteins that regulate their trafficking have been found to be region and subunit specific in brain, suggesting that abnormal trafficking of iGluRs may contribute toward altered glutamatergic neurotransmission. The post-translational modification N-glycosylation of iGluR subunits can be used as a proxy for their intracellular localization. Receptor complexes assemble in the lumen of the endoplasmic reticulum, where N-glycosylation begins with the addition of N-linked oligomannose glycans, and is subsequently trimmed and replaced by more elaborate glycans while trafficking through the Golgi apparatus. Previously, we found abnormalities in N-glycosylation of the GluR2 AMPA receptor subunit in schizophrenia. Here, we investigated N-glycosylation of N-methyl-D-aspartate and kainate (KA) receptor subunits in the dorsolateral prefrontal cortex from patients with schizophrenia and a comparison group. We used enzymatic deglycosylation with two glycosidases: endoglycosidase H (Endo H), which removes immature high mannose-containing sugars, and peptide-N-glycosidase F (PNGase F), which removes all N-linked sugars. The NR1, NR2A, NR2B, GluR6, and KA2 subunits were all sensitive to treatment with Endo H and PNGase F. The GluR6 KA receptor subunit was significantly more sensitive to Endo H-mediated deglycosylation in schizophrenia, suggesting a larger molecular mass of N-linked high mannose and/or hybrid sugars on GluR6. This finding, taken with our previous work, suggests that a cellular mechanism underlying abnormal glutamate neurotransmission in schizophrenia may involve abnormal trafficking of both AMPA and KA receptors.

Modulation of ionotropic glutamate receptor function by vertebrate galectins

PubMed Central

Copits, Bryan A; Vernon, Claire G; Sakai, Ryuichi; Swanson, Geoffrey T

2014-01-01

AMPA and kainate receptors are glutamate-gated ion channels whose function is known to be altered by a variety of plant oligosaccharide-binding proteins, or lectins, but the physiological relevance of this activity has been uncertain because no lectins with analogous allosteric modulatory effects have been identified in animals. We report here that members of the prototype galectin family, which are β-galactoside-binding lectins, exhibit subunit-specific allosteric modulation of desensitization of recombinant homomeric and heteromeric AMPA and kainate receptors. Galectin modulation of GluK2 kainate receptors was dependent upon complex oligosaccharide processing of N-glycosylation sites in the amino-terminal domain and downstream linker region. The sensitivity of GluA4 AMPA receptors to human galectin-1 could be enhanced by supplementation of culture media with uridine and N-acetylglucosamine (GlcNAc), precursors for the hexosamine pathway that supplies UDP-GlcNAc for synthesis of complex oligosaccharides. Neuronal kainate receptors in dorsal root ganglia were sensitive to galectin modulation, whereas AMPA receptors in cultured hippocampal neurons were insensitive, which could be a reflection of differential N-glycan processing or receptor subunit selectivity. Because glycan content of integral proteins can be modified dynamically, we postulate that physiological or pathological conditions in the CNS could arise in which galectins alter excitatory neurotransmission or neuronal excitability through their actions on AMPA or kainate receptors. PMID:24614744

Zn2+ currents are mediated by calcium-permeable AMPA/Kainate channels in cultured murine hippocampal neurones

PubMed Central

Jia, Yousheng; Jeng, Jade-Ming; Sensi, Stefano L; Weiss, John H

2002-01-01

Permeation of the endogenous cation Zn2+ through calcium-permeable AMPA/kainate receptor-gated (Ca-A/K) channels might subserve pathological and/or physiological signalling roles. Voltage-clamp recording was used to directly assess Zn2+ flux through these channels on cultured murine hippocampal neurones. Ca-A/K channels were present in large numbers only on a minority of neurones (Ca-A/K(+) neurones), many of which were GABAergic. The presence of these channels was assessed in whole-cell or outside-out patch recording as the degree of inward rectification of kainate-activated currents, quantified via a rectification index (RI = G+40/G-60), which ranged from <0.4 (strongly inwardly rectifying) to >2 (outwardly rectifying). The specificity of a low RI as an indication of robust Ca-A/K channel expression was verified by two other techniques, kainate-stimulated cobalt-uptake labelling, and fluorescence imaging of kainate-induced increases in intracellular Ca2+. In addition, the degree of inward rectification of kainate-activated currents correlated strongly with the positive shift of the reversal potential (Vrev) upon switching to a sodium-free, 10 mm Ca2+ buffer. With Zn2+ (3 mm) as the only permeant extracellular cation, kainate-induced inward currents were only observed in neurones that had previously been identified as Ca-A/K(+). A comparison between the Vrev observed with 3 mm Zn2+ and that observed with Ca2+ as the permeant cation revealed a PCa/PZn of ≈1.8. Inward currents recorded in 3 mm Ca2+ were unaffected by the addition of 0.3 mm Zn2+, while microfluorimetrically detected increases in the intracellular concentration of Zn2+ in Ca-A/K(+) neurones upon kainate exposure in the presence of 0.3 mm Zn2+ were only mildly attenuated by the addition of 1.8 mm Ca2+. These results provide direct evidence that Zn2+ can carry currents through Ca-A/K channels, and that there is little interference between Ca2+ and Zn2+ in permeating these channels. PMID:12181280

Evidence for a Specific Integrative Mechanism for Episodic Memory Mediated by AMPA/kainate Receptors in a Circuit Involving Medial Prefrontal Cortex and Hippocampal CA3 Region.

PubMed

de Souza Silva, Maria A; Huston, Joseph P; Wang, An-Li; Petri, David; Chao, Owen Yuan-Hsin

2016-07-01

We asked whether episodic-like memory requires neural mechanisms independent of those that mediate its component memories for "what," "when," and "where," and if neuronal connectivity between the medial prefrontal cortex (mPFC) and the hippocampus (HPC) CA3 subregion is essential for episodic-like memory. Unilateral lesion of the mPFC was combined with unilateral lesion of the CA3 in the ipsi- or contralateral hemispheres in rats. Episodic-like memory was tested using a task, which assesses the integration of memories for "what, where, and when" concomitantly. Tests for novel object recognition (what), object place (where), and temporal order memory (when) were also applied. Bilateral disconnection of the mPFC-CA3 circuit by N-methyl-d-aspartate (NMDA) lesions disrupted episodic-like memory, but left the component memories for object, place, and temporal order, per se, intact. Furthermore, unilateral NMDA lesion of the CA3 plus injection of (6-cyano-7-nitroquinoxaline-2,3-dione) (CNQX) (AMPA/kainate receptor antagonist), but not AP-5 (NMDA receptor antagonist), into the contralateral mPFC also disrupted episodic-like memory, indicating the mPFC AMPA/kainate receptors as critical for this circuit. These results argue for a selective neural system that specifically subserves episodic memory, as it is not critically involved in the control of its component memories for object, place, and time. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Pre-synaptic kainate receptor-mediated facilitation of glutamate release involves PKA and Ca(2+) -calmodulin at thalamocortical synapses.

PubMed

Andrade-Talavera, Yuniesky; Duque-Feria, Paloma; Sihra, Talvinder S; Rodríguez-Moreno, Antonio

2013-09-01

We have investigated the mechanisms underlying the facilitatory modulation mediated by kainate receptor (KAR) activation in the cortex, using isolated nerve terminals (synaptosomes) and slice preparations. In cortical nerve terminals, kainate (KA, 100 μM) produced an increase in 4-aminopyridine (4-AP)-evoked glutamate release. In thalamocortical slices, KA (1 μM) produced an increase in the amplitude of evoked excitatory post-synaptic currents (eEPSCs) at synapses established between thalamic axon terminals from the ventrobasal nucleus onto stellate neurons of L4 of the somatosensory cortex. In both, synaptosomes and slices, the effect of KA was antagonized by 6-cyano-7-nitroquinoxaline-2,3-dione, and persisted after pre-treatment with a cocktail of antagonists of other receptors whose activation could potentially have produced facilitation of release indirectly. Mechanistically, the observed effects of KA appear to be congruent in synaptosomal and slice preparations. Thus, the facilitation by KA of synaptosomal glutamate release and thalamocortical synaptic transmission were suppressed by the inhibition of protein kinase A and occluded by the stimulation of adenylyl cyclase. Dissecting this G-protein-independent regulation further in thalamocortical slices, the KAR-mediated facilitation of synaptic transmission was found to be sensitive to the block of Ca(2+) permeant KARs by philanthotoxin. Intriguingly, the synaptic facilitation was abrogated by depletion of intracellular Ca(2+) stores by thapsigargin, or inhibition of Ca(2+) -induced Ca(2+) -release by ryanodine. Thus, the KA-mediated modulation was contingent on both Ca(2+) entry through Ca(2+) -permeable KARs and liberation of intracellular Ca(2+) stores. Finally, sensitivity to W-7 indicated that the increased cytosolic [Ca(2+) ] underpinning KAR-mediated regulation of synaptic transmission at thalamocortical synapses, requires downstream activation of calmodulin. We conclude that neocortical pre

Small GTPase Rab17 Regulates the Surface Expression of Kainate Receptors but Not α-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid (AMPA) Receptors in Hippocampal Neurons via Dendritic Trafficking of Syntaxin-4 Protein*

PubMed Central

Mori, Yasunori; Fukuda, Mitsunori; Henley, Jeremy M.

2014-01-01

Glutamate receptors are fundamental for control synaptic transmission, synaptic plasticity, and neuronal excitability. However, many of the molecular mechanisms underlying their trafficking remain elusive. We previously demonstrated that the small GTPase Rab17 regulates dendritic trafficking in hippocampal neurons. Here, we investigated the role(s) of Rab17 in AMPA receptor (AMPAR) and kainate receptor (KAR) trafficking. Although Rab17 knockdown did not affect surface expression of the AMPAR subunit GluA1 under basal or chemically induced long term potentiation conditions, it significantly reduced surface expression of the KAR subunit GluK2. Rab17 co-localizes with Syntaxin-4 in the soma, dendritic shaft, the tips of developing hippocampal neurons, and in spines. Rab17 knockdown caused Syntaxin-4 redistribution away from dendrites and into axons in developing hippocampal neurons. Syntaxin-4 knockdown reduced GluK2 but had no effect on GluA1 surface expression. Moreover, overexpression of constitutively active Rab17 promoted dendritic surface expression of GluK2 by enhancing Syntaxin-4 translocation to dendrites. These data suggest that Rab17 mediates the dendritic trafficking of Syntaxin-4 to selectively regulate dendritic surface insertion of GluK2-containing KARs in rat hippocampal neurons. PMID:24895134

A kainate receptor subunit promotes the recycling of the neuron-specific K+-Cl- co-transporter KCC2 in hippocampal neurons.

PubMed

Pressey, Jessica C; Mahadevan, Vivek; Khademullah, C Sahara; Dargaei, Zahra; Chevrier, Jonah; Ye, Wenqing; Huang, Michelle; Chauhan, Alamjeet K; Meas, Steven J; Uvarov, Pavel; Airaksinen, Matti S; Woodin, Melanie A

2017-04-14

Synaptic inhibition depends on a transmembrane gradient of chloride, which is set by the neuron-specific K + -Cl - co-transporter KCC2. Reduced KCC2 levels in the neuronal membrane contribute to the generation of epilepsy, neuropathic pain, and autism spectrum disorders; thus, it is important to characterize the mechanisms regulating KCC2 expression. In the present study, we determined the role of KCC2-protein interactions in regulating total and surface membrane KCC2 expression. Using quantitative immunofluorescence in cultured mouse hippocampal neurons, we discovered that the kainate receptor subunit GluK2 and the auxiliary subunit Neto2 significantly increase the total KCC2 abundance in neurons but that GluK2 exclusively increases the abundance of KCC2 in the surface membrane. Using a live cell imaging assay, we further determined that KCC2 recycling primarily occurs within 1-2 h and that GluK2 produces an ∼40% increase in the amount of KCC2 recycled to the membrane during this time period. This GluK2-mediated increase in surface recycling translated to a significant increase in KCC2 expression in the surface membrane. Moreover, we found that KCC2 recycling is enhanced by protein kinase C-mediated phosphorylation of the GluK2 C-terminal residues Ser-846 and Ser-868. Lastly, using gramicidin-perforated patch clamp recordings, we found that the GluK2-mediated increase in KCC2 recycling to the surface membrane translates to a hyperpolarization of the reversal potential for GABA (E GABA ). In conclusion, our results have revealed a mechanism by which kainate receptors regulate KCC2 expression in the hippocampus. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Different structural requirements for functional ion pore transplantation suggest different gating mechanisms of NMDA and kainate receptors.

PubMed

Villmann, Carmen; Hoffmann, Jutta; Werner, Markus; Kott, Sabine; Strutz-Seebohm, Nathalie; Nilsson, Tanja; Hollmann, Michael

2008-10-01

Although considerable progress has been made in characterizing the physiological function of the high-affinity kainate (KA) receptor subunits KA1 and KA2, no homomeric ion channel function has been shown. An ion channel transplantation approach was employed in this study to directly test if homomerically expressed KA1 and KA2 pore domains are capable of conducting currents. Transplantation of the ion pore of KA1 or KA2 into GluR6 generated perfectly functional ion channels that allowed characterization of those electrophysiological and pharmacological properties that are determined exclusively by the ion pore of KA1 or KA2. This demonstrates for the first time that KA1 and KA2 ion pore domains are intrinsically capable of conducting ions even in homomeric pore assemblies. NMDA receptors, similar to KA1- or KA2-containing receptors, function only as heteromeric complexes. They are composed of NR1 and NR2 subunits, which both are non-functional when expressed homomerically. In contrast to NR1, the homomeric NR2B ion pore failed to translate ligand binding into pore opening when transplanted into GluR6. Similarly, heteromeric coexpression of the ion channel domains of both NR1 and NR2 inserted into GluR6 failed to produce functional channels. Therefore, we conclude that the mechanism underlying the ion channel opening in the obligatorily heterotetrameric NMDA receptors differs significantly from that in the facultatively heterotetrameric alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate and KA receptors.

Neto2 Assembles with Kainate Receptors in DRG Neurons during Development and Modulates Neurite Outgrowth in Adult Sensory Neurons

PubMed Central

Vernon, Claire G.

2017-01-01

Peripheral sensory neurons in the dorsal root ganglia (DRG) are the initial transducers of sensory stimuli, including painful stimuli, from the periphery to central sensory and pain-processing centers. Small- to medium-diameter non-peptidergic neurons in the neonatal DRG express functional kainate receptors (KARs), one of three subfamilies of ionotropic glutamate receptors, as well as the putative KAR auxiliary subunit Neuropilin- and tolloid-like 2 (Neto2). Neto2 alters recombinant KAR function markedly but has yet to be confirmed as an auxiliary subunit that assembles with and alters the function of endogenous KARs. KARs in neonatal DRG require the GluK1 subunit as a necessary constituent, but it is unclear to what extent other KAR subunits contribute to the function and proposed roles of KARs in sensory ganglia, which include promotion of neurite outgrowth and modulation of glutamate release at the DRG–dorsal horn synapse. In addition, KARs containing the GluK1 subunit are implicated in modes of persistent but not acute pain signaling. We show here that the Neto2 protein is highly expressed in neonatal DRG and modifies KAR gating in DRG neurons in a developmentally regulated fashion in mice. Although normally at very low levels in adult DRG neurons, Neto2 protein expression can be upregulated via MEK/ERK signaling and after sciatic nerve crush and Neto2−/− neurons from adult mice have stunted neurite outgrowth. These data confirm that Neto2 is a bona fide KAR auxiliary subunit that is an important constituent of KARs early in sensory neuron development and suggest that Neto2 assembly is critical to KAR modulation of DRG neuron process outgrowth. SIGNIFICANCE STATEMENT Pain-transducing peripheral sensory neurons of the dorsal root ganglia (DRG) express kainate receptors (KARs), a subfamily of glutamate receptors that modulate neurite outgrowth and regulate glutamate release at the DRG–dorsal horn synapse. The putative KAR auxiliary subunit Neuropilin- and

Modulation of ionotropic glutamate receptor function by vertebrate galectins.

PubMed

Copits, Bryan A; Vernon, Claire G; Sakai, Ryuichi; Swanson, Geoffrey T

2014-05-15

AMPA and kainate receptors are glutamate-gated ion channels whose function is known to be altered by a variety of plant oligosaccharide-binding proteins, or lectins, but the physiological relevance of this activity has been uncertain because no lectins with analogous allosteric modulatory effects have been identified in animals. We report here that members of the prototype galectin family, which are β-galactoside-binding lectins, exhibit subunit-specific allosteric modulation of desensitization of recombinant homomeric and heteromeric AMPA and kainate receptors. Galectin modulation of GluK2 kainate receptors was dependent upon complex oligosaccharide processing of N-glycosylation sites in the amino-terminal domain and downstream linker region. The sensitivity of GluA4 AMPA receptors to human galectin-1 could be enhanced by supplementation of culture media with uridine and N-acetylglucosamine (GlcNAc), precursors for the hexosamine pathway that supplies UDP-GlcNAc for synthesis of complex oligosaccharides. Neuronal kainate receptors in dorsal root ganglia were sensitive to galectin modulation, whereas AMPA receptors in cultured hippocampal neurons were insensitive, which could be a reflection of differential N-glycan processing or receptor subunit selectivity. Because glycan content of integral proteins can be modified dynamically, we postulate that physiological or pathological conditions in the CNS could arise in which galectins alter excitatory neurotransmission or neuronal excitability through their actions on AMPA or kainate receptors. © 2014 The Authors. The Journal of Physiology © 2014 The Physiological Society.

Losartan suppresses the kainate-induced changes of angiotensin AT1 receptor expression in a model of comorbid hypertension and epilepsy.

PubMed

Atanasova, Dimitrinka; Tchekalarova, Jana; Ivanova, Natasha; Nenchovska, Zlatina; Pavlova, Ekaterina; Atanassova, Nina; Lazarov, Nikolai

2018-01-15

Experimental and clinical studies have demonstrated that components of renin-angiotensin system are elevated in the hippocampus in epileptogenic conditions. In the present work, we explored the changes in the expression of angiotensin II receptor, type 1 (AT 1 receptor) in limbic structures, as well as the effect of the AT1 receptor antagonist losartan in a model of comorbid hypertension and epilepsy. The expression of AT 1 receptors was compared between spontaneously hypertensive rats (SHRs) and Wistar rats by using immunohistochemistry in the kainate (KA) model of temporal lobe epilepsy (TLE). The effect of losartan was studied on AT 1 receptor expression in epileptic rats that were treated for a period of 4weeks after status epilepticus. The naive and epileptic SHRs were characterized by stronger protein expression of AT 1 receptor than normotensive Wistar rats in the CA1, CA3a, CA3b, CA3c field and the hilus of the dentate gyrus of the dorsal hippocampus but fewer cells were immunostained in the piriform cortex. Increased AT 1 immunostaining was observed in the basolateral amygdala of epileptic SHRs but not of epileptic Wistar rats. Losartan exerted stronger and structure-dependent suppression of AT 1 receptor expression in SHRs compared to Wistar rats. Our results confirm the important role of AT 1 receptor in epilepsy and suggest that the AT 1 receptor antagonists could be used as a therapeutic strategy for treatment of comorbid hypertension and epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.

Neto2 Assembles with Kainate Receptors in DRG Neurons during Development and Modulates Neurite Outgrowth in Adult Sensory Neurons.

PubMed

Vernon, Claire G; Swanson, Geoffrey T

2017-03-22

Peripheral sensory neurons in the dorsal root ganglia (DRG) are the initial transducers of sensory stimuli, including painful stimuli, from the periphery to central sensory and pain-processing centers. Small- to medium-diameter non-peptidergic neurons in the neonatal DRG express functional kainate receptors (KARs), one of three subfamilies of ionotropic glutamate receptors, as well as the putative KAR auxiliary subunit Neuropilin- and tolloid-like 2 (Neto2). Neto2 alters recombinant KAR function markedly but has yet to be confirmed as an auxiliary subunit that assembles with and alters the function of endogenous KARs. KARs in neonatal DRG require the GluK1 subunit as a necessary constituent, but it is unclear to what extent other KAR subunits contribute to the function and proposed roles of KARs in sensory ganglia, which include promotion of neurite outgrowth and modulation of glutamate release at the DRG-dorsal horn synapse. In addition, KARs containing the GluK1 subunit are implicated in modes of persistent but not acute pain signaling. We show here that the Neto2 protein is highly expressed in neonatal DRG and modifies KAR gating in DRG neurons in a developmentally regulated fashion in mice. Although normally at very low levels in adult DRG neurons, Neto2 protein expression can be upregulated via MEK/ERK signaling and after sciatic nerve crush and Neto2 -/- neurons from adult mice have stunted neurite outgrowth. These data confirm that Neto2 is a bona fide KAR auxiliary subunit that is an important constituent of KARs early in sensory neuron development and suggest that Neto2 assembly is critical to KAR modulation of DRG neuron process outgrowth. SIGNIFICANCE STATEMENT Pain-transducing peripheral sensory neurons of the dorsal root ganglia (DRG) express kainate receptors (KARs), a subfamily of glutamate receptors that modulate neurite outgrowth and regulate glutamate release at the DRG-dorsal horn synapse. The putative KAR auxiliary subunit Neuropilin- and

Concentration-jump analysis of voltage-dependent conductances activated by glutamate and kainate in neurons of the avian cochlear nucleus.

PubMed Central

Raman, I M; Trussell, L O

1995-01-01

We have examined the mechanisms underlying the voltage sensitivity of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptors in voltage-clamped outside-out patches and whole cells taken from the nucleus magnocellularis of the chick. Responses to either glutamate or kainate had outwardly rectifying current-voltage relations. The rate and extent of desensitization during prolonged exposure to agonist, and the rate of deactivation after brief exposure to agonist, decreased at positive potentials, suggesting that a kinetic transition was sensitive to membrane potential. Voltage dependence of the peak conductance and of the deactivation kinetics persisted when desensitization was reduced with aniracetam or blocked with cyclothiazide. Furthermore, the rate of recovery from desensitization to glutamate was not voltage dependent. Upon reduction of extracellular divalent cation concentration, kainate-evoked currents increased but preserved rectifying current-voltage relations. Rectification was strongest at lower kainate concentrations. Surprisingly, nonstationary variance analysis of desensitizing responses to glutamate or of the current deactivation after kainate removal revealed an increase in the mean single-channel conductance with more positive membrane potentials. These data indicate that the rectification of the peak response to a high agonist concentration reflects an increase in channel conductance, whereas rectification of steady-state current is dominated by voltage-sensitive channel kinetics. Images FIGURE 2 FIGURE 3 PMID:8580330

Agonist- and subunit-dependent potentiation of glutamate receptors by a nootropic drug aniracetam.

PubMed

Tsuzuki, K; Takeuchi, T; Ozawa, S

1992-11-01

GluR1 and GluR2 cDNAs encoding non-NMDA subtypes of glutamate receptor were isolated from a rat brain cDNA library by Boulter et al. (Science, 249 (1990) 1033-1037). Functional receptors activated by kainate, alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) and glutamate were expressed in Xenopus oocytes injected with GluR1, GluR2 or a mixture of GluR1 and GluR2 RNAs. In GluR1-expressed oocytes, 1 mM aniracetam potentiated AMPA-induced currents by 99 +/- 10% (mean +/- S.E.M., n = 5) and glutamate-induced currents by 140 +/- 8% (n = 4), but little affected kainate-induced currents. Aniracetam was effective from a concentration of 0.1 mM, and it exhibited more conspicuous effects with the increase of the dose. In oocytes injected with GluR1 plus GluR2 RNAs, aniracetam more markedly potentiated current responses to AMPA and glutamate than those in oocytes injected with GluR1 RNA alone. For example, 1 mM aniracetam potentiated AMPA-induced currents by 396 +/- 76% (n = 4) and glutamate-induced currents by 970 +/- 65% (n = 5) in oocytes injected with 10% GluR1 and 90% GluR2 RNAs. In these oocytes, however, the potentiation of kainate-induced currents by 1 mM aniracetam was only 8 +/- 5% (n = 4). Thus, we conclude that the potentiation of the AMPA/kainate receptor by aniracetam depends on both species of agonists and subunit composition of the receptor.

Pharmacological Analysis of Ionotropic Glutamate Receptor Function in Neuronal Circuits of the Zebrafish Olfactory Bulb

PubMed Central

Tabor, Rico; Friedrich, Rainer W.

2008-01-01

Although synaptic functions of ionotropic glutamate receptors in the olfactory bulb have been studied in vitro, their roles in pattern processing in the intact system remain controversial. We therefore examined the functions of ionotropic glutamate receptors during odor processing in the intact olfactory bulb of zebrafish using pharmacological manipulations. Odor responses of mitral cells and interneurons were recorded by electrophysiology and 2-photon Ca2+ imaging. The combined blockade of AMPA/kainate and NMDA receptors abolished odor-evoked excitation of mitral cells. The blockade of AMPA/kainate receptors alone, in contrast, increased the mean response of mitral cells and decreased the mean response of interneurons. The blockade of NMDA receptors caused little or no change in the mean responses of mitral cells and interneurons. However, antagonists of both receptor types had diverse effects on the magnitude and time course of individual mitral cell and interneuron responses and, thus, changed spatio-temporal activity patterns across neuronal populations. Oscillatory synchronization was abolished or reduced by AMPA/kainate and NMDA receptor antagonists, respectively. These results indicate that (1) interneuron responses depend mainly on AMPA/kainate receptor input during an odor response, (2) interactions among mitral cells and interneurons regulate the total olfactory bulb output activity, (3) AMPA/kainate receptors participate in the synchronization of odor-dependent neuronal ensembles, and (4) ionotropic glutamate receptor-containing synaptic circuits shape odor-specific patterns of olfactory bulb output activity. These mechanisms are likely to be important for the processing of odor-encoding activity patterns in the olfactory bulb. PMID:18183297

Genetic ablation of the GluK4 kainate receptor subunit causes anxiolytic and antidepressant-like behavior in mice.

PubMed

Catches, Justin S; Xu, Jian; Contractor, Anis

2012-03-17

There is a clear link between dysregulation of glutamatergic signaling and mood disorders. Genetic variants in the glutamate receptor gene GRIK4, which encodes the kainate receptor subunit GluK4, alter the susceptibility for depression, bipolar disorder and schizophrenia. Here we demonstrate that Grik4(-/-) mice have reduced anxiety and an antidepressant-like phenotype. In the elevated zero-maze, a test for anxiety and risk taking behavior, Grik4(-/-) mice spent significantly more time exploring the open areas of the maze. In anxiogenic tests of marble-burying and novelty-induced suppression of feeding, anxiety-like behavior was consistently reduced in knockout animals. In the forced swim test, a test of learned helplessness that is used to determine depression-like behavior, knockout mice demonstrated significantly less immobility suggesting that Grik4 ablation has an antidepressant-like effect. Finally, in the sucrose preference test, a test for anhedonia in rodents, Grik4(-/-) mice demonstrated increased sucrose preference. Expression of the GluK4 receptor subunit in the forebrain is restricted to the CA3 region of the hippocampus and dentate gyrus regions where KARs are known to modulate synaptic plasticity. We tested whether Grik4 ablation had effects on mossy fiber (MF) plasticity and found there to be a significant impairment in LTP likely through a loss of KAR modulation of excitability of the presynaptic MF axons. These studies demonstrate a clear anxiolytic and antidepressant phenotype associated with ablation of Grik4 and a parallel disruption in hippocampal plasticity, providing support for the importance of this receptor subunit in mood disorders. Copyright © 2011 Elsevier B.V. All rights reserved.

Genetic ablation of the GluK4 kainate receptor subunit causes anxiolytic and antidepressant-like behavior in mice

PubMed Central

Catches, Justin S.; Xu, Jian; Contractor, Anis

2012-01-01

There is a clear link between dysregulation of glutamatergic signaling and mood disorders. Genetic variants in the glutamate receptor gene GRIK4, which encodes the kainate receptor subunit GluK4, alter the susceptibility for depression, bipolar disorder and schizophrenia. Here we demonstrate that Grik4−/− mice have reduced anxiety and an antidepressant-like phenotype. In the elevated zero-maze, a test for anxiety and risk taking behavior, Grik4−/− mice spent significantly more time exploring the open areas of the maze. In anxiogenic tests of marble-burying and novelty-induced suppression of feeding, anxiety-like behavior was consistently reduced in knockout animals. In the forced swim test, a test of learned helplessness that is used to determine depression-like behavior, knockout mice demonstrated significantly less immobility suggesting that Grik4 ablation has an antidepressant-like effect. Finally, in the sucrose preference test, a test for anhedonia in rodents, Grik4−/− mice demonstrated increased sucrose preference. Expression of the GluK4 receptor subunit in the forebrain is restricted to the CA3 region of the hippocampus and dentate gyrus regions where KARs are known to modulate synaptic plasticity. We tested whether Grik4 ablation had effects on mossy fiber (MF) plasticity and found there to be a significant impairment in LTP likely through a loss of KAR modulation of excitability of the presynaptic MF axons. These studies demonstrate a clear anxiolytic and antidepressant phenotype associated with ablation of Grik4 and a parallel disruption in hippocampal plasticity, providing support for the importance of this receptor subunit in mood disorders. PMID:22203159

High Concentrations of Tranexamic Acid Inhibit Ionotropic Glutamate Receptors.

PubMed

Lecker, Irene; Wang, Dian-Shi; Kaneshwaran, Kirusanthy; Mazer, C David; Orser, Beverley A

2017-07-01

The antifibrinolytic drug tranexamic acid is structurally similar to the amino acid glycine and may cause seizures and myoclonus by acting as a competitive antagonist of glycine receptors. Glycine is an obligatory co-agonist of the N-methyl-D-aspartate (NMDA) subtype of glutamate receptors. Thus, it is plausible that tranexamic acid inhibits NMDA receptors by acting as a competitive antagonist at the glycine binding site. The aim of this study was to determine whether tranexamic acid inhibits NMDA receptors, as well as α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid and kainate subtypes of ionotropic glutamate receptors. Tranexamic acid modulation of NMDA, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid, and kainate receptors was studied using whole cell voltage-clamp recordings of current from cultured mouse hippocampal neurons. Tranexamic acid rapidly and reversibly inhibited NMDA receptors (half maximal inhibitory concentration = 241 ± 45 mM, mean ± SD; 95% CI, 200 to 281; n = 5) and shifted the glycine concentration-response curve for NMDA-evoked current to the right. Tranexamic acid also inhibited α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (half maximal inhibitory concentration = 231 ± 91 mM; 95% CI, 148 to 314; n = 5 to 6) and kainate receptors (half maximal inhibitory concentration = 90 ± 24 mM; 95% CI, 68 to 112; n = 5). Tranexamic acid inhibits NMDA receptors likely by reducing the binding of the co-agonist glycine and also inhibits α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid and kainate receptors. Receptor blockade occurs at high millimolar concentrations of tranexamic acid, similar to the concentrations that occur after topical application to peripheral tissues. Glutamate receptors in tissues including bone, heart, and nerves play various physiologic roles, and tranexamic acid inhibition of these receptors may contribute to adverse drug effects.

Differences in kainate receptor involvement in hippocampal mossy fibre long-term potentiation depending on slice orientation.

PubMed

Sherwood, John L; Amici, Mascia; Dargan, Sheila L; Culley, Georgia R; Fitzjohn, Stephen M; Jane, David E; Collingridge, Graham L; Lodge, David; Bortolotto, Zuner A

2012-09-01

Long-term potentiation (LTP) is a well-established experimental model used to investigate the synaptic basis of learning and memory. LTP at mossy fibre - CA3 synapses in the hippocampus is unusual because it is normally N-methyl-d-aspartate (NMDA) receptor-independent. Instead it seems that the trigger for mossy fibre LTP involves kainate receptors (KARs). Although it is generally accepted that pre-synaptic KARs play an essential role in frequency facilitation and LTP, their subunit composition remains a matter of significant controversy. We have reported previously that both frequency facilitation and LTP can be blocked by selective antagonism of GluK1 (formerly GluR5/Glu(K5))-containing KARs, but other groups have failed to reproduce this effect. Moreover, data from receptor knockout and mRNA expression studies argue against a major role of GluK1, supporting a more central role for GluK2 (formerly GluR6/Glu(K6)). A potential reason underlying the controversy in the pharmacological experiments may reside in differences in the preparations used. Here we show differences in pharmacological sensitivity of synaptic plasticity at mossy fibre - CA3 synapses depend critically on slice orientation. In transverse slices, LTP of fEPSPs was invariably resistant to GluK1-selective antagonists whereas in parasagittal slices LTP was consistently blocked by GluK1-selective antagonists. In addition, there were pronounced differences in the magnitude of frequency facilitation and the sensitivity to the mGlu2/3 receptor agonist DCG-IV. Using anterograde labelling of granule cells we show that slices of both orientations possess intact mossy fibres and both large and small presynaptic boutons. Transverse slices have denser fibre tracts but a smaller proportion of giant mossy fibre boutons. These results further demonstrate a considerable heterogeneity in the functional properties of the mossy fibre projection. Copyright © 2012 Elsevier Ltd. All rights reserved.

Metabotropic and ionotropic glutamate receptors regulate calcium channel currents in salamander retinal ganglion cells

PubMed Central

Shen, Wen; Slaughter, Malcolm M

1998-01-01

Glutamate suppressed high-voltage-activated barium currents (IBa,HVA) in tiger salamander retinal ganglion cells. Both ionotropic (iGluR) and metabotropic (mGluR) receptors contributed to this calcium channel inhibition. Trans-ACPD (1-aminocyclopentane-trans-1S,3R-dicarboxylic acid), a broad-spectrum metabotropic glutamate receptor agonist, suppressed a dihydropyridine-sensitive barium current. Kainate, an ionotropic glutamate receptor agonist, reduced an ω-conotoxin GVIA-sensitive current. The relative effectiveness of selective agonists indicated that the predominant metabotropic receptor was the L-2-amino-4-phosphonobutyrate (l-AP4)-sensitive, group III receptor. This receptor reversed the action of forskolin, but this was not responsible for calcium channel suppression. l-AP4 raised internal calcium concentration. Antagonists of phospholipase C, inositol trisphosphate (IP3) receptors and ryanodine receptors inhibited the action of metabotropic agonists, indicating that group III receptor transduction was linked to this pathway. The action of kainate was partially suppressed by BAPTA, by calmodulin antagonists and by blockers of calmodulin-dependent phosphatase. Suppression by kainate of the calcium channel current was more rapid when calcium was the charge carrier, instead of barium. The results indicate that calcium influx through kainate-sensitive glutamate receptors can activate calmodulin, which stimulates phosphatases that may directly suppress voltage-sensitive calcium channels. Thus, ionotropic and metabotropic glutamate receptors inhibit distinct calcium channels. They could act synergistically, since both increase internal calcium. These pathways provide negative feedback that can reduce calcium influx when ganglion cells are depolarized. PMID:9660896

A proteomic analysis reveals the interaction of GluK1 ionotropic kainate receptor subunits with Go proteins.

PubMed

Rutkowska-Wlodarczyk, Izabela; Aller, M Isabel; Valbuena, Sergio; Bologna, Jean-Charles; Prézeau, Laurent; Lerma, Juan

2015-04-01

Kainate receptors (KARs) are found ubiquitously in the CNS and are present presynaptically and postsynaptically regulating synaptic transmission and excitability. Functional studies have proven that KARs act as ion channels as well as potentially activating G-proteins, thus indicating the existance of a dual signaling system for KARs. Nevertheless, it is not clear how these ion channels activate G-proteins and which of the KAR subunits is involved. Here we performed a proteomic analysis to define proteins that interact with the C-terminal domain of GluK1 and we identified a variety of proteins with many different functions, including a Go α subunit. These interactions were verified through distinct in vitro and in vivo assays, and the activation of the Go protein by GluK1 was validated in bioluminescence resonance energy transfer experiments, while the specificity of this association was confirmed in GluK1-deficient mice. These data reveal components of the KAR interactome, and they show that GluK1 and Go proteins are natural partners, accounting for the metabotropic effects of KARs. Copyright © 2015 the authors 0270-6474/15/355171-09$15.00/0.

Kainate-induced network activity in the anterior cingulate cortex.

PubMed

Shinozaki, R; Hojo, Y; Mukai, H; Hashizume, M; Murakoshi, T

2016-06-14

Anterior cingulate cortex (ACC) plays a pivotal role in higher order processing of cognition, attention and emotion. The network oscillation is considered an essential means for integration of these CNS functions. The oscillation power and coherence among related areas are often dis-regulated in several psychiatric and pathological conditions with a hemispheric asymmetric manner. Here we describe the network-based activity of field potentials recorded from the superficial layer of the mouse ACC in vitro using submerged type recordings. A short activation by kainic acid administration to the preparation induced populational activities ranging over several frequency bands including theta (3-8Hz), alpha (8-12Hz), beta (13-30Hz), low gamma (30-50Hz) and high gamma (50-80Hz). These responses were repeatable and totally abolished by tetrodotoxin, and greatly diminished by inhibitors of ionotropic and metabotropic glutamate receptors, GABAA receptor or gap-junctions. These observations suggest that the kainate-induced network activity can be a useful model of the network oscillation in the ACC circuit. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.

The dextromethorphan analog dimemorfan attenuates kainate-induced seizures via σ1 receptor activation: comparison with the effects of dextromethorphan

PubMed Central

Shin, Eun-Joo; Nah, Seung-Yeol; Kim, Won-Ki; Ko, Kwang Ho; Jhoo, Wang-Kee; Lim, Yong-Kwang; Cha, Joo Young; Chen, Chieh-Fu; Kim, Hyoung-Chun

2005-01-01

In a previous study, we demonstrated that a dextromethorphan analog, dimemorfan, has neuroprotective effects. Dextromethorphan and dimemorfan are high-affinity ligands at σ1 receptors. Dextromethorphan has moderate affinities for phencyclidine sites, while dimemorfan has very low affinities for such sites, suggesting that these sites are not essential for the anticonvulsant actions of dimemorfan. Kainate (KA) administration (10 mg kg−1, i.p.) produced robust convulsions lasting 4–6 h in rats. Pre-treatment with dimemorfan (12 or 24 mg kg−1) reduced seizures in a dose-dependent manner. Dimemorfan pre-treatment also attenuated the KA-induced increases in c-fos/c-jun expression, activator protein (AP)-1 DNA-binding activity, and loss of cells in the CA1 and CA3 fields of the hippocampus. These effects of dimemorfan were comparable to those of dextromethorphan. The anticonvulsant action of dextromethorphan or dimemorfan was significantly counteracted by a selective σ1 receptor antagonist BD 1047, suggesting that the anticonvulsant action of dextromethorphan or dimemorfan is, at least in part, related to σ1 receptor-activated modulation of AP-1 transcription factors. We asked whether dimemorfan produces the behavioral side effects seen with dextromethorphan or dextrorphan (a phencyclidine-like metabolite of dextromethorphan). Conditioned place preference and circling behaviors were significantly increased in mice treated with phencyclidine, dextrorphan or dextromethorphan, while mice treated with dimemorfan showed no behavioral side effects. Our results suggest that dimemorfan is equipotent to dextromethorphan in preventing KA-induced seizures, while it may lack behavioral effects, such as psychotomimetic reactions. PMID:15723099

Emerging structural insights into the function of ionotropic glutamate receptors

PubMed Central

Karakas, Erkan; Regan, Michael C.; Furukawa, Hiro

2015-01-01

Summary Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that mediate excitatory neurotransmission crucial for brain development and function including learning and memory formation. Recently a wealth of structural studies on iGluRs, including AMPA receptors (AMPARs), kainate receptors, and NMDA receptors (NMDARs) became available.. These studies showed structures of non-NMDARs including AMPAR and kainate receptor in various functional states, thereby providing the first visual sense of how non-NMDAR iGluRs may function in the context of homotetramers. Furthermore, they provided the first view of heterotetrameric NMDAR ion channels, which illuminated the similarities with and differences from non-NMDARs, thus raising a mechanistic distinction between the two groups of iGluRs. Here we review mechanistic insights into iGluR functions gained through structural studies of multiple groups. PMID:25941168

Emerging structural insights into the function of ionotropic glutamate receptors.

PubMed

Karakas, Erkan; Regan, Michael C; Furukawa, Hiro

2015-06-01

Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that mediate excitatory neurotransmission crucial for brain development and function, including learning and memory formation. Recently a wealth of structural studies on iGluRs including AMPA receptors (AMPARs), kainate receptors, and NMDA receptors (NMDARs) became available. These studies showed structures of non-NMDARs including AMPAR and kainate receptor in various functional states, thereby providing the first visual sense of how non-NMDAR iGluRs may function in the context of homotetramers. Furthermore, they provided the first view of heterotetrameric NMDAR ion channels, and this illuminated the similarities with and differences from non-NMDARs, thus raising a mechanistic distinction between the two groups of iGluRs. We review mechanistic insights into iGluR functions gained through structural studies of multiple groups. Copyright © 2015 Elsevier Ltd. All rights reserved.

mRNAs coding for neurotransmitter receptors and voltage-gated sodium channels in the adult rabbit visual cortex after monocular deafferentiation

PubMed Central

Nguyen, Quoc-Thang; Matute, Carlos; Miledi, Ricardo

1998-01-01

It has been postulated that, in the adult visual cortex, visual inputs modulate levels of mRNAs coding for neurotransmitter receptors in an activity-dependent manner. To investigate this possibility, we performed a monocular enucleation in adult rabbits and, 15 days later, collected their left and right visual cortices. Levels of mRNAs coding for voltage-activated sodium channels, and for receptors for kainate/α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA), N-methyl-d-aspartate (NMDA), γ-aminobutyric acid (GABA), and glycine were semiquantitatively estimated in the visual cortices ipsilateral and contralateral to the lesion by the Xenopus oocyte/voltage-clamp expression system. This technique also allowed us to study some of the pharmacological and physiological properties of the channels and receptors expressed in the oocytes. In cells injected with mRNA from left or right cortices of monocularly enucleated and control animals, the amplitudes of currents elicited by kainate or AMPA, which reflect the abundance of mRNAs coding for kainate and AMPA receptors, were similar. There was no difference in the sensitivity to kainate and in the voltage dependence of the kainate response. Responses mediated by NMDA, GABA, and glycine were unaffected by monocular enucleation. Sodium channel peak currents, activation, steady-state inactivation, and sensitivity to tetrodotoxin also remained unchanged after the enucleation. Our data show that mRNAs for major neurotransmitter receptors and ion channels in the adult rabbit visual cortex are not obviously modified by monocular deafferentiation. Thus, our results do not support the idea of a widespread dynamic modulation of mRNAs coding for receptors and ion channels by visual activity in the rabbit visual system. PMID:9501250

Novel Functional Properties of Drosophila CNS Glutamate Receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Yan; Dharkar, Poorva; Han, Tae-Hee

Phylogenetic analysis reveals AMPA, kainate, and NMDA receptor families in insect genomes, suggesting conserved functional properties corresponding to their vertebrate counterparts. However, heterologous expression of the Drosophila kainate receptor DKaiR1D and the AMPA receptor DGluR1A revealed novel ligand selectivity at odds with the classification used for vertebrate glutamate receptor ion channels (iGluRs). DKaiR1D forms a rapidly activating and desensitizing receptor that is inhibited by both NMDA and the NMDA receptor antagonist AP5; crystallization of the KaiR1D ligand-binding domain reveals that these ligands stabilize open cleft conformations, explaining their action as antagonists. Surprisingly, the AMPA receptor DGluR1A shows weak activation bymore » its namesake agonist AMPA and also by quisqualate. Crystallization of the DGluR1A ligand-binding domain reveals amino acid exchanges that interfere with binding of these ligands. The unexpected ligand-binding profiles of insect iGluRs allows classical tools to be used in novel approaches for the study of synaptic regulation.« less

Novel Functional Properties of Drosophila CNS Glutamate Receptors.

PubMed

Li, Yan; Dharkar, Poorva; Han, Tae-Hee; Serpe, Mihaela; Lee, Chi-Hon; Mayer, Mark L

2016-12-07

Phylogenetic analysis reveals AMPA, kainate, and NMDA receptor families in insect genomes, suggesting conserved functional properties corresponding to their vertebrate counterparts. However, heterologous expression of the Drosophila kainate receptor DKaiR1D and the AMPA receptor DGluR1A revealed novel ligand selectivity at odds with the classification used for vertebrate glutamate receptor ion channels (iGluRs). DKaiR1D forms a rapidly activating and desensitizing receptor that is inhibited by both NMDA and the NMDA receptor antagonist AP5; crystallization of the KaiR1D ligand-binding domain reveals that these ligands stabilize open cleft conformations, explaining their action as antagonists. Surprisingly, the AMPA receptor DGluR1A shows weak activation by its namesake agonist AMPA and also by quisqualate. Crystallization of the DGluR1A ligand-binding domain reveals amino acid exchanges that interfere with binding of these ligands. The unexpected ligand-binding profiles of insect iGluRs allows classical tools to be used in novel approaches for the study of synaptic regulation. VIDEO ABSTRACT. Published by Elsevier Inc.

Modulation of desensitization at glutamate receptors in isolated crucian carp horizontal cells by concanavalin A, cyclothiazide, aniracetam and PEPA.

PubMed

Shen, Y; Lu, T; Yang, X L

1999-03-01

In horizontal cells freshly dissociated from crucian carp (Carassius auratus) retina, we examined the effects of modulators of glutamate receptor desensitization, concanavalin A, cyclothiazide, aniracetam and 4-[2-(phenylsulfonylamino)ethylthio]-2,6-difluoro-phenoxyacetam ide (PEPA), on responses to rapid application of glutamate and kainate, using whole-cell voltage-clamp techniques. Incubation of concanavalin A suppressed the peak response but weakly potentiated the equilibrium response of horizontal cells to glutamate. Cyclothiazide blocked glutamate-induced desensitization in a dose-dependent manner, which resulted in a steady increase of the equilibrium current. The concentration of cyclothiazide causing a half-maximal potentiation for the equilibrium response was 85 microM. Furthermore, cyclothiazide shifted the dose-response relationship of the equilibrium current to the right, but slightly suppressed the kainate-induced sustained current. These effects of concanavalin A and cyclothiazide are consistent with the supposition that glutamate receptors of carp horizontal cells may be an alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate (AMPA)-preferring subtype. In order to further characterize the AMPA receptors of horizontal cells, modulation by aniracetam and PEPA of glutamate- and kainate-induced currents was studied. Aniracetam, a preferential modulator of flop variants of AMPA receptors, considerably blocked desensitization of glutamate-induced currents, but only slightly potentiated kainate-induced currents. It was further found that PEPA, a flop-preferring allosteric modulator of AMPA receptor desensitization, slightly suppressed the peak current, while it dramatically potentiated the equilibrium current induced by glutamate in a dose-dependent manner. PEPA was much potent than aniracetam at these receptors and showed the effect on glutamate-induced desensitization even at a concentration as low as 3 microM. PEPA also potentiated non

Glutamate receptor activation in the kindled dentate gyrus.

PubMed

Behr, J; Heinemann, U; Mody, I

2000-01-01

The contribution of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA), N-methyl-D-aspartate (NMDA), and kainate receptor activation to the enhanced seizure susceptibility of the dentate gyrus was investigated in an experimental model of temporal lobe epilepsy. Using the specific NMDA and AMPA receptor antagonists D-APV and SYM 2206, we examined alterations in glutamate receptor-dependent synaptic currents 48 hours and 28 days after kindling in field-potential and voltage-clamp recordings. Forty-eight hours after kindling, the fractions of AMPA and NMDA receptor-mediated excitatory postsynaptic current components shifted dramatically in favor of the NMDA receptor-mediated response. Four weeks after kindling, however, AMPA and NMDA receptor-mediated excitatory postsynaptic currents reverted to control-like values. Neither single nor repetitive perforant path stimuli evoked kainate receptor-mediated excitatory postsynaptic currents in dentate gyrus granule cells of control or kindled rats. The enhanced excitability of the kindled dentate gyrus 48 hours after the last seizure most likely results from transiently enhanced NMDA receptor activation. The NMDA receptor seems to play a critical role in the induction of the kindled state rather than in the persistence of the enhanced seizure susceptibility.

Role of ionotropic glutamate receptors in LTP in rat hippocampal CA1 oriens-lacunosum moleculare interneurons

PubMed Central

Oren, Iris; Nissen, Wiebke; Kullmann, Dimitri M.; Somogyi, Peter; Lamsa, Karri P.

2009-01-01

Some interneurons of the hippocampus exhibit NMDA receptor-independent long-term potentiation (LTP) that is induced by presynaptic glutamate release when the postsynaptic membrane potential is hyperpolarized. This ‘anti-Hebbian’ form of LTP is prevented by postsynaptic depolarization or by blocking AMPA and kainate receptors. Although both AMPA and kainate receptors are expressed in hippocampal interneurons, their relative roles in anti-Hebbian LTP are not known. Because interneuron diversity potentially conceals simple rules underlying different forms of plasticity, we focus on glutamatergic synapses onto a subset of interneurons with dendrites in stratum oriens and a main ascending axon that projects to stratum lacunosum-moleculare, the O-LM cells. We show that anti-Hebbian LTP in O-LM interneurons has consistent induction and expression properties, and is prevented by selective inhibition of AMPA receptors. The majority of the ionotropic glutamatergic synaptic current in these cells is mediated by inwardly rectifying Ca2+ -permeable AMPA receptors. Although GluR5-containing kainate receptors contribute to synaptic currents at high stimulus frequency, they are not required for LTP induction. Glutamatergic synapses on O-LM cells thus behave in a homogeneous manner, and exhibit LTP dependent on Ca2+-permeable AMPA receptors. PMID:19176803

Glycine activated ion channel subunits encoded by ctenophore glutamate receptor genes

DOE PAGES

Alberstein, Robert; Grey, Richard; Zimmet, Austin; ...

2015-10-12

Recent genome projects for ctenophores have revealed the presence of numerous ionotropic glutamate receptors (iGluRs) in Mnemiopsis leidyi and Pleurobrachia bachei, among our earliest metazoan ancestors. Sequence alignments and phylogenetic analysis show that these form a distinct clade from the well-characterized AMPA, kainate, and NMDA iGluR subtypes found in vertebrates. Although annotated as glutamate and kainate receptors, crystal structures of the ML032222a and PbiGluR3 ligand-binding domains (LBDs) reveal endogenous glycine in the binding pocket, whereas ligand-binding assays show that glycine binds with nanomolar affinity; biochemical assays and structural analysis establish that glutamate is occluded from the binding cavity. Further analysismore » reveals ctenophore-specific features, such as an interdomain Arg-Glu salt bridge, present only in subunits that bind glycine, but also a conserved disulfide in loop 1 of the LBD that is found in all vertebrate NMDA but not AMPA or kainate receptors. In this paper, we hypothesize that ctenophore iGluRs are related to an early ancestor of NMDA receptors, suggesting a common evolutionary path for ctenophores and bilaterian species, and finally suggest that future work should consider both glycine and glutamate as candidate neurotransmitters in ctenophore species.« less

AMPA Receptors Mediate Acetylcholine Release from Starburst Amacrine Cells in the Rabbit Retina

PubMed Central

FIRTH, SALLY I.; LI, WEI; MASSEY, STEPHEN C.; MARSHAK, DAVID W.

2012-01-01

The light response of starburst amacrine cells is initiated by glutamate released from bipolar cells. To identify the receptors that mediate this response, we used a combination of anatomical and physiological techniques. An in vivo, rabbit eyecup was preloaded with [3H]-choline, and the [3H]-acetylcholine (ACh) released into the superfusate was monitored. A photopic, 3 Hz flashing light increased ACh release, and the selective AMPA receptor antagonist, GYKI 53655, blocked this light-evoked response. Nonselective AMPA/kainate agonists increased the release of ACh, but the specific kainate receptor agonist, SYM 2081, did not increase ACh release. Selective AMPA receptor antagonists, GYKI 53655 or GYKI 52466, also blocked the responses to agonists. We conclude that the predominant excitatory input to starburst amacrine cells is mediated by AMPA receptors. We also labeled lightly fixed rabbit retinas with antisera to choline acetyltransferase (ChAT), AMPA receptor subunits GluR1, GluR2/3, or GluR4, and kainate receptor subunits GluR6/7 and KA2. Labeled puncta were observed in the inner plexiform layer with each of these antisera to glutamate receptors, but only GluR2/3-IR puncta and GluR4-IR puncta were found on the ChAT-IR processes. The same was true of starburst cells injected intracellularly with Neurobiotin, and these AMPA receptor subunits were localized to two populations of puncta. The AMPA receptors are expected to desensitize rapidly, enhancing the sensitivity of starburst amacrine cells to moving or other rapidly changing stimuli. PMID:14515241

The N-terminal domain of GluR6-subtype glutamate receptor ion channels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, Janesh; Schuck, Peter; Jin, Rongsheng

2009-09-25

The amino-terminal domain (ATD) of glutamate receptor ion channels, which controls their selective assembly into AMPA, kainate and NMDA receptor subtypes, is also the site of action of NMDA receptor allosteric modulators. Here we report the crystal structure of the ATD from the kainate receptor GluR6. The ATD forms dimers in solution at micromolar protein concentrations and crystallizes as a dimer. Unexpectedly, each subunit adopts an intermediate extent of domain closure compared to the apo and ligand-bound complexes of LIVBP and G protein-coupled glutamate receptors (mGluRs), and the dimer assembly has a markedly different conformation from that found in mGluRs.more » This conformation is stabilized by contacts between large hydrophobic patches in the R2 domain that are absent in NMDA receptors, suggesting that the ATDs of individual glutamate receptor ion channels have evolved into functionally distinct families.« less

The effect of Vitamin E on learning and memory deficits in intrahippocampal kainate-induced temporal lobe epilepsy in rats.

PubMed

Kiasalari, Zahra; Khalili, Mohsen; Shafiee, Samaneh; Roghani, Mehrdad

2016-01-01

Since temporal lobe epilepsy (TLE) is associated with learning and memory impairment, we investigated the beneficial effect of Vitamin E on the impaired learning and memory in the intrahippocampal kainate model of TLE in rats. Rats were divided into sham, Vitamin E-treated sham, kainate, and Vitamin E-treated kainate. Intrahippocampal kainate was used for induction of epilepsy. Vitamin E was injected intraperitoneal (i.p.) at a dose of 200 mg/kg/day started 1 week before surgery until 1 h presurgery. Initial and step-through latencies in the passive avoidance test and alternation behavior percentage in Y-maze were finally determined in addition to measurement of some oxidative stress markers. Kainate injection caused a higher severity and rate of seizures and deteriorated learning and memory performance in passive avoidance paradigm and spontaneous alternation as an index of spatial recognition memory in Y-maze task. Intrahippocampal kainate also led to the elevation of malondialdehyde (MDA) and nitrite and reduced activity of superoxide dismutase (SOD). Vitamin E pretreatment significantly attenuated severity and incidence rate of seizures, significantly improved retrieval and recall in passive avoidance, did not ameliorate spatial memory deficit in Y-maze, and lowered MDA and enhanced SOD activity. Vitamin E improves passive avoidance learning and memory and part of its beneficial effect is due to its potential to mitigate hippocampal oxidative stress.

AMPA, NMDA and kainate glutamate receptor subunits are expressed in human peripheral blood mononuclear cells (PBMCs) where the expression of GluK4 is altered by pregnancy and GluN2D by depression in pregnant women.

PubMed

Bhandage, Amol K; Jin, Zhe; Hellgren, Charlotte; Korol, Sergiy V; Nowak, Krzysztof; Williamsson, Louise; Sundström-Poromaa, Inger; Birnir, Bryndis

2017-04-15

The amino acid glutamate opens cation permeable ion channels, the iGlu receptors. These ion channels are abundantly expressed in the mammalian brain where glutamate is the main excitatory neurotransmitter. The neurotransmitters and their receptors are being increasingly detected in the cells of immune system. Here we examined the expression of the 18 known subunits of the iGlu receptors families; α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA), kainate, N-methyl-d-aspartate (NMDA) and delta in human peripheral blood mononuclear cells (PBMCs). We compared the expression of the subunits between four groups: men, non-pregnant women, healthy pregnant women and depressed pregnant women. Out of 18 subunits of the iGlu receptors, mRNAs for 11 subunits were detected in PBMCs from men and non-pregnant women; AMPA: GluA3, GluA4, kainate: GluK2, GluK4, GluK5, NMDA: GluN1, GluN2C, GluN2D, GluN3A, GluN3B, and delta: GluD1. In the healthy and the depressed pregnant women, in addition, the delta GluD2 subunit was identified. The mRNAs for GluK4, GluK5, GluN2C and GluN2D were expressed at a higher level than other subunits. Gender, pregnancy or depression during pregnancy altered the expression of GluA3, GluK4, GluN2D, GluN3B and GluD1 iGlu subunit mRNAs. The greatest changes recorded were the lower GluA3 and GluK4 mRNA levels in pregnant women and the higher GluN2D mRNA level in healthy but not in depressed pregnant women as compared to non-pregnant individuals. Using subunit specific antibodies, the GluK4, GluK5, GluN1, GluN2C and GluN2D subunit proteins were identified in the PBMCs. The results show expression of specific iGlu receptor subunit in the PBMCs and support the idea of physiology-driven changes of iGlu receptors subtypes in the immune cells. Copyright © 2017 Elsevier B.V. All rights reserved.

Potentiation of mouse vagal afferent mechanosensitivity by ionotropic and metabotropic glutamate receptors

PubMed Central

Slattery, James A; Page, Amanda J; Dorian, Camilla L; Brierley, Stuart M; Blackshaw, L Ashley

2006-01-01

Glutamate acts at central synapses via ionotropic (iGluR – NMDA, AMPA and kainate) and metabotropic glutamate receptors (mGluRs). Group I mGluRs are excitatory whilst group II and III are inhibitory. Inhibitory mGluRs also modulate peripherally the mechanosensitivity of gastro-oesophageal vagal afferents. Here we determined the potential of excitatory GluRs to play an opposing role in modulating vagal afferent mechanosensitivity, and investigated expression of receptor subunit mRNA within the nodose ganglion. The responses of mouse gastro-oesophageal vagal afferents to graded mechanical stimuli were investigated before and during application of selective GluR ligands to their peripheral endings. Two types of vagal afferents were tested: tension receptors, which respond to circumferential tension, and mucosal receptors, which respond only to mucosal stroking. The selective iGluR agonists NMDA and AMPA concentration-dependently potentiated afferent responses. Their corresponding antagonists AP-5 and NBQX alone attenuated mechanosensory responses as did the non-selective antagonist kynurenate. The kainate selective agonist SYM-2081 had minor effects on mechanosensitivity, and the antagonist UBP 302 was ineffective. The mGluR5 antagonist MTEP concentration-dependently inhibited mechanosensitivity. Efficacy of agonists and antagonists differed on mucosal and tension receptors. We conclude that excitatory modulation of afferent mechanosensitivity occurs mainly via NMDA, AMPA and mGlu5 receptors, and the role of each differs according to afferent subtypes. PCR data indicated that all NMDA, kainate and AMPA receptor subunits plus mGluR5 are expressed, and are therefore candidates for the neuromodulation we observed. PMID:16945965

Potentiation of mouse vagal afferent mechanosensitivity by ionotropic and metabotropic glutamate receptors.

PubMed

Slattery, James A; Page, Amanda J; Dorian, Camilla L; Brierley, Stuart M; Blackshaw, L Ashley

2006-11-15

Glutamate acts at central synapses via ionotropic (iGluR--NMDA, AMPA and kainate) and metabotropic glutamate receptors (mGluRs). Group I mGluRs are excitatory whilst group II and III are inhibitory. Inhibitory mGluRs also modulate peripherally the mechanosensitivity of gastro-oesophageal vagal afferents. Here we determined the potential of excitatory GluRs to play an opposing role in modulating vagal afferent mechanosensitivity, and investigated expression of receptor subunit mRNA within the nodose ganglion. The responses of mouse gastro-oesophageal vagal afferents to graded mechanical stimuli were investigated before and during application of selective GluR ligands to their peripheral endings. Two types of vagal afferents were tested: tension receptors, which respond to circumferential tension, and mucosal receptors, which respond only to mucosal stroking. The selective iGluR agonists NMDA and AMPA concentration-dependently potentiated afferent responses. Their corresponding antagonists AP-5 and NBQX alone attenuated mechanosensory responses as did the non-selective antagonist kynurenate. The kainate selective agonist SYM-2081 had minor effects on mechanosensitivity, and the antagonist UBP 302 was ineffective. The mGluR5 antagonist MTEP concentration-dependently inhibited mechanosensitivity. Efficacy of agonists and antagonists differed on mucosal and tension receptors. We conclude that excitatory modulation of afferent mechanosensitivity occurs mainly via NMDA, AMPA and mGlu5 receptors, and the role of each differs according to afferent subtypes. PCR data indicated that all NMDA, kainate and AMPA receptor subunits plus mGluR5 are expressed, and are therefore candidates for the neuromodulation we observed.

Neto Auxiliary Protein Interactions Regulate Kainate and NMDA Receptor Subunit Localization at Mossy Fiber–CA3 Pyramidal Cell Synapses

PubMed Central

Wyeth, Megan S.; Pelkey, Kenneth A.; Petralia, Ronald S.; Salter, Michael W.; McInnes, Roderick R.

2014-01-01

Neto1 and Neto2 auxiliary subunits coassemble with NMDA receptors (NMDARs) and kainate receptors (KARs) to modulate their function. In the hippocampus, Neto1 enhances the amplitude and prolongs the kinetics of KAR-mediated currents at mossy fiber (MF)–CA3 pyramidal cell synapses. However, whether Neto1 trafficks KARs to synapses or simply alters channel properties is unresolved. Therefore, postembedding electron microscopy was performed to investigate the localization of GluK2/3 subunits at MF–CA3 synapses in Neto-null mice. Postsynaptic GluK2/3 Immunogold labeling was substantially reduced in Neto-null mice compared with wild types. Moreover, spontaneous KAR-mediated synaptic currents and metabotropic KAR signaling were absent in CA3 pyramidal cells of Neto-null mice. A similar loss of ionotropic and metabotropic KAR function was observed in Neto1, but not Neto2, single knock-out mice, specifically implicating Neto1 in regulating CA3 pyramidal cell KAR localization and function. Additional controversy pertains to the role of Neto proteins in modulating synaptic NMDARs. While Immunogold labeling for GluN2A at MF–CA3 synapses was comparable between wild-type and Neto-null mice, labeling for postsynaptic GluN2B was robustly increased in Neto-null mice. Accordingly, NMDAR-mediated currents at MF–CA3 synapses exhibited increased sensitivity to a GluN2B-selective antagonist in Neto1 knockouts relative to wild types. Thus, despite preservation of the overall MF–CA3 synaptic NMDAR-mediated current, loss of Neto1 alters NMDAR subunit composition. These results confirm that Neto protein interactions regulate synaptic localization of KAR and NMDAR subunits at MF–CA3 synapses, with implications for both ionotropic and metabotropic glutamatergic recruitment of the CA3 network. PMID:24403160

Density and distribution of hippocampal neurotransmitter receptors in autism: an autoradiographic study.

PubMed

Blatt, G J; Fitzgerald, C M; Guptill, J T; Booker, A B; Kemper, T L; Bauman, M L

2001-12-01

Neuropathological studies in autistic brains have shown small neuronal size and increased cell packing density in a variety of limbic system structures including the hippocampus, a change consistent with curtailment of normal development. Based on these observations in the hippocampus, a series of quantitative receptor autoradiographic studies were undertaken to determine the density and distribution of eight types of neurotransmitter receptors from four neurotransmitter systems (GABAergic, serotoninergic [5-HT], cholinergic, and glutamatergic). Data from these single concentration ligand binding studies indicate that the GABAergic receptor system (3[H]-flunitrazepam labeled benzodiazepine binding sites and 3[H]-muscimol labeled GABA(A) receptors) is significantly reduced in high binding regions, marking for the first time an abnormality in the GABA system in autism. In contrast, the density and distribution of the other six receptors studied (3[H]-80H-DPAT labeled 5-HT1A receptors, 3[H]-ketanserin labeled 5-HT2 receptors, 3[H]-pirenzepine labled M1 receptors, 3[H]-hemicholinium labeled high affinity choline uptake sites, 3[H]-MK801 labeled NMDA receptors, and 3[H]-kainate labeled kainate receptors) in the hippocampus did not demonstrate any statistically significant differences in binding.

How glutamate receptor subunits mix and match: details uncovered.

PubMed

Hansen, Kasper B; Traynelis, Stephen F

2011-07-28

Until now, the atomic details explaining why certain subunits prefer to coassemble has been lacking in our understanding of glutamate receptor biogenesis. In this issue, Kumar et al. describe the structural basis by which preferential subunit assembly occurs for homomeric and heteromeric kainate-type glutamate receptors. Copyright © 2011 Elsevier Inc. All rights reserved.

AMPA/kainate glutamate receptors contribute to inflammation, degeneration and pain related behaviour in inflammatory stages of arthritis

PubMed Central

Bonnet, Cleo S; Williams, Anwen S; Gilbert, Sophie J; Harvey, Ann K; Evans, Bronwen A; Mason, Deborah J

2015-01-01

Objectives Synovial fluid glutamate concentrations increase in arthritis. Activation of kainate (KA) and α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) glutamate receptors (GluRs) increase interleukin-6 (IL-6) release and cause arthritic pain, respectively. We hypothesised that AMPA and KA GluRs are expressed in human arthritis, and that intra-articular NBQX (AMPA/KA GluR antagonist) prevents pain and pathology in antigen-induced arthritis (AIA). Methods GluR immunohistochemistry was related to synovial inflammation and degradation in osteoarthritis (OA) and rheumatoid arthritis (RA). A single intra-articular NBQX injection was given at induction, and knee swelling and gait of AIA and AIA+NBQX rats compared over 21 days, before imaging, RT-qPCR, histology and immunohistochemistry of joints. Effects of NBQX on human primary osteoblast (HOB) activity were determined. Results AMPAR2 and KA1 immunolocalised to remodelling bone, cartilage and synovial cells in human OA and RA, and rat AIA. All arthritic tissues showed degradation and synovial inflammation. NBQX reduced GluR abundance, knee swelling (p<0.001, days 1–21), gait abnormalities (days 1–2), end-stage joint destruction (p<0.001), synovial inflammation (p<0.001), and messenger RNA expression of meniscal IL-6 (p<0.05) and whole joint cathepsin K (p<0.01). X-ray and MRI revealed fewer cartilage and bone erosions, and less inflammation after NBQX treatment. NBQX reduced HOB number and prevented mineralisation. Conclusions AMPA/KA GluRs are expressed in human OA and RA, and in AIA, where a single intra-articular injection of NBQX reduced swelling by 33%, and inflammation and degeneration scores by 34% and 27%, respectively, exceeding the efficacy of approved drugs in the same model. AMPA/KA GluR antagonists represent a potential treatment for arthritis. PMID:24130267

Modulation of spinal nociception by GluR5 kainate receptor ligands in acute and hyperalgesic states and the role of gabaergic mechanisms.

PubMed

Mascias, Paula; Scheede, Manuela; Bloms-Funke, Petra; Chizh, Boris

2002-09-01

GluR5 receptors modulate spinal nociception, however, their role in nociceptive hypersensitivity remains unclear. Using behavioural and electrophysiological approaches, we have investigated several GluR5 ligands in acute and hyperalgesic states. Furthermore, as the GABAergic system plays a role in GluR5 mediated effects in the brain, we also analysed the interaction between GluR5 agonists and GABA(A) antagonists in the spinal cord. In young rats in vivo, the GluR5 selective agonist ATPA was antinociceptive and antihyperalgesic in a model of inflammatory hyperalgesia (ED(50) approximately 4.6 and approximately 5.2 mg/kg, respectively), whereas the GluR5/GluR6 agonist SYM2081 was only antihyperalgesic. ATPA, but not SYM2081, was also able to inhibit nociceptive motoneurone responses in anaesthetised adult rats after intrathecal administration. In hemisected spinal cords in vitro, SYM2081 was inactive, whereas ATPA and another GluR5 agonist, (S)-5-iodowillardiine, inhibited nociceptive reflexes (EC(50) 1.1+/-0.4 micro M and 0.36+/-0.05 micro M, respectively). Both GluR5 agonists also inhibited motoneurone responses to repetitive dorsal root stimulation and their cumulative depolarisation, a correlate of wind-up. The GABA(A) antagonists bicuculline (10 micro M) and SR95531 (1 micro M) enhanced polysynaptic responses to single stimuli but abolished the cumulative depolarisation. Both bicuculline and SR95531 significantly attenuated the inhibition of nociceptive responses by 1 micro M ATPA (by approximately 50%). We conclude that selective GluR5 kainate receptor activation inhibits spinal nociception and its sensitisation caused by ongoing peripheral nociceptive drive. GABA(A) receptors are involved in tonic inhibition of segmental responses, but contribute to their sensitisation by repetitive primary afferent stimulation. Furthermore, there is a cross-talk between the two systems, presumably due to GluR5-mediated activation of GABAergic inhibitory interneurones in the

Metabotropic Glutamate Receptors in the Trafficking of Ionotropic Glutamate and GABAA Receptors at Central Synapses

PubMed Central

Xiao, Min-Yi; Gustafsson, Bengt; Niu, Yin-Ping

2006-01-01

The trafficking of ionotropic glutamate (AMPA, NMDA and kainate) and GABAA receptors in and out of, or laterally along, the postsynaptic membrane has recently emerged as an important mechanism in the regulation of synaptic function, both under physiological and pathological conditions, such as information processing, learning and memory formation, neuronal development, and neurodegenerative diseases. Non-ionotropic glutamate receptors, primarily group I metabotropic glutamate receptors (mGluRs), co-exist with the postsynaptic ionotropic glutamate and GABAA receptors. The ability of mGluRs to regulate postsynaptic phosphorylation and Ca2+ concentration, as well as their interactions with postsynaptic scaffolding/signaling proteins, makes them well suited to influence the trafficking of ionotropic glutamate and GABAA receptors. Recent studies have provided insights into how mGluRs may impose such an influence at central synapses, and thus how they may affect synaptic signaling and the maintenance of long-term synaptic plasticity. In this review we will discuss some of the recent progress in this area: i) long-term synaptic plasticity and the involvement of mGluRs; ii) ionotropic glutamate receptor trafficking and long-term synaptic plasticity; iii) the involvement of postsynaptic group I mGluRs in regulating ionotropic glutamate receptor trafficking; iv) involvement of postsynaptic group I mGluRs in regulating GABAA receptor trafficking; v) and the trafficking of postsynaptic group I mGluRs themselves. PMID:18615134

Ionotropic and metabotropic glutamate receptor antagonism attenuates cue-induced cocaine seeking.

PubMed

Bäckström, Pia; Hyytiä, Petri

2006-04-01

Neuroanatomical and pharmacological evidence implicates glutamate transmission in drug-environment conditioning that partly controls drug seeking and relapse. Glutamate receptors could be targets for pharmacological attenuation of the motivational properties of drug-paired cues and for relapse prevention. The purpose of the present study was therefore to investigate the involvement of ionotropic and metabotropic glutamate receptor subtypes in cue-induced reinstatement of cocaine-seeking behavior. Rats were trained to self-administer cocaine using a second-order schedule of reinforcement (FR4(FR5:S)) under which a compound stimulus (light and tone) associated with cocaine infusions was presented contingently. Following extinction, the effects of the competitive NMDA receptor antagonist CGP 39551 (0, 2.5, 5, 10 mg/kg intraperitoneally (i.p.)), two competitive AMPA/kainate antagonists, CNQX (0, 0.75, 1.5, 3 mg/kg i.p.) and NBQX (0, 1.25, 2.5, 5 mg/kg i.p.), the NMDA/glycine site antagonist L-701,324 (0, 0.63, 1.25, 2.5 mg/kg i.p.), and the mGluR5 antagonist MPEP (0, 1.25, 2.5, 5 mg/kg i.p.) on cue-induced reinstatement of cocaine seeking were examined. The AMPA/kainate receptor antagonists CNQX and NBQX, the NMDA/glycine site antagonist L-701,324, and the mGluR5 antagonist MPEP attenuated significantly cue-induced reinstatement. The NMDA antagonist CGP 39551 failed to affect reinstatement. Additional control experiments indicated that attenuation of cue-induced reinstatement by CNQX, NBQX, L-701,324, and MPEP was not accompanied by significant suppression of spontaneous locomotor activity. These results suggest that conditioned influences on cocaine seeking depend on glutamate transmission. Accordingly, drugs with antagonist properties at various glutamate receptor subtypes could be useful in prevention of relapse induced by conditioned stimuli.

Insights into the olfactory system of the ectoparasite Caligus rogercresseyi: molecular characterization and gene transcription analysis of novel ionotropic receptors.

PubMed

Núñez-Acuña, Gustavo; Valenzuela-Muñoz, Valentina; Marambio, Jorge Pino; Wadsworth, Simon; Gallardo-Escárate, Cristian

2014-10-01

Although various elements of the olfactory system have been elucidated in insects, it remains practically unstudied in crustaceans at a molecular level. Among crustaceans, some species are classified as ectoparasites that impact the finfish aquaculture industry. Thus, there is an urgent need to identify and comprehend the signaling pathways used by these in host recognition. The present study, through RNA-seq and qPCR analyses, found novel transcripts involved in the olfactory system of Caligus rogercresseyi, in addition to the transcriptomic patterns expressed during different stages of salmon lice development. From a transcriptomic library generated by Illumina sequencing, contigs that annotated for ionotropic receptors and other genes implicated in the olfactory system were identified and extracted. Full length mRNA was obtained for the ionotropic glutamate receptor 25, which had 3923 bp, and for the glutamate receptor ionotropic kainate 2, which had 2737 bp. Furthermore, two other transcripts identified as glutamate receptor, ionotropic kainate 2-like were found. In silico analysis was performed for the transcription expression from different stages of development in C. rogercresseyi, and clusters according to RPKM values were constructed. Gene transcription data were validated through qPCR assays in ionotropic receptors, and showed an expression of glutamate receptor 25 associated with the copepodid stage whereas adults, especially male adults, were associated with the kainate 2 and kainate 2-like transcripts. Additionally, gene transcription analysis of the ionotropic receptors showed an overexpression in response to the presence of masking compounds and immunostimulant in salmon diets. This response correlated to a reduction in sea lice infection following in vivo challenge. Diets with masking compounds showed a decrease of lice infestation of up to 25%. This work contributes to the available knowledge on chemosensory systems in this ectoparasite, providing

Arctigenin reduces neuronal responses in the somatosensory cortex via the inhibition of non-NMDA glutamate receptors.

PubMed

Borbély, Sándor; Jócsák, Gergely; Moldován, Kinga; Sedlák, Éva; Preininger, Éva; Boldizsár, Imre; Tóth, Attila; Atlason, Palmi T; Molnár, Elek; Világi, Ildikó

2016-07-01

Lignans are biologically active phenolic compounds related to lignin, produced in different plants. Arctigenin, a dibenzylbutyrolactone-type lignan, has been used as a neuroprotective agent for the treatment of encephalitis. Previous studies of cultured rat cerebral cortical neurones raised the possibility that arctigenin inhibits kainate-induced excitotoxicity. The aims of the present study were: 1) to analyse the effect of arctigenin on normal synaptic activity in ex vivo brain slices, 2) to determine its receptor binding properties and test the effect of arctigenin on AMPA/kainate receptor activation and 3) to establish its effects on neuronal activity in vivo. Arctigenin inhibited glutamatergic transmission and reduced the evoked field responses. The inhibitory effect of arctigenin on the evoked field responses proved to be substantially dose dependent. Our results indicate that arctigenin exerts its effects under physiological conditions and not only on hyper-excited neurons. Furthermore, arctigenin can cross the blood-brain barrier and in the brain it interacts with kainate sensitive ionotropic glutamate receptors. These results indicate that arctigenin is a potentially useful new pharmacological tool for the inhibition of glutamate-evoked responses in the central nervous system in vivo. Copyright © 2016 Elsevier Ltd. All rights reserved.

Recurrent spontaneous motor seizures after repeated low-dose systemic treatment with kainate: assessment of a rat model of temporal lobe epilepsy.

PubMed

Hellier, J L; Patrylo, P R; Buckmaster, P S; Dudek, F E

1998-06-01

Human temporal lobe epilepsy is associated with complex partial seizures that can produce secondarily generalized seizures and motor convulsions. In some patients with temporal lobe epilepsy, the seizures and convulsions occur following a latent period after an initial injury and may progressively increase in frequency for much of the patient's life. Available animal models of temporal lobe epilepsy are produced by acute treatments that often have high mortality rates and/or are associated with a low proportion of animals developing spontaneous chronic motor seizures. In this study, rats were given multiple low-dose intraperitoneal (i.p.) injections of kainate in order to minimize the mortality rate usually associated with single high-dose injections. We tested the hypothesis that these kainate-treated rats consistently develop a chronic epileptic state (i.e. long-term occurrence of spontaneous, generalized seizures and motor convulsions) following a latent period after the initial treatment. Kainate (5 mg/kg per h, i.p.) was administered to rats every hour for several hours so that class III-V seizures were elicited for > or = 3 h, while control rats were treated similarly with saline. This treatment protocol had a relatively low mortality rate (15%). After acute treatment, rats were observed for the occurrence of motor seizures for 6-8 h/week. Nearly all of the kainate-treated rats (97%) had two or more spontaneous motor seizures months after treatment. With this observation protocol, the average latency for the first spontaneous motor seizure was 77+/-38 (+/-S.D.) days after treatment. Although variability was observed between rats, seizure frequency initially increased with time after treatment, and nearly all of the kainate-treated rats (91%) had spontaneous motor seizures until the time of euthanasia (i.e. 5-22 months after treatment). Therefore, multiple low-dose injections of kainate, which cause recurrent motor seizures for > or = 3 h, lead to the

Topiramate via NMDA, AMPA/kainate, GABAA and Alpha2 receptors and by modulation of CREB/BDNF and Akt/GSK3 signaling pathway exerts neuroprotective effects against methylphenidate-induced neurotoxicity in rats.

PubMed

Motaghinejad, Majid; Motevalian, Manijeh; Fatima, Sulail; Beiranvand, Tabassom; Mozaffari, Shiva

2017-11-01

Chronic abuse of methylphenidate (MPH) often causes neuronal cell death. Topiramate (TPM) carries neuroprotective effects, but its exact mechanism of action remains unclear. In the present study, the role of various doses of TPM and its possible mechanisms, receptors and signaling pathways involved against MPH-induced hippocampal neurodegeneration were evaluated in vivo. Thus, domoic acid (DOM) was used as AMPA/kainate receptor agonist, bicuculline (BIC) as GABA A receptor antagonist, ketamine (KET) as NMDA receptor antagonist, yohimbine (YOH) as α 2 adrenergic receptor antagonist and haloperidol (HAL) was used as dopamine D 2 receptor antagonist. Open field test (OFT) was used to investigate the disturbances in motor activity. Hippocampal neurodegenerative parameters were evaluated. Protein expressions of CREB/BDNF and Akt/GSK3 signaling pathways were also evaluated. Cresyl violet staining was performed to show and confirm the changes in the shape of the cells. TPM (70 and 100 mg/kg) reduced MPH-induced rise in lipid peroxidation, oxidized form of glutathione (GSSG), IL-1β and TNF-α levels, Bax expression and motor activity disturbances. In addition, TPM treatment increased Bcl-2 expression, the level of reduced form of glutathione (GSH) and the levels and activities of superoxide dismutase, glutathione peroxidase and glutathione reductase enzymes. TPM also inhibited MPH-induced hippocampal degeneration. Pretreatment of animals with DOM, BIC, KET and YOH inhibited TPM-induced neuroprotection and increased oxidative stress, neuroinflammation, neuroapoptosis and neurodegeneration while reducing CREB, BDNF and Akt protein expressions. Also pretreatment with DOM, BIC, KET and YOH inhibited TPM-induced decreases in GSK3. It can be concluded that the mentioned receptors by modulation of CREB/BDNF and Akt/GSK3 pathways, are involved in neuroprotection of TPM against MPH-induced neurodegeneration.

Metabotropic glutamate receptors in the trafficking of ionotropic glutamate and GABA(A) receptors at central synapses.

PubMed

Xiao, Min-Yi; Gustafsson, Bengt; Niu, Yin-Ping

2006-01-01

The trafficking of ionotropic glutamate (AMPA, NMDA and kainate) and GABA(A) receptors in and out of, or laterally along, the postsynaptic membrane has recently emerged as an important mechanism in the regulation of synaptic function, both under physiological and pathological conditions, such as information processing, learning and memory formation, neuronal development, and neurodegenerative diseases. Non-ionotropic glutamate receptors, primarily group I metabotropic glutamate receptors (mGluRs), co-exist with the postsynaptic ionotropic glutamate and GABA(A) receptors. The ability of mGluRs to regulate postsynaptic phosphorylation and Ca(2+) concentration, as well as their interactions with postsynaptic scaffolding/signaling proteins, makes them well suited to influence the trafficking of ionotropic glutamate and GABA(A) receptors. Recent studies have provided insights into how mGluRs may impose such an influence at central synapses, and thus how they may affect synaptic signaling and the maintenance of long-term synaptic plasticity. In this review we will discuss some of the recent progress in this area: i) long-term synaptic plasticity and the involvement of mGluRs; ii) ionotropic glutamate receptor trafficking and long-term synaptic plasticity; iii) the involvement of postsynaptic group I mGluRs in regulating ionotropic glutamate receptor trafficking; iv) involvement of postsynaptic group I mGluRs in regulating GABA(A) receptor trafficking; v) and the trafficking of postsynaptic group I mGluRs themselves.

Taurine release from the developing and ageing hippocampus: stimulation by agonists of ionotropic glutamate receptors.

PubMed

Saransaari, P; Oja, S S

1997-12-30

The inhibitory amino acid taurine has been held to function as a modulator and osmoregulator in the brain, being of particular importance in the immature brain. The release of preloaded [3H]taurine was now studied in hippocampal slices from developing (7-day-old), adult (3-month-old) and ageing (6-24-month-old) mice focussing on the effects of agonists of ionotropic glutamate receptors. N-methyl-D-aspartate (NMDA), kainate and 2-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) potentiated taurine release concentration-dependently at each age, more so in the immature than in the adult and ageing hippocampus. The effect of kainate was blocked by 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) in the developing and aged hippocampus and those of AMPA and NMDA by 6-nitro-7-sulphamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and dizocilpine a(MK-801) at every age studied. This indicates the involvement of NMDA and AMPA receptors in taurine release throughout the life-span of mice, while the kainate-receptor-mediated release does not appear to function in adults. The increased hippocampal taurine release evoked by ionotropic glutamate receptors could act neuroprotectively, counteracting by several mechanisms the harmful effects of the simultaneous release of excitatory amino acids. The substantial release of taurine in the immature hippocampus might be particularly significant in view of the vulnerability of brain tissue to excitotoxicity at early age.

Vinpocetine protects inner retinal neurons with functional NMDA glutamate receptors against retinal ischemia.

PubMed

Nivison-Smith, Lisa; Khoo, Pauline; Acosta, Monica L; Kalloniatis, Michael

2018-02-01

Retinal ischemia is involved in the pathogenesis of many major vision threatening diseases. Vinpocetine is a natural drug, which has a range of neuroprotective actions against retinal ischemia including modulating cation flow, improving metabolic activity and preventing apoptosis. The exact mechanism behind these actions remains unknown but may involve glutamate receptors, major components of the ischemic cascade. This study examined the effects of vinpocetine in association with specific ionotropic glutamate receptor agonists: N-methyl-D-aspartate (NMDA) and kainate. Vinpocetine's actions to improve cation channel permeability and cell marker immunoreactivity following ischemia appeared to be limited to NMDA activation with no changes observed following kainate stimulation. Vinpocetine's actions were lost in the presence of an NMDA receptor inhibitor further suggesting they may be secondary to NMDA receptor activation. NMDA receptor function was also necessary for vinpocetine's actions on glucose availability during ischemia but not lactate dehydrogenase (LDH) activity in the ischemic retina suggesting not all of vinpocetine's actions are linked to NMDA receptor function. These results may explain vinpocetine's effectiveness as a neuroprotective agent as the NMDA receptor is implicated in the pathogenesis of ischemia in a range of tissues of the central nervous system. Copyright © 2017 Elsevier Ltd. All rights reserved.

The utility of ionotropic glutamate receptor antagonists in the treatment of nociception induced by epidural glutamate infusion in rats.

PubMed

Osgood, Doreen B; Harrington, William F; Kenney, Elizabeth V; Harrington, J Frederick

2013-01-01

The authors have previously demonstrated that human herniated disc material contains high concentrations of free glutamate. In an experimental model, elevated epidural glutamate concentrations in the lumbar spine can cause a focal hyperesthetic state. Rats underwent epidural glutamate infusion in the lumbar spine by a miniosmotic pump over a 72-hour period. Some rats underwent coinfusion with glutamate and ionotropic glutamate antagonists. Nociception was assessed by von Frey fibers and by assessment of glutamate receptor expression in the corresponding dorsal horn of the spinal cord. The kainic acid antagonist, UBP 301, decreased epidural glutamate-based hyperesthesia in a dose dependent manner. Concordant with these findings, there was significant decrease in kainate receptor expression in the dorsal horn. The N-Methyl-4-isoxazoleproionic acid (NMDA) antagonist Norketamine also significantly diminished hyperesthesia and decreased receptor expression in the dorsal horn. Both UBP 301, the kainic acid receptor antagonist and Norketamine, an NMDA receptor antagonist, dampened epidural glutamate-based nociception. Focal epidural injections of Kainate or NMDA receptor antagonists could be effective treatments for disc herniation-based lumbar radiculopathy.

Variant ionotropic glutamate receptors as chemosensory receptors in Drosophila

PubMed Central

Benton, Richard; Vannice, Kirsten S.; Gomez-Diaz, Carolina; Vosshall, Leslie B.

2009-01-01

Summary Ionotropic glutamate receptors (iGluRs) mediate neuronal communication at synapses throughout vertebrate and invertebrate nervous systems. We have characterized a novel family of iGluR-related genes in Drosophila, which we name Ionotropic Receptors (IRs). These receptors do not belong to the well-described Kainate, AMPA, or NMDA classes of iGluRs, and have divergent ligand-binding domains that lack their characteristic glutamate-interacting residues. IRs are expressed in a combinatorial fashion in sensory neurons that respond to many distinct odors but do not express either insect odorant receptors (ORs) or gustatory receptors (GRs). IR proteins accumulate in sensory dendrites and not at synapses. Mis-expression of IRs induces novel odor responses in ectopic neurons. Together, these results lead us to propose that the IRs comprise a novel family of chemosensory receptors. Conservation of IR/iGluR-related proteins in bacteria, plants, and animals suggests that this receptor family represents an evolutionarily ancient mechanism for sensing both internal and external chemical cues. PMID:19135896

Aniracetam and DNQX affect the acquisition of rapid tolerance to ethanol in mice.

PubMed

Rial, Daniel; Takahashi, Reinaldo Naoto; Morato, Gina Struffaldi

2009-03-01

Several studies have emphasized the role of learning in the development of rapid tolerance and have shown that glutamate-mediated neurotransmission plays an important role in this phenomenon. Since the AMPA/kainate receptor system is directly involved in plasticity mechanisms, the influence of this receptor system on rapid tolerance induced by ethanol was studied using the rotarod. In the first experiment, mice were pretreated with aniracetam, an agonist of AMPA/kainate receptors, 30 min before ethanol (2.75 g/kg; IP) treatment, and tested on the rotarod. After 24 h, the groups were tested on the rotarod under ethanol treatment. Aniracetam facilitated the acquisition of rapid tolerance to ethanol. In the second experiment, mice received DNQX, a competitive antagonist of the AMPA receptor, 30 min before ethanol treatment (3 g/kg) and submitted to the rotarod. This dose of ethanol produced tolerance per se. Groups were tested under ethanol treatment (1.75 g/kg) after 24 h. DNQX blocked rapid tolerance to ethanol. Using a similar protocol, the third experiment showed that DNQX blocked the aniracetam-induced facilitation of rapid tolerance to ethanol. Our results show that aniracetam facilitates whereas DNQX blocks ethanol tolerance, suggesting that the non-NMDA receptors are involved in this phenomenon.

Dopamine Modulation of Avoidance Behavior in Caenorhabditis elegans Requires the NMDA Receptor NMR-1

PubMed Central

Baidya, Melvin; Genovez, Marx; Torres, Marissa; Chao, Michael Y.

2014-01-01

The nematode C. elegans utilizes a relatively simple neural circuit to mediate avoidance responses to noxious stimuli such as the volatile odorant octanol. This avoidance behavior is modulated by dopamine. cat-2 mutant animals that are deficient in dopamine biosynthesis have an increased response latency to octanol compared to wild type animals, and this defect can be fully restored with the application of exogenous dopamine. Because this avoidance behavior is mediated by glutamatergic signaling between sensory neurons and premotor interneurons, we investigated the genetic interactions between dopaminergic signaling and ionotropic glutamate receptors. cat-2 mutant animals lacking either the GLR-1 or GLR-2 AMPA/kainate receptors displayed an increased response latency to octanol, which could be restored via exogenous dopamine. However, whereas cat-2 mutant animals lacking the NMR-1 NMDA receptor had increased response latency to octanol they were insensitive to exogenous dopamine. Mutants that lacked both AMPA/kainate and NMDA receptors were also insensitive to exogenous dopamine. Our results indicate that dopamine modulation of octanol avoidance requires NMR-1, consistent with NMR-1 as a potential downstream signaling target for dopamine. PMID:25089710

Kainate and metabolic perturbation mimicking spinal injury differentially contribute to early damage of locomotor networks in the in vitro neonatal rat spinal cord.

PubMed

Taccola, G; Margaryan, G; Mladinic, M; Nistri, A

2008-08-13

Acute spinal cord injury evolves rapidly to produce secondary damage even to initially spared areas. The result is loss of locomotion, rarely reversible in man. It is, therefore, important to understand the early pathophysiological processes which affect spinal locomotor networks. Regardless of their etiology, spinal lesions are believed to include combinatorial effects of excitotoxicity and severe stroke-like metabolic perturbations. To clarify the relative contribution by excitotoxicity and toxic metabolites to dysfunction of locomotor networks, spinal reflexes and intrinsic network rhythmicity, we used, as a model, the in vitro thoraco-lumbar spinal cord of the neonatal rat treated (1 h) with either kainate or a pathological medium (containing free radicals and hypoxic/aglycemic conditions), or their combination. After washout, electrophysiological responses were monitored for 24 h and cell damage analyzed histologically. Kainate suppressed fictive locomotion irreversibly, while it reversibly blocked neuronal excitability and intrinsic bursting induced by synaptic inhibition block. This result was associated with significant neuronal loss around the central canal. Combining kainate with the pathological medium evoked extensive, irreversible damage to the spinal cord. The pathological medium alone slowed down fictive locomotion and intrinsic bursting: these oscillatory patterns remained throughout without regaining their control properties. This phenomenon was associated with polysynaptic reflex depression and preferential damage to glial cells, while neurons were comparatively spared. Our model suggests distinct roles of excitotoxicity and metabolic dysfunction in the acute damage of locomotor networks, indicating that different strategies might be necessary to treat the various early components of acute spinal cord lesion.

Cholesterol modulates open probability and desensitization of NMDA receptors

PubMed Central

Korinek, Miloslav; Vyklicky, Vojtech; Borovska, Jirina; Lichnerova, Katarina; Kaniakova, Martina; Krausova, Barbora; Krusek, Jan; Balik, Ales; Smejkalova, Tereza; Horak, Martin; Vyklicky, Ladislav

2015-01-01

NMDA receptors (NMDARs) are glutamate-gated ion channels that mediate excitatory neurotransmission in the CNS. Although these receptors are in direct contact with plasma membrane, lipid–NMDAR interactions are little understood. In the present study, we aimed at characterizing the effect of cholesterol on the ionotropic glutamate receptors. Whole-cell current responses induced by fast application of NMDA in cultured rat cerebellar granule cells (CGCs) were almost abolished (reduced to 3%) and the relative degree of receptor desensitization was increased (by seven-fold) after acute cholesterol depletion by methyl-β-cyclodextrin. Both of these effects were fully reversible by cholesterol repletion. By contrast, the responses mediated by AMPA/kainate receptors were not affected by cholesterol depletion. Similar results were obtained in CGCs after chronic inhibition of cholesterol biosynthesis by simvastatin and acute enzymatic cholesterol degradation to 4-cholesten-3-one by cholesterol oxidase. Fluorescence anisotropy measurements showed that membrane fluidity increased after methyl-β-cyclodextrin pretreatment. However, no change in fluidity was observed after cholesterol enzymatic degradation, suggesting that the effect of cholesterol on NMDARs is not mediated by changes in membrane fluidity. Our data show that diminution of NMDAR responses by cholesterol depletion is the result of a reduction of the open probability, whereas the increase in receptor desensitization is the result of an increase in the rate constant of entry into the desensitized state. Surface NMDAR population, agonist affinity, single-channel conductance and open time were not altered in cholesterol-depleted CGCs. The results of our experiments show that cholesterol is a strong endogenous modulator of NMDARs. Key points NMDA receptors (NMDARs) are tetrameric cation channels permeable to calcium; they mediate excitatory synaptic transmission in the CNS and their excessive activation can lead to

Rectification properties and Ca2+ permeability of glutamate receptor channels in hippocampal cells.

PubMed

Lerma, J; Morales, M; Ibarz, J M; Somohano, F

1994-07-01

Excitatory amino acids exert a depolarizing action on central nervous system cells through an increase in cationic conductances. Non-NMDA receptors have been considered to be selectively permeable to Na+ and K+, while Ca2+ influx has been thought to occur through the NMDA receptor subtype. Recently, however, the expression of cloned non-NMDA receptor subunits has shown that alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors are permeable to Ca2+ whenever the receptor lacks a particular subunit (edited GluR-B). The behaviour of recombinant glutamate receptor channels predicts that Ca2+ would only permeate through receptors that show strong inward rectification and vice versa, i.e. AMPA receptors with linear current-voltage relationships would be impermeable to Ca2+. Using the whole-cell configuration of the patch-clamp technique, we have studied the Ca2+ permeability and the rectifying properties of AMPA receptors, when activated by kainate, in hippocampal neurons kept in culture or acutely dissociated from differentiated hippocampus. Cells were classified according to whether they showed outward rectifying (type I), inward rectifying (type II) or almost linear (type III) current-voltage relationships for kainate-activated responses. AMPA receptors of type I cells (52.2%) were mostly Ca(2+)-impermeable (PCa/PCs = 0.1), while type II cells (6.5%) expressed Ca(2+)-permeable receptors (PCa/PCs = 0.9). Type III cells (41.3%) showed responses with low but not negligible Ca2+ permeability (PCa/PCs = 0.18). The degree of Ca2+ permeability and inward rectification were well correlated in cultured cells, i.e. more inward rectification corresponded to higher Ca2+ permeability.(ABSTRACT TRUNCATED AT 250 WORDS)

Preferential Zn2+ influx through Ca2+-permeable AMPA/kainate channels triggers prolonged mitochondrial superoxide production

PubMed Central

Sensi, Stefano L.; Yin, Hong Z.; Carriedo, Sean G.; Rao, Shyam S.; Weiss, John H.

1999-01-01

Synaptically released Zn2+ can enter and cause injury to postsynaptic neurons. Microfluorimetric studies using the Zn2+-sensitive probe, Newport green, examined levels of [Zn2+]i attained in cultured cortical neurons on exposure to N-methyl-d-asparte, kainate, or high K+ (to activate voltage-sensitive Ca2+ channels) in the presence of 300 μM Zn2+. Indicating particularly high permeability through Ca2+-permeable α-amino3-hydroxy-5-methyl-4-isoxazolepropionic-acid/kainate (Ca-A/K) channels, micromolar [Zn2+]i rises were observed only after kainate exposures and only in neurons expressing these channels [Ca-A/K(+) neurons]. Further studies using the oxidation-sensitive dye, hydroethidine, revealed Zn2+-dependent reactive oxygen species (ROS) generation that paralleled the [Zn2+]i rises, with rapid oxidation observed only in the case of Zn2+ entry through Ca-A/K channels. Indicating a mitochondrial source of this ROS generation, hydroethidine oxidation was inhibited by the mitochondrial electron transport blocker, rotenone. Additional evidence for a direct interaction between Zn2+ and mitochondria was provided by the observation that the Zn2+ entry through Ca-A/K channels triggered rapid mitochondrial depolarization, as assessed by using the potential-sensitive dye tetramethylrhodamine ethylester. Whereas Ca2+ influx through Ca-A/K channels also triggers ROS production, the [Zn2+]i rises and subsequent ROS production are of more prolonged duration. PMID:10051656

Central phencyclidine (PCP) receptor binding is glutamate dependent: evidence for a PCP/excitatory amino acid receptor (EAAR) complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Loo, P.; Braunwalder, A.; Lehmann, J.

PCP and other dissociative anesthetica block the increase in neuronal firing rate evoked by the EAAR agonist, N-methyl-Daspartate. NMDA and other EAAs such as glutamate (glu) have not been previously shown to affect PCP ligand binding. In the present study, using once washed rat forebrain membranes, 10 ..mu..M-glu was found to increase the binding of (/sup 3/H)TCP, a PCP analog, to defined PCP recognition sites by 20%. Removal of glu and aspartate (asp) by extensive washing decreased TCP binding by 75-90%. In these membranes, 10 ..mu..M L-glu increased TCP binding 3-fold. This effect was stereospecific and evoked by other EAAsmore » with the order of activity, L-glu > D-asp > L- asp > NMDA > D-glu > quisqualate. Kainate, GABA, NE, DA, 5-HT, 2-chloroadenosine, oxotremorine and histamine had no effect on TCP binding at concentrations up to 100 ..mu..M. The effects of L-glu were attenuated by the NMDA-type receptor antagonist, 2-amino-7--phosphonoheptanoate (AP7; 10 ..mu..M-1 mM). These findings indicate that EAAS facilitate TCP binding, possibly through NMDA-type receptors. The observed interaction between the PCP receptor and EAARs may reflect the existence of a macromolecular receptor complex similar to that demonstrated for the benzodiazepines and GABA.« less

Dopamine alters glutamate receptor desensitization in retinal horizontal cells of the perch (Perca fluviatilis).

PubMed Central

Schmidt, K F; Kruse, M; Hatt, H

1994-01-01

The patch-clamp technique in combination with a fast liquid filament application system was used to study the effect of dopamine on the glutamate receptor desensitization in horizontal cells of the perch (Perca fluviatilis). Kinetics of ligand-gated ion channels in fish horizontal cells are modulated by dopamine. This modulation is presumably mediated by a cAMP-dependent protein phosphorylation. Before incubation with dopamine, the glutamate receptors of horizontal cells activate and desensitize with fast time constants. In the whole-cell recording mode, fast application of the agonists L-glutamate, quisqualate, or alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid prior to the dopamine incubation gives rise to fast transient currents with peak values of about 200 pA that desensitize within 100 ms. Kainate as agonist produced higher steady-state currents but no transient currents. After incubation of the cells with dopamine for 3 min, the desensitization was significantly reduced and the agonists L-glutamate, quisqualate, or alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid induced steady-state currents with amplitudes that were similar to the previously observed transient currents. Kainate-induced currents were only slightly affected. Fast desensitizing currents upon fast application of L-glutamate were also recorded from outside-out patches that were excised from horizontal cells before incubation with dopamine. The currents from excised patches desensitized to a steady-state level of about 0.2 of the peak amplitude with time constants of less than 2 ms. When the outside-out patches were excised from cells after dopamine incubation, steady-state currents were enhanced and no transient currents were observed. The results may indicate that the dopamine-dependent modulation of glutamate-induced currents, which is presumably mediated by a protein phosphorylation, is due to an alteration of the desensitization of the glutamate receptors. PMID:7520178

Kainate Receptors in the Striatum: Implications for Excitotoxicity in Huntington’s Disease

DTIC Science & Technology

2005-08-01

called ionotropic glutamate receptors. Using specific antibodies and glutamate-related compounds, we have achieved successfully a series of studies of the...them from AMPA receptors. However, the recent development of specific antibodies and selective AMPA receptor antagonists allowed various groups to...highly specific antibodies and/or cDNA probes allowed the better characterization of the cellular localization of various GABA and glutamate receptor

Cyto- and receptor architecture of area 32 in human and macaque brains.

PubMed

Palomero-Gallagher, Nicola; Zilles, Karl; Schleicher, Axel; Vogt, Brent A

2013-10-01

Human area 32 plays crucial roles in emotion and memory consolidation. It has subgenual (s32), pregenual (p32), dorsal, and midcingulate components. We seek to determine whether macaque area 32 has subgenual and pregenual subdivisions and the extent to which they are comparable to those in humans by means of NeuN immunohistochemistry and multireceptor analysis of laminar profiles. The macaque has areas s32 and p32. In s32, layer IIIa/b neurons are larger than those of layer IIIc. This relationship is reversed in p32. Layer Va is thicker and Vb thinner in s32. Area p32 contains higher kainate, benzodiazepine (BZ), and serotonin (5-HT)1A but lower N-methyl-D-aspartate (NMDA) and α2 receptor densities. Most differences were found in layers I, II, and VI. Together, these differences support the dual nature of macaque area 32. Comparative analysis of human and macaque s32 and p32 supports equivalences in cyto- and receptor architecture. Although there are differences in mean areal receptor densities, there are considerable similarities at the layer level. Laminar receptor distribution patterns in each area are comparable in the two species in layers III-Va for kainate, NMDA, γ-aminobutyric acid (GABA)B , BZ, and 5-HT1A receptors. Multivariate statistical analysis of laminar receptor densities revealed that human s32 is more similar to macaque s32 and p32 than to human p32. Thus, macaque 32 is more complex than hitherto known. Our data suggest a homologous neural architecture in anterior cingulate s32 and p32 in human and macaque brains. © 2013 Wiley Periodicals, Inc.

Hypothyroidism Affects D2 Receptor-mediated Breathing without altering D2 Receptor Expression

PubMed Central

Schlenker, Evelyn H.; Rio, Rodrigo Del; Schultz, Harold D.

2015-01-01

Bromocriptine depressed ventilation in air and D2 receptor expression in the nucleus tractus solitaries (NTS) in male hypothyroid hamsters. Here we postulated that in age- matched hypothyroid female hamsters, the pattern of D2 receptor modulation of breathing and D2 receptor expression would differ from those reported in hypothyroid males. In females hypothyroidism did not affect D2 receptor protein levels in the NTS, carotid bodies or striatum. Bromocriptine, but not carmoxirole (a peripheral D2 receptor agonist), increased oxygen consumption and body temperature in awake air-exposed hypothyroid female hamsters and stimulated their ventilation before and following exposure to hypoxia. Carmoxirole depressed frequency of breathing in euthyroid hamsters prior to, during and following hypoxia exposures and stimulated it in the hypothyroid hamsters following hypoxia. Although hypothyroidism did not affect expression of D2 receptors, it influenced central D2 modulation of breathing in a disparate manner relative to euthyroid hamsters. PMID:24434437

Hypothyroidism affects D2 receptor-mediated breathing without altering D2 receptor expression.

PubMed

Schlenker, Evelyn H; Del Rio, Rodrigo; Schultz, Harold D

2014-03-01

Bromocriptine depressed ventilation in air and D2 receptor expression in the nucleus tractus solitaries (NTS) in male hypothyroid hamsters. Here we postulated that in age-matched hypothyroid female hamsters, the pattern of D2 receptor modulation of breathing and D2 receptor expression would differ from those reported in hypothyroid males. In females hypothyroidism did not affect D2 receptor protein levels in the NTS, carotid bodies or striatum. Bromocriptine, but not carmoxirole (a peripheral D2 receptor agonist), increased oxygen consumption and body temperature in awake air-exposed hypothyroid female hamsters and stimulated their ventilation before and following exposure to hypoxia. Carmoxirole depressed frequency of breathing in euthyroid hamsters prior to, during and following hypoxia exposures and stimulated it in the hypothyroid hamsters following hypoxia. Although hypothyroidism did not affect expression of D2 receptors, it influenced central D2 modulation of breathing in a disparate manner relative to euthyroid hamsters. Copyright © 2014 Elsevier B.V. All rights reserved.

Attenuation of excitatory amino acid toxicity by metabotropic glutamate receptor agonists and aniracetam in primary cultures of cerebellar granule cells.

PubMed

Pizzi, M; Fallacara, C; Arrighi, V; Memo, M; Spano, P F

1993-08-01

Activation of glutamate ionotropic receptors represents the primary event in the neurotoxicity process triggered by excitatory amino acids. We demonstrate here that the concentration-dependent stimulation of metabotropic glutamate receptor (mGluR) by the selective agonist trans-1-aminocyclopentane-1,3-dicarboxylate or by quisqualate counteracts both glutamate- and kainate-induced neurotoxicity in primary cultures of rat cerebellar granule cells. The mGluR-evoked responses are potentiated by aniracetam, which per se also elicits neuroprotection. Aniracetam concentration-dependently counteracted glutamate-, kainate-, or alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid-induced cell death and greatly facilitated neuroprotective response achieved by different concentrations of both quisqualate and trans-1-aminocyclopentane-1,3-dicarboxylate. In addition, aniracetam potentiated the mGluR-coupled stimulation of phospholipase C, as revealed by the measurement of 3H-inositol phosphate formation. Thus, mGluRs could be a suitable target for novel pharmacological strategies pointing to the treatment of neurodegenerative diseases.

Kainate toxicity in energy-compromised rat hippocampal slices: differences between oxygen and glucose deprivation.

PubMed

Schurr, A; Rigor, B M

1993-06-18

The effects of kainate (KA) on the recovery of neuronal function in rat hippocampal slices after hypoxia or glucose deprivation (GD) were investigated and compared to those of (R,S)-alpha-amino-3-hydroxy-5-methyl-4- isoxazoleproprionate (AMPA). KA and AMPA were found to be more toxic than either N-methyl-D-aspartate (NMDA), quinolinate, or glutamate, both under normal conditions and under states of energy deprivation. Doses as low as 1 microM KA or AMPA were sufficient to significantly reduce the recovery rate of neuronal function in slices after a standardized period of hypoxia or GD. The enhancement of hypoxic neuronal damage by both agonists could be partially blocked by the antagonist kynurenate, by the NMDA competitive antagonist AP5, and by elevating [Mg2+] in or by omitting Ca2+ from the perfusion medium. The AMPA antagonist glutamic acid diethyl ester was ineffective in preventing the enhanced hypoxic neuronal damage by either KA or AMPA. The antagonist of the glycine modulatory site on the NMDA receptor, 7-chlorokynurenate, did not block the KA toxicity but was able to block the toxicity of AMPA. 2,3-Dihydroxyquinoxaline completely blocked the KA- and AMPA-enhanced hypoxic neuronal damage. The KA-enhanced, GD-induced neuronal damage was prevented by Ca2+ depletion and partially antagonized by kynurenate but not by AP5 or elevated [Mg2+]. The results of the present study indicate that the KA receptor is involved in the mechanism of neuronal damage induced by hypoxia and GD, probably allowing Ca2+ influx and subsequent intracellular Ca2+ overload.(ABSTRACT TRUNCATED AT 250 WORDS)

Protein kinase and phosphatase modulation of quail brain GABA(A) and non-NMDA receptors co-expressed in Xenopus oocytes.

PubMed

Moon, C; Fraser, S P; Djamgoz, M B

2000-02-01

The GABA(A) receptor and the non-NMDA subtype of the ionotropic glutamate receptor were co-expressed in Xenopus oocytes by injection of quail brain mRNA. The oocytes were treated with various protein kinase (PK) and protein phosphatase (PP) activators and inhibitors and the effects on receptor functioning were monitored. Two phorbol esters, 4-beta-phorbol 12-myristate-13-acetate (PMA) and 4-beta-phorbol 12,13-dibutyrate (PDBu); the cGMP-dependent PK activators sodium nitroprusside (SNP) and S-nitrosoglutathione (SNOG); and the PP inhibitor okadaic acid (OA) reduced the amplitude of the GABA-induced currents, whilst the PK inhibitor staurosporine potentiated it. In addition, PMA, PDBu, SNP, and OA reduced the desensitization of the GABA-induced response. Identical treatments generally had similar but less pronounced effects on responses generated by kainate (KA) but the desensitization characteristic of the non-NMDA receptor was not affected. None of the treatments had any effect on the reversal potentials of the induced currents. Immunoblots revealed that the oocytes express endogenous PKG and guanylate cyclase. The results are discussed in terms of the molecular structures of GABA(A) and non-NMDA receptors and the potential functional consequences of phosphorylation/dephosphorylation.

Inhibition of choline acetyltransferase by excitatory amino acids as a possible mechanism for cholinergic dysfunction in the central nervous system.

PubMed

Loureiro-Dos-Santos, N E; Reis, R A; Kubrusly, R C; de Almeida, O M; Gardino, P F; de Mello, M C; de Mello, F G

2001-05-01

Choline acetyltransferase (ChAT) activity was reduced by more than 85% in cultured retina cells after 16 h treatment with 150 microM kainate (T(1/2) : 3.5 h). Glutamate, AMPA and quisqualate also inhibited the enzyme in equivalent proportion. Cell lesion measured by lactate dehydrogenase (LDH) release, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide - thiazolyl blue (MTT) reduction and microscopic observation was not detected even after 48 h with kainate. Other retina neurochemical markers were not affected by kainate and full recovery of the enzyme was achieved 9 days after kainate removal. Moreover, hemicolinium-3 sensitive choline uptake and hemicolinium-3 binding sites were maintained intact after kainate treatment. The immunoblot and immunohistochemical analysis of the enzyme revealed that ChAT molecules were maintained in cholinergic neurons. The use of antagonists showed that ionotropic and group 1 metabotropic receptors mediated the effect of glutamate on ChAT inhibition, in a calcium dependent manner. The quisqualate mediated ChAT inhibition and part of the kainate effect (30%) was prevented by 5 mM N(G)-nitro-L-arginine methyl ester (L-NAME). Veratridine (3 microM) also reduced ChAT by a Ca(2+) dependent, but glutamate independent mechanism and was prevented by 1 microM tetrodotoxin.

Co-induction of p75(NTR) and the associated death executor NADE in degenerating hippocampal neurons after kainate-induced seizures in the rat.

PubMed

Yi, Jung-Sun; Lee, Soon-Keum; Sato, Taka-Aki; Koh, Jae-Young

2003-08-21

Zinc induces in cultured cortical neurons both p75(NTR) and p75(NTR)-associated death executor (NADE), which together contribute to caspase-dependent neuronal apoptosis. Since zinc neurotoxicity may contribute to neuronal death following seizures, we examined whether p75(NTR) and NADE are co-induced also in rat hippocampal neurons degenerating after seizures. Staining of brain sections with a zinc-specific fluorescent dye (N-(6-methoxy-8-quinolyl)-p-carboxybenzoylsulphonamide) and acid fuchsin revealed zinc accumulation in degenerating neuronal cell bodies in CA1 and CA3 of hippocampus 24 h after kainate injection. Both anti-p75(NTR) and anti-NADE immunoreactivities appeared in zinc-accumulating/degenerating neurons in both areas. Intraventricular injection of CaEDTA, without altering the severity or time course of kainate-induced seizures, markedly attenuated the induction of p75(NTR)/NADE in hippocampus, which correlated with the decrease of caspase-3 activation and zinc accumulation/cell death. The present study has demonstrated that p75(NTR) and NADE are co-induced in neurons degenerating after kainate-induced seizures in rats, likely in a zinc-dependent manner.

Properties of GluR3 receptors tagged with GFP at the amino or carboxyl terminus

PubMed Central

Limon, Agenor; Reyes-Ruiz, Jorge Mauricio; Eusebi, Fabrizio; Miledi, Ricardo

2007-01-01

Anatomical visualization of neurotransmitter receptor localization is facilitated by tagging receptors, but this process can alter their functional properties. We have evaluated the distribution and properties of WT glutamate receptor 3 (GluR3) α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (WT GluR3) and two receptors in which GFP was tagged to the amino terminus (GFP-GluR3) or to the carboxyl terminus (GluR3-GFP). Although the fluorescence in Xenopus oocytes was stronger in the vegetal hemisphere because of localization of internal structures (probable sites of production, storage or recycling of receptors), the insertion of receptors into the plasma membrane was polarized to the animal hemisphere. The fluorescence intensity of oocytes injected with GluR3-GFP RNA was approximately double that of oocytes injected with GFP-GluR3 RNA. Accordingly, GluR3-GFP oocytes generated larger kainate-induced currents than GFP-GluR3 oocytes, with similar EC50 values. Currents elicited by glutamate, or AMPA coapplied with cyclothiazide, were also larger in GluR3-GFP oocytes. The glutamate- to kainate-current amplitude ratios differed, with GluR3-GFP being activated more efficiently by glutamate than the WT or GFP-GluR3 receptors. This pattern correlates with the slower decay of glutamate-induced currents generated by GluR3-GFP receptors. These changes were not observed when GFP was tagged to the amino terminus, and these receptors behaved like the WT. The antagonistic effects of 6-nitro-7-sulfamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) were not altered in any of the tagged receptors. We conclude that GFP is a useful and convenient tag for visualizing these proteins. However, the effects of different sites of tag insertion on receptor characteristics must be taken into account in assessing the roles played by these receptor proteins. PMID:17881566

Properties of GluR3 receptors tagged with GFP at the amino or carboxyl terminus.

PubMed

Limon, Agenor; Reyes-Ruiz, Jorge Mauricio; Eusebi, Fabrizio; Miledi, Ricardo

2007-09-25

Anatomical visualization of neurotransmitter receptor localization is facilitated by tagging receptors, but this process can alter their functional properties. We have evaluated the distribution and properties of WT glutamate receptor 3 (GluR3) alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (WT GluR3) and two receptors in which GFP was tagged to the amino terminus (GFP-GluR3) or to the carboxyl terminus (GluR3-GFP). Although the fluorescence in Xenopus oocytes was stronger in the vegetal hemisphere because of localization of internal structures (probable sites of production, storage or recycling of receptors), the insertion of receptors into the plasma membrane was polarized to the animal hemisphere. The fluorescence intensity of oocytes injected with GluR3-GFP RNA was approximately double that of oocytes injected with GFP-GluR3 RNA. Accordingly, GluR3-GFP oocytes generated larger kainate-induced currents than GFP-GluR3 oocytes, with similar EC(50) values. Currents elicited by glutamate, or AMPA coapplied with cyclothiazide, were also larger in GluR3-GFP oocytes. The glutamate- to kainate-current amplitude ratios differed, with GluR3-GFP being activated more efficiently by glutamate than the WT or GFP-GluR3 receptors. This pattern correlates with the slower decay of glutamate-induced currents generated by GluR3-GFP receptors. These changes were not observed when GFP was tagged to the amino terminus, and these receptors behaved like the WT. The antagonistic effects of 6-nitro-7-sulfamoylbenzo[f]quinoxaline-2,3-dione (NBQX) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) were not altered in any of the tagged receptors. We conclude that GFP is a useful and convenient tag for visualizing these proteins. However, the effects of different sites of tag insertion on receptor characteristics must be taken into account in assessing the roles played by these receptor proteins.

Loss of Hippocampal Neurons after Kainate Treatment Correlates with Behavioral Deficits

PubMed Central

Maia, Gisela H.; Quesado, José L.; Soares, Joana I.; do Carmo, Joana M.; Andrade, Pedro A.; Andrade, José P.; Lukoyanov, Nikolai V.

2014-01-01

Treating rats with kainic acid induces status epilepticus (SE) and leads to the development of behavioral deficits and spontaneous recurrent seizures later in life. However, in a subset of rats, kainic acid treatment does not induce overt behaviorally obvious acute SE. The goal of this study was to compare the neuroanatomical and behavioral changes induced by kainate in rats that developed convulsive SE to those who did not. Adult male Wistar rats were treated with kainic acid and tested behaviorally 5 months later. Rats that had experienced convulsive SE showed impaired performance on the spatial water maze and passive avoidance tasks, and on the context and tone retention tests following fear conditioning. In addition, they exhibited less anxiety-like behaviors than controls on the open-field and elevated plus-maze tests. Histologically, convulsive SE was associated with marked neuron loss in the hippocampal CA3 and CA1 fields, and in the dentate hilus. Rats that had not experienced convulsive SE after kainate treatment showed less severe, but significant impairments on the spatial water maze and passive avoidance tasks. These rats had fewer neurons than control rats in the dentate hilus, but not in the hippocampal CA3 and CA1 fields. Correlational analyses revealed significant relationships between spatial memory indices of rats and neuronal numbers in the dentate hilus and CA3 pyramidal field. These results show that a part of the animals that do not display intense behavioral seizures (convulsive SE) immediately after an epileptogenic treatment, later in life, they may still have noticeable structural and functional changes in the brain. PMID:24409306

Effects of ionotropic glutamate receptor antagonists on rat dural artery diameter in an intravital microscopy model.

PubMed

Chan, K Y; Gupta, S; de Vries, R; Danser, A H J; Villalón, C M; Muñoz-Islas, E; Maassenvandenbrink, A

2010-07-01

During migraine, trigeminal nerves may release calcitonin gene-related peptide (CGRP), inducing cranial vasodilatation and central nociception; hence, trigeminal inhibition or blockade of craniovascular CGRP receptors may prevent this vasodilatation and abort migraine headache. Several preclinical studies have shown that glutamate receptor antagonists affect the pathophysiology of migraine. This study investigated whether antagonists of NMDA (ketamine and MK801), AMPA (GYKI52466) and kainate (LY466195) glutamate receptors affected dural vasodilatation induced by alpha-CGRP, capsaicin and periarterial electrical stimulation in rats, using intravital microscopy. Male Sprague-Dawley rats were anaesthetized and the overlying bone was thinned to visualize the dural artery. Then, vasodilator responses to exogenous (i.v. alpha-CGRP) and endogenous (released by i.v. capsaicin and periarterial electrical stimulation) CGRP were elicited in the absence or presence of the above antagonists. alpha-CGRP, capsaicin and periarterial electrical stimulation increased dural artery diameter. Ketamine and MK801 inhibited the vasodilator responses to capsaicin and electrical stimulation, while only ketamine attenuated those to alpha-CGRP. In contrast, GYKI52466 only attenuated the vasodilatation to exogenous alpha-CGRP, while LY466195 did not affect the vasodilator responses to endogenous or exogenous CGRP. Although GYKI52466 has not been tested clinically, our data suggest that it would not inhibit migraine via vascular mechanisms. Similarly, the antimigraine efficacy of LY466195 seems unrelated to vascular CGRP-mediated pathways and/or receptors. In contrast, the cranial vascular effects of ketamine and MK801 may represent a therapeutic mechanism, although the same mechanism might contribute, peripherally, to cardiovascular side effects.

Effects of Chronic Alcohol Exposure on Kainate Receptor-Mediated Neurotransmission in the Hippocampus

DTIC Science & Technology

2004-09-01

hippocampus and hypothalamus. J Neurosci Res 63:200-208. Thorpe GH et al. (1989) Chemiluminescent enzyme immunoassay of alpha - fetoprotein based on an...cells. Proc Natl Acad Sci USA 83:6213-6215. Montpied Pet al. (1991) Prolonged ethanol inhalation decreases gamma-aminobutyric acidA receptor alpha ...potentials mediated via alpha -bungarotoxin-sensitive nico- tinic acetylcholine receptors in rat hippocampal interneurons. J Neurosci 18:8228- 8235

Faster flux of neurotransmitter glutamate during seizure — Evidence from 13C-enrichment of extracellular glutamate in kainate rat model

PubMed Central

2017-01-01

The objective is to examine how the flux of neurotransmitter glutamate from neurons to the extracellular fluid, as measured by the rate of 13C enrichment of extracellular glutamate (GLUECF), changes in response to seizures in the kainate-induced rat model of temporal-lobe epilepsy. Following unilateral intrahippocampal injection of kainate, GLUECF was collected by microdialysis from the CA1/CA3 region of awake rats, in combination with EEG recording of chronic-phase recurrent seizures and intravenous infusion of [2,5-13C]glucose. The 13C enrichment of GLUECF C5 at ~ 10 picomol level was measured by gas-chromatography mass-spectrometry. The rate of 13C enrichment, expressed as the increase of the fractional enrichment/min, was 0.0029 ± 0.0001/min in frequently seizing rats (n = 4); this was significantly higher (p < 0.01) than in the control (0.00167 ± 0.0001/min; n = 6) or in rats with infrequent seizures (0.00172 ± 0.0001/min; n = 6). This result strongly suggests that the flux of the excitatory neurotransmitter from neurons to the extracellular fluid is significantly increased by frequent seizures. The extracellular [12C + 13C]glutamate concentration increased progressively in frequently seizing rats. Taken together, these results strongly suggest that the observed seizure-induced high flux of glutamate overstimulated glutamate receptors, which triggered a chain reaction of excitation in the CA3 recurrent glutamatergic networks. The rate of 13C enrichment of extracellular glutamine (GLNECF) at C5 was 0.00299 ± 0.00027/min in frequently seizing rats, which was higher (p < 0.05) than in controls (0.00227 ± 0.00008/min). For the first time in vivo, this study examined the effects of epileptic seizures on fluxes of the neurotransmitter glutamate and its precursor glutamine in the extracellular fluid of the hippocampus. The advantages, limitations and the potential for improvement of this approach for pre-clinical and clinical studies of temporal-lobe epilepsy

Calcium permeable AMPA receptors and autoreceptors in external tufted cells of rat olfactory bulb

PubMed Central

Ma, Jie; Lowe, Graeme

2007-01-01

Glomeruli are functional units of the olfactory bulb responsible for early processing of odor information encoded by single olfactory receptor genes. Glomerular neural circuitry includes numerous external tufted (ET) cells whose rhythmic burst firing may mediate synchronization of bulbar activity with the inhalation cycle. Bursting is entrained by glutamatergic input from olfactory nerve terminals, so specific properties of ionotropic glutamate receptors on ET cells are likely to be important determinants of olfactory processing. Particularly intriguing is recent evidence that α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptors of juxta-glomerular neurons may permeate calcium. This could provide a novel pathway for regulating ET cell signaling. We tested the hypothesis that ET cells express functional calcium-permeable AMPA receptors. In rat olfactory bulb slices, excitatory postsynaptic currents (EPSCs) in ET cells were evoked by olfactory nerve shock, and by uncaging glutamate. We found attenuation of AMPA/kainate EPSCs by 1-naphthyl acetyl-spermine (NAS), an open-channel blocker specific for calcium permeable AMPA receptors. Cyclothiazide strongly potentiated EPSCs, indicating a major contribution from AMPA receptors. The current-voltage (I-V) relation of uncaging EPSCs showed weak inward rectification which was lost after > ~ 10 min of whole-cell dialysis, and was absent in NAS. In kainate-stimulated slices, Co2+ ions permeated cells of the glomerular layer. Large AMPA EPSCs were accompanied by fluorescence signals in fluo-4 loaded cells, suggesting calcium permeation. Depolarizing pulses evoked slow tail currents with pharmacology consistent with involvement of calcium permeable AMPA autoreceptors. Tail currents were abolished by Cd2+ and NBQX, and were sensitive to NAS block. Glutamate autoreceptors were confirmed by uncaging intracellular calcium to evoke a large inward current. Our results provide evidence that calcium permeable AMPA

Ionotropic glutamate receptors: regulation by G-protein-coupled receptors.

PubMed

Rojas, Asheebo; Dingledine, Raymond

2013-04-01

The function of many ion channels is under dynamic control by coincident activation of G-protein-coupled receptors (GPCRs), particularly those coupled to the Gαs and Gαq family members. Such regulation is typically dependent on the subunit composition of the ionotropic receptor or channel as well as the GPCR subtype and the cell-specific panoply of signaling pathways available. Because GPCRs and ion channels are so highly represented among targets of U.S. Food and Drug Administration-approved drugs, functional cross-talk between these drug target classes is likely to underlie many therapeutic and adverse effects of marketed drugs. GPCRs engage a myriad of signaling pathways that involve protein kinases A and C (PKC) and, through PKC and interaction with β-arrestin, Src kinase, and hence the mitogen-activated-protein-kinase cascades. We focus here on the control of ionotropic glutamate receptor function by GPCR signaling because this form of regulation can influence the strength of synaptic plasticity. The amino acid residues phosphorylated by specific kinases have been securely identified in many ionotropic glutamate (iGlu) receptor subunits, but which of these sites are GPCR targets is less well known even when the kinase has been identified. N-methyl-d-aspartate, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid, and heteromeric kainate receptors are all downstream targets of GPCR signaling pathways. The details of GPCR-iGlu receptor cross-talk should inform a better understanding of how synaptic transmission is regulated and lead to new therapeutic strategies for neuropsychiatric disorders.

Ionotropic Glutamate Receptors & CNS Disorders

PubMed Central

Bowie, Derek

2008-01-01

Disorders of the central nervous system (CNS) are complex disease states that represent a major challenge for modern medicine. Although etiology is often unknown, it is established that multiple factors such as defects in genetics and/or epigenetics, the environment as well as imbalance in neurotransmitter receptor systems are all at play in determining an individual’s susceptibility to disease. Gene therapy is currently not available and therefore, most conditions are treated with pharmacological agents that modify neurotransmitter receptor signaling. Here, I provide a review of ionotropic glutamate receptors (iGluRs) and the roles they fulfill in numerous CNS disorders. Specifically, I argue that our understanding of iGluRs has reached a critical turning point to permit, for the first time, a comprehensive re-evaluation of their role in the cause of disease. I illustrate this by highlighting how defects in AMPA receptor trafficking are important to Fragile X mental retardation and ectopic expression of kainate (KA) receptor synapses contributes to the pathology of temporal lobe epilepsy. Finally, I discuss how parallel advances in studies of other neurotransmitter systems may allow pharmacologists to work towards a cure for many CNS disorders rather than developing drugs to treat their symptoms. PMID:18537642

Ionotropic GABA and Glutamate Receptor Mutations and Human Neurologic Diseases.

PubMed

Yuan, Hongjie; Low, Chian-Ming; Moody, Olivia A; Jenkins, Andrew; Traynelis, Stephen F

2015-07-01

The advent of whole exome/genome sequencing and the technology-driven reduction in the cost of next-generation sequencing as well as the introduction of diagnostic-targeted sequencing chips have resulted in an unprecedented volume of data directly linking patient genomic variability to disorders of the brain. This information has the potential to transform our understanding of neurologic disorders by improving diagnoses, illuminating the molecular heterogeneity underlying diseases, and identifying new targets for therapeutic treatment. There is a strong history of mutations in GABA receptor genes being involved in neurologic diseases, particularly the epilepsies. In addition, a substantial number of variants and mutations have been found in GABA receptor genes in patients with autism, schizophrenia, and addiction, suggesting potential links between the GABA receptors and these conditions. A new and unexpected outcome from sequencing efforts has been the surprising number of mutations found in glutamate receptor subunits, with the GRIN2A gene encoding the GluN2A N-methyl-d-aspartate receptor subunit being most often affected. These mutations are associated with multiple neurologic conditions, for which seizure disorders comprise the largest group. The GluN2A subunit appears to be a locus for epilepsy, which holds important therapeutic implications. Virtually all α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor mutations, most of which occur within GRIA3, are from patients with intellectual disabilities, suggesting a link to this condition. Similarly, the most common phenotype for kainate receptor variants is intellectual disability. Herein, we summarize the current understanding of disease-associated mutations in ionotropic GABA and glutamate receptor families, and discuss implications regarding the identification of human mutations and treatment of neurologic diseases. Copyright © 2015 by The American Society for Pharmacology and Experimental

Ionotropic GABA and Glutamate Receptor Mutations and Human Neurologic Diseases

PubMed Central

Yuan, Hongjie; Low, Chian-Ming; Moody, Olivia A.; Jenkins, Andrew

2015-01-01

The advent of whole exome/genome sequencing and the technology-driven reduction in the cost of next-generation sequencing as well as the introduction of diagnostic-targeted sequencing chips have resulted in an unprecedented volume of data directly linking patient genomic variability to disorders of the brain. This information has the potential to transform our understanding of neurologic disorders by improving diagnoses, illuminating the molecular heterogeneity underlying diseases, and identifying new targets for therapeutic treatment. There is a strong history of mutations in GABA receptor genes being involved in neurologic diseases, particularly the epilepsies. In addition, a substantial number of variants and mutations have been found in GABA receptor genes in patients with autism, schizophrenia, and addiction, suggesting potential links between the GABA receptors and these conditions. A new and unexpected outcome from sequencing efforts has been the surprising number of mutations found in glutamate receptor subunits, with the GRIN2A gene encoding the GluN2A N-methyl-d-aspartate receptor subunit being most often affected. These mutations are associated with multiple neurologic conditions, for which seizure disorders comprise the largest group. The GluN2A subunit appears to be a locus for epilepsy, which holds important therapeutic implications. Virtually all α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor mutations, most of which occur within GRIA3, are from patients with intellectual disabilities, suggesting a link to this condition. Similarly, the most common phenotype for kainate receptor variants is intellectual disability. Herein, we summarize the current understanding of disease-associated mutations in ionotropic GABA and glutamate receptor families, and discuss implications regarding the identification of human mutations and treatment of neurologic diseases. PMID:25904555

Profiling neurotransmitter receptor expression in the Ambystoma mexicanum brain.

PubMed

Reyes-Ruiz, Jorge Mauricio; Limon, Agenor; Korn, Matthew J; Nakamura, Paul A; Shirkey, Nicole J; Wong, Jamie K; Miledi, Ricardo

2013-03-22

Ability to regenerate limbs and central nervous system (CNS) is unique to few vertebrates, most notably the axolotl (Ambystoma sp.). However, despite the fact the neurotransmitter receptors are involved in axonal regeneration, little is known regarding its expression profile. In this project, RT-PCR and qPCR were performed to gain insight into the neurotransmitter receptors present in Ambystoma. Its functional ability was studied by expressing axolotl receptors in Xenopus laevis oocytes by either injection of mRNA or by direct microtransplantation of brain membranes. Oocytes injected with axolotl mRNA expressed ionotropic receptors activated by GABA, aspartate+glycine and kainate, as well as metabotropic receptors activated by acetylcholine and glutamate. Interestingly, we did not see responses following the application of serotonin. Membranes from the axolotl brain were efficiently microtransplanted into Xenopus oocytes and two types of native GABA receptors that differed in the temporal course of their responses and affinities to GABA were observed. Results of this study are necessary for further characterization of axolotl neurotransmitter receptors and may be useful for guiding experiments aimed at understanding activity-dependant limb and CNS regeneration. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Radial symmetry in a chimeric glutamate receptor pore

NASA Astrophysics Data System (ADS)

Wilding, Timothy J.; Lopez, Melany N.; Huettner, James E.

2014-02-01

Ionotropic glutamate receptors comprise two conformationally different A/C and B/D subunit pairs. Closed channels exhibit fourfold radial symmetry in the transmembrane domain (TMD) but transition to twofold dimer-of-dimers symmetry for extracellular ligand binding and N-terminal domains. Here, to evaluate symmetry in open pores we analysed interaction between the Q/R editing site near the pore loop apex and the transmembrane M3 helix of kainate receptor subunit GluK2. Chimeric subunits that combined the GluK2 TMD with extracellular segments from NMDA receptors, which are obligate heteromers, yielded channels made up of A/C and B/D subunit pairs with distinct substitutions along M3 and/or Q/R site editing status, in an otherwise identical homotetrameric TMD. Our results indicate that Q/R site interaction with M3 occurs within individual subunits and is essentially the same for both A/C and B/D subunit conformations, suggesting that fourfold pore symmetry persists in the open state.

Allosteric potentiation of quisqualate receptors by a nootropic drug aniracetam.

PubMed

Ito, I; Tanabe, S; Kohda, A; Sugiyama, H

1990-05-01

1. Allosteric potentiation of the ionotropic quisqualate (iQA) receptor by a nootropic drug aniracetam (1-p-anisoyl-2-pyrrolidinone) was investigated using Xenopus oocytes injected with rat brain mRNA and rat hippocampal slices. 2. Aniracetam potentiates the iQA responses induced in Xenopus oocytes by rat brain mRNA in a reversible manner. This effect was observed above the concentrations of 0.1 mM. Kainate. N-methyl-D-aspartate and gamma-aminobutyric acid responses induced in the same oocytes were not affected. 3. The specific potentiation of iQA responses was accompanied by an increase in the conductance change of iQA and alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) responses, but the affinity of receptors for agonist and the ion-selectivity of the channels (reversal potentials) were not changed. 4. Aniracetam reversibly potentiated the iQA responses recorded intracellularly from the pyramidal cells in the CA1 region of rat hippocampal slices. The excitatory postsynaptic potentials (EPSPs) in Schaffer collateral-commissural-CA1 synapses were also potentiated by aniracetam. 5. Population EPSPs recorded in the mossy fibre-CA3 synapses as well as Schaffer-commissural synapses were also potentiated by aniracetam. The amplitudes of the potentiation were not changed by the formation of long-term potentiation.

HOMEOSTATIC REGULATION OF KCC2 ACTIVITY BY THE ZINC RECEPTOR mZnR/GPR39 DURING SEIZURES

PubMed Central

Gilad, David; Shorer, Sharon; Ketzef, Maya; Friedman, Alon; Sekler, Israel; Aizenman, Elias; Hershfinkel, Michal

2015-01-01

The aim of this study was to investigate the role of the synaptic metabotropic zinc receptor mZnR/GPR39 in physiological adaptation to epileptic seizures. We previously demonstrated that synaptic activation of mZnR/GPR39 enhances inhibitory drive in the hippocampus by upregulating neuronal K+/Cl− co-transporter 2 (KCC2) activity. Here, we first show that mZnR/GPR39 knockout (KO) adult mice have dramatically enhanced susceptibility to seizures triggered by a single intraperitoneal injection of kainic acid, when compared to wild type (WT) littermates. Kainate also substantially enhances seizure-associated gamma oscillatory activity in juvenile mZnR/GPR39 KO hippocampal slices, a phenomenon that can be reproduced in WT tissue by extracellular Zn2+ chelation. Importantly, kainate-induced synaptic Zn2+ release enhances surface expression and transport activity of KCC2 in WT, but not mZnR/GPR39 KO hippocampal neurons. Kainate-dependent upregulation of KCC2 requires mZnR/GPR39 activation of the Gαq/phospholipase C/extracellular regulated kinase (ERK1/2) signaling cascade. We suggest that mZnR/GPR39-dependent upregulation of KCC2 activity provides homeostatic adaptation to an excitotoxic stimulus by increasing inhibition. As such, mZnR/GPR39 may provide a novel pharmacological target for dampening epileptic seizure activity. PMID:25562657

Structure and symmetry inform gating principles of ionotropic glutamate receptors.

PubMed

Zhu, Shujia; Gouaux, Eric

2017-01-01

Ionotropic glutamate receptors (iGluRs) transduce signals derived from release of the excitatory neurotransmitter glutamate from pre-synaptic neurons into excitation of post-synaptic neurons on a millisecond time-scale. In recent years, the elucidation of full-length iGluR structures of NMDA, AMPA and kainate receptors by X-ray crystallography and single particle cryo-electron microscopy has greatly enhanced our understanding of the interrelationships between receptor architecture and gating mechanism. Here we briefly review full-length iGluR structures and discuss the similarities and differences between NMDA receptors and non-NMDA iGluRs. We focus on distinct conformations, including ligand-free, agonist-bound active, agonist-bound desensitized and antagonist-bound conformations as well as modulator and auxiliary protein-bound states. These findings provide insights into structure-based mechanisms of iGluR gating and modulation which together shape the amplitude and time course of the excitatory postsynaptic potential. This article is part of the Special Issue entitled 'Ionotropic glutamate receptors'. Copyright © 2016 Elsevier Ltd. All rights reserved.

Mediation of the neuroprotective action of R-phenylisopropyl-adenosine through a centrally located adenosine A1 receptor.

PubMed Central

MacGregor, D. G.; Miller, W. J.; Stone, T. W.

1993-01-01

1. Systemic injections of kainic acid, 10 mg kg-1, into adult rats resulted in lesions in the hippocampus, as assessed by peripheral benzodiazepine ligand binding. Co-administration of clonazepam at 1 mg kg-1 or 0.2 mg kg-1 prevented major seizures associated with kainate injections, but did not alter significantly the production of hippocampal damage. 2. The co-administration of the adenosine A1 agonist R-phenylisopropyladenosine (R-PIA, 25 micrograms kg-1, i.p.) abolished the lesions induced by kainic acid. 3. The presence of the selective A1 antagonist, 8-cyclopentyl-1,3-dipropylxanthine (250 or 50 micrograms kg-1, i.p.) abolished the R-PIA neuroprotective action. 4. The A1/A2 antagonist, 8-(p-sulphophenyl)theophylline (20 mg kg-1, i.p.) which cannot cross the blood brain barrier, did not alter significantly the neuroprotective action of R-PIA, indicating that the neuroprotective action of the purine may be predominantly central. 5. The time course of the neuroprotection was also examined. R-PIA was effective when administered 2 h before or after kainate administration. 6. The results emphasise the potential utility of systemically active adenosine A1 receptor ligands in reducing CNS gliosis induced by the activation of excitatory amino acid receptors. PMID:8220909

Crystal Structures of the Glutamate Receptor Ion Channel GluK3 and GluK5 Amino-Terminal Domains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, Janesh; Mayer, Mark L.

2010-11-30

Ionotropic glutamate receptors (iGluRs) mediate the majority of fast excitatory synaptic neurotransmission in the central nervous system. The selective assembly of iGluRs into AMPA, kainate, and N-methyl-d-aspartic acid (NMDA) receptor subtypes is regulated by their extracellular amino-terminal domains (ATDs). Kainate receptors are further classified into low-affinity receptor families (GluK1-GluK3) and high-affinity receptor families (GluK4-GluK5) based on their affinity for the neurotoxin kainic acid. These two families share a 42% sequence identity for the intact receptor but only a 27% sequence identity at the level of ATD. We have determined for the first time the high-resolution crystal structures of GluK3 andmore » GluK5 ATDs, both of which crystallize as dimers but with a strikingly different dimer assembly at the R1 interface. By contrast, for both GluK3 and GluK5, the R2 domain dimer assembly is similar to those reported previously for other non-NMDA iGluRs. This observation is consistent with the reports that GluK4-GluK5 cannot form functional homomeric ion channels and require obligate coassembly with GluK1-GluK3. Our analysis also reveals that the relative orientation of domains R1 and R2 in individual non-NMDA receptor ATDs varies by up to 10{sup o}, in contrast to the 50{sup o} difference reported for the NMDA receptor GluN2B subunit. This restricted domain movement in non-NMDA receptor ATDs seems to result both from extensive intramolecular contacts between domain R1 and domain R2 and from their assembly as dimers, which interact at both R1 and R2 domains. Our results provide the first insights into the structure and function of GluK4-GluK5, the least understood family of iGluRs.« less

Structural and Functional Architecture of AMPA-Type Glutamate Receptors and Their Auxiliary Proteins.

PubMed

Greger, Ingo H; Watson, Jake F; Cull-Candy, Stuart G

2017-05-17

AMPA receptors (AMPARs) are tetrameric ion channels that together with other ionotropic glutamate receptors (iGluRs), the NMDA and kainate receptors, mediate a majority of excitatory neurotransmission in the central nervous system. Whereas NMDA receptors gate channels with slow kinetics, responsible primarily for generating long-term synaptic potentiation and depression, AMPARs are the main fast transduction elements at synapses and are critical for the expression of plasticity. The kinetic and conductance properties of AMPARs are laid down during their biogenesis and are regulated by post-transcriptional RNA editing, splice variation, post-translational modification, and subunit composition. Furthermore, AMPAR assembly, trafficking, and functional heterogeneity depends on a large repertoire of auxiliary subunits-a feature that is particularly striking for this type of iGluR. Here, we discuss how the subunit structure, stoichiometry, and auxiliary subunits generate a heterogeneous plethora of receptors, each tailored to fulfill a vital role in fast synaptic signaling and plasticity. Copyright © 2017 Elsevier Inc. All rights reserved.

Bisphenol A affects androgen receptor function via multiple mechanisms.

PubMed

Teng, Christina; Goodwin, Bonnie; Shockley, Keith; Xia, Menghang; Huang, Ruili; Norris, John; Merrick, B Alex; Jetten, Anton M; Austin, Christopher P; Tice, Raymond R

2013-05-25

Bisphenol A (BPA), is a well-known endocrine disruptor compound (EDC) that affects the normal development and function of the female and male reproductive system, however the mechanisms of action remain unclear. To investigate the molecular mechanisms of how BPA may affect ten different nuclear receptors, stable cell lines containing individual nuclear receptor ligand binding domain (LBD)-linked to the β-Gal reporter were examined by a quantitative high throughput screening (qHTS) format in the Tox21 Screening Program of the NIH. The results showed that two receptors, estrogen receptor alpha (ERα) and androgen receptor (AR), are affected by BPA in opposite direction. To confirm the observed effects of BPA on ERα and AR, we performed transient transfection experiments with full-length receptors and their corresponding response elements linked to luciferase reporters. We also included in this study two BPA analogs, bisphenol AF (BPAF) and bisphenol S (BPS). As seen in African green monkey kidney CV1 cells, the present study confirmed that BPA and BPAF act as ERα agonists (half maximal effective concentration EC50 of 10-100 nM) and as AR antagonists (half maximal inhibitory concentration IC50 of 1-2 μM). Both BPA and BPAF antagonized AR function via competitive inhibition of the action of synthetic androgen R1881. BPS with lower estrogenic activity (EC50 of 2.2 μM), did not compete with R1881 for AR binding, when tested at 30 μM. Finally, the effects of BPA were also evaluated in a nuclear translocation assays using EGPF-tagged receptors. Similar to 17β-estradiol (E2) which was used as control, BPA was able to enhance ERα nuclear foci formation but at a 100-fold higher concentration. Although BPA was able to bind AR, the nuclear translocation was reduced. Furthermore, BPA was unable to induce functional foci in the nuclei and is consistent with the transient transfection study that BPA is unable to activate AR. Published by Elsevier Ireland Ltd.

Nootropic agents enhance the recruitment of fast GABAA inhibition in rat neocortex.

PubMed

Ling, Douglas S F; Benardo, Larry S

2005-07-01

It is widely believed that nootropic (cognition-enhancing) agents produce their therapeutic effects by augmenting excitatory synaptic transmission in cortical circuits, primarily through positive modulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionate receptors (AMPARs). However, GABA-mediated inhibition is also critical for cognition, and enhanced GABA function may be likewise therapeutic for cognitive disorders. Could nootropics act through such a mechanism as well? To address this question, we examined the effects of nootropic agents on excitatory and inhibitory postsynaptic currents (EPSCs and IPSCs) recorded from layer V pyramidal cells in acute slices of somatosensory cortex. Aniracetam, a positive modulator of AMPA/kainate receptors, increased the peak amplitude of evoked EPSCs and the amplitude and duration of polysynaptic fast IPSCs, manifested as a greater total charge carried by IPSCs. As a result, the EPSC/IPSC ratio of total charge was decreased, representing a shift in the excitation-inhibition balance that favors inhibition. Aniracetam did not affect the magnitude of either monosynaptic IPSCs (mono-IPSCs) recorded in the presence of excitatory amino acid receptor antagonists, or miniature IPSCs (mIPSCs) recorded in the presence of tetrodotoxin. However, the duration of both mono-IPSCs and mIPSCs was prolonged, suggesting that aniracetam also directly modulates GABAergic transmission. Cyclothiazide, a preferential modulator of AMPAR function, enhanced the magnitude and duration of polysynaptic IPSCs, similar to aniracetam, but did not affect mono-IPSCs. Concanavalin A, a kainate receptor modulator, had little effect on EPSCs or IPSCs, suggesting there was no contribution from kainate receptor activity. These findings indicate that AMPAR modulators strengthen inhibition in neocortical pyramidal cells, most likely by altering the kinetics of AMPARs on synaptically connected interneurons and possibly by modulating GABA(A) receptor responses

Role of glutamatergic receptors located in the nucleus raphe magnus on antinociceptive effect of morphine microinjected into the nucleus cuneiformis of rat.

PubMed

Haghparast, Abbas; Soltani-Hekmat, Ava; Khani, Abbas; Komaki, Alireza

2007-10-29

Neurons in the nucleus cuneiformis (CnF), located just ventrolateral to the periaqueductal gray, project to medullary nucleus raphe magnus (NRM), which is a key medullary relay for descending pain modulation and is critically involved in opioid-induced analgesia. Previous studies have shown that antinociceptive response of CnF-microinjected morphine can be modulated by the specific subtypes of glutamatergic receptors within the CnF. In this study, we evaluated the role of NMDA and kainate/AMPA receptors that are widely distributed within the NRM on morphine-induced antinociception elicited from the CnF. Hundred and five male Wistar rats weighing 250-300 g were used. Morphine (10, 20 and 40 microg) and NMDA receptor antagonist, MK-801 (10 microg) or kainate/AMPA receptor antagonist, DNQX (0.5 microg) in 0.5 microl saline were stereotaxically microinjected into the CnF and NRM, respectively. The latency of tail-flick response was measured at set intervals (2, 7, 12, 17, 22, 27 min after microinjection) by using an automated tail-flick analgesiometer. The results showed that morphine microinjection into the CnF dose-dependently causes increase in tail-flick latency (TFL). MK-801 microinjected into the NRM, just 1 min before morphine injection into the CnF, significantly attenuated antinociceptive effects of morphine. On the other hand, DNQX microinjected into the NRM, significantly increased TFL after local application of morphine into the CnF. We suggest that morphine related antinociceptive effect elicited from the CnF is mediated, in part, by NMDA receptor at the level of the NRM whereas kainite/AMPA receptor has a net inhibitory influence at the same pathway.

Expression of specific ionotropic glutamate and GABA-A receptor subunits is decreased in central amygdala of alcoholics.

PubMed

Jin, Zhe; Bhandage, Amol K; Bazov, Igor; Kononenko, Olga; Bakalkin, Georgy; Korpi, Esa R; Birnir, Bryndis

2014-01-01

The central amygdala (CeA) has a role for mediating fear and anxiety responses. It is also involved in emotional imbalance caused by alcohol abuse and dependence and in regulating relapse to alcohol abuse. Growing evidences suggest that excitatory glutamatergic and inhibitory γ-aminobutyric acid-ergic (GABAergic) transmissions in the CeA are affected by chronic alcohol exposure. Human post-mortem CeA samples from male alcoholics (n = 9) and matched controls (n = 9) were assayed for the expression level of ionotropic glutamate and GABA-A receptors subunit mRNAs using quantitative real-time reverse transcription-PCR (RT-qPCR). Our data revealed that out of the 16 ionotropic glutamate receptor subunits, mRNAs encoding two AMPA [2-amino-3-(3-hydroxy-5-methyl-isoxazol-4-yl)propanoic acid] receptor subunits GluA1 and GluA4; one kainate receptor subunit GluK2; one NMDA (N-methyl-D-aspartate) receptor subunit GluN2D and one delta receptor subunit GluD2 were significantly decreased in the CeA of alcoholics. In contrast, of the 19 GABA-A receptor subunits, only the mRNA encoding the α2 subunit was significantly down-regulated in the CeA of the alcoholics as compared with control subjects. Our findings imply that the down-regulation of specific ionotropic glutamate and GABA-A receptor subunits in the CeA of alcoholics may represent one of the molecular substrates underlying the new balance between excitatory and inhibitory neurotransmission in alcohol dependence.

Expression of specific ionotropic glutamate and GABA-A receptor subunits is decreased in central amygdala of alcoholics

PubMed Central

Jin, Zhe; Bhandage, Amol K.; Bazov, Igor; Kononenko, Olga; Bakalkin, Georgy; Korpi, Esa R.; Birnir, Bryndis

2014-01-01

The central amygdala (CeA) has a role for mediating fear and anxiety responses. It is also involved in emotional imbalance caused by alcohol abuse and dependence and in regulating relapse to alcohol abuse. Growing evidences suggest that excitatory glutamatergic and inhibitory γ-aminobutyric acid-ergic (GABAergic) transmissions in the CeA are affected by chronic alcohol exposure. Human post-mortem CeA samples from male alcoholics (n = 9) and matched controls (n = 9) were assayed for the expression level of ionotropic glutamate and GABA-A receptors subunit mRNAs using quantitative real-time reverse transcription-PCR (RT-qPCR). Our data revealed that out of the 16 ionotropic glutamate receptor subunits, mRNAs encoding two AMPA [2-amino-3-(3-hydroxy-5-methyl-isoxazol-4-yl)propanoic acid] receptor subunits GluA1 and GluA4; one kainate receptor subunit GluK2; one NMDA (N-methyl-D-aspartate) receptor subunit GluN2D and one delta receptor subunit GluD2 were significantly decreased in the CeA of alcoholics. In contrast, of the 19 GABA-A receptor subunits, only the mRNA encoding the α2 subunit was significantly down-regulated in the CeA of the alcoholics as compared with control subjects. Our findings imply that the down-regulation of specific ionotropic glutamate and GABA-A receptor subunits in the CeA of alcoholics may represent one of the molecular substrates underlying the new balance between excitatory and inhibitory neurotransmission in alcohol dependence. PMID:25278838

Glutamate mediates platelet activation through the AMPA receptor

PubMed Central

Morrell, Craig N.; Sun, Henry; Ikeda, Masahiro; Beique, Jean-Claude; Swaim, Anne Marie; Mason, Emily; Martin, Tanika V.; Thompson, Laura E.; Gozen, Oguz; Ampagoomian, David; Sprengel, Rolf; Rothstein, Jeffrey; Faraday, Nauder; Huganir, Richard; Lowenstein, Charles J.

2008-01-01

Glutamate is an excitatory neurotransmitter that binds to the kainate receptor, the N-methyl-D-aspartate (NMDA) receptor, and the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor (AMPAR). Each receptor was first characterized and cloned in the central nervous system (CNS). Glutamate is also present in the periphery, and glutamate receptors have been identified in nonneuronal tissues, including bone, heart, kidney, pancreas, and platelets. Platelets play a central role in normal thrombosis and hemostasis, as well as contributing greatly to diseases such as stroke and myocardial infarction. Despite the presence of glutamate in platelet granules, the role of glutamate during hemostasis is unknown. We now show that activated platelets release glutamate, that platelets express AMPAR subunits, and that glutamate increases agonist-induced platelet activation. Furthermore, we demonstrate that glutamate binding to the AMPAR increases intracellular sodium concentration and depolarizes platelets, which are important steps in platelet activation. In contrast, platelets treated with the AMPAR antagonist CNQX or platelets derived from GluR1 knockout mice are resistant to AMPA effects. Importantly, mice lacking GluR1 have a prolonged time to thrombosis in vivo. Our data identify glutamate as a regulator of platelet activation, and suggest that the AMPA receptor is a novel antithrombotic target. PMID:18283118

Mechanism of Positive Allosteric Modulators Acting on AMPA Receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jin,R.; Clark, S.; Weeks, A.

2005-01-01

Ligand-gated ion channels involved in the modulation of synaptic strength are the AMPA, kainate, and NMDA glutamate receptors. Small molecules that potentiate AMPA receptor currents relieve cognitive deficits caused by neurodegenerative diseases such as Alzheimer's disease and show promise in the treatment of depression. Previously, there has been limited understanding of the molecular mechanism of action for AMPA receptor potentiators. Here we present cocrystal structures of the glutamate receptor GluR2 S1S2 ligand-binding domain in complex with aniracetam [1-(4-methoxybenzoyl)-2-pyrrolidinone] or CX614 (pyrrolidino-1, 3-oxazino benzo-1, 4-dioxan-10-one), two AMPA receptor potentiators that preferentially slow AMPA receptor deactivation. Both potentiators bind within the dimermore » interface of the nondesensitized receptor at a common site located on the twofold axis of molecular symmetry. Importantly, the potentiator binding site is adjacent to the 'hinge' in the ligand-binding core 'clamshell' that undergoes conformational rearrangement after glutamate binding. Using rapid solution exchange, patch-clamp electrophysiology experiments, we show that point mutations of residues that interact with potentiators in the cocrystal disrupt potentiator function. We suggest that the potentiators slow deactivation by stabilizing the clamshell in its closed-cleft, glutamate-bound conformation.« less

Dynamical differences of hemoglobin and the ionotropic glutamate receptor in different states revealed by a new dynamics alignment method.

PubMed

Tobi, Dror

2017-08-01

A new algorithm for comparison of protein dynamics is presented. Compared protein structures are superposed and their modes of motions are calculated using the anisotropic network model. The obtained modes are aligned using the dynamic programming algorithm of Needleman and Wunsch, commonly used for sequence alignment. Dynamical comparison of hemoglobin in the T and R2 states reveals that the dynamics of the allosteric effector 2,3-bisphosphoglycerate binding site is different in the two states. These differences can contribute to the selectivity of the effector to the T state. Similar comparison of the ionotropic glutamate receptor in the kainate+(R,R)-2b and ZK bound states reveals that the kainate+(R,R)-2b bound states slow modes describe upward motions of ligand binding domain and the transmembrane domain regions. Such motions may lead to the opening of the receptor. The upper lobes of the LBDs of the ZK bound state have a smaller interface with the amino terminal domains above them and have a better ability to move together. The present study exemplifies the use of dynamics comparison as a tool to study protein function. Proteins 2017; 85:1507-1517. © 2014 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Neuroplasticity and Calcium Signaling in Stressed Rat Amygdala

DTIC Science & Technology

2005-02-01

kainate receptor and neuroplasticity in the amygdala. National Institute of aging, November, 2001. • He Li: GluR5 kainate receptor mediated synaptic...functions in the amygdala. National Institute of Mental Health, April, 2002. 50 " Maria F. M. Braga: Chronic Stress Causes Impairment of aI-Adrenoceptor...resistance All animal experiments were performed in accordance with of 1.5-5.0 Mf when filled with a solution containing (in our institutional guidelines

Dominant negative mutant of ionotropic glutamate receptor subunit GluR3: implications for the role of a cysteine residue for its channel activity and pharmacological properties.

PubMed Central

Watase, K; Sekiguchi, M; Matsui, T A; Tagawa, Y; Wada, K

1997-01-01

We reported that a 33-amino-acid deletion (from tyrosine-715 to glycine-747) in a putative extracellular loop of GluR3 produced a mutant that exhibited dominant negative effects upon the functional expression of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors [Sekiguchi et al. (1994) J. Biol. Chem. 269, 14559-14565]. In this study, we searched for a key residue in the dominant negative effects to explore the mechanism and examined the role of the residue in the function of the AMPA receptor. We prepared 20 GluR3 mutants with amino acid substitutions within the 33-amino-acid-region, and dominant negative effects were tested electrophysiologically in Xenopus oocytes co-expressing the mutant and normal subunits. Among the mutants, only a GluR3 mutant in which an original cysteine (Cys)-722 was replaced by alanine exhibited a dominant negative effect comparable with that of the original mutant in which the entire 33-amino-acid segment is deleted. The co-expression of the Cys-722 mutant did not inhibit the translation of normal subunits in oocytes. The Cys-722 mutant formed a functional homomeric receptor with significantly higher affinity for glutamate or kainate than a homomeric GluR3 receptor. The Cys-722 mutation greatly enhanced the sensitivity of GluR3 for aniracetam, which alters kinetic properties of AMPA receptors. The kainate-induced currents in oocytes expressing the Cys-722 mutant alone showed strong inward rectification. These results suggest that the Cys-722 in GluR3 is important for dominant negative effects and plays a crucial role in the determination of pharmacological properties in AMPA receptor function. PMID:9065754

Allosteric potentiation of quisqualate receptors by a nootropic drug aniracetam.

PubMed Central

Ito, I; Tanabe, S; Kohda, A; Sugiyama, H

1990-01-01

1. Allosteric potentiation of the ionotropic quisqualate (iQA) receptor by a nootropic drug aniracetam (1-p-anisoyl-2-pyrrolidinone) was investigated using Xenopus oocytes injected with rat brain mRNA and rat hippocampal slices. 2. Aniracetam potentiates the iQA responses induced in Xenopus oocytes by rat brain mRNA in a reversible manner. This effect was observed above the concentrations of 0.1 mM. Kainate. N-methyl-D-aspartate and gamma-aminobutyric acid responses induced in the same oocytes were not affected. 3. The specific potentiation of iQA responses was accompanied by an increase in the conductance change of iQA and alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) responses, but the affinity of receptors for agonist and the ion-selectivity of the channels (reversal potentials) were not changed. 4. Aniracetam reversibly potentiated the iQA responses recorded intracellularly from the pyramidal cells in the CA1 region of rat hippocampal slices. The excitatory postsynaptic potentials (EPSPs) in Schaffer collateral-commissural-CA1 synapses were also potentiated by aniracetam. 5. Population EPSPs recorded in the mossy fibre-CA3 synapses as well as Schaffer-commissural synapses were also potentiated by aniracetam. The amplitudes of the potentiation were not changed by the formation of long-term potentiation. PMID:1975272

Therapeutic potential of metabotropic glutamate receptor modulators.

PubMed

Hovelsø, N; Sotty, F; Montezinho, L P; Pinheiro, P S; Herrik, K F; Mørk, A

2012-03-01

Glutamate is the main excitatory neurotransmitter in the central nervous system (CNS) and is a major player in complex brain functions. Glutamatergic transmission is primarily mediated by ionotropic glutamate receptors, which include NMDA, AMPA and kainate receptors. However, glutamate exerts modulatory actions through a family of metabotropic G-protein-coupled glutamate receptors (mGluRs). Dysfunctions of glutamatergic neurotransmission have been implicated in the etiology of several diseases. Therefore, pharmacological modulation of ionotropic glutamate receptors has been widely investigated as a potential therapeutic strategy for the treatment of several disorders associated with glutamatergic dysfunction. However, blockade of ionotropic glutamate receptors might be accompanied by severe side effects due to their vital role in many important physiological functions. A different strategy aimed at pharmacologically interfering with mGluR function has recently gained interest. Many subtype selective agonists and antagonists have been identified and widely used in preclinical studies as an attempt to elucidate the role of specific mGluRs subtypes in glutamatergic transmission. These studies have allowed linkage between specific subtypes and various physiological functions and more importantly to pathological states. This article reviews the currently available knowledge regarding the therapeutic potential of targeting mGluRs in the treatment of several CNS disorders, including schizophrenia, addiction, major depressive disorder and anxiety, Fragile X Syndrome, Parkinson's disease, Alzheimer's disease and pain.

Therapeutic Potential of Metabotropic Glutamate Receptor Modulators

PubMed Central

Hovelsø, N; Sotty, F; Montezinho, L.P; Pinheiro, P.S; Herrik, K.F; Mørk, A

2012-01-01

Glutamate is the main excitatory neurotransmitter in the central nervous system (CNS) and is a major player in complex brain functions. Glutamatergic transmission is primarily mediated by ionotropic glutamate receptors, which include NMDA, AMPA and kainate receptors. However, glutamate exerts modulatory actions through a family of metabotropic G-protein-coupled glutamate receptors (mGluRs). Dysfunctions of glutamatergic neurotransmission have been implicated in the etiology of several diseases. Therefore, pharmacological modulation of ionotropic glutamate receptors has been widely investigated as a potential therapeutic strategy for the treatment of several disorders associated with glutamatergic dysfunction. However, blockade of ionotropic glutamate receptors might be accompanied by severe side effects due to their vital role in many important physiological functions. A different strategy aimed at pharmacologically interfering with mGluR function has recently gained interest. Many subtype selective agonists and antagonists have been identified and widely used in preclinical studies as an attempt to elucidate the role of specific mGluRs subtypes in glutamatergic transmission. These studies have allowed linkage between specific subtypes and various physiological functions and more importantly to pathological states. This article reviews the currently available knowledge regarding the therapeutic potential of targeting mGluRs in the treatment of several CNS disorders, including schizophrenia, addiction, major depressive disorder and anxiety, Fragile X Syndrome, Parkinson’s disease, Alzheimer’s disease and pain. PMID:22942876

1H-cyclopentapyrimidine-2,4(1H,3H)-dione-related ionotropic glutamate receptors ligands. structure-activity relationships and identification of potent and Selective iGluR5 modulators.

PubMed

Butini, Stefania; Pickering, Darryl S; Morelli, Elena; Coccone, Salvatore Sanna; Trotta, Francesco; De Angelis, Meri; Guarino, Egeria; Fiorini, Isabella; Campiani, Giuseppe; Novellino, Ettore; Schousboe, Arne; Christensen, Jeppe K; Gemma, Sandra

2008-10-23

(S)-CPW399 ((S)-1) is a potent and excitotoxic AMPA receptor partial agonist. Modifying the cyclopentane ring of (S)-1, we developed two of the most potent and selective functional antagonists (5 and 7) for kainate receptor (KA-R) subunit iGluR5. Derivatives 5 and 7, with their unique pharmacological profile, may lead to a better understanding of the different roles and modes of action of iGluR1-5 subunits, paving the way for the synthesis of new potent, subunit selective iGluR5 modulators.

Antinociceptive effects of MSVIII-19, a functional antagonist of the GluK1 kainate receptor

PubMed Central

Qiu, Chang-Shen; Wyhe, Leanne Lash-Van; Sasaki, Makoto; Sakai, Ryuichi; Swanson, Geoffrey T.; Gereau, Robert W.

2011-01-01

The ionotropic glutamate receptor subunit, GluK1 (GluR5), is expressed in many regions of nervous system related to sensory transmission. Recently, a selective ligand for the GluK1 receptor, MSVIII-19 (8,9-dideoxy-neodysiherbaine), was synthesized as a derivative of dysiherbaine, a toxin isolated from the marine sponge Lendenfeldia chodrodes. MSVIII-19 potently desensitizes GluK1 receptors without channel activation, rendering it useful as a functional antagonist. Given the high selectivity for GluK1 and the proposed role for this glutamate receptor in nociception, we sought to test the analgesic potential of MSVIII-19 in a series of models of inflammatory, neuropathic, and visceral pain in mice. MSVIII-19 delivered intrathecally (i.t.) dose-dependently reduced formalin-induced spontaneous behaviors and reduced thermal hypersensitivity 3 hours after formalin injection and 24 hours after complete freund’s adjuvant-induced inflammation, but had no effect on mechanical sensitivity in the same models. I.T. MSVIII-19 significantly reduced both thermal hyperalgesia and mechanical hypersensitivity in the chronic constriction injury model of neuropathic pain, but had no effect in the acetic acid model of visceral pain. Peripheral administration of MSVIII-19 had no analgesic efficacy in any of these models. Finally, i.t. MSVIII-19 did not alter responses in tail flick tests or performance on the accelerating RotaRod. These data suggest that spinal administration of MSVIII-19 reverses hypersensitivity in several models of pain in mice, supporting the clinical potential of GluK1 antagonists for the management of pain. PMID:21324591

Different Classes of Glutamate Receptors Mediate Distinct Behaviors in a Single Brainstem Nucleus

NASA Astrophysics Data System (ADS)

Dye, John; Heiligenberg, Walter; Keller, Clifford H.; Kawasaki, Masashi

1989-11-01

We have taken advantage of the increasing understanding of glutamate neuropharmacology to probe mechanisms of well-defined vertebrate behaviors. Here we report a set of experiments that suggests distinct roles for two major classes of glutamate receptors in a discrete premotor nucleus of the brainstem. The medullary pacemaker nucleus of weakly electric fish is an endogenous oscillator that controls the electric organ discharge (EOD). Its regular frequency of firing is modulated during several distinct behaviors. The pacemaker nucleus continues firing regularly when isolated in vitro, and modulatory behaviors can be reproduced by stimulating the descending input pathway. Glutamate agonists applied to the pacemaker in vitro produced increases in frequency, while glutamate antagonists selectively blocked stimulus-induced modulations. Experiments with glutamate antagonists in the intact animal resulted in specific effects on two well-characterized behaviors. Our data indicate that these behaviors are separately mediated in the pacemaker by receptors displaying characteristics of the kainate/quisqualate and N-methyl-D-aspartate subtypes of glutamate receptor, respectively.

Changes in calcium and iron levels in the brains of rats during kainate induced epilepsy

NASA Astrophysics Data System (ADS)

Ren, Min-Qin; Ong, Wei-Yi; Makjanic, Jagoda; Watt, Frank

1999-10-01

Epilepsy is a recurrent disorder of cerebral function characterised by sudden brief attacks of altered consciousness, motor activity or sensory phenomena, and affects approximately 1% of the population. Kainic acid injection induces neuronal degeneration in rats, is associated with glial hypertrophy and proliferation in the CA3-CA4 fields of hippocampal complex, and is a model for temporal lobe epilepsy. In this study we have applied Nuclear Microscopy to the investigation of the elemental changes within the hippocampus and the cortex areas of the rat brain following kainate injection. Analyses of unstained freeze dried tissue sections taken at 1 day and 1, 2, 3 and 4 weeks following injection were carried out using the Nuclear Microscopy facility at the Research Centre for Nuclear Microscopy, National University of Singapore. Quantitative analysis and elemental mapping indicates that there are significant changes in the calcium levels and distributions in the hippocampus as early as 1 day following injection. Preliminary results indicate a rapid increase in cellular calcium. High levels of calcium can activate calcium dependent proteins and phospholipases. Activation of phospholipase A 2 can be harmful to surrounding neurons through free radical damage. In addition to observed increases in calcium, there was evidence of increases in iron levels. This is consistent with measurements in other degenerative brain disorders, and may signal a late surge in free radical production.

Kinetic Contributions to Gating by Interactions Unique to N-methyl-d-aspartate (NMDA) Receptors*

PubMed Central

Borschel, William F.; Cummings, Kirstie A.; Tindell, LeeAnn K.; Popescu, Gabriela K.

2015-01-01

Among glutamate-gated channels, NMDA receptors produce currents that subside with unusually slow kinetics, and this feature is essential to the physiology of central excitatory synapses. Relative to the homologous AMPA and kainate receptors, NMDA receptors have additional intersubunit contacts in the ligand binding domain that occur at both conserved and non-conserved sites. We examined GluN1/GluN2A single-channel currents with kinetic analyses and modeling to probe these class-specific intersubunit interactions for their role in glutamate binding and receptor gating. We found that substitutions that eliminate such interactions at non-conserved sites reduced stationary gating, accelerated deactivation, and imparted sensitivity to aniracetam, an AMPA receptor-selective positive modulator. Abolishing unique contacts at conserved sites also reduced stationary gating and accelerated deactivation. These results show that contacts specific to NMDA receptors, which brace the heterodimer interface within the ligand binding domain, stabilize actively gating receptor conformations and result in longer bursts and slower deactivations. They support the view that the strength of the heterodimer interface modulates gating in both NMDA and non-NMDA receptors and that unique interactions at this interface are responsible in part for basic differences between the kinetics of NMDA and non-NMDA currents at glutamatergic synapses. PMID:26370091

The corticotropin-releasing factor receptor-1 pathway mediates the negative affective states of opiate withdrawal.

PubMed

Contarino, Angelo; Papaleo, Francesco

2005-12-20

The negative affective symptoms of opiate withdrawal powerfully motivate drug-seeking behavior and may trigger relapse to heroin abuse. To date, no medications exist that effectively relieve the negative affective symptoms of opiate withdrawal. The corticotropin-releasing factor (CRF) system has been hypothesized to mediate the motivational effects of drug dependence. The CRF signal is transmitted by two distinct receptors named CRF receptor-1 (CRF1) and CRF2. Here we report that genetic disruption of CRF1 receptor pathways in mice eliminates the negative affective states of opiate withdrawal. In particular, neither CRF1 receptor heterozygous (CRF1+/-) nor homozygous (CRF1-/-) null mutant mice avoided environmental cues repeatedly paired with the early phase of opiate withdrawal. These results were not due to altered associative learning processes because CRF1+/- and CRF1-/- mice displayed reliable, conditioned place aversions to environmental cues paired with the kappa-opioid receptor agonist U-50,488H. We also examined the impact of CRF1 receptor-deficiency upon opiate withdrawal-induced dynorphin activity in the nucleus accumbens, a brain molecular mechanism thought to underlie the negative affective states of drug withdrawal. Consistent with the behavioral indices, we found that, during the early phase of opiate withdrawal, neither CRF1+/- nor CRF1-/- showed increased dynorphin mRNA levels in the nucleus accumbens. This study reveals a cardinal role for CRF/CRF1 receptor pathways in the negative affective states of opiate withdrawal and suggests therapeutic strategies for the treatment of opiate addiction.

Periaqueductal gray glutamatergic, cannabinoid and vanilloid receptor interplay in defensive behavior and aversive memory formation.

PubMed

Back, Franklin P; Carobrez, Antonio P

2018-06-01

Stimulation of the midbrain periaqueductal gray matter (PAG) in humans elicits sensations of fear and impending terror, and mediates predator defensive responses in rodents. In rats, pharmacological stimulation of the dorsolateral portion of the PAG (dlPAG) with N-Methyl-d-Aspartate (NMDA) induces aversive conditioning that acts as an unconditioned stimulus (US). In the present work, we investigated the interplay between the vanilloid TRPV1 and cannabinoid CB1 receptors in the NMDA-dlPAG defensive response and in subsequent aversive learning. Rats were subjected to dlPAG NMDA infusion in an olfactory conditioned stimulus (CS) task allowing the evaluation of immediate and long-term defensive behavioral responses during CS presentation. The results indicated that an intermediate dose of NMDA (50 pmol) induced both immediate and long-term effects. A sub-effective dose of NMDA (25 pmol) was potentiated by the TRPV1 receptor agonist capsaicin (CAP, 1 nmol) and the CB1 receptor antagonist, AM251 (200 pmol). CAP (10 nmol) or the combination of CAP (1 nmol) and AM251 (200 pmol) induced long-term effects without increasing immediate defensive responses. The glutamate release inhibitor riluzole (2 or 4 nmol) and the AMPA/kainate receptor antagonist DNQX (2 or 4 nmol) potentiated the immediate effects but blocked the long-term effects. The results showed that immediate defensive responses rely on NMDA receptors, and aversive learning on the fine-tuning of TRPV1, CB1, metabotropic glutamate and AMPA receptors located in pre- and postsynaptic membranes. In conclusion, the activity of the dlPAG determines core affective aspects of aversive memory formation controlled by local TRPV1/CB1 balance. Copyright © 2018 Elsevier Ltd. All rights reserved.

Role of AMPA glutamate receptors in the conditioned rewarding effects of MDMA in mice.

PubMed

García-Pardo, M P; Miñarro, J; Aguilar, M A

2018-07-16

Currently, there is not an effective treatment for 3,4-methylenedioxymethamphetamine (MDMA) dependence but pharmacotherapies targeting glutamate neurotransmission are a promising strategy. Previously, we showed that blockade of glutamate NMDA and AMPA receptors impairs the conditioned rewarding effects of MDMA and cocaine, respectively. In this study we evaluated the role of AMPA receptors in the rewarding effects of MDMA in mice using the conditioned place preference (CPP) paradigm. Mice were conditioned with MDMA (1.25 mg/kg) 60 min after the treatment with saline or different doses (0.25, 1 and 5 mg/kg) of the AMPA/kainate receptor antagonist, 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX). Mice conditioned with MDMA acquired CPP while those treated with any dose of CNQX + MDMA did not. These results supported the involvement of the glutamatergic system in the rewarding properties of MDMA, and suggest that AMPA receptor blockade could be a new therapeutic option for the treatment of those individuals that develop MDMA dependence. Copyright © 2018 Elsevier B.V. All rights reserved.

Neurosteroid modulation of neuronal excitability and synaptic transmission in the rat medial vestibular nuclei.

PubMed

Grassi, Silvarosa; Frondaroli, Adele; Dieni, Cristina; Dutia, Mayank B; Pettorossi, Vito E

2007-07-01

In rat brainstem slices, we investigated the influence of the neurosteroids tetrahydrodeoxycorticosterone (THDOC) and allopregnanolone (ALLO) on the synaptically driven and spontaneous activity of vestibular neurons, by analysing their effects on the amplitude of the field potentials evoked in the medial vestibular nuclei (MVN) by vestibular afferent stimulation and on the spontaneous firing rate of MVN neurons. Furthermore, the interaction with gamma-aminobutyric acid (GABA) and glutamate receptors was analysed by using specific antagonists for GABA(A) (bicuculline), alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA)/ kainate [2,3-dioxo-6-nitro-1,2,3,4-tetrahydrobenzo(f)quinoxaline-7-sulphonamide disodium salt (NBQX)], N-methyl-D-aspartate (NMDA) [D-(-)-2-amino-5-phosphonopentanoic acid (AP-5)] and group I metabotropic glutamate receptors (mGlu-I) [(R,S)-1-aminoindan-1,5-dicarboxylic acid (AIDA)] receptors. THDOC and ALLO evoked two opposite long-lasting effects, consisting of either a potentiation or a reduction of field potential and firing rate, which showed early and late components, occurring in conjunction or separately after neurosteroid application. The depressions depended on GABA(A) receptors, as they were abolished by bicuculline, while early potentiation involved glutamate AMPA/kainate receptors, as NBQX markedly reduced the incidence of early firing rate enhancement and, in the case of ALLO, even provoked depression. This suggests that THDOC and ALLO enhance the GABA(A) inhibitory influence on the MVN neurons and facilitate the AMPA/kainate facilitatory one. Conversely, a late potentiation effect, which was still induced after glutamate and GABA(A) receptor blockade, might involve a different mechanism. We conclude that the modulation of neuronal activity in the MVN by THDOC and ALLO, through their actions on GABA(A) and AMPA/kainate receptors, may have a physiological role in regulating the vestibular system function under normal

Straight-chain alcohols exhibit a cutoff in potency for the inhibition of recombinant glutamate receptor subunits

PubMed Central

Akinshola, B Emmanuel

2001-01-01

The effects of n-alcohols (methanol to 1-decanol) on kainate-activated AMPA receptor subunit GluR1 and GluR3 ion currents were studied in Xenopus oocytes using the two-electrode voltage-clamp recording technique. For short-chain alcohols from methanol to 1-hexanol, potency for inhibition of GluR1 and GluR3 receptor-mediated current increased in proportion to the chain length or hydrophobicity of the alcohol. The IC50 values of these alcohols for GluR1 were: methanol, 702 mM; ethanol, 170 mM; 1-propanol, 69 mM; 1-butanol, 20 mM; 1-pentanol, 17 mM; and 1-hexanol, 10 mM. For GluR3, IC50 values were: methanol, 712 mM; ethanol, 238 mM; 1-propanol, 50 mM; 1-butanol, 32 mM; 1-pentanol, 13 mM; and 1-hexanol, 7 mM. For long-chain alcohols, 1-heptanol was less potent than 1-hexanol (estimated IC50: 19 mM for GluR1 and 18 mM for GluR3), 1-octanol had little effect only on GluR3, and 1-nonanol and 1-decanol did not significantly inhibit both GluR1 and GluR3 responses. The observations indicate that straight-chain n-alcohols exhibit a cutoff in their potency for inhibition of the function of non-NMDA glutamate receptor subunits, GluR1 and GluR3. The cutoff in potency of n-alcohols for inhibition of non-NMDA glutamate receptor function is consistent with the interpretation that alcohols affect the function of these receptor-channels by interacting with an alcohol binding site of specific dimensions on the receptor protein. PMID:11429388

Mutual enhancement of central neurotoxicity induced by ketamine followed by methamphetamine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ke, J.-J.; Chen, H.-I.; Jen, C.J.

2008-03-01

We hereby report that repeated administration of ketamine (350 mg/kg in total) and methamphetamine (30 mg/kg in total) causes specific glutamatergic and dopaminergic neuron deficits, respectively, in adult mouse brain. Acute ketamine did not affect basal body temperature or the later methamphetamine-induced hyperthermia. However, pretreatment with repeated doses of ketamine aggravated methamphetamine-induced dopaminergic terminal loss as evidenced by a drastic decrease in the levels of dopamine, 3,4-dihydroxyphenylacetic acid, and dopamine transporter density as well as poor gait balance performance. In contrast, methamphetamine-induced serotonergic depletion was not altered by ketamine pretreatment. Likewise, the subsequent treatment with methamphetamine exacerbated the ketamine-induced glutamatergicmore » damage as indicated by reduced levels of the vesicular glutamate transporter in hippocampus and striatum and poor memory performance in the Morris water maze. Finally, since activation of the D1 and AMPA/kainate receptors has been known to be involved in the release of glutamate and dopamine, we examined the effects of co-administration of SCH23390, a D1 antagonist, and CNQX, an AMPA/kainate antagonist. Intraventricular CNQX infusion abolished ketamine's potentiation of methamphetamine-induced dopamine neurotoxicity, while systemic SCH23390 mitigated methamphetamine's potentiation of ketamine-induced glutamatergic toxicity. We conclude that repeated doses of ketamine potentiate methamphetamine-induced dopamine neurotoxicity via AMPA/kainate activation and that conjunctive use of methamphetamine aggravates ketamine-induced glutamatergic neurotoxicity possibly via D1 receptor activation.« less

Contribution of different classes of glutamate receptors in the corticostriatal polysynaptic responses from striatal direct and indirect projection neurons

PubMed Central

2013-01-01

Background Previous work showed differences in the polysynaptic activation of GABAergic synapses during corticostriatal suprathreshold responses in direct and indirect striatal projection neurons (dSPNs and iSPNs). Here, we now show differences and similarities in the polysynaptic activation of cortical glutamatergic synapses on the same responses. Corticostriatal contacts have been extensively studied. However, several questions remain unanswered, e.g.: what are the differences and similarities in the responses to glutamate in dSPNs and iSPNs? Does glutamatergic synaptic activation exhibits a distribution of latencies over time in vitro? That would be a strong suggestion of polysynaptic cortical convergence. What is the role of kainate receptors in corticostriatal transmission? Current-clamp recordings were used to answer these questions. One hypothesis was: if prolonged synaptic activation distributed along time was present, then it would be mainly generated from the cortex, and not from the striatum. Results By isolating responses from AMPA-receptors out of the complex suprathreshold response of SPNs, it is shown that a single cortical stimulus induces early and late synaptic activation lasting hundreds of milliseconds. Prolonged responses depended on cortical stimulation because they could not be elicited using intrastriatal stimulation, even if GABAergic transmission was blocked. Thus, the results are not explained by differences in evoked inhibition. Moreover, inhibitory participation was larger after cortical than after intrastriatal stimulation. A strong activation of interneurons was obtained from the cortex, demonstrating that polysynaptic activation includes the striatum. Prolonged kainate (KA) receptor responses were also elicited from the cortex. Responses of dSPNs and iSPNs did not depend on the cortical area stimulated. In contrast to AMPA-receptors, responses from NMDA- and KA-receptors do not exhibit early and late responses, but generate slow

Low-frequency stimulation in anterior nucleus of thalamus alleviates kainate-induced chronic epilepsy and modulates the hippocampal EEG rhythm.

PubMed

Wang, Yi; Liang, Jiao; Xu, Cenglin; Wang, Ying; Kuang, Yifang; Xu, Zhenghao; Guo, Yi; Wang, Shuang; Gao, Feng; Chen, Zhong

2016-02-01

High-frequency stimulation (HFS) of the anterior nucleus of thalamus (ANT) is a new and alternative option for the treatment of intractable epilepsy. However, the responder rate is relatively low. The present study was designed to determine the effect of low-frequency stimulation (LFS) in ANT on chronic spontaneous recurrent seizures and related pathological pattern in intra-hippocampal kainate mouse model. We found that LFS (1 Hz, 100 μs, 300 μA), but not HFS (100 Hz, 100 μs, 30 μA), in bilateral ANT significantly decreased the frequency of spontaneous recurrent seizures, either non-convulsive focal seizures or tonic-clonic generalized seizures. The anti-epileptic effect persisted for one week after LFS cessation, which manifested as a long-term inhibition of the frequency of seizures with short (20-60 s) and intermediate duration (60-120 s). Meanwhile, LFS decreased the frequency of high-frequency oscillations (HFOs) and interictal spikes, two indicators of seizure severity, whereas HFS increased the HFO frequency. Furthermore, LFS decreased the power of the delta band and increased the power of the gamma band of hippocampal background EEG. In addition, LFS, but not HFS, improved the performance of chronic epileptic mice in objection-location task, novel objection recognition and freezing test. These results provide the first evidence that LFS in ANT alleviates kainate-induced chronic epilepsy and cognitive impairment, which may be related to the modulation of the hippocampal EEG rhythm. This may be of great therapeutic significance for clinical treatment of epilepsy with deep brain stimulation. Copyright © 2015 Elsevier Inc. All rights reserved.

Modulation of taurine release by glutamate receptors and nitric oxide.

PubMed

Oja, S S; Saransaari, P

2000-11-01

Taurine is held to function as a modulator and osmoregulator in the central nervous system, being of particular importance in the immature brain. In view of the possible involvement of excitatory pathways in the regulation of taurine function in the brain, the interference of glutamate receptors with taurine release from different tissue preparations in vitro and from the brain in vivo is of special interest. The release of taurine from the brain is enhanced by glutamate receptor agonists. This enhancement is inhibited by the respective receptor antagonists both in vitro and in vivo. The ionotropic N-methyl-D-aspartate (NMDA) and 2-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) receptor agonists appear to be the most effective in enhancing taurine release, their effects being receptor-mediated. Kainate is less effective, particularly in adults. Of the glutamate receptors, the NMDA class seems to be the most susceptible to modulation by nitric oxide. Nitric oxide also modulates taurine release, enhancing the basal release in both immature and mature hippocampus, whereas the K(+)-stimulated release is generally inhibited. Metabotropic glutamate receptors also participate in the regulation of taurine release, group I metabotropic glutamate receptors potentiating the release in the developing hippocampus, while group III receptors may be involved in the adult. Under various cell-damaging conditions, including ischemia, hypoxia and hypoglycemia, taurine release is enhanced, together with an enhanced release of excitatory amino acids. The increase in extracellular taurine upon excessive stimulation of glutamate receptors and under cell-damaging conditions may serve as an important protective mechanism against excitotoxicity, being particularly effective in the immature brain.

Facilitation of granule cell epileptiform activity by mossy fiber-released zinc in the pilocarpine model of temporal lobe epilepsy.

PubMed

Timofeeva, Olga; Nadler, J Victor

2006-03-17

Recurrent mossy fiber synapses in the dentate gyrus of epileptic brain facilitate the synchronous firing of granule cells and may promote seizure propagation. Mossy fiber terminals contain and release zinc. Released zinc inhibits the activation of NMDA receptors and may therefore oppose the development of granule cell epileptiform activity. Hippocampal slices from rats that had experienced pilocarpine-induced status epilepticus and developed a recurrent mossy fiber pathway were used to investigate this possibility. Actions of released zinc were inferred from the effects of chelation with 1 mM calcium disodium EDTA (CaEDTA). When granule cell population bursts were evoked by mossy fiber stimulation in the presence of 6 mM K(+) and 30 microM bicuculline, CaEDTA slowed the rate at which evoked bursting developed, but did not change the magnitude of the bursts once they had developed fully. The effects of CaEDTA were then studied on the pharmacologically isolated NMDA receptor- and AMPA/kainate receptor-mediated components of the fully developed bursts. CaEDTA increased the magnitude of NMDA receptor-mediated bursts and reduced the magnitude of AMPA/kainate receptor-mediated bursts. CaEDTA did not affect the granule cell bursts evoked in slices from untreated rats by stimulating the perforant path in the presence of bicuculline and 6 mM K(+). These results suggest that zinc released from the recurrent mossy fibers serves mainly to facilitate the recruitment of dentate granule cells into population bursts.

Trigeminal Medullary Dorsal Horn Neurons Activated by Nasal Stimulation Coexpress AMPA, NMDA, and NK1 Receptors

PubMed Central

McCulloch, P. F.; DiNovo, K. M.; Westerhaus, D. J.; Vizinas, T. A.; Peevey, J. F.; Lach, M. A.; Czarnocki, P.

2013-01-01

Afferent information initiating the cardiorespiratory responses during nasal stimulation projects from the nasal passages to neurons within the trigeminal medullary dorsal horn (MDH) via the anterior ethmoidal nerve (AEN). Central AEN terminals are thought to release glutamate to activate the MDH neurons. This study was designed to determine which neurotransmitter receptors (AMPA, kainate, or NMDA glutamate receptor subtypes or the Substance P receptor NK1) are expressed by these activated MDH neurons. Fos was used as a neuronal marker of activated neurons, and immunohistochemistry combined with epifluorescent microscopy was used to determine which neurotransmitter receptor subunits were coexpressed by activated MDH neurons. Results indicate that, during nasal stimulation with ammonia vapors in urethane-anesthetized Sprague-Dawley rats, activated neurons within the superficial MDH coexpress the AMPA glutamate receptor subunits GluA1 (95.8%) and GluA2/3 (88.2%), the NMDA glutamate receptor subunits GluN1 (89.1%) and GluN2A (41.4%), and NK1 receptors (64.0%). It is therefore likely that during nasal stimulation the central terminals of the AEN release glutamate and substance P that then produces activation of these MDH neurons. The involvement of AMPA and NMDA receptors may mediate fast and slow neurotransmission, respectively, while NK1 receptor involvement may indicate activation of a nociceptive pathway. PMID:24967301

Expression of functional neurotransmitter receptors in Xenopus oocytes after injection of human brain membranes

NASA Astrophysics Data System (ADS)

Miledi, Ricardo; Eusebi, Fabrizio; Martínez-Torres, Ataúlfo; Palma, Eleonora; Trettel, Flavia

2002-10-01

The Xenopus oocyte is a very powerful tool for studies of the structure and function of membrane proteins, e.g., messenger RNA extracted from the brain and injected into oocytes leads to the synthesis and membrane incorporation of many types of functional receptors and ion channels, and membrane vesicles from Torpedo electroplaques injected into oocytes fuse with the oocyte membrane and cause the appearance of functional Torpedo acetylcholine receptors and Cl channels. This approach was developed further to transplant already assembled neurotransmitter receptors from human brain cells to the plasma membrane of Xenopus oocytes. Membranes isolated from the temporal neocortex of a patient, operated for intractable epilepsy, were injected into oocytes and, within a few hours, the oocyte membrane acquired functional neurotransmitter receptors to -aminobutyric acid, -amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid, kainate, and glycine. These receptors were also expressed in the plasma membrane of oocytes injected with mRNA extracted from the temporal neocortex of the same patient. All of this makes the Xenopus oocyte a more useful model than it already is for studies of the structure and function of many human membrane proteins and opens the way to novel pathophysiological investigations of some human brain disorders.

Diverse roles for ionotropic glutamate receptors on inhibitory interneurons in developing and adult brain.

PubMed

Akgül, Gülcan; McBain, Chris J

2016-10-01

Glutamate receptor-mediated recruitment of GABAergic inhibitory interneurons is a critical determinant of network processing. Early studies observed that many, but not all, interneuron glutamatergic synapses contain AMPA receptors that are GluA2-subunit lacking and Ca(2+) permeable, making them distinct from AMPA receptors at most principal cell synapses. Subsequent studies demonstrated considerable alignment of synaptic AMPA and NMDA receptor subunit composition within specific subtypes of interneurons, suggesting that both receptor expression profiles are developmentally and functionally linked. Indeed glutamate receptor expression profiles are largely predicted by the embryonic origins of cortical interneurons within the medial and caudal ganglionic eminences of the developing telencephalon. Distinct complements of AMPA and NMDA receptors within different interneuron subpopulations contribute to the differential recruitment of functionally divergent interneuron subtypes by common afferent inputs for appropriate feed-forward and feedback inhibitory drive and network entrainment. In contrast, the lesser-studied kainate receptors, which are often present at both pre- and postsynaptic sites, appear to follow an independent developmental expression profile. Loss of specific ionotropic glutamate receptor (iGluR) subunits during interneuron development has dramatic consequences for both cellular and network function, often precipitating circuit inhibition-excitation imbalances and in some cases lethality. Here we briefly review recent findings highlighting the roles of iGluRs in interneuron development. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

Changes in flip/flop splicing of astroglial AMPA receptors in human temporal lobe epilepsy.

PubMed

Seifert, Gerald; Schröder, Wolfgang; Hinterkeuser, Stefan; Schumacher, Thekla; Schramm, Johannes; Steinhäuser, Christian

2002-01-01

Recent data suggested a role for glial cells in epilepsy. This study sought to identify and functionally characterize AMPA receptors expressed by astrocytes in human hippocampal tissue resected from patients with intractable temporal lobe epilepsy. Patch-clamp and fast application methods were combined to investigate astrocytes in situ and after fresh isolation from the stratum radiatum of the hippocampal CA1 subfield. Relying on presurgical and histopathologic analysis, we divided human specimens into two groups, Ammon's horn sclerosis (AHS) and lesion-associated epilepsy. Fast application of glutamate and kainate evoked receptor currents in all cells studied. Reversal-potential analysis revealed an intermediate Ca2+ permeability of the receptor channels that did not vary between the two groups of patients. However, preapplication of the AMPA receptor-specific modulator, cyclothiazide, disclosed differences in flip-flop splicing. This treatment considerably enhanced the receptor conductance, with potentiation being significantly stronger in cells from AHS specimens compared with lesion-associated cells, suggesting upregulation of AMPA receptor flip splice variants in astrocytes of the sclerotic tissue. Compelling evidence has been accumulated showing direct and rapid signaling between neurons and glial cells. Our data suggest that in AHS patients, neuronally released glutamate will lead to an enhanced and prolonged depolarization of astrocytes, which might be involved in seizure generation and spread in this particular condition of human temporal lobe epilepsy.

Immunohistochemical localization of ionotropic glutamate receptors in the rat red nucleus

PubMed Central

Minbay, Zehra; Kocoglu, Sema Serter; Yurtseven, Duygu Gok; Eyigor, Ozhan

2017-01-01

In this study, we aimed to determine the presence as well as the diverse distribution of N-methyl-D-aspartate (NMDA) and non-NMDA glutamate receptor subunits in the rat red nucleus. Using adult Sprague-Dawley rats as the experimental animals, immunohistochemistry was performed on 30 µm thick coronal brain sections with antibodies against α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (GluA1-4), kainate (GluK1, GluK2/3, and GluK5), and NMDA (GluN1 and GluN2A) receptor subunits. The results showed that all ionotropic glutamate receptor subunits are expressed in the red nucleus. Specific staining was localized in the neuron bodies and processes. However, the pattern of immunoreactivity and the number of labeled neurons changed depending on the type of ionotropic glutamate receptor subunits and the localization of neurons in the red nucleus. The neurons localized in the magnocellular part of the red nucleus were particularly immunopositive for GluA2, GluA4, GluK2/3, GluK5, GluN1, and GluN2A receptor proteins. In the parvocellular part of the red nucleus, ionotropic glutamate receptor subunit immunoreactivity of variable intensity (lightly to moderately stained) was detected in the neurons. These results suggest that red nucleus neurons in rat heterogeneously express ionotropic glutamate receptor subunits to form functional receptor channels. In addition, the likelihood of the coexpression of different subunits in the same subgroup of neurons suggests the formation of receptor channels with diverse structure by way of different subunit combination, and the possibility of various neuronal functions through these channels in the red nucleus. PMID:28027456

Immunohistochemical localization of ionotropic glutamate receptors in the rat red nucleus.

PubMed

Minbay, Zehra; Serter Kocoglu, Sema; Gok Yurtseven, Duygu; Eyigor, Ozhan

2017-02-21

In this study, we aimed to determine the presence as well as the diverse distribution of N-methyl-D-aspartate (NMDA) and non-NMDA glutamate receptor subunits in the rat red nucleus. Using adult Sprague-Dawley rats as the experimental animals, immunohistochemistry was performed on 30 µm thick coronal brain sections with antibodies against α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (GluA1-4), kainate (GluK1, GluK2/3, and GluK5), and NMDA (GluN1 and GluN2A) receptor subunits. The results showed that all ionotropic glutamate receptor subunits are expressed in the red nucleus. Specific staining was localized in the neuron bodies and processes. However, the pattern of immunoreactivity and the number of labeled neurons changed depending on the type of ionotropic glutamate receptor subunits and the localization of neurons in the red nucleus. The neurons localized in the magnocellular part of the red nucleus were particularly immunopositive for GluA2, GluA4, GluK2/3, GluK5, GluN1, and GluN2A receptor proteins. In the parvocellular part of the red nucleus, ionotropic glutamate receptor subunit immunoreactivity of variable intensity (lightly to moderately stained) was detected in the neurons. These results suggest that red nucleus neurons in rat heterogeneously express ionotropic glutamate receptor subunits to form functional receptor channels. In addition, the likelihood of the coexpression of different subunits in the same subgroup of neurons suggests the formation of receptor channels with diverse structure by way of different subunit combination, and the possibility of various neuronal functions through these channels in the red nucleus.

Glutamate Increases In Vitro Survival and Proliferation and Attenuates Oxidative Stress-Induced Cell Death in Adult Spinal Cord-Derived Neural Stem/Progenitor Cells via Non-NMDA Ionotropic Glutamate Receptors.

PubMed

Hachem, Laureen D; Mothe, Andrea J; Tator, Charles H

2016-08-15

Traumatic spinal cord injury (SCI) leads to a cascade of secondary chemical insults, including oxidative stress and glutamate excitotoxicity, which damage host neurons and glia. Transplantation of exogenous neural stem/progenitor cells (NSPCs) has shown promise in enhancing regeneration after SCI, although survival of transplanted cells remains poor. Understanding the response of NSPCs to the chemical mediators of secondary injury is essential in finding therapies to enhance survival. We examined the in vitro effects of glutamate and glutamate receptor agonists on adult rat spinal cord-derived NSPCs. NSPCs isolated from the periventricular region of the adult rat spinal cord were exposed to various concentrations of glutamate for 96 h. We found that glutamate treatment (500 μM) for 96 h significantly increased live cell numbers, reduced cell death, and increased proliferation, but did not significantly alter cell phenotype. Concurrent glutamate treatment (500 μM) in the setting of H2O2 exposure (500 μM) for 10 h increased NSPC survival compared to H2O2 exposure alone. The effects of glutamate on NSPCs were blocked by the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA)/kainate receptor antagonist GYKI-52466, but not by the N-methyl-D-aspartic acid receptor antagonist MK-801 or DL-AP5, or the mGluR3 antagonist LY-341495. Furthermore, treatment of NSPCs with AMPA, kainic acid, or the kainate receptor-specific agonist (RS)-2-amino-3-(3-hydroxy-5-tert-butylisoxazol-4-yl)propanoic acid mimicked the responses seen with glutamate both alone and in the setting of oxidative stress. These findings offer important insights into potential mechanisms to enhance NSPC survival and implicate a potential role for glutamate in promoting NSPC survival and proliferation after traumatic SCI.

Synthesis and Structure Activity Relationship of Tetrahydroisoquinoline-based Potentiators of GluN2C and GluN2D Containing N-Methyl-D-Aspartate Receptors

PubMed Central

Santangelo Freel, Rose M.; Ogden, Kevin K.; Strong, Katie L.; Khatri, Alpa; Chepiga, Kathryn M.; Jensen, Henrik S.; Traynelis, Stephen F.; Liotta, Dennis C.

2015-01-01

We describe here the synthesis and evaluation of a series of tetrahydroisoquinolines that show subunit-selective potentiation of NMDA receptors containing the GluN2C or GluN2D subunits. Bischler-Napieralski conditions were employed in the key step for the conversion of acyclic amides to the corresponding tetrahydroisoquinoline containing analogs. Compounds were evaluated using both two electrode voltage clamp recordings from Xenopus laevis oocytes and imaging of mammalian BHK cells loaded with Ca2+-sensitive dyes. The most potent analogues had EC50 values of 300 nM and showed over 2-fold potentiation of the response to maximally effective concentrations of glutamate and glycine, but had no effect on responses from NMDA receptors containing the GluN2A or GluN2B subunits, AMPA, kainate, GABA, or glycine receptors or a variety of other potential targets. These compounds represent a potent class of small molecule subunit-selective potentiators of NMDA receptors. PMID:23627311

The role of ionotropic glutamate receptors in childhood neurodevelopmental disorders: autism spectrum disorders and fragile x syndrome.

PubMed

Uzunova, Genoveva; Hollander, Eric; Shepherd, Jason

2014-01-01

Autism spectrum disorder (ASD) and Fragile X syndrome (FXS) are relatively common childhood neurodevelopmental disorders with increasing incidence in recent years. They are currently accepted as disorders of the synapse with alterations in different forms of synaptic communication and neuronal network connectivity. The major excitatory neurotransmitter system in brain, the glutamatergic system, is implicated in learning and memory, synaptic plasticity, neuronal development. While much attention is attributed to the role of metabotropic glutamate receptors in ASD and FXS, studies indicate that the ionotropic glutamate receptors (iGluRs) and their regulatory proteins are also altered in several brain regions. Role of iGluRs in the neurobiology of ASD and FXS is supported by a weight of evidence that ranges from human genetics to in vitro cultured neurons. In this review we will discuss clinical, molecular, cellular and functional changes in NMDA, AMPA and kainate receptors and the synaptic proteins that regulate them in the context of ASD and FXS. We will also discuss the significance for the development of translational biomarkers and treatments for the core symptoms of ASD and FXS.

Activity-dependent modulation of the axonal conduction of action potentials along rat hippocampal mossy fibers.

PubMed

Chida, Kuniaki; Kaneko, Kenya; Fujii, Satoshi; Yamazaki, Yoshihiko

2015-01-01

The axonal conduction of action potentials in the nervous system is generally considered to be a stable signal for the relaying of information, and its dysfunction is involved in impairment of cognitive function. Recent evidence suggests that the conduction properties and excitability of axons are more variable than traditionally thought. To investigate possible changes in the conduction of action potentials along axons in the central nervous system, we recorded action potentials from granule cells that were evoked and conducted antidromically along unmyelinated mossy fibers in the rat hippocampus. To evaluate changes in axons by eliminating any involvement of changes in the somata, two latency values were obtained by stimulating at two different positions and the latency difference between the action potentials was measured. A conditioning electrical stimulus of 20 pulses at 1 Hz increased the latency difference and this effect, which lasted for approximately 30 s, was inhibited by the application of an α-amino-3-hydroxy-5-methylisoxazole-4-propionate (AMPA)/kainate receptor antagonist or a GluK1-containing kainate receptor antagonist, but not by an AMPA receptor-selective antagonist or an N-methyl-d-aspartate receptor antagonist. These results indicated that axonal conduction in mossy fibers is modulated in an activity-dependent manner through the activation of GluK1-containing kainate receptors. These dynamic changes in axonal conduction may contribute to the physiology and pathophysiology of the brain. © 2014 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

Potentiation of NMDA receptor-mediated transmission in striatal cholinergic interneurons

PubMed Central

Oswald, Manfred J.; Schulz, Jan M.; Kelsch, Wolfgang; Oorschot, Dorothy E.; Reynolds, John N. J.

2015-01-01

Pauses in the tonic firing of striatal cholinergic interneurons (CINs) emerge during reward-related learning in response to conditioning of a neutral cue. We have previously reported that augmenting the postsynaptic response to cortical afferents in CINs is coupled to the emergence of a cell-intrinsic afterhyperpolarization (AHP) underlying pauses in tonic activity. Here we investigated in a bihemispheric rat-brain slice preparation the mechanisms of synaptic plasticity of excitatory afferents to CINs and the association with changes in the AHP. We found that high frequency stimulation (HFS) of commissural corticostriatal afferents from the contralateral hemisphere induced a robust long-term depression (LTD) of postsynaptic potentials (PSP) in CINs. Depression of the PSP of smaller magnitude and duration was observed in response to HFS of the ipsilateral white matter or cerebral cortex. In Mg2+-free solution HFS induced NMDA receptor-dependent potentiation of the PSP, evident in both the maximal slope and amplitude of the PSP. The increase in maximal slope corroborates previous findings, and was blocked by antagonism of either D1-like dopamine receptors with SCH23390 or D2-like dopamine receptors with sulpiride during HFS in Mg2+-free solution. Potentiation of the slower PSP amplitude component was due to augmentation of the NMDA receptor-mediated potential as this was completely reversed on subsequent application of the NMDA receptor antagonist AP5. HFS similarly potentiated NMDA receptor currents isolated by blockade of AMPA/kainate receptors with CNQX. The plasticity-induced increase in the slow PSP component was directly associated with an increase in the subsequent AHP. Thus plasticity of cortical afferent synapses is ideally suited to influence the cue-induced firing dynamics of CINs, particularly through potentiation of NMDA receptor-mediated synaptic transmission. PMID:25914618

Potentiation of NMDA receptor-mediated transmission in striatal cholinergic interneurons.

PubMed

Oswald, Manfred J; Schulz, Jan M; Kelsch, Wolfgang; Oorschot, Dorothy E; Reynolds, John N J

2015-01-01

Pauses in the tonic firing of striatal cholinergic interneurons (CINs) emerge during reward-related learning in response to conditioning of a neutral cue. We have previously reported that augmenting the postsynaptic response to cortical afferents in CINs is coupled to the emergence of a cell-intrinsic afterhyperpolarization (AHP) underlying pauses in tonic activity. Here we investigated in a bihemispheric rat-brain slice preparation the mechanisms of synaptic plasticity of excitatory afferents to CINs and the association with changes in the AHP. We found that high frequency stimulation (HFS) of commissural corticostriatal afferents from the contralateral hemisphere induced a robust long-term depression (LTD) of postsynaptic potentials (PSP) in CINs. Depression of the PSP of smaller magnitude and duration was observed in response to HFS of the ipsilateral white matter or cerebral cortex. In Mg(2+)-free solution HFS induced NMDA receptor-dependent potentiation of the PSP, evident in both the maximal slope and amplitude of the PSP. The increase in maximal slope corroborates previous findings, and was blocked by antagonism of either D1-like dopamine receptors with SCH23390 or D2-like dopamine receptors with sulpiride during HFS in Mg(2+)-free solution. Potentiation of the slower PSP amplitude component was due to augmentation of the NMDA receptor-mediated potential as this was completely reversed on subsequent application of the NMDA receptor antagonist AP5. HFS similarly potentiated NMDA receptor currents isolated by blockade of AMPA/kainate receptors with CNQX. The plasticity-induced increase in the slow PSP component was directly associated with an increase in the subsequent AHP. Thus plasticity of cortical afferent synapses is ideally suited to influence the cue-induced firing dynamics of CINs, particularly through potentiation of NMDA receptor-mediated synaptic transmission.

Receptor clustering affects signal transduction at the membrane level in the reaction-limited regime

NASA Astrophysics Data System (ADS)

Caré, Bertrand R.; Soula, Hédi A.

2013-01-01

Many types of membrane receptors are found to be organized as clusters on the cell surface. We investigate the potential effect of such receptor clustering on the intracellular signal transduction stage. We consider a canonical pathway with a membrane receptor (R) activating a membrane-bound intracellular relay protein (G). We use Monte Carlo simulations to recreate biochemical reactions using different receptor spatial distributions and explore the dynamics of the signal transduction. Results show that activation of G by R is severely impaired by R clustering, leading to an apparent blunted biological effect compared to control. Paradoxically, this clustering decreases the half maximal effective dose (ED50) of the transduction stage, increasing the apparent affinity. We study an example of inter-receptor interaction in order to account for possible compensatory effects of clustering and observe the parameter range in which such interactions slightly counterbalance the loss of activation of G. The membrane receptors’ spatial distribution affects the internal stages of signal amplification, suggesting a functional role for membrane domains and receptor clustering independently of proximity-induced receptor-receptor interactions.

Perfluorinated compounds affect the function of sex hormone receptors.

PubMed

Kjeldsen, Lisbeth Stigaard; Bonefeld-Jørgensen, Eva Cecilie

2013-11-01

Perfluorinated compounds (PFCs) are a large group of chemicals used in different industrial and commercial applications. Studies have suggested the potential of some PFCs to disrupt endocrine homeostasis, increasing the risk of adverse health effects. This study aimed to elucidate mechanisms behind PFC interference with steroid hormone receptor functions. Seven PFCs [perfluorohexane sulfonate (PFHxS), perfluorooctane sulfonate (PFOS), perfluorooctanoate (PFOA), perfluorononanoate (PFNA), perfluorodecanoate (PFDA), perfluoroundecanoate (PFUnA), and perfluorododecanoate (PFDoA)] were analyzed in vitro for their potential to affect estrogen receptor (ER) and androgen receptor (AR) transactivity as well as aromatase enzyme activity. The PFCs were assessed as single compounds and in an equimolar mixture. PFHxS, PFOS and PFOA significantly induced the ER transactivity, whereas PFHxS, PFOS, PFOA, PFNA and PFDA significantly antagonized the AR activity in a concentration-dependent manner. Moreover, PFDA weakly decreased the aromatase activity at a high test concentration. A mixture effect more than additive was observed on AR function. We conclude that five of the seven PFCs possess the potential in vitro to interfere with the function of the ER and/or the AR. The observed mixture effect emphasizes the importance of considering the combined action of PFCs in future studies to assess related health risks.

A conserved mechanism for gating in an ionotropic glutamate receptor.

PubMed

Moore, Bryn S; Mirshahi, Uyenlinh L; Ebersole, Tonya L; Mirshahi, Tooraj

2013-06-28

Ionotropic glutamate receptor (iGluR) channels control synaptic activity. The crystallographic structure of GluA2, the prototypical iGluR, reveals a clamshell-like ligand-binding domain (LBD) that closes in the presence of glutamate to open a gate on the pore lining α-helix. How LBD closure leads to gate opening remains unclear. Here, we show that bending the pore helix at a highly conserved alanine residue (Ala-621) below the gate is responsible for channel opening. Substituting Ala-621 with the smaller more flexible glycine resulted in a basally active, nondesensitizing channel with ∼39-fold increase in glutamate potency without affecting surface expression or binding. On GluA2(A621G), the partial agonist kainate showed efficacy similar to a full agonist, and competitive antagonists CNQX and DNQX acted as a partial agonists. Met-629 in GluA2 sits above the gate and is critical in transmitting LBD closure to the gate. Substituting Met-629 with the flexible glycine resulted in reduced channel activity and glutamate potency. The pore regions in potassium channels are structurally similar to iGluRs. Whereas potassium channels typically use glycines as a hinge for gating, iGluRs use the less flexible alanine as a hinge at a similar position to maintain low basal activity allowing for ligand-mediated gating.

The Role of GluK4 in Synaptic Plasticity and Affective Behavior in Mice

NASA Astrophysics Data System (ADS)

Catches, Justin Samuel

Kainate receptors (KARs) are glutamate-gated ion channels that signal through both ionotropic and metabotropic pathways (Contractor et al., 2011). Combinations of five KAR subunits (GluK1-5) form tetrameric receptors with GluK1, GluK2, and GluK3 able to form functional homomeric channels. The high-affinity subunits, GluK4 and GluK5, do not form homomeric channels but modify the properties of heteromeric receptors. Expression of the GluK4 receptor subunit in the forebrain is restricted to the CA3 region of the hippocampus and dentate gyrus regions where KARs modulate synaptic plasticity. In this study, ablation of Grik4, which encodes GluK4, in mice reduced KAR synaptic currents and altered activation properties of postsynaptic receptors but left two forms of presynaptic short-term plasticity intact. Disruption of both Grik4 and Grik5 caused complete loss of the postsynaptic ionotropic KAR current and impaired presynaptic frequency facilitation. Additionally, KAR surface expression was altered at pre- and postsynaptic sites at the MF synapse. Despite the loss of ionotropic signaling, KAR-mediated inhibition of the slow afterhyperpolarization current, which is dependent on metabotropic signaling, was intact in CA3 neurons. Long-term potentiation at the MF-CA3 synapse was reduced, likely through a loss of KAR modulation of excitability of the presynaptic MF axons. Genetic variants in the human GRIK4 gene alter the susceptibility for affective disorders (Bloss and Hunter, 2010). We found that ablation of Grik4 in mice resulted in reduced anxiety and an antidepressant-like phenotype. In the elevated zero-maze, a test for anxiety and risk taking behavior, and in two anxiogenic tests, marble-burying and novelty-induced suppression of feeding, anxiety-like behavior was consistently reduced in knockout animals. In the forced swim, a test of learned helplessness used to determine depression-like behavior, knockout mice demonstrated significantly less immobility suggesting

Modulation of GABA receptors expressed in Xenopus oocytes by 13-L-hydroxylinoleic acid and food additives.

PubMed

Aoshima, H; Tenpaku, Y

1997-12-01

To study the effects of 13-L-hydroxylinoleic acid (LOH) and food additives on gamma-aminobutyric acid (GABA) receptors, ionotropic GABA receptors were expressed in Xenopus oocytes by injecting mRNAs prepared from rat whole brain. LOH, which was prepared by reduction of 13-L-hydroperoxylinoleic acid (LOOH), inhibited the response of GABA receptors in the presence of high concentrations of GABA. LOH also inhibited nicotinic acetylcholine, glycine, and kainate receptors, while it had little effect on NMDA receptors expressed in Xenopus oocytes. However, LOH potentiated the response of GABA receptors as well as LOOH in the presence of low concentrations of GABA, possibly increasing the affinity of GABA for the receptors, while linoleic acid did not. Since some modification of the compounds seemed to change their effects on GABA receptors, the responses of GABA receptors elicited by 10 microM GABA were measured in the presence of compounds with various kinds of functional groups or the structural isomers of pentanol. Potentiation of GABA receptors depended strongly on the species of functional groups and also depended on the structure of the isomers. Then effects of various kinds of food additives on GABA receptors were also examined; perfumes such as alcohols or esters potentiated the responses strongly, while hexylamine, nicotinamide, or caffeine inhibited the responses, mainly in a competitive manner, and vanillin inhibited the responses noncompetitively. These results suggest the possibility that production of LOOH and LOH, or intake of much of some food additives, modulates the neural transmission in the brain, especially through ionotropic GABA receptors and changes the frame of the human mind, as alcohol or tobacco does.

Structure--activity studies for alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropanoic acid receptors: acidic hydroxyphenylalanines.

PubMed

Hill, R A; Wallace, L J; Miller, D D; Weinstein, D M; Shams, G; Tai, H; Layer, R T; Willins, D; Uretsky, N J; Danthi, S N

1997-09-26

Antagonists of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropanoic acid (AMPA) receptors may have therapeutic potential as psychotropic agents. A series of mononitro- and dinitro-2- and 3-hydroxyphenylalanines was prepared, and their activity compared with willardiine, 5-nitrowillardiine, AMPA, and 2,4,5-trihydroxyphenylalanine (6-hydroxydopa) as inhibitors of specific [3H]AMPA and [3H]kainate binding in rat brain homogenates. The most active compounds were highly acidic (pKa 3-4), namely, 2-hydroxy-3,5-dinitro-DL-phenylalanine (13; [3H]AMPA IC50 approximately equal to 25 microM) and 3-hydroxy-2,4-dinitro-DL-phenylalanine (19; [3H]AMPA IC50 approximately equal to 5 microM). Two other dinitro-3-hydroxyphenylalanines, and 3,5-dinitro-DL-tyrosine, were considerably less active. Various mononitrohydroxyphenylalanines, which are less acidic, were also less active or inactive, and 2- and 3-hydroxyphenylalanine (o- and m-tyrosine) were inactive. Compounds 13 and 19, DL-willardiine (pKa 9.3, [3H]AMPA IC50 = 2 microM), and 5-nitro-DL-willardiine (pKa 6.4, [3H]AMPA IC50 = 0.2 microM) displayed AMPA > kainate selectivity in binding studies. Compound 19 was an AMPA-like agonist, but 13 was an antagonist in an AMPA-evoked norepinephrine release assay in rat hippocampal nerve endings. Also, compound 13 injected into the rat ventral pallidum antagonized the locomotor activity elicited by systemic amphetamine.

Cytochemical Organization of the Retino-Suprachiasmatic System

DTIC Science & Technology

1994-03-11

strongly expiessed of the, non-NMDA ionotropic receptors . Other AMPA-preferring receptors , GluR3 and -R4, were also found, but to lesser extent...kainate, and NMDA receptor RN was found in the hypothalamus. GluRi and GluR2 were ang the nmst strongly expressed of the non-NvDA ionotropic receptors ...several different glutamate receptors . The expression of many different types of ionotropic glutamate receptors throughout the hypothalamus suggests that

Androgen Receptor Involvement in Rat Amelogenesis: An Additional Way for Endocrine-Disrupting Chemicals to Affect Enamel Synthesis.

PubMed

Jedeon, Katia; Loiodice, Sophia; Salhi, Khaled; Le Normand, Manon; Houari, Sophia; Chaloyard, Jessica; Berdal, Ariane; Babajko, Sylvie

2016-11-01

Endocrine-disrupting chemicals (EDCs) that interfere with the steroid axis can affect amelogenesis, leading to enamel hypomineralization similar to that of molar incisor hypomineralization, a recently described enamel disease. We investigated the sex steroid receptors that may mediate the effects of EDCs during rat amelogenesis. The expression of androgen receptor (AR), estrogen receptor (ER)-α, and progesterone receptor was dependent on the stage of ameloblast differentiation, whereas ERβ remained undetectable. AR was the only receptor selectively expressed in ameloblasts involved in final enamel mineralization. AR nuclear translocation and induction of androgen-responsive element-containing promoter activity upon T treatment, demonstrated ameloblast responsiveness to androgens. T regulated the expression of genes involved in enamel mineralization such as KLK4, amelotin, SLC26A4, and SLC5A8 but not the expression of genes encoding matrix proteins, which determine enamel thickness. Vinclozolin and to a lesser extent bisphenol A, two antiandrogenic EDCs that cause enamel defects, counteracted the actions of T. In conclusion, we show, for the first time, the following: 1) ameloblasts express AR; 2) the androgen signaling pathway is involved in the enamel mineralization process; and 3) EDCs with antiandrogenic effects inhibit AR activity and preferentially affect amelogenesis in male rats. Their action, through the AR pathway, may specifically and irreversibly affect enamel, potentially leading to the use of dental defects as a biomarker of exposure to environmental pollutants. These results are consistent with the steroid hormones affecting ameloblasts, raising the issue of the hormonal influence on amelogenesis and possible sexual dimorphism in enamel quality.

Association between the dopamine D3 receptor gene locus (DRD3) and unipolar affective disorder.

PubMed

Dikeos, D G; Papadimitriou, G N; Avramopoulos, D; Karadima, G; Daskalopoulou, E G; Souery, D; Mendlewicz, J; Vassilopoulos, D; Stefanis, C N

1999-12-01

Dopamine neurotransmission has been implicated in the pathophysiology of schizophrenia and, more recently, affective disorders. Among the dopamine receptors, D3 can be considered as particularly related to affective disorders due to its neuroanatomical localization in the limbic region of the brain and its relation to the serotoninergic activity of the CNS. The possible involvement of dopamine receptor D3 in unipolar (UP) major depression was investigated by a genetic association study of the D3 receptor gene locus (DRD3) on 36 UP patients and 38 ethnically matched controls. An allelic association of DRD3 (Bal I polymorphism) and UP illness was observed, with the Gly-9 allele (allele '2', 206/98 base-pairs long) being more frequent in patients than in controls (49% vs 29%, P < 0.02). The genotypes containing this allele (1-2 and 2-2) were found in 75% of patients vs 50% of controls (P < 0.03, odds ratio = 3.00, 95% CI = 1.12-8.05). The effect of the genotype remained significant (P < 0.02) after sex and family history were controlled by a multiple linear regression analysis. These results further support the hypothesis that dopaminergic mechanisms may be implicated in the pathogenesis of affective disorder. More specifically, the '2' allele of the dopamine receptor D3 gene seems to be associated with unipolar depression and can be considered as a 'phenotypic modifier' for major psychiatric disorders.

Expression of ionotropic glutamate receptors, AMPA, kainite and NMDA, in the pigeon retina.

PubMed

Atoji, Yasuro

2015-07-01

Glutamate is an excitatory neurotransmitter in the vertebrate retina. A previous study found vesicular glutamate transporter 2 (vGluT2) mRNA in the pigeon retina, suggesting that bipolar and ganglion cells are glutamatergic. The present study examined the localization of ionotropic glutamate receptors to identify receptor cells in the pigeon retina using in situ hybridization histochemistry. Nine subunits of AMPA receptor (GluA1, GluA2, GluA3, and GluA4), kainate receptor (GluK1, GluK2, and GluK4), and NMDA receptor (GluN1 and GluN2A) were found to be expressed in the inner nuclear layer (INL) and ganglion cell layers. GluA1, GluA2, GluA3, and GluA4 were primarily expressed in the inner half of INL, and the signal intensity was strong for GluA2, GluA3, and GluA4. GluK1 was intensely expressed in the outer half of INL, whereas GluK2 and GluK4 were mainly localized in the inner half of INL. GluN1 and GluN2A were moderately expressed in the inner half of INL. Horizontal cells expressed GluA3 and GluA4, and ganglion cells expressed all subunits examined. These results suggest that the glutamatergic neurotransmission in the pigeon retina is similar to that in mammals. Copyright © 2015 Elsevier Ltd. All rights reserved.

Transmitter receptors reveal segregation of cortical areas in the human superior parietal cortex: relations to visual and somatosensory regions.

PubMed

Scheperjans, Filip; Palomero-Gallagher, Nicola; Grefkes, Christian; Schleicher, Axel; Zilles, Karl

2005-11-01

Regional distributions of ligand binding sites of 12 different neurotransmitter receptors (glutamatergic: AMPA, kainate, NMDA; GABAergic: GABA(A), GABA(B); cholinergic: muscarinic M2, nicotinic; adrenergic: alpha1, alpha2; serotonergic: 5-HT1A, 5-HT2; dopaminergic: D1) were studied in human postmortem brains by means of quantitative receptor autoradiography. Binding site densities were measured in the superior parietal lobule (SPL) (areas 5L, 5M, 5Ci, and different locations within Brodmann's area (BA) 7), somatosensory (BA 2), and visual cortical areas (BA 17, and different locations within BAs 18 and 19). Similarities of receptor distribution between cortical areas were analyzed by cluster analysis, uni- and multivariate statistics of mean receptor densities (averaged over all cortical layers), and profiles representing the laminar distribution patterns of receptors. A considerable heterogeneity of regional receptor densities and laminar patterns between the sites was found in the SPL and the visual cortex. The most prominent regional differences were found for M2 receptors. In the SPL, rostrocaudally oriented changes of receptor densities were more pronounced than those in mediolateral direction. The receptor distribution in the rostral SPL was more similar to that of the somatosensory cortex, whereas caudal SPL resembled the receptor patterns of the dorsolateral extrastriate visual areas. These results suggest a segregation of the different SPL areas based on receptor distribution features typical for somatosensory or visual areas, which fits to the dual functional role of this cortical region, i.e., the involvement of the human SPL in visuomotor and somatosensory motor transformations.

The kinase activity of fibroblast growth factor receptor 3 with activation loop mutations affects receptor trafficking and signaling.

PubMed

Lievens, Patricia M-J; Mutinelli, Chiara; Baynes, Darcie; Liboi, Elio

2004-10-08

Amino acid substitutions at the Lys-650 codon within the activation loop kinase domain of fibroblast growth factor receptor 3 (FGFR3) result in graded constitutive phosphorylation of the receptor. Accordingly, the Lys-650 mutants are associated with dwarfisms with graded clinical severity. To assess the importance of the phosphorylation level on FGFR3 maturation along the secretory pathway, hemagglutinin A-tagged derivatives were studied. The highly activated SADDAN (severe achondroplasia with developmental delay and acanthosis nigricans) mutant accumulates in its immature and phosphorylated form in the endoplasmic reticulum (ER), which fails to be degraded. Furthermore, the Janus kinase (Jak)/STAT pathway is activated from the ER by direct recruitment of Jak1. Abolishing the autocatalytic property of the mutated FGFR3 by replacing the critical Tyr-718 reestablishes the receptor full maturation and inhibits signaling. Differently, the low activated hypochondroplasia mutant is present as a mature phosphorylated form on the plasma membrane, although with a delayed transition in the ER, and is completely processed. Signaling does not occur in the presence of brefeldin A; instead, STAT1 is activated when protein secretion is blocked with monensin, suggesting that the hypochondroplasia receptor signals at the exit from the ER. Our results suggest that kinase activity affects FGFR3 trafficking and determines the spatial segregation of signaling pathways. Consequently, the defect in down-regulation of the highly activated receptors results in the increased signaling capacity from the intracellular compartments, and this may determine the severity of the diseases.

The Role of Ionotropic Glutamate Receptors in Childhood Neurodevelopmental Disorders: Autism Spectrum Disorders and Fragile X Syndrome

PubMed Central

Uzunova, Genoveva; Hollander, Eric; Shepherd, Jason

2014-01-01

Autism spectrum disorder (ASD) and Fragile X syndrome (FXS) are relatively common childhood neurodevelopmental disorders with increasing incidence in recent years. They are currently accepted as disorders of the synapse with alterations in different forms of synaptic communication and neuronal network connectivity. The major excitatory neurotransmitter system in brain, the glutamatergic system, is implicated in learning and memory, synaptic plasticity, neuronal development. While much attention is attributed to the role of metabotropic glutamate receptors in ASD and FXS, studies indicate that the ionotropic glutamate receptors (iGluRs) and their regulatory proteins are also altered in several brain regions. Role of iGluRs in the neurobiology of ASD and FXS is supported by a weight of evidence that ranges from human genetics to in vitro cultured neurons. In this review we will discuss clinical, molecular, cellular and functional changes in NMDA, AMPA and kainate receptors and the synaptic proteins that regulate them in the context of ASD and FXS. We will also discuss the significance for the development of translational biomarkers and treatments for the core symptoms of ASD and FXS. PMID:24533017

Early exposure to caffeine affects gene expression of adenosine receptors, DARPP-32 and BDNF without affecting sensibility and morphology of developing zebrafish (Danio rerio).

PubMed

Capiotti, Katiucia Marques; Menezes, Fabiano Peres; Nazario, Luiza Reali; Pohlmann, Julhana Bianchini; de Oliveira, Giovanna M T; Fazenda, Lidiane; Bogo, Maurício Reis; Bonan, Carla Denise; Da Silva, Rosane Souza

2011-01-01

Adenosine receptors are the most important biochemical targets of caffeine, a common trimethylxanthine found in food and beverages. Adenosine plays modulatory action during the development through adenosine receptors and their intracellular pathways activation. In this study, we aimed to evaluate if caffeine gave to zebrafish in the very first steps of development is able to affect its direct targets, through the adenosine receptors mRNA expression evaluation, and latter indirect targets, through evaluation of the pattern of dopamine and cAMP-regulated phosphoprotein and brain-derived neurotrophic factor (BDNF) mRNA expression. Here, we demonstrate that zebrafish express adenosine receptor subtypes (A1, A2A1, A2A2 and A2B) since 24h post-fertilization (hpf) and that caffeine exposure is able to affect the expression of these receptors. Caffeine exposure from 1 hpf is able to increase A1 expression at 72-96 hpf and A2A1 expression at 72 hpf. No alterations occurred in A2A2 and A2B expression after caffeine treatment. DARPP-32, a phosphoprotein involved in adenosine intracellular pathway is also expressed since 24 hpf and early exposure to caffeine increased DARPP-32 expression at 168 hpf. We also evaluate the expression of BDNF as one of the targets of adenosine intracellular pathway activation. BDNF was also expressed since 24 hpf and caffeine treatment increased its expression at 48 and 72 hpf. No morphological alterations induced by caffeine treatment were registered by the check of general body features and total body length. Assessment of tactile sensibility also demonstrated no alterations by caffeine treatment. Altogether, these results suggest that caffeine is able to affect expression of its cellular targets since early phases of development in zebrafish without affect visible features. The up-regulation of direct and indirect targets of caffeine presents as a compensatory mechanism of maintenance of adenosinergic modulation during the developmental phase

Common α2A and α2C adrenergic receptor polymorphisms do not affect plasma membrane trafficking.

PubMed

Hurt, Carl M; Sorensen, Matt W; Angelotti, Timothy

2014-06-01

Various naturally occurring polymorphic forms of human G protein-coupled receptors (GPCRs) have been identified and linked to diverse pathological diseases, including receptors for vasopressin type 2 (nephrogenic diabetes insipidus) and gonadotropin releasing hormone (hypogonadotropic hypogonadism). In most cases, polymorphic amino acid mutations disrupt protein folding, altering receptor function as well as plasma membrane expression. Other pathological GPCR variants have been found that do not alter receptor function, but instead affect only plasma membrane trafficking (e.g., delta opiate and histamine type 1 receptors). Thus, altered membrane trafficking with retained receptor function may be another mechanism causing polymorphic GPCR dysfunction. Two common human α2A and α2C adrenergic receptor (AR) variants have been identified (α2A N251K and α2C Δ322-325 ARs), but pharmacological analysis of ligand binding and second messenger signaling has not consistently demonstrated altered receptor function. However, possible alterations in plasma membrane trafficking have not been investigated. We utilized a systematic approach previously developed for the study of GPCR trafficking motifs and accessory proteins to assess whether these α2 AR variants affected intracellular trafficking or plasma membrane expression. By combining immunofluorescent microscopy, glycosidic processing analysis, and quantitative fluorescent-activated cell sorting (FACS), we demonstrate that neither variant receptor had altered intracellular localization, glycosylation, nor plasma membrane expression compared to wild-type α2 ARs. Therefore, pathopharmacological properties of α2A N251K and α2C Δ322-325 ARs do not appear to be due to altered receptor pharmacology or plasma membrane trafficking, but may involve interactions with other intracellular signaling cascades or proteins.

Ionotropic glutamate receptors activate cell signaling in response to glutamate in Schwann cells.

PubMed

Campana, Wendy M; Mantuano, Elisabetta; Azmoon, Pardis; Henry, Kenneth; Banki, Michael A; Kim, John H; Pizzo, Donald P; Gonias, Steven L

2017-04-01

In the peripheral nervous system, Schwann cells (SCs) demonstrate surveillance activity, detecting injury and undergoing trans -differentiation to support repair. SC receptors that detect peripheral nervous system injury remain incompletely understood. We used RT-PCR to profile ionotropic glutamate receptor expression in cultured SCs. We identified subunits required for assembly of N -methyl-d-aspartic acid (NMDA) receptors (NMDA-Rs), α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors, and kainate receptors. Treatment of SCs with 40-100 µM glutamate or with 0.5-1.0 µM NMDA robustly activated Akt and ERK1/2. The response was transient and bimodal; glutamate concentrations that exceeded 250 µM failed to activate cell signaling. Phosphoprotein profiling identified diverse phosphorylated proteins in glutamate-treated SCs in addition to ERK1/2 and Akt, including p70 S6-kinase, glycogen synthase kinase-3, ribosomal S6 kinase, c-Jun, and cAMP response element binding protein. Activation of SC signaling by glutamate was blocked by EGTA and dizocilpine and by silencing expression of the NMDA-R NR1 subunit. Phosphoinositide 3-kinase/PI3K functioned as an essential upstream activator of Akt and ERK1/2 in glutamate-treated SCs. When glutamate or NMDA was injected directly into crush-injured rat sciatic nerves, ERK1/2 phosphorylation was observed in myelinated and nonmyelinating SCs. Glutamate promoted SC migration by a pathway that required PI3K and ERK1/2. These results identified ionotropic glutamate receptors and NMDA-Rs, specifically, as potentially important cell signaling receptors in SCs.-Campana, W. M., Mantuano, E., Azmoon, P., Henry, K., Banki, M. A., Kim, J. H., Pizzo, D. P., Gonias, S. L. Ionotropic glutamate receptors activate cell signaling in response to glutamate in Schwann cells. © FASEB.

Nucleus Accumbens AMPA Receptors Are Necessary for Morphine-Withdrawal-Induced Negative-Affective States in Rats

PubMed Central

Russell, Shayla E.; Puttick, Daniel J.; Sawyer, Allison M.; Potter, David N.; Mague, Stephen; Carlezon, William A.

2016-01-01

Dependence is a hallmark feature of opiate addiction and is defined by the emergence of somatic and affective withdrawal signs. The nucleus accumbens (NAc) integrates dopaminergic and glutamatergic inputs to mediate rewarding and aversive properties of opiates. Evidence suggests that AMPA glutamate-receptor-dependent synaptic plasticity within the NAc underlies aspects of addiction. However, the degree to which NAc AMPA receptors (AMPARs) contribute to somatic and affective signs of opiate withdrawal is not fully understood. Here, we show that microinjection of the AMPAR antagonist NBQX into the NAc shell of morphine-dependent rats prevented naloxone-induced conditioned place aversions and decreases in sensitivity to brain stimulation reward, but had no effect on somatic withdrawal signs. Using a protein cross-linking approach, we found that the surface/intracellular ratio of NAc GluA1, but not GluA2, increased with morphine treatment, suggesting postsynaptic insertion of GluA2-lacking AMPARs. Consistent with this, 1-naphthylacetyl spermine trihydrochloride (NASPM), an antagonist of GluA2-lacking AMPARs, attenuated naloxone-induced decreases in sensitivity to brain stimulation reward. Naloxone decreased the surface/intracellular ratio and synaptosomal membrane levels of NAc GluA1 in morphine-dependent rats, suggesting a compensatory removal of AMPARs from synaptic zones. Together, these findings indicate that chronic morphine increases synaptic availability of GluA1-containing AMPARs in the NAc, which is necessary for triggering negative-affective states in response to naloxone. This is broadly consistent with the hypothesis that activation of NAc neurons produces acute aversive states and raises the possibility that inhibiting AMPA transmission selectively in the NAc may have therapeutic value in the treatment of addiction. SIGNIFICANCE STATEMENT Morphine dependence and withdrawal result in profound negative-affective states that play a major role in the

Melanocortin-1 receptor gene variants affect pain and µ-opioid analgesia in mice and humans

PubMed Central

Mogil, J; Ritchie, J; Smith, S; Strasburg, K; Kaplan, L; Wallace, M; Romberg, R; Bijl, H; Sarton, E; Fillingim, R; Dahan, A

2005-01-01

Background: A recent genetic study in mice and humans revealed the modulatory effect of MC1R (melanocortin-1 receptor) gene variants on κ-opioid receptor mediated analgesia. It is unclear whether this gene affects basal pain sensitivity or the efficacy of analgesics acting at the more clinically relevant µ-opioid receptor. Objective: To characterise sensitivity to pain and µ-opioid analgesia in mice and humans with non-functional melanocortin-1 receptors. Methods: Comparisons of spontaneous mutant C57BL/6-Mc1re/e mice to C57BL/6 wildtype mice, followed by a gene dosage study of pain and morphine-6-glucuronide (M6G) analgesia in humans with MC1R variants. Results: C57BL/6-Mc1re/e mutant mice and human redheads—both with non-functional MC1Rs—display reduced sensitivity to noxious stimuli and increased analgesic responsiveness to the µ-opioid selective morphine metabolite, M6G. In both species the differential analgesia is likely due to pharmacodynamic factors, as plasma levels of M6G are similar across genotype. Conclusions: Genotype at MC1R similarly affects pain sensitivity and M6G analgesia in mice and humans. These findings confirm the utility of cross species translational strategies in pharmacogenetics. PMID:15994880

TAM receptors affect adult brain neurogenesis by negative regulation of microglial cell activation.

PubMed

Ji, Rui; Tian, Shifu; Lu, Helen J; Lu, Qingjun; Zheng, Yan; Wang, Xiaomin; Ding, Jixiang; Li, Qiutang; Lu, Qingxian

2013-12-15

TAM tyrosine kinases play multiple functional roles, including regulation of the target genes important in homeostatic regulation of cytokine receptors or TLR-mediated signal transduction pathways. In this study, we show that TAM receptors affect adult hippocampal neurogenesis and loss of TAM receptors impairs hippocampal neurogenesis, largely attributed to exaggerated inflammatory responses by microglia characterized by increased MAPK and NF-κB activation and elevated production of proinflammatory cytokines that are detrimental to neuron stem cell proliferation and neuronal differentiation. Injection of LPS causes even more severe inhibition of BrdU incorporation in the Tyro3(-/-)Axl(-/-)Mertk(-/-) triple-knockout (TKO) brains, consistent with the LPS-elicited enhanced expression of proinflammatory mediators, for example, IL-1β, IL-6, TNF-α, and inducible NO synthase, and this effect is antagonized by coinjection of the anti-inflammatory drug indomethacin in wild-type but not TKO brains. Conditioned medium from TKO microglia cultures inhibits neuron stem cell proliferation and neuronal differentiation. IL-6 knockout in Axl(-/-)Mertk(-/-) double-knockout mice overcomes the inflammatory inhibition of neurogenesis, suggesting that IL-6 is a major downstream neurotoxic mediator under homeostatic regulation by TAM receptors in microglia. Additionally, autonomous trophic function of the TAM receptors on the proliferating neuronal progenitors may also promote progenitor differentiation into immature neurons.

Differential alterations of cortical glutamatergic binding sites in senile dementia of the Alzheimer type

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chalmers, D.T.; Dewar, D.; Graham, D.I.

1990-02-01

Involvement of cortical glutamatergic mechanisms in senile dementia of the Alzheimer type (SDAT) has been investigated with quantitative ligand-binding autoradiography. The distribution and density of Na(+)-dependent glutamate uptake sites and glutamate receptor subtypes--kainate, quisqualate, and N-methyl-D-aspartate--were measured in adjacent sections of frontal cortex obtained postmortem from six patients with SDAT and six age-matched controls. The number of senile plaques was determined in the same brain region. Binding of D-(3H)aspartate to Na(+)-dependent uptake sites was reduced by approximately 40% throughout SDAT frontal cortex relative to controls, indicating a general loss of glutamatergic presynaptic terminals. (3H)Kainate receptor binding was significantly increased bymore » approximately 70% in deep layers of SDAT frontal cortex compared with controls, whereas this binding was unaltered in superficial laminae. There was a positive correlation (r = 0.914) between kainate binding and senile plaque number in deep cortical layers. Quisqualate receptors, as assessed by 2-amino-3-hydroxy-5-(3H)methylisoxazole-4-propionic acid binding, were unaltered in SDAT frontal cortex compared with controls. There was a small reduction (25%) in N-methyl-D-aspartate-sensitive (3H)glutamate binding only in superficial cortical layers of SDAT brains relative to control subjects. (3H)Glutamate binding in SDAT subjects was unrelated to senile plaque number in superficial cortical layers (r = 0.104). These results indicate that in the presence of cortical glutamatergic terminal loss in SDAT plastic alterations occur in some glutamate receptor subtypes but not in others.« less

Effects of AT1 receptor antagonism on kainate-induced seizures and concomitant changes in hippocampal extracellular noradrenaline, serotonin, and dopamine levels in Wistar-Kyoto and spontaneously hypertensive rats.

PubMed

Tchekalarova, Jana; Loyens, Ellen; Smolders, Ilse

2015-05-01

In the management of epilepsy, AT1 receptor antagonists have been suggested as an additional treatment strategy. A hyperactive brain angiotensin (Ang) II system and upregulated AT1 receptors are implicated in the cerebrovascular alterations in a genetic form of hypertension. Uncontrolled hypertension could also, in turn, be a risk factor for a seizure threshold decrease and development of epileptogenesis. The present study aimed to assess the effects of the selective AT1 receptor antagonist ZD7155 on kainic acid (KA)-induced status epilepticus (SE) development and accompanying changes in the hippocampal extracellular (EC) neurotransmitter levels of noradrenaline (NAD), serotonin (5-HT), and dopamine (DA) in spontaneously hypertensive rats (SHRs) and their parent strain Wistar-Kyoto (WKY) rats, since monoamines are well-known neurotransmitters involved in mechanisms of both epilepsy and hypertension. Status epilepticus was evoked in freely moving rats by a repetitive intraperitoneal (i.p.) administration of KA in subconvulsant doses. In the treatment group, ZD7155 (5mg/kg i.p.) was coadministered with the first KA injection. Spontaneously hypertensive rats exhibited higher susceptibility to SE than WKY rats, but the AT1 receptor antagonist did not alter the development of SE in SHRs or in WKY rats. In vivo microdialysis demonstrated significant KA-induced increases of the hippocampal NAD and DA levels in SHRs and of NAD, 5-HT, and DA in WKY rats. Although SHRs developed more severe seizures while receiving a lower dose of KA compared to WKY rats, AT1 receptor antagonism completely prevented all KA-induced increases of hippocampal monoamine levels in both rat strains without affecting seizure development per se. These results suggest a lack of direct relationship between KA-induced seizure susceptibility and adaptive changes of hippocampal NAD, 5-HT, and DA levels in the effects of ZD7155 in WKY rats and SHRs. Copyright © 2015 Elsevier Inc. All rights reserved.

Affective and cognitive effects of global deletion of alpha3-containing gamma-aminobutyric acid-A receptors.

PubMed

Fiorelli, Roberto; Rudolph, Uwe; Straub, Carolin J; Feldon, Joram; Yee, Benjamin K

2008-09-01

Gamma-aminobutyric acid (GABA)A receptors characterized by the presence of the alpha3 subunit are the major GABAA receptor subtype expressed in brain stem monoaminergic nuclei. These alpha3-GABAA receptors are therefore in a unique position to regulate monoaminergic functions. To characterize the functional properties of alpha3-GABAA receptors, we present a preliminary assessment of the expression of affective and cognitive behaviour in male mice with a targeted deletion of the Gabra3 gene encoding the alpha3 subunit [alpha3 knockout (KO) mice] on a C57BL/6Jx129X1/SvJ F1 hybrid genetic background. The alpha3 KO mice did not exhibit any gross change of anxiety-like behaviour or spontaneous locomotor behaviour. In the Porsolt forced swim test for potential antidepressant activity, alpha3 KO mice exhibited reduced floating and enhanced swimming behaviour relative to wild-type controls. Performance on a two-choice sucrose preference test, however, revealed no evidence for an increase in sucrose preference in the alpha3 KO mice that would have substantiated a potential phenotype for depression-related behaviour. In contrast, a suggestion of an enhanced negative contrast effect was revealed in a one-bottle sucrose consumption test across different sucrose concentrations. These affective phenotypes were accompanied by alterations in the balance between conditioned responding to the discrete conditioned stimulus and to the context, and a suggestion of faster extinction, in the Pavlovian conditioned freezing paradigm. Spatial learning in the water maze reference memory test, however, was largely unchanged in the alpha3 KO mice, except for a trend of preservation during reversal learning. The novel phenotypes following global deletion of the GABAA receptor alpha3 subunit identified here provided relevant insights, in addition to our earlier study, into the potential behavioural relevance of this specific receptor subtypes in the modulation of both affective and cognitive

Altered Sleep and Affect in the Neurotensin Receptor 1 Knockout Mouse

PubMed Central

Fitzpatrick, Karrie; Winrow, Christopher J.; Gotter, Anthony L.; Millstein, Joshua; Arbuzova, Janna; Brunner, Joseph; Kasarskis, Andrew; Vitaterna, Martha H.; Renger, John J.; Turek, Fred W.

2012-01-01

Study Objective: Sleep and mood disorders have long been understood to have strong genetic components, and there is considerable comorbidity of sleep abnormalities and mood disorders, suggesting the involvement of common genetic pathways. Here, we examine a candidate gene implicated in the regulation of both sleep and affective behavior using a knockout mouse model. Design: Previously, we identified a quantitative trait locus (QTL) for REM sleep amount, REM sleep bout number, and wake amount in a genetically segregating population of mice. Here, we show that traits mapping to this QTL correlated with an expression QTL for neurotensin receptor 1 (Ntsr1), a receptor for neurotensin, a ligand known to be involved in several psychiatric disorders. We examined sleep as well as behaviors indicative of anxiety and depression in the NTSR1 knockout mouse. Measurements and Results: NTSR1 knockouts had a lower percentage of sleep time spent in REM sleep in the dark phase and a larger diurnal variation in REM sleep duration than wild types under baseline conditions. Following sleep deprivation, NTSR1 knockouts exhibited more wake and less NREM rebound sleep. NTSR1 knockouts also showed increased anxious and despair behaviors. Conclusions: Here we illustrate a link between expression of the Ntsr1 gene and sleep traits previously associated with a particular QTL. We also demonstrate a relationship between Ntsr1 and anxiety and despair behaviors. Given the considerable evidence that anxiety and depression are closely linked with abnormalities in sleep, the data presented here provide further evidence that neurotensin and Ntsr1 may be a component of a pathway involved in both sleep and mood disorders. Citation: Fitzpatrick K; Winrow CJ; Gotter AL; Millstein J; Arbuzova J; Brunner J; Kasarskis A; Vitaterna MH; Renger JJ; Turek FW. Altered sleep and affect in the neurotensin receptor 1 knockout mouse. SLEEP 2012;35(7):949-956. PMID:22754041

The effects of L-glutamate, AMPA, quisqualate, and kainate on retinal horizontal cells depend on adaptational state: implications for rod-cone interactions.

PubMed

Krizaj, D; Akopian, A; Witkovsky, P

1994-09-01

We studied the responses of isolated and intact luminosity-type horizontal cells (L-HC) in the Xenopus retina to L-glutamate (L-glu) and its analogs. Isolated L-HCs studied with whole-cell patch clamp responded to L-glu, kainate (KA), AMPA, or quisqualate (quis) with inward currents from a holding potential of -60 mV, associated with a conductance increase. The current elicited by KA was relatively large and sustained, whereas AMPA or quis evoked a desensitizing current. Coapplication of quis and KA resulted in a smaller current and conductance change than that evoked by a pulse of either alone at the same concentration. This finding suggests that the L-HC has a single subtype of glutamate receptor that responds to both quis and KA. Prior exposure to dopamine enhanced the KA-evoked current about twofold. In the superfused eyecup we found that L-HC responses to quinoxalinediones (CNQX or DNQX) and to L-glu, KA, AMPA, and quis varied as a function of adaptational state. When driven exclusively by either cones or by rods, CNQX/DNQX hyperpolarized the L-HC and reduced its light response, without altering response kinetics, indicating that both rods and cones communicate with L-HCs at ionotropic glutamatergic synapses. Under mesopic conditions, however, as CNQX or DNQX reduced cone input, the rod input to the L-HC increased up to fivefold in magnitude and had slowed kinetics. The depolarizing response of the L-HC to L-glu, AMPA, or quis was relatively small and transient under photopic conditions, but was much larger and sustained when the eyecup was dark adapted. The D1 dopamine antagonist SCH 23390 potentiated the response to quis. In contrast, responses to KA were largest in light-adapted eyecups, were potentiated by a D1 dopamine agonist, SKF 38393, and were reduced by SCH 23390. We hypothesize that the segregated populations of glutamate receptors in the L-HC opposite cone and rod synaptic endings can be separately modulated to respond differentially to the native

Further association study on dopamine D2 receptor variant S311C in Schizophrenia and affective disorders

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arinami, Tadao; Hamaguchi, Hideo; Itokawa, Masanari

The dopamine D2 receptor gene is a candidate gene for schizophrenia because the potency of certain neuroleptics correlates with their affinity for this receptor. Case-control studies in 291 schizophrenics, 78 patients with affective disorders, and 579 controls on an association of a molecular variant of S311C of the dopamine D2 receptor with psychiatric disorders were conducted. The frequency of individuals with S311C was significantly higher in schizophrenics with the absence of negative symptoms (17.1%, P < 0.00001), but similar in schizophrenics with the presence of negative symptoms (5.7%, P = 0.46) when compared with the controls (4.1%). The frequency ofmore » S311C was significantly higher in familiar schizophrenics from one local area but not in those from other areas. It was significant that S311C was frequently present in patients with mood-incongruent psychotic affective disorders (33.3%, P < 0.0001), but not in those with other affective disorders. These data suggest that S311C might be one of the genetic factors for symptomatic dimensions of delusions and hallucinations and might be involved in underlying clinical heterogeneity in schizophrenia and affective disorders. 48 refs., 3 tabs.« less

Citrate Modulates the Regulation by Zn2+ of N-Methyl-D-Aspartate Receptor-Mediated Channel Current and Neurotransmitter Release

NASA Astrophysics Data System (ADS)

Westergaard, Niels; Banke, Tue; Wahl, Philip; Sonnewald, Ursula; Schousboe, Arne

1995-04-01

The effect of the two metal-ion chelators EDTA and citrate on the action of N-methyl-D-aspartate (NMDA) receptors was investigated by use of cultured mouse cerebellar granule neurons and Xenopus oocytes, respectively, to monitor either NMDA-evoked transmitter release or membrane currents. Transmitter release from the glutamatergic neurons was determined by superfusion of the cells after preloading with the glutamate analogue D-[^3H]aspartate. The oocytes were injected with mRNA isolated from mouse cerebellum and, after incubation to allow translation to occur, currents mediated by NMDA were recorded electrophysiologically by voltage clamp at a holding potential of -80 mV. It was found that citrate as well as EDTA could attenuate the inhibitory action of Zn2+ on NMDA receptor-mediated transmitter release from the neurons and membrane currents in the oocytes. These effects were specifically related to the NMDA receptor, since the NMDA receptor antagonist MK-801 abolished the action and no effects of Zn2+ and its chelators were observed when kainate was used to selectively activate non-NMDA receptors. Since it was additionally demonstrated that citrate (and EDTA) preferentially chelated Zn2+ rather than Ca2+, the present findings strongly suggest that endogenous citrate released specifically from astrocytes into the extracellular space in the brain may function as a modulator of NMDA receptor activity. This is yet another example of astrocytic influence on neuronal activity.

Role of glutamate and substance P in the amphibian respiratory network during development

PubMed Central

Chen, Anna K.; Hedrick, Michael S.

2008-01-01

This study tested the hypothesis that glutamatergic ionotropic (AMPA/kainate) receptors and neurokinin receptors (NKR) are important in the regulation of respiratory motor output during development in the bullfrog. The roles of these receptors were studied with in vitro brainstem preparations from pre-metamorphic tadpoles and post-metamorphic frogs. Brainstems were superfused with an artificial cerebrospinal fluid at 20–22°C containing CNQX, a selective non-NMDA antagonist, or with substance P (SP), an agonist of NKR. Blockade of glutamate receptors with CNQX in both groups caused a reduction of lung burst frequency that was reversibly abolished at 5 μM (P<0.01). CNQX, but not SP, application produced a significant increase (P<0.05) in gill and buccal frequency in tadpoles and frogs, respectively. SP caused a significant increase (P<0.05) in lung burst frequency at 5 μM in both groups. These results suggest that glutamatergic activation of AMPA/kainate receptors is necessary for generation of lung burst activity and that SP is an excitatory neurotransmitter for lung burst frequency generation. Both glutamate and SP provide excitatory input for lung burst generation throughout the aquatic to terrestrial developmental transition in bullfrogs. PMID:18450524

Role of glutamate and substance P in the amphibian respiratory network during development.

PubMed

Chen, Anna K; Hedrick, Michael S

2008-06-30

This study tested the hypothesis that glutamatergic ionotropic (AMPA/kainate) receptors and neurokinin receptors (NKR) are important in the regulation of respiratory motor output during development in the bullfrog. The roles of these receptors were studied with in vitro brainstem preparations from pre-metamorphic tadpoles and post-metamorphic frogs. Brainstems were superfused with an artificial cerebrospinal fluid at 20-22 degrees C containing CNQX, a selective non-NMDA antagonist, or with substance P (SP), an agonist of NKR. Blockade of glutamate receptors with CNQX in both groups caused a reduction of lung burst frequency that was reversibly abolished at 5 microM (P<0.01). CNQX, but not SP, application produced a significant increase (P<0.05) in gill and buccal frequency in tadpoles and frogs, respectively. SP caused a significant increase (P<0.05) in lung burst frequency at 5 microM in both groups. These results suggest that glutamatergic activation of AMPA/kainate receptors is necessary for generation of lung burst activity and that SP is an excitatory neurotransmitter for lung burst frequency generation. Both glutamate and SP provide excitatory input for lung burst generation throughout the aquatic to terrestrial developmental transition in bullfrogs.

Breathing is affected by dopamine D2-like receptors in the basolateral amygdala.

PubMed

Sugita, Toshihisa; Kanamaru, Mitsuko; Iizuka, Makito; Sato, Kanako; Tsukada, Setsuro; Kawamura, Mitsuru; Homma, Ikuo; Izumizaki, Masahiko

2015-04-01

The precise mechanisms underlying how emotions change breathing patterns remain unclear, but dopamine is a candidate neurotransmitter in the process of emotion-associated breathing. We investigated whether basal dopamine release occurs in the basolateral amygdala (BLA), where sensory-related inputs are received and lead to fear or anxiety responses, and whether D1- and D2-like receptor antagonists affect breathing patterns and dopamine release in the BLA. Adult male mice (C57BL/6N) were perfused with artificial cerebrospinal fluid, a D1-like receptor antagonist (SCH 23390), or a D2-like receptor antagonist ((S)-(-)-sulpiride) through a microdialysis probe in the BLA. Respiratory variables were measured using a double-chamber plethysmograph. Dopamine release was measured by an HPLC. Perfusion of (S)-(-)-sulpiride in the BLA, not SCH 23390, specifically decreased respiratory rate without changes in local release of dopamine. These results suggest that basal dopamine release in the BLA, at least partially, increases respiratory rates only through post-synaptic D2-like receptors, not autoreceptors, which might be associated with emotional responses. Copyright © 2014 Elsevier B.V. All rights reserved.

Lack of CB1 receptors increases noradrenaline release in vas deferens without affecting atrial noradrenaline release or cortical acetylcholine release

PubMed Central

Schlicker, Eberhard; Redmer, Agnes; Werner, André; Kathmann, Markus

2003-01-01

We studied whether cannabinoid CB1 receptor gene disruption (to yield CB1−/− mice) affects the electrically evoked tritium overflow from vas deferens and atrial pieces preincubated with [3H]-noradrenaline (NA) (‘noradrenaline release') and from cerebral cortex slices preincubated with [3H]-choline (‘acetylcholine release'). NA release was higher by 37% in vas deferens from CB1−/− mice than in vas deferens from CB1+/+ mice. The cannabinoid receptor agonist WIN 55,212-2 inhibited, and the CB1 receptor inverse agonist/antagonist SR 141716, increased NA release in vas deferens from CB1+/+ mice without affecting it in vas deferens from CB1−/− mice. Atrial NA release did not differ between CB1+/+ and CB1−/− mice nor did WIN 55,212-2 affect NA release in either strain. Cortical acetylcholine (Ach) release did not differ between CB1+/+ and CB1−/− mice. WIN 55,212-2 inhibited, but SR 141716 did not affect, Ach release in the cortex from CB1+/+ mice. Both drugs did not alter Ach release in the cortex from CB1−/− mice. Tritium content did not differ between CB1+/+ and CB1−/− mice in any preparation. In conclusion, the increase in NA release associated with CB1 receptor deficiency in the vas deferens, which cannot be ascribed to an alteration of tritium content of the preparations, suggests an endogenous tone at the CB1 receptors of CB1+/+ mice in this tissue. Furthermore, the effect of WIN 55,212-2 on NA release in the vas deferens and on cortical Ach release involves CB1 receptors, whereas the involvement of non-CB1–non-CB2 receptors can be excluded. PMID:12970076

Opioid receptor agonists may favorably affect bone mechanical properties in rats with estrogen deficiency-induced osteoporosis.

PubMed

Janas, Aleksandra; Folwarczna, Joanna

2017-02-01

The results of epidemiological, clinical, and in vivo and in vitro experimental studies on the effect of opioid analgesics on bone are inconsistent. The aim of the present study was to investigate the effect of morphine (an agonist of opioid receptors), buprenorphine (a partial μ opioid receptor agonist and κ opioid receptor antagonist), and naloxone (an antagonist of opioid receptors) on the skeletal system of female rats in vivo. The experiments were carried out on 3-month-old Wistar rats, divided into two groups: nonovariectomized (intact; NOVX) rats and ovariectomized (OVX) rats. The bilateral ovariectomy was performed 7 days before the start of drug administration. Morphine hydrochloride (20 mg/kg/day s.c.), buprenorphine (0.05 mg/kg/day s.c.), or naloxone hydrochloride dihydrate (2 mg/kg/day s.c.) were administered for 4 weeks to NOVX and OVX rats. In OVX rats, the use of morphine and buprenorphine counteracted the development of osteoporotic changes in the skeletal system induced by estrogen deficiency. Morphine and buprenorphine beneficially affected also the skeletal system of NOVX rats, but the effects were much weaker than those in OVX rats. Naloxone generally did not affect the rat skeletal system. The results confirmed the role of opioid receptors in the regulation of bone remodeling processes and demonstrated, in experimental conditions, that the use of opioid analgesics at moderate doses may exert beneficial effects on the skeletal system, especially in estrogen deficiency.

Changes in the expression of neurotransmitter receptors in Parkin and DJ-1 knockout mice--A quantitative multireceptor study.

PubMed

Cremer, J N; Amunts, K; Schleicher, A; Palomero-Gallagher, N; Piel, M; Rösch, F; Zilles, K

2015-12-17

Parkinson's disease (PD) is a well-characterized neurological disorder with regard to its neuropathological and symptomatic appearance. At the genetic level, mutations of particular genes, e.g. Parkin and DJ-1, were found in human hereditary PD with early onset. Neurotransmitter receptors constitute decisive elements in neural signal transduction. Furthermore, since they are often altered in neurological and psychiatric diseases, receptors have been successful targets for pharmacological agents. However, the consequences of PD-associated gene mutations on the expression of transmitter receptors are largely unknown. Therefore, we studied the expression of 16 different receptor binding sites of the neurotransmitters glutamate, GABA, acetylcholine, adrenaline, serotonin, dopamine and adenosine by means of quantitative receptor autoradiography in Parkin and DJ-1 knockout mice. These knockout mice exhibit electrophysiological and behavioral deficits, but do not show the typical dopaminergic cell loss. We demonstrated differential changes of binding site densities in eleven brain regions. Most prominently, we found an up-regulation of GABA(B) and kainate receptor densities in numerous cortical areas of Parkin and DJ-1 knockout mice, as well as increased NMDA but decreased AMPA receptor densities in different brain regions of the Parkin knockout mice. The alterations of three different glutamate receptor types may indicate the potential relevance of the glutamatergic system in the pathogenesis of PD. Furthermore, the cholinergic M1, M2 and nicotinic receptors as well as the adrenergic α2 and the adenosine A(2A) receptors showed differentially increased densities in Parkin and DJ-1 knockout mice. Taken together, knockout of the PD-associated genes Parkin or DJ-1 results in differential changes of neurotransmitter receptor densities, highlighting a possible role of altered non-dopaminergic, and in particular of glutamatergic neurotransmission in PD pathogenesis. Copyright

Seizures beget seizures in temporal lobe epilepsies: the boomerang effects of newly formed aberrant kainatergic synapses.

PubMed

Ben-Ari, Yehezkel; Crepel, Valérie; Represa, Alfonso

2008-01-01

Do temporal lobe epilepsy (TLE) seizures in adults promote further seizures? Clinical and experimental data suggest that new synapses are formed after an initial episode of status epilepticus, however their contribution to the transformation of a naive network to an epileptogenic one has been debated. Recent experimental data show that newly formed aberrant excitatory synapses on the granule cells of the fascia dentate operate by means of kainate receptor-operated signals that are not present on naive granule cells. Therefore, genuine epileptic networks rely on signaling cascades that differentiate them from naive networks. Recurrent limbic seizures generated by the activation of kainate receptors and synapses in naive animals lead to the formation of novel synapses that facilitate the emergence of further seizures. This negative, vicious cycle illustrates the central role of reactive plasticity in neurological disorders.

Low concentrations of ethanol do not affect radioligand binding to the delta-subunit-containing GABAA receptors in the rat brain.

PubMed

Mehta, Ashok K; Marutha Ravindran, C R; Ticku, Maharaj K

2007-08-24

In the present study, we investigated the co-localization pattern of the delta subunit with other subunits of GABA(A) receptors in the rat brain using immunoprecipitation and Western blotting techniques. Furthermore, we investigated whether low concentrations of ethanol affect the delta-subunit-containing GABA(A) receptor assemblies in the rat brain using radioligand binding to the rat brain membrane homogenates as well as to the immunoprecipitated receptor assemblies. Our results revealed that delta subunit is not co-localized with gamma(2) subunit but it is associated with the alpha(1), alpha(4) or alpha(6), beta(2) and/or beta(3) subunit(s) of GABA(A) receptors in the rat brain. Ethanol (1-50 mM) neither affected [(3)H]muscimol (3 nM) binding nor diazepam-insensitive [(3)H]Ro 15-4513 (2 nM) binding in the rat cerebellum and cerebral cortex membranes. However, a higher concentration of ethanol (500 mM) inhibited the binding of these radioligands to the GABA(A) receptors partially in the rat cerebellum and cerebral cortex. Similarly, ethanol (up to 50 mM) did not affect [(3)H]muscimol (15 nM) binding to the immunoprecipitated delta-subunit-containing GABA(A) receptor assemblies in the rat cerebellum and hippocampus but it inhibited the binding partially at a higher concentration (500 mM). These results suggest that the native delta-subunit-containing GABA(A) receptors do not play a major role in the pharmacology of clinically relevant low concentrations of ethanol.

Neuroprotective effect against axonal damage-induced retinal ganglion cell death in apolipoprotein E-deficient mice through the suppression of kainate receptor signaling.

PubMed

Omodaka, Kazuko; Nishiguchi, Koji M; Yasuda, Masayuki; Tanaka, Yuji; Sato, Kota; Nakamura, Orie; Maruyama, Kazuichi; Nakazawa, Toru

2014-10-24

Apolipoprotein E (ApoE) plays important roles in the body, including a carrier of cholesterols, an anti-oxidant, and a ligand for the low-density lipoprotein receptors. In the nervous system, the presence of ApoE4 isoforms is associated with Alzheimer's disease. ApoE gene polymorphisms are also associated with glaucoma, but the function of ApoE in the retina remains unclear. In this study, we investigated the role of ApoE in axonal damage-induced RGC death. ApoE was detected in the astrocytes and Müller cells in the wild-type (WT) retina. RGC damage was induced in adult ApoE-deficient mice (male, 10-12 weeks old) through ocular hypertension (OH), optic nerve crush (NC), or by administering kainic acid (KA) intravitreally. The WT mice were treated with a glutamate receptor antagonist (MK801 or CNQX) 30 min before performing NC or left untreated. Seven days later, the retinas were flat mounted and Fluorogold-labeled RGCs were counted. We found that the RGCs in the ApoE-deficient mice were resistant to OH-induced RGC death and optic nerve degeneration 4 weeks after induction. In WT mice, NC effectively induced RGC death (control: 4085±331 cells/mm(2), NC: 1728±170 cells/mm(2)). CNQX, an inhibitor of KA receptors, suppressed this RGC death (3031±246 cells/mm(2)), but MK801, an inhibitor of NMDA receptors, did not (1769±212 cells/mm(2)). This indicated the involvement of KA receptor signaling in NC-induced RGC death. We found that NC- or KA-induced RGC death was significantly less in the ApoE-deficient mice than in the WT mice. These data suggest that the ApoE deficiency had a neuroprotective effect against axonal damage-induced RGC death by suppressing the KA receptor signaling. Copyright © 2014 Elsevier B.V. All rights reserved.

Lipid raft integrity affects GABAA receptor, but not NMDA receptor modulation by psychopharmacological compounds.

PubMed

Nothdurfter, Caroline; Tanasic, Sascha; Di Benedetto, Barbara; Uhr, Manfred; Wagner, Eva-Maria; Gilling, Kate E; Parsons, Chris G; Rein, Theo; Holsboer, Florian; Rupprecht, Rainer; Rammes, Gerhard

2013-07-01

Lipid rafts have been shown to play an important role for G-protein mediated signal transduction and the function of ligand-gated ion channels including their modulation by psychopharmacological compounds. In this study, we investigated the functional significance of the membrane distribution of NMDA and GABAA receptor subunits in relation to the accumulation of the tricyclic antidepressant desipramine (DMI) and the benzodiazepine diazepam (Diaz). In the presence of Triton X-100, which allowed proper separation of the lipid raft marker proteins caveolin-1 and flotillin-1 from the transferrin receptor, all receptor subunits were shifted to the non-raft fractions. In contrast, under detergent-free conditions, NMDA and GABAA receptor subunits were detected both in raft and non-raft fractions. Diaz was enriched in non-raft fractions without Triton X-100 in contrast to DMI, which preferentially accumulated in lipid rafts. Impairment of lipid raft integrity by methyl-β-cyclodextrine (MβCD)-induced cholesterol depletion did not change the inhibitory effect of DMI at the NMDA receptor, whereas it enhanced the potentiating effect of Diaz at the GABAA receptor at non-saturating concentrations of GABA. These results support the hypothesis that the interaction of benzodiazepines with the GABAA receptor likely occurs outside of lipid rafts while the antidepressant DMI acts on ionotropic receptors both within and outside these membrane microdomains.

Distribution of Vesicular Glutamate Transporter 2 and Ionotropic Glutamate Receptors in the Auditory Ganglion and Cochlear Nuclei of Pigeons (Columba livia).

PubMed

Karim, M R; Atoji, Y

2016-02-01

Glutamate is a principal excitatory neurotransmitter in the auditory system. Our previous studies revealed localization of glutamate receptor mRNAs in the pigeon cochlear nuclei, suggesting the existence of glutamatergic input from the auditory nerve to the brainstem. This study demonstrated localization of mRNAs for vesicular glutamate transporter 2 (vGluT2) and ionotropic glutamate receptors (AMPA, kainate and NMDA) in the auditory ganglion (AG) and cochlear nuclei (magnocellular, angular and laminar nuclei). VGluT2 mRNA was intensely expressed in AG and intensely or moderately in the cochlear nuclei. The AG and cochlear nuclei showed intense-to-moderate mRNA signals for GluA2, GluA3, GluA4, GluK4 and GluN1. These results suggest that the pigeon AG neurons receives glutamatergic input from hair cells and in turn projects to the magnocellular and angular nuclei. Glutamate may play a pivotal role in the excitatory synapse transmission in the peripheral auditory pathway of birds. © 2015 Blackwell Verlag GmbH.

Pharmacological characterization of stress-induced hyperthermia in DBA/2 mice using metabotropic and ionotropic glutamate receptor ligands.

PubMed

Rorick-Kehn, Linda M; Hart, John C; McKinzie, David L

2005-12-01

Accumulating evidence suggests that drugs acting on the glutamatergic system may represent promising novel therapeutic targets for the treatment of anxiety disorders. The stress-induced hyperthermia paradigm has been used widely to model some of the physiological symptoms associated with anxiety disorders and has produced results that are predictive of clinical efficacy. We have modified this paradigm to measure the autonomic consequences of stress induced by the fear of predation in mice. To evaluate the efficacy of several classes of metabotropic and ionotropic glutamate receptor ligands, as well as known anxiolytics and psychotropic comparators, in attenuating predatory-stress-induced hyperthermia. Male DBA/2 mice were implanted with radiotelemetric transmitters in the peritoneal cavity to measure stress-related increases in core body temperature, following placement in a novel cage containing soiled rat shavings. Clinically active compounds such as chlordiazepoxide (5-10 mg/kg), alprazolam (0.3-3 mg/kg), and buspirone (10-30 mg/kg) exhibited an anxiolytic profile. Assessment of glutamatergic agents indicated that the mGlu1 receptor antagonist LY456236 (10-30 mg/kg), mGlu5 receptor antagonist MPEP (10-30 mg/kg), mGlu2/3 receptor agonist LY354740 (3-10 mg/kg), mGlu2 receptor potentiator LY566332 (30 and 100 mg/kg), mGlu8 receptor agonist (S)-3,4-dicarboxyphenylglycine (30-60 mg/kg), competitive NMDA receptor antagonist LY235959 (1 mg/kg), AMPA receptor antagonist GYKI-52466 (10-20 mg/kg), and glycine transporter-1 (GlyT-1) inhibitor ALX-5407 (3-10 mg/kg) dose-dependently attenuated stress-induced hyperthermia. The AMPA receptor potentiator LY451646, iGlu5 kainate receptor antagonist LY382884, glycine(B) receptor partial agonist D: -cycloserine, and GlyT-1 inhibitor ORG-24461 were ineffective in this model. Select metabotropic and ionotropic glutamate receptor ligands exhibited an anxiolytic profile, as measured by the attenuation of stress-induced hyperthermia

Excitatory Amino Acids as Transmitters in the Brain

DTIC Science & Technology

1989-04-30

Amino Acids as Transmitters in the Brain 12 PERSONAL AUTHOR(S) Cotman, C.W. 13a TYPE OF REPORT 1i3b TIME OYERED 14. DATE OF REPORT (Ye, Month, Day) 5s...necenearia i dentf by block number) FIEL.D GROUP SBGOP Excitatory receptors, excitatory amino acids , excitotoxicit N-methyl-D-aspartate, kainate...mediated by excitatory amino acids and their receptors. These receptors participate in both standard synaptic transmission as well as higher order

Positive allosteric modulation of mGlu7 receptors by AMN082 affects sleep and wakefulness in the rat.

PubMed

Cavas, María; Scesa, Gianluigi; Navarro, José Francisco

2013-02-01

Evidence indicates that metabotropic glutamate receptors (mGlu) are involved in the regulation of physiological and behavioral processes, and glutamate has been implicated in several pathologies of the Central Nervous System. Pharmacological evidence suggests the therapeutic potential of targeting mGlu7 receptor in a number of pathological conditions; and previous research has shown the involvement of glutamate on sleep and wakefulness regulation. Here, the effects of mGlu7 receptor selective modulation on sleep and wake states are explored. 32 male Wistar rats were implanted with electrodes for recording sleep and wakefulness. N,N'-Bis(diphenylmethyl)-1,2-ethanediamine dihydrochloride (AMN082) (5, 10, and 20mg/kg, i.p.), a potent, selective and systemically active mGlu7 receptor positive allosteric modulator, or vehicle was administered 1 hour after the beginning of the light period. AMN082 (5 and 10mg/kg) significantly increased total time of sleep; and time spent on Slow Wave Sleep (SWS) was increased. AMN082 at 10mg/kg specifically affected Light SWS, increasing time spent on Light SWS. The highest dose of AMN082, 20mg/kg, significantly reduced time spent in Rapid Eye Movement (REM) sleep, decreasing the number of REM sleep episodes and their mean duration. Total time spent awake was increased and mean episode duration of wakefulness was prolonged. The present results suggest that mGlu7 receptors might be involved in sleep regulation and drugs targeting these receptors could affect sleep and wakefulness architecture. Copyright © 2012 Elsevier Inc. All rights reserved.

Modification of caffeine effects on the affect-modulated startle by neuropeptide S receptor gene variation.

PubMed

Domschke, Katharina; Klauke, Benedikt; Winter, Bernward; Gajewska, Agnes; Herrmann, Martin J; Warrings, Bodo; Mühlberger, Andreas; Wosnitza, Katherina; Dlugos, Andrea; Naunin, Swantje; Nienhaus, Kathrin; Fobker, Manfred; Jacob, Christian; Arolt, Volker; Pauli, Paul; Reif, Andreas; Zwanzger, Peter; Deckert, Jürgen

2012-08-01

Both the neuropeptide S (NPS) system and antagonism at the adenosine A2A receptor (e.g., by caffeine) were found to play a crucial role in the mediation of arousal and anxiety/panic in animal and human studies. Furthermore, a complex interaction of the neuropeptide S and the adenosinergic system has been suggested with administration of the adenosine A2A receptor antagonist caffeine downregulating NPS levels (Lage et al., 2006) and attenuating the stimulatory effects of NPS in rodents (Boeck et al., 2010). Thus, in the present study, the impact of the functional neuropeptide S receptor (NPSR) A/T (Asn(107)Ile; rs324981) variant on affect-modulated (neutral, unpleasant, and pleasant IAPS pictures) startle response depending on the administration of 300 mg caffeine citrate was investigated in a sample of 124 (m = 58, f = 66) healthy probands using a double-blind, placebo-controlled design. ANOVA revealed a significant interaction between NPSR genotype, challenge condition, and picture valence. Comparing startle magnitudes upon stimulation with neutral or emotional pictures between the placebo and caffeine condition, in AA/AT non-risk genotype carriers no significant difference was discerned, while TT risk genotype carriers showed a significantly increased startle magnitude in response to neutral stimuli (p = .02) and a significantly decreased startle magnitude in response to unpleasant stimuli (p = .02) in the caffeine condition as compared to the placebo condition. In summary, the present findings - extending previous evidence from rodent studies - for the first time provide support for a complex, non-linear interaction of the neuropeptide S and adenosinergic systems affecting the affect-modulated startle response as an intermediate phenotype of anxiety in humans.

Transient protective effect of B-vitamins in experimental epilepsy in the mouse brain.

PubMed

Rabie, Tamer; Mühlhofer, Wolfgang; Bruckner, Thomas; Schwab, Anna; Bauer, Alexander T; Zimmermann, Manfred; Bonke, Dieter; Marti, Hugo H; Schenkel, Johannes

2010-05-01

The regulation of programmed cell death in the nervous system of vertebrates is a complex mechanism aimed to remove superfluous or damaged cells. Epileptic seizures can lead to an activation of pathways resulting in neuronal cell death. B-vitamins might have a neuroprotective potential reducing cell death following appropriate stimulation. Here, the role of the B-vitamins B(1) (thiamine), B(6) (pyridoxine), and B(12) (cobalamine) was investigated in a mouse model of experimental epilepsy induced by kainate. B-vitamin pre-treated animals showed a significantly reduced epileptic score during the first 15 min after kainate injection. The molecular response to kainate showed a bi-phased time course with early induction of Bcl-2 expression within 12 h and a second induction after 7 days of kainate exposure. B-vitamin pre-treatment resulted in significant higher Bcl-2 expression in control animals (no kainate) and at 12 h within the early phase. Bcl-2 expression was not affected by B-vitamins within the second phase. BAX expression was not significantly influenced during the whole experiment. Three days after kainate stimulation, the number of TdT-mediated dUTP-biotin nick end labeling-positive cells in the hippocampal region was lower in B-vitamin-treated animals. Therefore, B-vitamin pre-treatment may attenuate the response to epileptic stimulation.

Dexamethasone upregulates ANP C-receptor protein in human mesangial cells without affecting mRNA.

PubMed

Ardaillou, N; Blaise, V; Placier, S; Amestoy, F; Ardaillou, R

1996-03-01

The objective of this study was to examine the role of dexamethasone on the expression of natriuretic peptide B-type and C-type receptors (ANPR-B and ANPR-C) in cultured human mesangial cells, which only possess these two subtypes. Dexamethasone caused concentration- and time-dependent increases in 125I-labeled ANP binding, which were prevented by glucocorticoid receptor inhibition with RU-38486. A lag time of 24 h and a concentration of dexamethasone of at least 1 nmol/l were necessary for this effect to occur. Dexamethasone-induced upregulation of 125I-ANP binding resulted from increased receptor density. No change in dissociation constant (Kd) was observed. Only ANPR-C were affected by dexamethasone. Indeed, dexamethasone did not modify C-type natriuretic peptide (i.e., CNP)-dependent cGMP production by mesangial cells. Moreover, dexamethasone upregulated ANPR-C protein expression as shown by Western blot analysis and by an increase in ANPR-C immunoreactivity at the cell surface. In contrast, dexamethasone did not modify ANPR-C mRNA expression. In conclusion, glucocorticoids increase ANPR-C density on mesangial cells through a mechanism implying, successively, interaction with the glucocorticoid receptor and increase of ANPR-C protein synthesis at a posttranscriptional stage. Thus dexamethasone may influence availability of natriuretic peptides at their glomerular target sites.

Bidirectional modulation of hippocampal gamma (20-80 Hz) frequency activity in vitro via alpha(α)- and beta(β)-adrenergic receptors (AR).

PubMed

Haggerty, D C; Glykos, V; Adams, N E; Lebeau, F E N

2013-12-03

Noradrenaline (NA) in the hippocampus plays an important role in memory function and has been shown to modulate different forms of synaptic plasticity. Oscillations in the gamma frequency (20-80 Hz) band in the hippocampus have also been proposed to play an important role in memory functions and, evidence from both in vitro and in vivo studies, has suggested this activity can be modulated by NA. However, the role of different NA receptor subtypes in the modulation of gamma frequency activity has not been fully elucidated. We have found that NA (30 μM) exerts a bidirectional control on the magnitude of kainate-evoked (50-200 nM) gamma frequency oscillations in the cornu Ammonis (CA3) region of the rat hippocampus in vitro via activation of different receptor subtypes. Activation of alpha-adrenergic receptors (α-AR) reduced the power of the gamma frequency oscillation. In contrast, activation of beta-adrenergic receptors (β-AR) caused an increase in the power of the gamma frequency oscillations. Using specific agonists and antagonists of AR receptor subtypes we demonstrated that these effects are mediated specifically via α1A-AR and β1-AR subtypes. NA activated both receptor subtypes, but the α1A-AR-mediated effect predominated, resulting in a reversible suppression of gamma frequency activity. These results suggest that NA is able to differentially modulate on-going gamma frequency oscillatory activity that could result in either increased or decreased information flow through the hippocampus. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.

Reproductive Hormones and Their Receptors May Affect Lung Cancer.

PubMed

Dou, Mengmeng; Zhu, Keyan; Fan, Zhirui; Zhang, Yuxuan; Chen, Xiufang; Zhou, Xueliang; Ding, Xianfei; Li, Lifeng; Gu, Zhaosen; Guo, Maofeng; Yan, Ming; Deng, Xiaoming; Shen, Peihong; Wang, Shuling

2017-01-01

78.21±9.37; T: 0.82±0.14 and 1.46±0.16; ratio: 69.62±14.43±29.81 and 52.22±5.42; all P<0.05). The Western blot and IHC results indicated that AR, ERα and ERβ protein expression levels were obviously higher in transplanted tumour and lung tissues from the ovariectomized group, with particular increases in ERβ in transplanted tumour tissue and in ERα in lung tissue. The PCR results also showed markedly higher mRNA expression levels of AR, ERα and ERβ in the ovariectomized group, and in particular, ERβ in transplanted tumour tissue and ERα in lung tissue were significantly increased in the ovariectomized group. Ovariectomy decreased E2 and T serum levels and increased the E2/T ratio in mice, and this imbalance in the internal environment promoted the growth of transplanted tumours. Sex hormone disorder not only promoted transplanted tumour growth but also significantly reduced the protein and mRNA expression levels of sex hormone receptors. The metabolism of E2 and T may affect the growth, proliferation and metabolism of lung cancer cells, and the mechanism by which sex hormones and their receptors influence lung cancer is worthy of further research. © 2017 The Author(s). Published by S. Karger AG, Basel.

Gene expression of ionotropic glutamate receptor subunits in the tectofugal pathway of the pigeon.

PubMed

Atoji, Y

2016-03-01

The tectofugal pathway in birds consists of four stations, the retina, optic tectum, rotundal nucleus, and entopallium, and it conveys visual information via three ascending pathways. These pathways consist of retino-tectal, tecto-rotundal and rotundo-entopallial cells, all of which are glutamatergic. The present study examined the localization of ionotropic glutamate receptors (iGluRs) to identify the target areas of glutamatergic projections in the tectofugal pathway in pigeons. Nine subunits of iGluRs were analyzed using in situ hybridization as follows: AMPA receptors (GluA1, GluA2, GluA3, and GluA4), kainate receptors (GluK1, GluK2, and GluK4), and NMDA receptors (GluN1 and GluN2A). Hybridization signals of subunits showed various intensities in different cells. In the optic tectum, a strong to moderate expression was observed in layer 10 (GluA2, GluA3, GluK4, and GluN1) and layer 13 (GluA2, GluK4, GluN1, and GluN2A). The rotundal nucleus intensely expressed GluA3, GluA4, GluK1, and GluK4. In the entopallium, an intense to moderate expression of GluK1 and GluK4, and a moderate to weak expression of AMPA and NMDA receptors were observed. Furthermore, the parvocellular and magnocellular parts of the isthmic nuclei showed a strong expression of GluA2, GluA3, GluK4, and GluN1. The present findings demonstrate the expression of iGluRs in glutamatergic projection targets of the tectofugal pathway in birds and suggest a diversity of iGluRs in the transmission of visual information. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

The distribution of excitatory amino acid receptors on acutely dissociated dorsal horn neurons from postnatal rats.

PubMed

Arancio, O; Yoshimura, M; Murase, K; MacDermott, A B

1993-01-01

Excitatory amino acid receptor distribution was mapped on acutely dissociated neurons from postnatal rat spinal cord dorsal horn. N-methyl D-aspartate, quisqualate and kainate were applied to multiple locations along the somal and dendritic surfaces of voltage-clamped neurons by means of a pressure application system. To partially compensate for the decrement of response amplitude due to current loss between the site of activation on the dendrite and the recording electrode at the soma, a solution containing 0.15 M KCl was applied on the cell bodies and dendrites of some cells to estimate an empirical length constant. In the majority of the cells tested, the dendritic membrane had regions of higher sensitivity to excitatory amino acid agonists than the somatic membrane, with dendritic response amplitudes reaching more than seven times those at the cell body. A comparison of the relative changes in sensitivity between each combination of two of the three excitatory amino acid agonists along the same dendrite showed different patterns of agonist sensitivity along the dendrite in the majority of the cells. These data were obtained from dorsal horn neurons that had developed and formed synaptic connections in vivo. They demonstrate that in contrast to observations made on ventral horn neurons, receptor density for all the excitatory amino acid receptors on dorsal horn neurons, including the N-methyl-D-aspartate receptor, are generally higher on the dendrites than on the soma. Further, these results are similar to those obtained from dorsal horn neurons grown in culture.

Evidence for a modulatory effect of sulbutiamine on glutamatergic and dopaminergic cortical transmissions in the rat brain.

PubMed

Trovero, F; Gobbi, M; Weil-Fuggaza, J; Besson, M J; Brochet, D; Pirot, S

2000-09-29

Chronic treatment of rats by sulbutiamine induced no change in density of N-methyl-D-aspartate (NMDA) and (+/-)-alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptors in the cingular cortex, but a significant decrease of the kainate binding sites, as measured by quantitative autoradiography. In the same treated animals, an increase of D1 dopaminergic (DA) binding sites was measured both in the prefrontal and the cingular cortex, while no modification of the D2 binding sites was detected. Furthermore, an acute sulbutiamine administration induced a decrease of kainate binding sites but no change of the density of D1 and D2 DA receptors. Acute sulbutiamine injection led to a decrease of the DA levels in the prefrontal cortex and 3,4-dihydroxyphenylacetic acid levels in both the cingular and the prefrontal cortex. These observations are discussed in terms of a modulatory effect of sulbutiamine on both dopaminergic and glutamatergic cortical transmissions.

Cannabidiol and (−)Δ9-tetrahydrocannabinol are neuroprotective antioxidants

PubMed Central

Hampson, A. J.; Grimaldi, M.; Axelrod, J.; Wink, D.

1998-01-01

The neuroprotective actions of cannabidiol and other cannabinoids were examined in rat cortical neuron cultures exposed to toxic levels of the excitatory neurotransmitter glutamate. Glutamate toxicity was reduced by both cannabidiol, a nonpsychoactive constituent of marijuana, and the psychotropic cannabinoid (−)Δ9-tetrahydrocannabinol (THC). Cannabinoids protected equally well against neurotoxicity mediated by N-methyl-d-aspartate receptors, 2-amino-3-(4-butyl-3-hydroxyisoxazol-5-yl)propionic acid receptors, or kainate receptors. N-methyl-d-aspartate receptor-induced toxicity has been shown to be calcium dependent; this study demonstrates that 2-amino-3-(4-butyl-3-hydroxyisoxazol-5-yl)propionic acid/kainate receptor-type neurotoxicity is also calcium-dependent, partly mediated by voltage sensitive calcium channels. The neuroprotection observed with cannabidiol and THC was unaffected by cannabinoid receptor antagonist, indicating it to be cannabinoid receptor independent. Previous studies have shown that glutamate toxicity may be prevented by antioxidants. Cannabidiol, THC and several synthetic cannabinoids all were demonstrated to be antioxidants by cyclic voltametry. Cannabidiol and THC also were shown to prevent hydroperoxide-induced oxidative damage as well as or better than other antioxidants in a chemical (Fenton reaction) system and neuronal cultures. Cannabidiol was more protective against glutamate neurotoxicity than either ascorbate or α-tocopherol, indicating it to be a potent antioxidant. These data also suggest that the naturally occurring, nonpsychotropic cannabinoid, cannabidiol, may be a potentially useful therapeutic agent for the treatment of oxidative neurological disorders such as cerebral ischemia. PMID:9653176

Neuroprotective antioxidants from marijuana.

PubMed

Hampson, A J; Grimaldi, M; Lolic, M; Wink, D; Rosenthal, R; Axelrod, J

2000-01-01

Cannabidiol and other cannabinoids were examined as neuroprotectants in rat cortical neuron cultures exposed to toxic levels of the neurotransmitter, glutamate. The psychotropic cannabinoid receptor agonist delta 9-tetrahydrocannabinol (THC) and cannabidiol, (a non-psychoactive constituent of marijuana), both reduced NMDA, AMPA and kainate receptor mediated neurotoxicities. Neuroprotection was not affected by cannabinoid receptor antagonist, indicating a (cannabinoid) receptor-independent mechanism of action. Glutamate toxicity can be reduced by antioxidants. Using cyclic voltametry and a fenton reaction based system, it was demonstrated that Cannabidiol, THC and other cannabinoids are potent antioxidants. As evidence that cannabinoids can act as an antioxidants in neuronal cultures, cannabidiol was demonstrated to reduce hydroperoxide toxicity in neurons. In a head to head trial of the abilities of various antioxidants to prevent glutamate toxicity, cannabidiol was superior to both alpha-tocopherol and ascorbate in protective capacity. Recent preliminary studies in a rat model of focal cerebral ischemia suggest that cannabidiol may be at least as effective in vivo as seen in these in vitro studies.

μ-Opioid receptor availability in the amygdala is associated with smoking for negative affect relief.

PubMed

Falcone, Mary; Gold, Allison B; Wileyto, E Paul; Ray, Riju; Ruparel, Kosha; Newberg, Andrew; Dubroff, Jacob; Logan, Jean; Zubieta, Jon-Kar; Blendy, Julie A; Lerman, Caryn

2012-08-01

The perception that smoking relieves negative affect contributes to smoking persistence. Endogenous opioid neurotransmission, and the μ-opioid receptor (MOR) in particular, plays a role in affective regulation and is modulated by nicotine. We examined the relationship of MOR binding availability in the amygdala to the motivation to smoke for negative affect relief and to the acute effects of smoking on affective responses. Twenty-two smokers were scanned on two separate occasions after overnight abstinence using [¹¹C]carfentanil positron emission tomography imaging: after smoking a nicotine-containing cigarette and after smoking a denicotinized cigarette. Self-reports of smoking motives were collected at baseline, and measures of positive and negative affect were collected pre- and post- cigarette smoking. Higher MOR availability in the amygdala was associated with motivation to smoke to relieve negative affect. However, MOR availability was unrelated to changes in affect after smoking either cigarette. Increased MOR availability in amygdala may underlie the motivation to smoke for negative affective relief. These results are consistent with previous data highlighting the role of MOR neurotransmission in smoking behavior.

Ipsilateral feeding-specific circuits between the nucleus accumbens shell and the lateral hypothalamus: regulation by glutamate and GABA receptor subtypes.

PubMed

Urstadt, Kevin R; Kally, Peter; Zaidi, Sana F; Stanley, B Glenn

2013-04-01

The nucleus accumbens shell (AcbSh) and the lateral hypothalamus (LH) are both involved in the control of food intake. Activation of GABA(A) receptors or blockade of AMPA and kainate receptors within the AcbSh induces feeding, as does blockade of GABA(A) receptors or activation of NMDA receptors in the LH. Further, evidence suggests that feeding induced via the AcbSh can be suppressed by LH inhibition. However, it is unclear if this suppression is specific to feeding. Adult male Sprague-Dawley rats with 3 intracranial guide cannulas, one unilaterally into the AcbSh and two bilaterally into the LH, were used to explore this issue. DNQX (1.25 μg) or muscimol (100 ng) infused into the AcbSh unilaterally elicited feeding, and this elicited intake was suppressed by bilateral LH injection of d-AP5 (2 μg) or muscimol (25 ng). The effectiveness of d-AP5 or muscimol infusion into either the LH site ipsilateral or contralateral to the AcbSh injection was compared. Ipsilateral LH injection of d-AP5 or muscimol was significantly more effective than contralateral injection in suppressing food intake initiated by AcbSh injection of DNQX or muscimol. These results add to the prior evidence that inhibition of the LH through pharmacological modulation of NMDA or GABA(A) receptors specifically suppresses feeding initiated by AcbSh inhibition, and that these two regions communicate via an ipsilateral circuit to specifically regulate feeding. Copyright © 2012 Elsevier Ltd. All rights reserved.

Serotonin (5-HT) receptor 5A sequence variants affect human plasma triglyceride levels

PubMed Central

Zhang, Y.; Smith, E. M.; Baye, T. M.; Eckert, J. V.; Abraham, L. J.; Moses, E. K.; Kissebah, A. H.; Martin, L. J.

2010-01-01

Neurotransmitters such as serotonin (5-hydroxytryptamine, 5-HT) work closely with leptin and insulin to fine-tune the metabolic and neuroendocrine responses to dietary intake. Losing the sensitivity to excess food intake can lead to obesity, diabetes, and a multitude of behavioral disorders. It is largely unclear how different serotonin receptor subtypes respond to and integrate metabolic signals and which genetic variations in these receptor genes lead to individual differences in susceptibility to metabolic disorders. In an obese cohort of families of Northern European descent (n = 2,209), the serotonin type 5A receptor gene, HTR5A, was identified as a prominent factor affecting plasma levels of triglycerides (TG), supported by our data from both genome-wide linkage and targeted association analyses using 28 publicly available and 12 newly discovered single nucleotide polymorphisms (SNPs), of which 3 were strongly associated with plasma TG levels (P < 0.00125). Bayesian quantitative trait nucleotide (BQTN) analysis identified a putative causal promoter SNP (rs3734967) with substantial posterior probability (P = 0.59). Functional analysis of rs3734967 by electrophoretic mobility shift assay (EMSA) showed distinct binding patterns of the two alleles of this SNP with nuclear proteins from glioma cell lines. In conclusion, sequence variants in HTR5A are strongly associated with high plasma levels of TG in a Northern European population, suggesting a novel role of the serotonin receptor system in humans. This suggests a potential brain-specific regulation of plasma TG levels, possibly by alteration of the expression of HTR5A. PMID:20388841

Effect of intrathecal non-NMDA EAA receptor antagonist LY293558 in rats: a new class of drugs for spinal anesthesia.

PubMed

Von Bergen, Nicholas H; Subieta, Alberto; Brennan, Timothy J

2002-07-01

Excitatory amino acid receptors are important for both sensory and motor function in the spinal cord. We studied the effects of intrathecal LY293558, a competitive non-N-methyl-D-aspartate excitatory amino acid receptor antagonist, on motor and sensory function in rats to determine whether drugs blocking these receptors could potentially be used as alternative agents to local anesthetics for spinal anesthesia. Rats were tested before and 15-240 min after intrathecal injection of 5 nmol (in 10 microl) LY293558. Sensory function was tested at the hind paw using withdrawal response to pin prick and withdrawal to pinch with sharp forceps. Motor performance (ambulation, placing reflex, and Rotorod time), blood pressure, and heart rate were also evaluated. Some tests were repeated the next day. Responses after LY293558 were compared to injection of 40 microl bupivacaine, 0.75%. Pin-prick responses at the forepaw, chest, abdomen, hind leg, and hind paw were also examined after intrathecal LY293558. Intrathecal LY293558 blocked both sensory and motor responses through 180 min; complete recovery was present the following day. No change in blood pressure or heart rate occurred. The effects of LY293558 were more pronounced and sustained than those of bupivacaine. Segmental blockade of the response to pin prick was present after LY293558. Drugs like LY293558 that block alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA)/kainate receptors may be an alternative to local anesthetics for spinal anesthesia in humans.

Involvement of ventral tegmental area ionotropic glutamate receptors in the expression of ethanol-induced conditioned place preference.

PubMed

Pina, Melanie M; Cunningham, Christopher L

2016-10-15

The ventral tegmental area (VTA) is a well-established neural substrate of reward-related processes. Activity within this structure is increased by the primary and conditioned rewarding effects of abused drugs and its engagement is heavily reliant on excitatory input from structures upstream. In the case of drug seeking, it is thought that exposure to drug-associated cues engages glutamatergic VTA afferents that signal directly to dopamine cells, thereby triggering this behavior. It is unclear, however, whether glutamate input to VTA is directly involved in ethanol-associated cue seeking. Here, the role of intra-VTA ionotropic glutamate receptor (iGluR) signaling in ethanol-cue seeking was evaluated in DBA/2J mice using an ethanol conditioned place preference (CPP) procedure. Intra-VTA iGluRs α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPAR)/kainate and N-methyl-d-aspartate (NMDAR) were blocked during ethanol CPP expression by co-infusion of antagonist drugs 6,7-dinitroquinoxaline-2,3-dione (DNQX; AMPA/kainate) and d-(-)-2-Amino-5-phosphonopentanoic acid (AP5; NMDA). Compared to aCSF, bilateral infusion of low (1 DNQX+100 AP5ng/side) and high (5 DNQX+500 AP5ng/side) doses of the AMPAR and NMDAR antagonist cocktail into VTA blocked ethanol CPP expression. This effect was site specific, as DNQX/AP5 infusion proximal to VTA did not significantly impact CPP expression. An increase in activity was found at the high but not low dose of DNQX/AP5. These findings demonstrate that activation of iGluRs within the VTA is necessary for ethanol-associated cue seeking, as measured by CPP. Copyright © 2016 Elsevier B.V. All rights reserved.

Glutamate modulation of GABA transport in retinal horizontal cells of the skate

PubMed Central

Kreitzer, Matthew A; Andersen, Kristen A; Malchow, Robert Paul

2003-01-01

Transport of the amino acid GABA into neurons and glia plays a key role in regulating the effects of GABA in the vertebrate retina. We have examined the modulation of GABA-elicited transport currents of retinal horizontal cells by glutamate, the likely neurotransmitter of vertebrate photoreceptors. Enzymatically isolated external horizontal cells of skate were examined using whole-cell voltage-clamp techniques. GABA (1 mm) elicited an inward current that was completely suppressed by the GABA transport inhibitors tiagabine (10 μm) and SKF89976-A (100 μm), but was unaffected by 100 μm picrotoxin. Prior application of 100 μm glutamate significantly reduced the GABA-elicited current. Glutamate depressed the GABA dose-response curve without shifting the curve laterally or altering the voltage dependence of the current. The ionotropic glutamate receptor agonists kainate and AMPA also reduced the GABA-elicited current, and the effects of glutamate and kainate were abolished by the ionotropic glutamate receptor antagonist 6-cyano-7-nitroquinoxaline. NMDA neither elicited a current nor modified the GABA-induced current, and metabotropic glutamate analogues were also without effect. Inhibition of the GABA-elicited current by glutamate and kainate was reduced when extracellular calcium was removed and when recording pipettes contained high concentrations of the calcium chelator BAPTA. Caffeine (5 mm) and thapsigargin (2 nm), agents known to alter intracellular calcium levels, also reduced the GABA-elicited current, but increases in calcium induced by depolarization alone did not. Our data suggest that glutamate regulates GABA transport in retinal horizontal cells through a calcium-dependent process, and imply a close physical relationship between calcium-permeable glutamate receptors and GABA transporters in these cells. PMID:12562999

Non-neural androgen receptors affect sexual differentiation of brain and behaviour.

PubMed

Monks, D A; Swift-Gallant, A

2018-02-01

Although gonadal testosterone is the principal endocrine factor that promotes masculine traits in mammals, the development of a male phenotype requires local production of both androgenic and oestrogenic signals within target tissues. Much of our knowledge concerning androgenic components of testosterone signalling in sexual differentiation comes from studies of androgen receptor (Ar) loss of function mutants. Here, we review these studies of loss of Ar function and of AR overexpression either globally or selectively in the nervous system of mice. Global and neural mutations affect socio-sexual behaviour and the neuroanatomy of these mice in a sexually differentiated manner. Some masculine traits are affected by both global and neural mutation, indicative of neural mediation, whereas other masculine traits are affected only by global mutation, indicative of an obligatory non-neural androgen target. These results support a model in which multiple sites of androgen action coordinate to produce masculine phenotypes. Furthermore, AR overexpression does not always have a phenotype opposite to that of loss of Ar function mutants, indicative of a nonlinear relationship between androgen dose and masculine phenotype in some cases. Potential mechanisms of Ar gene function in non-neural targets in producing masculine phenotypes are discussed. © 2017 British Society for Neuroendocrinology.

[Glutamate receptors genes polymorphism and the risk of paranoid schizophrenia in Russians and tatars from the Republic of Bashkortostan].

PubMed

Gareeva, A E; Khusnutdinova, E K

2014-01-01

Schizophrenia is a severe mental disorder that affects about 1% of the world population, leading to disability and social exclusion. Glutamatergic neurotransmission is a violation of one of the main hypotheses put forward to explain the neurobiological mechanisms of schizophrenia. Post mortem studies have found changes in the degree of affinity glutamate receptors, their transcription, and altered expression of their subunits in the prefrontal cortex, hippocampus, and thalamus in patients with schizophrenia. As a result of genetic studies of gene family encoding ionotropic AMPA and kainate glutamate receptors in schizophrenia, ambiguous results were received. The association of polymorphic variants of genes GRIA2 and GRIK2 with paranoid schizophrenia and response to therapy with haloperidol in Russian and Tatar of the Republic of Bashkortostan was conducted in the present study. DNA samples of 257 patients with paranoid schizophrenia and of 349 healthy controls of Russian and Tatar ethnic group living in the Republic of Bashkortostan were involved into the present study. In the result of the present study: (1) high risk genetic markers of paranoid schizophrenia (PSZ) were obtained: in Russians-GR4IA2*CCC (OR = 9.60) and in Tatars-GRIK2*ATG (OR = 3.5), GRIK2*TGG (OR = 3.12) (2) The following low risk genetic markers of PSZ were revealed: in Tatars-GRIA2*T/T (rs43025506) of GRIA2 gene (OR = 0.34); in Russians.- GRIA2*CCT (OR = 0.481). (3) Genetic markers of low haloperido! treatment efficacy in respect of negative and positive symptoms GRIK2*T/T (rs2227281) of GRIK2 gene and GRAL42*C/C in Russians, GRIK2*A/A (rs995640) of GRIK2 gene in Tatars. (4) Genetic markers of low haloperidol treatment efficacy in respect of positive symptoms GRL42*C/C in Russians. The results of the present study support the hypothesis of the involvement of glutamate receptor genes in schizophrenia pathway. Considerable inter-ethnic'diversity of genetic risk factors for this disease was

Improvements in the Methodology for Analyzing Receptor Subtypes and Neuronal Populations Affected by Anticholinesterase Exposure.

DTIC Science & Technology

1984-11-14

Slide-mounted tissue sections can be treated with [ H]forskolin (a diterpene plant derivative which is a potent activator of adenylate cyclase) to...protein activities are altered in response to the chronic presence of anticholinesterase agents. Significant progress and improvement has been made in...359 FILE COPY IMPROVEMENTS IN THE METHODOLOGY FOR ANALYZING RECEPTOR SUBTYPES AND NEURONAL POPULATIONS AFFECTED BY ANTICHOLINESTERASE EXPOSURE Annual

Transmitter receptors reveal segregation of the arcopallium/amygdala complex in pigeons (Columba livia).

PubMed

Herold, Christina; Paulitschek, Christina; Palomero-Gallagher, Nicola; Güntürkün, Onur; Zilles, Karl

2018-02-15

At the beginning of the 20th century it was suggested that a complex group of nuclei in the avian posterior ventral telencephalon is comparable to the mammalian amygdala. Subsequent findings, however, revealed that most of these structures share premotor characteristics, while some indeed constitute the avian amygdala. These developments resulted in 2004 in a change of nomenclature of these nuclei, which from then on were named arcopallial or amygdala nuclei and referred to as the arcopallium/amygdala complex. The structural basis for the similarities between avian and mammalian arcopallial and amygdala subregions is poorly understood. Therefore, we analyzed binding site densities for glutamatergic AMPA, NMDA and kainate, GABAergic GABA A , muscarinic M 1 , M 2 and nicotinic acetylcholine (nACh; α 4 β 2 subtype), noradrenergic α 1 and α 2 , serotonergic 5-HT 1A and dopaminergic D 1/5 receptors using quantitative in vitro receptor autoradiography combined with a detailed analysis of the cyto- and myelo-architecture. Our approach supports a segregation of the pigeon's arcopallium/amygdala complex into the following subregions: the arcopallium anterius (AA), the arcopallium ventrale (AV), the arcopallium dorsale (AD), the arcopallium intermedium (AI), the arcopallium mediale (AM), the arcopallium posterius (AP), the nucleus posterioris amygdalopallii pars basalis (PoAb) and pars compacta (PoAc), the nucleus taeniae amgygdalae (TnA) and the area subpallialis amygdalae (SpA). Some of these subregions showed further subnuclei and each region of the arcopallium/amygdala complex are characterized by a distinct multi-receptor density expression. Here we provide a new detailed map of the pigeon's arcopallium/amygdala complex and compare the receptor architecture of the subregions to their possible mammalian counterparts. © 2017 Wiley Periodicals, Inc.

The Sigma Receptor Ligand (+)-Pentazocine Prevents Apoptotic Retinal Ganglion Cell Death induced in vitro by Homocysteine and Glutamate

PubMed Central

Martin, Pamela Moore; Ola, Mohammad S.; Agarwal, Neeraj; Ganapathy, Vadivel; Smith, Sylvia B.

2013-01-01

Recent studies demonstrated that the excitotoxic amino acid homocysteine induces apoptotic death of retinal ganglion cells in vivo. In the present study, an in vitro rat retinal ganglion cell (RGC-5) culture system was used to analyze the toxicity of acute exposure to high levels of homocysteine, the mechanism of homocysteine-induced toxicity and the usefulness of σR1 ligands as neuroprotectants. When cultured RGC-5 cells were subjected to treatment with 1 mM D, L- homocysteine, a significant increase in cell death was detected by TUNEL analysis and analysis of activated caspase. When cells were treated with homocysteine- or glutamate in the presence of MK-801, an antagonist of the NMDA receptor, the cell death was inhibited significantly. In contrast, NBQX, an antagonist of the AMPA/Kainate receptor, and nifedipine, a calcium channel blocker, did not prevent the homocysteine- or glutamate-induced cell death. Semi-quantitative RT-PCR and immunocytochemical analysis demonstrated that RGC-5 cells exposed to homocysteine or glutamate express type 1 sigma receptor at levels similar to control cells. Treatment of RGC-5 cells with 3 µM or 10 µM concentrations of the σR1-specific ligand (+)-pentazocine inhibited significantly the apoptotic cell death induced by homocysteine or glutamate. The results suggest that homocysteine is toxic to ganglion cells in vitro, that the toxicity is mediated via NMDA receptor activation, and that the σR1-specific ligand (+)-pentazocine can block the RGC-5 cell death induced by homocysteine and glutamate. PMID:15046867

A study of the potential neuroprotective effect of riluzole on locomotor networks of the neonatal rat spinal cord in vitro damaged by excitotoxicity.

PubMed

Sámano, C; Nasrabady, S E; Nistri, A

2012-10-11

Excitotoxicity triggered by over-stimulation of glutamatergic receptors is considered to be a major component of damage following acute spinal cord injury (SCI). Using an in vitro model of neonatal rat SCI caused by transient application (1h) of the glutamate agonist kainate (0.05-0.1 mM) to produce limited excitotoxicity, the present study investigated whether riluzole, a drug inhibiting glutamate release and neuronal excitability, could prevent neuronal loss and protect locomotor patterns 24 h later. Immunohistochemical analysis of neuronal and motoneuronal populations was associated with recording of fictive locomotion induced by neurochemicals or dorsal root stimuli. Riluzole (5 μM; 24 h application) per se exerted strong and persistent neurodepressant effects on network synaptic transmission from which recovery was very slow. When continuously applied after kainate, riluzole partially reduced the number of pyknotic cells in the gray matter, although motoneurons remained vulnerable and no fictive locomotion was present. In further experiments, riluzole per se was applied for 3 h (expected to coincide with kainate peak excitotoxicity) and washed out for 24 h with full return of fictive locomotion. When this protocol was implemented after kainate, no efficient histological or functional recovery was observed. No additional benefit was detected even when riluzole was co-applied with kainate and continued for the following 3 h. These results show that modest neuronal losses evoked by excitotoxicity have a severe impact on locomotor network function, and that they cannot be satisfactorily blocked by strong neurodepression with riluzole, suggesting the need for more effective pharmacological approaches. Copyright © 2012 IBRO. Published by Elsevier Ltd. All rights reserved.

Drosophila insulin-producing cells are differentially modulated by serotonin and octopamine receptors and affect social behavior.

PubMed

Luo, Jiangnan; Lushchak, Oleh V; Goergen, Philip; Williams, Michael J; Nässel, Dick R

2014-01-01

A set of 14 insulin-producing cells (IPCs) in the Drosophila brain produces three insulin-like peptides (DILP2, 3 and 5). Activity in IPCs and release of DILPs is nutrient dependent and controlled by multiple factors such as fat body-derived proteins, neurotransmitters, and neuropeptides. Two monoamine receptors, the octopamine receptor OAMB and the serotonin receptor 5-HT1A, are expressed by the IPCs. These receptors may act antagonistically on adenylate cyclase. Here we investigate the action of the two receptors on activity in and output from the IPCs. Knockdown of OAMB by targeted RNAi led to elevated Dilp3 transcript levels in the brain, whereas 5-HT1A knockdown resulted in increases of Dilp2 and 5. OAMB-RNAi in IPCs leads to extended survival of starved flies and increased food intake, whereas 5-HT1A-RNAi produces the opposite phenotypes. However, knockdown of either OAMB or 5-HT1A in IPCs both lead to increased resistance to oxidative stress. In assays of carbohydrate levels we found that 5-HT1A knockdown in IPCs resulted in elevated hemolymph glucose, body glycogen and body trehalose levels, while no effects were seen after OAMB knockdown. We also found that manipulations of the two receptors in IPCs affected male aggressive behavior in different ways and 5-HT1A-RNAi reduced courtship latency. Our observations suggest that activation of 5-HT1A and OAMB signaling in IPCs generates differential effects on Dilp transcription, fly physiology, metabolism and social interactions. However the findings do not support an antagonistic action of the two monoamines and their receptors in this particular system.

The aniracetam metabolite 2-pyrrolidinone induces a long-term enhancement in AMPA receptor responses via a CaMKII pathway.

PubMed

Nishizaki, Tomoyuki; Matsumura, Takuro

2002-01-31

The present study was conducted to assess the effect of aniracetam and its metabolites, such as 2-pyrrolidinone, p-anisic acid, and anisamide butyrate, on the alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors, heteromerically formed of GluR1,2 (GluR1 and GluR2), GluR1,3 (GluR1 and GluR3), and GluR1,2,3 (GluR1, GluR2, and GluR3), expressed in Xenopus oocytes. 2-Pyrrolidinone potentiated kainate-evoked currents through GluR1,2,3 channels in a bell-shaped dose-dependent manner at concentrations ranged from 1 nM to 300 microM, with a maximal effect at 100 microM. The potentiation was long-lasting, reaching approximately 180% of basal levels 60 min after 5-min treatment with 2-pyrrolidinone at 100 microM. 2-Pyrrolidinone (100 microM) potentiated GluR1,3 channel currents as observed in GluR1,2,3, but instead it depressed GluR1,2 currents. Aniracetam and p-anisic acid potentiated GluR1,2,3 channel currents, but to a lesser extent, each about 130 and 103% of basal levels 60 min after treatment at 100 microM. In contrast, anisamide butyrate had no potentiating effect on the currents. Potentiation of GluR1,2,3 channel currents obtained with 2-pyrrolidinone was inhibited by KN-93, a selective inhibitor of calcium/calmodulin-dependent protein kinase (CaMKII), while it was not affected by GF109203X, a selective inhibitor of protein kinase C or H-89, a selective inhibitor of cAMP-dependent protein kinase. The results of the present study suggest that 2-pyrrolidinone persistently enhances activity of the Ca2+-permeable AMPA receptors, GluR1,3 and GluR1,2,3, by interacting with CaMKII.

Cell type-specific in vivo expression of genes encoding signalling molecules in the brain in response to chronic mild stress and chronic treatment with fluoxetine.

PubMed

Dong, Lu; Li, Baoman; Verkhratsky, Alexei; Peng, Liang

2015-08-01

Previously, we reported that chronic treatment with fluoxetine increased gene expression of 5-hydroxytryptamine receptor 2B (5-HT2BR), cytosolic phospholipase 2α (cPLA2α), glutamate receptor, ionotropic kainate 2 (GluK2) and adenosine deaminase acting on RNA 2 (ADAR2), in cultured astrocytes and astrocytes freshly isolated from transgenic mice tagged with an astrocyte-specific marker. In contrast, neurones isolated from transgenic mice tagged with a neurone-specific marker and exposed to fluoxetine showed an increase in gene expression of glutamate receptor, ionotropic kainate 4 (GluK4) and 5-hydroxytryptamine receptor 2C (5-HT2CR). In a mouse model of anhedonia, the downregulation of 5-HT2BR, cPLA2α, ADAR2 and GluK4 but not GluK2 and 5-HT2CR was detected. To investigate the effects of chronic mild stress (CMS) and/or fluoxetine treatment on gene expression of 5-HT2BR, 5-HT2CR, cPLA2α, ADAR2, GluK2 and GluK4 specifically in astrocytes and neurones. Transgenic mice tagged with either astrocyte- or neurone-specific markers were exposed to the CMS. Real-time PCR was applied to determine expression of messenger RNA (mRNA). We found that (i) mRNAs of the 5-HT2BR and cPLA2α in astrocytes and GluK4 in neurones were significantly reduced in mice that became anhedonic; the mRNA levels were restored by fluoxetine treatment; (ii) ADAR2 in astrocytes was decreased by the CMS but showed no response to fluoxetine in anhedonic animals; (iii) neither GluK2 expression in astrocytes nor 5-HT2CR expression in neurones were affected in anhedonic animals, although expression of 5-HT2CR mRNA was upregulated by fluoxetine. Our results indicate that the effects of chronic treatment with fluoxetine are not only dependent on the cell type studied but also on the development of anhedonia. This suggests that fluoxetine may affect major depression (MD) patients and healthy people in a different manner.

The mechanism of action of aniracetam at synaptic alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors: indirect and direct effects on desensitization.

PubMed

Lawrence, J Josh; Brenowitz, Stephan; Trussell, Laurence O

2003-08-01

The mechanism of action of aniracetam on alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors was examined in outside-out patches and at glutamatergic synapses in neurons of the chick cochlear nucleus. A combination of rapid-flow analysis, using glutamate as an agonist, and kinetic modeling indicated that aniracetam slows both the rate of channel closing, and the microscopic rates of desensitization, even for partially liganded receptors. Little effect was observed on the rate of recovery from desensitization or on the response to the weakly desensitizing agonist kainate. Aniracetam's effects on receptor deactivation saturated at lower concentrations than its effects on desensitization, suggesting that cooperativity between homologous binding sites was required to regulate desensitization. Analysis of responses to paired pulses of agonist also indicated that AMPA receptors must desensitize partially even after agonist exposures too brief to permit rebinding. In the presence of aniracetam, evoked excitatory synaptic currents (EPSCs) and miniature EPSCs in low quantal-content conditions had decay times similar to the time course of receptor deactivation. Under these conditions, the time course of both transmitter release and clearance must be <1 to 2 ms. However, in high quantal-content conditions, the evoked EPSC in aniracetam decayed with a time course intermediate between deactivation and desensitization, suggesting that the time course of transmitter clearance is prolonged because of pooling of transmitter in the synaptic cleft. Moreover, by comparing the amounts of paired-pulse synaptic depression and patch desensitization prevented by aniracetam, we conclude that significant desensitization occurs in response to rebinding of transmitter to the AMPA receptors.

5-Hydroxytryptamine1A receptor-activation hyperpolarizes pyramidal cells and suppresses hippocampal gamma oscillations via Kir3 channel activation

PubMed Central

Johnston, April; McBain, Chris J; Fisahn, André

2014-01-01

Rhythmic cortical neuronal oscillations in the gamma frequency band (30–80 Hz, gamma oscillations) have been associated with cognitive processes such as sensory perception and integration, attention, learning, and memory. Gamma oscillations are disrupted in disorders for which cognitive deficits are hallmark symptoms such as schizophrenia and Alzheimer's disease. In vitro, various neurotransmitters have been found to modulate gamma oscillations. Serotonin (5-HT) has long been known to be important for both behavioural and cognitive functions such as learning and memory. Multiple 5-HT receptor subtypes are expressed in the CA3 region of the hippocampus and high doses of 5-HT reduce the power of induced gamma oscillations. Hypothesizing that 5-HT may have cell- and receptor subtype-specific modulatory effects, we investigated the receptor subtypes, cell types and cellular mechanisms engaged by 5-HT in the modulation of gamma oscillations in mice and rats. We found that 5-HT decreases the power of kainate-induced hippocampal gamma oscillations in both species via the 5-HT1A receptor subtype. Whole-cell patch clamp recordings demonstrated that this decrease was caused by a hyperpolarization of CA3 pyramidal cells and a reduction of their firing frequency, but not by alteration of inhibitory neurotransmission. Finally, our results show that the effect on pyramidal cells is mediated via the G protein-coupled receptor inwardly rectifying potassium channel Kir3. Our findings suggest this novel cellular mechanism as a potential target for therapies that are aimed at alleviating cognitive decline by helping the brain to maintain or re-establish normal gamma oscillation levels in neuropsychiatric and neurodegenerative disorders. PMID:25107925

Long-Range Regulatory Polymorphisms Affecting a GABA Receptor Constitute a Quantitative Trait Locus (QTL) for Social Behavior in Caenorhabditis elegans

PubMed Central

Bendesky, Andres; Pitts, Jason; Rockman, Matthew V.; Chen, William C.; Tan, Man-Wah; Kruglyak, Leonid; Bargmann, Cornelia I.

2012-01-01

Aggregation is a social behavior that varies between and within species, providing a model to study the genetic basis of behavioral diversity. In the nematode Caenorhabditis elegans, aggregation is regulated by environmental context and by two neuromodulatory pathways, one dependent on the neuropeptide receptor NPR-1 and one dependent on the TGF-β family protein DAF-7. To gain further insight into the genetic regulation of aggregation, we characterize natural variation underlying behavioral differences between two wild-type C. elegans strains, N2 and CB4856. Using quantitative genetic techniques, including a survey of chromosome substitution strains and QTL analysis of recombinant inbred lines, we identify three new QTLs affecting aggregation in addition to the two known N2 mutations in npr-1 and glb-5. Fine-mapping with near-isogenic lines localized one QTL, accounting for 5%–8% of the behavioral variance between N2 and CB4856, 3′ to the transcript of the GABA neurotransmitter receptor gene exp-1. Quantitative complementation tests demonstrated that this QTL affects exp-1, identifying exp-1 and GABA signaling as new regulators of aggregation. exp-1 interacts genetically with the daf-7 TGF-β pathway, which integrates food availability and population density, and exp-1 mutations affect the level of daf-7 expression. Our results add to growing evidence that genetic variation affecting neurotransmitter receptor genes is a source of natural behavioral variation. PMID:23284308

Inhibition of non-NMDA ionotropic glutamate receptors delays the retinal degeneration in rd10 mouse.

PubMed

Xiang, Zongqin; Bao, Yiqin; Zhang, Jia; Liu, Chao; Xu, Di; Liu, Feng; Chen, Hui; He, Liumin; Ramakrishna, Seeram; Zhang, Zaijun; Vardi, Noga; Xu, Ying

2018-06-22

Retinitis pigmentosa (RP) is a hereditary blinding disease characterized by neurodegeneration of photoreceptors. Retinal ganglion cells (RGCs) in animal models of RP exhibit an abnormally high spontaneous activity that interferes with signal processing. Blocking AMPA/Kainate receptors by bath application of CNQX decreases the spontaneous firing, suggesting that inhibiting these receptors in vivo may help maintain the function of inner retinal neurons in rd10 mice experiencing photoreceptor degeneration. To test this, rd10 mice were i.p. injected with CNQX or GYKI 52466 (an AMPA receptor antagonist) for 1-2 weeks, and examined for their retinal morphology (by immunocytochemistry), function (by MEA recordings) and visual behaviors (using a black/white box). Our data show that iGluRs were up-regulated in the inner plexiform layer (IPL) of rd10 retinas. Application of CNQX at low doses both in vitro and in vivo, attenuated the abnormal spontaneous spiking in RGCs, and increased the light-evoked response of ON RGCs, whereas GYKI 52466 had little effect. CNQX application also improved the behavioral performance. Interestingly, in vivo administration of CNQX delayed photoreceptor degeneration, evidenced by the increased cell number and restored structure. CNQX also improved the structure of bipolar cells. Together, we demonstrated that during photoreceptor degeneration, blockade of the non-NMDA iGluRs decelerates the progression of RGCs dysfunction, possibly by dual mechanisms including slowing photoreceptor degeneration and modulating signal processing within the IPL. Accordingly, this strategy may effectively extend the time window for treating RP. Copyright © 2018. Published by Elsevier Ltd.

Can correlations among receptors affect the information about the stimulus?

NASA Astrophysics Data System (ADS)

Singh, Vijay; Tchernookov, Martin; Nemenman, Ilya

2014-03-01

In the context of neural information processing, it has been observed that, compared to the case of independent receptors, correlated receptors can often carry more information about the stimulus. We explore similar ideas in the context of molecular information processing, analyzing a cell with receptors whose activity is intrinsically negatively correlated because they compete for the same ligand molecules. We show analytically that, in case the involved biochemical interactions are linear, the information between the number of molecules captured by the receptors and the ligand concentration does not depend on correlations among the receptors. For a nonlinear kinetic network, correlations similarly do not change the amount of information for observation times much shorter or much longer than the characteristic time scale of ligand molecule binding and unbinding. However, at intermediate times, correlations can increase the amount of available information. This work has been supported by the James S McDonnell foundation.

Undifferentiated embryonic stem cells express ionotropic glutamate receptor mRNAs

PubMed Central

Pachernegg, Svenja; Joshi, Illah; Muth-Köhne, Elke; Pahl, Steffen; Münster, Yvonne; Terhag, Jan; Karus, Michael; Werner, Markus; Ma-Högemeier, Zhan-Lu; Körber, Christoph; Grunwald, Thomas; Faissner, Andreas; Wiese, Stefan; Hollmann, Michael

2013-01-01

Ionotropic glutamate receptors (iGluRs) do not only mediate the majority of excitatory neurotransmission in the vertebrate CNS, but also modulate pre- and postnatal neurogenesis. Most of the studies on the developmental role of iGluRs are performed on neural progenitors and neural stem cells (NSCs). We took a step back in our study by examining the role of iGluRs in the earliest possible cell type, embryonic stem cells (ESCs), by looking at the mRNA expression of the major iGluR subfamilies in undifferentiated mouse ESCs. For that, we used two distinct murine ES cell lines, 46C ESCs and J1 ESCs. Regarding 46C ESCs, we found transcripts of kainate receptors (KARs) (GluK2 to GluK5), AMPA receptors (AMPARs) (GluA1, GluA3, and GluA4), and NMDA receptors (NMDARs) (GluN1, and GluN2A to GluN2D). Analysis of 46C-derived cells of later developmental stages, namely neuroepithelial precursor cells (NEPs) and NSCs, revealed that the mRNA expression of KARs is significantly upregulated in NEPs and, subsequently, downregulated in NSCs. However, we could not detect any protein expression of any of the KAR subunits present on the mRNA level either in ESCs, NEPs, or NSCs. Regarding AMPARs and NMDARs, GluN2A is weakly expressed at the protein level only in NSCs. Matching our findings for iGluRs, all three cell types were found to weakly express pre- and postsynaptic markers of glutamatergic synapses only at the mRNA level. Finally, we performed patch-clamp recordings of 46C ESCs and could not detect any current upon iGluR agonist application. Similar to 46C ESCs, J1 ESCs express KARs (GluK2 to GluK5), AMPARs (GluA3), and NMDARs (GluN1, and GluN2A to GluN2D) at the mRNA level, but these transcripts are not translated into receptor proteins either. Thus, we conclude that ESCs do not contain functional iGluRs, although they do express an almost complete set of iGluR subunit mRNAs. PMID:24348335

Long-Term Treatment with Losartan Attenuates Seizure Activity and Neuronal Damage Without Affecting Behavioral Changes in a Model of Co-morbid Hypertension and Epilepsy.

PubMed

Tchekalarova, Jana D; Ivanova, Natasha; Atanasova, Dimitrina; Pechlivanova, Daniela M; Lazarov, Nikolai; Kortenska, Lidia; Mitreva, Rumiana; Lozanov, Valentin; Stoynev, Alexander

2016-08-01

Over the last 10 years, accumulated experimental and clinical evidence has supported the idea that AT1 receptor subtype is involved in epilepsy. Recently, we have shown that the selective AT1 receptor antagonist losartan attenuates epileptogenesis and exerts neuroprotection in the CA1 area of the hippocampus in epileptic Wistar rats. This study aimed to verify the efficacy of long-term treatment with losartan (10 mg/kg) after kainate-induced status epilepticus (SE) on seizure activity, behavioral and biochemical changes, and neuronal damage in a model of co-morbid hypertension and epilepsy. Spontaneous seizures were video- and EEG-monitored in spontaneously hypertensive rats (SHRs) for a 16-week period after SE. The behavior was analyzed by open field, elevated plus maze, sugar preference test, and forced swim test. The levels of serotonin in the hippocampus and neuronal loss were estimated by HPLC and hematoxylin and eosin staining, respectively. The AT1 receptor antagonism delayed the onset of seizures and alleviated their frequency and duration during and after discontinuation of treatment. Losartan showed neuroprotection mostly in the CA3 area of the hippocampus and the septo-temporal hilus of the dentate gyrus in SHRs. However, the AT1 receptor antagonist did not exert a substantial influence on concomitant with epilepsy behavioral changes and decreased 5-HT levels in the hippocampus. Our results suggest that the antihypertensive therapy with an AT1 receptor blocker might be effective against seizure activity and neuronal damage in a co-morbid hypertension and epilepsy.

Inquiries into the Biological Significance of Transmembrane AMPA Receptor Regulatory Protein (TARP) γ-8 Through Investigations of TARP γ-8 Null Mice§.

PubMed

Gleason, Scott D; Kato, Akihiko; Bui, Hai H; Thompson, Linda K; Valli, Sabrina N; Stutz, Patrick V; Kuo, Ming-Shang; Falcone, Julie F; Anderson, Wesley H; Li, Xia; Witkin, Jeffrey M

2015-01-01

affected by deletion of the γ-8 protein. Of a large panel of plasma lipids, only two monoacylglycerols (1OG and 2OG) were marginally but nonsignificantly altered in WT vs KO mice. Overall, the data suggest genetic inactivation of this specific population of AMPA receptors results in modest changes in behavior characterized by a mild hyperactivity which is condition dependent and a marked reduction in digging and burying behaviors. Despite deletion of TARP γ-8, chemoconvulsants were still active. Consistent with their predicted pharmacological actions, the convulsant effects of kainate and the antidepressant-like effects of an AMPA receptor potentiator (both acting upon AMPA receptors) were reduced or absent in KO mice.

Functional Implications of Limited Leptin Receptor and Ghrelin Receptor Coexpression in the Brain

PubMed Central

Perello, Mario; Scott, Michael M.; Sakata, Ichiro; Lee, Charlotte E.; Chuang, Jen-Chieh; Osborne-Lawrence, Sherri; Rovinsky, Sherry A.; Elmquist, Joel K.; Zigman, Jeffrey M.

2012-01-01

The hormones leptin and ghrelin act in apposition to one another in the regulation of body weight homeostasis. Interestingly, both leptin receptor expression and ghrelin receptor expression have been observed within many of the same nuclei of the central nervous system (CNS), suggesting that these hormones may act on a common population of neurons to produce changes in food intake and energy expenditure. In the present study we explored the extent of this putative direct leptin and ghrelin interaction in the CNS and addressed the question of whether a loss of ghrelin signaling would affect sensitivity to leptin. Using histological mapping of leptin receptor and ghrelin receptor expression, we found that cells containing both leptin receptors and ghrelin receptors are mainly located in the medial part of the hypothalamic arcuate nucleus. In contrast, coexpression was much less extensive elsewhere in the brain. To assess the functional consequences of this observed receptor distribution, we explored the effect of ghrelin receptor deletion on leptin sensitivity. In particular, the responses of ad libitum-fed, diet-induced obese and fasted mice to the anorectic actions of leptin were examined. Surprisingly, we found that deletion of the ghrelin receptor did not affect the sensitivity to exogenously administrated leptin. Thus, we conclude that ghrelin and leptin act largely on distinct neuronal populations and that ghrelin receptor deficiency does not affect sensitivity to the anorexigenic and body weight-lowering actions of leptin. PMID:21674492

Functional implications of limited leptin receptor and ghrelin receptor coexpression in the brain.

PubMed

Perello, Mario; Scott, Michael M; Sakata, Ichiro; Lee, Charlotte E; Chuang, Jen-Chieh; Osborne-Lawrence, Sherri; Rovinsky, Sherry A; Elmquist, Joel K; Zigman, Jeffrey M

2012-02-01

The hormones leptin and ghrelin act in apposition to one another in the regulation of body weight homeostasis. Interestingly, both leptin receptor expression and ghrelin receptor expression have been observed within many of the same nuclei of the central nervous system (CNS), suggesting that these hormones may act on a common population of neurons to produce changes in food intake and energy expenditure. In the present study we explored the extent of this putative direct leptin and ghrelin interaction in the CNS and addressed the question of whether a loss of ghrelin signaling would affect sensitivity to leptin. Using histological mapping of leptin receptor and ghrelin receptor expression, we found that cells containing both leptin receptors and ghrelin receptors are mainly located in the medial part of the hypothalamic arcuate nucleus. In contrast, coexpression was much less extensive elsewhere in the brain. To assess the functional consequences of this observed receptor distribution, we explored the effect of ghrelin receptor deletion on leptin sensitivity. In particular, the responses of ad libitum-fed, diet-induced obese and fasted mice to the anorectic actions of leptin were examined. Surprisingly, we found that deletion of the ghrelin receptor did not affect the sensitivity to exogenously administrated leptin. Thus, we conclude that ghrelin and leptin act largely on distinct neuronal populations and that ghrelin receptor deficiency does not affect sensitivity to the anorexigenic and body weight-lowering actions of leptin. Copyright © 2011 Wiley-Liss, Inc.

Lateral septum growth hormone secretagogue receptor affects food intake and motivation for sucrose reinforcement.

PubMed

Terrill, Sarah J; Wall, Kaylee D; Medina, Nelson D; Maske, Calyn B; Williams, Diana L

2018-03-28

The hormone ghrelin promotes eating and is widely considered to be a hunger signal. Ghrelin receptors, growth hormone secretagogue receptors (GHSRs), are found in a number of specific regions throughout the brain, including the lateral septum (LS), an area not traditionally associated with the control of feeding. Here we investigated whether GHSRs in the LS play a role in the control of food intake. We examined the feeding effects of ghrelin and the GHSR antagonists ([D-Lys3]-GHRP-6 and JMV 2959), at doses subthreshold for effect when delivered to the lateral ventricle. Intra-LS ghrelin significantly increased chow intake during the mid-light phase, suggesting that pharmacologic activation of LS GHSRs promotes feeding. Conversely, GHSR antagonist delivered to the LS shortly before dark onset significantly reduced chow intake. These data support the hypothesis that exogenous and endogenous stimulation of GHSRs in the LS influence feeding. Ghrelin is known to affect motivation for food, and the dorsal subdivision of LS (dLS) has been shown to play a role in motivation. Thus, we investigated the role of dLS GHSRs in motivation for food reward by examining operant responding for sucrose on a progressive ratio (PR) schedule. Intra-dLS ghrelin increased PR responding for sucrose, while blockade of LS GHSRs did not affect responding in either a fed or fasted state. Together these findings for the first time substantiate the LS as a site of action for ghrelin signaling in the control of food intake.

Modest long-term ethanol consumption affects expression of neurotransmitter receptor genes in the rat nucleus accumbens.

PubMed

Jonsson, Susanne; Ericson, Mia; Söderpalm, Bo

2014-03-01

Over 100 million people worldwide are affected by alcohol use disorders. These conditions usually take years to develop where an initial, voluntary consumption is gradually replaced by a compulsive intake of alcohol. The exact mechanisms behind this transition remain unknown. However, ethanol (EtOH) is known to interact with several neurotransmitters and receptors in the central nervous system, and chronic EtOH consumption causes alterations in these neurotransmitter systems, proposed to contribute to the development of dependence. This study aimed to repeat previous findings that animals after long-term voluntary EtOH consumption spontaneously increase their intake. That the initial encounter with EtOH causes an elevation of dopamine in the nucleus accumbens (nAc), inducing feelings of well-being and creating an incentive to continue the behavior, has been repeatedly reported in both animals and humans. The effects of chronic EtOH consumption on this region are not as well investigated. We examined both long-term EtOH consumption behavior and its consequences on expression of neurotransmitter-related genes in the nAc of the Wistar rat using quantitative polymerase chain reaction. In general, the EtOH consumption of the animals in this study was modest with an average intake of 0.9 g/kg/d, and only 1 of the 24 rats consuming EtOH for 10 months drastically increased its intake in line with the results of Wolffgramm and Heyne (1995). Expression of the genes for dopamine receptor 2, μ-opioid receptor, and somatostatin receptor 4 were down-regulated in animals after 2 and/or 4, but not 10, months of EtOH consumption. Chronic consumption even of modest amounts of alcohol seems to affect regulation of expression of these genes, possibly leading to changes in neurotransmitter signaling. Studies are ongoing to investigate whether these alterations are specific for the nAc. Copyright © 2013 by the Research Society on Alcoholism.

Multireceptor fingerprints in progressive supranuclear palsy.

PubMed

Chiu, Wang Zheng; Donker Kaat, Laura; Boon, Agnita J W; Kamphorst, Wouter; Schleicher, Axel; Zilles, Karl; van Swieten, John C; Palomero-Gallagher, Nicola

2017-04-17

Progressive supranuclear palsy (PSP) with a frontal presentation, characterized by cognitive deficits and behavioral changes, has been recognized as an early clinical picture, distinct from the classical so-called Richardson and parkinsonism presentations. The midcingulate cortex is associated with executive and attention tasks and has consistently been found to be impaired in imaging studies of patients with PSP. The aim of the present study was to determine alterations in neurotransmission underlying the pathophysiology of PSP, as well as their significance for clinically identifiable PSP subgroups. In vitro receptor autoradiography was used to quantify densities of 20 different receptors in the caudate nucleus and midcingulate area 24' of patients with PSP (n = 16) and age- and sex-matched control subjects (n = 14). Densities of γ-aminobutyric acid type B, peripheral benzodiazepine, serotonin receptor type 2, and N-methyl-D-aspartate receptors were significantly higher in area 24' of patients with PSP, where tau impairment was stronger than in the caudate nucleus. Kainate and nicotinic cholinergic receptor densities were significantly lower, and adenosine receptor type 1 (A 1 ) receptors significantly higher, in the caudate nucleus of patients with PSP. Receptor fingerprints also segregated PSP subgroups when clinical parameters such as occurrence of frontal presentation and tau pathology severity were taken into consideration. We demonstrate, for the first time to our knowledge, that kainate and A 1 receptors are altered in PSP and that clinically identifiable PSP subgroups differ at the neurochemical level. Numerous receptors were altered in the midcingulate cortex, further suggesting that it may prove to be a key region in PSP. Finally, we add to the evidence that nondopaminergic systems play a role in the pathophysiology of PSP, thus highlighting potential novel treatment strategies.

SELF ADMINISTRATION OF OXYCODONE BY ADOLESCENT AND ADULT MICE AFFECTS STRIATAL NEUROTRANSMITTER RECEPTOR GENE EXPRESSION

PubMed Central

Mayer-Blackwell, B.; Schlussman, S. D.; Butelman, E. R.; Ho, A.; Ott, J.; Kreek, M. J.; Zhang, Y.

2014-01-01

Illicit use of prescription opioid analgesics (e.g., oxycodone) in adolescence is a pressing public health issue. Our goal was to determine whether oxycodone self administration differentially affects striatal neurotransmitter receptor gene expression in the dorsal striatum of adolescent compared to adult C57BL/6J mice. Groups of adolescent mice (4 weeks old, n= 12) and of adult mice (11 weeks old, n= 11) underwent surgery during which a catheter was implanted into their jugular veins. After recovering from surgery, mice self administered oxycodone (0.25 mg/kg/infusion) 2 h/day for 14 consecutive days or served as yoked saline controls. Mice were sacrificed within 1 h after the last self-administration session and the dorsal striatum was isolated for mRNA analysis. Gene expression was analyzed with real time PCR using a commercially available neurotransmitter receptor PCR array containing 84 genes. We found that adolescent mice self administered less oxycodone than adult mice over the 14 days. Monoamine oxidase A (Maoa) and neuropeptide Y receptor 5 mRNA levels were lower in adolescent mice than in adult mice without oxycodone exposure. Oxycodone self administration increased Maoa mRNA levels compared to controls in both age groups. There was a positive correlation of the amount of oxycodone self administered in the last session or across 14 sessions with Maoa mRNA levels. Gastrin-releasing peptide receptor mRNA showed a significant Drug × Age interaction, with point-wise significance. More genes in the dorsal striatum of adolescents (19) changed in response to oxycodone self administration compared to controls than in adult (4) mice. Overall, this study demonstrates that repeated oxycodone self administration alters neurotransmitter receptors gene expression in the dorsal striatum of adolescent and adult mice. PMID:24220688

Chemoenzymatic synthesis of new 2,4-syn-functionalized (S)-glutamate analogues and structure-activity relationship studies at ionotropic glutamate receptors and excitatory amino acid transporters.

PubMed

Assaf, Zeinab; Larsen, Anja P; Venskutonytė, Raminta; Han, Liwei; Abrahamsen, Bjarke; Nielsen, Birgitte; Gajhede, Michael; Kastrup, Jette S; Jensen, Anders A; Pickering, Darryl S; Frydenvang, Karla; Gefflaut, Thierry; Bunch, Lennart

2013-02-28

In the mammalian central nervous system, (S)-glutamate (Glu) is released from the presynaptic neuron where it activates a plethora of pre- and postsynaptic Glu receptors. The fast acting ionotropic Glu receptors (iGluRs) are ligand gated ion channels and are believed to be involved in a vast number of neurological functions such as memory and learning, synaptic plasticity, and motor function. The synthesis of 14 enantiopure 2,4-syn-Glu analogues 2b-p is accessed by a short and efficient chemoenzymatic approach starting from readily available cyclohexanone 3. Pharmacological characterization at the iGluRs and EAAT1-3 subtypes revealed analogue 2i as a selective GluK1 ligand with low nanomolar affinity. Two X-ray crystal structures of the key analogue 2i in the ligand-binding domain (LBD) of GluA2 and GluK3 were determined. Partial domain closure was seen in the GluA2-LBD complex with 2i comparable to that induced by kainate. In contrast, full domain closure was observed in the GluK3-LBD complex with 2i, similar to that of GluK3-LBD with glutamate bound.

Association between the GABA(A) receptor alpha5 subunit gene locus (GABRA5) and bipolar affective disorder.

PubMed

Papadimitriou, G N; Dikeos, D G; Karadima, G; Avramopoulos, D; Daskalopoulou, E G; Vassilopoulos, D; Stefanis, C N

1998-02-07

Genetic factors seem to play an important role in the pathogenesis of affective disorder. The candidate gene strategies are being used, among others, to identify the genes conferring vulnerability to the disease. The genes coding for the receptors of gamma-aminobutyric acid (GABA) have been proposed as candidates for affective disorder, since the GABA neurotransmitter system has been implicated in the pathogenesis of the illness. We examined the possible genetic association between the GABA(A) receptor alpha5 subunit gene locus (GABRA5) on chromosome 15 and affective disorder, in 48 bipolar patients (BP), 40 unipolar patients (UP), and 50 healthy individuals, age- and sex-matched to the patients. All patients and controls were unrelated Greeks. Diagnoses were made after direct interviews according to the DSM-IV and ICD-10 criteria. For the genotyping, a dinucleotide (CA) repeat marker was used. The polymerase chain reaction (PCR) products found were nine alleles with lengths between 272 and 290 base pairs (bp). The distribution of allelic frequencies of the GABRA5 locus differed significantly between BP patients and controls with the 282-bp allele found to be associated with BP affective disorder, while no such difference was observed between the groups of UP patients and controls nor between the two patient groups. The presence or absence of the 282-bp allele in the genotype of BP patients was not shown to influence the age of onset and the overall clinical severity, but was found to be associated with a preponderance of manic over depressive episodes in the course of the illness.

Changes in CB1 and CB2 receptors in the post-mortem cerebellum of humans affected by spinocerebellar ataxias

PubMed Central

Rodríguez-Cueto, Carmen; Benito, Cristina; Fernández-Ruiz, Javier; Romero, Julián; Hernández-Gálvez, Mariluz; Gómez-Ruiz, María

2014-01-01

Background and PurposeSpinocerebellar ataxias (SCAs) are a family of chronic progressive neurodegenerative diseases, clinically and genetically heterogeneous, characterized by loss of balance and motor coordination due to degeneration of the cerebellum and its afferent and efferent connections. Unlike other motor disorders, the possible role of changes in the endocannabinoid system in the pathogenesis of SCAs has not been investigated. Experimental ApproachThe status of cannabinoid receptor type 1 (CB1) and cannabinoid receptor type 2 (CB2) receptors in the post-mortem cerebellum of SCA patients and controls was investigated using immunohistochemical procedures. Key ResultsImmunoreactivity for the CB1 receptor, and also for the CB2 receptor, was found in the granular layer, Purkinje cells, neurons of the dentate nucleus and areas of white matter in the cerebellum of SCA patients at levels notably higher than controls. Double-labelling procedures demonstrated co-localization of CB1 and, in particular, CB2 receptors with calbindin, supporting the presence of these receptors in Purkinje neurons. Both receptors also co-localized with Iba-1 and glial fibrillary acidic protein in the granular layer and white matter areas, indicating that they are present in microglia and astrocytes respectively. Conclusions and ImplicationsOur results demonstrate that CB1 and CB2 receptor levels are significantly altered in the cerebellum of SCA patients. Their identification in Purkinje neurons, which are the main cells affected in SCAs, as well as the changes they experienced, suggest that alterations in endocannabinoid receptors may be related to the pathogenesis of SCAs. Therefore, the endocannabinoid system could provide potential therapeutic targets for the treatment of SCAs and its progression. Linked ArticlesThis article is part of a themed section on Cannabinoids 2013. To view the other articles in this section visit http://dx.doi.org/10.1111/bph.2014.171.issue-6 PMID:23808969

High fructose-mediated attenuation of insulin receptor signaling does not affect PDGF-induced proliferative signaling in vascular smooth muscle cells.

PubMed

Osman, Islam; Poulose, Ninu; Ganapathy, Vadivel; Segar, Lakshman

2016-11-15

Insulin resistance is associated with accelerated atherosclerosis. Although high fructose is known to induce insulin resistance, it remains unclear as to how fructose regulates insulin receptor signaling and proliferative phenotype in vascular smooth muscle cells (VSMCs), which play a major role in atherosclerosis. Using human aortic VSMCs, we investigated the effects of high fructose treatment on insulin receptor substrate-1 (IRS-1) serine phosphorylation, insulin versus platelet-derived growth factor (PDGF)-induced phosphorylation of Akt, S6 ribosomal protein, and extracellular signal-regulated kinase (ERK), and cell cycle proteins. In comparison with PDGF (a potent mitogen), neither fructose nor insulin enhanced VSMC proliferation and cyclin D1 expression. d-[ 14 C(U)]fructose uptake studies revealed a progressive increase in fructose uptake in a time-dependent manner. Concentration-dependent studies with high fructose (5-25mM) showed marked increases in IRS-1 serine phosphorylation, a key adapter protein in insulin receptor signaling. Accordingly, high fructose treatment led to significant diminutions in insulin-induced phosphorylation of downstream signaling components including Akt and S6. In addition, high fructose significantly diminished insulin-induced ERK phosphorylation. Nevertheless, high fructose did not affect PDGF-induced key proliferative signaling events including phosphorylation of Akt, S6, and ERK and expression of cyclin D1 protein. Together, high fructose dysregulates IRS-1 phosphorylation state and proximal insulin receptor signaling in VSMCs, but does not affect PDGF-induced proliferative signaling. These findings suggest that systemic insulin resistance rather than VSMC-specific dysregulation of insulin receptor signaling by high fructose may play a major role in enhancing atherosclerosis and neointimal hyperplasia. Copyright © 2016 Elsevier B.V. All rights reserved.

Increased Glutamate Receptor and Transporter Expression in the Cerebral Cortex and Striatum of Gcdh -/- Mice: Possible Implications for the Neuropathology of Glutaric Acidemia Type I

PubMed Central

Lagranha, Valeska Lizzi; Matte, Ursula; de Carvalho, Talita Giacomet; Seminotti, Bianca; Pereira, Carolina Coffi; Koeller, David M.; Woontner, Michael; Goodman, Stephen I.; de Souza, Diogo Onofre Gomes; Wajner, Moacir

2014-01-01

We determined mRNA expression of the ionotropic glutamate receptors NMDA (NR1, NR2A and NR2B subunits), AMPA (GluR2 subunit) and kainate (GluR6 subunit), as well as of the glutamate transporters GLAST and GLT1 in cerebral cortex and striatum of wild type (WT) and glutaryl-CoA dehydrogenase deficient (Gchh -/-) mice aged 7, 30 and 60 days. The protein expression levels of some of these membrane proteins were also measured. Overexpression of NR2A and NR2B in striatum and of GluR2 and GluR6 in cerebral cortex was observed in 7-day-old Gcdh -/-. There was also an increase of mRNA expression of all NMDA subunits in cerebral cortex and of NR2A and NR2B in striatum of 30-day-old Gcdh -/- mice. At 60 days of life, all ionotropic receptors were overexpressed in cerebral cortex and striatum of Gcdh -/- mice. Higher expression of GLAST and GLT1 transporters was also verified in cerebral cortex and striatum of Gcdh -/- mice aged 30 and 60 days, whereas at 7 days of life GLAST was overexpressed only in striatum from this mutant mice. Furthermore, high lysine intake induced mRNA overexpression of NR2A, NR2B and GLAST transcripts in striatum, as well as of GluR2 and GluR6 in both striatum and cerebral cortex of Gcdh -/- mice. Finally, we found that the protein expression of NR2A, NR2B, GLT1 and GLAST were significantly greater in cerebral cortex of Gcdh -/- mice, whereas NR2B and GLT1 was similarly enhanced in striatum, implying that these transcripts were translated into their products. These results provide evidence that glutamate receptor and transporter expression is higher in Gcdh -/- mice and that these alterations may be involved in the pathophysiology of GA I and possibly explain, at least in part, the vulnerability of striatum and cerebral cortex to injury in patients affected by GA I. PMID:24594605

Increased glutamate receptor and transporter expression in the cerebral cortex and striatum of gcdh-/- mice: possible implications for the neuropathology of glutaric acidemia type I.

PubMed

Lagranha, Valeska Lizzi; Matte, Ursula; de Carvalho, Talita Giacomet; Seminotti, Bianca; Pereira, Carolina Coffi; Koeller, David M; Woontner, Michael; Goodman, Stephen I; de Souza, Diogo Onofre Gomes; Wajner, Moacir

2014-01-01

We determined mRNA expression of the ionotropic glutamate receptors NMDA (NR1, NR2A and NR2B subunits), AMPA (GluR2 subunit) and kainate (GluR6 subunit), as well as of the glutamate transporters GLAST and GLT1 in cerebral cortex and striatum of wild type (WT) and glutaryl-CoA dehydrogenase deficient (Gchh-/-) mice aged 7, 30 and 60 days. The protein expression levels of some of these membrane proteins were also measured. Overexpression of NR2A and NR2B in striatum and of GluR2 and GluR6 in cerebral cortex was observed in 7-day-old Gcdh-/-. There was also an increase of mRNA expression of all NMDA subunits in cerebral cortex and of NR2A and NR2B in striatum of 30-day-old Gcdh-/- mice. At 60 days of life, all ionotropic receptors were overexpressed in cerebral cortex and striatum of Gcdh-/- mice. Higher expression of GLAST and GLT1 transporters was also verified in cerebral cortex and striatum of Gcdh-/- mice aged 30 and 60 days, whereas at 7 days of life GLAST was overexpressed only in striatum from this mutant mice. Furthermore, high lysine intake induced mRNA overexpression of NR2A, NR2B and GLAST transcripts in striatum, as well as of GluR2 and GluR6 in both striatum and cerebral cortex of Gcdh-/- mice. Finally, we found that the protein expression of NR2A, NR2B, GLT1 and GLAST were significantly greater in cerebral cortex of Gcdh-/- mice, whereas NR2B and GLT1 was similarly enhanced in striatum, implying that these transcripts were translated into their products. These results provide evidence that glutamate receptor and transporter expression is higher in Gcdh-/- mice and that these alterations may be involved in the pathophysiology of GA I and possibly explain, at least in part, the vulnerability of striatum and cerebral cortex to injury in patients affected by GA I.

High preservation of DNA standards diluted in 50% glycerol.

PubMed

Schaudien, Dirk; Baumgärtner, Wolfgang; Herden, Christiane

2007-09-01

Standard curves are important tools in real-time quantitative polymerase chain reaction (PCR) to precisely analyze gene expression patterns under physiologic and pathologic conditions. Handling of DNA standards often implies multiple cycles of freezing and thawing that might affect DNA stability and integrity. This in turn might influence the reliability and reproducibility of quantitative measurements in real-time PCR assays. In this study, 3 DNA standards such as murine tumor necrosis factor (TNF) alpha, interferon (IFN) gamma, and kainat-1 receptor were diluted in 50% glycerol or water after 1, 4, and 16 cycles of freezing and thawing and amplified copy numbers after real-time PCR were compared. The standards diluted in water showed a reduction to 83%, 55%, and 50% after 4 cycles, to 24%, 5%, and 4% after 16 cycles for kainat-1 receptor, TNFalpha, and IFNgamma standards, respectively, when compared with a single cycle of freezing and thawing. Interestingly, all cDNA samples diluted in 50% glycerol were amplified in comparable copy numbers even after 16 cycles of freezing and thawing. The effect of the standards undergoing different cycles of freezing and thawing on sample values was demonstrated by amplifying cDNA obtained from Borna disease virus infected and noninfected TNF-transgenic mice brain. This revealed significant differences of measured cDNA copy numbers using water-diluted DNA standards. In contrast, sample values did not vary using glycerol-diluted standards that were frozen and thawed for 16 times. In conclusion, glycerol storage of DNA standards represents a suitable tool for the accurate and reproducible quantification of cDNA samples in real-time PCR analysis.

S-Glutathionylation of estrogen receptor α affects dendritic cell function.

PubMed

Zhang, Jie; Ye, Zhi-Wei; Chen, Wei; Manevich, Yefim; Mehrotra, Shikhar; Ball, Lauren; Janssen-Heininger, Yvonne; Tew, Kenneth D; Townsend, Danyelle M

2018-03-23

Glutathione S -transferase Pi (GSTP) is a thiolase that catalyzes the addition of glutathione (GSH) to receptive cysteines in target proteins, producing an S -glutathionylated residue. Accordingly, previous studies have reported that S -glutathionylation is constitutively decreased in cells from mice lacking GSTP ( Gstp1 / p2 -/- ). Here, we found that bone marrow-derived dendritic cells (BMDDCs) from Gstp1 / p2 -/- mice have proliferation rates that are greater than those in their WT counterparts ( Gstp1 / p2 +/+ ). Moreover, Gstp1 / p2 -/- BMDDCs had increased reactive oxygen species (ROS) levels and decreased GSH:glutathione disulfide (GSSG) ratios. Estrogen receptor α (ERα) is linked to myeloproliferation and differentiation, and we observed that its steady-state levels are elevated in Gstp1 / p2 -/- BMDDCs, indicating a link between GSTP and ERα activities. BMDDCs differentiated by granulocyte-macrophage colony-stimulating factor had elevated ERα levels, which were more pronounced in Gstp1 / p2 -/- than WT mice. When stimulated with lipopolysaccharide for maturation, Gstp1 / p2 -/- BMDDCs exhibited augmented endocytosis, maturation rate, cytokine secretion, and T-cell activation; heightened glucose uptake and glycolysis; increased Akt signaling (in the mTOR pathway); and decreased AMPK-mediated phosphorylation of proteins. Of note, GSTP formed a complex with ERα, stimulating ERα S -glutathionylation at cysteines 221, 245, 417, and 447; altering ERα's binding affinity for estradiol; and reducing overall binding potential (receptor density and affinity) 3-fold. Moreover, in Gstp1 / p2 -/- BMDDCs, ERα S -glutathionylation was constitutively decreased. Taken together, these findings suggest that GSTP-mediated S -glutathionylation of ERα controls BMDDC differentiation and affects metabolic function in dendritic cells. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Altered sleep and affect in the neurotensin receptor 1 knockout mouse.

PubMed

Fitzpatrick, Karrie; Winrow, Christopher J; Gotter, Anthony L; Millstein, Joshua; Arbuzova, Janna; Brunner, Joseph; Kasarskis, Andrew; Vitaterna, Martha H; Renger, John J; Turek, Fred W

2012-07-01

Sleep and mood disorders have long been understood to have strong genetic components, and there is considerable comorbidity of sleep abnormalities and mood disorders, suggesting the involvement of common genetic pathways. Here, we examine a candidate gene implicated in the regulation of both sleep and affective behavior using a knockout mouse model. Previously, we identified a quantitative trait locus (QTL) for REM sleep amount, REM sleep bout number, and wake amount in a genetically segregating population of mice. Here, we show that traits mapping to this QTL correlated with an expression QTL for neurotensin receptor 1 (Ntsr1), a receptor for neurotensin, a ligand known to be involved in several psychiatric disorders. We examined sleep as well as behaviors indicative of anxiety and depression in the NTSR1 knockout mouse. NTSR1 knockouts had a lower percentage of sleep time spent in REM sleep in the dark phase and a larger diurnal variation in REM sleep duration than wild types under baseline conditions. Following sleep deprivation, NTSR1 knockouts exhibited more wake and less NREM rebound sleep. NTSR1 knockouts also showed increased anxious and despair behaviors. Here we illustrate a link between expression of the Ntsr1 gene and sleep traits previously associated with a particular QTL. We also demonstrate a relationship between Ntsr1 and anxiety and despair behaviors. Given the considerable evidence that anxiety and depression are closely linked with abnormalities in sleep, the data presented here provide further evidence that neurotensin and Ntsr1 may be a component of a pathway involved in both sleep and mood disorders.

Activation of the prelimbic medial prefrontal cortex induces anxiety-like behaviors via N-Methyl-D-aspartate receptor-mediated glutamatergic neurotransmission in mice.

PubMed

Saitoh, Akiyoshi; Ohashi, Masanori; Suzuki, Satoshi; Tsukagoshi, Mai; Sugiyama, Azusa; Yamada, Misa; Oka, Jun-Ichiro; Inagaki, Masatoshi; Yamada, Mitsuhiko

2014-08-01

We investigated the possible roles of the prelimbic medial prefrontal cortex (PL) in the regulation of anxiety-like behaviors by pharmacologically activating the terminals of neuronal inputs or postsynaptic efferent neurons with a sodium channel activator veratrine. The extracellular glutamate levels were measured by in vivo microdialysis, and the behaviors were assessed with the open field (OF) test in mice simultaneously. The samples were collected every 10 min for 60 min, as basal levels of glutamate. The medium containing drugs were perfused for 30 min. The OF test was performed in the last 10 min of drug perfusion. After the drug treatments, the perfusion medium containing drugs was switched back to perfusion medium without drugs, and then samples were collected for another 90 min. The extracellular glutamate levels were significantly elevated after local perfusion of veratrine in the PL. At the same time, perfusion of veratrine in the PL produced anxiety-like behaviors in mice. Local coperfusion of a sodium channel blocker, lamotrigine, completely diminished the veratrine-induced elevated extracellular glutamate levels and the behavioral changes. Local coperfusion of an NMDA receptor antagonist, MK-801, but not a non-NMDA (AMPA/kainate) receptor antagonist, CNQX, completely diminished the behavioral changes without any effects on the veratrine-induced elevated extracellular glutamate levels. This study demonstrates that the activation of the PL with veratrine induces anxiety-like behaviors via NMDA receptor-mediated glutamatergic neurotransmission in mice. © 2014 Wiley Periodicals, Inc.

β-adrenergic receptor inhibition affects cerebral glucose metabolism, motor performance, and inflammatory response after traumatic brain injury.

PubMed

Ley, Eric J; Clond, Morgan A; Bukur, Marko; Park, Ryan; Chervonski, Michael; Dagliyan, Grant; Margulies, Dan R; Lyden, Patrick D; Conti, Peter S; Salim, Ali

2012-07-01

The purpose of this study was to evaluate how β-adrenergic receptor inhibition after traumatic brain injury (TBI) alters changes in early cerebral glucose metabolism and motor performance, as well as cerebral cytokine and heat shock protein (HSP) expression. Mouse cerebral glucose metabolism was measured by microPET fluorodeoxyglucose uptake and converted into standardized uptake values (SUV). Four groups of C57/Bl6 mice (wild type [WT]) were initially evaluated: sham or TBI, followed by tail vein injection of either saline or a nonselective β-adrenergic receptor inhibitor (propranolol, 4 mg/kg). Then motor performance, cerebral cytokine, and HSP70 expression were studied at 12 hours and 24 hours after sham injury or TBI in WT mice treated with saline or propranolol and in β1-adrenergic/β2-adrenergic receptor knockout (BARKO) mice treated with saline. Cerebral glucose metabolism was significantly reduced after TBI (mean SUV TBI, 1.63 vs. sham 1.97, p < 0.01) and propranolol attenuated this reduction (mean SUV propranolol, 1.89 vs. saline 1.63, p < 0.01). Both propranolol and BARKO reduced motor deficits at 24 hours after injury, but only BARKO had an effect at 12 hours after injury. TBI WT mice treated with saline performed worse than propranolol mice at 24 hours after injury on rotarod (23 vs. 44 seconds, p < 0.01) and rearing (130 vs. 338 events, p = 0.01) results. At 24 hours after injury, sham BARKO and TBI BARKO mice were similar on rotarod (21 vs. 19 seconds, p = 0.53), ambulatory testing (2,891 vs. 2,274 events, p = 0.14), and rearing (129 vs. 64 events, p = 0.09) results. Interleukin 1β expression was affected by BARKO and propranolol after TBI; attenuation of interleukin 6 and increased HSP70 expression were noted only with BARKO. β-adrenergic receptor inhibition affects cerebral glucose metabolism, motor performance, as well as cerebral cytokine and HSP expression after TBI.

Pinitol Supplementation Does Not Affect Insulin-Mediated Glucose Metabolism and Muscle Insulin Receptor Content and Phosphorylation in Older Humans12

PubMed Central

Campbell, Wayne W.; Haub, Mark D.; Fluckey, James D.; Ostlund, Richard E.; Thyfault, John P.; Morse-Carrithers, Hannah; Hulver, Matthew W.; Birge, Zonda K.

2008-01-01

This study assessed the effect of oral pinitol supplementation on oral and intravenous glucose tolerances and on skeletal muscle insulin receptor content and phosphorylation in older people. Fifteen people (6 men, 9 women; age 66 ± 8 y; BMI 27.9 ± 3.3 kg/m2; hemoglobin A1c 5.39 ± 0.46%, mean ± SD) completed a 7-wk protocol. Subjects were randomly assigned to groups that during wk 2−7 consumed twice daily either a non-nutritive beverage (Placebo group, n = 8) or the same beverage with 1000 mg pinitol dissolved into it (Pinitol group, n = 7, total dose = 2000 mg pinitol/d). Testing was done at wk 1 and wk 7. In the Pinitol group with supplementation, 24-h urinary pinitol excretion increased 17-fold. The fasting concentrations of glucose, insulin, and C-peptide, and the 180-min area under the curve for these compounds, in response to oral (75 g) and intravenous (300 mg/kg) glucose tolerance challenges, were unchanged from wk 1 to wk 7 and were not influenced by pinitol. Also, pinitol did not affect indices of hepatic and whole-body insulin sensitivity from the oral glucose tolerance test and indices of insulin sensitivity, acute insulin response to glucose, and glucose effectiveness from the intravenous glucose tolerance test, estimated using minimal modeling. Pinitol did not differentially affect total insulin receptor content and insulin receptor phosphotyrosine 1158 and insulin receptor phosphotyrosine 1162/1163 activation in vastus lateralis samples taken during an oral-glucose–induced hyperglycemic and hyperinsulinemic state. These data suggest that pinitol supplementation does not influence whole-body insulin-mediated glucose metabolism and muscle insulin receptor content and phosphorylation in nondiabetic, older people. PMID:15514265

Design, Synthesis, and Structure–Activity Relationship of a Novel Series of GluN2C-Selective Potentiators

PubMed Central

2015-01-01

NMDA receptors are tetrameric complexes composed of GluN1 and GluN2A–D subunits that mediate a slow Ca2+-permeable component of excitatory synaptic transmission. NMDA receptors have been implicated in a wide range of neurological diseases and thus represent an important therapeutic target. We herein describe a novel series of pyrrolidinones that selectively potentiate only NMDA receptors that contain the GluN2C subunit. The most active analogues tested were over 100-fold selective for recombinant GluN2C-containing receptors over GluN2A/B/D-containing NMDA receptors as well as AMPA and kainate receptors. This series represents the first class of allosteric potentiators that are selective for diheteromeric GluN2C-containing NMDA receptors. PMID:24512267

Identification of multi-targeted anti-migraine potential of nystatin and development of its brain targeted chitosan nanoformulation.

PubMed

Girotra, Priti; Thakur, Aman; Kumar, Ajay; Singh, Shailendra Kumar

2017-03-01

The complex pathophysiology involved in migraine necessitates the drug treatment to act on several receptors simultaneously. The present investigation was an attempt to discover the unidentified anti-migraine activity of the already marketed drugs. Shared featured pharmacophore modeling was employed for this purpose on six target receptors (β 2 adrenoceptor, Dopamine D 3 , 5HT 1B , TRPV1, iGluR5 kainate and CGRP), resulting in the generation of five shared featured pharmacophores, which were further subjected to virtual screening of the ligands obtained from Drugbank database. Molecular docking, performed on the obtained hit compounds from virtual screening, indicated nystatin to be the only active lead against the receptors iGluR5 kainate receptor (1VSO), CGRP (3N7R), β 2 adrenoceptor (3NYA) and Dopamine D 3 (3PBL) with a high binding energy of -11.1, -10.9, -10.2 and -12kcal/mole respectively. The anti-migraine activity of nystatin was then adjudged by fabricating its brain targeted chitosan nanoparticles. Its brain targeting efficacy, analyzed qualitatively by confocal laser scanning microscopy, demonstrated a significant amount of drug reaching the brain. The pharmacodynamic models on Swiss male albino mice revealed significant anti-migraine activity of the nanoformulation. The present study reports for the first time the therapeutic potential of nystatin in migraine management, hence opening avenues for its future exploration. Copyright © 2016 Elsevier B.V. All rights reserved.

Progestin treatment does not affect expression of cytokines, steroid receptors, oxytocin receptor, and cyclooxygenase 2 in fetal membranes and endometrium from pony mares at parturition.

PubMed

Palm, F; Walter, I; Nowotny, N; Budik, S; Helmreich, M; Aurich, C

2013-01-01

In most mammalian species, progestins have a major function in maintaining pregnancy. In humans, the physiologic initiation of parturition bears similarities with inflammatory processes and anti-inflammatory effects of progestins have been suggested to postpone birth until term. To examine if comparable effects exist in the horse, mares were treated with the synthetic progestin altrenogest from day 280 of gestation until parturition (N = 5) or were left untreated as controls (N = 7). Tissue from the amnion (AMN), allantochorion (AC), and endometrium (EM) was collected at foaling and mRNA expression of interleukin (IL)-6 and -8, cyclooxygenase 2 (COX2), estrogen receptor (ER) α, progesterone receptor, and oxytocin receptor (OTR) was analyzed. Leukocytes, steroid receptors, COX2, and OTR were also investigated by histology and immunohistochemistry. Expression of mRNA for IL-6 was higher in AMN and EM versus AC (P < 0.01). Expression of IL-8 was higher in AMN than AC and EM (P < 0.001). Steroid receptors and OTR were highly expressed in EM but not in AMN and AC (P < 0.001). Expression of COX2 was most pronounced in AC whereas IL expression was not upregulated in AC. No differences in mRNA expression existed between altrenogest-treated and control animals. Endometrial polymorphonuclear leukocytes were increased in altrenogest-treated mares. Epithelial cells of all tissues, except AC chorionic villi stained progesterone receptor-positive. Staining for ER was more pronounced in the amnion facing epithelium of the AC in altrenogest-treated versus control animals (P < 0.01). In conclusion, COX2 is highly expressed in the AC. The fetal membranes thus might play a role in the onset of labor in the horse. Altrenogest did not affect gene expression in the AMN, AC, and EM but had localized effects on inflammatory cells and ER expression. No anti-inflammatory effects of altrenogest in healthy, late pregnant pony mares could be detected. Copyright © 2013 Elsevier Inc. All

Assay Design Affects the Interpretation of T-Cell Receptor Gamma Gene Rearrangements

PubMed Central

Cushman-Vokoun, Allison M.; Connealy, Solomon; Greiner, Timothy C.

2010-01-01

Interpretation of capillary electrophoresis results derived from multiplexed fluorochrome-labeled primer sets can be complicated by small peaks, which may be incorrectly interpreted as clonal T-cell receptor-γ gene rearrangements. In this report, different assay designs were used to illustrate how design may adversely affect specificity. Ten clinical cases, with subclonal peaks containing one of the two infrequently used joining genes, were identified with a tri-color, one-tube assay. The DNA was amplified with the same NED fluorochrome on all three joining primers, first combined (one-color assay) and then amplified separately using a single NED-labeled joining primer. The single primer assay design shows how insignificant peaks could easily be wrongly interpreted as clonal T-cell receptor-γ gene rearrangements. Next, the performance of the one-tube assay was compared with the two-tube BIOMED-2-based TCRG Gene Clonality Assay in a series of 44 cases. Whereas sensitivity was similar between the two methods (92.9% vs. 96.4%; P = 0.55), specificity was significantly less in the BIOMED-2 assay (87.5% vs. 56.3%; P = 0.049) when a 2× ratio was used to define clonality. Specificity was improved to 81.3% by the use of a 5× peak height ratio (P = 0.626). These findings illustrate how extra caution is needed in interpreting a design with multiple, separate distributions, which is more difficult to interpret than a single distribution assay. PMID:20959612

Piracetam induces plasma membrane depolarization in rat brain synaptosomes.

PubMed

Fedorovich, Sergei V

2013-10-11

Piracetam is a cyclic derivative of γ-aminobutyric acid (GABA). It was the first nootropic drug approved for clinical use. However, mechanism of its action is still not clear. In present paper, I investigated effects of piracetam on neurotransmitter release, plasma membrane potential monitored by fluorescent dye DiSC3(5) and chloride transport monitored by fluorescent dye SPQ in rat brain synaptosomes. It was shown that piracetam (1 mM) induces slow weak plasma membrane depolarization. This effect was decreased on 43% and 58% by both AMPA/kainate receptor blockers NBQX (10 μM) and CNQX (100 μM), respectively, on 84% by GABA ionotropic receptor blocker picrotoxin (50 μM) and on 91% upon withdrawal of HCO(3-) ions from incubation medium. GABA (1 mM) and kainate (100 μM) were found not to produce changes of plasma membrane potential. Also, it was found that piracetam induces chloride efflux which seems to be the reason of depolarization. Thereby, piracetam induces depolarization of plasma membrane of isolated neuronal presynaptic endings by picrotoxin-sensitive way. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Could the 5-HT1B receptor inverse agonism affect learning consolidation?

PubMed

Meneses, A

2001-03-01

Diverse evidence indicates that, the 5-HT system might play a role in learning and memory, since it occurs in brain areas mediating such processes and 5-HT drugs modulate them. Hence in this work, in order to explore further 5-HT involvement on learning and memory 5-HT1B receptors' role is investigated. Evidence indicates that SB-224289 (a 5-HT1B receptor inverse agonist) post-training injection facilitated learning consolidation in an associative autoshaping learning task, this effect was partially reversed by GR 127935 (a 5-HT1B/1D receptor antagonist), but unaffected by MDL 100907 (a 5-HT2A receptor antagonist) or ketanserin (a 5-HT1D/2A/7 receptor antagonist) at low doses. Moreover, SB-224289 antagonized the learning deficit produced by TFMPP (a 5-HT1A/1B/1D/2A/2C receptor agonist), GR 46611 (a 5-HT1A/1B/1D receptor agonist), mCPP (a 5-HT2A/2C/3/7 receptor agonist/antagonist) or GR 127935 (at low dose). SB-224289 did not alter the 8-OH-DPAT (a 5-HT1A/7 receptor agonist) learning facilitatory effect. SB-224289 eliminated the deficit learning produced by the anticholinergic muscarinic scopolamine or the glutamatergic antagonist dizocilpine. Administration of both, GR 127935 (5mg/kg) plus ketanserin (0.01 mg/kg) did not modify learning consolidation; nevertheless, when ketanserin dose was increased (0.1-1.0mg/kg) and SB-224289 dose was maintained constant, a learning facilitation effect was observed. Notably, SB-224289 at 1.0mg/kg potentiated a subeffective dose of the 5-HT1B/1D receptor agonist/antagonist mixed GR 127935, which facilitated learning consolidation and this effect was abolished by ketanserin at a higher dose. Collectively, the data confirm and extend the earlier findings with GR 127935 and the effects of non-selective 5-HT(1B) receptor agonists. Clearly 5-HT1B agonists induced a learning deficit which can be reversed with SB-224289. Perhaps more importantly, SB-224289 enhances learning consolidation when given alone and can reverse the deficits

Anticonvulsant effect of AMP by direct activation of adenosine A1 receptor.

PubMed

Muzzi, Mirko; Coppi, Elisabetta; Pugliese, Anna Maria; Chiarugi, Alberto

2013-12-01

Purinergic neurotransmission mediated by adenosine (Ado) type 1 receptors (A1Rs) plays pivotal roles in negative modulation of epileptic seizures, and Ado is thought to be a key endogenous anticonvulsant. Recent evidence, however, indicates that AMP, the metabolic precursor of Ado, also activate A1Rs. Here, we evaluated the antiepileptic effects of AMP adopting in vitro and in vivo models of epilepsy. We report that AMP reversed the increase in population spike (PS) amplitude and the decrease in PS latency induced by a Mg(2+)-free extracellular solution in CA1 neurons of mouse hippocampal slices. The AMP effects were inhibited by the A1R antagonist DPCPX, but not prevented by inhibiting conversion of AMP into Ado, indicating that AMP inhibited per se sustained hippocampal excitatory neurotransmission by directly activating A1Rs. AMP also reduced seizure severity and mortality in a model of audiogenic convulsion. Of note, the anticonvulsant effects of AMP were potentiated by preventing its conversion into Ado and inhibited by DPCPX. When tested in a model of kainate-induced seizure, AMP prolonged latency of convulsions but had no effects on seizure severity and mortality. Data provide the first evidence that AMP is an endogenous anticonvulsant acting at A1Rs. © 2013.

Crystal structure and association behaviour of the GluR2 amino-terminal domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jin, Rongsheng; Singh, Satinder K.; Gu, Shenyan

2009-09-02

Fast excitatory neurotransmission is mediated largely by ionotropic glutamate receptors (iGluRs), tetrameric, ligand-gated ion channel proteins comprised of three subfamilies, AMPA, kainate and NMDA receptors, with each subfamily sharing a common, modular-domain architecture. For all receptor subfamilies, active channels are exclusively formed by assemblages of subunits within the same subfamily, a molecular process principally encoded by the amino-terminal domain (ATD). However, the molecular basis by which the ATD guides subfamily-specific receptor assembly is not known. Here we show that AMPA receptor GluR1- and GluR2-ATDs form tightly associated dimers and, by the analysis of crystal structures of the GluR2-ATD, propose mechanismsmore » by which the ATD guides subfamily-specific receptor assembly.« less

The Brain Tourniquet: Physiological Isolation of Brain Regions Damaged by Traumatic Head Injury

DTIC Science & Technology

2008-06-19

brain slices were treated after injury with either a nootropic agent ( aniracetam , cyclothiazide, IDRA 21, or 1-BCP) or the antiepileptic drug...tourniquet approach. Four well-known nootropic agents were evaluated: aniracetam , a pyrrolidione analog that slows non-NMDA (AMPA/kainate) receptor...to improve cognition in rats [Stdubli et al., 1994], and has more potent effects than aniracetam in rat brain slices [Arai et al., 1994]. In

Radioiodination of chicken luteinizing hormone without affecting receptor binding potency

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kikuchi, M.; Ishii, S.

1989-12-01

By improving the currently used lactoperoxidase method, we were able to obtain radioiodinated chicken luteinizing hormone (LH) that shows high specific binding and low nonspecific binding to a crude plasma membrane fraction of testicular cells of the domestic fowl and the Japanese quail, and to the ovarian granulosa cells of the Japanese quail. The change we made from the original method consisted of (1) using chicken LH for radioiodination that was not only highly purified but also retained a high receptor binding potency; (2) controlling the level of incorporation of radioiodine into chicken LH molecules by employing a short reactionmore » time and low temperature; and (3) fractionating radioiodinated chicken LH further by gel filtration using high-performance liquid chromatography. Specific radioactivity of the final {sup 125}I-labeled chicken LH preparation was 14 microCi/micrograms. When specific binding was 12-16%, nonspecific binding was as low as 2-4% in the gonadal receptors. {sup 125}I-Labeled chicken LH was displaced by chicken LH and ovine LH but not by chicken follicle-stimulating hormone. The equilibrium association constant of quail testicular receptor was 3.6 x 10(9) M-1. We concluded that chicken LH radioiodinated by the present method is useful for studies of avian LH receptors.« less

How chimeric antigen receptor design affects adoptive T cell therapy

PubMed Central

Gacerez, Albert T.; Arellano, Benjamine; Sentman, Charles L.

2016-01-01

Chimeric antigen receptor (CAR) T cells have been developed to treat tumors and have shown great success against B cell malignancies. Exploiting modular designs and swappable domains, CARs can target an array of cell surface antigens and, upon receptor-ligand interactions, direct signaling cascades, thereby driving T cell effector functions. CARs have been designed using receptors, ligands, or scFv binding domains. Different regions of a CAR have each been found to play a role in determining the overall efficacy of CAR T cells. Therefore, this review provides an overview of CAR construction and common designs. Each CAR region is discussed in the context of its importance to a CAR’s function. Additionally, the review explores how various engineering strategies have been applied to CAR T cells in order to regulate CAR T cell function and activity. PMID:27163336

Androgen receptor polyglutamine repeat length affects receptor activity and C2C12 cell development.

PubMed

Sheppard, Ryan L; Spangenburg, Espen E; Chin, Eva R; Roth, Stephen M

2011-10-20

Testosterone (T) has an anabolic effect on skeletal muscle and is believed to exert its local effects via the androgen receptor (AR). The AR harbors a polymorphic stretch of glutamine repeats demonstrated to inversely affect receptor transcriptional activity in prostate and kidney cells. The effects of AR glutamine repeat length on skeletal muscle are unknown. In this study we examined the effect of AR CAG repeat length on AR function in C2C12 cells. AR expression vectors harboring 14, 24, and 33 CAG repeats were used to assess AR transcriptional activity. C2C12 cell proliferation, differentiation, gene expression, myotube formation, and myonuclear fusion index were assessed. Transcriptional activity increased with increasing repeat length and in response to testosterone (AR14 = 3.91 ± 0.26, AR24 = 25.21 ± 1.72, AR33 = 36.08 ± 3.22 relative light units; P < 0.001). Ligand activation was increased for AR33 (2.10 ± 0.04) compared with AR14 (1.54 ± 0.09) and AR24 (1.57 ± 0.05, P < 0.001). AR mRNA expression was elevated in each stably transfected line. AR33 cell proliferation (20,512.3 ± 1,024.0) was decreased vs. AR14 (27,604.17 ± 1,425.3; P < 0.001) after 72 h. Decreased CK activity in AR14 cells (54.9 ± 2.9 units/μg protein) in comparison to AR33 (70.8 ± 8.1) (P < 0.05) was noted. The myonuclear fusion index was lower for AR14 (15.21 ± 3.24%) and AR33 (9.97 ± 3.14%) in comparison to WT (35.07 ± 5.60%, P < 0.001). AR14 and AR33 cells also displayed atypical myotube morphology. RT-PCR revealed genotype differences in myostatin and myogenin expression. We conclude that AR polyglutamine repeat length is directly associated with transcriptional activity and alters the growth and development of C2C12 cells. This polymorphism may contribute to the heritability of muscle mass in humans.

A search for presynaptic inhibitory histamine receptors in guinea-pig tissues: Further H3 receptors but no evidence for H4 receptors.

PubMed

Petri, Doris; Schlicker, Eberhard

2016-07-01

The histamine H4 receptor is coupled to Gi/o proteins and expressed on inflammatory cells and lymphoid tissues; it was suggested that this receptor also occurs in the brain or on peripheral neurones. Since many Gi/o protein-coupled receptors, including the H3 receptor, serve as presynaptic inhibitory receptors, we studied whether the sympathetic neurones supplying four peripheral tissues and the cholinergic neurones in the hippocampus from the guinea-pig are equipped with release-modulating H4 and H3 receptors. For this purpose, we preincubated tissue pieces from the aorta, atrium, renal cortex and vas deferens with (3)H-noradrenaline and hippocampal slices with (3)H-choline and determined the electrically evoked tritium overflow. The stimulation-evoked overflow in the five superfused tissues was inhibited by the muscarinic receptor agonist oxotremorine, which served as a positive control, but not affected by the H4 receptor agonist 4-methylhistamine. The H3 receptor agonist R-α-methylhistamine inhibited noradrenaline release in the peripheral tissues without affecting acetylcholine release in the hippocampal slices. Thioperamide shifted the concentration-response curve of histamine in the aorta and the renal cortex to the right, yielding apparent pA2 values of 8.0 and 8.1, respectively, which are close to its affinity at other H3 receptors but higher by one log unit than its pKi at the H4 receptor of the guinea-pig. In conclusion, histamine H4 receptors could not be identified in five experimental models of the guinea-pig that are suited for the detection of presynaptic inhibitory receptors whereas H3 receptors could be shown in the peripheral tissues but not in the hippocampus. This article is part of the Special Issue entitled 'Histamine Receptors'. Copyright © 2015 Elsevier Ltd. All rights reserved.

Monosodium glutamate intake affect the function of the kidney through NMDA receptor.

PubMed

Mahieu, Stella; Klug, Maximiliano; Millen, Néstor; Fabro, Ana; Benmelej, Adriana; Contini, Maria Del Carmen

2016-03-15

We investigated whether the chronic intake of monosodium glutamate (MSG) with food affects kidney function, and renal response to glycine. We also established if the NMDA receptors are involved in the changes observed. Male Wistar rats (5weeks old) were fed a diet supplemented with MSG (3g/kg b.w./day), five days a week, and spontaneous ingestion of a 1% MSG solution during 16weeks. NaCl rats were fed a diet with NaCl (1g/kg b.w./day) and 0.35% NaCl solution at the same frequency and time. Control group was fed with normal chow and tap water. We utilized clearance techniques to examine glomerular filtration rate (GFR) and cortical renal plasma flow (CRPF) response to glycine and glycine+MK-801 (antagonist NMDA-R), and we determined NMDA-R1 in kidney by immunohistochemistry. The addition of MSG in the diet of rats increased both GFR and CRPF with an increase of absolute sodium reabsorption. However, hyperfiltration was accompanied with a normal response to glycine infusion. Immunostain of kidney demonstrate that the NMDA receptor is upregulated in rats fed with MSG diet. NMDA-R antagonist MK-801 significantly reduced both the GFR and CRPF; however the percentage of reduction was significantly higher in the group MSG. MK-801 also reduces fractional excretion of water, sodium and potassium in the three groups. Renal NMDAR may be conditioned by the addition of MSG in the diet, favoring the hyperfiltration and simultaneously Na retention in the body. Copyright © 2016 Elsevier Inc. All rights reserved.

Differential Expression of Glutamate Receptors in Avian Neural Pathways for Learned Vocalization

PubMed Central

WADA, KAZUHIRO; SAKAGUCHI, HIRONOBU; JARVIS, ERICH D.; HAGIWARA, MASATOSHI

2008-01-01

Learned vocalization, the substrate for human language, is a rare trait. It is found in three distantly related groups of birds—parrots, hummingbirds, and songbirds. These three groups contain cerebral vocal nuclei for learned vocalization not found in their more closely related vocal nonlearning relatives. Here, we cloned 21 receptor subunits/subtypes of all four glutamate receptor families (AMPA, kainate, NMDA, and metabotropic) and examined their expression in vocal nuclei of songbirds. We also examined expression of a subset of these receptors in vocal nuclei of hummingbirds and parrots, as well as in the brains of dove species as examples of close vocal nonlearning relatives. Among the 21 subunits/subtypes, 19 showed higher and/or lower prominent differential expression in songbird vocal nuclei relative to the surrounding brain subdivisions in which the vocal nuclei are located. This included relatively lower levels of all four AMPA subunits in lMAN, strikingly higher levels of the kainite subunit GluR5 in the robust nucleus of the arcopallium (RA), higher and lower levels respectively of the NMDA subunits NR2A and NR2B in most vocal nuclei and lower levels of the metabotropic group I subtypes (mGluR1 and -5) in most vocal nuclei and the group II subtype (mGluR2), showing a unique expression pattern of very low levels in RA and very high levels in HVC. The splice variants of AMPA subunits showed further differential expression in vocal nuclei. Some of the receptor subunits/subtypes also showed differential expression in hummingbird and parrot vocal nuclei. The magnitude of differential expression in vocal nuclei of all three vocal learners was unique compared with the smaller magnitude of differences found for nonvocal areas of vocal learners and vocal nonlearners. Our results suggest that evolution of vocal learning was accompanied by differential expression of a conserved gene family for synaptic transmission and plasticity in vocal nuclei. They also

How Chimeric Antigen Receptor Design Affects Adoptive T Cell Therapy.

PubMed

Gacerez, Albert T; Arellano, Benjamine; Sentman, Charles L

2016-12-01

Chimeric antigen receptor (CAR) T cells have been developed to treat tumors and have shown great success against B cell malignancies. Exploiting modular designs and swappable domains, CARs can target an array of cell surface antigens and, upon receptor-ligand interactions, direct signaling cascades, thereby driving T cell effector functions. CARs have been designed using receptors, ligands, or scFv binding domains. Different regions of a CAR have each been found to play a role in determining the overall efficacy of CAR T cells. Therefore, this review provides an overview of CAR construction and common designs. Each CAR region is discussed in the context of its importance to a CAR's function. Additionally, the review explores how various engineering strategies have been applied to CAR T cells in order to regulate CAR T cell function and activity. J. Cell. Physiol. 231: 2590-2598, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Glutamate as a neurotransmitter in the brain: review of physiology and pathology.

PubMed

Meldrum, B S

2000-04-01

Glutamate is the principal excitatory neurotransmitter in brain. Our knowledge of the glutamatergic synapse has advanced enormously in the last 10 years, primarily through application of molecular biological techniques to the study of glutamate receptors and transporters. There are three families of ionotropic receptors with intrinsic cation permeable channels [N-methyl-D-aspartate (NMDA), alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) and kainate]. There are three groups of metabotropic, G protein-coupled glutamate receptors (mGluR) that modify neuronal and glial excitability through G protein subunits acting on membrane ion channels and second messengers such as diacylglycerol and cAMP. There are also two glial glutamate transporters and three neuronal transporters in the brain. Glutamate is the most abundant amino acid in the diet. There is no evidence for brain damage in humans resulting from dietary glutamate. A kainate analog, domoate, is sometimes ingested accidentally in blue mussels; this potent toxin causes limbic seizures, which can lead to hippocampal and related pathology and amnesia. Endogenous glutamate, by activating NMDA, AMPA or mGluR1 receptors, may contribute to the brain damage occurring acutely after status epilepticus, cerebral ischemia or traumatic brain injury. It may also contribute to chronic neurodegeneration in such disorders as amyotrophic lateral sclerosis and Huntington's chorea. In animal models of cerebral ischemia and traumatic brain injury, NMDA and AMPA receptor antagonists protect against acute brain damage and delayed behavioral deficits. Such compounds are undergoing testing in humans, but therapeutic efficacy has yet to be established. Other clinical conditions that may respond to drugs acting on glutamatergic transmission include epilepsy, amnesia, anxiety, hyperalgesia and psychosis.

Protection from inorganic mercury effects on the in vivo dopamine release by ionotropic glutamate receptor antagonists and nitric oxide synthase inhibitors.

PubMed

Vidal, Lucía; Durán, Rafael; Faro, Lilian F; Campos, Francisco; Cervantes, Rosa C; Alfonso, Miguel

2007-09-05

The possible role of ionotropics glutamate receptors on the HgCl(2)-induced dopamine (DA) release from rat striatum was investigated by using in vivo brain microdialysis technique after administration of selective NMDA and AMPA/Kainate receptors antagonists dizocilpine (MK-801), D (-)-2-amino-5-phoshonopentanoic acid (AP5), and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX). Moreover, we have also studied the effects of nitric oxide synthase (NOS) inhibitors L-nitro-arginine methyl ester (L-NAME) and 7-nitro-indazol (7-NI) on HgCl(2)-induced DA release. Intraestriatal infusion of 1mM HgCl(2) increased striatal DA to 1717.2+/-375.4% respect to basal levels. Infusion of 1mM HgCl(2) in 400 microM MK-801 pre-treated animals produced an increase on striatal DA levels 61% smaller than that induced in non-pre-treated animals. In the case of AP5, this treatment reduced 92% the increase produced by HgCl(2) as compared to non-pre-treated rats. Nevertheless, the administration of CNQX did not produce any effect on HgCl(2)-induced dopamine release. Intrastriatal infusion of 1mM HgCl(2) in 100 microM L-NAME pre-treated animals produced an increase on extracellular DA levels 82% smaller than produced by HgCl(2) alone. In addition, the pre-treatment with 7-NI reduced 90% the increase produced by infusion of HgCl(2) alone in rats. Thus, HgCl(2)-induced DA release could be produced at last in part, by overstimulation of NMDA receptors with NO production, since administration of NMDA receptor antagonists and NOS inhibitors protected against HgCl(2) effects on DA release.

N-glycosylation of the β2 adrenergic receptor regulates receptor function by modulating dimerization.

PubMed

Li, Xiaona; Zhou, Mang; Huang, Wei; Yang, Huaiyu

2017-07-01

N-glycosylation is a common post-translational modification of G-protein-coupled receptors (GPCRs). However, it remains unknown how N-glycosylation affects GPCR signaling. β 2 adrenergic receptor (β 2 AR) has three N-glycosylation sites: Asn6, Asn15 at the N-terminus, and Asn187 at the second extracellular loop (ECL2). Here, we show that deletion of the N-glycan did not affect receptor expression and ligand binding. Deletion of the N-glycan at the N-terminus rather than Asn187 showed decreased effects on isoproterenol-promoted G-protein-dependent signaling, β-arrestin2 recruitment, and receptor internalization. Both N6Q and N15Q showed decreased receptor dimerization, while N187Q did not influence receptor dimerization. As decreased β 2 AR homodimer accompanied with reduced efficiency for receptor function, we proposed that the N-glycosylation of β 2 AR regulated receptor function by influencing receptor dimerization. To verify this hypothesis, we further paid attention to the residues at the dimerization interface. Studies of Lys60 and Glu338, two residues at the receptor dimerization interface, exhibited that the K60A/E338A showed decreased β 2 AR dimerization and its effects on receptor signaling were similar to N6Q and N15Q, which further supported the importance of receptor dimerization for receptor function. This work provides new insights into the relationship among glycosylation, dimerization, and function of GPCRs. Peptide-N-glycosidase F (PNGase F, EC 3.2.2.11); endo-β-N-acetylglucosaminidase A (Endo-A, EC 3.2.1.96). © 2017 Federation of European Biochemical Societies.

Morphology and kainate-receptor immunoreactivity of identified neurons within the entorhinal cortex projecting to superior temporal sulcus in the cynomolgus monkey

NASA Technical Reports Server (NTRS)

Good, P. F.; Morrison, J. H.; Bloom, F. E. (Principal Investigator)

1995-01-01

Projections of the entorhinal cortex to the hippocampus are well known from the classical studies of Cajal (Ramon y Cajal, 1904) and Lorente de No (1933). Projections from the entorhinal cortex to neocortical areas are less well understood. Such connectivity is likely to underlie the consolidation of long-term declarative memory in neocortical sites. In the present study, a projection arising in layer V of the entorhinal cortex and terminating in a polymodal association area of the superior temporal gyrus has been identified with the use of retrograde tracing. The dendritic arbors of neurons giving rise to this projection were further investigated by cell filling and confocal microscopy with computer reconstruction. This analysis demonstrated that the dendritic arbor of identified projection neurons was largely confined to layer V, with the exception of a solitary, simple apical dendrite occasionally ascending to superficial laminae but often confined to the lamina dissecans (layer IV). Finally, immunoreactivity for glutamate-receptor subunit proteins GluR 5/6/7 of the dendritic arbor of identified entorhinal projection neurons was examined. The solitary apical dendrite of identified entorhinal projection neurons was prominently immunolabeled for GluR 5/6/7, as was the dendritic arbor of basilar dendrites of these neurons. The restriction of the large bulk of the dendritic arbor of identified entorhinal projection neurons to layer V implies that these neurons are likely to be heavily influenced by hippocampal output arriving in the deep layers of the entorhinal cortex. Immunoreactivity for GluR 5/6/7 throughout the dendritic arbor of such neurons indicates that this class of glutamate receptor is in a position to play a prominent role in mediating excitatory neurotransmission within hippocampal-entorhinal circuits.

Neurotransmitter modulation of extracellular H+ fluxes from isolated retinal horizontal cells of the skate

PubMed Central

Molina, Anthony J A; Verzi, Michael P; Birnbaum, Andrea D; Yamoah, Ebenezer N; Hammar, Katherine; Smith, Peter J S; Malchow, Robert Paul

2004-01-01

Self-referencing H+-selective microelectrodes were used to measure extracellular H+ fluxes from horizontal cells isolated from the skate retina. A standing H+ flux was detected from quiescent cells, indicating a higher concentration of free hydrogen ions near the extracellular surface of the cell as compared to the surrounding solution. The standing H+ flux was reduced by removal of extracellular sodium or application of 5-(N-ethyl-N-isopropyl) amiloride (EIPA), suggesting activity of a Na+–H+ exchanger. Glutamate decreased H+ flux, lowering the concentration of free hydrogen ions around the cell. AMPA/kainate receptor agonists mimicked the response, and the AMPA/kainate receptor antagonist 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) eliminated the effects of glutamate and kainate. Metabotropic glutamate agonists were without effect. Glutamate-induced alterations in H+ flux required extracellular calcium, and were abolished when cells were bathed in an alkaline Ringer solution. Increasing intracellular calcium by photolysis of the caged calcium compound NP-EGTA also altered extracellular H+ flux. Immunocytochemical localization of the plasmalemma Ca2+–H+-ATPase (PMCA pump) revealed intense labelling within the outer plexiform layer and on isolated horizontal cells. Our results suggest that glutamate modulation of H+ flux arises from calcium entry into cells with subsequent activation of the plasmalemma Ca2+–H+-ATPase. These neurotransmitter-induced changes in extracellular pH have the potential to play a modulatory role in synaptic processing in the outer retina. However, our findings argue against the hypothesis that hydrogen ions released by horizontal cells normally act as the inhibitory feedback neurotransmitter onto photoreceptor synaptic terminals to create the surround portion of the centre-surround receptive fields of retinal neurones. PMID:15272044

REEPs Are Membrane Shaping Adapter Proteins That Modulate Specific G Protein-Coupled Receptor Trafficking by Affecting ER Cargo Capacity

PubMed Central

Ho, Vincent K.; Angelotti, Timothy

2013-01-01

Receptor expression enhancing proteins (REEPs) were identified by their ability to enhance cell surface expression of a subset of G protein-coupled receptors (GPCRs), specifically GPCRs that have proven difficult to express in heterologous cell systems. Further analysis revealed that they belong to the Yip (Ypt-interacting protein) family and that some REEP subtypes affect ER structure. Yip family comparisons have established other potential roles for REEPs, including regulation of ER-Golgi transport and processing/neuronal localization of cargo proteins. However, these other potential REEP functions and the mechanism by which they selectively enhance GPCR cell surface expression have not been clarified. By utilizing several REEP family members (REEP1, REEP2, and REEP6) and model GPCRs (α2A and α2C adrenergic receptors), we examined REEP regulation of GPCR plasma membrane expression, intracellular processing, and trafficking. Using a combination of immunolocalization and biochemical methods, we demonstrated that this REEP subset is localized primarily to ER, but not plasma membranes. Single cell analysis demonstrated that these REEPs do not specifically enhance surface expression of all GPCRs, but affect ER cargo capacity of specific GPCRs and thus their surface expression. REEP co-expression with α2 adrenergic receptors (ARs) revealed that this REEP subset interacts with and alter glycosidic processing of α2C, but not α2A ARs, demonstrating selective interaction with cargo proteins. Specifically, these REEPs enhanced expression of and interacted with minimally/non-glycosylated forms of α2C ARs. Most importantly, expression of a mutant REEP1 allele (hereditary spastic paraplegia SPG31) lacking the carboxyl terminus led to loss of this interaction. Thus specific REEP isoforms have additional intracellular functions besides altering ER structure, such as enhancing ER cargo capacity, regulating ER-Golgi processing, and interacting with select cargo proteins

Synthesis and biological evaluation of cyclopropyl analogues of 2-amino-5-phosphonopentanoic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dappen, M.S.; Pellicciari, R.; Natalini, B.

1991-01-01

A series of cyclopropyl analogues related to 2-amino-5-phosphonopentanoic acid (AP5) were synthesized and their biological activity was assessed as competitive antagonists for the N-methyl-D-aspartate (NMDA) receptor. In vitro receptor binding using (3H)-L-glutamate as the radioligand provided affinity data, while modulation of (3H)MK-801 binding was used as a functional assay. The analogues were also evaluated in (3H)kainate binding to assess selectivity over non-NMDA glutamate receptors. Of the compounds tested, 4,5-methano-AP5 analogue 26 was the most potent selective NMDA antagonist; however, potency was lower than that for (((+/-)-2-carboxypiperidin-4-yl)methyl)phosphonic acid (CGS 19755, 5).

The spike generator in the labellar taste receptors of the blowfly is differently affected by 4-aminopyridine and 5-hydroxytryptamine.

PubMed

Sollai, Giorgia; Solari, Paolo; Corda, Valentina; Masala, Carla; Crnjar, Roberto

2012-12-01

In taste chemoreception of invertebrates the interaction of taste stimuli with specific membrane receptors and/or ion channels located in the apical membrane of taste receptor cells results in the generation of a receptor potential which, in turn, activates the 'encoder' region to produce action potentials which propagate to the CNS. This study investigates, in the labellar chemosensilla of the blowfly, Protophormia terraenovae, the voltage-gated K(+) currents involved in the action potential repolarization and repetitive firing of the neurons by way of the K(v) channel inhibitors, 4-aminopyridine and 5-hydroxytryptamine. The receptor potential and the spike activity were simultaneously recorded from the 'salt', 'sugar' and 'deterrent' cells, by means of the extracellular side-wall technique, in response to 150 mM NaCl, 100 mM sucrose and 1 mM quinine HCl, before, 0÷10 min after apical administration of 4-AP (0.01-10 mM) or 5-HT (0.1-100 mM). The results show that the receptor potential in all three cells is neither affected by 4-AP nor by 5-HT. Instead, spike activity is significantly decreased, by way of blocking different K(v) channel types: an inactivating A-type K(+) current (KA) modulating repetitive firing of the cells and responsible for the after hyperpolarization, and a sustained K(+) current that resembles the delayed rectifier (DKR) and contributes to action potential repolarization. Copyright © 2012 Elsevier Ltd. All rights reserved.

Polymorphism of the beta3-adrenergic receptor gene affects basal metabolic rate in obese Finns.

PubMed

Sipiläinen, R; Uusitupa, M; Heikkinen, S; Rissanen, A; Laakso, M

1997-01-01

Low basal metabolic rate (BMR) is a risk factor for weight gain and obesity. The polymorphism at codon 64 of the beta3-adrenergic receptor gene has been suggested to be associated with BMR. We investigated the frequency of the Trp64Arg of the beta3-adrenergic receptor gene and the effects of this polymorphism on BMR in obese Finns. Altogether, 170 obese subjects (29 men, 141 women, BMI 34.7 +/- 3.8 kg/m2, mean +/- SD) participated in the study. The frequency of the Trp64Arg polymorphism was 19%. None of the obese subjects were homozygous for the Arg-encoding allele. The frequency of the Trp64Arg polymorphism in obese Finns did not differ from nonobese and normoglycemic control subjects. BMR adjusted for lean body mass and age was lower in subjects with the Trp64Arg polymorphism (n = 20) than in normal homozygotes Trp64Trp (n = 99) (1,569 +/- 73 vs. 1,635 +/- 142 kcal/day, P = 0.004). For the female group (n = 98), the respective values were 1,501 +/- 66 kcal/day vs. 1,568 +/- 127 kcal/day (P = 0.004). There were no significant differences in weight, BMI, waist-to-hip ratio, lean body mass, percentage of fat, and respiratory quotient between the groups with or without the Trp64Arg polymorphism. Neither serum glucose nor insulin levels differed between the two groups. We conclude that the Trp64Arg polymorphism of the beta3-adrenergic receptor gene affects basal metabolic rate in obese Finns but does not have significant effect on glucose metabolism.

Disturbances of Ligand Potency and Enhanced Degradation of the Human Glycine Receptor at Affected Positions G160 and T162 Originally Identified in Patients Suffering from Hyperekplexia

PubMed Central

Atak, Sinem; Langlhofer, Georg; Schaefer, Natascha; Kessler, Denise; Meiselbach, Heike; Delto, Carolyn; Schindelin, Hermann; Villmann, Carmen

2015-01-01

Ligand-binding of Cys-loop receptors is determined by N-terminal extracellular loop structures from the plus as well as from the minus side of two adjacent subunits in the pentameric receptor complex. An aromatic residue in loop B of the glycine receptor (GlyR) undergoes direct interaction with the incoming ligand via a cation-π interaction. Recently, we showed that mutated residues in loop B identified from human patients suffering from hyperekplexia disturb ligand-binding. Here, we exchanged the affected human residues by amino acids found in related members of the Cys-loop receptor family to determine the effects of side chain volume for ion channel properties. GlyR variants were characterized in vitro following transfection into cell lines in order to analyze protein expression, trafficking, degradation and ion channel function. GlyR α1 G160 mutations significantly decrease glycine potency arguing for a positional effect on neighboring aromatic residues and consequently glycine-binding within the ligand-binding pocket. Disturbed glycinergic inhibition due to T162 α1 mutations is an additive effect of affected biogenesis and structural changes within the ligand-binding site. Protein trafficking from the ER toward the ER-Golgi intermediate compartment, the secretory Golgi pathways and finally the cell surface is largely diminished, but still sufficient to deliver ion channels that are functional at least at high glycine concentrations. The majority of T162 mutant protein accumulates in the ER and is delivered to ER-associated proteasomal degradation. Hence, G160 is an important determinant during glycine binding. In contrast, T162 affects primarily receptor biogenesis whereas exchanges in functionality are secondary effects thereof. PMID:26733802

Differential S1P Receptor Profiles on M1- and M2-Polarized Macrophages Affect Macrophage Cytokine Production and Migration.

PubMed

Müller, Jan; von Bernstorff, Wolfram; Heidecke, Claus-Dieter; Schulze, Tobias

2017-01-01

Introduction . Macrophages are key players in complex biological processes. In response to environmental signals, macrophages undergo polarization towards a proinflammatory (M1) or anti-inflammatory (M2) phenotype. Sphingosine 1-phosphate (S1P) is a bioactive lysophospholipid that acts via 5 G-protein coupled receptors (S1P 1-5 ) in order to influence a broad spectrum of biological processes. This study assesses S1P receptor expression on macrophages before and after M1 and M2 polarization and performs a comparative analysis of S1P signalling in the two activational states of macrophages. Methods . Bone marrow derived macrophages (BMDM) from C57 BL/6 mice were cultured under either M1- or M2-polarizing conditions. S1P-receptor expression was determined by quantitative RT-PCR. Influence of S1P on macrophage activation, migration, phagocytosis, and cytokine secretion was assessed in vitro. Results . All 5 S1P receptor subclasses were expressed in macrophages. Culture under both M1- and M2-polarizing conditions led to significant downregulation of S1P 1 . In contrast, M1-polarized macrophages significantly downregulated S1P 4 . The expression of the remaining three S1P receptors did not change. S1P increased expression of iNOS under M2-polarizing conditions. Furthermore, S1P induced chemotaxis in M1 macrophages and changed cytokine production in M2 macrophages. Phagocytosis was not affected by S1P-signalling. Discussion . The expression of different specific S1P receptor profiles may provide a possibility to selectively influence M1- or M2-polarized macrophages.

Synthetic Ligands of Cannabinoid Receptors Affect Dauer Formation in the Nematode Caenorhabditis elegans.

PubMed

Reis Rodrigues, Pedro; Kaul, Tiffany K; Ho, Jo-Hao; Lucanic, Mark; Burkewitz, Kristopher; Mair, William B; Held, Jason M; Bohn, Laura M; Gill, Matthew S

2016-06-01

Under adverse environmental conditions the nematode Caenorhabditis elegans can enter an alternate developmental stage called the dauer larva. To identify lipophilic signaling molecules that influence this process, we screened a library of bioactive lipids and found that AM251, an antagonist of the human cannabinoid (CB) receptor, suppresses dauer entry in daf-2 insulin receptor mutants. AM251 acted synergistically with glucose supplementation indicating that the metabolic status of the animal influenced the activity of this compound. Similarly, loss of function mutations in the energy-sensing AMP-activated kinase subunit, aak-2, enhanced the dauer-suppressing effects of AM251, while constitutive activation of aak-2 in neurons was sufficient to inhibit AM251 activity. Chemical epistasis experiments indicated that AM251 acts via G-protein signaling and requires the TGF-β ligand DAF-7, the insulin peptides DAF-28 and INS-6, and a functional ASI neuron to promote reproductive growth. AM251 also required the presence of the SER-5 serotonin receptor, but in vitro experiments suggest that this may not be via a direct interaction. Interestingly, we found that other antagonists of mammalian CB receptors also suppress dauer entry, while the nonselective CB receptor agonist, O-2545, not only inhibited the activity of AM251, but also was able to promote dauer entry when administered alone. Since worms do not have obvious orthologs of CB receptors, the effects of synthetic CBs on neuroendocrine signaling in C. elegans are likely to be mediated via another, as yet unknown, receptor mechanism. However, we cannot exclude the existence of a noncanonical CB receptor in C. elegans. Copyright © 2016 Rodrigues et al.

Synthetic Ligands of Cannabinoid Receptors Affect Dauer Formation in the Nematode Caenorhabditis elegans

PubMed Central

Reis Rodrigues, Pedro; Kaul, Tiffany K.; Ho, Jo-Hao; Lucanic, Mark; Burkewitz, Kristopher; Mair, William B.; Held, Jason M.; Bohn, Laura M.; Gill, Matthew S.

2016-01-01

Under adverse environmental conditions the nematode Caenorhabditis elegans can enter an alternate developmental stage called the dauer larva. To identify lipophilic signaling molecules that influence this process, we screened a library of bioactive lipids and found that AM251, an antagonist of the human cannabinoid (CB) receptor, suppresses dauer entry in daf-2 insulin receptor mutants. AM251 acted synergistically with glucose supplementation indicating that the metabolic status of the animal influenced the activity of this compound. Similarly, loss of function mutations in the energy-sensing AMP-activated kinase subunit, aak-2, enhanced the dauer-suppressing effects of AM251, while constitutive activation of aak-2 in neurons was sufficient to inhibit AM251 activity. Chemical epistasis experiments indicated that AM251 acts via G-protein signaling and requires the TGF-β ligand DAF-7, the insulin peptides DAF-28 and INS-6, and a functional ASI neuron to promote reproductive growth. AM251 also required the presence of the SER-5 serotonin receptor, but in vitro experiments suggest that this may not be via a direct interaction. Interestingly, we found that other antagonists of mammalian CB receptors also suppress dauer entry, while the nonselective CB receptor agonist, O-2545, not only inhibited the activity of AM251, but also was able to promote dauer entry when administered alone. Since worms do not have obvious orthologs of CB receptors, the effects of synthetic CBs on neuroendocrine signaling in C. elegans are likely to be mediated via another, as yet unknown, receptor mechanism. However, we cannot exclude the existence of a noncanonical CB receptor in C. elegans. PMID:27172180

A study of cannabinoid-1 receptors during the early phase of excitotoxic damage to rat spinal locomotor networks in vitro.

PubMed

Veeraraghavan, Priyadharishini; Dekanic, Ana; Nistri, Andrea

2016-10-01

Endocannabinoids acting on cannabinoid-1 receptors (CB1Rs) are proposed to protect brain and spinal neurons from excitotoxic damage. The ability to recover from spinal cord injury (SCI), in which excitotoxicity is a major player, is usually investigated at late times after modulation of CB1Rs whose role in the early phases of SCI remains unclear. Using the rat spinal cord in vitro as a model for studying SCI initial pathophysiology, we investigated if agonists or antagonists of CB1Rs might affect SCI induced by the excitotoxic agent kainate (KA) within 24h from a transient (1h) application of this glutamate agonist. The CB1 agonist anandamide (AEA or pharmacological block of its degradation) did not limit excitotoxic depolarization of spinal networks: cyclic adenosine monophosphate (cAMP) assay demonstrated that CB1Rs remained functional 24h later and similarly expressed among dead or survived cells. Locomotor-like network activity recorded from ventral roots could not recover with such treatments and was associated with persistent depression of synaptic transmission. Motoneurons, that are particularly vulnerable to KA, were not protected by AEA. Application of 2-arachidonoylglycerol also did not attenuate the electrophysiological and histological damage. The intensification of damage by the CB1 antagonist AM251 suggested that endocannabinoids were operative after excitotoxic stimulation, yet insufficient to contrast it efficiently. The present data indicate that the early phases of excitotoxic SCI could not be arrested by pharmacologically exploiting the endocannabinoid system, consistent with the notion that AEA and its derivatives are more useful to treat late SCI phases. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.

NMDA or non-NMDA receptor antagonism within the amygdaloid central nucleus suppresses the affective dimension of pain in rats: evidence for hemispheric synergy.

PubMed

Spuz, Catherine A; Borszcz, George S

2012-04-01

The amygdala contributes to generation of affective behaviors to threats. The prototypical threat to an individual is exposure to a noxious stimulus and the amygdaloid central nucleus (CeA) receives nociceptive input that is mediated by glutamatergic neurotransmission. The present study evaluated the contribution of glutamate receptors in CeA to generation of the affective response to acute pain in rats. Vocalizations that occur following a brief noxious tail shock (vocalization afterdischarges) are a validated rodent model of pain affect, and were preferentially suppressed by bilateral injection into CeA of the NMDA receptor antagonist D-2-amino-5-phosphonovalerate (AP5, 1 μg, 2 μg, or 4 μg) or the non-NMDA receptor antagonist 6-Cyano-7-nitroquinoxaline-2,3-dione disodium (CNQX, .25 μg, .5 μg, 1 μg, or 2 μg). Vocalizations that occur during tail shock were suppressed to a lesser degree, whereas spinal motor reflexes (tail flick and hind limb movements) were unaffected by injection of AP5 or CNQX into CeA. Unilateral administration of AP5 or CNQX into CeA of either hemisphere also selectively elevated vocalization thresholds. Bilateral administration of AP5 or CNQX produced greater increases in vocalization thresholds than the same doses of antagonists administered unilaterality into either hemisphere indicating synergistic hemispheric interactions. The amygdala contributes to production of emotional responses to environmental threats. Blocking glutamate neurotransmission within the central nucleus of the amygdala suppressed rats' emotional response to acute painful stimulation. Understanding the neurobiology underlying emotional responses to pain will provide insights into new treatments for pain and its associated affective disorders. Copyright © 2012 American Pain Society. Published by Elsevier Inc. All rights reserved.

Acetylcholine affects osteocytic MLO-Y4 cells via acetylcholine receptors.

PubMed

Ma, Yuanyuan; Li, Xianxian; Fu, Jing; Li, Yue; Gao, Li; Yang, Ling; Zhang, Ping; Shen, Jiefei; Wang, Hang

2014-03-25

The identification of the neuronal control of bone remodeling has become one of the many significant recent advances in bone biology. Cholinergic activity has recently been shown to favor bone mass accrual by complex cellular regulatory networks. Here, we identified the gene expression of the muscarinic and nicotinic acetylcholine receptors (m- and nAChRs) in mice tibia tissue and in osteocytic MLO-Y4 cells. Acetylcholine, which is a classical neurotransmitter and an osteo-neuromediator, not only influences the mRNA expression of the AChR subunits but also significantly induces the proliferation and viability of osteocytes. Moreover, acetylcholine treatment caused the reciprocal regulation of RANKL and OPG mRNA expression, which resulted in a significant increase in the mRNA ratio of RANKL:OPG in osteocytes via acetylcholine receptors. The expression of neuropeptide Y and reelin, which are two neurogenic markers, was also modulated by acetylcholine via m- and nAChRs in MLO-Y4 cells. These results indicated that osteocytic acetylcholine receptors might be a new valuable mediator for cell functions and even for bone remodeling. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Antinociceptive effects of (1→3),(1→6)-linked β-glucan isolated from Pleurotus pulmonarius in models of acute and neuropathic pain in mice: evidence for a role for glutamatergic receptors and cytokine pathways.

PubMed

Baggio, Cristiane Hatsuko; Freitas, Cristina Setim; Martins, Daniel Fernandes; Mazzardo, Leidiane; Smiderle, Fhernanda Ribeiro; Sassaki, Guilherme Lanzi; Iacomini, Marcello; Marques, Maria Consuelo Andrade; Santos, Adair Roberto Soares

2010-10-01

The present study evaluated the antinociceptive effect of (1→3),(1→6)-linked β-glucan (GL) isolated from Pleurotus pulmonarius (Fr.) Quel. in mice and its possible mechanism of action. Intraperitoneal administration of GL inhibited glutamate-induced licking with an ID(50) of 0.34 mg/kg and inhibition of 96% ± 3%. The treatment of animals with GL (1 mg/kg i.p.) inhibited nociception induced by intrathecal injection of N-methyl-D-aspartic acid, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid, kainate and interleukin -1β in 67% ± 13%, 89% ± 11%, 74% ± 9%, and 75% ± 7%, respectively, but not the nociceptive response induced by (±)-1-aminocyclopentane-trans-1,3-dicarboxylic acid, substance P, and tumor necrosis factor-α. Moreover, GL (30 mg/kg i.p.) also reduced mechanical allodynia caused by partial sciatic nerve ligation for 2 hours, with inhibition of 47% ± 10% observed 0.5 hours after treatment. When given chronically (twice a day) over 7 days, GL reversed the mechanical allodynia caused by partial sciatic nerve ligation (inhibition of 45% ± 13% to 60% ± 8%). Interestingly, GL did not affect the locomotor activity of mice in an open field test with doses that produce antinociceptive effects. Our findings show that GL inhibits acute and neuropathic pain in mice through mechanisms that involve the inhibition of ionotropic glutamate receptors and the interleukin -1β pathway. This article presents the antinociceptive activity of GL in acute and neuropathic pain with participation of ionotropic glutamate receptors and pro-inflammatory cytokines (interleukin-1β). After further experiments, this compound may represent a new pharmacological agent for the treatment of clinical pain. Copyright © 2010 American Pain Society. Published by Elsevier Inc. All rights reserved.

FH Afrikaner-3 LDL receptor mutation results in defective LDL receptors and causes a mild form of familial hypercholesterolemia.

PubMed

Graadt van Roggen, J F; van der Westhuyzen, D R; Coetzee, G A; Marais, A D; Steyn, K; Langenhoven, E; Kotze, M J

1995-06-01

Three founder-related gene mutations (FH Afrikaner-1, -2, and -3) that affect the LDL receptor are responsible for 90% of the familial hypercholesterolemia (FH) in South African Afrikaners. Patients heterozygous for the FH Afrikaner-1 (FH1) mutation, which results in receptors having approximately 20% of normal receptor activity, have significantly lower plasma cholesterol levels and milder clinical symptoms than heterozygotes with the FH Afrikaner-2 mutation, which completely abolishes LDL receptor activity. In this study we re-created the FH3 mutation (Asp154-->Asn) in exon 4 by site-directed mutagenesis and analyzed the expression of the mutant receptors in Chinese hamster ovary cells. The mutation resulted in the formation of LDL receptors that are markedly defective in their ability to bind LDL, whereas binding of apoE-containing beta-VLDL is less affected. The mutant receptors are poorly expressed on the cell surface as a result of significant degradation of receptor precursors. The plasma cholesterol levels of 31 FH3 heterozygotes were similar to FH1 heterozygotes but significantly lower than FH2 heterozygotes. The FH1 and FH3 heterozygotes also tended to be less severely affected clinically (by coronary heart disease and xanthomata) than FH2 patients. This study demonstrates that mutational heterogeneity in the LDL receptor gene influences the phenotypic expression of heterozygous FH and that severity of expression correlates with the activity of the LDL receptor measured in vitro. The results further indicate that knowledge of the specific mutation underlying FH in heterozygotes is valuable in determining the potential risk of premature atherosclerosis and should influence the clinical management of FH patients.

Thymoquinone, the main constituent of Nigella sativa, affects adenosine receptors in asthmatic guinea pigs

PubMed Central

Pejman, Laleh; Omrani, Hasan; Mirzamohammadi, Zahra; Keyhanmanesh, Rana

2014-01-01

Objective(s): For determining the mechanism of anti-asthmatic effect of thymoquinone, this investigation evaluated the effect of thymoquinone in the presence of selective A2A and A2B adenosine receptor antagonists (ZM241385 and MRS1706, respectively). Materials and Methods: Seventy guinea pigs were randomly divided to 7 groups; control (C), sensitized with ovalbumin (S), sensitized groups pretreated with thymoquinone (S+TQ), ZM241385 (S+Anta A2A), MRS1706 (S+Anta A2B), thymoquinone and antagonists (S+Anta A2A+TQ and S+Anta A2B+TQ). Thymoquinone and each of these antagonists with 3 mg/kg dose were injected i.p. on 10th day of sensitization protocol. Tracheal responsiveness (TR) to methacholine and ovalbumin (OA), and total and differential cell count in lung lavage fluid (LLF) in different groups were measured. Results: Increased EC50 and LLF neutrophil count and decreased TR to methacholine and OA, LLF eosinophil and basophil counts were observed in S+TQ group compared to S group (P<0.001 to P<0.05). Significant decrease in EC50 (P<0.01), LLF neutrophil, lymphocyte and monocyte count (P<0.001 for all) and significant increase in TR to OA (P<0.01), LLF total WBC (P<0.01) and eosinophil count (P<0.001) were observed in S+A2A group compared to S+TQ group. There was significant increase in LLF eosinophil and monocyte counts in S+Anta A2B group compared with S+TQ group (P<0.001 for both). In S+TQ+Anta A2A group, there was significant increase in LLF eosinophil (P<0.001) and significant decrease in LLF neutrophil (P<0.01) and monocyte (P<0.001) counts compared with S+TQ group. Conclusion: Thymoquinone affects adenosine receptors, which suggest that some of its anti-inflammatory effects may be mediated by these receptors. PMID:25859306

In Adult Female Hamsters Hypothyroidism Stimulates D1 Receptor-mediated Breathing without altering D1 Receptor Expression

PubMed Central

Schlenker, Evelyn H.; Rio, Rodrigo Del; Schultz, Harold D.

2015-01-01

Hypothyroidism affects cardiopulmonary regulation and function of dopaminergic receptors. Here we evaluated effects of 5 months of hypothyroidism on dopamine D1 receptor modulation of breathing in female hamsters using a D1 receptor antagonist SCH23390. Euthyroid hamsters (EH) served as controls. Results indicated that hypothyroid female hamsters (HH) exhibited decreased body weights and minute ventilation (VE) following hypoxia due to decreased frequency of breathing (F). Moreover, SCH 23390 administration in HH increased VE by increasing tidal volume during exposure to air, hypoxia and following hypoxia. Relative to vehicle, SCH 23390 treatment decreased body temperature and hypoxic VE responsiveness in both groups. In EH, SCH 23390 decreased F in air, hypoxia and post hypoxia, and VE during hypoxia trended to decrease (P=0.053). Finally, expression of D1 receptor protein was not different between the two groups in any region evaluated. Thus, hypothyroidism in older female hamsters affected D1 receptor modulation of ventilation differently relative to euthyroid animals, but not expression of D1 receptors. PMID:26232642

In adult female hamsters hypothyroidism stimulates D1 receptor-mediated breathing without altering D1 receptor expression.

PubMed

Schlenker, Evelyn H; Del Rio, Rodrigo; Schultz, Harold D

2015-11-01

Hypothyroidism affects cardiopulmonary regulation and function of dopaminergic receptors. Here we evaluated effects of 5 months of hypothyroidism on dopamine D1 receptor modulation of breathing in female hamsters using a D1 receptor antagonist SCH 23390. Euthyroid hamsters (EH) served as controls. Results indicated that hypothyroid female hamsters (HH) exhibited decreased body weights and minute ventilation (VE) following hypoxia due to decreased frequency of breathing (F). Moreover, SCH 23390 administration in HH increased VE by increasing tidal volume during exposure to air, hypoxia and following hypoxia. Relative to vehicle, SCH 23390 treatment decreased body temperature and hypoxic VE responsiveness in both groups. In EH, SCH 23390 decreased F in air, hypoxia and post hypoxia, and VE during hypoxia trended to decrease (P=0.053). Finally, expression of D1 receptor protein was not different between the two groups in any region evaluated. Thus, hypothyroidism in older female hamsters affected D1 receptor modulation of ventilation differently relative to euthyroid animals, but not expression of D1 receptors. Copyright © 2015 Elsevier B.V. All rights reserved.

GluN2B N-methyl-D-aspartate receptor and excitatory amino acid transporter 3 are upregulated in primary sensory neurons after 7 days of morphine administration in rats: implication for opiate-induced hyperalgesia.

PubMed

Gong, Kerui; Bhargava, Aditi; Jasmin, Luc

2016-01-01

The contribution of the peripheral nervous system to opiate-induced hyperalgesia (OIH) is not well understood. In this study, we determined the changes in excitability of primary sensory neurons after sustained morphine administration for 7 days. Changes in the expression of glutamate receptors and glutamate transporters after morphine administration were ascertained in dorsal root ganglions. Patch clamp recordings from intact dorsal root ganglions (ex vivo preparation) of morphine-treated rats showed increased excitability of small diameter (≤30 μm) neurons with respect to rheobase and membrane threshold, whereas the excitability of large diameter (>30 μm) neurons remained unchanged. Small diameter neurons also displayed increased responses to glutamate, which were mediated mainly by GluN2B containing N-methyl-D-aspartate (NMDA) receptors, and to a lesser degree by the neuronal excitatory amino acid transporter 3/excitatory amino acid carrier 1. Coadministration in vivo of the GluN2B selective antagonist Ro 25-6981 with morphine for 7 days prevented the appearance of OIH and increased morphine-induced analgesia. Administration of morphine for 7 days led to an increased expression of GluN2B and excitatory amino acid transporter 3/excitatory amino acid carrier 1, but not of the α-amino-3-hydroxy-5-methyl-4-isoxazole propionate, kainate, or group I metabotropic glutamate receptors, or of the vesicular glutamate transporter 2. These results suggest that peripheral glutamatergic neurotransmission contributes to OIH and that GluN2B subunit of NMDA receptors in the periphery may be a target for therapy.

Involvement of AMPA/Kainate Glutamate Receptor in the Extinction and Reinstatement of Morphine-Induced Conditioned Place Preference: A Behavioral and Molecular Study.

PubMed

Siahposht-Khachaki, Ali; Fatahi, Zahra; Yans, Asal; Khodagholi, Fariba; Haghparast, Abbas

2017-03-01

Glutamate receptors in mesolimbic areas such as the nucleus accumbens, ventral tegmental area, prefrontal cortex (PFC), and hippocampus (HIP) are a component of the mechanisms of drug-induced reward and can modulate the firing pattern of dopaminergic neurons in the reward system. In addition, several lines of study have indicated that cAMP response element-binding protein (CREB) and c-fos have important role in morphine-induced conditioned place preference (CPP) induced by drugs of abuse, such as morphine, cocaine, nicotine, and alcohol. Therefore, in the present study, we investigated the changes in phosphorylated CREB (p-CREB) and c-fos induction within the nucleus accumbens (NAc), HIP, and PFC after intracerebroventricular (ICV) administration of different doses of CNQX or vehicle during extinction period or reinstatement of morphine-induced CPP. In all groups, the CPP procedure was done; afterward, the conditioning scores were recorded by Ethovision software. After behavioral test recording, we dissected out the NAc, HIP, and PFC regions and measured the p-CREB/CREB ratio and c-fos level by Western blot analysis. Our results showed that administration of CNQX significantly shortened the extinction of morphine CPP. Besides, ICV microinjection of CNQX following extinction period decreased the reinstatement of morphine CPP in extinguished rats. In molecular section, in treatment group, all mentioned factors were dose-dependently decreased in comparison with vehicle group (DMSO) after ICV microinjection of different doses of CNQX but not in pre-extinction microinjection. These findings suggested that antagonism of AMPA receptor decreased p-CREB/CREB ratio and c-fos level in the PFC, NAc, and HIP. Modulation of the drug memory reconsolidation may be useful for faster extinction of drug-induced reward and attenuation of drug-seeking behavior.

Molecular Perspectives for mu/delta Opioid Receptor Heteromers as Distinct, Functional Receptors

PubMed Central

Ong, Edmund W.; Cahill, Catherine M.

2014-01-01

Opioid receptors are the sites of action for morphine and the other opioid drugs. Abundant evidence now demonstrates that different opioid receptor types can physically associate to form heteromers. Understandings of the nature, behavior, and role of these opioid receptor heteromers are developing. Owing to their constituent monomers’ involvement in analgesia, mu/delta opioid receptor (M/DOR) heteromers have been a particular focus of attention. There is now considerable evidence demonstrating M/DOR to be an extant and physiologically relevant receptor species. Participating in the cellular environment as a distinct receptor type, M/DOR availability is complexly regulated and M/DOR exhibits unique pharmacology from that of other opioid receptors (ORs), including its constituents. M/DOR appears to have a range of actions that vary in a ligand- (or ligands-) dependent manner. These actions can meaningfully affect the clinical effects of opioid drugs: strategies targeting M/DOR may be therapeutically useful. This review presents and discusses developments in these understandings with a focus on the molecular nature and activity of M/DOR in the context of therapeutic potentials. PMID:24709907

Differences in glutamate receptors and inflammatory cell numbers are associated with the resolution of pain in human rotator cuff tendinopathy.

PubMed

Dean, Benjamin John Floyd; Snelling, Sarah J B; Dakin, Stephanie G; Murphy, Richard J; Javaid, Muhammad Kassim; Carr, Andrew Jonathan

2015-07-10

The relationship between peripheral tissue characteristics and pain symptoms in soft tissue inflammation is poorly understood. The primary aim of this study was to determine immunohistochemical differences in tissue obtained from patients with persistent pain and patients who had become pain-free after surgical treatment for rotator cuff tendinopathy. The secondary aim was to investigate whether there would be differences in glutaminergic and inflammatory gene expression between disease-derived and healthy control cells in vitro. Supraspinatus tendon biopsies were obtained from nine patients with tendon pain before shoulder surgery and from nine further patients whose pain had resolved completely following shoulder surgery. Histological markers relating to the basic tendon characteristics, inflammation and glutaminergic signalling were quantified by immunohistochemical analysis. Gene expression of glutaminergic and inflammatory markers was determined in tenocyte explants derived from painful rotator cuff tendon tears in a separate cohort of patients and compared to that of explants from healthy control tendons. Dual labelling was performed to identify cell types expressing nociceptive neuromodulators. Tendon samples from patients with persistent pain demonstrated increased levels of metabotropic glutamate receptor 2 (mGluR2), kainate receptor 1 (KA1), protein gene product 9.5 (PGP9.5), CD206 (macrophage marker) and CD45 (pan-leucocyte marker) versus pain-free controls (p <0.05). NMDAR1 co-localised with CD206-positive cells, whereas PGP9.5 and glutamate were predominantly expressed by resident tendon cells. These results were validated by in vitro increases in the expression of mGluR2, N-methyl-D-aspartate receptor (NMDAR1), KA1, CD45, CD206 and tumour necrosis factor alpha (TNF-α) genes (p <0.05) in disease-derived versus control cells. We conclude that differences in glutamate receptors and inflammatory cell numbers are associated with the resolution of shoulder

Protease-Activated Receptors and other G-Protein-Coupled Receptors: the Melanoma Connection

PubMed Central

Rosero, Rebecca A.; Villares, Gabriel J.; Bar-Eli, Menashe

2016-01-01

The vast array of G-protein-coupled receptors (GPCRs) play crucial roles in both physiological and pathological processes, including vision, coagulation, inflammation, autophagy, and cell proliferation. GPCRs also affect processes that augment cell proliferation and metastases in many cancers including melanoma. Melanoma is the deadliest form of skin cancer, yet limited therapeutic modalities are available to patients with metastatic melanoma. Studies have found that both chemokine receptors and protease-activated receptors, both of which are GPCRs, are central to the metastatic melanoma phenotype and may serve as potential targets in novel therapies against melanoma and other cancers. PMID:27379162

Protease-Activated Receptors and other G-Protein-Coupled Receptors: the Melanoma Connection.

PubMed

Rosero, Rebecca A; Villares, Gabriel J; Bar-Eli, Menashe

2016-01-01

The vast array of G-protein-coupled receptors (GPCRs) play crucial roles in both physiological and pathological processes, including vision, coagulation, inflammation, autophagy, and cell proliferation. GPCRs also affect processes that augment cell proliferation and metastases in many cancers including melanoma. Melanoma is the deadliest form of skin cancer, yet limited therapeutic modalities are available to patients with metastatic melanoma. Studies have found that both chemokine receptors and protease-activated receptors, both of which are GPCRs, are central to the metastatic melanoma phenotype and may serve as potential targets in novel therapies against melanoma and other cancers.

Enhanced sensitivity of muscarinic cholinergic receptor associated with dopaminergic receptor subsensitivity after chronic antidepressant treatment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koide, T.; Matsushita, H.

1981-03-09

The chronic effects of antidepressant treatment on striatal dopaminergic (DA) and muscarinic cholinergic (mACh) receptors of the rat brain have been examined comparatively in this study using /sup 3/H-spiroperidol (/sup 3/H-SPD) and /sup 3/H-quinuclidinyl benzilate (/sup 3/H-QNB) as the respective radioactive ligands. Imipramine and desipramine were used as prototype antidepressants. Although a single administration of imipramine or desipramine did not affect each receptor sensitivity, chronic treatment with each drug caused a supersensitivity of mACh receptor subsequent to DA receptor subsensitivity. Furthermore, it has been suggested that anti-mACh properties of imipramine or desipramine may not necessarily be related to the manifestationmore » of mACh receptor supersensitivity and that sustained DA receptor subsensitivity may play some role in the alterations of mACh receptor sensitivity.« less

Effect of the non-NMDA receptor antagonist GYKI 52466 on the microdialysate and tissue concentrations of amino acids following transient forebrain ischaemia.

PubMed

Arvin, B; Lekieffre, D; Graham, J L; Moncada, C; Chapman, A G; Meldrum, B S

1994-04-01

The effect of the non-N-methyl-D-aspartate (non-NMDA) receptor antagonist 1-(4-aminophenyl)-4-methyl-7,8-methylenedioxy-5H-2,3-benzodiazepine hydrochloride (GYKI 52466) on ischaemia-induced changes in the microdialysate and tissue concentrations of glutamate, aspartate, and gamma-aminobutyric acid (GABA) was studied in rats. Twenty minutes of four-vessel occlusion resulted in a transient increase in microdialysate levels of glutamate, aspartate, and GABA in striatum, cortex, and hippocampus. Administration of GYKI 52466 (10 mg/kg bolus + 10 mg/kg/60 min intravenously starting 20 min before onset of ischaemia) inhibited ischaemia-induced increases in microdialysate glutamate and GABA in striatum without affecting the increases in hippocampus or cortex. Twenty minutes of four-vessel occlusion resulted in immediate small decreases and larger delayed (72 h) decreases in tissue levels of glutamate and aspartate. Transient increases in tissue levels of GABA were shown in all three structures at the end of the ischaemic period. At 72 h, after the ischaemic period, significantly reduced GABA levels were observed in striatum and hippocampus. GYKI 52466, given under identical conditions as above, augmented the ischaemia-induced decrease in striatal tissue levels of glutamate and aspartate, without significantly affecting the decreases in hippocampus and cortex. Twenty minutes of ischaemia resulted in a large increase in microdialysate dopamine in striatum. GYKI 52466 failed to inhibit this increase. Kainic acid (500 microM infused through the probe for 20 min) caused increases in microdialysate glutamate and aspartate in the striatum. GYKI 52466 (10 mg/kg bolus + 10 mg/kg/60 min) completely inhibited the kainic acid-induced glutamate release. In conclusion, the action of the non-NMDA antagonist, GYKI 52466, in the striatum is different from that in the cortex and hippocampus. The inhibition by GYKI 52466 of ischaemia-induced and kainate-induced increases in microdialysate

Schizophrenia and the androgen receptor gene: Report of a sibship showing co-segregation with Reifenstein Syndrome but no evidence for linkage in 23 multiply affected families

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arranz, M.; Sharma, T.; Sham, P.

Crow et al. have reported excess sharing of alleles by male sibling pairs with schizophrenia, at a triplet repeat marker within the androgen receptor gene, indicating that mutations at or near this gene may be a risk factor for males. In this report, we describe a pair of male siblings concordant for both schizophrenia and Reifenstein syndrome, which is caused by a mutation in this gene. This provides support for the hypothesis that the androgen receptor may contribute to liability to develop schizophrenia. Because of this, we have examined a collection of 23 pedigrees multiply affected by schizophrenia for linkagemore » to the androgen receptor. We have found no evidence for linkage by both the LOD score and affected sibling-pair methods, under a range of genetic models with a broad and narrow definition of phenotype, and when families with male-to-male transmission are excluded. However, because of the small number of informative male-male pairs in our sample, we cannot confirm or refute the excess allele sharing for males reported by Crow. 35 refs., 1 fig., 2 tabs.« less

Oxyntomodulin differentially affects glucagon-like peptide-1 receptor beta-arrestin recruitment and signaling through Galpha(s).

PubMed

Jorgensen, Rasmus; Kubale, Valentina; Vrecl, Milka; Schwartz, Thue W; Elling, Christian E

2007-07-01

The glucagon-like peptide (GLP)-1 receptor is a promising target for the treatment of type 2 diabetes and obesity, and there is great interest in characterizing the pharmacology of the GLP-1 receptor and its ligands. In the present report, we have applied bioluminescence resonance energy transfer assays to measure agonist-induced recruitment of betaarrestins and G-protein-coupled receptor kinase (GRK) 2 to the GLP-1 receptor in addition to traditional measurements of second messenger generation. The peptide hormone oxyntomodulin is described in the literature as a full agonist on the glucagon and GLP-1 receptors. Surprisingly, despite being full agonists in GLP-1 receptor-mediated cAMP accumulation, oxyntomodulin and glucagon were observed to be partial agonists in recruiting betaarrestins and GRK2 to the GLP-1 receptor. We suggest that oxyntomodulin and glucagon are biased ligands on the GLP-1 receptor.

AMPA/Kainate, NMDA, and Dopamine D1 Receptor Function in the Nucleus Accumbens Core: A Context-Limited Role in the Encoding and Consolidation of Instrumental Memory

ERIC Educational Resources Information Center

Hernandez, Pepe J.; Andrzejewski, Matthew E.; Sadeghian, Kenneth; Panksepp, Jules B.; Kelley, Ann E.

2005-01-01

Neural integration of glutamate- and dopamine-coded signals within the nucleus accumbens (NAc) is a fundamental process governing cellular plasticity underlying reward-related learning. Intra-NAc core blockade of NMDA or D1 receptors in rats impairs instrumental learning (lever-pressing for sugar pellets), but it is not known during which phase of…

Ozone-derived Oxysterols Affect Liver X Receptor (LXR) Signaling

PubMed Central

Kim, Hye-Young H.; Bauer, Rebecca N.; Fessler, Michael B.; Duncan, Kelly E.; Liu, Wei; Porter, Ned A.

2016-01-01

When inhaled, ozone (O3) interacts with cholesterols of airway epithelial cell membranes or the lung-lining fluid, generating chemically reactive oxysterols. The mechanism by which O3-derived oxysterols affect molecular function is unknown. Our data show that in vitro exposure of human bronchial epithelial cells to O3 results in the formation of oxysterols, epoxycholesterol-α and -β and secosterol A and B (Seco A and Seco B), in cell lysates and apical washes. Similarly, bronchoalveolar lavage fluid obtained from human volunteers exposed to O3 contained elevated levels of these oxysterol species. As expected, O3-derived oxysterols have a pro-inflammatory effect and increase NF-κB activity. Interestingly, expression of the cholesterol efflux pump ATP-binding cassette transporter 1 (ABCA1), which is regulated by activation of the liver X receptor (LXR), was suppressed in epithelial cells exposed to O3. Additionally, exposure of LXR knock-out mice to O3 enhanced pro-inflammatory cytokine production in the lung, suggesting LXR inhibits O3-induced inflammation. Using alkynyl surrogates of O3-derived oxysterols, our data demonstrate adduction of LXR with Seco A. Similarly, supplementation of epithelial cells with alkynyl-tagged cholesterol followed by O3 exposure causes observable lipid-LXR adduct formation. Experiments using Seco A and the LXR agonist T0901317 (T09) showed reduced expression of ABCA1 as compared with stimulation with T0901317 alone, indicating that Seco A-LXR protein adduct formation inhibits LXR activation by traditional agonists. Overall, these data demonstrate that O3-derived oxysterols have pro-inflammatory functions and form lipid-protein adducts with LXR, thus leading to suppressed cholesterol regulatory gene expression and providing a biochemical mechanism mediating O3-derived formation of oxidized lipids in the airways and subsequent adverse health effects. PMID:27703007

Assessment of Chitosan-Affected Metabolic Response by Peroxisome Proliferator-Activated Receptor Bioluminescent Imaging-Guided Transcriptomic Analysis

PubMed Central

Kao, Chia-Hung; Hsiang, Chien-Yun; Ho, Tin-Yun

2012-01-01

Chitosan has been widely used in food industry as a weight-loss aid and a cholesterol-lowering agent. Previous studies have shown that chitosan affects metabolic responses and contributes to anti-diabetic, hypocholesteremic, and blood glucose-lowering effects; however, the in vivo targeting sites and mechanisms of chitosan remain to be clarified. In this study, we constructed transgenic mice, which carried the luciferase genes driven by peroxisome proliferator-activated receptor (PPAR), a key regulator of fatty acid and glucose metabolism. Bioluminescent imaging of PPAR transgenic mice was applied to report the organs that chitosan acted on, and gene expression profiles of chitosan-targeted organs were further analyzed to elucidate the mechanisms of chitosan. Bioluminescent imaging showed that constitutive PPAR activities were detected in brain and gastrointestinal tract. Administration of chitosan significantly activated the PPAR activities in brain and stomach. Microarray analysis of brain and stomach showed that several pathways involved in lipid and glucose metabolism were regulated by chitosan. Moreover, the expression levels of metabolism-associated genes like apolipoprotein B (apoB) and ghrelin genes were down-regulated by chitosan. In conclusion, these findings suggested the feasibility of PPAR bioluminescent imaging-guided transcriptomic analysis on the evaluation of chitosan-affected metabolic responses in vivo. Moreover, we newly identified that downregulated expression of apoB and ghrelin genes were novel mechanisms for chitosan-affected metabolic responses in vivo. PMID:22496881

The association between oxytocin receptor gene (OXTR) polymorphisms and affective temperaments, as measured by TEMPS-A.

PubMed

Kawamura, Yoshiya; Liu, Xiaoxi; Akiyama, Tsuyoshi; Shimada, Takafumi; Otowa, Takeshi; Sakai, Yoshie; Kakiuchi, Chihiro; Umekage, Tadashi; Sasaki, Tsukasa; Akiskal, Hagop S

2010-12-01

Oxytocin is associated with social interaction, trust, and affectivity. Affective temperaments are traits based on Kraepelin's typological definition of the "fundamental states" of manic-depressive illness. These states can be measured by the Temperament Evaluation of Memphis, Pisa, Paris and San Diego-Autoquestionnaire version (TEMPS-A). The objective of this study is to assess the association between oxytocin receptor gene (OXTR) polymorphisms and affective temperaments. Participants consisted of 493 genetically unrelated, non-clinical Japanese subjects (307 males and 186 females). The Mini-International Neuropsychiatric Interview (MINI) was used to screen and exclude those who had a lifetime diagnosis of schizophrenia or other psychotic disorders. Fifteen OXTR tag single nucleotide polymorphisms (SNPs) were genotyped using TaqMan® or direct sequencing. The Haploview 4.1. software determined the haplotype block structure. Haplotype-based quantitative trait association analysis with Bonferroni correction using PLINK 1.06 software was used to assess the association between haplotypes and the following affective temperaments: depressive, cyclothymic, hyperthymic, irritable, and anxious. Two haplotype blocks were identified on the OXTR. The depressive temperament was significantly associated with the most frequent haplotype GGGTGTC (rs11131149/rs2243370/rs2243369/rs13316193/rs2254298/rs2268493/rs2268491) (corrected P<0.05). This study consisted of participants from a corporation and the effect sizes were small. The findings suggest that an OXTR haplotype is associated with a discrete depressive temperament. Clarification of the biological basis of this temperamental trait may help to elucidate the pathophysiology of depressive disorder. Copyright © 2010 Elsevier B.V. All rights reserved.

Acetylcholine receptor antibody

MedlinePlus

... found in the blood of most people with myasthenia gravis . The antibody affects a chemical that sends signals ... Performed This test is used to help diagnose myasthenia gravis . Normal Results Normally, there is no acetylcholine receptor ...

Avermectins differentially affect ethanol intake and receptor function: Implications for developing new therapeutics for alcohol use disorders

PubMed Central

Asatryan, Liana; Yardley, Megan M.; Khoja, Sheraz; Trudell, James R.; Hyunh, Nhat; Louie, Stan G.; Petasis, Nicos A.; Alkana, Ronald L.; Davies, Daryl L.

2014-01-01

Our laboratory is investigating ivermectin (IVM) and other members of the avermectin family as new pharmaco-therapeutics to prevent and/or treat alcohol use disorders (AUDs). Prior work found that IVM significantly reduced ethanol intake in mice and that this effect likely reflects IVM’s ability to modulate ligand-gated ion channels. We hypothesized that structural modifications that enhance IVM’s effects on key receptors and/or increase its brain concentration should improve its anti-alcohol efficacy. We tested this hypothesis by comparing the abilities of IVM and two other avermectins, abamectin (ABM) and selamectin (SEL), to reduce ethanol intake in mice, to alter modulation of GABA ARs and P2X4Rs expressed in Xenopus oocytes and to increase their ability to penetrate the brain. IVM and ABM significantly reduced ethanol intake and antagonized the inhibitory effects of ethanol on P2X4R function. In contrast, SEL did not affect either measure, despite achieving higher brain concentrations than IVM and ABM. All three potentiated GABAA receptor function. These findings suggest that chemical structure and effects on receptor function play key roles in the ability of avermectins to reduce ethanol intake and that these factors are more important than brain penetration alone. The direct relationship between the effect of these avermectins on P2X4R function and ethanol intake suggest that the ability to antagonize ethanol-mediated inhibition of P2X4R function may be a good predictor of the potential of an avermectin to reduce ethanol intake and support the use of avermectins as a platform for developing novel drugs to prevent and/or treat AUDs. PMID:24451653

Progesterone receptor antagonist CDB-4124 increases depression-like behavior in mice without affecting locomotor ability

PubMed Central

Beckley, Ethan H.; Scibelli, Angela C.; Finn, Deborah A.

2010-01-01

Progesterone withdrawal has been proposed as an underlying factor in premenstrual syndrome and postpartum depression. Progesterone withdrawal induces forced swim test (FST) immobility in mice, a depression-like behavior, but the contribution of specific receptors to this effect is unclear. The role of progesterone’s GABAA receptor-modulating metabolite allopregnanolone in depression- and anxiety-related behaviors has been extensively documented, but little attention has been paid to the role of progesterone receptors. We administered the classic progesterone receptor antagonist mifepristone (RU-38486) and the specific progesterone receptor antagonist CDB-4124 to mice that had been primed with progesterone for five days, and found that both compounds induced FST immobility reliably, robustly, and in a dose-dependent fashion. Although CDB-4124 increased FST immobility, it did not suppress initial activity in a locomotor test. These findings suggest that decreased progesterone receptor activity contributes to depression-like behavior in mice, consistent with the hypothesis that progesterone withdrawal may contribute to the symptoms of premenstrual syndrome or postpartum depression. PMID:21163582

Progesterone receptor antagonist CDB-4124 increases depression-like behavior in mice without affecting locomotor ability.

PubMed

Beckley, Ethan H; Scibelli, Angela C; Finn, Deborah A

2011-07-01

Progesterone withdrawal has been proposed as an underlying factor in premenstrual syndrome and postpartum depression. Progesterone withdrawal induces forced swim test (FST) immobility in mice, a depression-like behavior, but the contribution of specific receptors to this effect is unclear. The role of progesterone's GABA(A) receptor-modulating metabolite allopregnanolone in depression- and anxiety-related behaviors has been extensively documented, but little attention has been paid to the role of progesterone receptors. We administered the classic progesterone receptor antagonist mifepristone (RU-38486) and the specific progesterone receptor antagonist CDB-4124 to mice that had been primed with progesterone for five days, and found that both compounds induced FST immobility reliably, robustly, and in a dose-dependent fashion. Although CDB-4124 increased FST immobility, it did not suppress initial activity in a locomotor test. These findings suggest that decreased progesterone receptor activity contributes to depression-like behavior in mice, consistent with the hypothesis that progesterone withdrawal may contribute to the symptoms of premenstrual syndrome or postpartum depression. Copyright © 2010 Elsevier Ltd. All rights reserved.

Modeling Multivalent Ligand-Receptor Interactions with Steric Constraints on Configurations of Cell-Surface Receptor Aggregates

PubMed Central

Monine, Michael I.; Posner, Richard G.; Savage, Paul B.; Faeder, James R.; Hlavacek, William S.

2010-01-01

Abstract We use flow cytometry to characterize equilibrium binding of a fluorophore-labeled trivalent model antigen to bivalent IgE-FcεRI complexes on RBL cells. We find that flow cytometric measurements are consistent with an equilibrium model for ligand-receptor binding in which binding sites are assumed to be equivalent and ligand-induced receptor aggregates are assumed to be acyclic. However, this model predicts extensive receptor aggregation at antigen concentrations that yield strong cellular secretory responses, which is inconsistent with the expectation that large receptor aggregates should inhibit such responses. To investigate possible explanations for this discrepancy, we evaluate four rule-based models for interaction of a trivalent ligand with a bivalent cell-surface receptor that relax simplifying assumptions of the equilibrium model. These models are simulated using a rule-based kinetic Monte Carlo approach to investigate the kinetics of ligand-induced receptor aggregation and to study how the kinetics and equilibria of ligand-receptor interaction are affected by steric constraints on receptor aggregate configurations and by the formation of cyclic receptor aggregates. The results suggest that formation of linear chains of cyclic receptor dimers may be important for generating secretory signals. Steric effects that limit receptor aggregation and transient formation of small receptor aggregates may also be important. PMID:20085718

Systematic screening for mutations in the human serotonin 1F receptor gene in patients with bipolar affective disorder and schizophrenia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shimron-Abarbanell, D.; Harms, H.; Erdmann, J.

1996-04-09

Using single strand conformational analysis we screened the complete coding sequence of the serotonin 1F (5-HT{sub 1F}) receptor gene for the presence of DNA sequence variation in a sample of 137 unrelated individuals including 45 schizophrenic patients, 46 bipolar patients, as well as 46 healthy controls. We detected only three rare sequence variants which are characterized by single base pair substitutions, namely a silent T{r_arrow}A transversion in the third position of codon 261 (encoding isoleucine), a silent C{r_arrow}T transition in the third position of codon 176 (encoding histidine), and a C{r_arrow}T transition in position -78 upstream from the start codon.more » The lack of significant mutations in patients suffering from schizophrenia and bipolar affective disorder indicates that the 5-HT{sub 1F} receptor is not commonly involved in the etiology of these diseases. 12 refs., 1 fig., 2 tabs.« less

Nuclear Receptors in Neurodegenerative Diseases

PubMed Central

Skerrett, Rebecca; Malm, Tarja; Landreth, Gary

2014-01-01

Nuclear receptors have generated substantial interest in the past decade as potential therapeutic targets for the treatment of neurodegenerative disorders. Despite years of effort, effective treatments for progressive neurodegenerative diseases such as Alzheimer’s disease, Parkinson’s disease, Huntington’s disease and ALS remain elusive, making non-classical drug targets such as nuclear receptors an attractive alternative. A substantial literature in mouse models of disease and several clinical trials have investigated the role of nuclear receptors in various neurodegenerative disorders, most prominently AD. These studies have met with mixed results, yet the majority of studies in mouse models report positive outcomes. The mechanisms by which nuclear receptor agonists affect disease pathology remain unclear. Deciphering the complex signaling underlying nuclear receptor action in neurodegenerative diseases is essential for understanding this variability in preclinical studies, and for the successful translation of nuclear receptor agonists into clinical therapies. PMID:24874548

The neuropharmacology of L-theanine(N-ethyl-L-glutamine): a possible neuroprotective and cognitive enhancing agent.

PubMed

Nathan, Pradeep J; Lu, Kristy; Gray, M; Oliver, C

2006-01-01

L-theanine (N-ethyl-L-glutamine) or theanine is a major amino acid uniquely found in green tea. L-theanine has been historically reported as a relaxing agent, prompting scientific research on its pharmacology. Animal neurochemistry studies suggest that L-theanine increases brain serotonin, dopamine, GABA levels and has micromolar affinities for AMPA, Kainate and NMDA receptors. In addition has been shown to exert neuroprotective effects in animal models possibly through its antagonistic effects on group 1 metabotrophic glutamate receptors. Behavioural studies in animals suggest improvement in learning and memory. Overall, L-theanine displays a neuropharmacology suggestive of a possible neuroprotective and cognitive enhancing agent and warrants further investigation in animals and humans.

Neuroprotective Effects of Glutamate Antagonists and Extracellular Acidity

NASA Astrophysics Data System (ADS)

Kaku, David A.; Giffard, Rona G.; Choi, Dennis W.

1993-06-01

Glutamate antagonists protect neurons from hypoxic injury both in vivo and in vitro, but in vitro studies have not been done under the acidic conditions typical of hypoxia-ischemia in vivo. Consistent with glutamate receptor antagonism, extracellular acidity reduced neuronal death in murine cortical cultures that were deprived of oxygen and glucose. Under these acid conditions, N-methyl-D-aspartate and α-amino-3-hydroxy-5-methyl-4-isox-azolepropionate-kainate antagonists further reduced neuronal death, such that some neurons tolerated prolonged oxygen and glucose deprivation almost as well as did astrocytes. Neuroprotection induced by this combination exceeded that induced by glutamate antagonists alone, suggesting that extracellular acidity has beneficial effects beyond the attenuation of ionotropic glutamate receptor activation.

Palmitoylation as a Functional Regulator of Neurotransmitter Receptors

PubMed Central

Naumenko, Vladimir S.

2018-01-01

The majority of neuronal proteins involved in cellular signaling undergo different posttranslational modifications significantly affecting their functions. One of these modifications is a covalent attachment of a 16-C palmitic acid to one or more cysteine residues (S-palmitoylation) within the target protein. Palmitoylation is a reversible modification, and repeated cycles of palmitoylation/depalmitoylation might be critically involved in the regulation of multiple signaling processes. Palmitoylation also represents a common posttranslational modification of the neurotransmitter receptors, including G protein-coupled receptors (GPCRs) and ligand-gated ion channels (LICs). From the functional point of view, palmitoylation affects a wide span of neurotransmitter receptors activities including their trafficking, sorting, stability, residence lifetime at the cell surface, endocytosis, recycling, and synaptic clustering. This review summarizes the current knowledge on the palmitoylation of neurotransmitter receptors and its role in the regulation of receptors functions as well as in the control of different kinds of physiological and pathological behavior. PMID:29849559

Double Dissociation of the Roles of Metabotropic Glutamate Receptor 5 and Oxytocin Receptor in Discrete Social Behaviors.

PubMed

Mesic, Ivana; Guzman, Yomayra F; Guedea, Anita L; Jovasevic, Vladimir; Corcoran, Kevin A; Leaderbrand, Katherine; Nishimori, Katsuhiko; Contractor, Anis; Radulovic, Jelena

2015-09-01

Social interactions in vertebrates are complex phenomena based on affective and cognitive processes. Multiple brain regions and neurotransmitter systems are involved in the expression of social behaviors, but their individual roles in specific aspects of social interactions are not well understood. Here we investigated how Gq-protein-coupled metabotropic glutamate receptor 5 (mGluR5) and oxytocin receptor (Oxtr) affect social affiliation and social memory. We used conditional genetic approaches in which the genes coding for these receptors were knocked out in the lateral septum by infusion of recombinant adeno-associated viral vectors containing Cre recombinase (AAV-Cre). Social behavior was assessed 2 weeks later using a three-chamber paradigm for sociability and preference for social novelty. Septal deletion of mGluR5 abolished sociability while leaving preference for social novelty intact. In contrast, deletion of Oxtr did not affect sociability but significantly impaired preference for social novelty. Nonsocial behaviors or memories, including novel object recognition or fear conditioning, were not affected by these genetic manipulations. Immunohistochemical analyses of the distribution of mGluR5 and Oxtr revealed non-overlapping localization of these receptors within the lateral septum, suggesting that not only different neurotransmitters but also different neuronal types contribute to sociability versus preference for social novelty. Our findings identify highly specialized roles of lateral septal mGluR5 and Oxtr in the the regulation of discrete social behaviors, and suggest that deficits in social interactions, which accompany many mental illnesses, would benefit from comprehensive treatments targeting different components of social functioning.

Double Dissociation of the Roles of Metabotropic Glutamate Receptor 5 and Oxytocin Receptor in Discrete Social Behaviors

PubMed Central

Mesic, Ivana; Guzman, Yomayra F; Guedea, Anita L; Jovasevic, Vladimir; Corcoran, Kevin A; Leaderbrand, Katherine; Nishimori, Katsuhiko; Contractor, Anis; Radulovic, Jelena

2015-01-01

Social interactions in vertebrates are complex phenomena based on affective and cognitive processes. Multiple brain regions and neurotransmitter systems are involved in the expression of social behaviors, but their individual roles in specific aspects of social interactions are not well understood. Here we investigated how Gq-protein-coupled metabotropic glutamate receptor 5 (mGluR5) and oxytocin receptor (Oxtr) affect social affiliation and social memory. We used conditional genetic approaches in which the genes coding for these receptors were knocked out in the lateral septum by infusion of recombinant adeno-associated viral vectors containing Cre recombinase (AAV-Cre). Social behavior was assessed 2 weeks later using a three-chamber paradigm for sociability and preference for social novelty. Septal deletion of mGluR5 abolished sociability while leaving preference for social novelty intact. In contrast, deletion of Oxtr did not affect sociability but significantly impaired preference for social novelty. Nonsocial behaviors or memories, including novel object recognition or fear conditioning, were not affected by these genetic manipulations. Immunohistochemical analyses of the distribution of mGluR5 and Oxtr revealed non-overlapping localization of these receptors within the lateral septum, suggesting that not only different neurotransmitters but also different neuronal types contribute to sociability versus preference for social novelty. Our findings identify highly specialized roles of lateral septal mGluR5 and Oxtr in the the regulation of discrete social behaviors, and suggest that deficits in social interactions, which accompany many mental illnesses, would benefit from comprehensive treatments targeting different components of social functioning. PMID:25824423

Fibroblast growth factor receptors in breast cancer.

PubMed

Wang, Shuwei; Ding, Zhongyang

2017-05-01

Fibroblast growth factor receptors are growth factor receptor tyrosine kinases, exerting their roles in embryogenesis, tissue homeostasis, and development of breast cancer. Recent genetic studies have identified some subtypes of fibroblast growth factor receptors as strong genetic loci associated with breast cancer. In this article, we review the recent epidemiological findings and experiment results of fibroblast growth factor receptors in breast cancer. First, we summarized the structure and physiological function of fibroblast growth factor receptors in humans. Then, we discussed the common genetic variations in fibroblast growth factor receptors that affect breast cancer risk. In addition, we also introduced the potential roles of each fibroblast growth factor receptors isoform in breast cancer. Finally, we explored the potential therapeutics targeting fibroblast growth factor receptors for breast cancer. Based on the biological mechanisms of fibroblast growth factor receptors leading to the pathogenesis in breast cancer, targeting fibroblast growth factor receptors may provide new opportunities for breast cancer therapeutic strategies.

Multiple cholinergic nicotinic receptor genes affect nicotine dependence risk in African and European Americans.

PubMed

Saccone, N L; Schwantes-An, T-H; Wang, J C; Grucza, R A; Breslau, N; Hatsukami, D; Johnson, E O; Rice, J P; Goate, A M; Bierut, L J

2010-10-01

Several independent studies show that the chromosome 15q25.1 region, which contains the CHRNA5-CHRNA3-CHRNB4 gene cluster, harbors variants strongly associated with nicotine dependence, other smoking behaviors, lung cancer and chronic obstructive pulmonary disease. We investigated whether variants in other cholinergic nicotinic receptor subunit (CHRN) genes affect the risk of nicotine dependence in a new sample of African Americans (AAs) (N = 710). We also analyzed this AA sample together with a European American (EA) sample (N = 2062, 1608 of which have been previously studied), allowing for differing effects in the two populations. Cases are current nicotine-dependent smokers and controls are non-dependent smokers. Variants in or near CHRND-CHRNG, CHRNA7 and CHRNA10 show modest association with nicotine dependence risk in the AA sample. In addition, CHRNA4, CHRNB3-CHRNA6 and CHRNB1 show association in at least one population. CHRNG and CHRNA4 harbor single nucleotide polymorphisms (SNPs) that have opposite directions of effect in the two populations. In each of the population samples, these loci substantially increase the trait variation explained, although no loci meet Bonferroni-corrected significance in the AA sample alone. The trait variation explained by three key associated SNPs in CHRNA5-CHRNA3-CHRNB4 is 1.9% in EAs and also 1.9% in AAs; this increases to 4.5% in EAs and 7.3% in AAs when we add six variants representing associations at other CHRN genes. Multiple nicotinic receptor subunit genes outside chromosome 15q25 are likely to be important in the biological processes and development of nicotine dependence, and some of these risks may be shared across diverse populations. © 2010 The Authors. Genes, Brain and Behavior © 2010 Blackwell Publishing Ltd and International Behavioural and Neural Genetics Society.

5-HT1A receptor blockade reverses GABAA receptor α3 subunit-mediated anxiolytic effects on stress-induced hyperthermia

PubMed Central

van Oorschot, Ruud; Korte, S. Mechiel; Olivier, Berend; Groenink, Lucianne

2010-01-01

Rationale Stress-related disorders are associated with dysfunction of both serotonergic and GABAergic pathways, and clinically effective anxiolytics act via both neurotransmitter systems. As there is evidence that the GABAA and the serotonin receptor system interact, a serotonergic component in the anxiolytic actions of benzodiazepines could be present. Objectives The main aim of the present study was to investigate whether the anxiolytic effects of (non-)selective α subunit GABAA receptor agonists could be reversed with 5-HT1A receptor blockade using the stress-induced hyperthermia (SIH) paradigm. Results The 5-HT1A receptor antagonist WAY-100635 (0.1–1 mg/kg) reversed the SIH-reducing effects of the non-α-subunit selective GABAA receptor agonist diazepam (1–4 mg/kg) and the GABAA receptor α3-subunit selective agonist TP003 (1 mg/kg), whereas WAY-100635 alone was without effect on the SIH response or basal body temperature. At the same time, co-administration of WAY-100635 with diazepam or TP003 reduced basal body temperature. WAY-100635 did not affect the SIH response when combined with the preferential α1-subunit GABAA receptor agonist zolpidem (10 mg/kg), although zolpidem markedly reduced basal body temperature. Conclusions The present study suggests an interaction between GABAA receptor α-subunits and 5-HT1A receptor activation in the SIH response. Specifically, our data indicate that benzodiazepines affect serotonergic signaling via GABAA receptor α3-subunits. Further understanding of the interactions between the GABAA and serotonin system in reaction to stress may be valuable in the search for novel anxiolytic drugs. PMID:20535452

Regulation of AMPA receptors by phosphorylation.

PubMed

Carvalho, A L; Duarte, C B; Carvalho, A P

2000-10-01

The AMPA receptors for glutamate are oligomeric structures that mediate fast excitatory responses in the central nervous system. Phosphorylation of AMPA receptors is an important mechanism for short-term modulation of their function, and is thought to play an important role in synaptic plasticity in different brain regions. Recent studies have shown that phosphorylation of AMPA receptors by cAMP-dependent protein kinase (PKA) and Ca2+- and calmodulin-dependent protein kinase II (CaMKII) potentiates their activity, but phosphorylation of the receptor subunits may also affect their interaction with intracellular proteins, and their expression at the plasma membrane. Phosphorylation of AMPA receptor subunits has also been investigated in relation to processes of synaptic plasticity. This review focuses on recent advances in understanding the molecular mechanisms of regulation of AMPA receptors, and their implications in synaptic plasticity.

Vascular Effects of Endothelin Receptor Antagonists Depends on Their Selectivity for ETA Versus ETB Receptors and on the Functionality of Endothelial ETB Receptors.

PubMed

Iglarz, Marc; Steiner, Pauline; Wanner, Daniel; Rey, Markus; Hess, Patrick; Clozel, Martine

2015-10-01

The goal of this study was to characterize the role of Endothelin (ET) type B receptors (ETB) on vascular function in healthy and diseased conditions and demonstrate how it affects the pharmacological activity of ET receptor antagonists (ERAs). The contribution of the ETB receptor to vascular relaxation or constriction was characterized in isolated arteries from healthy and diseased rats with systemic (Dahl-S) or pulmonary hypertension (monocrotaline). Because the role of ETB receptors is different in pathological vis-à-vis normal conditions, we compared the efficacy of ETA-selective and dual ETA/ETB ERAs on blood pressure in hypertensive rats equipped with telemetry. In healthy vessels, ETB receptors stimulation with sarafotoxin S6c induced vasorelaxation and no vasoconstriction. In contrast, in arteries of rats with systemic or pulmonary hypertension, endothelial ETB-mediated relaxation was lost while vasoconstriction on stimulation by sarafotoxin S6c was observed. In hypertensive rats, administration of the dual ETA/ETB ERA macitentan on top of a maximal effective dose of the ETA-selective ERA ambrisentan further reduced blood pressure, indicating that ETB receptors blockade provides additional benefit. Taken together, these data suggest that in pathology, dual ETA/ETB receptor antagonism can provide superior vascular effects compared with ETA-selective receptor blockade.

Endocannabinoid receptor deficiency affects maternal care and alters the dam's hippocampal oxytocin receptor and brain-derived neurotrophic factor expression.

PubMed

Schechter, M; Weller, A; Pittel, Z; Gross, M; Zimmer, A; Pinhasov, A

2013-10-01

Maternal care is the newborn's first experience of social interaction, and this influences infant survival, development and social competences throughout life. We recently found that postpartum blocking of the endocannabinoid receptor-1 (CB1R) altered maternal behaviour. In the present study, maternal care was assessed by the time taken to retrieve pups, pups' ultrasonic vocalisations (USVs) and pup body weight, comparing CB1R deleted (CB1R KO) versus wild-type (WT) mice. After culling on postpartum day 8, hippocampal expression of oxytocin receptor (OXTR), brain-derived neurotrophic factor (BDNF) and stress-mediating factors were evaluated in CB1R KO and WT dams. Comparisons were also performed with nulliparous (NP) CB1R KO and WT mice. Compared to WT, CB1R KO dams were slower to retrieve their pups. Although the body weight of the KO pups did not differ from the weight of WT pups, they emitted fewer USVs. This impairment of the dam-pup relationship correlated with a significant reduction of OXTR mRNA and protein levels among CB1R KO dams compared to WT dams. Furthermore, WT dams exhibited elevated OXTR mRNA expression, as well as increased levels of mineralocorticoid and glucocorticoid receptors, compared to WT NP mice. By contrast, CB1R KO dams showed no such elevation of OXTR expression, alongside lower BDNF and mineralocorticoid receptors, as well as elevated corticotrophin-releasing hormone mRNA levels, when compared to CB1R KO NP. Thus, it appears that the disruption of endocannabinoid signalling by CB1R deletion alters expression of the OXTR, apparently leading to deleterious effects upon maternal behaviour. © 2013 British Society for Neuroendocrinology.

Enhanced pre-synaptic glutamate release in deep-dorsal horn contributes to calcium channel alpha-2-delta-1 protein-mediated spinal sensitization and behavioral hypersensitivity

PubMed Central

Nguyen, David; Deng, Ping; Matthews, Elizabeth A; Kim, Doo-Sik; Feng, Guoping; Dickenson, Anthony H; Xu, Zao C; Luo, Z David

2009-01-01

Nerve injury-induced expression of the spinal calcium channel alpha-2-delta-1 subunit (Cavα2δ1) has been shown to mediate behavioral hypersensitivity through a yet identified mechanism. We examined if this neuroplasticity modulates behavioral hypersensitivity by regulating spinal glutamatergic neurotransmission in injury-free transgenic mice overexpressing the Cavα2δ1 proteins in neuronal tissues. The transgenic mice exhibited hypersensitivity to mechanical stimulation (allodynia) similar to the spinal nerve ligation injury model. Intrathecally delivered antagonists for N-methyl-D-aspartate (NMDA) and α-amino-3-hydroxyl-5-methylisoxazole-4-propionic acid (AMPA)/kainate receptors, but not for the metabotropic glutamate receptors, caused a dose-dependent allodynia reversal in the transgenic mice without changing the behavioral sensitivity in wild-type mice. This suggests that elevated spinal Cavα2δ1 mediates allodynia through a pathway involving activation of selective glutamate receptors. To determine if this is mediated by enhanced spinal neuronal excitability or pre-synaptic glutamate release in deep-dorsal horn, we examined wide-dynamic-range (WDR) neuron excitability with extracellular recording and glutamate-mediated excitatory postsynaptic currents with whole-cell patch recording in deep-dorsal horn of the Cavα2δ1 transgenic mice. Our data indicated that overexpression of Cavα2δ1 in neuronal tissues led to increased frequency, but not amplitude, of miniature excitatory post synaptic currents mediated mainly by AMPA/kainate receptors at physiological membrane potentials, and also by NMDA receptors upon depolarization, without changing the excitability of WDR neurons to high intensity stimulation. Together, these findings support a mechanism of Cavα2δ1-mediated spinal sensitization in which elevated Cavα2δ1 causes increased pre-synaptic glutamate release that leads to reduced excitation thresholds of post-synaptic dorsal horn neurons to innocuous

Ionotropic glutamate receptor mRNA editing in the prefrontal cortex: no alterations in schizophrenia or bipolar disorder.

PubMed

Lyddon, Rebecca; Navarrett, Scott; Dracheva, Stella

2012-07-01

Dysfunction of glutamate neurotransmission has been implicated in the pathology of schizophrenia and bipolar disorder, and one mechanism by which glutamate signalling can be altered is through RNA editing of ionotropic glutamate receptors (iGluRs). The objectives of the present study were to evaluate the editing status of iGluRs in the human prefrontal cortex, determine whether iGluR editing is associated with psychiatric disease or suicide and evaluate a potential association between editing and alternative splicing in the α-amino-3-hydroxy-5-methylisoxazole-4-propionate (AMPA) iGluR subunits' pre-mRNA. We studied specimens derived from patients with antemortem diagnoses of bipolar disorder (n = 31) or schizophrenia (n = 34) who died by suicide or other causes, and from psychiatrically healthy controls (n = 34) who died from causes other than suicide. The RNA editing at all 8 editing sites within AMPA (GluA2-4 subunits) and kainate (GluK1-2 subunits) iGluRs was analyzed using a novel real-time quantitative polymerase chain reaction assay. No differences in editing were detected among schizophrenia, bipolar or control groups or between suicide completers and patients who died from causes other than suicide. The editing efficiency was significantly higher in the flop than in the flip splicoforms of GluA3-4 AMPA subunits (all p < 0.001). The study is limited by the near absence of specimens from medicationnaive psychiatric patients and considerable variation in medication regimens among individuals, both of which introduce considerable uncertainty into the analysis of potential medication effects. We found that iGluR RNA editing status was not associated with bipolar disorder, schizophrenia or suicide. Differences in editing between flip and flop splicoforms suggest that glutamate sensitivity of receptors containing GluA3 and/or GluA4 flop subunits is moderated as a result of increased editing.

The lipid habitats of neurotransmitter receptors in brain.

PubMed

Borroni, María Virginia; Vallés, Ana Sofía; Barrantes, Francisco J

2016-11-01

Neurotransmitter receptors, the macromolecules specialized in decoding the chemical signals encrypted in the chemical signaling mechanism in the nervous system, occur either at the somatic cell surface of chemically excitable cells or at specialized subcellular structures, the synapses. Synapses have lipid compositions distinct from the rest of the cell membrane, suggesting that neurotransmitter receptors and their scaffolding and adaptor protein partners require specific lipid habitats for optimal operation. In this review we discuss some paradigmatic cases of neurotransmitter receptor-lipid interactions, highlighting the chemical nature of the intervening lipid species and providing examples of the receptor mechanisms affected by interaction with lipids. The focus is on the effects of cholesterol, glycerophospholipids and covalent fatty acid acylation on neurotransmitter receptors. We also briefly discuss the role of lipid phase states involving lateral heterogeneities of the host membrane known to modulate membrane transport, protein sorting and signaling. Modulation of neurotransmitter receptors by lipids occurs at multiple levels, affecting a wide span of activities including their trafficking, sorting, stability, residence lifetime at the cell surface, endocytosis, and recycling, among other important functional properties at the synapse. Copyright © 2016 Elsevier B.V. All rights reserved.

Function of the cytoplasmic tail of human calcitonin receptor-like receptor in complex with receptor activity-modifying protein 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuwasako, Kenji, E-mail: kuwasako@fc.miyazaki-u.ac.jp; Kitamura, Kazuo; Nagata, Sayaka

2010-02-12

Receptor activity-modifying protein 2 (RAMP2) enables calcitonin receptor-like receptor (CRLR) to form an adrenomedullin (AM)-specific receptor. Here we investigated the function of the cytoplasmic C-terminal tail (C-tail) of human (h)CRLR by co-transfecting its C-terminal mutants into HEK-293 cells stably expressing hRAMP2. Deleting the C-tail from CRLR disrupted AM-evoked cAMP production or receptor internalization, but did not affect [{sup 125}I]AM binding. We found that CRLR residues 428-439 are required for AM-evoked cAMP production, though deleting this region had little effect on receptor internalization. Moreover, pretreatment with pertussis toxin (100 ng/mL) led to significant increases in AM-induced cAMP production via wild-type CRLR/RAMP2more » complexes. This effect was canceled by deleting CRLR residues 454-457, suggesting Gi couples to this region. Flow cytometric analysis revealed that CRLR truncation mutants lacking residues in the Ser/Thr-rich region extending from Ser{sup 449} to Ser{sup 467} were unable to undergo AM-induced receptor internalization and, in contrast to the effect on wild-type CRLR, overexpression of GPCR kinases-2, -3 and -4 failed to promote internalization of CRLR mutants lacking residues 449-467. Thus, the hCRLR C-tail is crucial for AM-evoked cAMP production and internalization of the CRLR/RAMP2, while the receptor internalization is dependent on the aforementioned GPCR kinases, but not Gs coupling.« less

Influence of GRIK4 genetic variants on the electroconvulsive therapy response.

PubMed

Minelli, Alessandra; Congiu, Chiara; Ventriglia, Mariacarla; Bortolomasi, Marco; Bonvicini, Cristian; Abate, Maria; Sartori, Riccardo; Gainelli, Giulio; Gennarelli, Massimo

2016-07-28

Several lines of evidence have shown the involvement of the glutamatergic system in the function of electroconvulsive therapy (ECT). In particular, patients with treatment resistant depression (TRD) and chronic depression have lower levels of glutamate/glutamine than controls, and ECT can reverse this deficit. Genetic factors might contribute to modulating the mechanisms underlying ECT. This study aimed to evaluate the relationship between three polymorphisms (rs1954787, rs4936554 and rs11218030) of the glutamate receptor ionotropic kainate 4 (GRIK4) gene and responsiveness to ECT treatment in a sample of one hundred individuals, TRD or depressive Bipolar Disorder patients resistant to pharmacological treatments. The results revealed that GRIK4 variants were significantly associated with the response to ECT. In particular, we found that patients carrying the G allele of the GRIK4 rs11218030 had a significantly poorer response to ECT (p=2.71×10(-4)), showing five times the risk of relapse after ECT compared to the AA homozygotes. Analogously, patients carrying the GG rs1954787 genotype and rs4936554A allele carriers presented a double risk of lack of response after ECT (p=0.013 and p=0.040, respectively). In conclusion, the current study provides new evidence, indicating that some GRIK4 variants modulate the response to ECT in patients with depression resistant to treatment, suggesting a role for kainate receptor modulation. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Peroxisome proliferator-activated receptor gamma activators affect the maturation of human monocyte-derived dendritic cells.

PubMed

Gosset, P; Charbonnier, A S; Delerive, P; Fontaine, J; Staels, B; Pestel, J; Tonnel, A B; Trottein, F

2001-10-01

Peroxisome proliferator-activated receptor gamma (PPARgamma ), a member of the nuclear receptor superfamily, has recently been described as a modulator of macrophage functions and as an inhibitor of T cell proliferation. Here, we investigated the role of PPARgamma in dendritic cells (DC), the most potent antigen-presenting cells. We showed that PPARgamma is highly expressed in immature human monocyte-derived DC (MDDC) and that it may affect the immunostimulatory function of MDDC stimulated with lipopolysaccharide (LPS) or via CD40 ligand (CD40L). We found that the synthetic PPARgamma agonist rosiglitazone (as well as pioglitazone and troglitazone) significantly increases on LPS- and CD40L-activated MDDC, the surface expression of CD36 (by 184% and 104%, respectively) and CD86 (by 54% and 48%), whereas it reduces the synthesis of CD80 (by 42% and 42%). Moreover, activation of PPARgamma resulted in a dramatic decreased secretion of the Th1-promoting factor IL-12 in LPS- and CD40L-stimulated cells (by 47% and 62%), while the production of IL-1beta, TNF-alpha, IL-6 and IL-10 was unaffected. Finally, PPARgamma ligands down-modulate the synthesis of IFN-gamma -inducible protein-10 (recently termed as CXCL10) and RANTES (CCL5), both chemokines involved in the recruitment of Th1 lymphocytes (by 49% and 30%), but not the levels of the Th2 cell-attracting chemokines,macrophage-derived chemokine (CCL22) and thymus and activation regulated chemokine (CCL17), in mature MDDC. Taken together, our data suggest that activation of PPARgamma in human DC may have an impact in the orientation of primary and secondary immune responses by favoring type 2 responses.

Regulation of GABAA and Glutamate Receptor Expression, Synaptic Facilitation and Long-Term Potentiation in the Hippocampus of Prion Mutant Mice

PubMed Central

Rangel, Alejandra; Madroñal, Noelia; Massó, Agnès Gruart i.; Gavín, Rosalina; Llorens, Franc; Sumoy, Lauro; Torres, Juan María; Delgado-García, José María; Río, José Antonio Del

2009-01-01

Background Prionopathies are characterized by spongiform brain degeneration, myoclonia, dementia, and periodic electroencephalographic (EEG) disturbances. The hallmark of prioniopathies is the presence of an abnormal conformational isoform (PrPsc) of the natural cellular prion protein (PrPc) encoded by the Prnp gene. Although several roles have been attributed to PrPc, its putative functions in neuronal excitability are unknown. Although early studies of the behavior of Prnp knockout mice described minor changes, later studies report altered behavior. To date, most functional PrPc studies on synaptic plasticity have been performed in vitro. To our knowledge, only one electrophysiological study has been performed in vivo in anesthetized mice, by Curtis and coworkers. They reported no significant differences in paired-pulse facilitation or LTP in the CA1 region after Schaffer collateral/commissural pathway stimulation. Methodology/Principal Findings Here we explore the role of PrPc expression in neurotransmission and neural excitability using wild-type, Prnp −/− and PrPc-overexpressing mice (Tg20 strain). By correlating histopathology with electrophysiology in living behaving mice, we demonstrate that both Prnp −/− mice but, more relevantly Tg20 mice show increased susceptibility to KA, leading to significant cell death in the hippocampus. This finding correlates with enhanced synaptic facilitation in paired-pulse experiments and hippocampal LTP in living behaving mutant mice. Gene expression profiling using Illumina™ microarrays and Ingenuity pathways analysis showed that 129 genes involved in canonical pathways such as Ubiquitination or Neurotransmission were co-regulated in Prnp −/− and Tg20 mice. Lastly, RT-qPCR of neurotransmission-related genes indicated that subunits of GABAA and AMPA-kainate receptors are co-regulated in both Prnp −/− and Tg20 mice. Conclusions/Significance Present results demonstrate that PrPc is necessary for the proper

Stimulation of lactate receptor (HCAR1) affects cellular DNA repair capacity.

PubMed

Wagner, Waldemar; Kania, Katarzyna D; Ciszewski, Wojciech M

2017-04-01

Numerous G-protein coupled receptors have been reported to enhance cancer cell survival and resistance to clinically used chemotherapeutics. Recently, hydroxycarboxylic acid receptor 1 (HCAR1) was shown to drive lactate-dependent enhancement of cell survival and metastasis in pancreatic and breast cancers. Furthermore, our previous study confirmed the involvement of HCAR1 in lactate-related enhancement of DNA repair in cervical cancer cells. In the present study, we examined the possible mechanisms of HCAR1-mediated enhancement of DNA repair capacity. We observed that the HCAR1 agonist dihydroxybenzoic acid (DHBA) up-regulated BRCA1 (breast cancer type 1 susceptibility protein) and NBS1 (Nijmegen breakage syndrome 1) expression in HeLa cells. Moreover, HCAR1 silencing decreased mRNA and protein levels of BRCA1 by 30% and 20%, respectively. Immunocytochemical analyses of BRCA1, nibrin and DNA-PKcs indicated an increased accumulation of these proteins in cell nuclei after DHBA stimulation. Subsequently, these changes in the DNA repair protein levels translated into an enhanced DNA repair rate after doxorubicin treatment, as shown by γ-H2AX and comet assay experiments. In contrast, the down-regulation of HCAR1 decreased the efficiency of DNA repair. Finally, we observed the abrogation of DHBA-driven BRCA1 protein up-regulation and enhanced DNA repair following the preincubation of cells with the PKC inhibitor Gö6983. Taken together, our data indicate that lactate receptor/HCAR1 expression in cervical carcinoma cells may contribute to the modulation of cellular DNA repair mechanisms. Copyright © 2017 Elsevier B.V. All rights reserved.

Structure-Activity Relationship Study of Ionotropic Glutamate Receptor Antagonist (2S,3R)-3-(3-Carboxyphenyl)pyrrolidine-2-carboxylic Acid.

PubMed

Krogsgaard-Larsen, Niels; Storgaard, Morten; Møller, Charlotte; Demmer, Charles S; Hansen, Jeanette; Han, Liwei; Monrad, Rune N; Nielsen, Birgitte; Tapken, Daniel; Pickering, Darryl S; Kastrup, Jette S; Frydenvang, Karla; Bunch, Lennart

2015-08-13

Herein we describe the first structure-activity relationship study of the broad-range iGluR antagonist (2S,3R)-3-(3-carboxyphenyl)pyrrolidine-2-carboxylic acid (1) by exploring the pharmacological effect of substituents in the 4, 4', or 5' positions and the bioisosteric substitution of the distal carboxylic acid for a phosphonic acid moiety. Of particular interest is a hydroxyl group in the 4' position 2a which induced a preference in binding affinity for homomeric GluK3 over GluK1 (Ki = 0.87 and 4.8 μM, respectively). Two X-ray structures of ligand binding domains were obtained: 2e in GluA2-LBD and 2f in GluK1-LBD, both at 1.9 Å resolution. Compound 2e induces a D1-D2 domain opening in GluA2-LBD of 17.3-18.8° and 2f a domain opening in GluK1-LBD of 17.0-17.5° relative to the structures with glutamate. The pyrrolidine-2-carboxylate moiety of 2e and 2f shows a similar binding mode as kainate. The 3-carboxyphenyl ring of 2e and 2f forms contacts comparable to those of the distal carboxylate in kainate.

Combined unilateral blockade of cholinergic, peptidergic, and serotonergic receptors in the ventral respiratory column does not affect breathing in awake or sleeping goats

PubMed Central

Muere, Clarissa; Neumueller, Suzanne; Olesiak, Samantha; Miller, Justin; Langer, Thomas; Hodges, Matthew R.; Pan, Lawrence

2015-01-01

Previous work in intact awake and sleeping goats has found that unilateral blockade of excitatory inputs in the ventral respiratory column (VRC) elicits changes in the concentrations of multiple neurochemicals, including serotonin (5-HT), substance P, glycine, and GABA, while increasing or having no effect on breathing. These findings are consistent with the concept of interdependence between neuromodulators, whereby attenuation of one modulator elicits compensatory changes in other modulators to maintain breathing. Because there is a large degree of redundancy and multiplicity of excitatory inputs to the VRC, we herein tested the hypothesis that combined unilateral blockade of muscarinic acetylcholine (mACh), neurokinin-1 (NK1, the receptor for substance P), and 5-HT2A receptors would elicit changes in multiple neurochemicals, but would not change breathing. We unilaterally reverse-dialyzed a cocktail of antagonists targeting these receptors into the VRC of intact adult goats. Breathing was continuously monitored while effluent fluid from dialysis was collected for quantification of neurochemicals. We found that neither double blockade of mACh and NK1 receptors, nor triple blockade of mACh, NK1, and 5-HT2A receptors significantly affected breathing (P ≥ 0.05) in goats that were awake or in non-rapid eye movement (NREM) sleep. However, both double and triple blockade increased the effluent concentration of substance P (P < 0.001) and decreased GABA concentrations. These findings support our hypothesis and, together with past data, suggest that both in wakefulness and NREM sleep, multiple neuromodulator systems collaborate to stabilize breathing when a deficit in one or multiple excitatory neuromodulators exists. PMID:26023224

Basic pharmacology of NMDA receptors.

PubMed

Gonda, Xenia

2012-01-01

NMDA receptors are ionotropic receptors mediating glutamatergic neurotransmission and play a role in several basic functions in the central nervous system, from regulating neurodevelopment and synaptic plasticity, learning and memory formation, cognitive processes, rhythm generation necessary for locomotor activity and breathing, and excitotoxicity. Due to their complex involvement in the above processes, NMDA receptors have been established to play a role in the etiopathology of several neuropsychiatric disorders such as ischaemia and traumatic brain injury, neurodegenerative disorders, pain syndromes, addiction, affective disorders and such neurodevelopmental disorders as autism or schizophrenia. NMDA receptors contain multiple types of subunits with distinct functional and pharmacological properties making the picture more complex. These receptors also offer multiple binding sites to be targeted with pharmacons, however, early broad-spectrum NMDA receptor antagonists had limited clinical use due to their intolerable adverse effect profile. The discovery of several types of subunit selective NMDA receptor antagonists may offer valuable therapeutic possibilities for several disorders, with improved clinical efficacy and decreased side effects. However, in spite of our increasing knowledge concerning the involvement of NMDA receptors in pathological processes, molecules with a selective action, tolerable side effect profile and good clinical efficacy are still only in clinical development in the majority of cases. Nevertheless, NMDA receptors offer a novel opportunity in the treatment of various neuropsychiatric conditions.

Haematopoietic leptin receptor deficiency does not affect macrophage accumulation in adipose tissue or systemic insulin sensitivity.

PubMed

Gutierrez, Dario A; Hasty, Alyssa H

2012-03-01

The adipokine leptin is primarily produced by white adipose tissue (AT) and is a potent monocyte/macrophage chemoattractant in vitro. The long form of the leptin receptor (LepR) is required for monocyte/macrophage chemotaxis towards leptin. In this study, we examined the effects of haematopoietic LepR as well as LepR with C-C chemokine receptor 2 (CCR2) deficiency (double knockout (DKO)) on macrophage recruitment to AT after two different periods of high fat diet (HFD) feeding. Briefly, 8-week-old C57BL/6 mice were transplanted with bone marrow (BM) from Lepr(+/+), Lepr(-/-) or DKO donors (groups named BM-Lepr(+/+), BM-Lepr(-/-) and BM-DKO respectively), and were placed on an HFD for 6 or 12 weeks. At the end of the study, macrophage infiltration and the inflammatory state of AT were evaluated by real-time RT-PCR, histology and flow cytometry. In addition, glucose and insulin tolerance were assessed at both time points. Our results showed no differences in macrophage accumulation or AT inflammatory state between the BM-Lepr(+/+) and BM-Lepr(-/-) mice after 6 or 12 weeks of HFD feeding; any effects observed in the BM-DKO were attributed to the haematopoietic deficiency of CCR2. In addition, no changes in glucose or insulin tolerance were observed between groups after either period of HFD feeding. Our findings suggest that although leptin is a potent chemoattractant in vitro, haematopoietic LepR deficiency does not affect macrophage accumulation in AT in early to moderate stages of diet-induced obesity.

Aβ mediates Sigma receptor degradation via CaN/NFAT pathway

PubMed Central

Fang, Min; Zhang, Pei; Zhao, Yanxin; Jin, Aiping; Liu, Xueyuan

2016-01-01

Sigma receptor is an endoplasmic reticulum protein and belongs to non-opioid receptor. Increasing evidence shows that Sigma receptor activation can significantly attenuate AD induced neurological dysfunction and the functional deficiency of Sigma receptor plays an important role in the Aβ induced neuronal loss. This study aimed to investigate the influence of extracellular accumulation of Aβ on the Sigma receptor expression. Our results showed the increase in extracellular Aβ had little influence on the mRNA expression of Sigma receptor, but gradually reduced its protein expression. Co-immunoprecipitation was employed to evaluate the interaction of Sigma receptor with other proteins. Results showed BIP could bind to Sigma receptor to affect the ubiquitination of Sigma receptor. Further investigation showed there was a NFAT binding site at the promoter of BIP. Then, Western blot assay was performed to detect NFAT expression. Results showed extracellular Aβ affected the nuclear translocation of NFAT and the CaN activity of NFAT also increased with the accumulation of extracellular Aβ. In this study, NFAT-BIP luciferase reporter gene system was constructed. Results showed NFAT was able to regulate the transcription of BIP. Thus, we speculate that extracellular Aβ accumulation may activate CaN/NFAT signaling pathway to induce chaperone BIP expression, which results in Sigma receptor ubiquitination and its degradation. PMID:27648137

Systems Reconsolidation Reveals a Selective Role for the Anterior Cingulate Cortex in Generalized Contextual Fear Memory Expression

PubMed Central

Einarsson, Einar Ö; Pors, Jennifer; Nader, Karim

2015-01-01

After acquisition, hippocampus-dependent memories undergo a systems consolidation process, during which they become independent of the hippocampus and dependent on the anterior cingulate cortex (ACC) for memory expression. However, consolidated remote memories can become transiently hippocampus-dependent again following memory reactivation. How this systems reconsolidation affects the role of the ACC in remote memory expression is not known. Using contextual fear conditioning, we show that the expression of 30-day-old remote memory can transiently be supported by either the ACC or the dorsal hippocampus following memory reactivation, and that the ACC specifically mediates expression of remote generalized contextual fear memory. We found that suppression of neural activity in the ACC with the AMPA/kainate receptor antagonist 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) impaired the expression of remote, but not recent, contextual fear memory. Fear expression was not affected by this treatment if preceded by memory reactivation 6 h earlier, nor was it affected by suppression of neural activity in the dorsal hippocampus with the GABA-receptor agonist muscimol. However, simultaneous targeting of both the ACC and the dorsal hippocampus 6 h after memory reactivation disrupted contextual fear memory expression. Second, we observed that expression of a 30-day-old generalized contextual fear memory in a novel context was not affected by memory reactivation 6 h earlier. However, intra-ACC CNQX infusion before testing impaired contextual fear expression in the novel context, but not the original training context. Together, these data suggest that although the dorsal hippocampus may be recruited during systems reconsolidation, the ACC remains necessary for the expression of generalized contextual fear memory. PMID:25091528

Systems reconsolidation reveals a selective role for the anterior cingulate cortex in generalized contextual fear memory expression.

PubMed

Einarsson, Einar Ö; Pors, Jennifer; Nader, Karim

2015-01-01

After acquisition, hippocampus-dependent memories undergo a systems consolidation process, during which they become independent of the hippocampus and dependent on the anterior cingulate cortex (ACC) for memory expression. However, consolidated remote memories can become transiently hippocampus-dependent again following memory reactivation. How this systems reconsolidation affects the role of the ACC in remote memory expression is not known. Using contextual fear conditioning, we show that the expression of 30-day-old remote memory can transiently be supported by either the ACC or the dorsal hippocampus following memory reactivation, and that the ACC specifically mediates expression of remote generalized contextual fear memory. We found that suppression of neural activity in the ACC with the AMPA/kainate receptor antagonist 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) impaired the expression of remote, but not recent, contextual fear memory. Fear expression was not affected by this treatment if preceded by memory reactivation 6 h earlier, nor was it affected by suppression of neural activity in the dorsal hippocampus with the GABA-receptor agonist muscimol. However, simultaneous targeting of both the ACC and the dorsal hippocampus 6 h after memory reactivation disrupted contextual fear memory expression. Second, we observed that expression of a 30-day-old generalized contextual fear memory in a novel context was not affected by memory reactivation 6 h earlier. However, intra-ACC CNQX infusion before testing impaired contextual fear expression in the novel context, but not the original training context. Together, these data suggest that although the dorsal hippocampus may be recruited during systems reconsolidation, the ACC remains necessary for the expression of generalized contextual fear memory.

G Protein-Coupled Receptors in Anopheles gambiae

NASA Astrophysics Data System (ADS)

Hill, Catherine A.; Fox, A. Nicole; Pitts, R. Jason; Kent, Lauren B.; Tan, Perciliz L.; Chrystal, Mathew A.; Cravchik, Anibal; Collins, Frank H.; Robertson, Hugh M.; Zwiebel, Laurence J.

2002-10-01

We used bioinformatic approaches to identify a total of 276 G protein-coupled receptors (GPCRs) from the Anopheles gambiae genome. These include GPCRs that are likely to play roles in pathways affecting almost every aspect of the mosquito's life cycle. Seventy-nine candidate odorant receptors were characterized for tissue expression and, along with 76 putative gustatory receptors, for their molecular evolution relative to Drosophila melanogaster. Examples of lineage-specific gene expansions were observed as well as a single instance of unusually high sequence conservation.

Pathophysiological consequences of receptor mistraffic: Tales from the platelet P2Y12 receptor.

PubMed

Cunningham, Margaret R; Aungraheeta, Riyaad; Mundell, Stuart J

2017-07-05

Genetic variations in G protein-coupled receptor (GPCR) genes can disrupt receptor function in a wide variety of human genetic diseases, including platelet bleeding disorders. Platelets are critical for haemostasis with inappropriate platelet activation leading to the development of arterial thrombosis, which can result in heart attack and stroke whilst decreased platelet activity is associated with an increased risk of bleeding. GPCRs expressed on the surface of platelets play key roles in regulating platelet activity and therefore function. Receptors include purinergic receptors (P2Y 1 and P2Y 12 ), proteinase-activated receptor (PAR1 and PAR4) and thromboxane receptors (TPα), among others. Pharmacological blockade of these receptors forms a powerful therapeutic tool in the treatment and prevention of arterial thrombosis. With the advance of genomic technologies, there has been a substantial increase in the identification of naturally occurring rare and common GPCR variants. These variants include single-nucleotide polymorphisms (SNPs) and insertion or deletions that have the potential to alter GPCR expression or function. A number of defects in platelet GPCRs that disrupt receptor function have now been characterized in patients with mild bleeding disorders. This review will focus on rare, function-disrupting variants of platelet GPCRs with particular emphasis upon mutations in the P2Y 12 receptor gene that affect receptor traffic to modulate platelet function. Further this review will outline how the identification and characterization of function-disrupting GPCR mutations provides an essential link in translating our detailed understanding of receptor traffic and function in cell line studies into relevant human biological systems. Copyright © 2017. Published by Elsevier B.V.

A novel highly selective 5-HT6 receptor antagonist attenuates ethanol and nicotine seeking but does not affect inhibitory response control in Wistar rats.

PubMed

de Bruin, N M W J; McCreary, A C; van Loevezijn, A; de Vries, T J; Venhorst, J; van Drimmelen, M; Kruse, C G

2013-01-01

Recent studies suggest a potential role for 5-hydroxytryptamine(6) (5-HT(6)) receptors in the regulation of addictive behavior. In the present study, our aim was to investigate whether the novel highly selective 5-HT(6) receptor antagonist compound (CMP) 42 affected nicotine and ethanol seeking behavior in Wistar rats. We have also studied whether CMP 42 had beneficial effects in a model of impulse control, as measured in the 5-choice serial reaction time task (5-CSRTT). Rats were trained to nose poke to receive intravenous infusions of nicotine or an ethanol drop. CMP 42 (3-30 mg/kg intraperitoneally, i.p.) was administered to investigate the effects on nicotine self-administration. Rats were also tested for cue-induced reinstatement of nicotine and ethanol seeking. In addition, the effects of CMP 42 were studied on the number of anticipatory responses in the 5-CSRTT. CMP 42 was effective in reducing nicotine self-administration and reinstatement of nicotine seeking at a dose of 30 mg/kg (i.p.). CMP 42 was also effective in reducing reinstatement of ethanol seeking (30 mg/kg i.p.). In contrast, CMP 42 did not affect anticipatory responding at doses tested, indicating no effects on impulse control. These results add to a body of evidence implicating the 5-HT(6) receptor as a viable target for the control of drug abuse. Specifically, we demonstrated for the first time effects on nicotine self-administration and on nicotine and ethanol reinstatement. Further, these effects are probably not mediated by effects on impulse control. Copyright © 2012 Elsevier B.V. All rights reserved.

GLYX-13, a NMDA Receptor Glycine-Site Functional Partial Agonist, Induces Antidepressant-Like Effects Without Ketamine-Like Side Effects

PubMed Central

Burgdorf, Jeffrey; Zhang, Xiao-lei; Nicholson, Katherine L; Balster, Robert L; David Leander, J; Stanton, Patric K; Gross, Amanda L; Kroes, Roger A; Moskal, Joseph R

2013-01-01

Recent human clinical studies with the NMDA receptor (NMDAR) antagonist ketamine have revealed profound and long-lasting antidepressant effects with rapid onset in several clinical trials, but antidepressant effects were preceded by dissociative side effects. Here we show that GLYX-13, a novel NMDAR glycine-site functional partial agonist, produces an antidepressant-like effect in the Porsolt, novelty induced hypophagia, and learned helplessness tests in rats without exhibiting substance abuse-related, gating, and sedative side effects of ketamine in the drug discrimination, conditioned place preference, pre-pulse inhibition and open-field tests. Like ketamine, the GLYX-13-induced antidepressant-like effects required AMPA/kainate receptor activation, as evidenced by the ability of NBQX to abolish the antidepressant-like effect. Both GLYX-13 and ketamine persistently (24 h) enhanced the induction of long-term potentiation of synaptic transmission and the magnitude of NMDAR-NR2B conductance at rat Schaffer collateral-CA1 synapses in vitro. Cell surface biotinylation studies showed that both GLYX-13 and ketamine led to increases in both NR2B and GluR1 protein levels, as measured by Western analysis, whereas no changes were seen in mRNA expression (microarray and qRT-PCR). GLYX-13, unlike ketamine, produced its antidepressant-like effect when injected directly into the medial prefrontal cortex (MPFC). These results suggest that GLYX-13 produces an antidepressant-like effect without the side effects seen with ketamine at least in part by directly modulating NR2B-containing NMDARs in the MPFC. Furthermore, the enhancement of ‘metaplasticity' by both GLYX-13 and ketamine may help explain the long-lasting antidepressant effects of these NMDAR modulators. GLYX-13 is currently in a Phase II clinical development program for treatment-resistant depression. PMID:23303054

Gating characteristics control glutamate receptor distribution and trafficking in vivo.

PubMed

Petzoldt, Astrid G; Lee, Yü-Hien; Khorramshahi, Omid; Reynolds, Eric; Plested, Andrew J R; Herzel, Hanspeter; Sigrist, Stephan J

2014-09-08

Glutamate-releasing synapses dominate excitatory release in the brain. Mechanisms governing their assembly are of major importance for circuit development and long-term plasticity underlying learning and memory. AMPA/Kainate-type glutamate receptors (GluRs) are tetrameric ligand-gated ion channels that open their ion-conducting pores in response to binding of the neurotransmitter. Changes in subunit composition of postsynaptic GluRs are highly relevant for plasticity and development of glutamatergic synapses [1-4]. To date, posttranslational modifications, mostly operating via the intracellular C-terminal domains (CTDs) of GluRs, are presumed to be the major regulator of trafficking [5]. In recent years, structural and electrophysiological analyses have improved our understanding of GluR gating mechanism [6-11]. However, whether conformational changes subsequent to glutamate binding may per se be able to influence GluR trafficking has remained an unaddressed question. Using a Drosophila system allowing for extended visualization of GluR trafficking in vivo, we here provide evidence that mutations changing the gating behavior alter GluR distribution and trafficking. GluR mutants associated with reduced charge transfer segregated from coexpressed wild-type GluRs on the level of individual postsynaptic densities. Segregation was lost upon blocking of evoked glutamate release. Photobleaching experiments suggested increased mobility of mutants with reduced charge transfer, which accumulated prematurely during early steps of synapse assembly, but failed to further increase their level in accordance with assembly of the presynaptic scaffold. In summary, gating characteristics seem to be a new variable for the understanding of GluR trafficking relevant to both development and plasticity. Copyright © 2014 Elsevier Ltd. All rights reserved.

Glutamatergic targets for new alcohol medications

PubMed Central

Spanagel, Rainer; Krystal, John H.

2013-01-01

Rationale An increasingly compelling literature points to a major role for the glutamate system in mediating the effects of alcohol on behavior and the pathophysiology of alcoholism. Preclinical studies indicate that glutamate signaling mediates certain aspects of ethanol’s intoxicating and rewarding effects, and undergoes adaptations following chronic alcohol exposure that may contribute to the withdrawal, craving and compulsive drug-seeking that drive alcohol abuse and alcoholism. Objectives We discuss the potential for targeting the glutamate system as a novel pharmacotherapeutic approach to treating alcohol use disorders, focusing on five major components of the glutamate system: the N-methyl-D-aspartate (NMDA) receptor and specific NMDA subunits, the glycineB site on the NMDA receptors (NMDAR), L-alpha-amino-3-hydroxy-5-methyl-isoxazole-4-propionic acid ionotropic (AMPA) and kainate (KAR) receptors, metabotropic receptors (mGluR), and glutamate transporters. Results Chronic alcohol abuse produces a hyperglutamatergic state, characterized by elevated extracellular glutamate and altered glutamate receptors and transporters. Pharmacologically manipulating glutamatergic neurotransmission alters alcohol-related behaviors including intoxication, withdrawal, and alcohol-seeking, in rodents and human subjects. Blocking NMDA and AMPA receptors reduces alcohol consumption in rodents, but side-effects may limit this as a therapeutic approach. Selectively targeting NMDA and AMPA receptor subunits (e.g., GluN2B, GluA3), or the NMDAR glycineB site offers an alternative approach. Blocking mGluR5 potently affects various alcohol-related behaviors in rodents, and mGluR2/3 agonism also suppresses alcohol consumption. Finally, glutamate transporter upregulation may mitigate behavioral and neurotoxic sequelae of excess glutamate caused by alcohol. Conclusions Despite the many challenges that remain, targeting the glutamate system offers genuine promise for developing new

Desensitization of the nicotinic acetylcholine receptor by diisopropylfluorophosphate.

PubMed

Eldefrawi, M E; Schweizer, G; Bakry, N M; Valdes, J J

1988-01-01

The interaction of diisopropylfluorophosphate (DFP) with the nicotinic acetylcholine (ACh) receptor of Torpedo electric organ was studied, using [3H]-phencyclidine ([3H]-PCP) as a reporter probe. Phencyclidine binds with different kinetics to resting, activated, and desensitized receptor conformations. Although DFP did not inhibit binding of [3H]-ACh or 125I-alpha-bungarotoxin (BGT) to the receptor recognition sites and potentiated in a time-dependent manner [3H]-PCP binding to the receptor's high-affinity allosteric site, it inhibited the ACh- or carbamylcholine-stimulated [3H]-PCP binding. This suggested that DFP bound to a third kind of site on the receptor and affected receptor conformation. Preincubation of the membranes with DFP increased the receptor's affinity for carbamylcholine by eightfold and raised the pseudo-first-order rate of [3H]-PCP binding to that of an agonist-desensitized receptor. Accordingly, it is suggested that DFP induces receptor desensitization by binding to a site that is distinct from the recognition or high-affinity noncompetitive sites.

Cellular mechanisms underlying an effect of "early handling" on pCREB and BDNF in the neonatal rat hippocampus.

PubMed

Garoflos, Efstathios; Stamatakis, Antonios; Mantelas, Athanasios; Philippidis, Helen; Stylianopoulou, Fotini

2005-08-09

Early experiences have long-term effects on brain function and behavior. However, the precise mechanisms involved still remain elusive. In an effort to address this issue, we employed the model of "early handling", which is known to affect the ability of the adult organism to respond to stressful stimuli, and determined its effects on hippocampal pCREB and BDNF 2, 4, and 8 h later. 8 h following "handling" on postnatal day 1, there was an increase in pCREB and BDNF positive cells in the hippocampus, a brain area which is a specific target of "handling". On the other hand, vehicle injection resulted in decreased pCREB and BDNF in both handled and non-handled animals 2 and 4 h later. The "handling"-induced increase of pCREB and BDNF was cancelled by inhibition of NMDA, AMPA/kainate, GABA-A, 5-HT1A or 5-HT2A/C receptors, as well as L-type voltage-gated Ca(2+) channels. It thus appears that "early handling" activates these neurotransmitter receptors, leading to increased intracellular Ca(2+), phosphorylation of the transcription factor CREB, and increased BDNF expression. BDNF can then exert its morphogenetic effects and thus "imprint" the effects of "handling" on the brain.

The Identification of Novel Protein-Protein Interactions in Liver that Affect Glucagon Receptor Activity

PubMed Central

Froese, Sean; Dai, Feihan F.; Robitaille, Mélanie; Bhattacharjee, Alpana; Huang, Xinyi; Jia, Weiping; Angers, Stéphane; Wheeler, Michael B.; Wei, Li

2015-01-01

Glucagon regulates glucose homeostasis by controlling glycogenolysis and gluconeogenesis in the liver. Exaggerated and dysregulated glucagon secretion can exacerbate hyperglycemia contributing to type 2 diabetes (T2D). Thus, it is important to understand how glucagon receptor (GCGR) activity and signaling is controlled in hepatocytes. To better understand this, we sought to identify proteins that interact with the GCGR to affect ligand-dependent receptor activation. A Flag-tagged human GCGR was recombinantly expressed in Chinese hamster ovary (CHO) cells, and GCGR complexes were isolated by affinity purification (AP). Complexes were then analyzed by mass spectrometry (MS), and protein-GCGR interactions were validated by co-immunoprecipitation (Co-IP) and Western blot. This was followed by studies in primary hepatocytes to assess the effects of each interactor on glucagon-dependent glucose production and intracellular cAMP accumulation, and then in immortalized CHO and liver cell lines to further examine cell signaling. Thirty-three unique interactors were identified from the AP-MS screening of GCGR expressing CHO cells in both glucagon liganded and unliganded states. These studies revealed a particularly robust interaction between GCGR and 5 proteins, further validated by Co-IP, Western blot and qPCR. Overexpression of selected interactors in mouse hepatocytes indicated that two interactors, LDLR and TMED2, significantly enhanced glucagon-stimulated glucose production, while YWHAB inhibited glucose production. This was mirrored with glucagon-stimulated cAMP production, with LDLR and TMED2 enhancing and YWHAB inhibiting cAMP accumulation. To further link these interactors to glucose production, key gluconeogenic genes were assessed. Both LDLR and TMED2 stimulated while YWHAB inhibited PEPCK and G6Pase gene expression. In the present study, we have probed the GCGR interactome and found three novel GCGR interactors that control glucagon-stimulated glucose production

Recent developments in the study of opioid receptors.

PubMed

Cox, Brian M

2013-04-01

It is now about 40 years since Avram Goldstein proposed the use of the stereoselectivity of opioid receptors to identify these receptors in neural membranes. In 2012, the crystal structures of the four members of the opioid receptor family were reported, providing a structural basis for understanding of critical features affecting the actions of opiate drugs. This minireview summarizes these recent developments in our understanding of opiate receptors. Receptor function is also influenced by amino acid substitutions in the protein sequence. Among opioid receptor genes, one polymorphism is much more frequent in human populations than the many others that have been found, but the functional significance of this single nucleotide polymorphism (SNP) has been unclear. Recent studies have shed new light on how this SNP might influence opioid receptor function. In this minireview, the functional significance of the most prevalent genetic polymorphism among the opioid receptor genes is also considered.

Glutamate Receptors in the Central Nucleus of the Amygdala Mediate Cisplatin-Induced Malaise and Energy Balance Dysregulation through Direct Hindbrain Projections.

PubMed

Alhadeff, Amber L; Holland, Ruby A; Nelson, Alexandra; Grill, Harvey J; De Jonghe, Bart C

2015-08-05

Cisplatin chemotherapy is used commonly to treat a variety of cancers despite severe side effects such as nausea, vomiting, and anorexia that compromise quality of life and limit treatment adherence. The neural mechanisms mediating these side effects remain elusive despite decades of clinical use. Recent data highlight the dorsal vagal complex (DVC), lateral parabrachial nucleus (lPBN), and central nucleus of the amygdala (CeA) as potential sites of action in mediating the side effects of cisplatin. Here, results from immunohistochemical studies in rats identified a population of cisplatin-activated DVC neurons that project to the lPBN and a population of cisplatin-activated lPBN calcitonin gene-related peptide (CGRP, a marker for glutamatergic neurons in the lPBN) neurons that project to the CeA, outlining a neuroanatomical circuit that is activated by cisplatin. CeA gene expressions of AMPA and NMDA glutamate receptor subunits were markedly increased after cisplatin treatment, suggesting that CeA glutamate receptor signaling plays a role in mediating cisplatin side effects. Consistent with gene expression results, behavioral/pharmacological data showed that CeA AMPA/kainate receptor blockade attenuates cisplatin-induced pica (a proxy for nausea/behavioral malaise in nonvomiting laboratory rodents) and that CeA NMDA receptor blockade attenuates cisplatin-induced anorexia and body weight loss in addition to pica, demonstrating that glutamate receptor signaling in the CeA is critical for the energy balance dysregulation caused by cisplatin treatment. Together, these data highlight a novel circuit and CGRP/glutamatergic mechanism through which cisplatin-induced malaise and energy balance dysregulation are mediated. To treat cancer effectively, patients must follow prescribed chemotherapy treatments without interruption, yet most cancer treatments produce side effects that devastate quality of life (e.g., nausea, vomiting, anorexia, weight loss). Although hundreds of

Glutamate Receptors in the Central Nucleus of the Amygdala Mediate Cisplatin-Induced Malaise and Energy Balance Dysregulation through Direct Hindbrain Projections

PubMed Central

Alhadeff, Amber L.; Holland, Ruby A.; Nelson, Alexandra; Grill, Harvey J.

2015-01-01

Cisplatin chemotherapy is used commonly to treat a variety of cancers despite severe side effects such as nausea, vomiting, and anorexia that compromise quality of life and limit treatment adherence. The neural mechanisms mediating these side effects remain elusive despite decades of clinical use. Recent data highlight the dorsal vagal complex (DVC), lateral parabrachial nucleus (lPBN), and central nucleus of the amygdala (CeA) as potential sites of action in mediating the side effects of cisplatin. Here, results from immunohistochemical studies in rats identified a population of cisplatin-activated DVC neurons that project to the lPBN and a population of cisplatin-activated lPBN calcitonin gene-related peptide (CGRP, a marker for glutamatergic neurons in the lPBN) neurons that project to the CeA, outlining a neuroanatomical circuit that is activated by cisplatin. CeA gene expressions of AMPA and NMDA glutamate receptor subunits were markedly increased after cisplatin treatment, suggesting that CeA glutamate receptor signaling plays a role in mediating cisplatin side effects. Consistent with gene expression results, behavioral/pharmacological data showed that CeA AMPA/kainate receptor blockade attenuates cisplatin-induced pica (a proxy for nausea/behavioral malaise in nonvomiting laboratory rodents) and that CeA NMDA receptor blockade attenuates cisplatin-induced anorexia and body weight loss in addition to pica, demonstrating that glutamate receptor signaling in the CeA is critical for the energy balance dysregulation caused by cisplatin treatment. Together, these data highlight a novel circuit and CGRP/glutamatergic mechanism through which cisplatin-induced malaise and energy balance dysregulation are mediated. SIGNIFICANCE STATEMENT To treat cancer effectively, patients must follow prescribed chemotherapy treatments without interruption, yet most cancer treatments produce side effects that devastate quality of life (e.g., nausea, vomiting, anorexia, weight loss

Type-7 metabotropic glutamate receptors negatively regulate α1-adrenergic receptor signalling.

PubMed

Iacovelli, Luisa; Di Menna, Luisa; Peterlik, Daniel; Stangl, Christina; Orlando, Rosamaria; Molinaro, Gemma; De Blasi, Antonio; Bruno, Valeria; Battaglia, Giuseppe; Flor, Peter J; Uschold-Schmidt, Nicole; Nicoletti, Ferdinando

2017-02-01

We studied the interaction between mGlu7 and α 1 -adrenergic receptors in heterologous expression systems, brain slices, and living animals. L-2-Amino-4-phosphonobutanoate (L-AP4), and l-serine-O-phosphate (L-SOP), which activate group III mGlu receptors, restrained the stimulation of polyphosphoinositide (PI) hydrolysis induced by the α 1 -adrenergic receptor agonist, phenylephrine, in HEK 293 cells co-expressing α 1 -adrenergic and mGlu7 receptors. The inibitory action of L-AP4 was abrogated by (i) the mGlu7 receptor antagonist, XAP044; (ii) the C-terminal portion of type-2 G protein coupled receptor kinase; and (iii) the MAP kinase inhibitors, UO126 and PD98059. This suggests that the functional interaction between mGlu7 and α 1 -adrenergic receptors was mediated by the βγ-subunits of the G i protein and required the activation of the MAP kinase pathway. Remarkably, activation of neither mGlu2 nor mGlu4 receptors reduced α 1 -adrenergic receptor-mediated PI hydrolysis. In mouse cortical slices, both L-AP4 and L-SOP were able to attenuate norepinephrine- and phenylephrine-stimulated PI hydrolysis at concentrations consistent with the activation of mGlu7 receptors. L-AP4 failed to affect norepinephrine-stimulated PI hydrolysis in cortical slices from mGlu7 -/- mice, but retained its inhibitory activity in slices from mGlu4 -/- mice. At behavioural level, i.c.v. injection of phenylephrine produced antidepressant-like effects in the forced swim test. The action of phenylephrine was attenuated by L-SOP, which was inactive per se. Finally, both phenylephrine and L-SOP increased corticosterone levels in mice, but the increase was halved when the two drugs were administered in combination. Our data demonstrate that α 1 -adrenergic and mGlu7 receptors functionally interact and suggest that this interaction might be targeted in the treatment of stress-related disorders. Copyright © 2016 Elsevier Ltd. All rights reserved.

Prevalence of thyrotropin receptor germline mutations and clinical courses in 89 hyperthyroid patients with diffuse goiter and negative anti-thyrotropin receptor antibodies.

PubMed

Nishihara, Eijun; Fukata, Shuji; Hishinuma, Akira; Amino, Nobuyuki; Miyauchi, Akira

2014-05-01

We studied the frequency of thyrotropin (TSH) receptor mutations in hyperthyroid patients with diffuse goiter and negative TSH receptor antibodies (TRAb), and the clinical pictures of the hyperthyroid patients in the presence and absence of mutations. From 2003 through 2012, 89 hyperthyroid patients with diffuse goiter and negative TRAb based on a second- or third-generation assay underwent sequence analysis of the TSH receptor gene from peripheral leukocytes. The outcome of hyperthyroidism in patients with a TSH receptor mutation and their affected family members was compared with that in patients without any mutation after a 1-10-year follow-up. Germline mutations of the TSH receptor occurred in 4 of the 89 patients (4.5%), including 3 definitive constitutively activating mutations (L512Q, E575K, and D617Y). The main difference in the clinical outcome of hyperthyroidism was that no patients with a TSH receptor mutation achieved euthyroidism throughout the follow-up, while 23.5% of patients without any mutation entered remission. The progression from subclinical to overt hyperthyroidism was not significantly different between patients with or without a mutation. Meanwhile, 10.3% of TRAb-negative patients without any TSH receptor mutation developed TRAb-positive Graves' hyperthyroidism during the follow-up. The prevalence of nonautoimmune hyperthyroidism with TSH receptor mutations is lower than that of latent Graves' disease in TRAb-negative patients with hyperthyroidism. However, all affected patients with a TSH receptor mutation showed persistent hyperthyroidism regardless of subclinical or overt hyperthyroidism throughout the follow-up.

Estrogen receptor-alpha genotype affects exercise-related reduction of arterial stiffness.

PubMed

Hayashi, Koichiro; Maeda, Seiji; Iemitsu, Motoyuki; Otsuki, Takeshi; Sugawara, Jun; Tanabe, Takumi; Miyauchi, Takashi; Kuno, Shinya; Ajisaka, Ryuichi; Matsuda, Mitsuo

2008-02-01

Arterial stiffness, an independent risk factor for cardiovascular disease, increases with advancing age. Arterial stiffness is improved by regular exercise, but individual responses to exercise training are variable. Given that estrogen and estrogen receptor-alpha (ER-alpha) can induce vasodilation and can exert an antiatherosclerotic effect in vessels, we hypothesized that gene polymorphisms of ER-alpha might influence the ability of regular exercise to improve arterial stiffness in postmenopausal women. One hundred ninety-five healthy postmenopausal women (62 +/- 6 yr, mean +/- SD) participated in our cross-sectional study. We determined the genotype of single-nucleotide polymorphisms (SNP) at -401T/C of intron 1 of the ER-alpha gene. Arterial stiffness was measured by brachial-ankle pulse wave velocity (baPWV), and daily physical activity was estimated by a uniaxial accelerometer. Subjects were divided into active and inactive groups according to the median value (200 kcal.d(-1)) of energy expenditure. baPWV in individuals with the TT variant of -401T/C genotype were significantly higher than for individuals with the TC+CC genotype. No significant differences in mean baPWV values were found between the active group and the inactive group (P = 0.09). A significant reduction of baPWV secondary to increased daily physical activity was observed in individuals with the TC+CC genotype but not in individuals with the TT genotype (TT/active: 1470 +/- 36 cm.s(-1); TT/inactive: 1457 +/- 34 cm.s(-1); TC+CC/active: 1359 +/- 21 cm.s(-1); TC+CC/inactive: 1433 +/- 24 cm.s(-1)). These results suggest that ER-alpha polymorphism affects the regular exercise-related reduction in arterial stiffness in healthy postmenopausal women.

Glucagon-like peptide-1 acutely affects renal blood flow and urinary flow rate in spontaneously hypertensive rats despite significantly reduced renal expression of GLP-1 receptors.

PubMed

Ronn, Jonas; Jensen, Elisa P; Wewer Albrechtsen, Nicolai J; Holst, Jens Juul; Sorensen, Charlotte M

2017-12-01

Glucagon-like peptide-1 (GLP-1) is an incretin hormone increasing postprandial insulin release. GLP-1 also induces diuresis and natriuresis in humans and rodents. The GLP-1 receptor is extensively expressed in the renal vascular tree in normotensive rats where acute GLP-1 treatment leads to increased mean arterial pressure (MAP) and increased renal blood flow (RBF). In hypertensive animal models, GLP-1 has been reported both to increase and decrease MAP. The aim of this study was to examine expression of renal GLP-1 receptors in spontaneously hypertensive rats (SHR) and to assess the effect of acute intrarenal infusion of GLP-1. We hypothesized that GLP-1 would increase diuresis and natriuresis and reduce MAP in SHR. Immunohistochemical staining and in situ hybridization for the GLP-1 receptor were used to localize GLP-1 receptors in the kidney. Sevoflurane-anesthetized normotensive Sprague-Dawley rats and SHR received a 20 min intrarenal infusion of GLP-1 and changes in MAP, RBF, heart rate, dieresis, and natriuresis were measured. The vasodilatory effect of GLP-1 was assessed in isolated interlobar arteries from normo- and hypertensive rats. We found no expression of GLP-1 receptors in the kidney from SHR. However, acute intrarenal infusion of GLP-1 increased MAP, RBF, dieresis, and natriuresis without affecting heart rate in both rat strains. These results suggest that the acute renal effects of GLP-1 in SHR are caused either by extrarenal GLP-1 receptors activating other mechanisms (e.g., insulin) to induce the renal changes observed or possibly by an alternative renal GLP-1 receptor. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

Modulation of neuronal and recombinant GABAA receptors by redox reagents

PubMed Central

Amato, Alessandra; Connolly, Christopher N; Moss, Stephen J; Smart, Trevor G

1999-01-01

The functional role played by the postulated disulphide bridge in γ-aminobutyric acid type A (GABAA) receptors and its susceptibility to oxidation and reduction were studied using recombinant (murine receptor subunits expressed in human embryonic kidney cells) and rat neuronal GABAA receptors in conjunction with whole-cell and single channel patch-clamp techniques. The reducing agent dithiothreitol (DTT) reversibly potentiated GABA-activated responses (IGABA) of α1β1 or α1β2 receptors while the oxidizing reagent 5,5′-dithio-bis-(2-nitrobenzoic acid) (DTNB) caused inhibition. Redox modulation of IGABA was independent of GABA concentration, membrane potential and the receptor agonist and did not affect the GABA EC50 or Hill coefficient. The endogenous antioxidant reduced glutathione (GSH) also potentiated IGABA in α1β2 receptors, while both the oxidized form of DTT and glutathione (GSSG) caused small inhibitory effects. Recombinant receptors composed of α1β1γ2S or α1β2γ2S were considerably less sensitive to DTT and DTNB. For neuronal GABAA receptors, IGABA was enhanced by flurazepam and relatively unaffected by redox reagents. However, in cultured sympathetic neurones, nicotinic acetylcholine-activated responses were inhibited by DTT whilst in cerebellar granule neurones, NMDA-activated currents were potentiated by DTT and inhibited by DTNB. Single GABA-activated ion channel currents exhibited a conductance of 16 pS for α1β1 constructs. DTT did not affect the conductance or individual open time constants determined from dwell time histograms, but increased the mean open time by affecting the channel open probability without increasing the number of cell surface receptors. A kinetic model of the effects of DTT and DTNB suggested that the receptor existed in equilibrium between oxidized and reduced forms. DTT increased the rate of entry into reduced receptor forms and also into desensitized states. DTNB reversed these kinetic effects. Our results

Expression of plasma membrane receptor genes during megakaryocyte development

PubMed Central

Sun, Sijie; Wang, Wenjing; Latchman, Yvette; Gao, Dayong; Aronow, Bruce

2013-01-01

Megakaryocyte (MK) development is critically informed by plasma membrane-localized receptors that integrate a multiplicity of environmental cues. Given that the current understanding about receptors and ligands involved in megakaryocytopoiesis is based on single targets, we performed a genome-wide search to identify a plasma membrane receptome for developing MKs. We identified 40 transmembrane receptor genes as being upregulated during MK development. Seven of the 40 receptor-associated genes were selected to validate the dataset. These genes included: interleukin-9 receptor (IL9R), transforming growth factor, β receptor II (TGFBR2), interleukin-4 receptor (IL4R), colony stimulating factor-2 receptor-beta (CSFR2B), adiponectin receptor (ADIPOR2), thrombin receptor (F2R), and interleukin-21 receptor (IL21R). RNA and protein analyses confirmed their expression in primary human MKs. Matched ligands to IL9R, TGFBR2, IL4R, CSFR2B, and ADIPOR2 affected megakaryocytopoiesis. IL9 was unique in its ability to increase the number of MKs formed. In contrast, MK colony formation was inhibited by adiponectin, TGF-β, IL4, and GM-CSF. The thrombin-F2R axis affected platelet function, but not MK development, while IL21 had no apparent detectable effects. ADP-induced platelet aggregation was suppressed by IL9, TGF-β, IL4, and adiponectin. Overall, six of seven of the plasma membrane receptors were confirmed to have functional roles in MK and platelet biology. Also, results show for the first time that adiponectin plays a regulatory role in MK development. Together these data support a strong likelihood that the 40 transmembrane genes identified as being upregulated during MK development will be an important resource to the research community for deciphering the complex repertoire of environmental cues regulating megakaryocytopoiesis and/or platelet function. PMID:23321270

Hydronephrosis alters cardiac ACE2 and Mas receptor expression in mice.

PubMed

Zhang, Yanling; Ma, Lulu; Wu, Junyan; Chen, Tingting

2015-06-01

Hydronephrosis is characterized by substantial loss of tubules and affects renin secretion in the kidney. However, whether alterations of angiotensin-converting enzyme (ACE), ACE2 and Mas receptor in the heart are observed in hydronephrosis is unknown. Thus, we assessed these components in hydronephrotic mice treated with AT1 receptor blockade and ACE inhibitor. Hydronephrosis was induced by left ureteral ligation in Balb/C mice except sham-operated animals. The levels of cardiac ACE, ACE2 and Mas receptor were measured after treatment of losartan or enalapril. Hydronephrosis led to an increase of ACE level and a decrease of ACE2 and Mas receptor in the heart. Losartan decreased cardiac ACE level, but ACE2 and Mas receptor levels significantly increased in hydronephrotic mice (p < 0.01). Enalapril increased ACE2 levels (p < 0.01), but did not affect Mas receptor in the heart. Plasma renin activity (PRA) and Ang II decreased in hydronephrotic mice, but significantly increased after treatment with losartan or enalapril. Hydronephrosis increased cardiac ACE and suppressed ACE2 and Mas receptor levels. AT1 blockade caused sustained activation of cardiac ACE2 and Mas receptor, but ACE inhibitor had the limitation of such activation of Mas receptor in hydronephrotic animals. © The Author(s) 2015.

Neomycin is a platelet-derived growth factor (PDGF) antagonist that allows discrimination of PDGF alpha- and beta-receptor signals in cells expressing both receptor types.

PubMed

Vassbotn, F S; Ostman, A; Siegbahn, A; Holmsen, H; Heldin, C H

1992-08-05

The aminoglycoside neomycin has recently been found to affect certain platelet-derived growth factor (PDGF) responses in C3H/10T1/2 C18 fibroblasts. Using porcine aortic endothelial cells transfected with PDGF alpha- or beta-receptors, we explored the possibility that neomycin interferes with the interaction between the different PDGF isoforms and their receptors. We found that neomycin (5 mM) inhibited the binding of 125I-PDGF-BB to the alpha-receptor with only partial effect on the binding of 125I-PDGF-AA; in contrast, the binding of 125I-PDGF-BB to the beta-receptor was not affected by the aminoglycoside. Scatchard analyses showed that neomycin (5 mM) decreased the number of binding sites for PDGF-BB on alpha-receptor-expressing cells by 87%. Together with cross-competition studies with 125I-labeled PDGF homodimers, the effect of neomycin indicates that PDGF-AA and PDGF-BB bind to both common and unique structures on the PDGF alpha-receptor. Neomycin specifically inhibited the autophosphorylation of the alpha-receptor by PDGF-BB, with less effect on the phosphorylation induced by PDGF-AA and no effect on the phosphorylation of the beta-receptor by PDGF-BB. Thus, neomycin is a PDGF isoform- and receptor-specific antagonist that provides a possibility to compare the signal transduction pathways of alpha- and beta-receptors in cells expressing both receptor types. This approach was used to show that activation of PDGF beta-receptors by PDGF-BB mediated a chemotactic response in human fibroblasts, whereas activation of alpha-receptors by the same ligand inhibited chemotaxis.

Immunization against exon 1 decapeptides from the lutropin/choriogonadotropin receptor or the follitropin receptor as potential male contraceptive.

PubMed

Remy, J J; Couture, L; Rabesona, H; Haertle, T; Salesse, R

1996-11-01

Pituitary gonadotropin hormones lutropin (LH) and follitropin (FSH) control steroidogenesis and gametogenesis in male and female gonads through interaction with G protein-coupled receptors, LHR and FSHR. In the male, LH acts on leydig cells and is mostly responsible for the acquisition of puberty and the production of androgens while FSH, together with androgens, regulates spermatogenesis within Sertoli cells. We have engineered filamentous phages displaying mouse LHR and human FSHR decapeptides chosen in hormone binding regions. Peptides from both receptors displayed on phages belong either to the receptor specific exon 1 (amino acids 18-27) or to the homologous exon 4 (amino acids 98-107). Vaccination of prepubertal BALB/c male mice with hybrid phages using sub-cutaneous or intraperitoneal injections induced immunity against receptors. Anti-receptor immunization produced agonist or antagonist effects depending only on the circulating levels of the antibodies. Both anti-LHR and anti-FSHR vaccines induced efficient as well as reversible male contraception, through different mechanisms: targeting LH receptors inhibited or hyperstimulated Leydig cell testosterone production while targeting FSH receptors did not affect testosterone levels.

Kynurenic acid analogues with improved affinity and selectivity for the glycine site on the N-methyl-D-aspartate receptor from rat brain.

PubMed

Foster, A C; Kemp, J A; Leeson, P D; Grimwood, S; Donald, A E; Marshall, G R; Priestley, T; Smith, J D; Carling, R W

1992-05-01

The glycine site on the N-methyl-D-aspartate (NMDA) subtype of receptors for the excitatory neurotransmitter glutamate is a potential target for the development of neuroprotective drugs. We report here two chemical series of glycine site antagonists derived from kynurenic acid (KYNA), with greatly improved potency and selectivity. Disubstitution with chlorine or bromine in the 5- and 7-positions of KYNA increased affinity for [3H]glycine binding sites in rat cortex/hippocampus P2 membranes, with a parallel increase of potency for antagonism of NMDA-evoked responses in the rat cortical wedge preparation. The optimal compound was 5-I,7-Cl-KYNA, with an IC50 for [3H]glycine binding of 29 nM and an apparent Kb in the cortical wedge preparation of 0.41 microM. Reduction of the right-hand ring of 5,7-diCl-KYNA reduced affinity by 10-fold, but this was restored by substitution in the 4-position with the trans-phenylamide and further improved in the trans-benzylamide. The optimal compound was the transphenylurea (L-689,560), with an IC50 of 7.4 nM and an apparent Kb of 0.13 microM. Both series of compounds displayed a high degree of selectivity for the glycine site, having IC50 values of greater than 10 microM versus radioligand binding to the glutamate recognition sites of NMDA, alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA), and kainate receptors and the strychnine-sensitive glycine receptor. Selectivity versus AMPA receptor-mediated responses was also apparent in the rat cortical wedge and in patch-clamp recordings of cortical neurons in culture. Experiments using [3H]dizocilpine (MK-801) binding indicated that 5,7-diBr-KYNA, 5,7-diCl-KYNA, 5-I,7-Cl-KYNA, and L-689,560 all behaved as full antagonists and were competitive with glycine. Patch-clamp recordings of cortical neurons in culture also indicated that NMDA-induced currents were antagonized by competition for the glycine site, and gave no evidence for partial agonist activity. pKi values for 5,7-di

Researching glutamate – induced cytotoxicity in different cell lines: a comparative/collective analysis/study

PubMed Central

Kritis, Aristeidis A.; Stamoula, Eleni G.; Paniskaki, Krystallenia A.; Vavilis, Theofanis D.

2015-01-01

Although glutamate is one of the most important excitatory neurotransmitters of the central nervous system, its excessive extracellular concentration leads to uncontrolled continuous depolarization of neurons, a toxic process called, excitotoxicity. In excitotoxicity glutamate triggers the rise of intracellular Ca2+ levels, followed by up regulation of nNOS, dysfunction of mitochondria, ROS production, ER stress, and release of lysosomal enzymes. Excessive calcium concentration is the key mediator of glutamate toxicity through over activation of ionotropic and metabotropic receptors. In addition, glutamate accumulation can also inhibit cystine (CySS) uptake by reversing the action of the CySS/glutamate antiporter. Reversal of the antiporter action reinforces the aforementioned events by depleting neurons of cysteine and eventually glutathione’s reducing potential. Various cell lines have been employed in the pursuit to understand the mechanism(s) by which excitotoxicity affects the cells leading them ultimately to their demise. In some cell lines glutamate toxicity is exerted mainly through over activation of NMDA, AMPA, or kainate receptors whereas in other cell lines lacking such receptors, the toxicity is due to glutamate induced oxidative stress. However, in the greatest majority of the cell lines ionotropic glutamate receptors are present, co-existing to CySS/glutamate antiporters and metabotropic glutamate receptors, supporting the assumption that excitotoxicity effect in these cells is accumulative. Different cell lines differ in their responses when exposed to glutamate. In this review article the responses of PC12, SH-SY5Y, HT-22, NT-2, OLCs, C6, primary rat cortical neurons, RGC-5, and SCN2.2 cell systems are systematically collected and analyzed. PMID:25852482

Effect of endurance training on seizure susceptibility, behavioral changes and neuronal damage after kainate-induced status epilepticus in spontaneously hypertensive rats.

PubMed

Tchekalarova, J; Shishmanova, M; Atanasova, D; Stefanova, M; Alova, L; Lazarov, N; Georgieva, K

2015-11-02

The therapeutic efficacy of regular physical exercises in an animal model of epilepsy and depression comorbidity has been confirmed previously. In the present study, we examined the effects of endurance training on susceptibility to kainate (KA)-induced status epilepticus (SE), behavioral changes and neuronal damage in spontaneously hypertensive rats (SHRs). Male SHRs were randomly divided into two groups. One group was exercised on a treadmill with submaximal loading for four weeks and the other group was sedentary. Immediately after the training period, SE was evoked in half of the sedentary and trained rats by KA, while the other half of the two groups received saline. Basal systolic (SP), diastolic (DP) and mean arterial pressure (MAP) of all rats were measured at the beginning and at the end of the training period. Anxiety, memory and depression-like behaviour were evaluated a month after SE. The release of 5-HT in the hippocampus was measured using a liquid scintillation method and neuronal damage was analyzed by hematoxylin and eosin staining. SP and MAP of exercised SHRs decreased in comparison with the initial values. The increased resistance of SHRs to KA-induced SE was accompanied by an elongated latent seizure-free period, improved object recognition memory and antidepressant effect after the training program. While the anticonvulsant and positive behavioral effects of endurance training were accompanied by an increase of 5-HT release in the hippocampus, it did not exert neuroprotective activity. Our results indicate that prior exercise is an effective means to attenuate KA-induced seizures and comorbid behavioral changes in a model of hypertension and epilepsy suggesting a potential influence of hippocampal 5-HT on a comorbid depression. However, this beneficial impact does not prevent the development of epilepsy and concomitant brain damage. Copyright © 2015 Elsevier B.V. All rights reserved.

Sex Differences in Serotonin 1 Receptor Binding in Rat Brain

NASA Astrophysics Data System (ADS)

Fischette, Christine T.; Biegon, Anat; McEwen, Bruce S.

1983-10-01

Male and female rats exhibit sex differences in binding by serotonin 1 receptors in discrete areas of the brain, some of which have been implicated in the control of ovulation and of gonadotropin release. The sex-specific changes in binding, which occur in response to the same hormonal (estrogenic) stimulus, are due to changes in the number of binding sites. Castration alone also affects the number of binding sites in certain areas. The results lead to the conclusion that peripheral hormones modulate binding by serotonin 1 receptors. The status of the serotonin receptor system may affect the reproductive capacity of an organism and may be related to sex-linked emotional disturbances in humans.

Sexual experience affects reproductive behavior and preoptic androgen receptors in male mice

PubMed Central

Swaney, William T.; Dubose, Brittany N.; Curley, James P.; Champagne, Frances A.

2012-01-01

Reproductive behavior in male rodents is made up of anticipatory and consummatory elements which are regulated in the brain by sensory systems, reward circuits and hormone signaling. Gonadal steroids play a key role in the regulation of male sexual behavior via steroid receptors in the hypothalamus and preoptic area. Typical patterns of male reproductive behavior have been characterized, however these are not fixed but are modulated by adult experience. We assessed the effects of repeated sexual experience on male reproductive behavior of C57BL/6 mice; including measures of olfactory investigation of females, mounting, intromission and ejaculation. The effects of sexual experience on the number of cells expressing either androgen receptor (AR) or estrogen receptor alpha (ERα) in the primary brain nuclei regulating male sexual behavior was also measured. Sexually experienced male mice engaged in less sniffing of females before initiating sexual behavior and exhibited shorter latencies to mount and intromit, increased frequency of intromission, and increased duration of intromission relative to mounting. No changes in numbers of ERα-positive cells were observed, however sexually experienced males had increased numbers of AR-positive cells in the medial preoptic area (MPOA); the primary regulatory nucleus for male sexual behavior. These results indicate that sexual experience results in a qualitative change in male reproductive behavior in mice that is associated with increased testosterone sensitivity in the MPOA and that this nucleus may play a key integrative role in mediating the effects of sexual experience on male behavior. PMID:22266118

Genetic variants of dopamine D2 receptor impact heterodimerization with dopamine D1 receptor.

PubMed

Błasiak, Ewa; Łukasiewicz, Sylwia; Szafran-Pilch, Kinga; Dziedzicka-Wasylewska, Marta

2017-04-01

The human dopamine D2 receptor gene has three polymorphic variants that alter its amino acid sequence: alanine substitution by valine in position 96 (V96A), proline substitution by serine in position 310 (P310S) and serine substitution by cysteine in position 311 (S311C). Their functional role has never been the object of extensive studies, even though there is some evidence that their occurrence correlates with schizophrenia. The HEK293 cell line was transfected with dopamine D1 and D2 receptors (or genetic variants of the D2 receptor), coupled to fluorescent proteins which allowed us to measure the extent of dimerization of these receptors, using a highly advanced biophysical approach (FLIM-FRET). Additionally, Fluoro-4 AM was used to examine changes in the level of calcium release after ligand stimulation of cells expressing different combinations of dopamine receptors. Using FLIM-FRET experiments we have shown that in HEK 293 expressing dopamine receptors, polymorphic mutations in the D2 receptor play a role in dimmer formation with the dopamine D1 receptor. The association level of dopamine receptors is affected by ligand administration, with variable effects depending on polymorphic variant of the D2 dopamine receptor. We have found that the level of heteromer formation is reflected by calcium ion release after ligand stimulation and have observed variations of this effect dependent on the polymorphic variant and the ligand. The data presented in this paper support the hypothesis on the role of calcium signaling regulated by the D1-D2 heteromer which may be of relevance for schizophrenia etiology. Copyright © 2016 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

Local activation of uterine Toll-like receptor 2 and 2/6 decreases embryo implantation and affects uterine receptivity in mice.

PubMed

Sanchez-Lopez, Javier Arturo; Caballero, Ignacio; Montazeri, Mehrnaz; Maslehat, Nasim; Elliott, Sarah; Fernandez-Gonzalez, Raul; Calle, Alexandra; Gutierrez-Adan, Alfonso; Fazeli, Alireza

2014-04-01

Embryo implantation is a complex interaction between maternal endometrium and embryonic structures. Failure to implant is highly recurrent and impossible to diagnose. Inflammation and infections in the female reproductive tract are common causes of infertility, embryo loss, and preterm labor. The current work describes how the activation of endometrial Toll-like receptor (TLR) 2 and 2/6 reduces embryo implantation chances. We developed a morphometric index to evaluate the effects of the TLR 2/6 activation along the uterine horn (UH). TLR 2/6 ligation reduced the endometrial myometrial and glandular indexes and increased the luminal index. Furthermore, TLR 2/6 activation increased the proinflammatory cytokines such as interleukin (IL)-1beta and monocyte chemotactic protein (MCP)-1 in UH lavages in the preimplantation day and IL-1 receptor antagonist in the implantation day. The engagement of TLR 2/6 with its ligand in the UH during embryo transfer severely affected the rate of embryonic implantation (45.00% ± 6.49% vs. 16.69% ± 5.01%, P < 0.05, control vs. test, respectively). Furthermore, this interference with the embryo implantation process was verified using an in vitro model of human embryo implantation where trophoblast spheroids failed to adhere to a monolayer of TLR 2- and TLR 2/6-activated endometrial cells. The inhibition of TLR receptors 2 and 6 in the presence of their specific ligands restored the ability of the spheroids to bind to the endometrial cells. In conclusion, the activation of the innate immune system in the uterus at the time of implantation interfered with the endometrial receptivity and reduced the chances of implantation success.

Glutaraldehyde pretreatment blocks phospholipase A2 modulation of adrenergic receptors.

PubMed

Cohen, R M; McLellan, C; Dauphin, M; Hirata, F

1985-01-07

Treatment of rat cerebral cortical membranes with phospholipase A2 affects, in a parallel fashion, beta-, alpha 1- and alpha 2-adrenergic receptor binding, but not the affinity of these receptors for their respective ligands. Pretreatment of membranes with 0.1 percent glutaraldehyde blocks the effects of phospholipase A2 on adrenergic receptor binding. The results support the hypothesis that desensitization or "masking" of adrenergic receptors may involve changes in membrane lipid composition. Furthermore, glutaraldehyde may prove a useful tool in the investigation of the dynamic roles of lipids in receptor function and more specifically, their regulation and coupling to physiological events.

Charge and Geometry of Residues in the Loop 2 β Hairpin Differentially Affect Agonist and Ethanol Sensitivity in Glycine Receptors

PubMed Central

Perkins, Daya I.; Trudell, James R.; Asatryan, Liana; Alkana, Ronald L.

2012-01-01

Recent studies highlighted the importance of loop 2 of α1 glycine receptors (GlyRs) in the propagation of ligand-binding energy to the channel gate. Mutations that changed polarity at position 52 in the β hairpin of loop 2 significantly affected sensitivity to ethanol. The present study extends the investigation to charged residues. We found that substituting alanine with the negative glutamate at position 52 (A52E) significantly left-shifted the glycine concentration response curve and increased sensitivity to ethanol, whereas the negative aspartate substitution (A52D) significantly right-shifted the glycine EC50 but did not affect ethanol sensitivity. It is noteworthy that the uncharged glutamine at position 52 (A52Q) caused only a small right shift of the glycine EC50 while increasing ethanol sensitivity as much as A52E. In contrast, the shorter uncharged asparagine (A52N) caused the greatest right shift of glycine EC50 and reduced ethanol sensitivity to half of wild type. Collectively, these findings suggest that charge interactions determined by the specific geometry of the amino acid at position 52 (e.g., the 1-Å chain length difference between aspartate and glutamate) play differential roles in receptor sensitivity to agonist and ethanol. We interpret these results in terms of a new homology model of GlyR based on a prokaryotic ion channel and propose that these mutations form salt bridges to residues across the β hairpin (A52E-R59 and A52N-D57). We hypothesize that these electrostatic interactions distort loop 2, thereby changing agonist activation and ethanol modulation. This knowledge will help to define the key physical-chemical parameters that cause the actions of ethanol in GlyRs. PMID:22357974

Cow's milk increases the activities of human nuclear receptors peroxisome proliferator-activated receptors alpha and delta and retinoid X receptor alpha involved in the regulation of energy homeostasis, obesity, and inflammation.

PubMed

Suhara, W; Koide, H; Okuzawa, T; Hayashi, D; Hashimoto, T; Kojo, H

2009-09-01

The nuclear peroxisome proliferator-activated receptors (PPAR) have been shown to play crucial roles in regulating energy homeostasis including lipid and carbohydrate metabolism, inflammatory responses, and cell proliferation, differentiation, and survival. Because PPAR agonists have the potential to prevent or ameliorate diseases such as hyperlipidemia, diabetes, atherosclerosis, and obesity, we have explored new natural agonists for PPAR. For this purpose, cow's milk was tested for agonistic activity toward human PPAR subtypes using a reporter gene assay. Milk increased human PPARalpha activity in a dose-dependent manner with a 3.2-fold increase at 0.5% (vol/vol). It also enhanced human PPARdelta activity in a dose-dependent manner with an 11.5-fold increase at 0.5%. However, it only slightly affected human PPARgamma activity. Ice cream, butter, and yogurt also increased the activities of PPARalpha and PPARdelta, whereas vegetable cream affected activity of PPARdelta but not PPARalpha. Skim milk enhanced the activity of PPAR to a lesser degree than regular milk. Milk and fresh cream increased the activity of human retinoid X receptor (RXR)alpha as well as PPARalpha and PPARdelta, whereas neither affected vitamin D3 receptor, estrogen receptors alpha and beta, or thyroid receptors alpha and beta. Both milk and fresh cream were shown by quantitative real-time PCR to increase the quantity of mRNA for uncoupling protein 2 (UCP2), an energy expenditure gene, in a dose-dependent manner. The increase in UCP2 mRNA was found to be reduced by treatment with PPARdelta-short interfering (si)RNA. This study unambiguously clarified at the cellular level that cow's milk increased the activities of human PPARalpha, PPARdelta, and RXRalpha. The possible role in enhancing the activities of PPARalpha, PPARdelta, and RXRalpha, and the health benefits of cow's milk were discussed.

Functional plasticity of the N/OFQ-NOP receptor system determines analgesic properties of NOP receptor agonists

PubMed Central

Schröder, W; Lambert, D G; Ko, M C; Koch, T

2014-01-01

Despite high sequence similarity between NOP (nociceptin/orphanin FQ opioid peptide) and opioid receptors, marked differences in endogenous ligand selectivity, signal transduction, phosphorylation, desensitization, internalization and trafficking have been identified; underscoring the evolutionary difference between NOP and opioid receptors. Activation of NOP receptors affects nociceptive transmission in a site-specific manner, with antinociceptive effects prevailing after peripheral and spinal activation, and pronociceptive effects after supraspinal activation in rodents. The net effect of systemically administered NOP receptor agonists on nociception is proposed to depend on the relative contribution of peripheral, spinal and supraspinal activation, and this may depend on experimental conditions. Functional expression and regulation of NOP receptors at peripheral and central sites of the nociceptive pathway exhibits a high degree of plasticity under conditions of neuropathic and inflammatory pain. In rodents, systemically administered NOP receptor agonists exerted antihypersensitive effects in models of neuropathic and inflammatory pain. However, they were largely ineffective in acute pain while concomitantly evoking severe motor side effects. In contrast, systemic administration of NOP receptor agonists to non-human primates (NHPs) exerted potent and efficacious antinociception in the absence of motor and sedative side effects. The reason for this species difference with respect to antinociceptive efficacy and tolerability is not clear. Moreover, co-activation of NOP and μ-opioid peptide (MOP) receptors synergistically produced antinociception in NHPs. Hence, both selective NOP receptor as well as NOP/MOP receptor agonists may hold potential for clinical use as analgesics effective in conditions of acute and chronic pain. PMID:24762001

The cannabinoid receptor CB1 modulates the signaling properties of the lysophosphatidylinositol receptor GPR55.

PubMed

Kargl, Julia; Balenga, Nariman; Parzmair, Gerald P; Brown, Andrew J; Heinemann, Akos; Waldhoer, Maria

2012-12-28

The G protein-coupled receptor (GPCR) 55 (GPR55) and the cannabinoid receptor 1 (CB1R) are co-expressed in many tissues, predominantly in the central nervous system. Seven transmembrane spanning (7TM) receptors/GPCRs can form homo- and heteromers and initiate distinct signaling pathways. Recently, several synthetic CB1 receptor inverse agonists/antagonists, such as SR141716A, AM251, and AM281, were reported to activate GPR55. Of these, SR141716A was marketed as a promising anti-obesity drug, but was withdrawn from the market because of severe side effects. Here, we tested whether GPR55 and CB1 receptors are capable of (i) forming heteromers and (ii) whether such heteromers could exhibit novel signaling patterns. We show that GPR55 and CB1 receptors alter each others signaling properties in human embryonic kidney (HEK293) cells. We demonstrate that the co-expression of FLAG-CB1 receptors in cells stably expressing HA-GPR55 specifically inhibits GPR55-mediated transcription factor activation, such as nuclear factor of activated T-cells and serum response element, as well as extracellular signal-regulated kinases (ERK1/2) activation. GPR55 and CB1 receptors can form heteromers, but the internalization of both receptors is not affected. In addition, we observe that the presence of GPR55 enhances CB1R-mediated ERK1/2 and nuclear factor of activated T-cell activation. Our data provide the first evidence that GPR55 can form heteromers with another 7TM/GPCR and that this interaction with the CB1 receptor has functional consequences in vitro. The GPR55-CB1R heteromer may play an important physiological and/or pathophysiological role in tissues endogenously co-expressing both receptors.

The Cannabinoid Receptor CB1 Modulates the Signaling Properties of the Lysophosphatidylinositol Receptor GPR55*

PubMed Central

Kargl, Julia; Balenga, Nariman; Parzmair, Gerald P.; Brown, Andrew J.; Heinemann, Akos; Waldhoer, Maria

2012-01-01

The G protein-coupled receptor (GPCR) 55 (GPR55) and the cannabinoid receptor 1 (CB1R) are co-expressed in many tissues, predominantly in the central nervous system. Seven transmembrane spanning (7TM) receptors/GPCRs can form homo- and heteromers and initiate distinct signaling pathways. Recently, several synthetic CB1 receptor inverse agonists/antagonists, such as SR141716A, AM251, and AM281, were reported to activate GPR55. Of these, SR141716A was marketed as a promising anti-obesity drug, but was withdrawn from the market because of severe side effects. Here, we tested whether GPR55 and CB1 receptors are capable of (i) forming heteromers and (ii) whether such heteromers could exhibit novel signaling patterns. We show that GPR55 and CB1 receptors alter each others signaling properties in human embryonic kidney (HEK293) cells. We demonstrate that the co-expression of FLAG-CB1 receptors in cells stably expressing HA-GPR55 specifically inhibits GPR55-mediated transcription factor activation, such as nuclear factor of activated T-cells and serum response element, as well as extracellular signal-regulated kinases (ERK1/2) activation. GPR55 and CB1 receptors can form heteromers, but the internalization of both receptors is not affected. In addition, we observe that the presence of GPR55 enhances CB1R-mediated ERK1/2 and nuclear factor of activated T-cell activation. Our data provide the first evidence that GPR55 can form heteromers with another 7TM/GPCR and that this interaction with the CB1 receptor has functional consequences in vitro. The GPR55-CB1R heteromer may play an important physiological and/or pathophysiological role in tissues endogenously co-expressing both receptors. PMID:23161546

Allelic variation of the Tas1r3 taste receptor gene selectively affects taste responses to sweeteners: evidence from 129.B6-Tas1r3 congenic mice

PubMed Central

Inoue, Masashi; Glendinning, John I.; Theodorides, Maria L.; Harkness, Sarah; Li, Xia; Bosak, Natalia; Beauchamp, Gary K.; Bachmanov, Alexander A.

2008-01-01

The Tas1r3 gene encodes the T1R3 receptor protein, which is involved in sweet taste transduction. To characterize ligand specificity of the T1R3 receptor and the genetic architecture of sweet taste responsiveness, we analyzed taste responses of 129.B6-Tas1r3 congenic mice to a variety of chemically diverse sweeteners and glucose polymers with three different measures: consumption in 48-h two-bottle preference tests, initial licking responses, and responses of the chorda tympani nerve. The results were generally consistent across the three measures. Allelic variation of the Tas1r3 gene influenced taste responsiveness to nonnutritive sweeteners (saccharin, acesulfame-K, sucralose, SC-45647), sugars (sucrose, maltose, glucose, fructose), sugar alcohols (erythritol, sorbitol), and some amino acids (d-tryptophan, d-phenylalanine, l-proline). Tas1r3 genotype did not affect taste responses to several sweet-tasting amino acids (l-glutamine, l-threonine, l-alanine, glycine), glucose polymers (Polycose, maltooligosaccharide), and nonsweet NaCl, HCl, quinine, monosodium glutamate, and inosine 5′-monophosphate. Thus Tas1r3 polymorphisms affect taste responses to many nutritive and nonnutritive sweeteners (all of which must interact with a taste receptor involving T1R3), but not to all carbohydrates and amino acids. In addition, we found that the genetic architecture of sweet taste responsiveness changes depending on the measure of taste response and the intensity of the sweet taste stimulus. Variation in the T1R3 receptor influenced peripheral taste responsiveness over a wide range of sweetener concentrations, but behavioral responses to higher concentrations of some sweeteners increasingly depended on mechanisms that could override input from the peripheral taste system. PMID:17911381

Myelin Proteolipid Protein Complexes with αv Integrin and AMPA Receptors In Vivo and Regulates AMPA-Dependent Oligodendrocyte Progenitor Cell Migration through the Modulation of Cell-Surface GluR2 Expression

PubMed Central

Harlow, Danielle E.; Saul, Katherine E.; Komuro, Hitoshi

2015-01-01

In previous studies, stimulation of ionotropic AMPA/kainate glutamate receptors on cultured oligodendrocyte cells induced the formation of a signaling complex that includes the AMPA receptor, integrins, calcium-binding proteins, and, surprisingly, the myelin proteolipid protein (PLP). AMPA stimulation of cultured oligodendrocyte progenitor cells (OPCs) also caused an increase in OPC migration. The current studies focused primarily on the formation of the PLP–αv integrin–AMPA receptor complex in vivo and whether complex formation impacts OPC migration in the brain. We found that in wild-type cerebellum, PLP associates with αv integrin and the calcium-impermeable GluR2 subunit of the AMPA receptor, but in mice lacking PLP, αv integrin did not associate with GluR2. Live imaging studies of OPC migration in ex vivo cerebellar slices demonstrated altered OPC migratory responses to neurotransmitter stimulation in the absence of PLP and GluR2 or when αv integrin levels were reduced. Chemotaxis assays of purified OPCs revealed that AMPA stimulation was neither attractive nor repulsive but clearly increased the migration rate of wild-type but not PLP null OPCs. AMPA receptor stimulation of wild-type OPCs caused decreased cell-surface expression of the GluR2 AMPA receptor subunit and increased intracellular Ca2+ signaling, whereas PLP null OPCs did not reduce GluR2 at the cell surface or increase Ca2+ signaling in response to AMPA treatment. Together, these studies demonstrate that PLP is critical for OPC responses to glutamate signaling and has important implications for OPC responses when levels of glutamate are high in the extracellular space, such as following demyelination. SIGNIFICANCE STATEMENT After demyelination, such as occurs in multiple sclerosis, remyelination of axons is often incomplete, leading to loss of neuronal function and clinical disability. Remyelination may fail because oligodendrocyte precursor cells (OPCs) do not completely migrate into

History of retinoic acid receptors.

PubMed

Benbrook, Doris M; Chambon, Pierre; Rochette-Egly, Cécile; Asson-Batres, Mary Ann

2014-01-01

The discovery of retinoic acid receptors arose from research into how vitamins are essential for life. Early studies indicated that Vitamin A was metabolized into an active factor, retinoic acid (RA), which regulates RNA and protein expression in cells. Each step forward in our understanding of retinoic acid in human health was accomplished by the development and application of new technologies. Development cDNA cloning techniques and discovery of nuclear receptors for steroid hormones provided the basis for identification of two classes of retinoic acid receptors, RARs and RXRs, each of which has three isoforms, α, β and ɣ. DNA manipulation and crystallographic studies revealed that the receptors contain discrete functional domains responsible for binding to DNA, ligands and cofactors. Ligand binding was shown to induce conformational changes in the receptors that cause release of corepressors and recruitment of coactivators to create functional complexes that are bound to consensus promoter DNA sequences called retinoic acid response elements (RAREs) and that cause opening of chromatin and transcription of adjacent genes. Homologous recombination technology allowed the development of mice lacking expression of retinoic acid receptors, individually or in various combinations, which demonstrated that the receptors exhibit vital, but redundant, functions in fetal development and in vision, reproduction, and other functions required for maintenance of adult life. More recent advancements in sequencing and proteomic technologies reveal the complexity of retinoic acid receptor involvement in cellular function through regulation of gene expression and kinase activity. Future directions will require systems biology approaches to decipher how these integrated networks affect human stem cells, health, and disease.

Electroacupuncture alleviates affective pain in an inflammatory pain rat model

PubMed Central

Zhang, Yu; Meng, Xianze; Li, Aihui; Xin, Jiajia; Berman, Brian M.; Lao, Lixing; Tan, Ming; Ren, Ke; Zhang, Rui-Xin

2011-01-01

Pain has both sensory-discriminative and emotional-affective dimensions. Previous studies demonstrate that electroacupuncture (EA) alleviates the sensory dimension but do not address the affective. An inflammatory pain rat model, produced by a complete Freund adjuvant (CFA) injection into the hind paw, was combined with a conditioned place avoidance (CPA) test to determine whether EA inhibits spontaneous pain-induced affective response and, if so, to study the possibility that rostral anterior cingulate cortex (rACC) opioids underlie this effect. Male Sprague-Dawley rats (250–275g, Harlan) were used. The rats showed place aversion (i.e. affective pain) by spending less time in a pain-paired compartment after conditioning than during a preconditioning test. Systemic non-analgesic morphine (0.5 and 1.0 mg/ kg, i.p.) inhibited the affective reaction, suggesting that the affective dimension is underpinned by mechanisms different from those of the sensory dimension of pain. Morphine at 0.5 and at 1 mg/kg did not induce reward. Rats given EA treatment before pain-paired conditioning at GB 30 showed no aversion to the pain-paired compartment, indicating that EA inhibited the affective dimension. EA treatment did not produce reward or aversive effect. Intra-rACC administration of D-Phe-Cys-Tyr-D-Trp-Orn-Thr-Pen-Thr amide (CTOP), a selective mu opioid receptor antagonist, but not norbinaltorphimine (nor-BNI), a selective kappa opioid receptor antagonist, blocked EA inhibition of the affective dimension. These data demonstrate that EA activates opioid receptors in the rACC to inhibit pain-induced affective responses and that EA may be an effective therapy for both the sensory-discriminative and the affective dimensions of pain. PMID:22323370

Dimerization between aequorea fluorescent proteins does not affect interaction between tagged estrogen receptors in living cells

PubMed Central

Kofoed, Eric M.; Guerbadot, Martin; Schaufele, Fred

2008-01-01

Förster resonance energy transfer (FRET) detection of protein interaction in living cells is commonly measured following the expression of interacting proteins genetically fused to the cyan (CFP) and yellow (YFP) derivatives of the Aequorea victoria fluorescent protein (FP). These FPs can dimerize at mM concentrations, which may introduce artifacts into the measurement of interaction between proteins that are fused with the FPs. Here, FRET analysis of the interaction between estrogen receptors (alpha isoform, ERα) labeled with “wild-type” CFP and YFP is compared with that of ERα labeled with “monomeric” A206K mutants of CFP and YFP. The intracellular equilibrium dissociation constant for the hormone-induced ERα-ERα interaction is similar for ERα labeled with wild-type or monomeric FPs. However, the measurement of energy transfer measured for ERα-ERα interaction in each cell is less consistent with the monomeric FPs. Thus, dimerization of the FPs does not affect the kinetics of ERα-ERα interaction but, when brought close together via ERα-ERα interaction, FP dimerization modestly improves FRET measurement. PMID:18601531

Avermectins differentially affect ethanol intake and receptor function: implications for developing new therapeutics for alcohol use disorders.

PubMed

Asatryan, Liana; Yardley, Megan M; Khoja, Sheraz; Trudell, James R; Hyunh, Nhat; Louie, Stan G; Petasis, Nicos A; Alkana, Ronald L; Davies, Daryl L

2014-06-01

Our laboratory is investigating ivermectin (IVM) and other members of the avermectin family as new pharmaco-therapeutics to prevent and/or treat alcohol use disorders (AUDs). Earlier work found that IVM significantly reduced ethanol intake in mice and that this effect likely reflects IVM's ability to modulate ligand-gated ion channels. We hypothesized that structural modifications that enhance IVM's effects on key receptors and/or increase its brain concentration should improve its anti-alcohol efficacy. We tested this hypothesis by comparing the abilities of IVM and two other avermectins, abamectin (ABM) and selamectin (SEL), to reduce ethanol intake in mice, to alter modulation of GABAARs and P2X4Rs expressed in Xenopus oocytes and to increase their ability to penetrate the brain. IVM and ABM significantly reduced ethanol intake and antagonized the inhibitory effects of ethanol on P2X4R function. In contrast, SEL did not affect either measure, despite achieving higher brain concentrations than IVM and ABM. All three potentiated GABAAR function. These findings suggest that chemical structure and effects on receptor function play key roles in the ability of avermectins to reduce ethanol intake and that these factors are more important than brain penetration alone. The direct relationship between the effect of these avermectins on P2X4R function and ethanol intake suggest that the ability to antagonize ethanol-mediated inhibition of P2X4R function may be a good predictor of the potential of an avermectin to reduce ethanol intake and support the use of avermectins as a platform for developing novel drugs to prevent and/or treat AUDs.

Increased Grik4 Gene Dosage Causes Imbalanced Circuit Output and Human Disease-Related Behaviors.

PubMed

Arora, Vineet; Pecoraro, Valeria; Aller, M Isabel; Román, Celia; Paternain, Ana V; Lerma, Juan

2018-06-26

Altered glutamatergic neurotransmission is thought to contribute to mental disorders and neurodegenerative diseases. Copy-number variation in genes associated with glutamatergic synapses represents a source of genetic variability, possibly underlying neurological and mental disease susceptibility. The GRIK4 gene encodes a high-affinity kainate receptor subunit of essentially unknown function, although de novo duplication of the 11q23.3-q24.1 locus to which it maps has been detected in autism and other disorders. To determine how changes in the dose of Grik4 affect synaptic activity, we studied mice overexpressing this gene in the forebrain. A mild gain in Grik4 enhances synaptic transmission, causing a persistent imbalance in inhibitory and excitatory activity and disturbing the circuits responsible for the main amygdala outputs. These changes in glutamatergic activity reverse when Grik4 levels are normalized; thus, they may account for the behavioral abnormalities in disorders like autism or schizophrenia. Copyright © 2018 Agencia Estatal Consejo Superior de Investigaciones Científicas. Published by Elsevier Inc. All rights reserved.

Advantages of Repeated Low Dose against Single High Dose of Kainate in C57BL/6J Mouse Model of Status Epilepticus: Behavioral and Electroencephalographic Studies

PubMed Central

Beamer, Edward; Sills, Graeme J.; Thippeswamy, Thimmasettappa

2014-01-01

A refined kainate (KA) C57BL/6J mouse model of status epilepticus (SE) using a repeated low dose (RLD) of KA (5 mg/kg, intraperitoneal; at 30 min intervals) was compared with the established single high dose (SHD) of KA (20 mg/kg, intraperitoneal) model. In the RLD group, increased duration of convulsive motor seizures (CMS, Racine scale stage ≥3) with a significant reduction in mortality from 21% to 6% and decreased variability in seizure severity between animals/batches were observed when compared to the SHD group. There was a significant increase in the percentage of animals that reached stage-5 seizures (65% versus 96%) in the RLD group. Integrated real-time video-EEG analysis of both groups, using NeuroScore software, revealed stage-specific spikes and power spectral density characteristics. When the seizures progressed from non-convulsive seizures (NCS, stage 1–2) to CMS (stage 3–5), the delta power decreased which was followed by an increase in gamma and beta power. A transient increase in alpha and sigma power marked the transition from NCS to CMS with characteristic ‘high frequency trigger’ spikes on the EEG, which had no behavioral expression. During SE the spike rate was higher in the RLD group than in the SHD group. Overall these results confirm that RLD of KA is a more robust and consistent mouse model of SE than the SHD of KA mouse model. PMID:24802808

Insulin receptor substrates 1 and 2 but not Shc can activate the insulin receptor independent of insulin and induce proliferation in CHO-IR cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Niessen, Markus; Jaschinski, Frank; Item, Flurin

2007-02-15

Ligand-activated insulin receptor (IR) attracts and phosphorylates various substrates such as insulin receptor substrates 1-4 (IRS) and Shc. To investigate how binding affinity for substrate affects signalling we generated chimeric receptors with the {beta}-chain of the insulin receptor containing NPXY motives with different affinities for receptor substrates. We found that the extent of receptor tyrosine phosphorylation positively correlates with binding affinity towards IRS1/2 but not towards Shc. Moreover, overexpression of IRS1 or IRS2 but not of Shc increased IR tyrosine phosphorylation in a dose-dependent manner, also independent of insulin. Molecular truncations of IRS1 revealed that neither the isolated PH andmore » PTB domains nor the C-terminus with the tyrosine phosphorylation sites alone are sufficient for substrate-dependent receptor activation. Overexpression of IRS1 and IRS2 impaired insulin-induced internalization of the IR in a dose-dependent manner suggesting that IRS proteins prevent endosome-associated receptor dephosphorylation/inactivation. IRS1 and IRS2 could therefore target the activated IR to different cellular compartments. Overexpression of IRS1 and IRS2 inhibited insulin-stimulated activation of the MAP kinases Erk1/2 while it increased/induced activation of Akt/PKB. Finally, overexpression of IRS1 and IRS2 but not of Shc induced DNA synthesis in starved CHO-IR cells independent of exogenous growth factors. Our results demonstrate that variations in cellular IRS1 and IRS2 concentration affect insulin signalling both upstream and downstream and that IRS proteins could play instructive rather than just permissive roles in signal transmission.« less

Glutamate receptors modulate sodium-dependent and calcium-independent vitamin C bidirectional transport in cultured avian retinal cells.

PubMed

Portugal, Camila Cabral; Miya, Vivian Sayuri; Calaza, Karin da Costa; Santos, Rochelle Alberto Martins; Paes-de-Carvalho, Roberto

2009-01-01

Vitamin C is transported in the brain by sodium vitamin C co-transporter 2 (SVCT-2) for ascorbate and glucose transporters for dehydroascorbate. Here we have studied the expression of SVCT-2 and the uptake and release of [(14)C] ascorbate in chick retinal cells. SVCT-2 immunoreactivity was detected in rat and chick retina, specially in amacrine cells and in cells in the ganglion cell layer. Accordingly, SVCT-2 was expressed in cultured retinal neurons, but not in glial cells. [(14)C] ascorbate uptake was saturable and inhibited by sulfinpyrazone or sodium-free medium, but not by treatments that inhibit dehydroascorbate transport. Glutamate-stimulated vitamin C release was not inhibited by the glutamate transport inhibitor l-beta-threo-benzylaspartate, indicating that vitamin C release was not mediated by glutamate uptake. Also, ascorbate had no effect on [(3)H] D-aspartate release, ruling out a glutamate/ascorbate exchange mechanism. 2-Carboxy-3-carboxymethyl-4-isopropenylpyrrolidine (Kainate) or NMDA stimulated the release, effects blocked by their respective antagonists 6,7-initroquinoxaline-2,3-dione (DNQX) or (5R,2S)-(1)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine hydrogen maleate (MK-801). However, DNQX, but not MK-801 or 2-amino-5-phosphonopentanoic acid (APV), blocked the stimulation by glutamate. Interestingly, DNQX prevented the stimulation by NMDA, suggesting that the effect of NMDA was mediated by glutamate release and stimulation of non-NMDA receptors. The effect of glutamate was neither dependent on external calcium nor inhibited by 1,2-bis (2-aminophenoxy) ethane-N',N',N',N',-tetraacetic acid tetrakis (acetoxy-methyl ester) (BAPTA-AM), an internal calcium chelator, but was inhibited by sulfinpyrazone or by the absence of sodium. In conclusion, retinal cells take up and release vitamin C, probably through SVCT-2, and the release can be stimulated by NMDA or non-NMDA glutamate receptors.

Zolpidem, a clinical hypnotic that affects electronic transfer, alters synaptic activity through potential GABA receptors in the nervous system without significant free radical generation.

PubMed

Kovacic, Peter; Somanathan, Ratnasamy

2009-01-01

Zolpidem (trade name Ambien) has attracted much interest as a sleep-inducing agent and also in research. Attention has been centered mainly on receptor binding and electrochemistry in the central nervous system which are briefly addressed herein. A novel integrated approach to mode of action is presented. The pathways to be discussed involve basicity, reduction potential, electrostatics, cell signaling, GABA receptor binding, electron transfer (ET), pharmacodynamics, structure activity relationships (SAR) and side effects. The highly conjugated pyridinium salt formed by protonation of the amidine moiety is proposed to be the active form acting as an ET agent. Extrapolation of reduction potentials for related compounds supports the premise that zolpidem may act as an ET species in vivo. From recent literature reports, electrostatics is believed to play a significant role in drug action. The pyridinium cation displays molecular electrostatic potential which may well play a role energetically or as a bridging mechanism. An SAR analysis points to analogy with other physiologically active xenobiotics, namely benzodiazepines and paraquat in the conjugated iminium category. Inactivity of metabolites indicates that the parent is the active form of zolpidem. Absence of reactive oxygen species and oxidative stress is in line with minor side effects. In contrast, generally, the prior literature contains essentially no discussion of these fundamental biochemical relationships. Pharmacodynamics may play an important role. Concerning behavior at the blood-brain barrier, useful insight can be gained from investigations of the related cationic anesthetics that are structurally related to acetyl choline. Evidently, the neutral form of the drug penetrates the neuronal membrane, with the salt form operating at the receptor. The pathways of zolpidem have several clinical implications since the agent affects sedation, electroencephalographic activity, oxidative metabolites and

New ligands for melanocortin receptors.

PubMed

Kaelin, C B; Candille, S I; Yu, B; Jackson, P; Thompson, D A; Nix, M A; Binkley, J; Millhauser, G L; Barsh, G S

2008-12-01

Named originally for their effects on peripheral end organs, the melanocortin system controls a diverse set of physiological processes through a series of five G-protein-coupled receptors and several sets of small peptide ligands. The central melanocortin system plays an essential role in homeostatic regulation of body weight, in which two alternative ligands, alpha-melanocyte-stimulating hormone and agouti-related protein, stimulate and inhibit receptor signaling in several key brain regions that ultimately affect food intake and energy expenditure. Much of what we know about the relationship between central melanocortin signaling and body weight regulation stems from genetic studies. Comparative genomic studies indicate that melanocortin receptors used for controlling pigmentation and body weight regulation existed more than 500 million years ago in primitive vertebrates, but that fine-grained control of melanocortin receptors through neuropeptides and endogenous antagonists developed more recently. Recent studies based on dog coat-color genetics revealed a new class of melanocortin ligands, the beta-defensins, which reveal the potential for cross talk between the melanocortin and the immune systems.

Rivastigmine improves isolation rearing-induced prepulse inhibition deficits via muscarinic acetylcholine receptors in mice.

PubMed

Higashino, Kosuke; Ago, Yukio; Umeki, Takahiro; Hasebe, Shigeru; Onaka, Yusuke; Hashimoto, Hitoshi; Takuma, Kazuhiro; Matsuda, Toshio

2016-02-01

The acetylcholinesterase inhibitors donepezil, galantamine, and rivastigmine are used for the treatment of Alzheimer's disease. We previously demonstrated that donepezil and galantamine differentially affect isolation rearing-induced prepulse inhibition (PPI) deficits and that this might be due to differential effects on brain muscarinic acetylcholine (mACh) receptor function in mice. We examined the effects of rivastigmine on isolation rearing-induced PPI deficits, brain ACh levels, and mACh receptor function in mice. Acoustic startle responses were measured in a startle chamber. Microdialysis was performed, and the levels of dopamine and ACh in the prefrontal cortex were measured. Rivastigmine (0.3 mg/kg) improved PPI deficits, and this improvement was antagonized by the mACh receptor antagonist telenzepine but not by the nicotinic ACh receptor antagonist mecamylamine. Rivastigmine increased extracellular ACh levels by approximately 2-3-fold, less than the increase produced by galantamine. Rivastigmine enhanced the effect of the mACh receptor agonist N-desmethylclozapine on prefrontal dopamine release, a marker of mACh receptor function, and this increase was blocked by telenzepine. In contrast, galantamine did not affect N-desmethylclozapine-induced dopamine release. Furthermore, rivastigmine did not affect cortical dopamine release induced by the serotonin1A receptor agonist osemozotan, suggesting that the effect of rivastigmine has specificity for mACh receptors. Taken together with our previous finding that marked increases in ACh levels are required for the PPI deficit improvement induced by galantamine, our present results suggest that rivastigmine improves isolation rearing-induced PPI deficits by increasing ACh levels and by concomitantly enhancing mACh receptor function.

Subtle Changes in Peptide Conformation Profoundly Affect Recognition of the Non-Classical MHC Class I Molecule HLA-E by the CD94-NKG2 Natural Killer Cell Receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoare, Hilary L; Sullivan, Lucy C; Clements, Craig S

2008-03-31

Human leukocyte antigen (HLA)-E is a non-classical major histocompatibility complex class I molecule that binds peptides derived from the leader sequences of other HLA class I molecules. Natural killer cell recognition of these HLA-E molecules, via the CD94-NKG2 natural killer family, represents a central innate mechanism for monitoring major histocompatibility complex expression levels within a cell. The leader sequence-derived peptides bound to HLA-E exhibit very limited polymorphism, yet subtle differences affect the recognition of HLA-E by the CD94-NKG2 receptors. To better understand the basis for this peptide-specific recognition, we determined the structure of HLA-E in complex with two leader peptides,more » namely, HLA-Cw*07 (VMAPRALLL), which is poorly recognised by CD94-NKG2 receptors, and HLA-G*01 (VMAPRTLFL), a high-affinity ligand of CD94-NKG2 receptors. A comparison of these structures, both of which were determined to 2.5-Å resolution, revealed that allotypic variations in the bound leader sequences do not result in conformational changes in the HLA-E heavy chain, although subtle changes in the conformation of the peptide within the binding groove of HLA-E were evident. Accordingly, our data indicate that the CD94-NKG2 receptors interact with HLA-E in a manner that maximises the ability of the receptors to discriminate between subtle changes in both the sequence and conformation of peptides bound to HLA-E.« less

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

Nuclear Receptors, Mitochondria, and Lipid Metabolism

PubMed Central

Alaynick, William A.

2009-01-01

Lipid metabolism is a continuum from emulsification and uptake of lipids in the intestine to cellular uptake and transport to compartments such as mitochondria. Whether fats are shuttled into lipid droplets in adipose tissue or oxidized in mitochondria and peroxisomes depends on metabolic substrate availability, energy balance and endocrine signaling of the organism. Several members of the nuclear hormone receptor superfamily are lipid-sensing factors that affect all aspects of lipid metabolism. The physiologic actions of glandular hormones (e.g. thyroid, mineralocorticoid and glucocorticoid), vitamins (e.g. vitamins A and D) and reproductive hormones (e.g. progesterone, estrogen and testosterone) and their cognate receptors are well established. The peroxisome proliferator activated receptors (PPARs) and Liver X receptors (LXRs), acting in concert with PPARγ Coactivator 1α (PGC-1α), have been shown to regulate insulin sensitivity and lipid handling. These receptors are the focus of intense pharmacologic studies to expand the armamentarium of small molecule ligands to treat diabetes and the metabolic syndrome (hypertension, insulin resistance, hyperglycemia, dyslipidemia, and obesity). Recently, additional partners of PGC-1α have moved to the forefront of metabolic research, the Estrogen-related Receptors (ERRs). Although no endogenous ligands for these receptors have been identified, phenotypic analyses of knockout mouse models demonstrate an important role for these molecules in substrate sensing and handling as well as mitochondrial function. PMID:18375192

Effects of weightlessness on neurotransmitter receptors in selected brain areas

NASA Technical Reports Server (NTRS)

Miller, J. D.; Murakami, D. M.; Mcmillen, B. A.; Mcconnaughey, M. M.; Williams, H. L.

1985-01-01

The central nervous system receptor dynamics of rats exposed to 7 days of microgravity are studied. The receptor affinity and receptor number at the hippocampus, lateral frontal cortex, prefrontal cortex, corpus striatum, cerebellum and pons-medulla, and the Na(+)/K(+)ATPase activity are examined. The data reveal that there is no significant change in the receptor affinity and receptor number for the lateral frontal cortex, prefrontal cortex, cerebellum and pons-medulla; however, there is an increase from 81 + or - 11 to 120 + or 5 fmole/mg protein in the receptor number for hippocampal binding, and a decrease in receptor number for the striatum from 172 + or - 14 to 143 + or - 10 fmoles/mg protein. A 9 percent decrease in Mg-dependent Na(+)/K(+)ATPase activity is observed. It is detected that the terminal mechanism may be affected by exposure to microgravity.

Estrous cycle and food availability affect feeding induced by amygdala 5-HT receptor blockade.

PubMed

Parker, Graham C; Bishop, Christopher; Coscina, Donald V

2002-04-01

We have recently reported that bilateral infusions of the 5-HT receptor antagonist metergoline (MET) into the posterior basolateral amygdala (pBLA) elicit feeding in female rats tested at mid-light cycle. The present study was performed to determine whether (1) testing at two different phases of the estrous cycle, and/or (2) the palatability of the food might modify this effect. Subjects were 18 adult females with bilateral pBLA cannulae. Following familiarization with Froot Loops cereal, a within-subjects design tested all animals for 1- and 2-h food intake under 2 Drug (0.3 nmol MET vs. Vehicle), 2 Estrous Cycle (diestrus vs. estrus) and 2 Food (lab chow vs. Froot Loops) conditions. Rats weighed more at diestrus than at proestrus (P<.05) or estrus (P<.005). Multivariate analyses of variance (MANOVAs) revealed a preference for Froot Loops over lab chow (P<.0001). MET increased feeding regardless of food type (P<.0001). Rats ate more Froot Loops (P<.01), but not lab chow, at diestrus vs. estrus. A three-way interaction (P<.05) showed rats ate more during the first hour in estrus than in diestrus to lab chow but not Froot Loops. These data suggest pBLA MET differentially affects feeding over the estrous cycle depending on the palatability of food available.

Duration of treatment and activation of α1-containing GABAA receptors variably affect the level of anxiety and seizure susceptibility after diazepam withdrawal in rats

PubMed Central

Kovačević, Jovana; Timić, Tamara; Tiruveedhula, Veera V.; Batinić, Bojan; Namjoshi, Ojas A.; Milić, Marija; Joksimović, Srđan; Cook, James M.; Savić, Miroslav M.

2014-01-01

Long-term use of benzodiazepine-type drugs may lead to physical dependence, manifested by withdrawal syndrome after abrupt cessation of treatment. The aim of the present study was to investigate the influence of duration of treatment, as well as the role of α1-containing GABAA receptors, in development of physical dependence to diazepam, assessed through the level of anxiety and susceptibility to pentylenetetrazole (PTZ)-induced seizures, 24 h after withdrawal from protracted treatment in rats. Withdrawal of 2 mg/kg diazepam after 28, but not after 14 or 21 days of administration led to an anxiety-like behavior in the elevated plus maze. Antagonism of the diazepam effects at α1-containing GABAA receptors, achieved by daily administration of the neutral modulator βCCt (5 mg/kg), did not affect the anxiety level during withdrawal. An increased susceptibility to PTZ-induced seizures was observed during diazepam withdrawal after 21 and 28 days of treatment. Daily co-administration of βCCt further decreased the PTZ-seizure threshold after 21 days of treatment, whilst it prevented the diazepam withdrawal-elicited decrease of the PTZ threshold after 28 days of treatment. In conclusion, the current study suggests that the role of α1-containing GABAA receptors in mediating the development of physical dependence may vary based on the effect being studied and duration of protracted treatment. Moreover, the present data supports previous findings that the lack of activity at α1-containing GABAA receptors is not sufficient to eliminate physical dependence liability of ligands of the benzodiazepine type. PMID:24695241

Chronic administration of the anabolic androgenic steroid nandrolone alters neurosteroid action at the sigma-1 receptor but not at the sigma-2 or NMDA receptors.

PubMed

Elfverson, Martin; Johansson, Tobias; Zhou, Qin; Le Grevès, Pierre; Nyberg, Fred

2011-12-01

Studies have shown that anabolic androgenic steroids (AASs) can induce profound changes to mental health. Commonly reported psychiatric side effects among AAS users include aggression, anxiety, depression, drug abuse and cognitive disabilities. In experimental animals, many of these effects have been associated with alterations in a number of neurotransmitter systems. We have observed that chronic administration of the AAS nandrolone (nandrolone decanoate) can affect excitatory amino acids as well as monoaminergic and peptidergic pathways in a way that is compatible with nandrolone-induced behavioural changes. The aim of the present work was to further explore the mechanisms underlying nandrolone-induced effects, with a particular focus on components known to be involved in aggression and cognitive function. Male rats were given daily injections of nandrolone decanoate for 14 days and the effects on neurosteroid interactions with sites on the N-methyl-D-aspartyl (NMDA) and sigma receptors were examined. These receptors were chosen because of their involvement in aggressive and cognitive behaviors and the hypothesis that nandrolone might affect the brain via interaction with neurosteroids. Radiolabelled [³H]ifenprodil was used in the binding studies because of its significant affinity for the NMDA and sigma receptors. The results indicated that [³H]ifenprodil binds to both sigma-1 and sigma-2 sites and can be displaced to a certain extent from both sites by the neurosteroids pregnenolone sulphate (PS), pregnanolone sulphate (3α5βS) and dehydroepiandrosterone sulphate (DHEAS). The remainder of the [³H]ifenprodil was displaced from the sigma-1 site by the sigma-1 receptor-selective ligand (+)-SKF 10,047. Chronic nandrolone treatment changed the sigma-1 receptor target for the neurosteroids but not for ifenprodil. The sigma-2 receptor site was unaltered by treatment with nandrolone decanoate. The results also indicated that the neurosteroid-induced allosteric

Bile Acid Receptor Agonist GW4064 Regulates PPARγ Coactivator-1α Expression Through Estrogen Receptor-Related Receptor α

PubMed Central

Dwivedi, Shailendra Kumar Dhar; Singh, Nidhi; Kumari, Rashmi; Mishra, Jay Sharan; Tripathi, Sarita; Banerjee, Priyam; Shah, Priyanka; Kukshal, Vandana; Tyagi, Abdul Malik; Gaikwad, Anil Nilkanth; Chaturvedi, Rajnish Kumar; Mishra, Durga Prasad; Trivedi, Arun Kumar; Sanyal, Somali; Chattopadhyay, Naibedya; Ramachandran, Ravishankar; Siddiqi, Mohammad Imran; Bandyopadhyay, Arun; Arora, Ashish; Lundåsen, Thomas; Anakk, Sayee Priyadarshini; Moore, David D.

2011-01-01

Peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α) is induced in energy-starved conditions and is a key regulator of energy homeostasis. This makes PGC-1α an attractive therapeutic target for metabolic syndrome and diabetes. In our effort to identify new regulators of PGC-1α expression, we found that GW4064, a widely used synthetic agonist for the nuclear bile acid receptor [farnesoid X receptor (FXR)] strongly enhances PGC-1α promoter reporter activity, mRNA, and protein expression. This induction in PGC-1α concomitantly enhances mitochondrial mass and expression of several PGC-1α target genes involved in mitochondrial function. Using FXR-rich or FXR-nonexpressing cell lines and tissues, we found that this effect of GW4064 is not mediated directly by FXR but occurs via activation of estrogen receptor-related receptor α (ERRα). Cell-based, biochemical and biophysical assays indicate GW4064 as an agonist of ERR proteins. Interestingly, FXR disruption alters GW4064 induction of PGC-1α mRNA in a tissue-dependent manner. Using FXR-null [FXR knockout (FXRKO)] mice, we determined that GW4064 induction of PGC-1α expression is not affected in oxidative soleus muscles of FXRKO mice but is compromised in the FXRKO liver. Mechanistic studies to explain these differences revealed that FXR physically interacts with ERR and protects them from repression by the atypical corepressor, small heterodimer partner in liver. Together, this interplay between ERRα-FXR-PGC-1α and small heterodimer partner offers new insights into the biological functions of ERRα and FXR, thus providing a knowledge base for therapeutics in energy balance-related pathophysiology. PMID:21493670

β1-adrenergic receptors activate two distinct signaling pathways in striatal neurons

PubMed Central

Meitzen, John; Luoma, Jessie I.; Stern, Christopher M.; Mermelstein, Paul G.

2010-01-01

Monoamine action in the dorsal striatum and nucleus accumbens plays essential roles in striatal physiology. Although research often focuses on dopamine and its receptors, norepinephrine and adrenergic receptors are also crucial in regulating striatal function. While noradrenergic neurotransmission has been identified in the striatum, little is known regarding the signaling pathways activated by β-adrenergic receptors in this brain region. Using cultured striatal neurons, we characterized a novel signaling pathway by which activation of β1-adrenergic receptors leads to the rapid phosphorylation of cAMP Response Element Binding Protein (CREB), a transcription-factor implicated as a molecular switch underlying long-term changes in brain function. Norepinephrine-mediated CREB phosphorylation requires β1-adrenergic receptor stimulation of a receptor tyrosine kinase, ultimately leading to the activation of a Ras/Raf/MEK/MAPK/MSK signaling pathway. Activation of β1-adrenergic receptors also induces CRE-dependent transcription and increased c-fos expression. In addition, stimulation of β1-adrenergic receptors produces cAMP production, but surprisingly, β1-adrenergic receptor activation of adenylyl cyclase was not functionally linked to rapid CREB phosphorylation. These findings demonstrate that activation of β1-adrenergic receptors on striatal neurons can stimulate two distinct signaling pathways. These adrenergic actions can produce long-term changes in gene expression, as well as rapidly modulate cellular physiology. By elucidating the mechanisms by which norepinephrine and β1-adrenergic receptor activation affects striatal physiology, we provide the means to more fully understand the role of monoamines in modulating striatal function, specifically how norepinephrine and β1-adrenergic receptors may affect striatal physiology. PMID:21143600

Low-density lipoprotein receptor genetic polymorphism in chronic hepatitis C virus Egyptian patients affects treatment response.

PubMed

Naga, Mazen; Amin, Mona; Algendy, Dina; Elbadry, Ahmed; Fawzi, May; Foda, Ayman; Esmat, Serag; Sabry, Dina; Rashed, Laila; Gabal, Samia; Kamal, Manal

2015-10-21

To correlate a genetic polymorphism of the low-density lipoprotein (LDL) receptor with antiviral responses in Egyptian chronic hepatitis C virus (HCV) patients. Our study included 657 HCV-infected patients with genotype 4 who received interferon-based combination therapy. Patients were divided into two groups based on their response to therapy: 356 were responders, and 301 were non-responders. Patients were compared to 160 healthy controls. All patients and controls underwent a thorough physical examination, measurement of body mass index (BMI) and the following laboratory tests: serum alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, albumin, total bilirubin, direct bilirubin, prothrombin time, prothrombin concentration, INR, complete blood count, serum creatinine, fasting blood sugar, HCV antibody, and hepatitis B surface antigen. All HCV patients were further subjected to the following laboratory tests: HCV-RNA using quantitative polymerase chain reaction (PCR), antinuclear antibodies, thyroid-stimulating hormone, an LDL receptor (LDLR) genotype study of LDLR exon8c.1171G>A and exon10c.1413G>A using real-time PCR-based assays, abdominal ultrasonography, ultrasonographic-guided liver biopsy, and histopathological examination of liver biopsies. Correlations of LDL receptor polymorphisms with HAI, METAVIR score, presence of steatosis, and BMI were performed in all cases. There were no statistically significant differences in response rates between the different types of interferon used or LDLR exon10c.1413G>A. However, there was a significant difference in the frequency of the LDL receptor exon8c.1171G>A genotype between cases (AA: 25.9%, GA: 22.2%, GG: 51.9%) and controls (AA: 3.8%, GA: 53.1% and GG: 43.1%) (P < 0.001). There was a statistically significant difference in the frequency of the LDLR exon 8C:1171 G>A polymorphism between responders (AA: 3.6%, GA: 15.2%, GG: 81.2%) and non-responders (AA: 52.2%, GA: 30.6%, GG: 17.2%) (P < 0

A desensitization-selective potentiator of AMPA-type glutamate receptors

PubMed Central

Sekiguchi, Masayuki; Nishikawa, Kaori; Aoki, Shunsuke; Wada, Keiji

2002-01-01

We examined the effects of PEPA, an allosteric potentiator of AMPA receptors, on AMPA receptor kinetics. PEPA did not affect the deactivation of glutamate responses but potently attenuated the extent of receptor desensitization without slowing the onset of desensitization in most of the recombinant AMPA receptors (GluR1-flip, GluR1-flop, GluR3-flip, GluR3-flip + GluR2-flip, and GluR3-flop + GluR2-flop) expressed in Xenopus oocytes. For the GluR3-flop subunit, PEPA attenuated the extent of desensitization and only weakly prolonged deactivation (1.3 fold). PEPA did not significantly affect recovery from desensitization in oocytes expressing GluR3-flip, GluR1-flop, and GluR1-flop, but weakly accelerated (2.6 fold) recovery from desensitization in oocytes expressing GluR3-flop. PEPA's effect on desensitization of GluR3-flop-containing receptors is unique in that onset is very slow. Simulation studies using simplified kinetic models for AMPA receptors are utilized to explore the differential effects of PEPA on GluR3-flip and -flop. It is possible to simulate the action on GluR3-flip by modulating two rate constants in a 12-state kinetic model. For simulation of the action on GluR3-flop, the 12-state kinetic model is not enough, and it is necessary to invoke a 13th state, a PEPA-bound receptor to which glutamate cannot bind. These results suggest that attenuation of extent of desensitization represents the principal mechanism underlying the potentiation of AMPA receptors by PEPA, and that PEPA exhibits different mechanisms with respect to GluR3-flip and GluR3-flop. PMID:12145103

Co-administration of delta- and mu-opioid receptor agonists promotes peripheral opioid receptor function

PubMed Central

Schramm, Cicely L.; Honda, Christopher N.

2010-01-01

Enhancement of peripheral opioid analgesia following tissue injury or inflammation in animal models is well-documented, but clinical results of peripheral opioid therapy remain inconsistent. Previous studies in the central nervous system have shown that co-administration of μ- and δ-opioid receptor agonists can enhance analgesic outcomes; however, less is known about the functional consequences of opioid receptor interactions in the periphery. The present study examines the effects of intraplantar injection of the μ- and δ-opioid receptor agonists, morphine and deltorphin, alone and in combination on behavioral tests of nociception in naïve rats and on potassium-evoked release of CGRP from sciatic nerves of naïve rats. Neither drug alone affected nociceptive behaviors or CGRP release. Two separate measures of mechanical nociceptive sensitivity remained unchanged after co-administration of the two drugs. In contrast, when deltorphin was co-injected with morphine, dose-dependent and peripherally-restricted increases in paw withdrawal latencies to radiant heat were observed. Similarly, concentration-dependent inhibition of CGRP release was observed when deltorphin and morphine were administered in sequence prior to potassium stimulation. However, no inhibition was observed when morphine was administered prior to deltorphin. All combined opioid effects were blocked by co-application of antagonists. Deltorphin exposure also enhanced the in vivo and in vitro effects of another μ-opioid receptor agonist, DAMGO. Together, these results suggest that under normal conditions, δ-opioid receptor agonists enhance the effect of μ-opioid receptor agonists in the periphery, and local co-administration of δ- and μ-opioid receptor agonists may improve results of peripheral opioid therapy for the treatment of pain. PMID:20970925

Slow synaptic transmission mediated by TRPV1 channels in CA3 interneurons of the hippocampus.

PubMed

Eguchi, Noriomi; Hishimoto, Akitoyo; Sora, Ichiro; Mori, Masahiro

2016-03-11

Metabotropic glutamate receptors (mGluRs) modulate various neuronal functions in the central nervous system. Many studies reported that mGluRs have linkages to neuronal disorders such as schizophrenia and autism related disorders, indicating that mGluRs are involved in critical functions of the neuronal circuits. To study this possibility further, we recorded mGluR-induced synaptic responses in the interneurons of the CA3 stratum radiatum using rat hippocampal organotypic slice cultures. Electrical stimulation in the CA3 pyramidal cell layer evoked a slow inward current in the interneurons at a holding potential of -70mV in the presence of antagonists for AMPA/kainate receptors, NMDA receptors, GABAA receptors and GABAB receptors. The slow inward current was blocked in the absence of extracellular calcium, suggesting that this was a synaptic response. The slow excitatory postsynaptic current (EPSC) reversed near 0mV, reflecting an increase in a non-selective cationic conductance. The slow EPSC is mediated by group I mGluRs, as it was blocked by AP3, a group I mGluR antagonist. Neither a calcium chelator BAPTA nor a phospholipase C (PLC) inhibitor U73122 affected the slow EPSC. La(3+), a general TRP channel blocker or capsazepine, a selective TRPV1 channel antagonist significantly suppressed the slow EPSC. DHPG, a selective group I mGluRs agonist induced an inward current, which was suppressed by capsazepine. These results indicate that in the interneurons of the hippocampal CA3 stratum radiatum group I mGluRs activate TRPV1 channels independently of PLC and intracellular Ca(2+), resulting in the slow EPSC in the interneurons. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Olanzapine, but not clozapine, increases glutamate release in the prefrontal cortex of freely moving mice by inhibiting D-aspartate oxidase activity

PubMed Central

Sacchi, Silvia; Novellis, Vito De; Paolone, Giovanna; Nuzzo, Tommaso; Iannotta, Monica; Belardo, Carmela; Squillace, Marta; Bolognesi, Paolo; Rosini, Elena; Motta, Zoraide; Frassineti, Martina; Bertolino, Alessandro; Pollegioni, Loredano; Morari, Michele; Maione, Sabatino; Errico, Francesco; Usiello, Alessandro

2017-01-01

D-aspartate levels in the brain are regulated by the catabolic enzyme D-aspartate oxidase (DDO). D-aspartate activates NMDA receptors, and influences brain connectivity and behaviors relevant to schizophrenia in animal models. In addition, recent evidence reported a significant reduction of D-aspartate levels in the post-mortem brain of schizophrenia-affected patients, associated to higher DDO activity. In the present work, microdialysis experiments in freely moving mice revealed that exogenously administered D-aspartate efficiently cross the blood brain barrier and stimulates L-glutamate efflux in the prefrontal cortex (PFC). Consistently, D-aspartate was able to evoke L-glutamate release in a preparation of cortical synaptosomes through presynaptic stimulation of NMDA, mGlu5 and AMPA/kainate receptors. In support of a potential therapeutic relevance of D-aspartate metabolism in schizophrenia, in vitro enzymatic assays revealed that the second-generation antipsychotic olanzapine, differently to clozapine, chlorpromazine, haloperidol, bupropion, fluoxetine and amitriptyline, inhibits the human DDO activity. In line with in vitro evidence, chronic systemic administration of olanzapine induces a significant extracellular release of D-aspartate and L-glutamate in the PFC of freely moving mice, which is suppressed in Ddo knockout animals. These results suggest that the second-generation antipsychotic olanzapine, through the inhibition of DDO activity, increases L-glutamate release in the PFC of treated mice. PMID:28393897

Metabolic products of linalool and modulation of GABAA receptors

NASA Astrophysics Data System (ADS)

Milanos, Sinem; Elsharif, Shaimaa A.; Janzen, Dieter; Buettner, Andrea; Villmann, Carmen

2017-06-01

Terpenoids are major subcomponents in aroma substances which harbor sedative physiological potential. We have demonstrated that various monoterpenoids such as the acyclic linalool enhance GABAergic currents in an allosteric manner in vitro upon overexpression of inhibitory a1b2 GABAA receptors in various expression systems. However, in plants or humans, i.e. following intake via inhalation or ingestion, linalool undergoes metabolic modifications including oxygenation and acetylation, which may affect the modulatory efficacy of the generated linalool derivatives. Here, we analyzed the modulatory potential of linalool derivatives at a1b2g2 GABAA receptors upon transient overexpression. Following receptor expression control, electrophysiological recordings in a whole cell configuration were used to determine the chloride influx upon co-application of GABA EC5-10 together with the modulatory substance. Our results show that only oxygenated linalool metabolites at carbon 8 positively affect GABAergic currents whereas derivatives hydroxylated or carboxylated at carbon 8 were rather ineffective. Acetylated linalool derivatives resulted in non-significant changes of GABAergic currents. We can conclude that metabolism of linalool reduces its positive allosteric potential at GABAA receptors compared to the significant potentiation effects of the parent molecule linalool itself.

Mutation of Three Residues in the Third Intracellular Loop of the Dopamine D2 Receptor Creates an Internalization-defective Receptor*

PubMed Central

Clayton, Cecilea C.; Donthamsetti, Prashant; Lambert, Nevin A.; Javitch, Jonathan A.; Neve, Kim A.

2014-01-01

Arrestins mediate desensitization and internalization of G protein-coupled receptors and also direct receptor signaling toward heterotrimeric G protein-independent signaling pathways. We previously identified a four-residue segment (residues 212–215) of the dopamine D2 receptor that is necessary for arrestin binding in an in vitro heterologous expression system but that also impairs receptor expression. We now describe the characterization of additional mutations at that arrestin binding site in the third intracellular loop. Mutating two (residues 214 and 215) or three (residues 213–215) of the four residues to alanine partially decreased agonist-induced recruitment of arrestin3 without altering activation of a G protein. Arrestin-dependent receptor internalization, which requires arrestin binding to β2-adaptin (the β2 subunit of the clathrin-associated adaptor protein AP2) and clathrin, was disproportionately affected by the three-residue mutation, with no agonist-induced internalization observed even in the presence of overexpressed arrestin or G protein-coupled receptor kinase 2. The disjunction between arrestin recruitment and internalization could not be explained by alterations in the time course of the receptor-arrestin interaction, the recruitment of G protein-coupled receptor kinase 2, or the receptor-induced interaction between arrestin and β2-adaptin, suggesting that the mutation impairs a property of the internalization complex that has not yet been identified. PMID:25336643

The Laminin Receptor Is a Cellular Attachment Receptor for Classical Swine Fever Virus

PubMed Central

Chen, Jianing; He, Wen-Rui; Shen, Liang; Dong, Hong; Yu, Jiahui; Wang, Xiao; Yu, Shaoxiong; Li, Yongfeng; Li, Su; Luo, Yuzi; Sun, Yuan

2015-01-01

ABSTRACT Classical swine fever virus (CSFV) is the causative agent of classical swine fever (CSF), a highly contagious, economically important viral disease in many countries. The Erns and E2 envelope glycoproteins are responsible for the binding to and entry into the host cell by CSFV. To date, only one cellular receptor, heparan sulfate (HS), has been identified as being involved in CSFV attachment. HS is also present on the surface of various cells that are nonpermissive to CSFV. Hence, there must be another receptor(s) that has been unidentified to date. In this study, we used a set of small interfering RNAs (siRNAs) against a number of porcine cell membrane protein genes to screen cellular proteins involved in CSFV infection. This approach resulted in the identification of several proteins, and of these, the laminin receptor (LamR) has been demonstrated to be a cellular receptor for several viruses. Confocal analysis showed that LamR is colocalized with CSFV virions on the membrane, and a coimmunoprecipitation assay indicated that LamR interacts with the CSFV Erns protein. In inhibition assays, anti-LamR antibodies, soluble laminin, or LamR protein significantly inhibited CSFV infection in a dose-dependent manner. Transduction of PK-15 cells with a recombinant lentivirus expressing LamR yielded higher viral titers. Moreover, an attachment assay demonstrated that LamR functions during virus attachment. We also demonstrate that LamR acts as an alternative attachment receptor, especially in SK6 cells. These results indicate that LamR is a cellular attachment receptor for CSFV. IMPORTANCE Classical swine fever virus (CSFV) is the causative agent of classical swine fever (CSF), an economically important viral disease affecting the pig industry in many countries. To date, only heparan sulfate (HS) has been identified to be an attachment receptor for CSFV. Here, using RNA interference screening with small interfering RNAs (siRNAs) against a number of porcine membrane

Clinical and molecular genetic spectrum of congenital deficiency of the leptin receptor.

PubMed

Farooqi, I Sadaf; Wangensteen, Teresia; Collins, Stephan; Kimber, Wendy; Matarese, Giuseppe; Keogh, Julia M; Lank, Emma; Bottomley, Bill; Lopez-Fernandez, Judith; Ferraz-Amaro, Ivan; Dattani, Mehul T; Ercan, Oya; Myhre, Anne Grethe; Retterstol, Lars; Stanhope, Richard; Edge, Julie A; McKenzie, Sheila; Lessan, Nader; Ghodsi, Maryam; De Rosa, Veronica; Perna, Francesco; Fontana, Silvia; Barroso, Inês; Undlien, Dag E; O'Rahilly, Stephen

2007-01-18

A single family has been described in which obesity results from a mutation in the leptin-receptor gene (LEPR), but the prevalence of such mutations in severe, early-onset obesity has not been systematically examined. We sequenced LEPR in 300 subjects with hyperphagia and severe early-onset obesity, including 90 probands from consanguineous families, and investigated the extent to which mutations cosegregated with obesity and affected receptor function. We evaluated metabolic, endocrine, and immune function in probands and affected relatives. Of the 300 subjects, 8 (3%) had nonsense or missense LEPR mutations--7 were homozygotes, and 1 was a compound heterozygote. All missense mutations resulted in impaired receptor signaling. Affected subjects were characterized by hyperphagia, severe obesity, alterations in immune function, and delayed puberty due to hypogonadotropic hypogonadism. Serum leptin levels were within the range predicted by the elevated fat mass in these subjects. Their clinical features were less severe than those of subjects with congenital leptin deficiency. The prevalence of pathogenic LEPR mutations in a cohort of subjects with severe, early-onset obesity was 3%. Circulating levels of leptin were not disproportionately elevated, suggesting that serum leptin cannot be used as a marker for leptin-receptor deficiency. Congenital leptin-receptor deficiency should be considered in the differential diagnosis in any child with hyperphagia and severe obesity in the absence of developmental delay or dysmorphism. Copyright 2007 Massachusetts Medical Society.

Low-density lipoprotein receptor genetic polymorphism in chronic hepatitis C virus Egyptian patients affects treatment response

PubMed Central

Naga, Mazen; Amin, Mona; Algendy, Dina; Elbadry, Ahmed; Fawzi, May; Foda, Ayman; Esmat, Serag; Sabry, Dina; Rashed, Laila; Gabal, Samia; Kamal, Manal

2015-01-01

AIM: To correlate a genetic polymorphism of the low-density lipoprotein (LDL) receptor with antiviral responses in Egyptian chronic hepatitis C virus (HCV) patients. METHODS: Our study included 657 HCV-infected patients with genotype 4 who received interferon-based combination therapy. Patients were divided into two groups based on their response to therapy: 356 were responders, and 301 were non-responders. Patients were compared to 160 healthy controls. All patients and controls underwent a thorough physical examination, measurement of body mass index (BMI) and the following laboratory tests: serum alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, albumin, total bilirubin, direct bilirubin, prothrombin time, prothrombin concentration, INR, complete blood count, serum creatinine, fasting blood sugar, HCV antibody, and hepatitis B surface antigen. All HCV patients were further subjected to the following laboratory tests: HCV-RNA using quantitative polymerase chain reaction (PCR), antinuclear antibodies, thyroid-stimulating hormone, an LDL receptor (LDLR) genotype study of LDLR exon8c.1171G>A and exon10c.1413G>A using real-time PCR-based assays, abdominal ultrasonography, ultrasonographic-guided liver biopsy, and histopathological examination of liver biopsies. Correlations of LDL receptor polymorphisms with HAI, METAVIR score, presence of steatosis, and BMI were performed in all cases. RESULTS: There were no statistically significant differences in response rates between the different types of interferon used or LDLR exon10c.1413G>A. However, there was a significant difference in the frequency of the LDL receptor exon8c.1171G>A genotype between cases (AA: 25.9%, GA: 22.2%, GG: 51.9%) and controls (AA: 3.8%, GA: 53.1% and GG: 43.1%) (P < 0.001). There was a statistically significant difference in the frequency of the LDLR exon 8C:1171 G>A polymorphism between responders (AA: 3.6%, GA: 15.2%, GG: 81.2%) and non-responders (AA: 52.2%, GA: 30

Heteromerization of the μ- and δ-Opioid Receptors Produces Ligand-Biased Antagonism and Alters μ-Receptor TraffickingS⃞